WorldWideScience

Sample records for transgenic oilseed brassica

  1. Bt-transgenic oilseed rape hybridization with its weedy relative, Brassica rapa.

    Science.gov (United States)

    Halfhill, Matthew D; Millwood, Reginald J; Raymer, Paul L; Stewart, C Neal

    2002-10-01

    The movement of transgenes from crops to weeds and the resulting consequences are concerns of modern agriculture. The possible generation of "superweeds" from the escape of fitness-enhancing transgenes into wild populations is a risk that is often discussed, but rarely studied. Oilseed rape, Brassica napus (L.), is a crop with sexually compatible weedy relatives, such as birdseed rape (Brassica rapa (L.)). Hybridization of this crop with weedy relatives is an extant risk and an excellent interspecific gene flow model system. In laboratory crosses, T3 lines of seven independent transformation events of Bacillus thuringiensis (Bt) oilseed rape were hybridized with two weedy accessions of B. rapa. Transgenic hybrids were generated from six of these oilseed rape lines, and the hybrids exhibited an intermediate morphology between the parental species. The Bt transgene was present in the hybrids, and the protein was synthesized at similar levels to the corresponding independent oilseed rape lines. Insect bioassays were performed and confirmed that the hybrid material was insecticidal. The hybrids were backcrossed with the weedy parent, and only half the oilseed rape lines were able to produce transgenic backcrosses. After two backcrosses, the ploidy level and morphology of the resultant plants were indistinguishable from B. rapa. Hybridization was monitored under field conditions (Tifton, GA, USA) with four independent lines of Bt oilseed rape with a crop to wild relative ratio of 1200:1. When B. rapa was used as the female parent, hybridization frequency varied among oilseed rape lines and ranged from 16.9% to 0.7%.

  2. Low level impurities in imported wheat are a likely source of feral transgenic oilseed rape (Brassica napus L.) in Switzerland.

    Science.gov (United States)

    Schulze, Juerg; Brodmann, Peter; Oehen, Bernadette; Bagutti, Claudia

    2015-11-01

    In Switzerland, the cultivation of genetically modified (GM) oilseed rape (Brassica napus L.) and the use of its seeds for food and feed are not permitted. Nevertheless, the GM oilseed rape events GT73, MS8×RF3, MS8 and RF3 have recently been found in the Rhine port of Basel, Switzerland. The sources of GM oilseed rape seeds have been unknown. The main agricultural good being imported at the Rhine port of Basel is wheat and from 2010 to 2013, 19% of all Swiss wheat imports originated from Canada. As over 90% of all oilseed rape grown in Canada is GM, we hypothesised that imports of Canadian wheat may contain low level impurities of GM oilseed rape. Therefore, waste fraction samples gathered during the mechanical cleaning of Canadian wheat from two Swiss grain mills were analysed by separating oilseed rape seeds from waste fraction samples and testing DNA of pooled seeds for the presence of transgenes by real-time PCR. Furthermore, oilseed rape seeds from each grain mill were sown in a germination experiment, and seedling DNA was tested for the presence of transgenes by real-time PCR. GT73, MS8×RF3, MS8 and RF3 oilseed rape was detected among seed samples and seedlings of both grain mills. Based on this data, we projected a mean proportion of 0.005% of oilseed rape in wheat imported from Canada. Besides Canadian wheat, the Rhine port of Basel does not import any other significant amounts of agricultural products from GM oilseed rape producing countries. We therefore conclude that Canadian wheat is the major source of unintended introduction of GM oilseed rape seeds into Switzerland.

  3. Genetic load and transgenic mitigating genes in transgenic Brassica rapa (field mustard × Brassica napus (oilseed rape hybrid populations

    Directory of Open Access Journals (Sweden)

    Warwick Suzanne I

    2009-10-01

    Full Text Available Abstract Background One theoretical explanation for the relatively poor performance of Brassica rapa (weed × Brassica napus (crop transgenic hybrids suggests that hybridization imparts a negative genetic load. Consequently, in hybrids genetic load could overshadow any benefits of fitness enhancing transgenes and become the limiting factor in transgenic hybrid persistence. Two types of genetic load were analyzed in this study: random/linkage-derived genetic load, and directly incorporated genetic load using a transgenic mitigation (TM strategy. In order to measure the effects of random genetic load, hybrid productivity (seed yield and biomass was correlated with crop- and weed-specific AFLP genomic markers. This portion of the study was designed to answer whether or not weed × transgenic crop hybrids possessing more crop genes were less competitive than hybrids containing fewer crop genes. The effects of directly incorporated genetic load (TM were analyzed through transgene persistence data. TM strategies are proposed to decrease transgene persistence if gene flow and subsequent transgene introgression to a wild host were to occur. Results In the absence of interspecific competition, transgenic weed × crop hybrids benefited from having more crop-specific alleles. There was a positive correlation between performance and number of B. napus crop-specific AFLP markers [seed yield vs. marker number (r = 0.54, P = 0.0003 and vegetative dry biomass vs. marker number (r = 0.44, P = 0.005]. However under interspecific competition with wheat or more weed-like conditions (i.e. representing a situation where hybrid plants emerge as volunteer weeds in subsequent cropping systems, there was a positive correlation between the number of B. rapa weed-specific AFLP markers and seed yield (r = 0.70, P = 0.0001, although no such correlation was detected for vegetative biomass. When genetic load was directly incorporated into the hybrid genome, by inserting a

  4. Do competitive conditions affect introgression of transgenes from oilseed rape (Brassica napus) to weedy Brassica rapa? AS case study with special reference to transplastomic oilseed rape

    DEFF Research Database (Denmark)

    Johannessen, Marina

    In species where chloroplast inheritance is exclusively or predominantly maternal, pollen-mediated flow of transgenes is reduced if transgenes are inserted in chloroplast DNA instead of nuclear DNA. However, transmission of chloroplast-encoded transgeneswill still occur if transgenic individuals ...... affected the thousand-kernel weight significantly. It was concluded that further introgression of transgenes from transplastomic oilseed rape to B. rapa is mostlikely at current field densities of B. napus and when B. rapa is an abundant weed....

  5. Oilseed brassica improvement: through induced mutations

    International Nuclear Information System (INIS)

    Shah, S.A.; Ali, I.; Rehman, K.

    1990-06-01

    The oilseed brassica improvement programme is discussed in this report. Some observations on different plant mutants were made throughout the growth period and results revealed that most of the selected mutants of both the varieties expressed better performance than the parent by showing superior plant traits. A new species named brassica carinata has tremendous untapped potential as an oilseed crop. Efforts for creating maximum variability in rapeseed mustard varieties by means other than gamma radiation continued. (A.B.)

  6. Inheritance of oilseed rape (Brassica napus) RAPD markers in a backcross progeny with Brassica campestris

    DEFF Research Database (Denmark)

    Mikkelsen, T.R.; Jensen, J.; Bagger Jørgensen, Rikke

    1996-01-01

    Different cultivars/transgenic lines of oilseed rape (Brassica napus) were crossed (as females) with different cultivars/populations of Brassica campestris. All cross combinations produced seed, with an average seed set per pollination of 9.8. Backcrossing of selected interspecific hybrids (as...... females) to B. campestris resulted in a much lower seed set, average 0.7 seed per pollination. In the single backcross progeny where a large enough population (92 plants) was obtained for analysis, 33 B. napus specific RAPD markers were investigated to determine the extent of transfer of oilseed rape...

  7. NMR metabolomics of ripened and developing oilseed rape (Brassica napus) and turnip rape (Brassica rapa).

    Science.gov (United States)

    Kortesniemi, Maaria; Vuorinen, Anssi L; Sinkkonen, Jari; Yang, Baoru; Rajala, Ari; Kallio, Heikki

    2015-04-01

    The oilseeds of the commercially important oilseed rape (Brassica napus) and turnip rape (Brassica rapa) were investigated with (1)H NMR metabolomics. The compositions of ripened (cultivated in field trials) and developing seeds (cultivated in controlled conditions) were compared in multivariate models using principal component analysis (PCA), partial least squares discriminant analysis (PLS-DA), and orthogonal partial least squares discriminant analysis (OPLS-DA). Differences in the major lipids and the minor metabolites between the two species were found. A higher content of polyunsaturated fatty acids and sucrose were observed in turnip rape, while the overall oil content and sinapine levels were higher in oilseed rape. The genotype traits were negligible compared to the effect of the growing site and concomitant conditions on the oilseed metabolome. This study demonstrates the applicability of NMR-based analysis in determining the species, geographical origin, developmental stage, and quality of oilseed Brassicas. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. BjuB.CYP79F1 Regulates Synthesis of Propyl Fraction of Aliphatic Glucosinolates in Oilseed Mustard Brassica juncea: Functional Validation through Genetic and Transgenic Approaches.

    Directory of Open Access Journals (Sweden)

    Manisha Sharma

    Full Text Available Among the different types of methionine-derived aliphatic glucosinolates (GS, sinigrin (2-propenyl, the final product in 3C GS biosynthetic pathway is considered very important as it has many pharmacological and therapeutic properties. In Brassica species, the candidate gene regulating synthesis of 3C GS remains ambiguous. Earlier reports of GSL-PRO, an ortholog of Arabidopsis thaliana gene At1g18500 as a probable candidate gene responsible for 3C GS biosynthesis in B. napus and B. oleracea could not be validated in B. juncea through genetic analysis. In this communication, we report the isolation and characterization of the gene CYP79F1, an ortholog of A. thaliana gene At1g16410 that is involved in the first step of core GS biosynthesis. The gene CYP79F1 in B. juncea showed presence-absence polymorphism between lines Varuna that synthesizes sinigrin and Heera virtually free from sinigrin. Using this presence-absence polymorphism, CYP79F1 was mapped to the previously mapped 3C GS QTL region (J16Gsl4 in the LG B4 of B. juncea. In Heera, the gene was observed to be truncated due to an insertion of a ~4.7 kb TE like element leading to the loss of function of the gene. Functional validation of the gene was carried out through both genetic and transgenic approaches. An F2 population segregating only for the gene CYP79F1 and the sinigrin phenotype showed perfect co-segregation. Finally, genetic transformation of a B. juncea line (QTL-NIL J16Gsl4 having high seed GS but lacking sinigrin with the wild type CYP79F1 showed the synthesis of sinigrin validating the role of CYP79F1 in regulating the synthesis of 3C GS in B. juncea.

  9. Consequences of gene flow between oilseed rape (Brassica napus) and its relatives.

    Science.gov (United States)

    Liu, Yongbo; Wei, Wei; Ma, Keping; Li, Junsheng; Liang, Yuyong; Darmency, Henri

    2013-10-01

    Numerous studies have focused on the probability of occurrence of gene flow between transgenic crops and their wild relatives and the likelihood of transgene escape, which should be assessed before the commercial release of transgenic crops. This review paper focuses on this issue for oilseed rape, Brassica napus L., a species that produces huge numbers of pollen grains and seeds. We analyze separately the distinct steps of gene flow: (1) pollen and seeds as vectors of gene flow; (2) spontaneous hybridization; (3) hybrid behavior, fitness cost due to hybridization and mechanisms of introgression; (4) and fitness benefit due to transgenes (e.g. herbicide resistance and Bt toxin). Some physical, biological and molecular means of transgene containment are also described. Although hybrids and first generation progeny are difficult to identify in fields and non-crop habitats, the literature shows that transgenes could readily introgress into Brassica rapa, Brassica juncea and Brassica oleracea, while introgression is expected to be rare with Brassica nigra, Hirschfeldia incana and Raphanus raphanistrum. The hybrids grow well but produce less seed than their wild parent. The difference declines with increasing generations. However, there is large uncertainty about the evolution of chromosome numbers and recombination, and many parameters of life history traits of hybrids and progeny are not determined with satisfactory confidence to build generic models capable to really cover the wide diversity of situations. We show that more studies are needed to strengthen and organize biological knowledge, which is a necessary prerequisite for model simulations to assess the practical and evolutionary outputs of introgression, and to provide guidelines for gene flow management. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. Oilseed brassica improvement through induced mutations

    International Nuclear Information System (INIS)

    Shah, S.A.; Ali, I.; Rehman, K.

    1992-07-01

    The improvement in processing and refining technologies of oil seed brassica have now made possible the use of rape seed mustard oil as cooking medium shortening, salad ingredients and in margarine in many countries. Different promising rape seed mutants were tested for yield and other agronomic traits in eight preliminary yields trails and results of these trails are presented in this report. Three varieties of rape seeds were subjected to 80, 100, 120 krads and two varieties of mustard were treated 60, 80, 100 krads dose of gamma rays. (A.B.)

  11. Unexpected diversity of feral genetically modified oilseed rape (Brassica napus L. despite a cultivation and import ban in Switzerland.

    Directory of Open Access Journals (Sweden)

    Juerg Schulze

    Full Text Available Despite cultivation and seed import bans of genetically modified (GM oilseed rape (Brassica napus L., feral GM plants were found growing along railway lines and in port areas at four sites in Switzerland in 2011 and 2012. All GM plants were identified as glyphosate-resistant GM event GT73 (Roundup Ready, Monsanto. The most affected sites were the Rhine port of Basel and the St. Johann freight railway station in Basel. To assess the distribution and intra- and interspecific outcrossing of GM oilseed rape in more detail, we monitored these two sites in 2013. Leaves and seed pods of feral oilseed rape plants, their possible hybridization partners and putative hybrid plants were sampled in monthly intervals and analysed for the presence of transgenes by real-time PCR. Using flow cytometry, we measured DNA contents of cell nuclei to confirm putative hybrids. In total, 2787 plants were sampled. The presence of GT73 oilseed rape could be confirmed at all previously documented sampling locations and was additionally detected at one new sampling location within the Rhine port. Furthermore, we found the glufosinate-resistant GM events MS8xRF3, MS8 and RF3 (all traded as InVigor, Bayer at five sampling locations in the Rhine port. To our knowledge, this is the first time that feral MS8xRF3, MS8 or RF3 plants were detected in Europe. Real-time PCR analyses of seeds showed outcrossing of GT73 into two non-GM oilseed rape plants, but no outcrossing of transgenes into related wild species was observed. We found no hybrids between oilseed rape and related species. GM plants most frequently occurred at unloading sites for ships, indicating that ship cargo traffic is the main entry pathway for GM oilseed rape. In the future, it will be of major interest to determine the source of GM oilseed rape seeds.

  12. Unexpected diversity of feral genetically modified oilseed rape (Brassica napus L.) despite a cultivation and import ban in Switzerland.

    Science.gov (United States)

    Schulze, Juerg; Frauenknecht, Tina; Brodmann, Peter; Bagutti, Claudia

    2014-01-01

    Despite cultivation and seed import bans of genetically modified (GM) oilseed rape (Brassica napus L.), feral GM plants were found growing along railway lines and in port areas at four sites in Switzerland in 2011 and 2012. All GM plants were identified as glyphosate-resistant GM event GT73 (Roundup Ready, Monsanto). The most affected sites were the Rhine port of Basel and the St. Johann freight railway station in Basel. To assess the distribution and intra- and interspecific outcrossing of GM oilseed rape in more detail, we monitored these two sites in 2013. Leaves and seed pods of feral oilseed rape plants, their possible hybridization partners and putative hybrid plants were sampled in monthly intervals and analysed for the presence of transgenes by real-time PCR. Using flow cytometry, we measured DNA contents of cell nuclei to confirm putative hybrids. In total, 2787 plants were sampled. The presence of GT73 oilseed rape could be confirmed at all previously documented sampling locations and was additionally detected at one new sampling location within the Rhine port. Furthermore, we found the glufosinate-resistant GM events MS8xRF3, MS8 and RF3 (all traded as InVigor, Bayer) at five sampling locations in the Rhine port. To our knowledge, this is the first time that feral MS8xRF3, MS8 or RF3 plants were detected in Europe. Real-time PCR analyses of seeds showed outcrossing of GT73 into two non-GM oilseed rape plants, but no outcrossing of transgenes into related wild species was observed. We found no hybrids between oilseed rape and related species. GM plants most frequently occurred at unloading sites for ships, indicating that ship cargo traffic is the main entry pathway for GM oilseed rape. In the future, it will be of major interest to determine the source of GM oilseed rape seeds.

  13. Biology and harmfulness of Brassica pod midge (Dasineura brassicae Winn. in winter oilseed rape

    Directory of Open Access Journals (Sweden)

    Draga Graora

    2015-04-01

    Full Text Available The Brassica pod midge (Dasineura brassicae Winn. is an important pest in oilseed rape (Brasica napus L.. It develops two generations per year and overwinters in the larval stage in cocoons in soil. Immigration of the first generation adults lasted from the beginning of April until the end of May. Larvae developed in pods from mid-April to mid-June, causing pod deformation and cracking, which resulted in premature falling out of seeds and yield reduction. Pod damage amounted to 11.6%. The emergence of the second generation adults was detected at the end of May and in the first ten days of June. D. brassicae was found to lay eggs in healthy pods and no correlation was found with the cabbage seed weevil, Ceutorhynchus assimilis Paykull.

  14. Hormones and Pod Development in Oilseed Rape (Brassica napus) 1

    Science.gov (United States)

    de Bouille, Pierre; Sotta, Bruno; Miginiac, Emile; Merrien, André

    1989-01-01

    The endogenous levels of several plant growth substances (indole acetic acid, IAA; abscisic acid, ABA; zeatin, Z; zeatin riboside, [9R]Z; isopentenyladenine, iP; and isopentenyladenosine, [9R]iP were measured during pod development of field grown oilseed Rape (Brassica napus L. var oleifera cv Bienvenu) with high performance liquid chromatography and immunoenzymic (enzyme-linked immunosorbent assay, ELISA) techniques. Results show that pod development is characterized by high levels of Z and [9R]Z in 3 day old fruits and of IAA on the fourth day. During pod maturation, initially a significant increase of IAA and cytokinins was observed, followed by a progressive rise of ABA levels and a concomitant decline of IAA and cytokinin (except iP) levels. The relationship between hormone levels and development, especially pod number, seed number per pod, and seed weight determination, will be discussed. PMID:16666891

  15. Quantification of Plasmodiophora brassicae Using a DNA-Based Soil Test Facilitates Sustainable Oilseed Rape Production

    OpenAIRE

    Ann-Charlotte Wallenhammar; Albin Gunnarson; Fredrik Hansson; Anders Jonsson

    2016-01-01

    Outbreaks of clubroot disease caused by the soil-borne obligate parasite Plasmodiophora brassicae are common in oilseed rape (OSR) in Sweden. A DNA-based soil testing service that identifies fields where P. brassicae poses a significant risk of clubroot infection is now commercially available. It was applied here in field surveys to monitor the prevalence of P. brassicae DNA in field soils intended for winter OSR production and winter OSR field experiments. In 2013 in Scania, prior to plantin...

  16. The effects of seed size on hybrids formed between oilseed rape (Brassica napus and wild brown mustard (B. juncea.

    Directory of Open Access Journals (Sweden)

    Yong-Bo Liu

    Full Text Available Seed size has significant implications in ecology, because of its effects on plant fitness. The hybrid seeds that result from crosses between crops and their wild relatives are often small, and the consequences of this have been poorly investigated. Here we report on plant performance of hybrid and its parental transgenic oilseed rape (Brassica napus and wild B. juncea, all grown from seeds sorted into three seed-size categories.Three seed-size categories were sorted by seed diameter for transgenic B. napus, wild B. juncea and their transgenic and non-transgenic hybrids. The seeds were sown in a field at various plant densities. Globally, small-seeded plants had delayed flowering, lower biomass, fewer flowers and seeds, and a lower thousand-seed weight. The seed-size effect varied among plant types but was not affected by plant density. There was no negative effect of seed size in hybrids, but it was correlated with reduced growth for both parents.Our results imply that the risk of further gene flow would probably not be mitigated by the small size of transgenic hybrid seeds. No fitness cost was detected to be associated with the Bt-transgene in this study.

  17. Quantification of Plasmodiophora brassicae Using a DNA-Based Soil Test Facilitates Sustainable Oilseed Rape Production.

    Science.gov (United States)

    Wallenhammar, Ann-Charlotte; Gunnarson, Albin; Hansson, Fredrik; Jonsson, Anders

    2016-04-22

    Outbreaks of clubroot disease caused by the soil-borne obligate parasite Plasmodiophora brassicae are common in oilseed rape (OSR) in Sweden. A DNA-based soil testing service that identifies fields where P. brassicae poses a significant risk of clubroot infection is now commercially available. It was applied here in field surveys to monitor the prevalence of P. brassicae DNA in field soils intended for winter OSR production and winter OSR field experiments. In 2013 in Scania, prior to planting, P. brassicae DNA was detected in 60% of 45 fields on 10 of 18 farms. In 2014, P. brassicae DNA was detected in 44% of 59 fields in 14 of 36 farms, in the main winter OSR producing region in southern Sweden. P. brassicae was present indicative of a risk for >10% yield loss with susceptible cultivars (>1300 DNA copies g soil(-1)) in 47% and 44% of fields in 2013 and 2014 respectively. Furthermore, P. brassicae DNA was indicative of sites at risk of complete crop failure if susceptible cultivars were grown (>50 000 copies g(-1) soil) in 14% and 8% of fields in 2013 and 2014, respectively. A survey of all fields at Lanna research station in western Sweden showed that P. brassicae was spread throughout the farm, as only three of the fields (20%) showed infection levels below the detection limit for P.brassicae DNA, while the level was >50,000 DNA copies g(-1) soil in 20% of the fields. Soil-borne spread is of critical importance and soil scraped off footwear showed levels of up to 682 million spores g(-1) soil. Soil testing is an important tool for determining the presence of P. brassicae and providing an indication of potential yield loss, e.g., in advisory work on planning for a sustainable OSR crop rotation. This soil test is gaining acceptance as a tool that increases the likelihood of success in precision agriculture and in applied research conducted in commercial oilseed fields and at research stations. The present application highlights the importance of prevention of

  18. Quantification of Plasmodiophora brassicae Using a DNA-Based Soil Test Facilitates Sustainable Oilseed Rape Production

    Directory of Open Access Journals (Sweden)

    Ann-Charlotte Wallenhammar

    2016-04-01

    Full Text Available Outbreaks of clubroot disease caused by the soil-borne obligate parasite Plasmodiophora brassicae are common in oilseed rape (OSR in Sweden. A DNA-based soil testing service that identifies fields where P. brassicae poses a significant risk of clubroot infection is now commercially available. It was applied here in field surveys to monitor the prevalence of P. brassicae DNA in field soils intended for winter OSR production and winter OSR field experiments. In 2013 in Scania, prior to planting, P. brassicae DNA was detected in 60% of 45 fields on 10 of 18 farms. In 2014, P. brassicae DNA was detected in 44% of 59 fields in 14 of 36 farms, in the main winter OSR producing region in southern Sweden. P. brassicae was present indicative of a risk for >10% yield loss with susceptible cultivars (>1300 DNA copies g soil−1 in 47% and 44% of fields in 2013 and 2014 respectively. Furthermore, P. brassicae DNA was indicative of sites at risk of complete crop failure if susceptible cultivars were grown (>50 000 copies g−1 soil in 14% and 8% of fields in 2013 and 2014, respectively. A survey of all fields at Lanna research station in western Sweden showed that P. brassicae was spread throughout the farm, as only three of the fields (20% showed infection levels below the detection limit for P.brassicae DNA, while the level was >50,000 DNA copies g−1 soil in 20% of the fields. Soil-borne spread is of critical importance and soil scraped off footwear showed levels of up to 682 million spores g−1 soil. Soil testing is an important tool for determining the presence of P. brassicae and providing an indication of potential yield loss, e.g., in advisory work on planning for a sustainable OSR crop rotation. This soil test is gaining acceptance as a tool that increases the likelihood of success in precision agriculture and in applied research conducted in commercial oilseed fields and at research stations. The present application highlights the importance of

  19. Effects of plant densities on yield, yield components and some morphological characters of two cultivators of oilseed rape (Brassica napus L.)

    DEFF Research Database (Denmark)

    Al-Barzinjy, M.; Stölen, O.; Christiansen, Jørgen Lindskrog

    2003-01-01

    Effects of Plant Densities on Yield, Yield Components and some Morphological Characters of two Cultivators of Oilseed Rape (Brassica napus L.)......Effects of Plant Densities on Yield, Yield Components and some Morphological Characters of two Cultivators of Oilseed Rape (Brassica napus L.)...

  20. Indications of selenium protection against cadmium and lead toxicity in oilseed rape (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Zhilin Wu

    2016-12-01

    Full Text Available The present study investigated the beneficial role of selenium (Se in protecting oilseed rape (Brassica napus L. plants from cadmium (Cd+2 and lead (Pb+2 toxicity. Exogenous Se markedly reduced Cd and Pb concentration in both roots and shoots. Supplementation of the medium with Se (5, 10 and 15 mg kg-1 alleviated the negative effect of Cd and Pb on growth and led to a decrease in oxidative damages caused by Cd and Pb. Furthermore, Se enhanced superoxide free radicals (O2-, hydrogen peroxide (H2O2 and lipid peroxidation, as indicated by malondialdehyde (MDA accumulation, but decreased superoxide dismutase (SOD and glutathione peroxidase (GPx activities. Meanwhile, the presence of Cd and Pb in the medium affected Se speciation in shoots. The results suggest that Se could alleviate Cd and Pb toxicity by preventing oxidative stress in oilseed rape plant.

  1. Landscape-scale distribution and persistence of genetically modified oilseed rape (Brassica napus) in Manitoba, Canada.

    Science.gov (United States)

    Knispel, Alexis L; McLachlan, Stéphane M

    2010-01-01

    Genetically modified herbicide-tolerant (GMHT) oilseed rape (OSR; Brassica napus L.) was approved for commercial cultivation in Canada in 1995 and currently represents over 95% of the OSR grown in western Canada. After a decade of widespread cultivation, GMHT volunteers represent an increasing management problem in cultivated fields and are ubiquitous in adjacent ruderal habitats, where they contribute to the spread of transgenes. However, few studies have considered escaped GMHT OSR populations in North America, and even fewer have been conducted at large spatial scales (i.e. landscape scales). In particular, the contribution of landscape structure and large-scale anthropogenic dispersal processes to the persistence and spread of escaped GMHT OSR remains poorly understood. We conducted a multi-year survey of the landscape-scale distribution of escaped OSR plants adjacent to roads and cultivated fields. Our objective was to examine the long-term dynamics of escaped OSR at large spatial scales and to assess the relative importance of landscape and localised factors to the persistence and spread of these plants outside of cultivation. From 2005 to 2007, we surveyed escaped OSR plants along roadsides and field edges at 12 locations in three agricultural landscapes in southern Manitoba where GMHT OSR is widely grown. Data were analysed to examine temporal changes at large spatial scales and to determine factors affecting the distribution of escaped OSR plants in roadside and field edge habitats within agricultural landscapes. Additionally, we assessed the potential for seed dispersal between escaped populations by comparing the relative spatial distribution of roadside and field edge OSR. Densities of escaped OSR fluctuated over space and time in both roadside and field edge habitats, though the proportion of GMHT plants was high (93-100%). Escaped OSR was positively affected by agricultural landscape (indicative of cropping intensity) and by the presence of an

  2. Progressive introgression between ¤Brassica napus¤ (oilseed rape) and ¤B-rapa¤

    DEFF Research Database (Denmark)

    Hansen, L.B.; Siegismund, H.R.; Bagger Jørgensen, Rikke

    2003-01-01

    We have earlier shown extensive introgression between oilseed rape (Brassica napus) and B. rapa in a weedy population using AFLP markers specific for the nuclear genomes. In order to describe the progress of this introgression, we examined 117 offspring from 12 maternal plants from the introgress...

  3. Male fitness of oilseed rape (¤Brassica napus¤), weedy ¤B-rapa¤ and their F1 hybrids when pollinating ¤B-rapa¤ seeds

    DEFF Research Database (Denmark)

    Pertl, M.; Hauser, T.P.; Damgaard, C.

    2002-01-01

    The likelihood that two species hybridise and backcross may depend strongly on environmental conditions, and possibly on competitive interactions between parents and hybrids. We studied the paternity of seeds produced by weedy Brassica rapa growing in mixtures with oilseed rape (B. napus) and the...... is strongly influenced by their local frequencies, and that male fitness of F(1)hybrids, when pollinating B. rapa seeds, is low even when their female fitness (seed set) is high.......The likelihood that two species hybridise and backcross may depend strongly on environmental conditions, and possibly on competitive interactions between parents and hybrids. We studied the paternity of seeds produced by weedy Brassica rapa growing in mixtures with oilseed rape (B. napus......) and their F(1) hybrids at different frequencies and densities. Paternity was determined by the presence of a transgene, morphology, and AFLP markers. In addition, observations of flower and pollen production, and published data on pollen fertilisation success, zygote survival, and seed germination, allowed us...

  4. The responses of crop - wild Brassica hybrids to simulated herbivory and interspecific competition: implications for transgene introgression.

    Science.gov (United States)

    Sutherland, Jamie P; Justinova, Lenka; Poppy, Guy M

    2006-01-01

    Brassica rapa grows as a wild and weedy species throughout the world and is the most likely recipient of transgenes from GM oilseed rape. For transgene introgression to occur, the critical step which must be realized, is the formation of an F1 hybrid. Concerns exist that hybrid populations could be more vigorous and competitive compared to the parental species. This study examines the effect of simulated herbivory and interspecific competition on the vegetative and reproductive performance of non-transgenic F1 hybrids and their parental lines. Several vegetative and reproductive performance measures were used to determine the effect of simulated herbivory and competition on the Brassica lines, including leaf length and biomass for herbivory and seedling height and biomass for competition. For defoliation experiments, B. rapa showed little response in terms of leaf length but B. napus and the F1 hybrid responded negatively. Brassica rapa showed elevated biomass responses, but B. napus and the hybrid demonstrated negative responses to defoliation. Defoliation at the cotyledon stage had a slight effect upon final biomass with the F1 hybrid performing significantly worse than B. napus, although seed counts were not significantly different. For the series of competition experiments, hybrids seemed to be more similar to B. rapa in terms of early seedling growth and reproductive measures. The underperformance of hybrid plants when challenged by herbivory and competition, could potentially decrease survivorship and explain the rarity of hybrids in field surveys. However, should transgene introgression occur, the dynamics of hybrids could change radically thus increasing the risk of gene flow from a transgenic oilseed rape crop to the wild recipient.

  5. Senescence-specific alteration of hydrogen peroxide levels in Arabidopsis thaliana and oilseed rape spring variety Brassica napus L. cv. Mozart.

    Science.gov (United States)

    Bieker, Stefan; Riester, Lena; Stahl, Mark; Franzaring, Jürgen; Zentgraf, Ulrike

    2012-08-01

    In order to analyze the signaling function of hydrogen peroxide (H(2)O(2)) production in senescence in more detail, we manipulated intracellular H(2)O(2) levels in Arabidopsis thaliala (L.) Heynh by using the hydrogen-peroxide-sensitive part of the Escherichia coli transcription regulator OxyR, which was directed to the cytoplasm as well as into the peroxisomes. H(2)O(2) levels were lowered and senescence was delayed in both transgenic lines, but OxyR was found to be more effective in the cytoplasm. To transfer this knowledge to crop plants, we analyzed oilseed rape plants Brassica napus L. cv. Mozart for H(2)O(2) and its scavenging enzymes catalase (CAT) and ascorbate peroxidase (APX) during leaf and plant development. H(2)O(2) levels were found to increase during bolting and flowering time, but no increase could be observed in the very late stages of senescence. With increasing H(2)O(2) levels, CAT and APX activities declined, so it is likely that similar mechanisms are used in oilseed rape and Arabidopsis to control H(2)O(2) levels. Under elevated CO(2) conditions, oilseed rape senescence was accelerated and coincided with an earlier increase in H(2)O(2) levels, indicating that H(2)O(2) may be one of the signals to inducing senescence in a broader range of Brassicaceae. © 2012 Institute of Botany, the Chinese Academy of Sciences.

  6. Microspore culture of winter oilseed rape (Brassica napus L.) in conjunction with other in vitro technologies

    International Nuclear Information System (INIS)

    Cegielska-Taras, T.; Szala, L.; Bartkowiak-Broda, I.

    2001-01-01

    Microspore culture in conjunction with other technologies such as selection, mutagenesis and transformation has been used for the production of novel genotypes of Brassica napus L. for crop improvement. The example of in vitro selection of microspore - derived embryos includes: a) ploidy level, b) seed oil composition (for example: high level of erucic acid), c) genotypes with restorer gene for CMS-ogura system (by means of isozyme marker PGI-2 ), d) herbicide resistant forms. Efficiency of microspore mutagenesis has been tested by the treatment of freshly isolated microspores with UV and MNU. Direct delivery of foreign gene to the microspores (microprojectile bombardment) combined with the use of Agrobacterium tumefaciens to microspore derived embryos seems to be a promising way of oilseed rape transformation. (author)

  7. Cadmium stress alters the redox reaction and hormone balance in oilseed rape (Brassica napus L.) leaves.

    Science.gov (United States)

    Yan, Hui; Filardo, Fiona; Hu, Xiaotao; Zhao, Xiaomin; Fu, DongHui

    2016-02-01

    In order to understand the physiological response of oilseed rape (Brassica napus L.) leaves to cadmium (Cd) stress and exploit the physiological mechanisms involved in Cd tolerance, macro-mineral and chlorophyll concentrations, reactive oxygen species (ROS) accumulation, activities of enzymatic antioxidants, nonenzymatic compounds metabolism, endogenous hormonal changes, and balance in leaves of oilseed rape exposed to 0, 100, or 200 μM CdSO4 were investigated. The results showed that under Cd exposure, Cd concentrations in the leaves continually increased while macro-minerals and chlorophyll concentrations decreased significantly. Meanwhile, with increased Cd stress, superoxide anion (O2(• -)) production rate and hydrogen peroxide (H2O2) concentrations in the leaves increased significantly, which caused malondialdehyde (MDA) accumulation and oxidative stress. For scavenging excess accumulated ROS and alleviating oxidative injury in the leaves, the activity of enzymatic antioxidants, such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), was increased significantly at certain stress levels. However, with increased Cd stress, the antioxidant enzyme activities all showed a trend towards reduction. The nonenzymatic antioxidative compounds, such as proline and total soluble sugars, accumulated continuously with increased Cd stress to play a long-term role in scavenging ROS. In addition, ABA levels also increased continuously with Cd stress while ZR decreased and the ABA/ZR ratio increased, which might also be providing a protective role against Cd toxicity.

  8. Persistence of seeds from crops of conventional and herbicide tolerant oilseed rape (Brassica napus).

    Science.gov (United States)

    Lutman, Peter J W; Berry, Kate; Payne, Roger W; Simpson, Euan; Sweet, Jeremy B; Champion, Gillian T; May, Mike J; Wightman, Pat; Walker, Kerr; Lainsbury, Martin

    2005-09-22

    A series of rotation experiments at five sites over four years has explored the environmental and agronomic implications of growing herbicide tolerant oilseed rape and sugar beet. This paper reports on the population dynamics of volunteer rape (Brassica napus). The experiments compared four winter oilseed rape (WOSR) cultivars: a conventional cultivar (Apex) and three developmental cultivars either genetically modified (GM) to be tolerant to glyphosate or glufosinate, or conventionally bred to be tolerant to herbicides of the imidazolinone group. Seed losses at harvest averaged 3575 seeds m(-2) but ranged from less than 2000 up to more than 10000 seeds m(-2). There was a rapid decline in seed numbers during the first few months after harvest, resulting in a mean loss of seeds of 60%. In subsequent seasons, the seedbank declined much more slowly at four of the five sites (ca 20% per year) and the models predicted 95% seed loss after approximately 9 years. Seed decline was much faster at the fifth site. There were no clear differences between the four cultivars in either the numbers of seeds shed at harvest or in their subsequent persistence. The importance of the persistence of GM rape seeds, in the context of the coexistence of GM and non-GM crops and the role of good management practices that minimize seed persistence, are discussed.

  9. Adventitious presence of other varieties in oilseed rape (¤Brassica napus¤) from seed banks and certified seed

    DEFF Research Database (Denmark)

    Jørgensen, T.; Hauser, Thure Pavlo; Bagger Jørgensen, Rikke

    2007-01-01

    To obtain information on possible sources of contamination of the seed harvest of oilseed rape (Brassica napus L., spp. napus) by other varieties (adventitious presence), we investigated the purity of certified seed lots; the abundance and origin of volunteers; and longevity and origin of seeds...... in the soil seed-bank. This information was acquired through DNA analysis of volunteers collected in the field and seedlings derived from the soil seed-bank. DNA profiles of the volunteers and seedlings were obtained using Inter Simple Sequence Repeat (ISSR) markers, and the profiles were compared with ISSR...... profiles from an assortment of 14 of the most commonly cultivated oilseed rape varieties from 1985 to 2004. This comparison was performed using the assignment program, AFLPOP. The age of the seed bank germinating to become volunteers was assumed from information on previously cultivated oilseed rape...

  10. Glyphostate-drift but not herbivory alters the rate of transgene flow from single and stacked trait transgenic canola (Brassica napus L.) to non-transgenic B. napus and B. rapa

    Science.gov (United States)

    While transgenic plants can offer agricultural benefits, the escape of transgenes out of crop fields is a major environmental concern. Escape of transgenic herbicide resistance has occurred between transgenic Brassica napus (canola) and weedy species in numerous locations. In t...

  11. Sulphur Nutrition and its Effect on Yield and Oil Content of Oilseed Rape (Brassica Napus L.

    Directory of Open Access Journals (Sweden)

    Mária Varényiová

    2017-01-01

    Full Text Available The aim of the experiment was to study the importance of sulphur in oilseed rape (Brassica napus L. nutrition as well as the effect of rising doses of sulphur in combination with nitrogen on yield, oiliness, oil production, nutrients content in seed and nutrients uptake by rapeseed. The plot–scale experiment was established in years 2013/14 and 2014/15 within the agricultural cooperative in Mojmírovce. There were four fertilization treatments on 600 m2 experimental plots in three replications in this experiment. The first treatment was unfertilized control. Other three treatments were fertilized by the same nitrogen dose of 160 kg.ha−1 and by increasing doses of sulphur. The second treatment was fertilized by a dose of 15 kg.ha−1 S, the third by a dose of 40 kg.ha−1 and a dose of 65 kg.ha−1 S was applied at the fourth treatment. The highest average yield 3.96 t.ha-1 was found when a dose of 40 kg.ha−1 S was applied. The application of sulphur in a dose of 65 kg.ha−1 was accompanied by a yield decrease by 11.4 % as compared to the treatment where a sulphur dose of 40 kg.ha−1 was used. An average oil content of 45.1, 45.5, and 44.0 % was found in treatments in which the doses of sulphur of 15, 40 and 65 kg.ha−1 were applied. No significant difference among the treatments fertilized by sulphur was found. The average oil production reached 1809, 1802 and 1595 kg.ha−1 in cases of treatments fertilized by sulphur doses of 15, 40 and 65 kg.ha−1.

  12. Identification and characterization of microRNAs in oilseed rape (Brassica napus) responsive to infection with the pathogenic fungus Verticillium longisporum using Brassica AA (Brassica rapa) and CC (Brassica oleracea) as reference genomes.

    Science.gov (United States)

    Shen, Dan; Suhrkamp, Ina; Wang, Yu; Liu, Shenyi; Menkhaus, Jan; Verreet, Joseph-Alexander; Fan, Longjiang; Cai, Daguang

    2014-11-01

    Verticillium longisporum, a soil-borne pathogenic fungus, causes vascular disease in oilseed rape (Brassica napus). We proposed that plant microRNAs (miRNAs) are involved in the plant-V. longisporum interaction. To identify oilseed rape miRNAs, we deep-sequenced two small RNA libraries made from V. longisporum infected/noninfected roots and employed Brassica rapa and Brassica oleracea genomes as references for miRNA prediction and characterization. We identified 893 B. napus miRNAs representing 360 conserved and 533 novel miRNAs, and mapped 429 and 464 miRNAs to the AA and CC genomes, respectively. Microsynteny analysis with the conserved miRNAs and their flanking protein coding sequences revealed 137 AA-CC genome syntenic miRNA pairs and 61 AA and 42 CC genome-unique miRNAs. Sixty-two miRNAs were responsive to the V. longisporum infection. We present data for specific interactions and simultaneously reciprocal changes in the expression levels of the miRNAs and their targets in the infected roots. We demonstrate that miRNAs are involved in the plant-fungus interaction and that miRNA168-Argonaute 1 (AGO1) expression modulation might act as a key regulatory module in a compatible plant-V. longisporum interaction. Our results suggest that V. longisporum may have evolved a virulence mechanism by interference with plant miRNAs to reprogram plant gene expression and achieve infection. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  13. The response of transgenic Brassica species to salt stress: a review.

    Science.gov (United States)

    Shah, Nadil; Anwar, Sumera; Xu, Jingjing; Hou, Zhaoke; Salah, Akram; Khan, Shahbaz; Gong, Jianfang; Shang, Zhengwei; Qian, Li; Zhang, Chunyu

    2018-06-01

    Salt stress is considered one of the main abiotic factors to limit crop growth and productivity by affecting morpho-physiological and biochemical processes. Genetically, a number of salt tolerant Brassica varieties have been developed and introduced, but breeding of such varieties is time consuming. Therefore, current focus is on transgenic technology, which plays an important role in the development of salt tolerant varieties. Various salt tolerant genes have been characterized and incorporated into Brassica. Therefore, such genetic transformation of Brassica species is a significant step for improvement of crops, as well as conferring salt stress resistance qualities to Brassica species. Complete genome sequencing has made the task of genetically transforming Brassica species easier, by identifying desired candidate genes. The present review discusses relevant information about the principles which should be employed to develop transgenic Brassica species, and also will recommend tools for improved tolerance to salinity.

  14. Genome-wide analysis and expression profiling of the GRF gene family in oilseed rape (Brassica napus L.).

    Science.gov (United States)

    Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na

    2017-07-15

    Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.

  15. Introduction of beet cyst nematode resistance from Sinapis alba L. and Raphanus sativus L. into Brassica napus L. (oil-seed rape) through sexual and somatic hybridization

    NARCIS (Netherlands)

    Lelivelt, C.L.C.

    1993-01-01

    Experiments were performed to select for beet cyst nematode (Heterodera schachtii Schm., abbrev. BCN) resistant genotypes of Brassica napus L. (oilseed rape), and to introduce BCN-resistance from the related species Raphanus

  16. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  17. TRANSGENIC PLANTS OF RAPE (BRASSICA NAPUS L. WITH GENE OSMYB4 HAVE INCREASED RESISTANCE TO SALTS OF HEAVY METALS

    Directory of Open Access Journals (Sweden)

    Raldugina G.N.

    2012-08-01

    Full Text Available This work aims to study the response of the transgenic spring rape plants (Brassica napus L. var. ‘Westar’ with the rice transfactor-encoding gene Osmyb4 to treatment with salts of heavy metals (HM CuSO4 or ZnSO4 and accumulation in the leaves of biomass, metals, photosynthetic pigments, lipid peroxidation, and antioxidant compounds: total phenols, anthocyanins, and antioxidant enzyme activity superoxide dismutase (SOD and guaiacol peroxidase (POX were determined. Vegetatively propagated transgenic plants and wild-type plants were grown on Hoagland-Snyder medium at 24°C, then at the 5-6th leaves-stage, CuSO4 (in concentration 25-150 mM or ZnSO4 (500 - 5000 mM were added to the growth medium, and plants were exposed to the salts for 15 days. Under the action of small concentrations of salts, the results obtained for the transgenic and untransformed plants did not differ, but at high concentrations strong differences between transgenic and untransformed plants were observed. In transgenic plants, accumulation of biomass was greater. Carotene and xanthophyll were destroyed in transgenic plants less than in the untransformed plants. They have accumulated in their leaves more metal, especially Zn, reaching almost to the accumulation of 7 mg per g of dry biomass, bringing these plants to the hyperaccumulation of Zn. In the tissues of transgenic plants exposed to high concentrations of salts, the content of total phenols, anthocyanins, and low molecular weight compounds, that are responsible for protection against ROS, increased significantly. All these results indicate a greater stability of the transgenic plants to the action of heavy metals, as evidenced also by less activity of lipid peroxidases in their tissue: at high salt concentrations, malondialdehyde (MDA accumulated significantly less in transgenic plants than in non-transformed plant tissues. The greater stability of transgenic plants to stressful effect of HM is also evidenced by the

  18. Significant reductions in oil quality and lipid content of oilseed rape (Brassica napus L.) under climate change

    DEFF Research Database (Denmark)

    Namazkar, Shahla; Egsgaard, Helge; Frenck, Georg

    2015-01-01

    Despite of the potential importance to food and bioenergy purposes, effects from climate change on plant oil quality have hardly been characterized.On a global basis Brassica napus L., rapeseed or oilseed rape, is the second largest source of vegetable oil after soybean and the predominant oil crop...... in Europe. We found significant changes in oil quality and quantity of four cultivars of oilseed rape grown in five future climate scenarios with elevated [CO2], [O-3] temperature and combinations hereof (similar to RCP8.5,(1)). Populations of the cultivars were grown under ambient and climate change...... conditions in a climate-phytotron. The treatments were ambient (360 ppm CO2, 19/12 degrees C (day/night), 20/20 ppb O-3 (day/night)), all factors elevated (650 ppm CO2, 24/17 degrees C, 60/20 ppb O-3), as well as two- and single-factor treatments with the elevated factors.The overall trend was that oil...

  19. Production of transgenic brassica juncea with the synthetic chitinase gene (nic) conferring resistance to alternaria brassicicola

    International Nuclear Information System (INIS)

    Munir, I.; Hussan, W.; Kazi, M.; Mian, A.

    2016-01-01

    Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)

  20. Hyperspectral and thermal imaging of oilseed rape (Brassica napus response to fungal species of the genus Alternaria.

    Directory of Open Access Journals (Sweden)

    Piotr Baranowski

    Full Text Available In this paper, thermal (8-13 µm and hyperspectral imaging in visible and near infrared (VNIR and short wavelength infrared (SWIR ranges were used to elaborate a method of early detection of biotic stresses caused by fungal species belonging to the genus Alternaria that were host (Alternaria alternata, Alternaria brassicae, and Alternaria brassicicola and non-host (Alternaria dauci pathogens to oilseed rape (Brassica napus L.. The measurements of disease severity for chosen dates after inoculation were compared to temperature distributions on infected leaves and to averaged reflectance characteristics. Statistical analysis revealed that leaf temperature distributions on particular days after inoculation and respective spectral characteristics, especially in the SWIR range (1000-2500 nm, significantly differed for the leaves inoculated with A. dauci from the other species of Alternaria as well as from leaves of non-treated plants. The significant differences in leaf temperature of the studied Alternaria species were observed in various stages of infection development. The classification experiments were performed on the hyperspectral data of the leaf surfaces to distinguish days after inoculation and Alternaria species. The second-derivative transformation of the spectral data together with back-propagation neural networks (BNNs appeared to be the best combination for classification of days after inoculation (prediction accuracy 90.5% and Alternaria species (prediction accuracy 80.5%.

  1. Genetic variants associated with the root system architecture of oilseed rape (Brassica napus L.) under contrasting phosphate supply.

    Science.gov (United States)

    Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei

    2017-08-01

    Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  2. Transgene escape and persistence in an agroecosystem: the case of glyphosate-resistant Brassica rapa L. in central Argentina.

    Science.gov (United States)

    Pandolfo, Claudio E; Presotto, Alejandro; Carbonell, Francisco Torres; Ureta, Soledad; Poverene, Mónica; Cantamutto, Miguel

    2018-03-01

    Brassica rapa L. is an annual Brassicaceae species cultivated for oil and food production, whose wild form is a weed of crops worldwide. In temperate regions of South America and especially in the Argentine Pampas region, this species is widely distributed. During 2014, wild B. rapa populations that escaped control with glyphosate applications by farmers were found in this area. These plants were characterized by morphology and seed acidic profile, and all the characters agreed with B. rapa description. The dose-response assays showed that the biotypes were highly resistant to glyphosate. It was also shown that they had multiple resistance to AHAS-inhibiting herbicides. The transgenic origin of the glyphosate resistance in B. rapa biotypes was verified by an immunological test which confirmed the presence of the CP4 EPSPS protein and by an event-specific GT73 molecular marker. The persistence of the transgene in nature was confirmed for at least 4 years, in ruderal and agrestal habitats. This finding suggests that glyphosate resistance might come from GM oilseed rape crops illegally cultivated in the country or as a seed contaminant, and it implies gene flow and introgression between feral populations of GM B. napus and wild B. rapa. The persistence and spread of the resistance in agricultural environments was promoted by the high selection pressure imposed by intensive herbicide usage in the prevalent no-till farming systems.

  3. Greenhouse gas emissions from the energy crop oilseed rape (Brassica napus); the role of photosynthetically active radiation in diurnal N2O flux variation.

    OpenAIRE

    Keane, J.Ben; Ineson, P.; Vallack, Harry W.; Blei, Emanuel; Howarth, Steve; McNamara, Niall P.; Rowe, Rebecca; Williams, Mathew; Toet, Sylvia

    2017-01-01

    Oilseed rape (OSR, Brassica napus L.) is an important feedstock for biodiesel; hence, carbon dioxide (CO2), methane (CH4) and particularly fertilizer-derived nitrous oxide (N2O) emissions during cultivation must be quantified to assess putative greenhouse gas (GHG) savings, thus creating an urgent and increasing need for such data. Substrates of nitrification [ammonium (NH4)] and denitrification [nitrate (NO3)], the predominant N2O production pathways, were supplied separately and in combinat...

  4. Analysis of yield and plant traits of oilseed rape (Brassica napus L. cultivated in temperate region in light of the possibilities of sowing in arid areas

    Directory of Open Access Journals (Sweden)

    Tadeusz Zając

    2016-12-01

    Full Text Available This work is a review of selected literature on the species of Brassica with the greatest economic significance. Oilseed rape (Brassica napus ssp. oleifera currently ranks third worldwide among oilseed crops used for oil production and is the most important in the temperate zone. The manifold uses of rape include not only human consumption of oil, but also the use of post-extraction meal to feed livestock as well as industrial applications as a source of bioenergy or cellulose. The improvement in the economic position of rape among crop plants is also due to the doubling of its yield between 1970 and 2009; the average annual increase in seed yield worldwide was 27 kg ha−1 yr−1. The yield level in Europe exceeds the average yields achieved in the world, particularly in Asia. Recently, the cultivation of oilseed rape was started on a relatively large acreage in Iran where the yield amounted 2.1 t ha−1, exceeding the yields of China and India. In Poland, the acreage of oilseed rape cultivation between 1965 and 2013 increased 3–4 times, and during this period the annual increase in seed yield was 29 kg ha−1 yr−1. Under the field conditions of the temperate climate zone, winter oilseed rape yield is mainly determined by agro-climatic conditions during the growing period, the level of nitrogen fertilization, and the production potential of varieties, which is currently highest in hybrids. There is a noticeable tendency of hybrids towards formation of more siliques by individual oilseed plants. Different production categories of plants appear in a rape crop. Semi-dwarf varieties of winter rapeseed are distinguished by greater silique density, particularly on the main shoot. Moreover, these hybrids are characterized by faster growth of the root system, which enables them to take up nitrogen from the soil more efficiently.

  5. Hydroponics versus field lysimeter studies of urea, ammonium and nitrate uptake by oilseed rape (Brassica napus L.).

    Science.gov (United States)

    Arkoun, Mustapha; Sarda, Xavier; Jannin, Laëtitia; Laîné, Philippe; Etienne, Philippe; Garcia-Mina, José-Maria; Yvin, Jean-Claude; Ourry, Alain

    2012-09-01

    N-fertilizer use efficiencies are affected by their chemical composition and suffer from potential N-losses by volatilization. In a field lysimeter experiment, (15)N-labelled fertilizers were used to follow N uptake by Brassica napus L. and assess N-losses by volatilization. Use of urea with NBPT (urease inhibitor) showed the best efficiency with the lowest N losses (8% of N applied compared with 25% with urea alone). Plants receiving ammonium sulphate, had similar yield achieved through a better N mobilization from vegetative tissues to the seeds, despite a lower N uptake resulting from a higher volatilization (43% of applied N). Amounts of (15)N in the plant were also higher when plants were fertilized with ammonium nitrate but N-losses reached 23% of applied N. In parallel, hydroponic experiments showed a deleterious effect of ammonium and urea on the growth of oilseed rape. This was alleviated by the nitrate supply, which was preferentially taken up. B. napus was also characterized by a very low potential for urea uptake. BnDUR3 and BnAMT1, encoding urea and ammonium transporters, were up-regulated by urea, suggesting that urea-grown plants suffered from nitrogen deficiency. The results also suggested a role for nitrate as a signal for the expression of BnDUR3, in addition to its role as a major nutrient. Overall, the results of the hydroponic study showed that urea itself does not contribute significantly to the N nutrition of oilseed rape. Moreover, it may contribute indirectly since a better use efficiency for urea fertilizer, which was further increased by the application of a urease inhibitor, was observed in the lysimeter study.

  6. Biomass and biomass water use efficiency in oilseed crop (Brassica juncea L.) under semi-arid microenvironments

    International Nuclear Information System (INIS)

    Adak, Tarun; Kumar, Gopal; Chakravarty, N.V.K.; Katiyar, R.K.; Deshmukh, P.S.; Joshi, H.C.

    2013-01-01

    Biomass production in arid and semi-arid regions requires a special attention owing to spatiotemporal scarcity of irrigation water wherein improved water use efficiency (WUE) of the crop is targeted. Under field conditions, the crop undergoes dynamic changes in near ground or within-canopy microenvironments. This changed microclimatic condition may have an impact on phenological response of the oilseed crop which in turn would affect biomass productivity, economic seed yield and water use efficiency of the crop. Henceforth, quantification of biomass production and its WUE of oilseed Brassica crop is essentially required owing to have better understanding of the crop water requirement under the era of climate change. Following a 2 years field experiment, it was revealed that the changes in leaf area index were explained by about 68–74%. The best fit polynomial third order regression analysis indicated >93% prediction in biomass production as a function of time factor. Improved biomass partitioning into economic sinks was also observed. Small scale change in near ground microenvironment may reduce the prediction of biomass variability to the extent of 3%. The mean ET variations were observed as 2.4, 1.5 and 3.2 mm day −1 during the critical phenological stages. Mean seed yield, biomass WUE and seed yield WUE ranged between 2.71 and 2.87 Mg ha −1 , 11.4 and 13.1 g m −2 mm −1 and 19.3 and 22.9 kg ha −1 mm −1 respectively. Variations in both biomass and seed yield water use efficiencies due to small scale change in near ground microclimates were revealed. -- Highlights: ► Assessing biomass productivity and its water use efficiency under arid and semi-arid regions is important. ► Under field conditions, the crop undergoes dynamic changes in near ground or within-canopy microenvironments. ► We have estimated changes in seasonal ET, within-canopy micrometeorological dynamics. ► Biomass productivity, partitioning and water use efficiencies were

  7. Ideotype population exploration: growth, photosynthesis, and yield components at different planting densities in winter oilseed rape (Brassica napus L.).

    Science.gov (United States)

    Ma, Ni; Yuan, Jinzhan; Li, Ming; Li, Jun; Zhang, Liyan; Liu, Lixin; Naeem, Muhammad Shahbaz; Zhang, Chunlei

    2014-01-01

    Rapeseed is one of the most important edible oil crops in the world and the seed yield has lagged behind the increasing demand driven by population growth. Winter oilseed rape (Brassica napus L.) is widely cultivated with relatively low yield in China, so it is necessary to find the strategies to improve the expression of yield potential. Planting density has great effects on seed yield of crops. Hence, field experiments were conducted in Wuhan in the Yangtze River basin with one conventional variety (Zhongshuang 11, ZS11) and one hybrid variety (Huayouza 9, HYZ9) at five planting densities (27.0×10(4), 37.5×10(4), 48.0×10(4), 58.5×10(4), 69.0×10(4) plants ha(-1)) during 2010-2012 to investigate the yield components. The physiological traits for high-yield and normal-yield populations were measured during 2011-2013. Our results indicated that planting densities of 58.5×10(4) plants ha(-1) in ZS11 and 48.0×10(4) plants ha(-1) in HYZ9 have significantly higher yield compared with the density of 27.0×10(4) plants ha(-1) for both varieties. The ideal silique numbers for ZS11 and HYZ9 were ∼0.9×10(4) (n m(-2)) and ∼1×10(4) (n m(-2)), respectively, and ideal primary branches for ZS11 and HYZ9 were ∼250 (n m(-2)) and ∼300 (n m(-2)), respectively. The highest leaf area index (LAI) and silique wall area index (SAI) was ∼5.0 and 7.0, respectively. Moreover, higher leaf net photosynthetic rate (Pn) and water use efficiency (WUE) were observed in the high-yield populations. A significantly higher level of silique wall photosynthesis and rapid dry matter accumulation were supposed to result in the maximum seed yield. Our results suggest that increasing the planting density within certain range is a feasible approach for higher seed yield in winter rapeseed in China.

  8. Development of transgenic Brassica juncea lines for reduced seed sinapine content by perturbing phenylpropanoid pathway genes.

    Directory of Open Access Journals (Sweden)

    Sachin Kajla

    Full Text Available Sinapine is a major anti-nutritive compound that accumulates in the seeds of Brassica species. When ingested, sinapine imparts gritty flavuor in meat and milk of animals and fishy odor to eggs of brown egg layers, thereby compromising the potential use of the valuable protein rich seed meal. Sinapine content in Brassica juncea germplasm ranges from 6.7 to 15.1 mg/g of dry seed weight (DSW which is significantly higher than the prescribed permissible level of 3.0 mg/g of DSW. Due to limited natural genetic variability, conventional plant breeding approach for reducing the sinapine content has largely been unsuccessful. Hence, transgenic approach for gene silencing was adopted by targeting two genes-SGT and SCT, encoding enzymes UDP- glucose: sinapate glucosyltransferase and sinapoylglucose: choline sinapoyltransferase, respectively, involved in the final two steps of sinapine biosynthetic pathway. These two genes were isolated from B. juncea and eight silencing constructs were developed using three different RNA silencing approaches viz. antisense RNA, RNAi and artificial microRNA. Transgenics in B. juncea were developed following Agrobacterium-mediated transformation. From a total of 1232 independent T0 transgenic events obtained using eight silencing constructs, 25 homozygous lines showing single gene inheritance were identified in the T2 generation. Reduction of seed sinapine content in these lines ranged from 15.8% to 67.2%; the line with maximum reduction had sinapine content of 3.79 mg/g of DSW. The study also revealed that RNAi method was more efficient than the other two methods used in this study.

  9. Transgenic Brassica juncea plants expressing MsrA1, a synthetic cationic antimicrobial peptide, exhibit resistance to fungal phytopathogens.

    Science.gov (United States)

    Rustagi, Anjana; Kumar, Deepak; Shekhar, Shashi; Yusuf, Mohd Aslam; Misra, Santosh; Sarin, Neera Bhalla

    2014-06-01

    Cationic antimicrobial peptides (CAPs) have shown potential against broad spectrum of phytopathogens. Synthetic versions with desirable properties have been modeled on these natural peptides. MsrA1 is a synthetic chimera of cecropin A and melittin CAPs with antimicrobial properties. We generated transgenic Brassica juncea plants expressing the msrA1 gene aimed at conferring fungal resistance. Five independent transgenic lines were evaluated for resistance to Alternaria brassicae and Sclerotinia sclerotiorum, two of the most devastating pathogens of B. juncea crops. In vitro assays showed inhibition by MsrA1 of Alternaria hyphae growth by 44-62 %. As assessed by the number and size of lesions and time taken for complete leaf necrosis, the Alternaria infection was delayed and restricted in the transgenic plants with the protection varying from 69 to 85 % in different transgenic lines. In case of S. sclerotiorum infection, the lesions were more severe and spread profusely in untransformed control compared with transgenic plants. The sclerotia formed in the stem of untransformed control plants were significantly more in number and larger in size than those present in the transgenic plants where disease protection of 56-71.5 % was obtained. We discuss the potential of engineering broad spectrum biotic stress tolerance by transgenic expression of CAPs in crop plants.

  10. Comparative field evaluation of some newer versus conventional insecticides for the control of aphids (homoptera: aphididae) on oilseed rape (brassica napus l.)

    International Nuclear Information System (INIS)

    Sarwar, M.; Ahmad, N.; Bux, M.; Nasrullah, A.; Tofique, M.

    2011-01-01

    This study was designed to evaluate the effects of new insecticides like, Imidacloprid (Confidor 200 EC), Thiomethoxam (Actara 25 WG) and Acetamiprid (Megamos 20 SL) belonging to Nitroguanidine group along with conventional insecticides such as, Chlorpyrifos (Lorsban 40 EC) and Dimethoate (Systoate 40 EC) belonging to Organophosphate group against aphids' population on oilseed rape (Brassica napus L.). A perusal of data, based on the overall performance of the test compounds, reflected that newer insecticides were superior in reducing the population of aphids and yield enhancement as compared to conventional insecticides. The best results were achieved with the application of Imidacloprid by recording the lowest number of aphids (2.2 per plant) than obtained with Thiomethoxam and Acetamiprid (3.22 and 4.66, respectively). Other insecticides, viz., Chlorpyrifos and Dimethoate were also found to be effective in maintaining the aphids' population at lower levels per plant (16.2 and 17.5, respectively) over untreated control (227.7). Imidacloprid was responsible for increasing the grain yield to 3722.85 Kg per Hectare, approached by Thiomethoxam, Acetamiprid, Chlorpyrifos and Dimethoate as against unsprayed control (2980.0, 2542.85, 1542.85, 540.0 and 604.85 Kg per Hectare, respectively). Study indicated that selective use of newer insecticides would seem a reasonable strategy in aphids controlling and integration of such chemicals in insects' management package could help to reduce pest densities. (author)

  11. Reproductive fitness of outcrossed hybrids between transgenic broccoli (brassica oleracea) carrying the ipt transgene and conventional varieties of kale, broccoli and cauliflower

    International Nuclear Information System (INIS)

    Ting, P.; Tu, Y.; Lin, C.; Chang, H.; Chen, L.; Litfu, A

    2014-01-01

    Pollens are potential carriers for genetically modified crops to transfer genetic materials horizontally to other plants. For phanerogams, pollen viability and cross-compatibility are critical factors for successful outcross hybridization. To evaluate this possibility, this project investigated pollen viability and pod setting rate by comparing broccoli (Brassica oleracea L. var. italica Planck) and broccoli transformed with the isopentenyl transferase (ipt) gene. Both served as pollen donors and four other varieties as pollen receptors to determine outcross rates. For pollen viability, F1 progeny was higher (p?0.05) for the cross of transgenic ipt broccoli with Li Syue significantly by FDA (fluorescein diacetate) assay. Higher successful hybrids were observed for transgenic ipt broccoli with Fu Yue, Li Syue and Green King. As pollen properties, number and grain diameter were significantly larger (p?0.05) in hybrid combinations of transgenic ipt broccoli with Li Syue and Green King significantly (p?0.05). The pod setting rates were higher while transgenic ipt broccoli served as donor plant. These results analyzing pollen properties between transgenic crops with possible outcross candidates would serve as one of those critical strategies for evaluating environmental biosafety issues for transgenic crops. (author)

  12. Diversity and Genome Analysis of Australian and Global Oilseed Brassica napus L. Germplasm Using Transcriptomics and Whole Genome Re-sequencing

    Directory of Open Access Journals (Sweden)

    M. Michelle Malmberg

    2018-04-01

    Full Text Available Intensive breeding of Brassica napus has resulted in relatively low diversity, such that B. napus would benefit from germplasm improvement schemes that sustain diversity. As such, samples representative of global germplasm pools need to be assessed for existing population structure, diversity and linkage disequilibrium (LD. Complexity reduction genotyping-by-sequencing (GBS methods, including GBS-transcriptomics (GBS-t, enable cost-effective screening of a large number of samples, while whole genome re-sequencing (WGR delivers the ability to generate large numbers of unbiased genomic single nucleotide polymorphisms (SNPs, and identify structural variants (SVs. Furthermore, the development of genomic tools based on whole genomes representative of global oilseed diversity and orientated by the reference genome has substantial industry relevance and will be highly beneficial for canola breeding. As recent studies have focused on European and Chinese varieties, a global diversity panel as well as a substantial number of Australian spring types were included in this study. Focusing on industry relevance, 633 varieties were initially genotyped using GBS-t to examine population structure using 61,037 SNPs. Subsequently, 149 samples representative of global diversity were selected for WGR and both data sets used for a side-by-side evaluation of diversity and LD. The WGR data was further used to develop genomic resources consisting of a list of 4,029,750 high-confidence SNPs annotated using SnpEff, and SVs in the form of 10,976 deletions and 2,556 insertions. These resources form the basis of a reliable and repeatable system allowing greater integration between canola genomics studies, with a strong focus on breeding germplasm and industry applicability.

  13. High-throughput phenotyping (HTP) identifies seedling root traits linked to variation in seed yield and nutrient capture in field-grown oilseed rape (Brassica napus L.).

    Science.gov (United States)

    Thomas, C L; Graham, N S; Hayden, R; Meacham, M C; Neugebauer, K; Nightingale, M; Dupuy, L X; Hammond, J P; White, P J; Broadley, M R

    2016-04-06

    Root traits can be selected for crop improvement. Techniques such as soil excavations can be used to screen root traits in the field, but are limited to genotypes that are well-adapted to field conditions. The aim of this study was to compare a low-cost, high-throughput root phenotyping (HTP) technique in a controlled environment with field performance, using oilseed rape (OSR;Brassica napus) varieties. Primary root length (PRL), lateral root length and lateral root density (LRD) were measured on 14-d-old seedlings of elite OSR varieties (n = 32) using a 'pouch and wick' HTP system (∼40 replicates). Six field experiments were conducted using the same varieties at two UK sites each year for 3 years. Plants were excavated at the 6- to 8-leaf stage for general vigour assessments of roots and shoots in all six experiments, and final seed yield was determined. Leaves were sampled for mineral composition from one of the field experiments. Seedling PRL in the HTP system correlated with seed yield in four out of six (r = 0·50, 0·50, 0·33, 0·49;P emergence in three out of five (r = 0·59, 0·22, 0·49;P emergence, general early vigour or yield in the field. Associations between PRL and field performance are generally related to early vigour. These root traits might therefore be of limited additional selection value, given that vigour can be measured easily on shoots/canopies. In contrast, LRD cannot be assessed easily in the field and, if LRD can improve nutrient uptake, then it may be possible to use HTP systems to screen this trait in both elite and more genetically diverse, non-field-adapted OSR. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company.

  14. Evaluation of Effect of Gamma Rays Irradiation for Increasing of Variation in Germination and Agronomic Traits in Oilseed rape (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    R. Momeni

    2012-04-01

    Full Text Available Increasing of genetic diversity is one of primary and basic goals of plant breeding programs. Induction of mutation is a method to increase genetic diversity that can be used in accommodate with selection, recombination and or combination of them in plant breeding. The aim of this study was to investigate the impact of different doses of gamma rays (500, 700, 900, 1100 and 1300 Gry on primary growth characters, such as: rate and percentage of germination, the length of rootlet and stemlet in M1 generation, and on agronomic characters such as: plant height, number of lateral branches, number of pods on main and lateral stem, length of pods and weigth of 1000-seed in M2 generation for two varieties of oilseed rape (Brassica napus, PF and Zarfam. Results of lab experiments showed that for both varieties, the germination percentage, the length of rootlet and the length of stemlet were significantly decreased by mutagen in compare with the control. While germination rate was only significantly affected by mutagen in PF. The estimation of "F" showed that there was significant difference between the variance of treatments for the germination rate and germination percentage in PF cultivar and for germination rate and stemlet length in Zarfam cultivar. In fact, increasing of gamma doses causes considerable enhancement in variance of treatment in compare with the control. The maximum relative coefficient of variation was related to 1300 Gry for germination rate of PF. In M2, all traits of study except number of pods on main stem was decreased by different doses of Gamma rays in PF cultivar. In opposition to other traits, Pods on main stem in PF cultivar was increased in different doses of gamma ray in compare with the control. But in Zarfam cultivar, only 1000-seed weight was significantly affected by Gamma rays.

  15. Modelling and estimating pollen movement in oilseed rape (Brassica napus) at the landscape scale using genetic markers.

    Science.gov (United States)

    Devaux, C; Lavigne, C; Austerlitz, F; Klein, E K

    2007-02-01

    Understanding patterns of pollen movement at the landscape scale is important for establishing management rules following the release of genetically modified (GM) crops. We use here a mating model adapted to cultivated species to estimate dispersal kernels from the genotypes of the progenies of male-sterile plants positioned at different sampling sites within a 10 x 10-km oilseed rape production area. Half of the pollen clouds sampled by the male-sterile plants originated from uncharacterized pollen sources that could consist of both large volunteer and feral populations, and fields within and outside the study area. The geometric dispersal kernel was the most appropriate to predict pollen movement in the study area. It predicted a much larger proportion of long-distance pollination than previously fitted dispersal kernels. This best-fitting mating model underestimated the level of differentiation among pollen clouds but could predict its spatial structure. The estimation method was validated on simulated genotypic data, and proved to provide good estimates of both the shape of the dispersal kernel and the rate and composition of pollen issued from uncharacterized pollen sources. The best dispersal kernel fitted here, the geometric kernel, should now be integrated into models that aim at predicting gene flow at the landscape level, in particular between GM and non-GM crops.

  16. Study of Plant Growth Promoting Rhizobacteria (PGPR and Drought on Physiological Traits and Ultimate Yield of Cultivars of Oilseed Rape (Brassica spp. L.

    Directory of Open Access Journals (Sweden)

    pooya arvin

    2018-02-01

    Full Text Available Introduction Oilseed rape (Brassica spp L. is one of the valuable oilseed crops which has been attracting attention in recent years. Iran is located in a semi-arid region, and water shortage has caused problems, namely providing drinking water as much as water supply for crop production. Not only does Plant Growth Promoting Rhizobacteria (PGPR make plant growth stimulating hormones like Auxin and Gibberellin but also can ease stress conditions by producing ABA. Consequently, considering the current water shortage crisis in Iran, we took three main criteria into account: the roles of PGPRs in increasing resistance to abiotic stress, relief of drought effects, and the importance of cultivation of oilseed rape. The present research has been compiled to study drought and some Plant Growth Promoting Rhizobacteria (PGPR on Physiological Traits and Ultimate Yield of Cultivars of Oilseed Rape. Materials and Methods The current study was done on the basis of two simultaneous experiments (under stress and non-stress experiments during 2010- 2011 growing season at Agriculture and Natural Resources Research Station of Torogh, Mashhad is situated in East-North of Iran (36° N, 59° E, 1003 ASL . Two research sites (under stress and no-stress fields were selected beside each other. This region has a semi-arid climate (annual rainfall 286 mm. The experimental design was factorial based on randomized completely block design with three replications in each experiment. The first treatment was Plant Growth Promoting Rizobactria, including B0: no inoculation (control, B1: co-inoculation (Pseudomonas flourescens 169+P. putida 108, B2: inoculation with P. flourescens 169 and B3: inoculation with P. putida 108. Second treatment was cultivar, including Hayola401 and Hayola330 cultivars belong to Brassica napus, Parkland and Goldrush cultivars belong to B. rapa and BP18 and landrace cultivars belong to B.juncea .Greenness index, plant height, relative water content

  17. Genetic and Epigenetic Changes in Oilseed Rape (Brassica napus L.) Extracted from Intergeneric Allopolyploid and Additions with Orychophragmus.

    Science.gov (United States)

    Gautam, Mayank; Dang, Yanwei; Ge, Xianhong; Shao, Yujiao; Li, Zaiyun

    2016-01-01

    Allopolyploidization with the merger of the genomes from different species has been shown to be associated with genetic and epigenetic changes. But the maintenance of such alterations related to one parental species after the genome is extracted from the allopolyploid remains to be detected. In this study, the genome of Brassica napus L. (2n = 38, genomes AACC) was extracted from its intergeneric allohexaploid (2n = 62, genomes AACCOO) with another crucifer Orychophragmus violaceus (2n = 24, genome OO), by backcrossing and development of alien addition lines. B. napus-type plants identified in the self-pollinated progenies of nine monosomic additions were analyzed by the methods of amplified fragment length polymorphism, sequence-specific amplified polymorphism, and methylation-sensitive amplified polymorphism. They showed modifications to certain extents in genomic components (loss and gain of DNA segments and transposons, introgression of alien DNA segments) and DNA methylation, compared with B. napus donor. The significant differences in the changes between the B. napus types extracted from these additions likely resulted from the different effects of individual alien chromosomes. Particularly, the additions which harbored the O. violaceus chromosome carrying dominant rRNA genes over those of B. napus tended to result in the development of plants which showed fewer changes, suggesting a role of the expression levels of alien rRNA genes in genomic stability. These results provided new cues for the genetic alterations in one parental genome that are maintained even after the genome becomes independent.

  18. Genetic and epigenetic changes in oilseed rape (Brassica napus L. extracted from intergeneric allopolyploid and additions with Orychophragmus

    Directory of Open Access Journals (Sweden)

    Mayank eGautam

    2016-04-01

    Full Text Available ABSTRACT Allopolyploidization with the merger of the genomes from different species has been shown to be associated with genetic and epigenetic changes. But the maintenance of such alterations related to one parental species after the genome is extracted from the allopolyploid remains to be detected. In this study, the genome of Brassica napus L. (2n=38, genomes AACC was extracted from its intergeneric allohexaploid (2n=62, genomes AACCOO with another crucifer Orychophragmus violaceus (2n=24, genome OO, by backcrossing and development of alien addition lines. B. napus-type plants identified in the self-pollinated progenies of nine monosomic additions were analyzed by the methods of amplified fragment length polymorphism (AFLP, sequence-specific amplified polymorphism (SSAP, and methylation-sensitive amplified polymorphism (MSAP. They showed modifications to certain extents in genomic components (loss and gain of DNA segments and transposons, introgression of alien DNA segments and DNA methylation, compared with B. napus donor. The significant differences in the changes between the B. napus types extracted from these additions likely resulted from the different effects of individual alien chromosomes. Particularly, the additions which harbored the O. violaceus chromosome carrying dominant rRNA genes over those of B. napus tended to result in the development of plants which showed fewer changes, suggesting a role of the expression levels of alien rRNA genes in genomic stability. These results provided new cues for the genetic alterations in one parental genome that are maintained even after the genome becomes independent.

  19. Fixed-route monitoring and a comparative study of the occurrence of herbicide-resistant oilseed rape (Brassica napus L.) along a Japanese roadside

    Science.gov (United States)

    Nishizawa, Toru; Nakajima, Nobuyoshi; Tamaoki, Masanori; Aono, Mitsuko; Kubo, Akihiro; Saji, Hikaru

    2016-01-01

    ABSTRACT Previously, we conducted a roadside survey to reveal the occurrence of genetically modified (GM) oilseed rape along a Japanese roadside (Route 51). In this study, we performed successive and thorough fixed-route monitoring in 5 sections along another road (Route 23). Oilseed rape plants were detected on both sides of the road in each section between autumn 2009 and winter 2013, which included 3 flowering seasons. In four sections, more plants were found on the side of the road leading from the Yokkaichi port than on the opposite side. In the fifth section, the presence of clogged drains on the roadside, where juvenile plants concentrated, caused the opposite distribution: oilseed rape predominantly occurred along the inbound lanes (leading to the Yokkaichi port) in 2010 and 2012. Unlike in our previous survey, glyphosate- or glufosinate-resistant oilseed rape plants were abundant (>75% of analyzed plants over 3 years). Moreover, a few individuals bearing both herbicide resistance traits were also detected in some sections. The spillage of imported seeds may explain the occurrence of oilseed rape on the roadside. The abundance of herbicide-resistant oilseed rape plants may reflect the extent of contamination with GM oilseed rape seed within imports. PMID:26838503

  20. To be or not to be biosafe : an evaluation of transgenic phosphinothricin-tolerant oilseed rape (Brassica napus L.)

    NARCIS (Netherlands)

    Metz, P.L.J.

    1997-01-01

    Genetic modification is an additional tool for conventional plant breeding to improve the application and quality of crop plants. No longer hampered by natural crossing barriers, application of genetic modification results in a nearly infinite pool from which genes, after isolation, can be

  1. Subgenome parallel selection is associated with morphotype diversification and convergent crop domestication in Brassica rapa and Brassica oleracea

    NARCIS (Netherlands)

    Cheng, Feng; Sun, Rifei; Hou, Xilin; Zheng, Hongkun; Zhang, Fenglan; Zhang, Yangyong; Liu, Bo; Liang, Jianli; Zhuang, Mu; Liu, Yunxia; Liu, Dongyuan; Wang, Xiaobo; Li, Pingxia; Liu, Yumei; Lin, Ke; Bucher, Johan; Zhang, Ningwen; Wang, Yan; Wang, Hui; Deng, Jie; Liao, Yongcui; Wei, Keyun; Zhang, Xueming; Fu, Lixia; Hu, Yunyan; Liu, Jisheng; Cai, Chengcheng; Zhang, Shujiang; Zhang, Shifan; Li, Fei; Zhang, Hui; Zhang, Jifang; Guo, Ning; Liu, Zhiyuan; Liu, Jin; Sun, Chao; Ma, Yuan; Zhang, Haijiao; Cui, Yang; Freeling, Micheal R.; Borm, Theo; Bonnema, Guusje; Wu, Jian; Wang, Xiaowu

    2016-01-01

    Brassica species, including crops such as cabbage, turnip and oilseed, display enormous phenotypic variation. Brassica genomes have all undergone a whole-genome triplication (WGT) event with unknown effects on phenotype diversification. We resequenced 199 Brassica rapa and 119 Brassica oleracea

  2. Transgenic tobacco plants expressing BoRS1 gene from Brassica ...

    Indian Academy of Sciences (India)

    Water stress is by far the leading environmental stress limiting crop yields worldwide. Genetic engineering techniques hold great promise for developing crop cultivars with high tolerance to water stress. In this study, the Brassica oleracea var. acephala BoRS1 gene was transferred into tobacco through ...

  3. Glyphosate drift promotes changes in fitness and transgene flow in canola (Brassica napus) and hybrids

    Science.gov (United States)

    1. With the advent of transgenic crops, genetically modified, herbicide resistant B. napus has become a model system for examining the risks of escape of transgenes from cultivation and for evaluating potential ecological consequences of novel genes in wild species. 2. We exam...

  4. Multiple transgene traits may create un-intended fitness effects in Brassica napus

    Science.gov (United States)

    Increasingly, genetically modified crops are being developed to express multiple “stacked” traits for different types of transgenes, for example, herbicide resistance, insect resistance, crop quality and resistance to environmental factors. The release of crops that express mult...

  5. Status of feral oilseed rape in Europe: its minor role as a GM impurity and its potential as a reservoir of transgene persistence

    DEFF Research Database (Denmark)

    Squire, Geoffrey R.; Breckling, Broder; Dietz Pfeilstetter, Antje

    2011-01-01

    Feral oilseed rape has become widespread in Europe on waysides and waste ground. Its potential as a source of GM impurity in oilseed rape harvests is quantified, for the first time, by a consistent analysis applied over a wide range of study areas in Europe. The maximum contribution of feral...

  6. Altered Fruit and Seed Development of Transgenic Rapeseed (Brassica napus Over-Expressing MicroRNA394.

    Directory of Open Access Journals (Sweden)

    Jian Bo Song

    Full Text Available Fruit and seed development in plants is a complex biological process mainly involved in input and biosynthesis of many storage compounds such as proteins and oils. Although the basic biochemical pathways for production of the storage metabolites in plants are well characterized, their regulatory mechanisms are not fully understood. In this study, we functionally identified rapeseed (Brassica napus miR394 with its target gene Brassica napus leaf curling responsiveness (BnLCR to dissect a role of miR394 during the fruit and seed development. Transgenic rapeseed plants over-expressing miR394 under the control of the cauliflower mosaic virus 35S promoter were generated. miR394 over-expression plants exhibited a delayed flowering time and enlarged size of plants, leaf blade, pods and seed body, but developed seeds with higher contents of protein and glucosinolates (GLS and lower levels of oil accumulation as compared to wild-type. Over-expression of miR394 altered the fatty acid (FA composition by increasing several FA species such as C16:0 and C18:0 and unsaturated species of C20:1 and C22:1 but lowering C18:3. This change was accompanied by induction of genes coding for transcription factors of FA synthesis including leafy cotyledon1 (BnLEC1, BnLEC2, and FUSCA3 (FUS3. Because the phytohormone auxin plays a crucial role in fruit development and seed patterning, the DR5-GUS reporter was used for monitoring the auxin response in Arabidopsis siliques and demonstrated that the DR5 gene was strongly expressed. These results suggest that BnmiR394 is involved in rapeseed fruit and seed development.

  7. Differences between winter oilseed rape (Brassica napus L.) cultivars in nitrogen starvation-induced leaf senescence are governed by leaf-inherent rather than root-derived signals

    Czech Academy of Sciences Publication Activity Database

    Koeslin-Findeklee, F.; Becker, M. A.; van der Graaff, E.; Roitsch, Thomas; Horst, W. J.

    2015-01-01

    Roč. 66, č. 13 (2015), s. 3669-3681 ISSN 0022-0957 Institutional support: RVO:67179843 Keywords : Brassica napus * cytokinins * genotypic differences * leaf senescence * nitrogen efficiency * nitrogen starvation * reciprocal grafting * stay-green Subject RIV: EH - Ecology, Behaviour Impact factor: 5.677, year: 2015

  8. Climate change and genetically modified insecticidal plants. Plant-herbivore interactions and secondary chemistry of Bt Cry1Ac-toxin producing oilseed rape (Brassica napus L.) under elevated CO{sub 2} or O{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Himanen, S.

    2008-07-01

    Transgenic insect-resistant plants producing Bacillus thuringiensis (Bt) crystalline endotoxins are the first commercial applications of genetically modified crops and their use has steadily expanded over the last ten years. Together with the expanding agricultural use of transgenic crops, climate change is predicted to be among the major factors affecting agriculture in the coming years. Plants, herbivores and insects of higher trophic levels are all predicted to be affected by the current atmospheric climate change. However, only very few studies to date have addressed the sustained use and herbivore interactions of Bt-producing plants under the influence of these abiotic factors. The main objective of this study was to comparatively assess the performance of a Bt Cry1Ac toxin-producing oilseed rape line and its non-transgenic parent line in terms of vegetative growth and allocation to secondary defence compounds (glucosinolates and volatile terpenoids), and the performance of Bt-target and nontarget insect herbivores as well as tritrophic interaction functioning on these lines. For this, several growth chamber experiments with vegetative stage non-Bt and Bt plants facing exposures to doubled atmospheric CO{sub 2} level alone or together with increased temperature and different regimes of elevated O{sub 3} were conducted. The main hypothesis of this work was that Bt-transgenic plants have reduced performance or allocation to secondary compounds due to the cost of producing Bt toxin under changed abiotic environments. The Bt-transgenic oilseed rape line exhibited slightly delayed vegetative growth and had increased nitrogen and reduced carbon content compared to the non-transgenic parent line, but the physiological responses (i.e. biomass gain and photosynthesis) of the plant lines to CO{sub 2} and O{sub 3} enhancements were equal. Two aphid species, non-susceptible to Bt Cry1Ac, showed equal performance and reproduction on both plant lines under elevated CO{sub 2

  9. Impact of Transgenic Brassica napus Harboring the Antifungal Synthetic Chitinase (NiC Gene on Rhizosphere Microbial Diversity and Enzyme Activities

    Directory of Open Access Journals (Sweden)

    Mohammad S. Khan

    2017-07-01

    Full Text Available Transgenic Brassica napus harboring the synthetic chitinase (NiC gene exhibits broad-spectrum antifungal resistance. As the rhizosphere microorganisms play an important role in element cycling and nutrient transformation, therefore, biosafety assessment of NiC containing transgenic plants on soil ecosystem is a regulatory requirement. The current study is designed to evaluate the impact of NiC gene on the rhizosphere enzyme activities and microbial community structure. The transgenic lines with the synthetic chitinase gene (NiC showed resistance to Alternaria brassicicola, a common disease causing fungal pathogen. The rhizosphere enzyme analysis showed no significant difference in the activities of fivesoil enzymes: alkalyine phosphomonoestarase, arylsulphatase, β-glucosidase, urease and sucrase between the transgenic and non-transgenic lines of B. napus varieties, Durr-e-NIFA (DN and Abasyne-95 (AB-95. However, varietal differences were observed based on the analysis of molecular variance. Some individual enzymes were significantly different in the transgenic lines from those of non-transgenic but the results were not reproducible in the second trail and thus were considered as environmental effect. Genotypic diversity of soil microbes through 16S–23S rRNA intergenic spacer region amplification was conducted to evaluate the potential impact of the transgene. No significant diversity (4% for bacteria and 12% for fungal between soil microbes of NiC B. napus and the non-transgenic lines was found. However, significant varietal differences were observed between DN and AB-95 with 79% for bacterial and 54% for fungal diversity. We conclude that the NiC B. napus lines may not affect the microbial enzyme activities and community structure of the rhizosphere soil. Varietal differences might be responsible for minor changes in the tested parameters.

  10. Contribution of Nitrogen Uptake and Retranslocation during Reproductive Growth to the Nitrogen Efficiency of Winter Oilseed-Rape Cultivars (Brassica napus L. Differing in Leaf Senescence

    Directory of Open Access Journals (Sweden)

    Fabian Koeslin-Findeklee

    2016-01-01

    Full Text Available Genotypic variation in N efficiency defined as high grain yield under limited nitrogen (N supply of winter oilseed-rape line-cultivars has been predominantly attributed to N uptake efficiency (NUPT through maintained N uptake during reproductive growth related to functional stay-green. For investigating the role of stay-green, N retranslocation and N uptake during the reproductive phase for grain yield formation, two line cultivars differing in N starvation-induced leaf senescence were grown in a field experiment without mineral N (N0 and with 160 kg N·ha−1 (N160. Through frequent harvests from full flowering until maturity N uptake, N utilization and apparent N remobilization from vegetative plant parts to the pods could be calculated. NUPT proved being more important than N utilization efficiency (NUE for grain yield formation under N-limiting (N0 conditions. For cultivar differences in N efficiency, particularly N uptake during flowering (NUPT and biomass allocation efficiency (HI to the grains, were decisive. Both crop traits were related to delayed senescence of the older leaves. Remobilization of N particularly from stems and leaves was more important for pod N accumulation than N uptake after full flowering. Pod walls (high N concentrations and stems (high biomass mainly contributed to the crop-residue N at maturity. Decreasing the crop-inherent high N budget surplus of winter oilseed-rape requires increasing the low N remobilization efficiency particularly of pod-wall N to the grains. Addressing this conclusion, multi-year and -location field experiments with an extended range of cultivars including hybrids are desirable.

  11. Molecular cloning and characterization of a KCS gene from Cardamine graeca and its heterologous expression in Brassica oilseeds to engineer high nervonic acid oils for potential medical and industrial use.

    Science.gov (United States)

    Taylor, David C; Francis, Tammy; Guo, Yiming; Brost, Jennifer M; Katavic, Vesna; Mietkiewska, Elzbieta; Michael Giblin, E; Lozinsky, Sharla; Hoffman, Travis

    2009-12-01

    Nervonic acid 24:1 Delta15 (cis-tetracos-15-enoic acid) is a very long-chain monounsaturated fatty acid and exists in nature as an elongation product of oleic acid. There is an increasing interest in production of high nervonic acid oils for pharmaceutical, nutraceutical and industrial applications. Using a polymerase chain reaction approach, we have isolated a gene from Cardamine graeca L., which encodes a 3-ketoacyl-CoA synthase (KCS), the first component of the elongation complex involved in synthesis of nervonic acid. Expression of the Cardamine KCS in yeast resulted in biosynthesis of nervonic acid, which is not normally present in yeast cells. We transformed Arabidopsis and Brassica carinata with the Cardamine KCS under the control of the seed-specific promoter, napin. The T(3) generations of transgenic Arabidopsis and B. carinata plants expressing the Cardamine KCS showed that seed-specific expression resulted in relatively large comparative increases in nervonic acid proportions in Arabidopsis seed oil, and 15-fold increase in nervonic acid proportions in B. carinata seed oil. The highest nervonic acid level in transgenic B. carinata lines reached 44%, with only 6% of residual erucic acid. In contrast, similar transgenic expression of the Cardamine KCS in high erucic B. napus resulted in 30% nervonic acid but with 20% residual erucic acid. Experiments using the Lunaria KCS gene gave results similar to the latter. In both cases, the erucic acid content is too high for human or animal consumption. Thus, the Cardamine KCS: B. carinata high nervonic/highly reduced erucic transgenic seed oils will be the most suitable for testing in pharmaceutical/nutraceutical applications to improve human and animal health.

  12. Tolerance of transgenic canola plants (Brassica napus) amended with plant growth-promoting bacteria to flooding stress at a metal-contaminated field site

    International Nuclear Information System (INIS)

    Farwell, Andrea J.; Vesely, Susanne; Nero, Vincent; Rodriguez, Hilda; McCormack, Kimberley; Shah, Saleh; Dixon, D. George; Glick, Bernard R.

    2007-01-01

    The growth of transgenic canola (Brassica napus) expressing a gene for the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase was compared to non-transformed canola exposed to flooding and elevated soil Ni concentration, in situ. In addition, the ability of the plant growth-promoting bacterium Pseudomonas putida UW4, which also expresses ACC deaminase, to facilitate the growth of non-transformed and transgenic canola under the above mentioned conditions was examined. Transgenic canola and/or canola treated with P. putida UW4 had greater shoot biomass compared to non-transformed canola under low flood-stress conditions. Under high flood-stress conditions, shoot biomass was reduced and Ni accumulation was increased in all instances relative to low flood-stress conditions. This is the first field study to document the increase in plant tolerance utilizing transgenic plants and plant growth-promoting bacteria exposed to multiple stressors. - Using transgenic plants and plant growth-promoting bacteria as phytoremediation methods increased plant tolerance at a metal-contaminated field site under low flood conditions

  13. Genome-Wide Identification and Expression Profiling of Cytokinin Oxidase/Dehydrogenase (CKX) Genes Reveal Likely Roles in Pod Development and Stress Responses in Oilseed Rape (Brassica napus L.).

    Science.gov (United States)

    Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na

    2018-03-16

    Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.

  14. Effects of NaCl treatment on the antioxidant enzymes of oilseed rape ...

    African Journals Online (AJOL)

    The effects of NaCl treatment on the activity of antioxidant enzymes in leaves of oilseed rape seedlings (Brassica napus L.) were studied. The results showed that the relative water content from leaves of oilseed rape seedlings was gradually decreased and the electronic conductivity was increased during 0 - 24 h under 200 ...

  15. Genome-Wide Identification of MicroRNAs in Response to Cadmium Stress in Oilseed Rape (Brassica napus L. Using High-Throughput Sequencing

    Directory of Open Access Journals (Sweden)

    Hongju Jian

    2018-05-01

    Full Text Available MicroRNAs (miRNAs have important roles in regulating stress-response genes in plants. However, identification of miRNAs and the corresponding target genes that are induced in response to cadmium (Cd stress in Brassica napus remains limited. In the current study, we sequenced three small-RNA libraries from B. napus after 0 days, 1 days, and 3 days of Cd treatment. In total, 44 known miRNAs (belonging to 27 families and 103 novel miRNAs were identified. A comprehensive analysis of miRNA expression profiles found 39 differentially expressed miRNAs between control and Cd-treated plants; 13 differentially expressed miRNAs were confirmed by qRT-PCR. Characterization of the corresponding target genes indicated functions in processes including transcription factor regulation, biotic stress response, ion homeostasis, and secondary metabolism. Furthermore, we propose a hypothetical model of the Cd-response mechanism in B. napus. Combined with qRT-PCR confirmation, our data suggested that miRNAs were involved in the regulations of TFs, biotic stress defense, ion homeostasis and secondary metabolism synthesis to respond Cd stress in B. napus.

  16. Determination of the Titanium Contents in the Winter Oilseed Rape Plants (Brassica napus L. by the Application of Fertilizer Containing Titanium

    Directory of Open Access Journals (Sweden)

    Peter Kováčik

    2016-01-01

    Full Text Available In order to obtain the information about changes of titanium contents in the phytomass during the growing season of winter oilseed rape and about the titanium contents drawn by the rape yield during two farming years the small plot field trial was established. In the trial the fertilizer Mg-Titanit (MgTi containing 8.5 g of titanium in 1 liter was used. The experiment consisted of 5 treatments. 0 – control treatment without MgTi fertilizer; 2xTi0.2 – two applications of MgTi in the dose of 0.2 l/ha; 3xTi0.2 – three applications of MgTi in the dose of 0.2 l/ha; 2xTi0.4 – two applications of MgTi in the dose of 0.4 l/ha; 3xTi0.4 – three applications of MgTi in the dose of 0.4 l/ha. The fertilizer was applied in spring during two, or three different growth stages: BBCH 50, BBCH 59, BBCH 66. The first plant sampling was carried out shortly before the first application of fertilizer (BBCH 50. The second, third and fourth sampling was taken 2–3 weeks after the application of Mg-Titanitu (BBCH 59, BBCH 66, BBCH 71. The obtained results showed that the titanium content in the phytomass of rape was falling during the monitored period. The titanium content in the rape aboveground phytomass varied in the interval from 16.81 to 67.6 mg/kg and in the root in the interval from 56.6 to 258.81 mg/kg. The titanium application on plant leaves in the quantities from 3.4 to 10.2 g per hectare of soil did not have the unambiguous impact on the titanium content in the rape phytomass. In the yield of one tonne of seed and appropriate quantity of rape straw on average 20 grams of titanium was taken in.

  17. Elevated atmospheric ozone increases concentration of insecticidal Bacillus thuringiensis (Bt) Cry1Ac protein in Bt Brassica napus and reduces feeding of a Bt target herbivore on the non-transgenic parent

    International Nuclear Information System (INIS)

    Himanen, Sari J.; Nerg, Anne-Marja; Nissinen, Anne; Stewart, C. Neal; Poppy, Guy M.; Holopainen, Jarmo K.

    2009-01-01

    Sustained cultivation of Bacillus thuringiensis (Bt) transgenic crops requires stable transgene expression under variable abiotic conditions. We studied the interactions of Bt toxin production and chronic ozone exposure in Bt cry1Ac-transgenic oilseed rape and found that the insect resistance trait is robust under ozone elevations. Bt Cry1Ac concentrations were higher in the leaves of Bt oilseed rape grown under elevated ozone compared to control treatment, measured either per leaf fresh weight or per total soluble protein of leaves. The mean relative growth rate of a Bt target herbivore, Plutella xylostella L. larvae was negative on Bt plants in all ozone treatments. On the non-transgenic plants, larval feeding damage was reduced under elevated ozone. Our results indicate the need for monitoring fluctuations in Bt toxin concentrations to reveal the potential of ozone exposure for altering dosing of Bt proteins to target and non-target herbivores in field environments experiencing increasing ozone pollution. - Elevated atmospheric ozone can induce fluctuations in insecticidal protein concentrations in transgenic plants

  18. Elevated atmospheric ozone increases concentration of insecticidal Bacillus thuringiensis (Bt) Cry1Ac protein in Bt Brassica napus and reduces feeding of a Bt target herbivore on the non-transgenic parent

    Energy Technology Data Exchange (ETDEWEB)

    Himanen, Sari J. [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland)], E-mail: sari.himanen@uku.fi; Nerg, Anne-Marja [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland); Nissinen, Anne [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland); MTT Agrifood Research Finland, Plant Protection, FIN-31600 Jokioinen (Finland); Stewart, C. Neal [University of Tennessee, Department of Plant Sciences, Knoxville, TN 37996-4561 (United States); Poppy, Guy M. [University of Southampton, School of Biological Sciences, Southampton SO16 7PX (United Kingdom); Holopainen, Jarmo K. [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland)

    2009-01-15

    Sustained cultivation of Bacillus thuringiensis (Bt) transgenic crops requires stable transgene expression under variable abiotic conditions. We studied the interactions of Bt toxin production and chronic ozone exposure in Bt cry1Ac-transgenic oilseed rape and found that the insect resistance trait is robust under ozone elevations. Bt Cry1Ac concentrations were higher in the leaves of Bt oilseed rape grown under elevated ozone compared to control treatment, measured either per leaf fresh weight or per total soluble protein of leaves. The mean relative growth rate of a Bt target herbivore, Plutella xylostella L. larvae was negative on Bt plants in all ozone treatments. On the non-transgenic plants, larval feeding damage was reduced under elevated ozone. Our results indicate the need for monitoring fluctuations in Bt toxin concentrations to reveal the potential of ozone exposure for altering dosing of Bt proteins to target and non-target herbivores in field environments experiencing increasing ozone pollution. - Elevated atmospheric ozone can induce fluctuations in insecticidal protein concentrations in transgenic plants.

  19. Isolation of an ascorbate peroxidase in Brassica napus and analysis ...

    African Journals Online (AJOL)

    USER

    2010-04-05

    Apr 5, 2010 ... domain; APX, ascorbate peroxidase; Bn-APX, Brassica napus ascorbate ... Brassica napus, which is widely grown as the oilseed crop of rape or canola, .... grew on the SD-Leu-Trp-His-Ade medium and were verified by PCR.

  20. Expression of BrD1, a plant defensin from Brassica rapa, confers resistance against brown planthopper (Nilaparvata lugens) in transgenic rices.

    Science.gov (United States)

    Choi, Man-Soo; Kim, Yul-Ho; Park, Hyang-Mi; Seo, Bo-Yoon; Jung, Jin-Kyo; Kim, Sun-Tae; Kim, Min-Chul; Shin, Dong-Bum; Yun, Hong-Tai; Choi, Im-Soo; Kim, Chung-Kon; Lee, Jang-Yong

    2009-08-31

    Plant defensins are small (5-10 kDa) basic peptides thought to be an important component of the defense pathway against fungal and/or bacterial pathogens. To understand the role of plant defensins in protecting plants against the brown planthopper, a type of insect herbivore, we isolated the Brassica rapa Defensin 1 (BrD1) gene and introduced it into rice (Oryza sativa L.) to produce stable transgenic plants. The BrD1 protein is homologous to other plant defensins and contains both an N-terminal endoplasmic reticulum signal sequence and a defensin domain, which are highly conserved in all plant defensins. Based on a phylogenetic analysis of the defensin domain of various plant defensins, we established that BrD1 belongs to a distinct subgroup of plant defensins. Relative to the wild type, transgenic rices expressing BrD1 exhibit strong resistance to brown planthopper nymphs and female adults. These results suggest that BrD1 exhibits insecticidal activity, and might be useful for developing cereal crop plants resistant to sap-sucking insects, such as the brown planthopper.

  1. Tuning growth cycles of Brassica crops via natural antisense transcripts of BrFLC.

    Science.gov (United States)

    Li, Xiaorong; Zhang, Shaofeng; Bai, Jinjuan; He, Yuke

    2016-03-01

    Several oilseed and vegetable crops of Brassica are biennials that require a prolonged winter cold for flowering, a process called vernalization. FLOWERING LOCUS C (FLC) is a central repressor of flowering. Here, we report that the overexpression of natural antisense transcripts (NATs) of Brassica rapa FLC (BrFLC) greatly shortens plant growth cycles. In rapid-, medium- and slow-cycling crop types, there are four copies of the BrFLC genes, which show extensive variation in sequences and expression levels. In Bre, a biennial crop type that requires vernalization, five NATs derived from the BrFLC2 locus are rapidly induced under cold conditions, while all four BrFLC genes are gradually down-regulated. The transgenic Bre lines overexpressing a long NAT of BrFLC2 do not require vernalization, resulting in a gradient of shortened growth cycles. Among them, a subset of lines both flower and set seeds as early as Yellow sarson, an annual crop type in which all four BrFLC genes have non-sense mutations and are nonfunctional in flowering repression. Our results demonstrate that the growth cycles of biennial crops of Brassica can be altered by changing the expression levels of BrFLC2 NATs. Thus, BrFLC2 NATs and their transgenic lines are useful for the genetic manipulation of crop growth cycles. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  2. A- or C-chromosomes, does it matter for the transfer of transgenes from ¤Brassica napus¤

    DEFF Research Database (Denmark)

    Tomiuk, J.; Hauser, T.P.; Bagger Jørgensen, Rikke

    2000-01-01

    of herbicide-tolerant plants was explained by selection against the C-chromosomes of B. napus in favor of the homeologous ii-chromosomes. Obviously, such C-chromosomes could be potential candidates as safe integration sites for transgenes. We considered these safety aspects using a simple population genetic...... model. Theory and experiments, however, do not favor the chromosomes of B. napus as safe candidates with respect to the introgression of transgenes into wild populations of B. rapa....

  3. SSR marker variations in Brassica species provide insight into the origin and evolution of Brassica amphidiploids.

    Science.gov (United States)

    Thakur, Ajay Kumar; Singh, Kunwar Harendra; Singh, Lal; Nanjundan, Joghee; Khan, Yasin Jeshima; Singh, Dhiraj

    2018-01-01

    Oilseed Brassica represents an important group of oilseed crops with a long history of evolution and cultivation. To understand the origin and evolution of Brassica amphidiploids, simple sequence repeat (SSR) markers were used to unravel genetic variations in three diploids and three amphidiploid Brassica species of U's triangle along with Eruca sativa as an outlier. Of 124 Brassica-derived SSR loci assayed, 100% cross-transferability was obtained for B. juncea and three subspecies of B. rapa , while lowest cross-transferability (91.93%) was obtained for Eruca sativa . The average % age of cross-transferability across all the seven species was 98.15%. The number of alleles detected at each locus ranged from one to six with an average of 3.41 alleles per primer pair. Neighbor-Joining-based dendrogram divided all the 40 accessions into two main groups composed of B. juncea / B. nigra/B. rapa and B. carinata/B. napus/B. oleracea . C-genome of oilseed Brassica species remained relatively more conserved than A- and B-genome. A- genome present in B. juncea and B. napus seems distinct from each other and hence provides great opportunity for generating diversity through synthesizing amphidiploids from different sources of A- genome. B. juncea had least intra-specific distance indicating narrow genetic base. B. rapa appears to be more primitive species from which other two diploid species might have evolved. The SSR marker set developed in this study will assist in DNA fingerprinting of various Brassica species cultivars, evaluating the genetic diversity in Brassica germplasm, genome mapping and construction of linkage maps, gene tagging and various other genomics-related studies in Brassica species. Further, the evolutionary relationship established among various Brassica species would assist in formulating suitable breeding strategies for widening the genetic base of Brassica amphidiploids by exploiting the genetic diversity present in diploid progenitor gene pools.

  4. Cryptochrome 1 regulates growth and development in Brassica through alteration in the expression of genes involved in light, phytohormone and stress signalling.

    Science.gov (United States)

    Sharma, Pooja; Chatterjee, Mithu; Burman, Naini; Khurana, Jitendra P

    2014-04-01

    The blue light photoreceptors cryptochromes are ubiquitous in higher plants and are vital for regulating plant growth and development. In spite of being involved in controlling agronomically important traits like plant height and flowering time, cryptochromes have not been extensively characterized from agriculturally important crops. Here we show that overexpression of CRY1 from Brassica napus (BnCRY1), an oilseed crop, results in short-statured Brassica transgenics, likely to be less prone to wind and water lodging. The overexpression of BnCRY1 accentuates the inhibition of cell elongation in hypocotyls of transgenic seedlings. The analysis of hypocotyl growth inhibition and anthocyanin accumulation responses in BnCRY1 overexpressors substantiates that regulation of seedling photomorphogenesis by cry1 is dependent on light intensity. This study highlights that the photoactivated cry1 acts through coordinated induction and suppression of specific downstream genes involved in phytohormone synthesis or signalling, and those involved in cell wall modification, during de-etiolation of Brassica seedlings. The microarray-based transcriptome profiling also suggests that the overexpression of BnCRY1 alters abiotic/biotic stress signalling pathways; the transgenic seedlings were apparently oversensitive to abscisic acid (ABA) and mannitol. © 2013 John Wiley & Sons Ltd.

  5. 'Abasin-95', a new oilseed rape cultivar developed through induced mutations

    International Nuclear Information System (INIS)

    Shah, S.A.; Ali, I.; Rahman, K.

    2001-01-01

    Brassica oilseeds are the second most important source of vegetable oil in Pakistan. Due to the low priority attached to these to these crops in the past, no systematic breeding work was undertaken to develop improved varieties of rapeseed/mustard, resulting in a narrow genetic base of these crops. At the Nuclear Institute for Food and Agriculture (NIFA), gamma radiation was used to induce genetic variability in traits of economic importance thus diversifying the genetic base of indigenous/exotic cultivars of Brassica oilseeds

  6. Transgenic tobacco overexpressing Brassica juncea HMG-CoA synthase 1 shows increased plant growth, pod size and seed yield.

    Directory of Open Access Journals (Sweden)

    Pan Liao

    Full Text Available Seeds are very important not only in the life cycle of the plant but they represent food sources for man and animals. We report herein a mutant of 3-hydroxy-3-methylglutaryl-coenzyme A synthase (HMGS, the second enzyme in the mevalonate (MVA pathway that can improve seed yield when overexpressed in a phylogenetically distant species. In Brassica juncea, the characterisation of four isogenes encoding HMGS has been previously reported. Enzyme kinetics on recombinant wild-type (wt and mutant BjHMGS1 had revealed that S359A displayed a 10-fold higher enzyme activity. The overexpression of wt and mutant (S359A BjHMGS1 in Arabidopsis had up-regulated several genes in sterol biosynthesis, increasing sterol content. To quickly assess the effects of BjHMGS1 overexpression in a phylogenetically more distant species beyond the Brassicaceae, wt and mutant (S359A BjHMGS1 were expressed in tobacco (Nicotiana tabacum L. cv. Xanthi of the family Solanaceae. New observations on tobacco OEs not previously reported for Arabidopsis OEs included: (i phenotypic changes in enhanced plant growth, pod size and seed yield (more significant in OE-S359A than OE-wtBjHMGS1 in comparison to vector-transformed tobacco, (ii higher NtSQS expression and sterol content in OE-S359A than OE-wtBjHMGS1 corresponding to greater increase in growth and seed yield, and (iii induction of NtIPPI2 and NtGGPPS2 and downregulation of NtIPPI1, NtGGPPS1, NtGGPPS3 and NtGGPPS4. Resembling Arabidopsis HMGS-OEs, tobacco HMGS-OEs displayed an enhanced expression of NtHMGR1, NtSMT1-2, NtSMT2-1, NtSMT2-2 and NtCYP85A1. Overall, increased growth, pod size and seed yield in tobacco HMGS-OEs were attributed to the up-regulation of native NtHMGR1, NtIPPI2, NtSQS, NtSMT1-2, NtSMT2-1, NtSMT2-2 and NtCYP85A1. Hence, S359A has potential in agriculture not only in improving phytosterol content but also seed yield, which may be desirable in food crops. This work further demonstrates HMGS function in plant

  7. Evaluation of Yield and Yield Components of Oilseed Rape in the Wheat-Oilseed Rape Strip Intercropping Influenced by Chemical and Biological Fertilizers

    Directory of Open Access Journals (Sweden)

    R Amirmardfar

    2015-01-01

    Full Text Available To evaluate the effects of wheat (Triticum aestivum and oilseed rape (Brassica napus strip intercropping on yield components, seed and biological yields of oilseed rape, field experiments were carried out as factorial based on randomized complete block design with three replications at Research Farm of Tabriz University, Tabriz, Iran during 2010-2012 cropping seasons. The first factor consisted of four types of wheat and oilseed rape cropping system, sole crop of oilseed rape (A1,: strip intercropping with 8:3 (A2, 12:4 (A3 and 16:5 (A4 of wheat and oilseed rape rows, respectively and the other factor consisted of two fertilizer levels, B1: 100% chemical fertilizers (urea and triple superphosphate and B2: 50% chemical fertilizers + biofertilizers (Nitrazhin and Barvar2. The results showed that strip intercropping of wheat- oilseed rape resulted in significant increase in yield components, seed yield per occupied unit area and biological yield per occupied unit area of oilseed rape as compared with mono-cropping. The number of silique per plant in intercropping systems was significantly higher than that of mono-cropping. The highest seed yield was obtained in the 16:5 rows of wheat-oilseed rape with 343.76 g.m-2 and the lowest mean was observed in mono-cropping of oilseed rape with 260.21 g.m-2. Biological yield per occupied unit area and seed yield per intercropped unit area in B1 were significantly greater than that of B2, but this treatment had no significant effect on the other traits. Because, B1 and B2 had no significant difference in seed yield per occupied unit area and due to the importance of reduction in chemical fertilizers consumption and food and environmental health care, strip intercropping of wheat-oilseed rape under 50% chemical fertilizers + biofertilizers can be recommended as a suitable cultural method.

  8. Potential impact of genetically modified Lepidoptera-resistant Brassica napus in biodiversity hotspots: Sicily as a theoretical model.

    Science.gov (United States)

    Manachini, Barbara; Bazan, Giuseppe; Schicchi, Rosario

    2018-03-14

    The general increase of the cultivation and trade of Bt transgenic plants resistant to Lepidoptera pests raises concerns regarding the conservation of animal and plant biodiversity. Demand for biofuels has increased the cultivation and importation of oilseed rape (Brassica napus L.), including transgenic lines. In environmental risk assessments (ERAs) for its potential future cultivation as well as for food and feed uses, the impact on wild Brassicaeae relatives and on non-target Lepidoptera should be assessed. Here we consider the potential exposure of butterflies as results of possible cultivation or naturalization of spilled seed in Sicily (Italy). Diurnal Lepidoptera, which are pollinators, can be exposed directly to the insecticidal proteins as larvae (mainly of Pieridae) through the host and through the pollen that can deposit on other host plants. Adults can be exposed via pollen and nectar. The flight periods of butterflies were recorded, and they were found to overlap for about 90% of the flowering period of B. napus for the majority of the species. In addition, B. napus has a high potential to hybridise with endemic taxa belonging to the B. oleracea group. This could lead to an exposure of non-target Lepidoptera if introgression of the Bt gene into a wild population happens. A rank of the risk for butterflies and wild relatives of oilseed rape is given. We conclude that, in environmental risk assessments, attention should be paid to plant-insect interaction especially in a biodiversity hotspot such as Sicily. © 2018 Institute of Zoology, Chinese Academy of Sciences.

  9. In-field frequencies and characteristics of oilseed rape with double herbicide resistance.

    Science.gov (United States)

    Dietz-Pfeilstetter, Antje; Zwerger, Peter

    2009-01-01

    When growing different transgenic herbicide-resistant oilseed rape cultivars side by side, seeds with multiple herbicide resistance can arise, possibly causing problems for the management of volunteer plants. Large-scale field experiments were performed in the years 1999/2000 and 2000/2001 in order to investigate the frequencies and the consequences of the transfer of herbicide resistance genes from transgenic oilseed rape to cultivars grown on neighboring agricultural fields. Transgenic oilseed rape with resistance to glufosinate-ammonium (LibertyLink, LL) and with glyphosate resistance (RoundupReady, RR), respectively, was sown in adjacent 0.5 ha plots, surrounded by about 8 ha non-transgenic oilseed rape. The plots and the field were either in direct contact (0.5 m gap width) or they were separated by 10 m of fallow land. Seed samples taken during harvest in the transgenic plots at different distances were investigated for progeny with resistance to the respective other herbicide. It was found that outcrossing frequencies were reduced to different extents by a 10 m isolation distance. In addition to pollen-mediated transgene flow as a result of outcrossing, we found considerable seed-mediated gene flow by adventitious dispersal of transgenic seeds through the harvesting machine. Volunteer plants with double herbicide resistance emerging in the transgenic plots after harvest were selected by suitable applications of the complementary herbicides Basta and Roundup Ultra. In both years, double-resistant volunteers were largely restricted to the inner edges of the plots. Expression analysis under controlled laboratory conditions of double-resistant plants generated by manual crosses revealed stability of transgene expression even at elevated temperatures. Greenhouse tests with double-resistant oilseed rape plants gave no indication that the sensitivity to a range of different herbicides is changed as compared to non-transgenic oilseed rape.

  10. Research fields, challenges and opportunities in European oilseed crops breeding

    Directory of Open Access Journals (Sweden)

    Vincourt Patrick

    2014-11-01

    Full Text Available Due to the geographical specialization in oilseed world production, Europe has a major role to play in winter oilseed rape and sunflower breeding. Mainly based on the most recen t results, this review aims to identify the main research and breeding targets for these two crops, as seen through publications, with an attempt to suggest what are opportunities and challenges in these research fields. Growing a healthy and yielding crop remains the key driver for agronomic production. However sustainability and environmental profiles of the cultivar are now entering the field of play: The sustainability concern invested the field of resistance to diseases. Nitrogen use efficiency became an important target for Brassica napus, and crop resilience toward drought stresses is the way chosen in Helianthus annuus breeding for yield improvement. Significant advances are underway for quality traits, but the uncertainty on nutritional and industrial demand may explain why the product diversification remains low.

  11. Subgenome parallel selection is associated with morphotype diversification and convergent crop domestication in Brassica rapa and Brassica oleracea.

    Science.gov (United States)

    Cheng, Feng; Sun, Rifei; Hou, Xilin; Zheng, Hongkun; Zhang, Fenglan; Zhang, Yangyong; Liu, Bo; Liang, Jianli; Zhuang, Mu; Liu, Yunxia; Liu, Dongyuan; Wang, Xiaobo; Li, Pingxia; Liu, Yumei; Lin, Ke; Bucher, Johan; Zhang, Ningwen; Wang, Yan; Wang, Hui; Deng, Jie; Liao, Yongcui; Wei, Keyun; Zhang, Xueming; Fu, Lixia; Hu, Yunyan; Liu, Jisheng; Cai, Chengcheng; Zhang, Shujiang; Zhang, Shifan; Li, Fei; Zhang, Hui; Zhang, Jifang; Guo, Ning; Liu, Zhiyuan; Liu, Jin; Sun, Chao; Ma, Yuan; Zhang, Haijiao; Cui, Yang; Freeling, Micheal R; Borm, Theo; Bonnema, Guusje; Wu, Jian; Wang, Xiaowu

    2016-10-01

    Brassica species, including crops such as cabbage, turnip and oilseed, display enormous phenotypic variation. Brassica genomes have all undergone a whole-genome triplication (WGT) event with unknown effects on phenotype diversification. We resequenced 199 Brassica rapa and 119 Brassica oleracea accessions representing various morphotypes and identified signals of selection at the mesohexaploid subgenome level. For cabbage morphotypes with their typical leaf-heading trait, we identified four subgenome loci that show signs of parallel selection among subgenomes within B. rapa, as well as four such loci within B. oleracea. Fifteen subgenome loci are under selection and are shared by these two species. We also detected strong subgenome parallel selection linked to the domestication of the tuberous morphotypes, turnip (B. rapa) and kohlrabi (B. oleracea). Overall, we demonstrated that the mesohexaploidization of the two Brassica genomes contributed to their diversification into heading and tuber-forming morphotypes through convergent subgenome parallel selection of paralogous genes.

  12. Overexpression of phyA and appA Genes Improves Soil Organic Phosphorus Utilisation and Seed Phytase Activity in Brassica napus

    Science.gov (United States)

    Wang, Yi; Ye, Xiangsheng; Ding, Guangda; Xu, Fangsen

    2013-01-01

    Phytate is the major storage form of organic phosphorus in soils and plant seeds, and phosphorus (P) in this form is unavailable to plants or monogastric animals. In the present study, the phytase genes phyA and appA were introduced into Brassica napus cv Westar with a signal peptide sequence and CaMV 35S promoter, respectively. Three independent transgenic lines, P3 and P11 from phyA and a18 from appA, were selected. The three transgenic lines exhibited significantly higher exuded phytase activity when compared to wild-type (WT) controls. A quartz sand culture experiment demonstrated that transgenic Brassica napus had significantly improved P uptake and plant biomass. A soil culture experiment revealed that seed yields of transgenic lines P11 and a18 increased by 20.9% and 59.9%, respectively, when compared to WT. When phytate was used as the sole P source, P accumulation in seeds increased by 20.6% and 46.9% with respect to WT in P11 and a18, respectively. The P3 line accumulated markedly more P in seeds than WT, while no significant difference was observed in seed yields when phytate was used as the sole P source. Phytase activities in transgenic canola seeds ranged from 1,138 to 1,605 U kg–1 seeds, while no phytase activity was detected in WT seeds. Moreover, phytic acid content in P11 and a18 seeds was significantly lower than in WT. These results introduce an opportunity for improvement of soil and seed phytate-P bioavailability through genetic manipulation of oilseed rape, thereby increasing plant production and P nutrition for monogastric animals. PMID:23573285

  13. Overexpression of phyA and appA genes improves soil organic phosphorus utilisation and seed phytase activity in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Yi Wang

    Full Text Available Phytate is the major storage form of organic phosphorus in soils and plant seeds, and phosphorus (P in this form is unavailable to plants or monogastric animals. In the present study, the phytase genes phyA and appA were introduced into Brassica napus cv Westar with a signal peptide sequence and CaMV 35S promoter, respectively. Three independent transgenic lines, P3 and P11 from phyA and a18 from appA, were selected. The three transgenic lines exhibited significantly higher exuded phytase activity when compared to wild-type (WT controls. A quartz sand culture experiment demonstrated that transgenic Brassica napus had significantly improved P uptake and plant biomass. A soil culture experiment revealed that seed yields of transgenic lines P11 and a18 increased by 20.9% and 59.9%, respectively, when compared to WT. When phytate was used as the sole P source, P accumulation in seeds increased by 20.6% and 46.9% with respect to WT in P11 and a18, respectively. The P3 line accumulated markedly more P in seeds than WT, while no significant difference was observed in seed yields when phytate was used as the sole P source. Phytase activities in transgenic canola seeds ranged from 1,138 to 1,605 U kg(-1 seeds, while no phytase activity was detected in WT seeds. Moreover, phytic acid content in P11 and a18 seeds was significantly lower than in WT. These results introduce an opportunity for improvement of soil and seed phytate-P bioavailability through genetic manipulation of oilseed rape, thereby increasing plant production and P nutrition for monogastric animals.

  14. Oilseeds business opportunities in Ethiopia

    NARCIS (Netherlands)

    Wijnands, J.H.M.; Biersteker, J.; Hiel, R.

    2007-01-01

    In this study the business opportunities for Dutch companies in the Ethiopian oilseeds sector are explored. Opportunities for setting up sustainable export chains should mutually benefit Dutch companies as well as the Ethiopian oilseeds sector in particular and the Ethiopian society in general.

  15. Agrobacterium mediated transformation of brassica juncea (l.) czern with chitinase gene conferring resistance against fungal infections

    International Nuclear Information System (INIS)

    Ahmad, B.; Ambreen, S.; Khan, I.

    2015-01-01

    Brassica juncea (Czern and Coss., L.) is an important oilseed crop. Since it is attacked by several bacterial and fungal diseases, therefore, we developed an easy and simple protocol for the regeneration and transformation of B. juncea variety RAYA ANMOL to give rise to transgenic plants conferring resistance against various fungal diseases. The transformation was carried out using Agrobacterium with Chitinase gene. This gene was isolated from Streptomyces griseus HUT6037. We used two types of explants for transformation i.e. hypocotyls and cotyledons. Only hypocotyls explants showed good results regarding callus initiation. Different hormonal concentrations were applied i.e. BAP 2, 4 and 6 mgL-1 and NAA 0.1, 0.2 and 0.3 mgL-1. However, high transformation efficiency was observed by supplementing the medium with combination of 2 mgL-1 BAP and 0.2 mgL-1 for initiation of callus. Similarly 10 mgL-1 kanamycin and 200 mgL-1 cefotaxime also proved successful for the selection of transformed callus. In order to confirm the presence of transgenic callus Polymerase chain reaction was performed using specific primers for Chitinase gene. (author)

  16. Ozone dose-response relationships for spring oilseed rape and broccoli

    Science.gov (United States)

    De Bock, Maarten; Op de Beeck, Maarten; De Temmerman, Ludwig; Guisez, Yves; Ceulemans, Reinhart; Vandermeiren, Karine

    2011-03-01

    Tropospheric ozone is an important air pollutant with known detrimental effects for several crops. Ozone effects on seed yield, oil percentage, oil yield and 1000 seed weight were examined for spring oilseed rape ( Brassica napus cv. Ability). For broccoli ( Brassica oleracea L. cv. Italica cv. Monaco) the effects on fresh marketable weight and total dry weight were studied. Current ozone levels were compared with an increase of 20 and 40 ppb during 8 h per day, over the entire growing season. Oilseed rape seed yield was negatively correlated with ozone dose indices calculated from emergence until harvest. This resulted in an R2 of 0.24 and 0.26 ( p broccoli the applied ozone doses had no effect on yield.

  17. Brassica villosa, a system for studying non-glandular trichomes and genes in the Brassicas.

    Science.gov (United States)

    Nayidu, Naghabushana K; Tan, Yifang; Taheri, Ali; Li, Xiang; Bjorndahl, Trent C; Nowak, Jacek; Wishart, David S; Hegedus, Dwayne; Gruber, Margaret Y

    2014-07-01

    Brassica villosa is a wild Brassica C genome species with very dense trichome coverage and strong resistance to many insect pests of Brassica oilseeds and vegetables. Transcriptome analysis of hairy B. villosa leaves indicated higher expression of several important trichome initiation genes compared with glabrous B. napus leaves and consistent with the Arabidopsis model of trichome development. However, transcripts of the TRY inhibitory gene in hairy B. villosa were surprisingly high relative to B. napus and relative transcript levels of SAD2, EGL3, and several XIX genes were low, suggesting potential ancillary or less important trichome-related roles for these genes in Brassica species compared with Arabidopsis. Several antioxidant, calcium, non-calcium metal and secondary metabolite genes also showed differential expression between these two species. These coincided with accumulation of two alkaloid-like compounds, high levels of calcium, and other metals in B. villosa trichomes that are correlated with the known tolerance of B. villosa to high salt and the calcium-rich natural habitat of this wild species. This first time report on the isolation of large amounts of pure B. villosa trichomes, on trichome content, and on relative gene expression differences in an exceptionally hairy Brassica species compared with a glabrous species opens doors for the scientific community to understand trichome gene function in the Brassicas and highlights the potential of B. villosa as a trichome research platform.

  18. Population structure and phylogenetic relationships in a diverse panel of Brassica rapa L

    Science.gov (United States)

    The crop species Brassica rapa L. has significant economic importance around the globe. Crop domestication and improvement has resulted in extreme phenotypic diversity and subspecies that are used for oilseed, food for human consumption and fodder for livestock. However, the global distribution and ...

  19. Induction and purification of chitinase in Brassica napus L. ssp. oleifera infected with Phoma lingam

    DEFF Research Database (Denmark)

    Rasmussen, U.; Giese, H.; Dalgaard Mikkelsen, J.

    1992-01-01

    A pathogen-induced chitinase (EC 3.2.1.14) was isolated from cotyledons of oilseed rape (Brassica napus cv. Bienvenu) 8 d after inoculation with Phoma lingam. The purified chitinase has a molecular weight of 30 kDa, and an isoelectric point of approx. 9.1. A partial amino-acid sequence obtained a...

  20. An oilseed rape WRKY-type transcription factor regulates ROS accumulation and leaf senescence in Nicotiana benthamiana and Arabidopsis through modulating transcription of RbohD and RbohF.

    Science.gov (United States)

    Yang, Liu; Ye, Chaofei; Zhao, Yuting; Cheng, Xiaolin; Wang, Yiqiao; Jiang, Yuan-Qing; Yang, Bo

    2018-06-01

    Overexpression of BnaWGR1 causes ROS accumulation and promotes leaf senescence. BnaWGR1 binds to promoters of RbohD and RbohF and regulates their expression. Manipulation of leaf senescence process affects agricultural traits of crop plants, including biomass, seed yield and stress resistance. Since delayed leaf senescence usually enhances tolerance to multiple stresses, we analyzed the function of specific MAPK-WRKY cascades in abiotic and biotic stress tolerance as well as leaf senescence in oilseed rape (Brassica napus L.), one of the important oil crops. In the present study, we showed that expression of one WRKY gene from oilseed rape, BnaWGR1, induced an accumulation of reactive oxygen species (ROS), cell death and precocious leaf senescence both in Nicotiana benthamiana and transgenic Arabidopsis (Arabidopsis thaliana). BnaWGR1 regulates the transcription of two genes encoding key enzymes implicated in production of ROS, that is, respiratory burst oxidase homolog (Rboh) D and RbohF. A dual-luciferase reporter assay confirmed the transcriptional regulation of RbohD and RbohF by BnaWGR1. In vitro electrophoresis mobility shift assay (EMSA) showed that BnaWGR1 could bind to W-box cis-elements within promoters of RbohD and RbohF. Moreover, RbohD and RbohF were significantly upregulated in transgenic Arabidopsis overexpressing BnaWGR1. In summary, these results suggest that BnaWGR1 could positively regulate leaf senescence through regulating the expression of RbohD and RbohF genes.

  1. Improvement of brassica oilseeds through modern biotechnological approaches

    International Nuclear Information System (INIS)

    Khan, M.R.; Rashid, H.

    2007-01-01

    Pakistan is chronically deficient in the production of edible oils. So much so that 3/4 (three fourth) of the country's requirements are met through imports, costing huge amounts in foreign exchange. The total edible-oil requirements of Pakistan for 1999-2000 stands at 2 million tons. The rest was imported on heavy foreign exchange cost of US dollars 800 million/year (Anonymous, 2000). One disturbing aspect of this critical issue is an annual increase in the gap between consumption and domestic production of edible oils. The different uses of rapeseed have given rise to specialized cultivars, and it is important to differentiate between the three principal types viz. seed quality, high erucic acid (HEAR), and canola. The term Canola refers to seed or seed-products with less than 2% erucic acid in the oil and less than 30 macro mol/g meal of aliphatic glucosinolates. (author)

  2. Transgenic Brassica rapa plants over-expressing eIF(iso)4E variants show broad-spectrum Turnip mosaic virus (TuMV) resistance.

    Science.gov (United States)

    Kim, Jinhee; Kang, Won-Hee; Hwang, Jeena; Yang, Hee-Bum; Dosun, Kim; Oh, Chang-Sik; Kang, Byoung-Cheorl

    2014-08-01

    The protein-protein interaction between VPg (viral protein genome-linked) of potyviruses and eIF4E (eukaryotic initiation factor 4E) or eIF(iso)4E of their host plants is a critical step in determining viral virulence. In this study, we evaluated the approach of engineering broad-spectrum resistance in Chinese cabbage (Brassica rapa) to Turnip mosaic virus (TuMV), which is one of the most important potyviruses, by a systematic knowledge-based approach to interrupt the interaction between TuMV VPg and B. rapa eIF(iso)4E. The seven amino acids in the cap-binding pocket of eIF(iso)4E were selected on the basis of other previous results and comparison of protein models of cap-binding pockets, and mutated. Yeast two-hybrid assay and co-immunoprecipitation analysis demonstrated that W95L, K150L and W95L/K150E amino acid mutations of B. rapa eIF(iso)4E interrupted its interaction with TuMV VPg. All eIF(iso)4E mutants were able to complement an eIF4E-knockout yeast strain, indicating that the mutated eIF(iso)4E proteins retained their function as a translational initiation factor. To determine whether these mutations could confer resistance, eIF(iso)4E W95L, W95L/K150E and eIF(iso)4E wild-type were over-expressed in a susceptible Chinese cabbage cultivar. Evaluation of the TuMV resistance of T1 and T2 transformants demonstrated that the over-expression of the eIF(iso)4E mutant forms can confer resistance to multiple TuMV strains. These data demonstrate the utility of knowledge-based approaches for the engineering of broad-spectrum resistance in Chinese cabbage. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  3. BRAD, the genetics and genomics database for Brassica plants

    Directory of Open Access Journals (Sweden)

    Li Pingxia

    2011-10-01

    Full Text Available Abstract Background Brassica species include both vegetable and oilseed crops, which are very important to the daily life of common human beings. Meanwhile, the Brassica species represent an excellent system for studying numerous aspects of plant biology, specifically for the analysis of genome evolution following polyploidy, so it is also very important for scientific research. Now, the genome of Brassica rapa has already been assembled, it is the time to do deep mining of the genome data. Description BRAD, the Brassica database, is a web-based resource focusing on genome scale genetic and genomic data for important Brassica crops. BRAD was built based on the first whole genome sequence and on further data analysis of the Brassica A genome species, Brassica rapa (Chiifu-401-42. It provides datasets, such as the complete genome sequence of B. rapa, which was de novo assembled from Illumina GA II short reads and from BAC clone sequences, predicted genes and associated annotations, non coding RNAs, transposable elements (TE, B. rapa genes' orthologous to those in A. thaliana, as well as genetic markers and linkage maps. BRAD offers useful searching and data mining tools, including search across annotation datasets, search for syntenic or non-syntenic orthologs, and to search the flanking regions of a certain target, as well as the tools of BLAST and Gbrowse. BRAD allows users to enter almost any kind of information, such as a B. rapa or A. thaliana gene ID, physical position or genetic marker. Conclusion BRAD, a new database which focuses on the genetics and genomics of the Brassica plants has been developed, it aims at helping scientists and breeders to fully and efficiently use the information of genome data of Brassica plants. BRAD will be continuously updated and can be accessed through http://brassicadb.org.

  4. Ukrainian cereals and oilseeds trade

    Directory of Open Access Journals (Sweden)

    Б. В. Духницький

    2016-07-01

    Full Text Available Purpose. To analyze peculiarities of Ukrainian cereals and oilseeds trade, the situation on the world market, and determine future prospects of its development. Methods. Analysis and synthesis, comparative evaluation, graphic procedure. Results. The role and place of Ukraine in a total grain supply to the world market was determined. Ukraine is a world’s top ten grain producer. Among domestic agricultural products, cereals, oilseeds and sunflower oil are in the highest demand in the world. In recent years, our state has reinforced its status as one of the leading exporters of cereals. The commodity pattern of cereals and oilseeds export was analyzed with specifying most in-demand positions and the main countries purchasing these pro­ducts. According to the results of 2015, Ukraine obtained the highest foreign currency revenue from export of corn, wheat and barley (in grain structure including soybeans and rapeseed (among oil crops. Key domestic and multinational operators are the main exporters of cereals and oilseeds in Ukraine and still hold their leading position. It was found a significant excess of import price of seeds as compared with export price of crops grown in Ukraine. Assortment of maize and sunflower seeds offered by major companies-producers in Ukraine was studied. Main trends of the world grain market development are considered. Conclusions. It was established that Ukraine is one of the major exporters of cereals and oilseeds. However, volatility of their prices significantly affects the export revenue that was decreasing even with increasing export quantities in kind. The dependence of domestic grain industry development on high-quality imported seed of maize and sunflower hybrids was recorded. It is expected that in the years to come Ukraine will maintain its strong positions in the world’s grain market.

  5. Ozone effects on yield quality of spring oilseed rape and broccoli

    Science.gov (United States)

    Vandermeiren, Karine; De Bock, Maarten; Horemans, Nele; Guisez, Yves; Ceulemans, Reinhart; De Temmerman, Ludwig

    2012-02-01

    The impact of elevated tropospheric ozone (O 3) on the quality of spring oilseed rape ( Brassica napus cv Ability) and broccoli ( Brassica oleracea L. cv Italic cv Monaco) was assessed during a three year Open - Top Chamber (OTC) experiment. Current ambient O 3 levels were compared to an increase of 20 and 40 ppb during 8 h per day over the entire growing season. The qualitative responses were expressed as a function of the accumulated hourly O 3 concentrations over a threshold of 40 ppb (AOT40) and the phytotoxic O 3 dose above a threshold of 6 nmol s -1 m -2 projected leaf area (POD 6). Our results provide clear evidence that O 3 has an influence on the qualitative attributes of the harvested products of these Brassica species. The responses were comparable whether they were expressed as a function of the accumulated O 3 concentrations or of the modelled O 3 uptake. The protein concentration of oilseed rape seeds and broccoli heads was significantly increased in response to O 3. There was also a shift in the fatty acid composition of the vegetable oil derived from seeds of oilseed rape. Oleic acid (18:1) declined significantly ( p broccoli an important shift occurred from indolic to aliphatic GSLs although the total GSL concentration was not changed. The increase in the aliphatic/indolic GSL ratio ( p broccoli were not influenced by O 3; glutathione (GSH) was slightly increased in response to a higher O 3 uptake ( p < 0.05). The consequences of these changes with regard to food and feed quality and human health are discussed.

  6. A comparison of two stomatal conductance models for ozone flux modelling using data from two Brassica species

    International Nuclear Information System (INIS)

    Op de Beeck, M.; De Bock, M.; Vandermeiren, K.; Temmerman, L. de; Ceulemans, R.

    2010-01-01

    In this study we tested and compared a multiplicative stomatal model and a coupled semi-empirical stomatal-photosynthesis model in their ability to predict stomatal conductance to ozone (g st ) using leaf-level data from oilseed rape (Brassica napus L.) and broccoli (Brassica oleracea L. var. italica Plenck). For oilseed rape, the multiplicative model and the coupled model were able to explain 72% and 73% of the observed g st variance, respectively. For broccoli, the models were able to explain 53% and 51% of the observed g st variance, respectively. These results support the coupled semi-empirical stomatal-photosynthesis model as a valid alternative to the multiplicative stomatal model for O 3 flux modelling, in terms of predictive performance. - A multiplicative stomatal model and a coupled semi-empirical stomatal-photosynthesis model performed equally well when tested against leaf-level data for oilseed rape and broccoli.

  7. Recent Genetic Gains in Nitrogen Use Efficiency in Oilseed Rape

    Science.gov (United States)

    Stahl, Andreas; Pfeifer, Mara; Frisch, Matthias; Wittkop, Benjamin; Snowdon, Rod J.

    2017-01-01

    Nitrogen is essential for plant growth, and N fertilization allows farmers to obtain high yields and produce sufficient agricultural commodities. On the other hand, nitrogen losses potentially cause adverse effects to ecosystems and to human health. Increasing nitrogen use efficiency (NUE) is vital to solve the conflict between productivity, to secure the demand of a growing world population, and the protection of the environment. To ensure this, genetic improvement is considered to be a paramount aspect toward ecofriendly crop production. Winter oilseed rape (Brassica napus L.) is the second most important oilseed crop in the world and is cultivated in many regions across the temperate zones. To our knowledge, this study reports the most comprehensive field-based data generated to date for an empirical evaluation of genetic improvement in winter oilseed rape varieties under two divergent nitrogen fertilization levels (NFLs). A collection of 30 elite varieties registered between 1989 and 2014, including hybrids and open pollinated varieties, was tested in a 2-year experiment in 10 environments across Germany for changes in seed yield and seed quality traits. Furthermore, NUE was calculated. We observed a highly significant genetics-driven increase in seed yield per-se and, thus, increased NUE at both NFLs. On average, seed yield from modern open-pollinated varieties and modern hybrids was higher than from old open-pollinated varieties and old hybrids. The annual yield progress across all tested varieties was ~35 kg ha−1 year−1 at low nitrogen and 45 kg ha−1 year−1 under high nitrogen fertilization. Furthermore, in modern varieties an increased oil concentration and decreased protein concentration was observed. Despite, the significant effects of nitrogen fertilization, a surprisingly low average seed yield gap of 180 kg N ha−1 was noted between high and low nitrogen fertilization. Due to contrary effects of N fertilization on seed yield per-se and seed

  8. Uptake, translocation, and distribution of root-applied [C ring-U-14C]-ZJ0273 in plants of oilseed rape and rice

    International Nuclear Information System (INIS)

    Li Zheng; Han Ailiang; Zhang Yanfei; Li Juying; Wang Yue; Wang Haiyan; Ye Qingfu; Lu Long

    2009-01-01

    ZJ0273, propyl 4-(2-(4, 6-dimethoxypyrimidin-2-yloxy) benzylamino) benzoate, is a novel ALS-inhibited herbicide development for pre-and post-emergence weed control in field of oilseed rape. The comparative uptake, translocation and distribution of root-applied [C ring-U- 14 C] ZJ0273 in the plants of susceptible rice and tolerant oilseed rape were investigated under laboratory conditions. The results showed that the uptake of [C ring-U- 14 C]-ZJ0273 in both rice (Oryza sativa L.) and oilseed rape (Brassica napus L.) increased with time. Larger percentage of the applied ZJ0273 was uptaken by rice than oilseed rape at any sampling time. At 384 hours after treatment, the uptake of [C ring-U- 14 C]-ZJ0273 reached 24.1% of the applied amount in rice, while only 4.1% of the applied in oilseed rape. The majority of the absorbed ZJ0273 remained in the root of the tested plants, which indicated the weak mobility of ZJ0273 and/or its metabolites in both the plants of susceptible rice and tolerant oilseed rape. The radioactivity per unit of dry weight in the roots and leaves of rice was 9.470 Bq/mg and 0.910 Bq/mg, respectively, which was significantly higher than that in oilseed rape (3.870 Bq/mg and 0.390 Bq/mg). Therefore, the difference in the total uptake of ZJ0273 and the accumulation of ZJ0273 and/or its metabolites perunit of dry weight between rice and oilseed rape, which revealed in this study, might be one of the reasons for the different susceptibility of rice and oilseed rape on ZJ0273. (authors)

  9. Gas assisted Mechanical Expression of oilseeds

    NARCIS (Netherlands)

    Willems, P.

    2007-01-01

    It is the objective of this thesis to show the general applicability of the Gas Assisted Mechanical Expression (GAME) process for recovery of oil from oilseeds with high yields. In this process, the oilseeds are saturated with supercritical CO2 before mechanical pressing. The CO2 displaces part of

  10. Determinants of nectar production in oilseed rape

    DEFF Research Database (Denmark)

    Enkegaard, Annie; Kryger, Per; Boelt, Birte

    2016-01-01

    in the beginning of a year (January–March) leading to the setting of more flowers. On the other hand, the decrease in the number of open oilseed rape flowers during the flowering period seems to be governed exclusively by inherent characteristics of oilseed rape. A late flowering in 2013 was associated...

  11. Quantitative Multilevel Analysis of Central Metabolism in Developing Oilseeds of Oilseed Rape During In Vitro Culture

    Energy Technology Data Exchange (ETDEWEB)

    Schwender, Jorg [Brookhaven National Lab. (BNL), Upton, NY (United States); Hebbelmann, Inga [Brookhaven National Lab. (BNL), Upton, NY (United States); Heinzel, Nicholas [Leibniz Inst. of Plant Genetics and Crop Plant Research, Gatersleben (Germany); Hildebrandt, Tatjana [Univ. of Hannover (Germany); Rogers, Alistair [Brookhaven National Lab. (BNL), Upton, NY (United States); Naik, Dhiraj [Brookhaven National Lab. (BNL), Upton, NY (United States); Indian Inst. of Advanced Research Koba, Gujarat (India); Klapperstuck, Matthias [Monash Univ., Melbourne, VIC (Australia); Braun, Hans -Peter [Univ. of Hannover (Germany); Schreiber, Falk [Monash Univ., Melbourne, VIC (Australia); Univ. Halle-Wittenberg, Melbourne (Australia); Denolf, Peter [Bayer CropScience (Belgium); Borisjuk, Ljudmilla [Leibniz Inst. of Plant Genetics and Crop Plant Research, Gatersleben (Germany); Rolletschek, Hardy [Leibniz Inst. of Plant Genetics and Crop Plant Research, Gatersleben (Germany)

    2015-07-01

    Seeds provide the basis for many food, feed, and fuel products. Continued increases in seed yield, composition, and quality require an improved understanding of how the developing seed converts carbon and nitrogen supplies into storage. Current knowledge of this process is often based on the premise that transcriptional regulation directly translates via enzyme concentration into flux. In an attempt to highlight metabolic control, we explore genotypic differences in carbon partitioning for in vitro cultured developing embryos of oilseed rape (Brassica napus). We determined biomass composition as well as 79 net fluxes, the levels of 77 metabolites, and 26 enzyme activities with specific focus on central metabolism in nine selected germplasm accessions. We observed a tradeoff between the biomass component fractions of lipid and starch. With increasing lipid content over the spectrum of genotypes, plastidic fatty acid synthesis and glycolytic flux increased concomitantly, while glycolytic intermediates decreased. The lipid/starch tradeoff was not reflected at the proteome level, pointing to the significance of (posttranslational) metabolic control. Enzyme activity/flux and metabolite/flux correlations suggest that plastidic pyruvate kinase exerts flux control and that the lipid/starch tradeoff is most likely mediated by allosteric feedback regulation of phosphofructokinase and ADP-glucose pyrophosphorylase. Also, quantitative data were used to calculate in vivo mass action ratios, reaction equilibria, and metabolite turnover times. Compounds like cyclic 3',5'-AMP and sucrose-6-phosphate were identified to potentially be involved in so far unknown mechanisms of metabolic control. This study provides a rich source of quantitative data for those studying central metabolism..

  12. The main weed species and their control in oilseed crops in Finland

    Directory of Open Access Journals (Sweden)

    J. SALONEN

    2008-12-01

    Full Text Available A survey of weeds in spring-sown oilseed crops (Brassica rapa ssp. oleifera and Brassica napus ssp. oleifera was conducted in southern and central Finland during 2007–2009, representing the first such extensive investigation in the country. The occurrence of the most abundant weed species in oilseeds was surveyed in 429 fields. In the fields with moderate or high weed infestation, 1–6 harmful weed species were recorded by visual observation according to their biomass production. About 40 weed species were recorded, the most predominant being Chenopodium album, Galeopsis spp., Galium spurium, Sonchus arvensis and Tripleurospermum inodorum. Elymus repens was the only major grass weed. Chemical weed control of broad-leaved weeds had been practised in 53% of the fields, resulting in relatively good control. In addition, both selective graminicides and glyphosate were used to control E. repens. Mechanical weed control was not practised in any field. The crop yield level was about 300 kg ha-1 higher in the fields with low weed infestation compared with in the highly infested fields. New promising options to replace the banned herbicide trifluralin are available. Thus, the most harmful weeds, such as C. album, which interferes with the production of high-quality oil for human consumption, can still be effectively controlled.;

  13. Mapping Above-Ground Biomass of Winter Oilseed Rape Using High Spatial Resolution Satellite Data at Parcel Scale under Waterlogging Conditions

    Directory of Open Access Journals (Sweden)

    Jiahui Han

    2017-03-01

    Full Text Available Oilseed rape (Brassica napus L. is one of the three most important oil crops in China, and is regarded as a drought-tolerant oilseed crop. However, it is commonly sensitive to waterlogging, which usually refers to an adverse environment that limits crop development. Moreover, crop growth and soil irrigation can be monitored at a regional level using remote sensing data. High spatial resolution optical satellite sensors are very useful to capture and resist unfavorable field conditions at the sub-field scale. In this study, four different optical sensors, i.e., Pleiades-1A, Worldview-2, Worldview-3, and SPOT-6, were used to estimate the dry above-ground biomass (AGB of oilseed rape and track the seasonal growth dynamics. In addition, three different soil water content field experiments were carried out at different oilseed rape growth stages from November 2014 to May 2015 in Northern Zhejiang province, China. As a significant indicator of crop productivity, AGB was measured during the seasonal growth stages of the oilseed rape at the experimental plots. Several representative vegetation indices (VIs obtained from multiple satellite sensors were compared with the simultaneously-collected oilseed rape AGB. Results showed that the estimation model using the normalized difference vegetation index (NDVI with a power regression model performed best through the seasonal growth dynamics, with the highest coefficient of determination (R2 = 0.77, the smallest root mean square error (RMSE = 104.64 g/m2, and the relative RMSE (rRMSE = 21%. It is concluded that the use of selected VIs and high spatial multiple satellite data can significantly estimate AGB during the winter oilseed rape growth stages, and can be applied to map the variability of winter oilseed rape at the sub-field level under different waterlogging conditions, which is very promising in the application of agricultural irrigation and precision agriculture.

  14. Increased [CO2] does not compensate for negative effects on yield caused by higher temperature and [O3] in Brassica napus L

    DEFF Research Database (Denmark)

    Frenck, Georg; van der Linden, Leon Gareth; Mikkelsen, Teis Nørgaard

    2011-01-01

    in existing genotypes is vital. In this study, the responses in yield and biomass production of four different cultivars of oilseed rape (Brassica napus L.) were tested under five different combinations of increased [CO2] (700 ppm), temperature (+5 °C) and [O3] (+40 ppb). Especially the multifactor treatments...

  15. The effect of phytohormones on the 133Cs and 88Sr accumulation in oilseed rape

    International Nuclear Information System (INIS)

    Guo Mengluo; Xu Changhe; Li Xinlei; Wang Dan

    2011-01-01

    The effect of uptake and distribution of 133 Cs and 88 Sr in the common plant-India mustard (Brassica napus L.) by exogenous phytohormones (Gibberelin-A 3 GA 3 , Salicylates, SA, 3-indole acetic acid, IAA) treatments were studied by using hydroponic experiment. The results shown as follows: the biomass of above-ground and that of roots of oilseed rape were obviously higher than that of contrary (non-hormone), and the accumulation of 133 Cs and 88 Sr increased as well, under the three phytohormones treatments. The distribution sequence of 133 Cs and 88 Sr in oilseed rape was roots>above-grounds, and the contents was 1 3 3 Cs> 88 Sr. The accumulation ability of phytohormones was GA>SA>IAA, the accumulation of 133 Cs or 88 Sr increased with the phytohormone concentration. The treatment of mid-level of Gibberelin-A 3 (500 mg/L) and Salicylates acid (500 μmol/L) increased the biomass, enrichment and the translocation factors under the low concentration of 133 Cs and 88 Sr stress (1 mmol/L). Therefore, the phyto-extraction efficiency was enhanced in oilseed rape by using exogenous phytohormones. (authors)

  16. Changes in seed weight in response to different sources: sink ratio in oilseed rape

    Directory of Open Access Journals (Sweden)

    Francisco M Iglesias

    2014-06-01

    Full Text Available Little knowledge exists about the degree of source, sink and source: sink limitations on mean seed weight in oilseed rape (Brassica napus L.. The objective of this work was to analyze the nature and magnitude on seed weight response to assimilate availability during the effective seed-filling period in oilseed rape. Three Argentinean varieties, Eclipse, Impulse, and Master, were grown under field conditions, and at the beginning of the effective seed filling period, a broad range of source: sink manipulation combinations were produced. Source manipulations consisted of two incoming radiation (R level reductions: 0% (Rn and ~50% (Rs combined with three different sources: sink treatments were applied: C, control; PR, ~50% pod removal, and D, 100% defoliation. Rs significantly reduced yield (15% and MSW (12% with respect to Rn, without significant effects on the rest of the sub yield components. Source:sink manipulation treatments significantly affected all yield components. PR diminished yield by 29%, reducing ca. 40% seeds pl-1 by reductions pods pl-1 (41% with respect to Rn, whereas PR increased MSW by 19%, counterbalancing the reduction in seeds pl-1 and thereby in yield. When considering different seed positions along the main raceme, Rs reduced MSW by 12% independently of seed positions onto the raceme. On the contrary, PR increased MSW in average 17% with respect to C. Results reported here suggest that oilseed rape has source: sink co-limitation during the effective seed filling period, which is apparently higher than wheat and lower than maize.

  17. Omics Approach to Identify Factors Involved in Brassica Disease Resistance.

    Science.gov (United States)

    Francisco, Marta; Soengas, Pilar; Velasco, Pablo; Bhadauria, Vijai; Cartea, Maria E; Rodríguez, Victor M

    2016-01-01

    Understanding plant's defense mechanisms and their response to biotic stresses is of fundamental meaning for the development of resistant crop varieties and more productive agriculture. The Brassica genus involves a large variety of economically important species and cultivars used as vegetable source, oilseeds, forage and ornamental. Damage caused by pathogens attack affects negatively various aspects of plant growth, development, and crop productivity. Over the last few decades, advances in plant physiology, genetics, and molecular biology have greatly improved our understanding of plant responses to biotic stress conditions. In this regard, various 'omics' technologies enable qualitative and quantitative monitoring of the abundance of various biological molecules in a high-throughput manner, and thus allow determination of their variation between different biological states on a genomic scale. In this review, we have described advances in 'omic' tools (genomics, transcriptomics, proteomics and metabolomics) in the view of conventional and modern approaches being used to elucidate the molecular mechanisms that underlie Brassica disease resistance.

  18. A spatial assessment of Brassica napus gene flow potential to wild and weedy relatives in the Fynbos Biome

    Directory of Open Access Journals (Sweden)

    J. M. Kalwij

    2010-01-01

    Full Text Available Gene flow between related plant species, and between transgenic and non-transgenic crop varieties, may be considered a form of biological invasion. Brassica napus (oilseed rape or canola and its relatives are well known for intra- and inter-specific gene flow, hybridisation and weediness. Gene flow associated with B. napus poses a potential ecological risk in the Fynbos Biome of South Africa, because of the existence of both naturalised (alien, weedy and native relatives in this region. This risk is particularly pertinent given the proposed use of B. napus for biofuel and the potential future introduction of herbicide-tolerant transgenic B. napus. Here we quantify the presence and co-occurrence of B. napus and its wild and weedy relatives in the Fynbos Biome, as a first step in the ecological risk assessment for this crop. Several alien and at least one native relative of B. napus were found to be prevalent in the region, and to be spatially congruent with B. napus fields. The first requirement for potential gene flow to occur has thus been met. In addition, a number of these species have elsewhere been found to be reproductively compatible with B. napus. Further assessment of the potential ecological risks associated with B. napus in South Africa is constrained by uncertainties in the phylogeny of the Brassicaceae, difficulties with morphology-based identification, and poor knowledge of the biology of several of the species involved, particularly under South African conditions.

  19. RESEARCHES ON OILSEEDS MARKET IN ROMANIA

    Directory of Open Access Journals (Sweden)

    Elena SOARE

    2014-12-01

    Full Text Available This scientific paper presents the evolution of oilseeds market in Romania, during the period 2008-2013. In order to show as concise as possible the reality of the oilseeds sector, the research pictures, on the one hand, an evolution of oilseeds specific indicators and on the other hand, an evolution of external trade. Romania disposes of tradition and favourable pedo-climatic conditions for cultivating the oilseeds plants. This is demonstrated by the favourable results obtained in the last years, especially concerning the sunflower crop. In 2013, Romania registered a record for sunflower, occupying the first position in the European Union for cultivated area and production. A negative aspect is represented by the fact that our country has the best conditions in Europe for soybean crop, but it is still dependent on import. Romania imports a huge quantity of soybean oilcakes for animal feeding. Nowadays, Romania is an important actor in the sunflower world market, covering almost 19% of the global demand. In perspective, one could expect significant oilseeds productions with a positive influence on the agro-food trade balance in our country.

  20. Comparative mapping of Brassica juncea and Arabidopsis thaliana using Intron Polymorphism (IP markers: homoeologous relationships, diversification and evolution of the A, B and C Brassica genomes

    Directory of Open Access Journals (Sweden)

    Gupta Vibha

    2008-03-01

    Full Text Available Abstract Background Extensive mapping efforts are currently underway for the establishment of comparative genomics between the model plant, Arabidopsis thaliana and various Brassica species. Most of these studies have deployed RFLP markers, the use of which is a laborious and time-consuming process. We therefore tested the efficacy of PCR-based Intron Polymorphism (IP markers to analyze genome-wide synteny between the oilseed crop, Brassica juncea (AABB genome and A. thaliana and analyzed the arrangement of 24 (previously described genomic block segments in the A, B and C Brassica genomes to study the evolutionary events contributing to karyotype variations in the three diploid Brassica genomes. Results IP markers were highly efficient and generated easily discernable polymorphisms on agarose gels. Comparative analysis of the segmental organization of the A and B genomes of B. juncea (present study with the A and B genomes of B. napus and B. nigra respectively (described earlier, revealed a high degree of colinearity suggesting minimal macro-level changes after polyploidization. The ancestral block arrangements that remained unaltered during evolution and the karyotype rearrangements that originated in the Oleracea lineage after its divergence from Rapa lineage were identified. Genomic rearrangements leading to the gain or loss of one chromosome each between the A-B and A-C lineages were deciphered. Complete homoeology in terms of block organization was found between three linkage groups (LG each for the A-B and A-C genomes. Based on the homoeology shared between the A, B and C genomes, a new nomenclature for the B genome LGs was assigned to establish uniformity in the international Brassica LG nomenclature code. Conclusion IP markers were highly effective in generating comparative relationships between Arabidopsis and various Brassica species. Comparative genomics between the three Brassica lineages established the major rearrangements

  1. Infestation of Polish Agricultural Soils by Plasmodiophora Brassicae Along The Polish-Ukrainian Border

    Directory of Open Access Journals (Sweden)

    Jędryczka Małgorzata

    2014-07-01

    Full Text Available There has been a rapid, worldwide increase in oilseed rape production that has resulted in enormous intensification of oilseed rape cultivation, leading to tight rotations. This in turn, has caused an accumulation of pests as well as foliar and soil-borne diseases. Recently, clubroot has become one of the biggest concerns of oilseed rape growers. Clubroot is caused by the soil-borne protist Plasmodiophora brassicae Woronin. The pathogen may be present in groundwater, lakes, and irrigation water used in sprinkling systems. It can be easily transmitted from one field to another not only by water, but also by soil particles and dust transmitted by wind and on machinery. The aim of our overall study was to check for P. brassicae infestation of Polish agricultural soils. This paper presents the 2012 results of a study performed along the Polish-Ukrainian border in two provinces: Lublin (Lubelskie Voivodeship and the Carpathian Foothills (Podkarpackie Voivodeship, in south-east Poland. Monitoring was done in 11 counties, including nine rural and two municipal ones. In total, 40 samples were collected, out of which 36 were collected from fields located in rural areas and four from municipal areas, with two per municipal region. Each sample was collected at 8-10 sites per field, using a soil auger. The biotest to detect the presence of P. brassicae was done under greenhouse conditions using seedlings of the susceptible Brassicas: B. rapa ssp. pekinensis and the Polish variety of oilseed rape B. napus cv. Monolit. Susceptible plants grown in heavily infested soils produced galls on their roots. A county was regarded as free from the pathogen, if none of the bait plants became infected. The pathogen was found in three out of 40 fields monitored (7.5% in the Carpathian Foothill region. The fields were located in two rural counties. The pathogen was not found in Lublin province, and was also not detected in any of the municipal counties. The detection with

  2. Tolerance of Brassica nigra to Pieris brassicae herbivory

    NARCIS (Netherlands)

    Blatt, S.E.; Smallegange, R.C.; Hess, L.; Harvey, J.A.; Dicke, M.; Loon, van J.J.A.

    2008-01-01

    Black mustard, Brassica nigra (L.) Koch, is a wild annual species found throughout Europe and fed on by larvae of the large cabbage-white butterfly, Pieris brassicae L. We examined the impact of herbivory from P. brassicae, a gregarious herbivore, on B. nigra grown from wild seed collected locally.

  3. Effects of strontium stress on antioxidant characteristics of oilseed rape seedling

    International Nuclear Information System (INIS)

    Ao Jia; Tang Yunlai; Chen Mei; An Bing; Wang Dan; Tao Yang

    2010-01-01

    Seedlings of oilseed rape (Brassica napus L.) were treated with different concentration of Sr 2+ (0, 10, 20, 40 mmol/L SrCl 2 ) for 0, 7, 14, 21 days under quartz sand and Hoagland solution culture, and the antioxidant characteristics and Sr 2+ accumulation of seedling were investigated. Rape seedlings showed high accumulation capacity for strontium, especial the leaves. But the accumulation capacity declined with the increasing of Sr 2+ concentration. The activity of superoxide dismutase (SOD) and the content of malondialdehyde (MDA) increased with the increasing of Sr 2+ concentration and then declined with the extention of the stress time. The activity of catalase (CAT) and peroxidase (POD) declined with the increasing of the Sr 2+ accumulation capacity. This study showed that oilseed rape had a very high strontium-tolerant and strontium-uptake capacity, and leaf was the organ that accumulates most of strontium. The accumulation capacity and activity of CAT, POD exhibited a significantly-negative correlation. (authors)

  4. Arthropod Pest Control for UK Oilseed Rape - Comparing Insecticide Efficacies, Side Effects and Alternatives.

    Directory of Open Access Journals (Sweden)

    Han Zhang

    Full Text Available Oilseed rape (Brassica napus is an important combinable break crop in the UK, which is largely protected from arthropod pests by insecticidal chemicals. Despite ongoing debate regarding the use of neonicotinoids, the dominant seed treatment ingredients used for this crop, there is little publicly available data comparing the efficacy of insecticides in controlling key arthropod pests or comparing the impacts on non-target species and the wider environment. To provide an insight into these matters, a UK-wide expert survey targeting agronomists and entomologists was conducted from March to June 2015. Based on the opinions of 90 respondents, an average of 20% yield loss caused by the key arthropod pests was expected to have occurred in the absence of insecticide treatments. Relatively older chemical groups were perceived to have lower efficacy for target pests than newer ones, partly due to the development of insecticide resistance. Without neonicotinoid seed treatments, a lack of good control for cabbage stem flea beetle was perceived. Wide spectrum foliar insecticide sprays were perceived to have significantly greater negative impacts than seed treatments on users' health, natural enemies, pollinators, soil and water, and many foliar active ingredients have had potential risks for non-target arthropod species in UK oilseed rape fields for the past 25 years. Overall, 72% of respondents opposed the neonicotinoid restriction, while 10% supported it. Opposition and support of the restriction were largely based on concerns for pollinators and the wider environment, highlighting the uncertainty over the side effects of neonicotinoid use. More people from the government and research institutes leaned towards neutrality over the issue, compared to those directly involved in growing the crop. Neonicotinoid restriction was expected to result in greater effort and expenditure on pest control and lower production (0-1 t/ha less. Alternatives for future

  5. DEVELOPMENT OF MOLECULAR MONITORING TECHNOLOGIES TO MEASURE TRANSGENE FLOW AND INTROGRESSION IN CROP AND NON-CROP PLANT SPECIES

    Science.gov (United States)

    The Gene Flow Project at the US Environmental Protection Agency, Western Ecology Division is developing methodologies for ecological risk assessments of transgene flow using Agrostis and Brassica engineered with CP4 EPSPS genes that confer resistance to glyphosate herbicide. In ...

  6. Proteomic Analysis of Pollen and Blossom Honey from Rape Seed Brassica Napus L.

    Directory of Open Access Journals (Sweden)

    Borutinskaitė Veronika

    2017-06-01

    Full Text Available In the study, honey from oilseed rape Brassica napus L., and both hand-collected (winter rape Visby and Cult and bee-collected pollen of oilseed rape were analyzed for their proteome content, in order to see if any plant proteins were present to allow the proteo-typing of the oilseed rape honey. Proteins were fractionated by two-dimensional gel electrophoresis (2DE, stained by Coomassie blue and then analyzed by mass spectrometry. All identified proteins were divided into few groups due to their biological function. In 2DE gels with separated proteins from blossom honey, only bee (Apis mellifera main proteins (Major royal jelly protein 1-5 and Glucosidase were found. So we analyzed all proteins using gel-free based analysis with the SYNAPT G2 high definition mass spectrometry. We identified proteins that were present in both oilseed rape pollen and honey (Bna, Polygalacturonase, Non-specific lipid-transfer protein, GAPDH and others. We believe that these proteins are important for the nutritional value of plant pollen-enriched honey and further research is required on honey and honeybee pollen protein.

  7. A rich TILLING resource for studying gene function in Brassica rapa

    Directory of Open Access Journals (Sweden)

    Amoah Stephen

    2010-04-01

    Full Text Available Abstract Background The Brassicaceae family includes the model plant Arabidopsis thaliana as well as a number of agronomically important species such as oilseed crops (in particular Brassica napus, B. juncea and B. rapa and vegetables (eg. B. rapa and B. oleracea. Separated by only 10-20 million years, Brassica species and Arabidopsis thaliana are closely related, and it is expected that knowledge obtained relating to Arabidopsis growth and development can be translated into Brassicas for crop improvement. Moreover, certain aspects of plant development are sufficiently different between Brassica and Arabidopsis to warrant studies to be carried out directly in the crop species. However, mutating individual genes in the amphidiploid Brassicas such as B. napus and B. juncea may, on the other hand, not give rise to expected phenotypes as the genomes of these species can contain up to six orthologues per single-copy Arabidopsis gene. In order to elucidate and possibly exploit the function of redundant genes for oilseed rape crop improvement, it may therefore be more efficient to study the effects in one of the diploid Brassica species such as B. rapa. Moreover, the ongoing sequencing of the B. rapa genome makes this species a highly attractive model for Brassica research and genetic resource development. Results Seeds from the diploid Brassica A genome species, B. rapa were treated with ethyl methane sulfonate (EMS to produce a TILLING (Targeting Induced Local Lesions In Genomes population for reverse genetics studies. We used the B. rapa genotype, R-o-18, which has a similar developmental ontogeny to an oilseed rape crop. Hence this resource is expected to be well suited for studying traits with relevance to yield and quality of oilseed rape. DNA was isolated from a total of 9,216 M2 plants and pooled to form the basis of the TILLING platform. Analysis of six genes revealed a high level of mutations with a density of about one per 60 kb. This

  8. The Emerging British Verticillium longisporum Population Consists of Aggressive Brassica Pathogens.

    Science.gov (United States)

    Depotter, Jasper R L; Rodriguez-Moreno, Luis; Thomma, Bart P H J; Wood, Thomas A

    2017-11-01

    Verticillium longisporum is an economically important fungal pathogen of brassicaceous crops that originated from at least three hybridization events between different Verticillium spp., leading to the hybrid lineages A1/D1, A1/D2, and A1/D3. Isolates of lineage A1/D1 generally cause stem striping on oilseed rape (Brassica napus), which has recently been reported for the first time to occur in the United Kingdom. Intriguingly, the emerging U.K. population is distinct from the north-central European stem striping population. Little is known about the pathogenicity of the newly emerged U.K. population; hence, pathogenicity tests were executed to compare British isolates to previously characterized reference strains. In addition to the model plant Arabidopsis thaliana, the pathogenicity of four British isolates was assessed on four cultivars of three Brassica crop species: oilseed rape (Quartz and Incentive), cauliflower (Clapton), and Chinese cabbage (Hilton). To this end, vascular discoloration of the roots, plant biomass accumulations, and fungal stem colonization upon isolate infection were evaluated. The British isolates appeared to be remarkably aggressive, because plant biomass was significantly affected and severe vascular discoloration was observed. The British isolates were successful stem colonizers and the extent of fungal colonization negatively correlated with plant biomass of cauliflower and Quartz oilseed rape. However, in Quartz, the fungal colonization of A1/D1 isolates was significantly lower than that of the virulent reference isolate from lineage A1/D3, PD589. Moreover, despite levels of stem colonization similar to those of A1/D1 strains, PD589 did not cause significant disease on Incentive. Thus, A1/D1 isolates, including British isolates, are aggressive oilseed rape pathogens despite limited colonization levels in comparison with a virulent A1/D3 isolate.

  9. NAPUS 2000 Rapeseed (Brassica napus breeding for improved human nutrition

    Directory of Open Access Journals (Sweden)

    Friedt Wolfgang

    2001-01-01

    Full Text Available Following a competition announcement of the Federal Ministry of Research and Education (BMBF a project dealing with the improvement of the nutritional value of oilseed rape (Brassica napus for food applications and human nutrition was worked out and started in autumn 1999. A number of partners (Figure 2 are carrying out a complex project reaching from the discovery, characterisation, isolation and transfer of genes of interest up to breeding of well performing varieties combined with important agronomic traits. Economic studies and processing trials as well as nutritional investigations of the new qualities are undertaken. B. napus seed quality aspects with respect to seed coat colour, oil composition, lecithin and protein fractions and antioxidants like tocopherols and resveratrol will be improved.

  10. EFFECTS OF PLANT NUTRITION ON CANOLA (Brassica napus L. GROWTH

    Directory of Open Access Journals (Sweden)

    Sami Süzer

    2016-03-01

    Full Text Available Canola (Brassica napus L. is an important edible oilseed crop in the World and in Turkey. It has a healthy vegetable oil because of its balance with omega 3-6-9 essential fatty acids, making canola oil a healthy vegetable oil throughout the World for cooking and processed food industry. Canola production of high yield and good quality usually depends on well-balanced plant nutrition and growing conditions. A well-balanced soil condition also affects canola plants responses to stress factors such as disease and bad weather conditions. Nitrogen, phosphorus and potassium (NPK are some of the major nutrients required to significantly increase canola yield. Fertilizer application dosages in canola production vary because of the variable occurrence of NPK in the soil. A high yielding canola production needs a well-balanced fertilization program.

  11. Transgene flow: Facts, speculations and possible countermeasures

    Science.gov (United States)

    Ryffel, Gerhart U

    2014-01-01

    Convincing evidence has accumulated that unintended transgene escape occurs in oilseed rape, maize, cotton and creeping bentgrass. The escaped transgenes are found in variant cultivars, in wild type plants as well as in hybrids of sexually compatible species. The fact that in some cases stacked events are present that have not been planted commercially, implies unintended recombination of transgenic traits. As the consequences of this continuous transgene escape for the ecosystem cannot be reliably predicted, I propose to use more sophisticated approaches of gene technology in future. If possible GM plants should be constructed using either site-directed mutagenesis or cisgenic strategies to avoid the problem of transgene escape. In cases where a transgenic trait is needed, efficient containment should be the standard approach. Various strategies available or in development are discussed. Such a cautious approach in developing novel types of GM crops will enhance the sustainable potential of GM crops and thus increase the public trust in green gene technology. PMID:25523171

  12. Preparation of food supplements from oilseed cakes.

    Science.gov (United States)

    Sunil, L; Appaiah, Prakruthi; Prasanth Kumar, P K; Gopala Krishna, A G

    2015-05-01

    Oilseed cakes have been in use for feed preparation. Being rich in proteins, antioxidants, fibers, vitamins and minerals, oilseed cakes have been considered ideal for food supplementation. These oilseed cakes can be processed and made more palatable and edible by suitable treatments and then incorporated as food supplements for human consumption. Rice bran pellets (RBP), stabilized rice bran (SRB), coconut cake (CC) and sesame cake (SC) were taken up for the study. These were mixed with distilled water and cooked in such a way to separate the cooked solid residue and liquid extract followed by freeze drying to get two products from each. The raw, cooked dried residue and extract were analyzed for various parameters such as moisture (0.9-27.4 %), fat (2.1-16.1 %), ash (3.3-9.0 %), minerals (2.6-633.2 mg/100 g), total dietary fiber (23.2-58.2 %), crude fiber (2.7-10.5 %), protein (3.2-34.0 %), and the fat further analyzed for fatty acid composition, oryzanol (138-258 mg/100 g) and lignan (99-113 mg/100 g) contents and also evaluated sensory evaluation. Nutritional composition of products as affected by cooking was studied. The cooked products (residue and extract) showed changes in nutrients content and composition from that of the starting cakes and raw materials, but retained more nutrients in cooked residue than in the extract. The sensory evaluation of cooked residue and extract showed overall higher acceptability by the panelists than the starting cakes and raw materials. On the basis of these findings it can be concluded that these cooked residue and extract products are highly valuable for food supplementation than the raw ones.

  13. Effects of Single and Multifactor Treatments with Elevated Temperature, CO2 and Ozone on Oilseed Rape and Barley

    DEFF Research Database (Denmark)

    Clausen, Sabine Karin; Frenck, Georg; van der Linden, Leon Gareth

    2011-01-01

    We investigated the effect of elevated [CO2], [O3] and temperature on plant productivity and if these climate factors interacted with each other in multifactor treatments. The climate effects were studied in 14 different cultivars/lines of European spring oilseed rape (Brassica napus L.) and spring...... barley (Hordeum vulgare L.). Seven genotypes of each species were cultivated in six single- and multifactor treatments with ambient or elevated CO2 (385 ppm and 700 ppm), O3 (20 ppb and 60 ppb) and temperature (12/19 °C and 17/24 °C). Growth and production parameters were measured. Elevated CO2 increased....... A significantly decreased yield and thousand grain weight was also seen in barley due to elevated O3. The multifactor combination of elevated CO2, O3 and temperature showed a decrease in growth and production in the two species, though not statistically significant for all parameters. This trend suggests...

  14. The health condition of spring oilseed crops in relation to the fungi colonising their seeds

    Directory of Open Access Journals (Sweden)

    Barbara Majchrzak

    2013-12-01

    Full Text Available The research was conduced in the years 1999-2000. The aim of the research was to determine the health condition of overground parts and seeds of the following spring oilseed crops: crambe (Crambe abbysinica Hoechst. cv. B o r o w s k i, false flax (Camelina sativa L. cv. B o r o w s k a, spring rape (Brassica napus ssp. oleifera L. cv. M a r g o and oleiferous radish (Raphanus sativus var. oleiferus L. cv. P e g l e t t a. In all the years of the research alternaria blight was found on the leaves and siliques of spring rape and oleiferous radish and on the leaves and stems of crambe. False flax proved to be weakly infected by pathogens. On its leaves gray mould (Botrytis cinerea was found in all the years of the research. The disease was found on the siliques only in 1999. In 2000 powdery mildew was found on spring rape and false flax (respectively, Erysiphe crucifearum and E.cichoracearum. The weather conditions affected the intensity of the diseases on the studied spring oilseed crops. Alernaria genus, especially A.alternata was most commonly isolated from the seeds of examined plants. It constituted from 37% (in crambe to 63,3% (in spring rape of all the isolates. Of the remaining pathogenic species, numerous fungi of the Fusarium genus (F.avenaceum, F.culmorum, F.equiseti and F.oxysporum were isolated. They constituted from 1,0% (false flax to 17,3% (crambe of the isolates.

  15. Impact of Indian Mustard (Brassica juncea and Flax (Linum usitatissimum Seed Meal Applications on Soil Carbon, Nitrogen, and Microbial Dynamics

    Directory of Open Access Journals (Sweden)

    Autumn S. Wang

    2012-01-01

    Full Text Available There is a critical need to investigate how land application of dedicated biofuel oilseed meals affects soil ecosystems. In this study, mustard (Brassica juncea and flax (Linum usitatissimum seed meals and sorghum-sudangrass (Sorghum bicolor were added to soil at levels of 0, 1, 2.5, and 5% (w/w. Both the type of amendment and application rate affected soil organic C, total C & N, and C & N mineralization. Mustard meal amendment initially inhibited C mineralization as compared to flax, but >50% of mustard and flax organic C was mineralized within 51 d. Nitrogen mineralization was similar for flax and mustard, except for the 2.5% rate for which a lower proportion of mustard N was converted to nitrate. The mustard meal greatly impacted microbial community composition, appearing to select for specific fungal populations. The potential varying impacts of different oilseed meals on soil ecosystems should be considered when developing recommendations for land application.

  16. Reprogramming the Phenylpropanoid Metabolism in Seeds of Oilseed Rape by Suppressing the Orthologs of REDUCED EPIDERMAL FLUORESCENCE11[W

    Science.gov (United States)

    Mittasch, Juliane; Böttcher, Christoph; Frolov, Andrej; Strack, Dieter; Milkowski, Carsten

    2013-01-01

    As a result of the phenylpropanoid pathway, many Brassicaceae produce considerable amounts of soluble hydroxycinnamate conjugates, mainly sinapate esters. From oilseed rape (Brassica napus), we cloned two orthologs of the Arabidopsis (Arabidopsis thaliana) gene REDUCED EPIDERMAL FLUORESCENCE1 (REF1) encoding a coniferaldehyde/sinapaldehyde dehydrogenase. The enzyme is involved in the formation of ferulate and sinapate from the corresponding aldehydes, thereby linking lignin and hydroxycinnamate biosynthesis as a potential branch-point enzyme. We used RNA interference to silence REF1 genes in seeds of oilseed rape. Nontargeted metabolite profiling showed that BnREF1-suppressing seeds produced a novel chemotype characterized by reduced levels of sinapate esters, the appearance of conjugated monolignols, dilignols, and trilignols, altered accumulation patterns of kaempferol glycosides, and changes in minor conjugates of caffeate, ferulate, and 5-hydroxyferulate. BnREF1 suppression affected the level of minor sinapate conjugates more severely than that of the major component sinapine. Mapping of the changed metabolites onto the phenylpropanoid metabolic network revealed partial redirection of metabolic sequences as a major impact of BnREF1 suppression. PMID:23424250

  17. Reprogramming the phenylpropanoid metabolism in seeds of oilseed rape by suppressing the orthologs of reduced epidermal fluorescence1.

    Science.gov (United States)

    Mittasch, Juliane; Böttcher, Christoph; Frolov, Andrej; Strack, Dieter; Milkowski, Carsten

    2013-04-01

    As a result of the phenylpropanoid pathway, many Brassicaceae produce considerable amounts of soluble hydroxycinnamate conjugates, mainly sinapate esters. From oilseed rape (Brassica napus), we cloned two orthologs of the Arabidopsis (Arabidopsis thaliana) gene reduced epidermal fluorescence1 (REF1) encoding a coniferaldehyde/sinapaldehyde dehydrogenase. The enzyme is involved in the formation of ferulate and sinapate from the corresponding aldehydes, thereby linking lignin and hydroxycinnamate biosynthesis as a potential branch-point enzyme. We used RNA interference to silence REF1 genes in seeds of oilseed rape. Nontargeted metabolite profiling showed that BnREF1-suppressing seeds produced a novel chemotype characterized by reduced levels of sinapate esters, the appearance of conjugated monolignols, dilignols, and trilignols, altered accumulation patterns of kaempferol glycosides, and changes in minor conjugates of caffeate, ferulate, and 5-hydroxyferulate. BnREF1 suppression affected the level of minor sinapate conjugates more severely than that of the major component sinapine. Mapping of the changed metabolites onto the phenylpropanoid metabolic network revealed partial redirection of metabolic sequences as a major impact of BnREF1 suppression.

  18. Root length densities of UK wheat and oilseed rape crops with implications for water capture and yield

    Science.gov (United States)

    White, Charlotte A.; Sylvester-Bradley, Roger; Berry, Peter M.

    2015-01-01

    Root length density (RLD) was measured to 1 m depth for 17 commercial crops of winter wheat (Triticum aestivum) and 40 crops of winter oilseed rape [Brassica napus; oilseed rape (OSR)] grown in the UK between 2004 and 2013. Taking the critical RLD (cRLD) for water capture as 1cm cm–3, RLDs appeared inadequate for full water capture on average below a depth of 0.32 m for winter wheat and below 0.45 m for OSR. These depths compare unfavourably (for wheat) with average depths of ‘full capture’ of 0.86 m and 0.48 m, respectively, determined for three wheat crops and one OSR crop studied in the 1970s and 1980s, and treated as references here. A simple model of water uptake and yield indicated that these shortfalls in wheat and OSR rooting compared with the reference data might be associated with shortfalls of up to 3.5 t ha–1 and 1.2 t ha–1, respectively, in grain yields under water-limited conditions, as increasingly occur through climate change. Coupled with decreased summer rainfall, poor rooting of modern arable crops could explain much of the yield stagnation that has been observed on UK farms since the 1990s. Methods of monitoring and improving rooting under commercial conditions are reviewed and discussed. PMID:25750427

  19. Genetic variation and inheritance of phytosterol and oil content in a doubled haploid population derived from the winter oilseed rape Sansibar × Oase cross.

    Science.gov (United States)

    Teh, Lishia; Möllers, Christian

    2016-01-01

    Identification of QTL for phytosterol content, oil content, fatty acids content, protein content of defatted meal, and seed weight by multiple interval mapping in a Brassica napus DH population. Phytosterols are minor seed constituents in oilseed rape which have recently drawn wide-interest from the food and nutrition industry due to their health benefit in lowering LDL cholesterol in humans. To understand the genetic basis of phytosterol content and its relationship with other seed quality traits in oilseed rape, QTL mapping was performed in a segregating DH population derived from the cross of two winter oilseed rape varieties, Sansibar and Oase, termed SODH population. Both parental lines are of canola quality which differ in phytosterol and oil content in seed. A genetic map was constructed for SODH population based on a total of 1638 markers organized in 23 linkage groups and covering a map length of 2350 cM with a mean marker interval of 2.0 cM. The SODH population and the parental lines were cultivated at six environments in Europe and were phenotyped for phytosterol content, oil content, fatty acids content, protein content of the defatted meal, and seed weight. Multiple interval mapping identified between one and six QTL for nine phytosterol traits, between two and six QTL for four fatty acids, five QTL for oil content, four QTL for protein content of defatted meal, and three QTL for seed weight. Colocalizations of QTL for different traits were more frequently observed than individual isolated QTL. Major QTL (R (2) ≥ 25%) were all located in the A genome, and the possible candidate genes were investigated by physical localization of the QTL to the reference genome sequence of Brassica rapa.

  20. Mycoflora and mycotoxin production in oilseed cakes during farm storage.

    Science.gov (United States)

    Lanier, Caroline; Heutte, Natacha; Richard, Estelle; Bouchart, Valerie; Lebailly, Pierre; Garon, David

    2009-02-25

    Agricultural activities involve the use of oilseed cakes as a source of proteins for livestock. Because the storage of oilseed cakes could induce the development of molds and the production of mycotoxins, a survey was conducted during the 5 months of farm storage. Mycoflora was studied by microscopic examinations, and the presence of Aspergillus fumigatus was confirmed by polymerase chain reaction. A multimycotoxin method was developed to quantify seven mycotoxins (aflatoxin B(1), alternariol, fumonisin B(1), gliotoxin, ochratoxin A, T-2 toxin, and zearalenone) in oilseed cakes by high-performance liquid chromatography coupled to mass spectrometry. Among 34 fungal species identified, A. fumigatus and Aspergillus repens were observed during 5 and 4 months, respectively. Gliotoxin, an immunosuppressive mycotoxin, was quantified in oilseed cakes up to 45 microg/kg, which was associated with the presence of toxigenic isolates of A. fumigatus.

  1. Coat protein of Turnip mosaic virus in oilseed rape (Brassica napus)

    African Journals Online (AJOL)

    mohammad

    2Department of Plant Breeding and Biotechnology, Faculty of Agriculture, Ferdowsi University of Mashhad, Mashhad,. Iran. Accepted 15 August, 2012 ... led to prevalence of infectious diseases. Turnip mosaic virus (TuMV) is an .... During the sampling of canola plants for the detection of virus, some colonies of aphids were ...

  2. Brassica cover crops for nitrogen retention in the Mid-Atlantic coastal plain.

    Science.gov (United States)

    Dean, Jill E; Weil, Ray R

    2009-01-01

    Brassica cover crops are new to the mid-Atlantic region, and limited information is available on their N uptake capabilities for effective N conservation. Forage radish (Raphanus sativus L. cv. Daikon), oilseed radish (Raphanus sativus L. cv. Adagio), and rape (Brassica napus L. cv. Dwarf Essex) were compared with rye (Secale cereale L. cv. Wheeler), a popular cover crop in the region, with regard to N uptake ability and potential to decrease N leaching at two sites in Maryland. Plants were harvested in fall and spring for dry matter and N analysis. Soil samples from 0 cm to 105 to 180 cm depth were obtained in fall and spring for NH(4)-N and NO(3)-N analyses. Ceramic cup tension lysimeters were installed at depths of 75 to 120 cm to monitor NO(3)-N in soil pore water. Averaged across 3 site-years, forage radish and rape shoots had greater dry matter production and captured more N in fall than rye shoots. Compared with a weedy fallow control, rape and rye caused similar decreases in soil NO(3)-N in fall and spring throughout the sampled profile. Cover crops had no effect on soil NH(4)-N. During the spring on coarse textured soil, pore water NO(3)-N concentrations in freeze-killed Brassica (radish) plots were greater than in control and overwintering Brassica (rape) and rye plots. On fine textured soil, all cover crops provided a similar decrease in pore water NO(3)-N concentration compared with control. On coarse textured soils, freeze-killed Brassica cover crops should be followed by an early-planted spring main crop.

  3. The globalization of international oilseeds trade

    Directory of Open Access Journals (Sweden)

    Mittaine Jean-François

    2012-09-01

    Full Text Available In a globalised world, the trade of goods and services constitute the heart of the economic system. But the trade patterns may show extreme diversity depending upon the nature of the concerned products. The technical and functional constraints do impose their laws, particularly when they relate to biological products/commodities. The term globalization is generally used to describe a complex process of international integration. When referring to oilseeds, the term must also relate to agriculture and human nutritional requirements for a rising human population spread all over the world, particularly in large urban environment. With an annual harvest of about 450 Mn T, oilseeds are naturally “globalized” in their production patterns. The complexity of their production schemes associated with the diversity of their usage on widespread geographical regions gives this group of commodities a unique role on the world markets. This process of opened trade channels has enabled the sector to meet the supply requirements of a quickly rising demand coming from both the population and all the industrial usages including alternative “green” energy. However, for the time being, demand growth has not been fully counter-balanced by production growth. As a consequence, unless some strict reallocation of acreage is effectively organized or new high yielding technologies are developed, it is a fact that vegetable oil will keep a strong demand base for a long time, compounded by the mechanical demand from economic growth in highly populated emerging economies. The balancing of supply and demand is expected to remain a tight exercise every year. At the end of the day, the future of the entire industry largely lies in technology because the final stake is to ensure the proper feeding of a 9 billion people population in a not too far future.

  4. Green solvents and technologies for oil extraction from oilseeds

    OpenAIRE

    Kumar, S. P. Jeevan; Prasad, S. Rajendra; Banerjee, Rintu; Agarwal, Dinesh K.; Kulkarni, Kalyani S.; Ramesh, K. V.

    2017-01-01

    Oilseeds are crucial for the nutritional security of the global population. The conventional technology used for oil extraction from oilseeds is by solvent extraction. In solvent extraction, n-hexane is used as a solvent for its attributes such as simple recovery, non-polar nature, low latent heat of vaporization (330?kJ/kg) and high selectivity to solvents. However, usage of hexane as a solvent has lead to several repercussions such as air pollution, toxicity and harmfulness that prompted to...

  5. Brassica ASTRA: an integrated database for Brassica genomic research.

    Science.gov (United States)

    Love, Christopher G; Robinson, Andrew J; Lim, Geraldine A C; Hopkins, Clare J; Batley, Jacqueline; Barker, Gary; Spangenberg, German C; Edwards, David

    2005-01-01

    Brassica ASTRA is a public database for genomic information on Brassica species. The database incorporates expressed sequences with Swiss-Prot and GenBank comparative sequence annotation as well as secondary Gene Ontology (GO) annotation derived from the comparison with Arabidopsis TAIR GO annotations. Simple sequence repeat molecular markers are identified within resident sequences and mapped onto the closely related Arabidopsis genome sequence. Bacterial artificial chromosome (BAC) end sequences derived from the Multinational Brassica Genome Project are also mapped onto the Arabidopsis genome sequence enabling users to identify candidate Brassica BACs corresponding to syntenic regions of Arabidopsis. This information is maintained in a MySQL database with a web interface providing the primary means of interrogation. The database is accessible at http://hornbill.cspp.latrobe.edu.au.

  6. High-throughput multiplex cpDNA resequencing clarifies the genetic diversity and genetic relationships among Brassica napus, Brassica rapa and Brassica oleracea.

    Science.gov (United States)

    Qiao, Jiangwei; Cai, Mengxian; Yan, Guixin; Wang, Nian; Li, Feng; Chen, Binyun; Gao, Guizhen; Xu, Kun; Li, Jun; Wu, Xiaoming

    2016-01-01

    Brassica napus (rapeseed) is a recent allotetraploid plant and the second most important oilseed crop worldwide. The origin of B. napus and the genetic relationships with its diploid ancestor species remain largely unresolved. Here, chloroplast DNA (cpDNA) from 488 B. napus accessions of global origin, 139 B. rapa accessions and 49 B. oleracea accessions were populationally resequenced using Illumina Solexa sequencing technologies. The intraspecific cpDNA variants and their allelic frequencies were called genomewide and further validated via EcoTILLING analyses of the rpo region. The cpDNA of the current global B. napus population comprises more than 400 variants (SNPs and short InDels) and maintains one predominant haplotype (Bncp1). Whole-genome resequencing of the cpDNA of Bncp1 haplotype eliminated its direct inheritance from any accession of the B. rapa or B. oleracea species. The distribution of the polymorphism information content (PIC) values for each variant demonstrated that B. napus has much lower cpDNA diversity than B. rapa; however, a vast majority of the wild and cultivated B. oleracea specimens appeared to share one same distinct cpDNA haplotype, in contrast to its wild C-genome relatives. This finding suggests that the cpDNA of the three Brassica species is well differentiated. The predominant B. napus cpDNA haplotype may have originated from uninvestigated relatives or from interactions between cpDNA mutations and natural/artificial selection during speciation and evolution. These exhaustive data on variation in cpDNA would provide fundamental data for research on cpDNA and chloroplasts. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  7. Oilseed Meal Effects on the Emergence and Survival of Crop and Weed Species

    Directory of Open Access Journals (Sweden)

    Katie L. Rothlisberger

    2012-01-01

    Full Text Available Oilseed crops are being widely evaluated for potential biodiesel production. Seed meal (SM remaining after extracting oil may have use as bioherbicides or organic fertilizers. Brassicaceae SM often contains glucosinolates that hydrolyze into biologically active compounds that may inhibit various pests. Jatropha curcas SM contains curcin, a phytoxin. A 14-day greenhouse study determined that Sinapis alba (white mustard, Brassica juncea (Indian mustard, Camelina sativa, and Jatropha curcas applied to soil at varying application rates [0, 0.5, 1.0, and 2.5% (w/w] and incubation times (1, 7, and 14 d prior to planting affected seed emergence and seedling survival of cotton [Gossypium hirsutum (L.], sorghum [Sorghum bicolor (L. Moench], johnsongrass (Sorghum halepense, and redroot pigweed (Amaranthus retroflexus. With each species, emergence and survival was most decreased by 2.5% SM application applied at 1 and 7 d incubations. White mustard SM incubated for 1 d applied at low and high rates had similar negative effects on johnsongrass seedlings. Redroot pigweed seedling survival was generally most decreased by all 2.5% SM applications. Based on significant effects determined by ANOVA, results suggested that the type, rate, and timing of SM application should be considered before land-applying SMs in cropping systems.

  8. Mutagenesis and haploid culture for disease resistance in Brassica napus

    Energy Technology Data Exchange (ETDEWEB)

    MacDonald, M V; Ahmad, I; Ingram, D S [Botany School, University of Cambridge, Cambridge (United Kingdom)

    1990-01-01

    Full text: Most winter oilseed rape cultivars share parentage and therefore show little genetic diversity. There is no known resistance to Alternaria spp. in oilseed rape or in any related Brassica species. Experiments with tissue culture yielded only transient, non-genetic resistance. Therefore, mutagenesis may be used to generate heritable resistance to Alternaria spp. Gamma irradiation was applied to seeds of 'Bienvenue', secondary embryoids of cvs 'Primor' and 'Rapora', and buds of cvs 'Primor' and 'Ariana'. Isolated microspores from cv 'Ariana' and rapid cycling B. napus were also treated. The doses used ranged from 0-100 Gy for isolated microspores and buds, up to 600 Gy for seeds and 960 Gy for secondary embryoids. EMS was used to treat seeds of line WRG-42 (supplied by Nickersons RPB) and microspores of cv 'Bienvenue' and rapid cycling B. napus. Seeds were treated with up to 2.0% EMS for 0.2 h. before plating them on the culture medium. Seed irradiation up to 600 Gy did not reduce germination. M{sub 1} and M{sub 2} progenies were tested both in the laboratory and in field trials, and none of these were found to be resistant to Alternaria. However, considerable variation for other characters was observed. Haploid cultures from these plants were extremely difficult to regenerate, and for this reason no regenerant plants have been tested for resistance. For irradiated secondary embryoids the regeneration capacity decreased with increasing dose. Regenerated plants have been tested for resistance to Alternaria, but stable resistance was not observed. Haploid cultures were obtained from irradiated buds, using both anther and microspore culture. Low irradiation treatment was beneficial to developing embryoids. Some regenerants have been obtained from EMS treated microspores and seeds. Four plants have repeatedly given increased levels of resistance to A. brassicicola, and progenies are being tested to determine the genetic nature of the resistance. (author)

  9. Mutagenesis and haploid culture for disease resistance in Brassica napus

    International Nuclear Information System (INIS)

    MacDonald, M.V.; Ahmad, I.; Ingram, D.S.

    1990-01-01

    Full text: Most winter oilseed rape cultivars share parentage and therefore show little genetic diversity. There is no known resistance to Alternaria spp. in oilseed rape or in any related Brassica species. Experiments with tissue culture yielded only transient, non-genetic resistance. Therefore, mutagenesis may be used to generate heritable resistance to Alternaria spp. Gamma irradiation was applied to seeds of 'Bienvenue', secondary embryoids of cvs 'Primor' and 'Rapora', and buds of cvs 'Primor' and 'Ariana'. Isolated microspores from cv 'Ariana' and rapid cycling B. napus were also treated. The doses used ranged from 0-100 Gy for isolated microspores and buds, up to 600 Gy for seeds and 960 Gy for secondary embryoids. EMS was used to treat seeds of line WRG-42 (supplied by Nickersons RPB) and microspores of cv 'Bienvenue' and rapid cycling B. napus. Seeds were treated with up to 2.0% EMS for 0.2 h. before plating them on the culture medium. Seed irradiation up to 600 Gy did not reduce germination. M 1 and M 2 progenies were tested both in the laboratory and in field trials, and none of these were found to be resistant to Alternaria. However, considerable variation for other characters was observed. Haploid cultures from these plants were extremely difficult to regenerate, and for this reason no regenerant plants have been tested for resistance. For irradiated secondary embryoids the regeneration capacity decreased with increasing dose. Regenerated plants have been tested for resistance to Alternaria, but stable resistance was not observed. Haploid cultures were obtained from irradiated buds, using both anther and microspore culture. Low irradiation treatment was beneficial to developing embryoids. Some regenerants have been obtained from EMS treated microspores and seeds. Four plants have repeatedly given increased levels of resistance to A. brassicicola, and progenies are being tested to determine the genetic nature of the resistance. (author)

  10. Compositional and proteomic analyses of genetically modified broccoli (Brassica oleracea var. italica) harboring an agrobacterial gene.

    Science.gov (United States)

    Liu, Mao-Sen; Ko, Miau-Hwa; Li, Hui-Chun; Tsai, Shwu-Jene; Lai, Ying-Mi; Chang, You-Ming; Wu, Min-Tze; Chen, Long-Fang O

    2014-08-28

    Previously, we showed improved shelf life for agrobacterial isopentenyltransferase (ipt) transgenic broccoli (Brassica oleracea var. italica), with yield comparable to commercial varieties, because of the protection mechanism offered by molecular chaperones and stress-related proteins. Here, we used proximate analysis to examine macronutrients, chemical and mineral constituents as well as anti-nutrient and protein changes of ipt-transgenic broccoli and corresponding controls. We also preliminarily assessed safety in mice. Most aspects were comparable between ipt-transgenic broccoli and controls, except for a significant increase in carbohydrate level and a decrease in magnesium content in ipt-transgenic lines 101, 102 and 103, as compared with non-transgenic controls. In addition, the anti-nutrient glucosinolate content was increased and crude fat content decreased in inbred control 104 and transgenic lines as compared with the parental control, "Green King". Gel-based proteomics detected more than 50 protein spots specifically found in ipt-transgenic broccoli at harvest and after cooking; one-third of these proteins showed homology to potential allergens that also play an important role in plant defense against stresses and senescence. Mice fed levels of ipt-transgenic broccoli mimicking the 120 g/day of broccoli eaten by a 60-kg human adult showed normal growth and immune function. In conclusion, the compositional and proteomic changes attributed to the transgenic ipt gene did not affect the growth and immune response of mice under the feeding regimes examined.

  11. Analysis of oilseed of Halophytic species

    Directory of Open Access Journals (Sweden)

    Parto Roshandel

    2015-07-01

    Full Text Available Seeds of Atriplex griffithii, Haloxylon ammodendron, Salicornia europaea and Salsola yazdiana were analyzed to determine their potential as sources of edible oil. The quantity of total oil varied from 13.8% in Atriplex griffithii to 20.9% in H. ammodendron. The proportion of unsaturated fatty acids were higher (62-73.8%, with the highest values of α-linoleic acid (18.6%, linoleic acid (28.6% and oleic acid (19.7% in the seeds of A. griffithii, H. ammodendron and S. europaea, respectively. Results of physicochemical evaluation of the extracted oils ranged as follows: iodine values, 99.8-106.5 (g I2/100 g; saponification value, 188-283 (mg KOH/1g of oil; peroxide value, 9-13 (meq./kg and refractive index, 1.4750- 1.4761. Amongst these oilseeds, S. europaea (containing 73.8% unsaturated fatty acids but not erucic acid was the highest in quality for human consumption followed by H. ammodendron.

  12. A review on the challenges for the increased production of oilseeds ...

    African Journals Online (AJOL)

    This paper presents the trends of production, utilization and export of oilseeds and import of vegetable oils; available technologies and the prospects of increasing oilseeds production in Ethiopia. The oilseed industry is faced with enormous and multidimensional challenges that brought both treats and opportunities.

  13. Selection during crop diversification involves correlated evolution of the circadian clock and ecophysiological traits in Brassica rapa.

    Science.gov (United States)

    Yarkhunova, Yulia; Edwards, Christine E; Ewers, Brent E; Baker, Robert L; Aston, Timothy Llewellyn; McClung, C Robertson; Lou, Ping; Weinig, Cynthia

    2016-04-01

    Crop selection often leads to dramatic morphological diversification, in which allocation to the harvestable component increases. Shifts in allocation are predicted to impact (as well as rely on) physiological traits; yet, little is known about the evolution of gas exchange and related anatomical features during crop diversification. In Brassica rapa, we tested for physiological differentiation among three crop morphotypes (leaf, turnip, and oilseed) and for correlated evolution of circadian, gas exchange, and phenological traits. We also examined internal and surficial leaf anatomical features and biochemical limits to photosynthesis. Crop types differed in gas exchange; oilseed varieties had higher net carbon assimilation and stomatal conductance relative to vegetable types. Phylogenetically independent contrasts indicated correlated evolution between circadian traits and both gas exchange and biomass accumulation; shifts to shorter circadian period (closer to 24 h) between phylogenetic nodes are associated with higher stomatal conductance, lower photosynthetic rate (when CO2 supply is factored out), and lower biomass accumulation. Crop type differences in gas exchange are also associated with stomatal density, epidermal thickness, numbers of palisade layers, and biochemical limits to photosynthesis. Brassica crop diversification involves correlated evolution of circadian and physiological traits, which is potentially relevant to understanding mechanistic targets for crop improvement. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  14. The bioaccumulation of heavy metals in Brassica napus L. in the area around Turów Power Station, Poland

    Directory of Open Access Journals (Sweden)

    Niedźwiecka Alicja

    2017-01-01

    Full Text Available Brassica napus L. is a known bioaccumulator of copper, zinc, cadmium, lead, chromium, nickel and arsenic from soils. The metal ions are accumulated in the roots, stems, leaves and seeds of the oilseed rape. The samples of soils and plants were collected in the area around the Turów power station (Bogatynia city, Lower Silesia. The soil samples were collected from the surface layer of 0-25 cm. Roots, stems and pods of the oilseed rape were used in the study. The environmental samples were digested in HNO3, 60%, using the Microwave Digestion System. Metal concentrations have been dermined through the FAAS method. Three heavy metals - zinc, copper and lead – have been analyzed. The content of zinc was higher than the content of copper in all samples (plants and soils. In the roots of the oilseed rape higher concentration of metals compared to other parts of the plant was observed. In the soil samples, there was no correlation between the concentration of pollution and the distance from the power plant. Permissible concentrations of heavy metals relative to the standard according to the Polish Ministry of Environment Regulation from September 1st, 2016, have not been exceeded. The permissible pollution indexes (Wn in soils were exceeded compared to the geochemical background in uncontaminated soils of Poland. The bioaccumulation coefficients of heavy metals indicate lower metal concentrations in plants than in soils

  15. Phenolic Compounds in Brassica Vegetables

    Directory of Open Access Journals (Sweden)

    Pablo Velasco

    2010-12-01

    Full Text Available Phenolic compounds are a large group of phytochemicals widespread in the plant kingdom. Depending on their structure they can be classified into simple phenols, phenolic acids, hydroxycinnamic acid derivatives and flavonoids. Phenolic compounds have received considerable attention for being potentially protective factors against cancer and heart diseases, in part because of their potent antioxidative properties and their ubiquity in a wide range of commonly consumed foods of plant origin. The Brassicaceae family includes a wide range of horticultural crops, some of them with economic significance and extensively used in the diet throughout the world. The phenolic composition of Brassica vegetables has been recently investigated and, nowadays, the profile of different Brassica species is well established. Here, we review the significance of phenolic compounds as a source of beneficial compounds for human health and the influence of environmental conditions and processing mechanisms on the phenolic composition of Brassica vegetables.

  16. Detecting the Hormonal Pathways in Oilseed Rape behind Induced Systemic Resistance by Trichoderma harzianum TH12 to Sclerotinia sclerotiorum.

    Science.gov (United States)

    Alkooranee, Jawadayn Talib; Aledan, Tamarah Raad; Ali, Ali Kadhim; Lu, Guangyuan; Zhang, Xuekun; Wu, Jiangsheng; Fu, Chunhua; Li, Maoteng

    2017-01-01

    Plants have the ability to resist pathogen attack after infection or treatment with biotic and abiotic elicitors. In oilseed rape plant Brassica napus AACC and in the artificially synthesized Raphanus alboglabra RRCC, the root-colonizing Trichoderma harzianum TH12 fungus triggers induced systemic resistance (ISR), and its culture filtrate (CF) triggers a systemic acquired resistance (SAR) response against infection by the Sclerotinia sclerotiorum. Salicylic acid (SA) and jasmonic acid/ethylene (JA/ET) are plant hormone signals that play important roles in the regulation of ISR and SAR. In this study, at six different time points (1, 2, 4, 6, 8 and 10 days post-infection [dpi]), six resistance genes were used as markers of signaling pathways: JA/ET signaling used AOC3, PDF1.2 and ERF2 genes, while PR-1, TGA5 and TGA6 genes were used as markers of SA signaling. The results of quantitative real-time polymerase chain reaction (qRT-PCR) showed that AOC3, PDF1.2 and ERF2 expression levels in infected leaves of AACC and RRCC increase at 1 and 2 dpi with S. sclerotiorum or inoculation with TH12. PR-1, TGA5 and TGA6 expression levels increased at 8 and 10 dpi in infected leaves. PR-1, TGA5 and TGA6 expression levels increased early in plants treated with CF in both of the healthy genotypes. Furthermore, induction of SA- and JA/ET-dependent defense decreased disease symptoms in infected leaves at different times. The results suggest that the RRCC genotype exhibits resistance to disease and that the ability of TH12 and its CF to induce systemic resistance in susceptible and resistant oilseed rape genotypes exists. In addition, the results indicate for the first time that in RRCC the SA signaling pathway is involved in resistance to necrotrophic pathogens.

  17. Defective APETALA2 Genes Lead to Sepal Modification in Brassica Crops

    Science.gov (United States)

    Zhang, Yanfeng; Huang, Shuhua; Wang, Xuefang; Liu, Jianwei; Guo, Xupeng; Mu, Jianxin; Tian, Jianhua; Wang, Xiaofeng

    2018-01-01

    Many vegetable and oilseed crops belong to Brassica species. The seed production of these crops is hampered often by abnormal floral organs, especially under the conditions of abiotic conditions. However, the molecular reasons for these abnormal floral organs remains poorly understood. Here, we report a novel pistil-like flower mutant of B. rapa. In the flower of this mutant, the four sepals are modified to one merged carpel that look like a ring in the sepal positions, enveloping some abnormal stamens and a pistil, and resulting in poor seed production. This novel mutant is named sepal-carpel modification (scm). DNA sequencing showed that the BrAP2a gene, the ortholog of Arabidopsis APETALA2 (AP2) that specifies sepal identity, losses the function of in scm mutant due to a 119-bp repeated sequence insertion that resulted in an early transcription termination. BrAP2b, the paralog of BrAP2a featured two single-nucleotide substitutions that cause a single amino acid substitution in the highly conserved acidic serine-rich transcriptional activation domain. Each of the two BrAP2 genes rescues the sepal defective phenotype of the ap2-5 mutant of Arabidopsis. Furthermore, the knockout mutation of the corresponding BnAP2 genes of oilseed rape (B. napus) by CRISPR/Cas9-mediated genome editing system resulted in scm-like phenotype. These results suggest that BrAP2 gene plays a key role in sepal modification. Our finding provides an insight into molecular mechanism underlying morphological modification of floral organs and is useful for genetic manipulation of flower modification and improvement of seed production of Brassica crops. PMID:29616073

  18. Defective APETALA2 Genes Lead to Sepal Modification in Brassica Crops

    Directory of Open Access Journals (Sweden)

    Yanfeng Zhang

    2018-03-01

    Full Text Available Many vegetable and oilseed crops belong to Brassica species. The seed production of these crops is hampered often by abnormal floral organs, especially under the conditions of abiotic conditions. However, the molecular reasons for these abnormal floral organs remains poorly understood. Here, we report a novel pistil-like flower mutant of B. rapa. In the flower of this mutant, the four sepals are modified to one merged carpel that look like a ring in the sepal positions, enveloping some abnormal stamens and a pistil, and resulting in poor seed production. This novel mutant is named sepal-carpel modification (scm. DNA sequencing showed that the BrAP2a gene, the ortholog of Arabidopsis APETALA2 (AP2 that specifies sepal identity, losses the function of in scm mutant due to a 119-bp repeated sequence insertion that resulted in an early transcription termination. BrAP2b, the paralog of BrAP2a featured two single-nucleotide substitutions that cause a single amino acid substitution in the highly conserved acidic serine-rich transcriptional activation domain. Each of the two BrAP2 genes rescues the sepal defective phenotype of the ap2-5 mutant of Arabidopsis. Furthermore, the knockout mutation of the corresponding BnAP2 genes of oilseed rape (B. napus by CRISPR/Cas9-mediated genome editing system resulted in scm-like phenotype. These results suggest that BrAP2 gene plays a key role in sepal modification. Our finding provides an insight into molecular mechanism underlying morphological modification of floral organs and is useful for genetic manipulation of flower modification and improvement of seed production of Brassica crops.

  19. Oilseed rape genotypes response to boron toxicity

    Directory of Open Access Journals (Sweden)

    Savić Jasna

    2013-01-01

    Full Text Available Response of 16 oilseed rape genotypes to B (boron toxicity was analyzed by comparing the results of two experiments conducted in a glasshouse. In Experiment 1 plants were grown in standard nutrient solutions with 10 µMB (control and 1000 µM B. Relative root and shoot growth varied from 20-120% and 31-117%, respectively. Variation in B concentration in shoots was also wide (206.5-441.7 µg B g-1 DW as well as total B uptake by plant (62.3-281.2 µg B g1. Four selected genotypes were grown in Experiment 2 in pots filled with high B soil (8 kg ha-1 B; B8. Shoot growth was not affected by B8 treatment, while root and shoot B concentration was significantly increased compared to control. Genotypes Panther and Pronto which performed low relative root and shoot growth and high B accumulation in plants in Experiment 1, had good growth in B8 treatment. In Experiment 2 genotype NS-L-7 had significantly lower B concentration in shots under treatment B8, but also very high B accumulation in Experiment 1. In addition, cluster analyses classified genotypes in three groups according to traits contrasting in their significance for analyzing response to B toxicity. The first group included four varieties based on their shared characteristics that have small value for the relative growth of roots and shoots and large values of B concentration in shoot. In the second largest group were connected ten genotypes that are heterogeneous in traits and do not stand out on any characteristic. Genotypes NS-L-7 and Navajo were separated in the third group because they had big relative growth of root and shoot, but also a high concentration of B in the shoot, and high total B uptake. Results showed that none of tested genotypes could not be recommended for breeding process to tolerance for B toxicity. [Projekat Ministarstva nauke Republike Srbije, br. OI 173028

  20. The Edible Oil and Oilseeds Value Chain in Ethiopia

    NARCIS (Netherlands)

    F. Mandefro (Fenta); S. Drost (Sarah); J.C.A.C. van Wijk (Jeroen)

    2011-01-01

    textabstractThis report investigates the dynamics of a multi-stakeholder platform (named: Coordination Group, or CG) for stakeholders of the oilseeds and edible oil value chains in Ethiopia. The CG was initiated by the Dutch development organisation SNV in 2005 as part of a broader programme to

  1. The global market for oilseeds: prospects and challenges for Morocco

    Directory of Open Access Journals (Sweden)

    Gosselet Nathalie

    2014-03-01

    Full Text Available The global market for oilseeds, grains, vegetable oil and oilseed meal is a complex market which is growing at a very fast pace, and which is characterized by the large volume of production which is traded between countries. Offer is geographically constrained in this market: there are few exporting countries and these are mainly situated on the American continent. Demand on the other hand is more widespread, although highest in Asiatic countries, China in particular. As a result, small importing countries, like Morocco, are in a vulnerable position, and take the full brunt of price volatility. In the 90s, Moroccan oilseed production was relatively high, unfortunately production dropped over the years, and Morocco must now buy vegetable oil and proteins on the global market. Reviving oilseed production in Morocco would considerably help the country and provide numerous benefits, such as food security, improving the country’s trade balance, and enhancing the agronomic management of land thanks to the introduction of break crops. Finally, it would also boost the entire agricultural sector and help increase the income of farmers.

  2. Biological control of Sclerotinia sclerotiorum (oilseed rape isolate ...

    African Journals Online (AJOL)

    Jane

    2011-06-27

    Jun 27, 2011 ... Sclerotinia sclerotiorum (Lib) De Bary, the causal agent of stem rot of oilseed rape, is one of the most important phytopathogens. In order to find appropriate biocontrol agents, antagonistic and especially chitinolytical activities of 110 soil actinomycetes were examined. Among assayed isolates,.

  3. Sesame: the Underexploited Organic Oilseed Crop | Olowe | Journal ...

    African Journals Online (AJOL)

    Sesame (Sesamum indicum L.) is an important oilseed crop that ranks sixth among vegetable oils worldwide. Asia and Africa respectively account for 2.55 and 0.95 of the 3.66 million tons produced worldwide. However, Africa's net export of the commodity is just 38% of its production, despite the fact that the Continent has ...

  4. Biological control of Sclerotinia sclerotiorum (oilseed rape isolate ...

    African Journals Online (AJOL)

    Sclerotinia sclerotiorum (Lib) De Bary, the causal agent of stem rot of oilseed rape, is one of the most important phytopathogens. In order to find appropriate biocontrol agents, antagonistic and especially chitinolytical activities of 110 soil actinomycetes were examined. Among assayed isolates, Streptomyces sp. isolate 422 ...

  5. Green solvents and technologies for oil extraction from oilseeds.

    Science.gov (United States)

    Kumar, S P Jeevan; Prasad, S Rajendra; Banerjee, Rintu; Agarwal, Dinesh K; Kulkarni, Kalyani S; Ramesh, K V

    2017-01-01

    Oilseeds are crucial for the nutritional security of the global population. The conventional technology used for oil extraction from oilseeds is by solvent extraction. In solvent extraction, n -hexane is used as a solvent for its attributes such as simple recovery, non-polar nature, low latent heat of vaporization (330 kJ/kg) and high selectivity to solvents. However, usage of hexane as a solvent has lead to several repercussions such as air pollution, toxicity and harmfulness that prompted to look for alternative options. To circumvent the problem, green solvents could be a promising approach to replace solvent extraction. In this review, green solvents and technology like aqueous assisted enzyme extraction are better solution for oil extraction from oilseeds. Enzyme mediated extraction is eco-friendly, can obtain higher yields, cost-effective and aids in obtaining co-products without any damage. Enzyme technology has great potential for oil extraction in oilseed industry. Similarly, green solvents such as terpenes and ionic liquids have tremendous solvent properties that enable to extract the oil in eco-friendly manner. These green solvents and technologies are considered green owing to the attributes of energy reduction, eco-friendliness, non-toxicity and non-harmfulness. Hence, the review is mainly focussed on the prospects and challenges of green solvents and technology as the best option to replace the conventional methods without compromising the quality of the extracted products.

  6. Defense to Sclerotinia sclerotiorum in oilseed rape is associated with the sequential activations of salicylic acid signaling and jasmonic acid signaling.

    Science.gov (United States)

    Wang, Zheng; Tan, Xiaoli; Zhang, Zhiyan; Gu, Shoulai; Li, Guanying; Shi, Haifeng

    2012-03-01

    Signaling pathways mediated by salicylic acid (SA) and jasmonic acid (JA) are widely studied in various host-pathogen interactions. For oilseed rape (Brassica napus)-Sclerotinia sclerotiorum interaction, little information of the two signaling molecules has been described in detail. In this study, we showed that the level of SA and JA in B. napus leaves was increased with a distinct temporal profile, respectively, after S. sclerotiorum infection. The application of SA or methyl jasmonate enhanced the resistance to the pathogen. Furthermore, a set of SA and JA signaling marker genes were identified from B. napus and were used to monitor the signaling responses to S. sclerotiorum infection by examining the temporal expression profiles of these marker genes. The SA signaling was activated within 12h post inoculation (hpi) followed by the JA signaling which was activated around 24 hpi. In addition, SA-JA crosstalk genes were activated during this process. These results suggested that defense against S. sclerotiorum in oilseed rape is associated with a sequential activation of SA signaling and JA signaling, which provide important clues for designing strategies to curb diseases caused by S. sclerotioru. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  7. Brassica napus seed endosperm - metabolism and signaling in a dead end tissue.

    Science.gov (United States)

    Lorenz, Christin; Rolletschek, Hardy; Sunderhaus, Stephanie; Braun, Hans-Peter

    2014-08-28

    Oilseeds are an important element of human nutrition and of increasing significance for the production of industrial materials. The development of the seeds is based on a coordinated interplay of the embryo and its surrounding tissue, the endosperm. This study aims to give insights into the physiological role of endosperm for seed development in the oilseed crop Brassica napus. Using protein separation by two-dimensional (2D) isoelectric focusing (IEF)/SDS polyacrylamide gel electrophoresis (PAGE) and protein identification by mass spectrometry three proteome projects were carried out: (i) establishment of an endosperm proteome reference map, (ii) proteomic characterization of endosperm development and (iii) comparison of endosperm and embryo proteomes. The endosperm proteome reference map comprises 930 distinct proteins, including enzymes involved in genetic information processing, carbohydrate metabolism, environmental information processing, energy metabolism, cellular processes and amino acid metabolism. To investigate dynamic changes in protein abundance during seed development, total soluble proteins were extracted from embryo and endosperm fractions at defined time points. Proteins involved in sugar converting and recycling processes, ascorbate metabolism, amino acid biosynthesis and redox balancing were found to be of special importance for seed development in B. napus. Implications for the seed filling process and the function of the endosperm for seed development are discussed. The endosperm is of key importance for embryo development during seed formation in plants. We present a broad study for characterizing endosperm proteins in the oilseed plant B. napus. Furthermore, a project on the biochemical interplay between the embryo and the endosperm during seed development is presented. We provide evidence that the endosperm includes a complete set of enzymes necessary for plant primary metabolism. Combination of our results with metabolome data will further

  8. Genetic Diversity Studies Based on Morphological Variability, Pathogenicity and Molecular Phylogeny of the Sclerotinia sclerotiorum Population From Indian Mustard (Brassica juncea

    Directory of Open Access Journals (Sweden)

    Pankaj Sharma

    2018-06-01

    Full Text Available White mold or stem rot disease are ubiquitously distributed throughout the world and the causal organism of this disease Sclerotinia sclerotiorum (Lib. de Bary, is known to infect over 400 plant species. Sclerotinia stem rot is one of the most devastating fungal diseases and poses a serious threat to the worldwide cultivation of oilseed Brassica including India. S. sclerotiorum pathogen usually infects the stem but in severe cases leaves and pods also affected at different developmental stages that deteriorate not only the oil quality but also causing the seed and oil yield losses up to 90% depending on the severity of the disease infestation. This study investigated the morphological and molecular characterization of pathogenic S. sclerotiorum (Lib de Bary geographical isolates from oilseed Brassica including Brassica juncea (Indian mustard. The aim of this study was to compare isolates of S. sclerotiorum originated from different agro-climatic conditions and to analyse similarity or differences between them as well as to examine the virulence of this pathogen specifically in Brassica for the first time. The collection of S. sclerotiorum isolates from symptomatic Brassica plants was done and analyzed for morphological features, and molecular characterization. The virulence evaluation test of 65 isolates on four Brassica cultivars has shown 5 of them were highly virulent, 46 were virulent and 14 were moderately virulent. Phylogenetic analysis encompassing all the morphological features, SSR polymorphism, and ITS sequencing has shown the existence of high genetic diversity among the isolates that categorized all the isolates in three evolutionary lineages in the derived dendrogram. Further, genetic variability analysis based on sequences variation in ITS region of all the isolates has shown the existence of either insertions or deletions of the nucleotides in the ITS region has led to the interspecies variability and observed the variation were

  9. Different myrosinase and idioblast distribution in Arabidopsis and Brassica napus

    DEFF Research Database (Denmark)

    Andreasson, Erik; Jørgensen, Lise Bolt; Höglund, Anna-Stina

    2001-01-01

    Arabidopsis, Brassica napus, Myrosinase, Myrosinase Binding Protein, Glucosinolates, Myrosin Cell, Immunocytochemistry......Arabidopsis, Brassica napus, Myrosinase, Myrosinase Binding Protein, Glucosinolates, Myrosin Cell, Immunocytochemistry...

  10. Remote Diagnosis of Nitrogen Status in Winter Oilseed Rape

    Science.gov (United States)

    Liu, S.

    2016-12-01

    Winter oilseed rape is one of the most important oilseed crops in the world. Compared with cereal crops, it requires high amount of nitrogen (N) supplies, but it is also characterized by low N use efficiency. The N nutrition index (NNI), defined as the ratio of the actual plant N concentration (PNC) to the critical PNC at a given biomass level, has been widely used to diagnose plant N status and to aid optimizing N fertilization. But traditional techniques to determine NNI in the lab are time-consuming and expensive. Remote sensing provides a promising approach for large-scale and rapid monitoring and diagnosis of crop N status. In this study, we conducted the experiment in the winter oilseed rape field with eight fertilization treatments in the growing season of 2014 and 2015. PNC, dry mass, and canopy spectra were measured during the different growth stages of winter oilseed rape. The N dilution curve was developed with measurements, and NNI was computed and analyzed for different treatments and different growth stage. For the same treatment, NNI decreased as more leaves were developing. Two methods were applied to remotely estimating NNI for winter oilseed rape: (1) NNI was estimated directly with vegetation indices (VIs) derived from canopy spectra; (2) the actual PNC and the critical PNC at the given biomass level were estimated separately with different types of VIs, and NNI was then computed with the two parts of the estimations. We found that VIs based solely on bands in the visible region provided the most accurate estimates of PNC. Estimating NNI directly with VIs had better performance than estimating the actual PNC and the critical PNC separately.

  11. Distance from forest edge affects bee pollinators in oilseed rape fields.

    Science.gov (United States)

    Bailey, Samantha; Requier, Fabrice; Nusillard, Benoît; Roberts, Stuart P M; Potts, Simon G; Bouget, Christophe

    2014-02-01

    Wild pollinators have been shown to enhance the pollination of Brassica napus (oilseed rape) and thus increase its market value. Several studies have previously shown that pollination services are greater in crops adjoining forest patches or other seminatural habitats than in crops completely surrounded by other crops. In this study, we investigated the specific importance of forest edges in providing potential pollinators in B. napus fields in two areas in France. Bees were caught with yellow pan traps at increasing distances from both warm and cold forest edges into B. napus fields during the blooming period. A total of 4594 individual bees, representing six families and 83 taxa, were collected. We found that both bee abundance and taxa richness were negatively affected by the distance from forest edge. However, responses varied between bee groups and edge orientations. The ITD (Inter-Tegular distance) of the species, a good proxy for bee foraging range, seems to limit how far the bees can travel from the forest edge. We found a greater abundance of cuckoo bees (Nomada spp.) of Andrena spp. and Andrena spp. males at forest edges, which we assume indicate suitable nesting sites, or at least mating sites, for some abundant Andrena species and their parasites (Fig. 1). Synthesis and Applications. This study provides one of the first examples in temperate ecosystems of how forest edges may actually act as a reservoir of potential pollinators and directly benefit agricultural crops by providing nesting or mating sites for important early spring pollinators. Policy-makers and land managers should take forest edges into account and encourage their protection in the agricultural matrix to promote wild bees and their pollination services.

  12. User Guidelines for the Brassica Database: BRAD.

    Science.gov (United States)

    Wang, Xiaobo; Cheng, Feng; Wang, Xiaowu

    2016-01-01

    The genome sequence of Brassica rapa was first released in 2011. Since then, further Brassica genomes have been sequenced or are undergoing sequencing. It is therefore necessary to develop tools that help users to mine information from genomic data efficiently. This will greatly aid scientific exploration and breeding application, especially for those with low levels of bioinformatic training. Therefore, the Brassica database (BRAD) was built to collect, integrate, illustrate, and visualize Brassica genomic datasets. BRAD provides useful searching and data mining tools, and facilitates the search of gene annotation datasets, syntenic or non-syntenic orthologs, and flanking regions of functional genomic elements. It also includes genome-analysis tools such as BLAST and GBrowse. One of the important aims of BRAD is to build a bridge between Brassica crop genomes with the genome of the model species Arabidopsis thaliana, thus transferring the bulk of A. thaliana gene study information for use with newly sequenced Brassica crops.

  13. Spectral data based vegetation indices to characterise crop growth parameters and radiation interception in brassica

    International Nuclear Information System (INIS)

    Kar, G.; Chakravarty, N.V.K.

    2001-01-01

    Four spectral data based vegetation indices viz., infra-red/red (IR/R) ratio, normalized difference (N.D.), greenness index (GNI) and brightness index (BNI) were derived to characterise leaf area index, above ground biomass production and intercepted photosynthetically active radiation in Brassica oilseed crop. It was found from correlation study among different spectral indices, plant growth parameters and radiation interception that there was strong relationship between infrared/red and normalized difference with green area index for all the three Brassica cultivars whereas these spectral were not significantly correlated with above ground biomass. On the other hand, the brightness and greenness indices were closely correlated with above groundry biomass as compared to infrared/red ratio and normalized difference. All the four spectral indices were correlated with intercepted photosynthetically active radiation (IP AR). The best fit equations relating them were derived, which can be incorporated in the algorithms of crop growth simulation model to estimate plant growth parameters and radiation interception using spectral indices

  14. Spillage of Viable Seeds of Oilseed Rape along Transportation Routes: Ecological Risk Assessment and Perspectives on Management Efforts

    Directory of Open Access Journals (Sweden)

    Kathrin Pascher

    2017-09-01

    Full Text Available Seed spillage during handling and transportation promotes establishment and invasion of feral crops into adjacent semi-natural habitats. This is also the case for oilseed rape (OSR, Brassica napus, where seed spillage may lead to establishment of herbicide resistant OSR populations in countries without cultivation of genetically modified OSR. Using data from Austria—where cultivation and import of genetically modified OSR are banned—as a prime example, we demonstrate that ports, oil mills, switchyards, and border railway stations to countries with different electric current systems—where trains have to stop—are the sites of primary concern with respect to seed spillage. Based on the results of the Austrian case study we discuss common measures to limit crop seed spillage which include intensified controls at border railway stations and the mode of seed packing during transportation. We further recommend sufficient cleaning both of goods wagons and of loading areas of trucks and ships as well as an appropriate weed management.

  15. Domesticated proboscidea parviflora: a potential oilseed crop for arid lands

    Energy Technology Data Exchange (ETDEWEB)

    Berry, J.; Bretting, P.K.; Nabhan, G.P.; Weber, C.

    1981-01-01

    Wild and domesticated Proboscidea parviflora were evaluated as oilseed crops for arid lands through chemical and biological analyses. Domesticated plants grown in the Sonoran desert bore seed containing 35-40 per cent oil and 23-27 per cent protein. Yield per hectare was estimated at 1000 kg of oil and 675 kg of protein, quantities which compare favourably with other crops. An ephemeral life cycle and certain characteristics of the fruit and seed allow this plant to grow in xeric habitats unsuitable for many other plants. Several Proboscidea species hybridize with P. parviflora and could be used in future crop breeding. Rapid germination and higher oil and protein content of seed make the domesticated P. parviflora superior to the wild form as a crop. Domesticated P. parviflora thus shows promise as an oilseed crop for the Sonoran Desert and possibly for other arid regions. (Refs. 22).

  16. Effect of cadmium on plants of oilseed rape

    International Nuclear Information System (INIS)

    Pesko, M.

    2010-01-01

    The aim of this work was to study the influence of some production parameters of hydroponically grown plants of new Czech species of oilseed rape Opponent by cadmium and determine the amount of cadmium accumulated in plant organs. Studying the effect of cadmium on plants of new Czech species of oilseed rape Opponent confirmed that application of metal reduced the length and also fresh and dry weight of plant organs, while the inhibitory effect of Cd with increasing concentration of metal in solution increased. Plant roots responded to toxic effect of Cd more responsive. As a result of Cd applications occurred a significant decrease of content of assimilation pigments (chlorophyll a, chlorophyll b, carotenoids) in plant leaves. Species of rape Opponent is a significant Cd battery, and for these plants is characterized by a high rate of translocation of this metal into the shoots.

  17. Applications of Enzymes in Oil and Oilseed Processing

    DEFF Research Database (Denmark)

    Xu, Xuebing

    Enzymes, through the last 20-30 years research and development, have been widely explored for the uses in oil and oilseed processing. Following the conventional processing technology from oilseeds, the oil can be produced through pressing or solvent extraction. The crude oil is then refined to meet...... edible requirements. The oil can be also modified to meet functional or even nutritional needs. In each of those steps, enzymes have been used in industry successfully. For the oil processing stage, enzymes have been used to destroy the cell structure so that makes the oil release easier, where...... conventionally high temperature conditioning or cooking is necessary. The good story in industry is the fish oil and olive oil processing. Good quality and higher oil yield have been achieved through the use of enzymes in the processing stages. For the refining stage, the use of enzymes for degumming has...

  18. Factors Defining Field Germination of Oilseed Radish Seeds

    Directory of Open Access Journals (Sweden)

    N.V. Dorofeev

    2013-08-01

    Full Text Available Influence of temperature, depth of crops and granulometric of soil structure on germination speed, laboratory and field germination of oilseed radish seeds were studied. It was established that the period of seed-germination is defined both by temperature and granulometric structure of soil. The highest field germination was marked on sandy loam at depth of crops' seeds at 3 cm and 20°С.

  19. Study of Pea Accessions for Development of an Oilseed Pea

    Directory of Open Access Journals (Sweden)

    Ehsan Khodapanahi

    2012-09-01

    Full Text Available Global interest in stable energy resources coupled with growing demand for bio-oils in various conventional and arising industries has renewed the importance of vegetable oil production. To address this global interest, oilseed production has been increased in recent decades by different approaches, such as extending the cultivation area of oil crops, or breeding and growing genetically modified plants. In this study, pea (Pisum sativum L. accessions were screened for lipid content using a rapid extraction method. This method quantifies lipid concentration in pea seeds and was developed by assessing and comparing the results of existing extraction methods used for canola and soybean, the top two Canadian oilseeds. Seeds of 151 field pea accessions were grown to maturity in 2009 and 2010 at McGill University (Quebec, Canada. Overall, lipid concentration in pea seeds ranged from 0.9 to 5.0%. Among several seed characteristics, only seed shape (wrinkled verses round had a significant effect on the total lipid production in the seeds. Peas are a valuable source of protein and starch, but the lipid concentration in their seeds has been undervalued. This research supports the idea of developing a novel dual-purpose oilseed pea that emulates the protein and oil production in soybean seeds while being conveniently adapted to a colder climate.

  20. Neuroanatomy and transgenic technologies

    Science.gov (United States)

    This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

  1. Nondestructive determination of nutritional information in oilseed rape leaves using visible/near infrared spectroscopy and multivariate calibrations

    NARCIS (Netherlands)

    Liu Fei, [No Value; Nie PengCheng, [No Value; Huang Min, [No Value; Kong WenWen, [No Value; He Yong, [No Value

    Nitrogen, phosphorus and potassium content are the three most important nutritional parameters for growing oilseed rape. We investigated visible and near infrared (Vis/NIR) spectroscopy combined with chemometrics for the fast and nondestructive determination of nutritional information in oilseed

  2. Overexpression of NPR1 in Brassica juncea Confers Broad Spectrum Resistance to Fungal Pathogens

    Directory of Open Access Journals (Sweden)

    Sajad Ali

    2017-10-01

    Full Text Available Brassica juncea (Indian mustard is a commercially important oil seed crop, which is highly affected by many biotic stresses. Among them, Alternaria leaf blight and powdery mildew are the most devastating diseases leading to huge yield losses in B. juncea around the world. In this regard, genetic engineering is a promising tool that may possibly allow us to enhance the B. juncea disease resistance against these pathogens. NPR1 (non-expressor of pathogen-related gene 1 is a bonafide receptor of salicylic acid (SA which modulates multiple immune responses in plants especially activation of induced and systemic acquired resistance (SAR. Here, we report the isolation and characterization of new NPR1 homolog (BjNPR1 from B. juncea. The phylogenetic tree constructed based on the deduced sequence of BjNPR1 with homologs from other species revealed that BjNPR1 grouped together with other known NPR1 proteins of Cruciferae family, and was nearest to B. napus. Furthermore, expression analysis showed that BjNPR1 was upregulated after SA treatment and fungal infection but not by jasmonic acid or abscisic acid. To understand the defensive role of this gene, we generated B. juncea transgenic lines overexpressing BjNPR1, and further confirmed by PCR and Southern blotting. The transgenic lines showed no phenotypic abnormalities, and constitutive expression of BjNPR1 activates defense signaling pathways by priming the expression of antifungal PR genes. Moreover, BjNPR1 transgenic lines showed enhanced resistance to Alternaria brassicae and Erysiphe cruciferarum as there was delay in symptoms and reduced disease severity than non-transgenic plants. In addition, the rate of disease spreading to uninfected or distal parts was also delayed in transgenic plants thus suggesting the activation of SAR. Altogether, the present study suggests that BjNPR1 is involved in broad spectrum of disease resistance against fungal pathogens.

  3. Formulations of Bacillus subtilis BY-2 suppress Sclerotinia sclerotiorum on oilseed rape in the field

    Science.gov (United States)

    We are developing a collection of Bacillus strains, isolated from different environments, for use in controlling Sclerotinia sclerotiorum on oilseed rape in China and elsewhere. Strain BY-2, isolated from internal tissues of an oilseed rape root, was demonstrated to be Bacillus subtilis based on bi...

  4. In situ ruminal crude protein degradability of by-products from cereals, oilseeds and animal origin

    NARCIS (Netherlands)

    Habib, G.; Khan, N.A.; Ali, M.; Bezabih, M.

    2013-01-01

    The aim of this study was to establish a database on in situ ruminal crude protein (CP) degradability characteristics of by-products from cereal grains, oilseeds and animal origin commonly fed to ruminants in Pakistan and South Asian Countries. The oilseed by-products were soybean meal, sunflower

  5. OILSEEDS AS A PERSPECTIVE IN THE NUTRITION ON DAIRY FARM

    Directory of Open Access Journals (Sweden)

    Ágnes Süli

    2017-11-01

    Full Text Available In the last decades many researches were made to change the milk product food’s composition. The production of better fat-compound milk and dairy products became a goal in the name of health conscious nutrition. Our researches were motivated by non-adequate milk fat’s compound. With the optimal supplement of the feed can be increased the proportion of the polyunsaturated fatty acids and can decreased the unsaturated fatty acids. The object of our experiment to study the effect of natural-based feed additives, such as oilseeds (whole linseed, extruded linseed, whole rapeseed on the fatty acid composition of milk fat. Further information was gained about of oilseeds in specific amounts to be fitted into technology of an intensive dairy farm in practice. The feed supplements were whole, untreated rapeseed and linseed and cold extruded linseed as a part of total mixed ration. The level of the processing of feed supplements affected the fatty acid composition of milk fat. The effect of full fat linseed feed supplement was more significant than that of the cold extruded linseed, in the increase of the polyunsaturated fatty acids, with special regard to the increase of the α-linolenic acid proportion. Out of the full fat oilseeds the feeding of full fat rapeseed did not result in a considerable change in the fatty acid composition of milk fat. After applying full fat linseed as feed supplement, the proportion of α-linolenic acid, a conjugated linoleic acid, an eicosadienoic acid and a docosapentaenoic acid increased in the fatty acid composition of milk fat, while the concentration of many saturated fatty acids reduced

  6. The high-quality genome of Brassica napus cultivar 'ZS11' reveals the introgression history in semi-winter morphotype.

    Science.gov (United States)

    Sun, Fengming; Fan, Guangyi; Hu, Qiong; Zhou, Yongming; Guan, Mei; Tong, Chaobo; Li, Jiana; Du, Dezhi; Qi, Cunkou; Jiang, Liangcai; Liu, Weiqing; Huang, Shunmou; Chen, Wenbin; Yu, Jingyin; Mei, Desheng; Meng, Jinling; Zeng, Peng; Shi, Jiaqin; Liu, Kede; Wang, Xi; Wang, Xinfa; Long, Yan; Liang, Xinming; Hu, Zhiyong; Huang, Guodong; Dong, Caihua; Zhang, He; Li, Jun; Zhang, Yaolei; Li, Liangwei; Shi, Chengcheng; Wang, Jiahao; Lee, Simon Ming-Yuen; Guan, Chunyun; Xu, Xun; Liu, Shengyi; Liu, Xin; Chalhoub, Boulos; Hua, Wei; Wang, Hanzhong

    2017-11-01

    Allotetraploid oilseed rape (Brassica napus L.) is an agriculturally important crop. Cultivation and breeding of B. napus by humans has resulted in numerous genetically diverse morphotypes with optimized agronomic traits and ecophysiological adaptation. To further understand the genetic basis of diversification and adaptation, we report a draft genome of an Asian semi-winter oilseed rape cultivar 'ZS11' and its comprehensive genomic comparison with the genomes of the winter-type cultivar 'Darmor-bzh' as well as two progenitors. The integrated BAC-to-BAC and whole-genome shotgun sequencing strategies were effective in the assembly of repetitive regions (especially young long terminal repeats) and resulted in a high-quality genome assembly of B. napus 'ZS11'. Within a short evolutionary period (~6700 years ago), semi-winter-type 'ZS11' and the winter-type 'Darmor-bzh' maintained highly genomic collinearity. Even so, certain genetic differences were also detected in two morphotypes. Relative to 'Darmor-bzh', both two subgenomes of 'ZS11' are closely related to its progenitors, and the 'ZS11' genome harbored several specific segmental homoeologous exchanges (HEs). Furthermore, the semi-winter-type 'ZS11' underwent potential genomic introgressions with B. rapa (A r ). Some of these genetic differences were associated with key agronomic traits. A key gene of A03.FLC3 regulating vernalization-responsive flowering time in 'ZS11' was first experienced HE, and then underwent genomic introgression event with A r , which potentially has led to genetic differences in controlling vernalization in the semi-winter types. Our observations improved our understanding of the genetic diversity of different B. napus morphotypes and the cultivation history of semi-winter oilseed rape in Asia. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  7. Components of a Rice-Oilseed Rape Production System Augmented with Trichoderma sp. Tri-1 Control Sclerotinia sclerotiorum on Oilseed Rape.

    Science.gov (United States)

    Hu, Xiaojia; Roberts, Daniel P; Xie, Lihua; Maul, Jude E; Yu, Changbing; Li, Yinshui; Zhang, Yinbo; Qin, Lu; Liao, Xing

    2015-10-01

    Sclerotinia sclerotiorum causes serious yield losses on many crops throughout the world. A multicomponent treatment that consisted of the residual rice straw remaining after rice harvest and Trichoderma sp. Tri-1 (Tri-1) formulated with the oilseed rape seedcake fertilizer was used in field soil infested with S. sclerotiorum. This treatment resulted in oilseed rape seed yield that was significantly greater than the nontreated control or when the fungicide carbendizem was used in the presence of this pathogen in field trials. Yield data suggested that the rice straw, oilseed rape seedcake, and Tri-1 components of this treatment all contributed incrementally. Similar treatment results were obtained regarding reduction in disease incidence. Slight improvements in yield and disease incidence were detected when this multicomponent treatment was combined with a fungicide spray. Inhibition of sclerotial germination by this multicomponent treatment trended greater than the nontreated control at 90, 120, and 150 days in field studies but was not significantly different from this control. This multicomponent treatment resulted in increased yield relative to the nontreated control in the absence of pathogen in a greenhouse pot study, while the straw alone and the straw plus oilseed rape seedcake treatments did not; suggesting that Tri-1 was capable of promoting growth. Experiments reported here indicate that a treatment containing components of a rice-oilseed rape production system augmented with Tri-1 can control S. sclerotiorum on oilseed rape, be used in integrated strategies containing fungicide sprays for control of this pathogen, and promote plant growth.

  8. Genetic diversity and relationships among cabbage ( Brassica ...

    African Journals Online (AJOL)

    The integration of our data with historical documents confirmed that traditional cabbage landraces cultivated in North of China were first introduced from Russia. Key words: Amplified fragment length polymorphism (AFLP), genetic diversity, cabbage (Brassica oleracea var. capitata), landraces, population structure.

  9. Quantitative Trait Loci Mapping in Brassica rapa Revealed the Structural and Functional Conservation of Genetic Loci Governing Morphological and Yield Component Traits in the A, B, and C Subgenomes of Brassica Species

    Science.gov (United States)

    Li, Xiaonan; Ramchiary, Nirala; Dhandapani, Vignesh; Choi, Su Ryun; Hur, Yoonkang; Nou, Ill-Sup; Yoon, Moo Kyoung; Lim, Yong Pyo

    2013-01-01

    Brassica rapa is an important crop species that produces vegetables, oilseed, and fodder. Although many studies reported quantitative trait loci (QTL) mapping, the genes governing most of its economically important traits are still unknown. In this study, we report QTL mapping for morphological and yield component traits in B. rapa and comparative map alignment between B. rapa, B. napus, B. juncea, and Arabidopsis thaliana to identify candidate genes and conserved QTL blocks between them. A total of 95 QTL were identified in different crucifer blocks of the B. rapa genome. Through synteny analysis with A. thaliana, B. rapa candidate genes and intronic and exonic single nucleotide polymorphisms in the parental lines were detected from whole genome resequenced data, a few of which were validated by mapping them to the QTL regions. Semi-quantitative reverse transcriptase PCR analysis showed differences in the expression levels of a few genes in parental lines. Comparative mapping identified five key major evolutionarily conserved crucifer blocks (R, J, F, E, and W) harbouring QTL for morphological and yield components traits between the A, B, and C subgenomes of B. rapa, B. juncea, and B. napus. The information of the identified candidate genes could be used for breeding B. rapa and other related Brassica species. PMID:23223793

  10. Leaf Senescence, Root Morphology, and Seed Yield of Winter Oilseed Rape (Brassica napus L. at Varying Plant Densities

    Directory of Open Access Journals (Sweden)

    Ming Li

    2017-01-01

    Full Text Available In this study, the yield and yield components were studied using a conventional variety Zhongshuang 11 (ZS 11 and a hybrid variety Zhongyouza 12 (ZYZ 12 at varying plant densities. The increase in plant density led to an initial increase in seed yield and pod numbers per unit area, followed by a decrease. The optimal plant density was 58.5 × 104 plants ha−1 in both ZS 11 and ZYZ 12. The further researches on physiological traits showed a rapid decrease in the green leaf area index (GLAI and chlorophyll content and a remarkable increase in malondialdehyde content in high plant density (HPD population than did the low plant density (LPD population, which indicated the rapid leaf senescence. However, HPD had higher values in terms of pod area index (PAI, pod photosynthesis, and radiation use efficiency (RUE after peak anthesis. A significantly higher level of dry matter accumulation and nitrogen utilization efficiency were observed, which resulted in higher yield. HPD resulted in a rapid decrease in root morphological parameters (root length, root tips, root surface area, and root volume. These results suggested that increasing the plant density within a certain range was a promising option for high seed yield in winter rapeseed in China.

  11. Preferential exclusion of hybrids in mixed pollinations between oilseed rape (Brassica napus) and weedy B. campestris (Brassicaceae)

    DEFF Research Database (Denmark)

    Hauser, T.P.; Bagger Jørgensen, Rikke; Østergård, Hanne

    1997-01-01

    amplified polymorphic DNA analysis. Using data on the proportion of fully developed seeds and the proportion of these seeds that were hybrids, a statistical model was constructed to estimate the fitness of conspecific and heterospecific pollen and the survival of conspecific and heterospecific zygotes...... for competition between male gametophytes and/or seeds within pods. To test whether competition influences the success of hybridization, pollen from the two species was mixed in different proportions and applied to stigmas of both species. The resulting seeds were scored for paternity by isozyme and randomly...... to seeds. B. campestris pollen in B. napus styles had a significantly lower fitness than the conspecific pollen, whereas no difference between pollen types was found in B. campestris styles. Hybrid zygotes survived to significantly lower proportions than conspecific zygotes in both species, with the lowest...

  12. Annual dynamics of wild bee densities: attractiveness and productivity effects of oilseed rape.

    Science.gov (United States)

    Riedinger, Verena; Mitesser, Oliver; Hovestadt, Thomas; Steffan-Dewenter, Ingolf; Holzschuh, Andrea

    2015-05-01

    Mass-flowering crops may affect long-term population dynamics, but effects on pollinators have never been studied across several years. We monitored wild bees in oilseed rape fields in 16 landscapes in Germany in two consecutive years. Effects on bee densities of landscape oilseed rape cover in the years of monitoring and in the previous years were evaluated with landscape data from three consecutive years. We fit empirical data to a mechanistic model to provide estimates for oilseed rape attractiveness and its effect on bee productivity in comparison to the rest of the landscape, and we evaluated consequences for pollinator densities in consecutive years. Our results show that high oilseed rape cover in the previous year enhances current densities of wild bees (except for bumble bees). Moreover, we show a strong attractiveness of and dilution on (i.e., decreasing bee densities with increasing landscape oilseed rape cover) oilseed rape for bees during flowering in the current year, modifying the effect of the previous year's oilseed rape cover in the case of wild bees (excluding Bombus). As long as other factors such as nesting sites or natural enemies do not limit bee reproduction, our findings suggest long-term positive effects of mass-flowering crops on bee populations, at least for non-Bombus generalists, which possibly help to maintain crop pollination services even when crop area increases. Similar effects are conceivable for other organisms providing ecosystem services in annual crops and should be considered in future studies.

  13. Origins of the amphiploid species Brassica napus L. investigated by chloroplast and nuclear molecular markers

    Directory of Open Access Journals (Sweden)

    Allender Charlotte J

    2010-03-01

    Full Text Available Abstract Background The amphiploid species Brassica napus (oilseed rape, Canola is a globally important oil crop yielding food, biofuels and industrial compounds such as lubricants and surfactants. Identification of the likely ancestors of each of the two genomes (designated A and C found in B. napus would facilitate incorporation of novel alleles from the wider Brassica genepool in oilseed rape crop genetic improvement programmes. Knowledge of the closest extant relatives of the genotypes involved in the initial formation of B. napus would also allow further investigation of the genetic factors required for the formation of a stable amphiploid and permit the more efficient creation of fully fertile re-synthesised B. napus. We have used a combination of chloroplast and nuclear genetic markers to investigate the closest extant relatives of the original maternal progenitors of B. napus. This was based on a comprehensive sampling of the relevant genepools, including 83 accessions of A genome B. rapa L. (both wild and cultivated types, 94 accessions of B. napus and 181 accessions of C genome wild and cultivated B. oleracea L. and related species. Results Three chloroplast haplotypes occurred in B. napus. The most prevalent haplotype (found in 79% of accessions was not present within the C genome accessions but was found at low frequencies in B. rapa. Chloroplast haplotypes characteristic of B. napus were found in a small number of wild and weedy B. rapa populations, and also in two accessions of cultivated B. rapa 'brocoletto'. Whilst introgression of the B. napus chloroplast type in the wild and weedy B. rapa populations has been proposed by other studies, the presence of this haplotype within the two brocoletto accessions is unexplained. Conclusions The distribution of chloroplast haplotypes eliminate any of the C genome species as being the maternal ancestor of the majority of the B. napus accessions. The presence of multiple chloroplast

  14. Mineral, vitamin C and crude protein contents in kale (Brassica ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-27

    Oct 27, 2011 ... Key words: Kale (Brassica oleracea var. acephala), harvesting stage, vitamin C, crude protein, mineral content. .... L-ascorbic acid (or vitamin C) in plant tissues. .... Cooking methods of Brassica rapa affect the preservation of.

  15. Transgenic plants: from first successes to future applications.

    Science.gov (United States)

    Van Lijsebettens, Mieke; Angenon, Geert; De Block, Marc

    2013-01-01

    This dialogue was held between the Guest Editors of the Special Issue on "Plant Transgenesis" of the Int. J. Dev. Biol. and Marc De Block. He was one of the first scientists worldwide to obtain transgenic plants transformed with the chimeric selectable marker genes encoding neomycin phosphotransferase and bialaphos that confer resistance against the antibiotic kanamycin and the herbicide Basta®/glufosinate, respectively at the Department of Genetics of Ghent University and, later on, at the spin-off company, Plant Genetic Systems. Today, these two genes are still the most frequently utilized markers in transgene technology. Marc De Block chose to work on the improvement of crops in an industrial environment to help realize the production of superior seeds or products. He was part of the team that developed the male sterility/restorer system in canola (Brassica napus var. napus) that led to the first hybrid lines to be commercialized as successful products of transgene technology. In more than 30 years of research, he developed transformation procedures for numerous crops, designed histochemical, biochemical and physiological assays to monitor plant performance, and made original and innovative contributions to plant biology. Presently, he considers transgenic research part of the toolbox for plant improvement and essential for basic plant research.

  16. Can soil microbial diversity influence plant metabolites and life history traits of a rhizophagous insect? A demonstration in oilseed rape.

    Science.gov (United States)

    Lachaise, Tom; Ourry, Morgane; Lebreton, Lionel; Guillerm-Erckelboudt, Anne-Yvonne; Linglin, Juliette; Paty, Chrystelle; Chaminade, Valérie; Marnet, Nathalie; Aubert, Julie; Poinsot, Denis; Cortesero, Anne-Marie; Mougel, Christophe

    2017-12-01

    Interactions between plants and phytophagous insects play an important part in shaping the biochemical composition of plants. Reciprocally plant metabolites can influence major life history traits in these insects and largely contribute to their fitness. Plant rhizospheric microorganisms are an important biotic factor modulating plant metabolites and adaptation to stress. While plant-insects or plant-microorganisms interactions and their consequences on the plant metabolite signature are well-documented, the impact of soil microbial communities on plant defenses against phytophagous insects remains poorly known. In this study, we used oilseed rape (Brassica napus) and the cabbage root fly (Delia radicum) as biological models to tackle this question. Even though D. radicum is a belowground herbivore as a larva, its adult life history traits depend on aboveground signals. We therefore tested whether soil microbial diversity influenced emergence rate and fitness but also fly oviposition behavior, and tried to link possible effects to modifications in leaf and root metabolites. Through a removal-recolonization experiment, 3 soil microbial modalities ("high," "medium," "low") were established and assessed through amplicon sequencing of 16S and 18S ribosomal RNA genes. The "medium" modality in the rhizosphere significantly improved insect development traits. Plant-microorganism interactions were marginally associated to modulations of root metabolites profiles, which could partly explain these results. We highlighted the potential role of plant-microbial interaction in plant defenses against Delia radicum. Rhizospheric microbial communities must be taken into account when analyzing plant defenses against herbivores, being either below or aboveground. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  17. In vitro propagation of Ethiopian mustard ( Brassica carinata A ...

    African Journals Online (AJOL)

    Brassica carinata (A. Braun) is an amphi-diploid species that originated from interspecific hybridization between Brassica nigra and Brassica oleracea in the highlands of Ethiopia. The crop has many desirable agronomic traits but with oil quality constraints like high erucic acid and glucosinolate contents. In this study, two ...

  18. Tolerence of Braccica nigra to Pieris brassicae herbivory

    NARCIS (Netherlands)

    Blatt, S.E.; Smallegange, R.C.; Hess, L.; Harvey, J.A.; Dicke, D.; van Loon, J.J.A.

    2008-01-01

    Black mustard, Brassica nigra (L.) Koch, is a wild annual species found throughout Europe and fed on by larvae of the large cabbage-white butterfly, Pieris brassicae L. We examined the impact of herbivory from P. brassicae, a gregarious herbivore, on B. nigra grown from wild seed collected locally.

  19. Oilseeds and vegetable oils in asia: a world of diversity

    Directory of Open Access Journals (Sweden)

    Mittaine Jean-François

    2016-11-01

    Full Text Available Out of the two dozen countries that constitute what is generally called “Asia”, some are the largest in the world while others are islands with smaller populations. When looking at oilseeds and vegetable oils in the region, one is faced with the same huge diversity which makes it complex to analyze, all the more that statistics are not easily available for many countries. Aside from the large differences in size, the region covers a wide spectrum of diversified climate environments. Asia is also mainly characterized by its huge population which has become largely urban, a key factor leading to the impressive growth of vegetable oil demand in the past 30 years. At an verage of 23.2 kg/year, Asian per capita consumption of oils and fats still remains slightly below the world average of 28.3 kg/capita/year. Therefore, although 53% of the world population is located in Asia, only 45% of world oils and fats is consumed in the region. As detailed in the paper, the world of Asian oilseeds and vegetable oils is highly concentrated on soybeans and palm oil. In spite of a large domestic production in China (12.3 MnT, soybeans are imported in huge quantities, mostly by China (78 MnT, 84% of the region’s imports where more than 28% of world soybeans production is being crushed. Palm oil, the second large commodity consumed in the region, is mainly produced within the region, mostly in Indonesia and Malaysia. So where is the “world of diversity”? Hidden behind those two dominant commodities, practically all of the ten oilseeds constituting the core of the world production are grown in significant quantities in the region while, for vegetable oils, all those of significant importance are produced within the region with the exception of olive oil. The main question that should be kept in mind when reviewing this large regional demand is under what condition will future vegetable oil production be able to meet the expected rise of per capita oils and

  20. BrassicaTED - a public database for utilization of miniature transposable elements in Brassica species.

    Science.gov (United States)

    Murukarthick, Jayakodi; Sampath, Perumal; Lee, Sang Choon; Choi, Beom-Soon; Senthil, Natesan; Liu, Shengyi; Yang, Tae-Jin

    2014-06-20

    MITE, TRIM and SINEs are miniature form transposable elements (mTEs) that are ubiquitous and dispersed throughout entire plant genomes. Tens of thousands of members cause insertion polymorphism at both the inter- and intra- species level. Therefore, mTEs are valuable targets and resources for development of markers that can be utilized for breeding, genetic diversity and genome evolution studies. Taking advantage of the completely sequenced genomes of Brassica rapa and B. oleracea, characterization of mTEs and building a curated database are prerequisite to extending their utilization for genomics and applied fields in Brassica crops. We have developed BrassicaTED as a unique web portal containing detailed characterization information for mTEs of Brassica species. At present, BrassicaTED has datasets for 41 mTE families, including 5894 and 6026 members from 20 MITE families, 1393 and 1639 members from 5 TRIM families, 1270 and 2364 members from 16 SINE families in B. rapa and B. oleracea, respectively. BrassicaTED offers different sections to browse structural and positional characteristics for every mTE family. In addition, we have added data on 289 MITE insertion polymorphisms from a survey of seven Brassica relatives. Genes with internal mTE insertions are shown with detailed gene annotation and microarray-based comparative gene expression data in comparison with their paralogs in the triplicated B. rapa genome. This database also includes a novel tool, K BLAST (Karyotype BLAST), for clear visualization of the locations for each member in the B. rapa and B. oleracea pseudo-genome sequences. BrassicaTED is a newly developed database of information regarding the characteristics and potential utility of mTEs including MITE, TRIM and SINEs in B. rapa and B. oleracea. The database will promote the development of desirable mTE-based markers, which can be utilized for genomics and breeding in Brassica species. BrassicaTED will be a valuable repository for scientists

  1. Broadening the genetic base of Abyssinian mustard (Brassica carinata A. Braun through introgression of genes from related allotetraploid species

    Directory of Open Access Journals (Sweden)

    Farooq A. Sheikh

    2014-07-01

    Full Text Available Brassica carinata (BBCC, 2n=34 has still to emerge as a major oilseed crop owing to poor agronomic attributes like long stature, long maturity duration and low seed yield. The restricted amount of genetic variability available in natural B. carinata necessitates utilization of new sources of variability for broadening its genetic base. Interspecific hybridization followed by selection in selfed and back cross progenies was employed to generate useful variability into B. carinata cv ˈPC5ˈ from elite lines of Brassica napus (AACC, 2n=38 and Brassica juncea (AABB, 2n=36. The morphological evaluation of 24 stable introgressed progenies revealed wide range of variability for key economic traits. The progenies with mean maturity duration of 161 ± 2.1 days, short stature of 139.5 ± 6.5 cm and seed yield per plant of 18.6 ± 2.0 g in comparison to the corresponding figures of 168 ± 4.6 days, 230.6 ± 12.7 cm and 12.0 ± 2.4 g in ˈPC5ˈ (recurrent parent were recovered. Diversity analysis at morphological level revealed that 22 out of 24 stable introgressed progenies were grouped with B. carinata ˈPC5ˈ at average taxonomic distance of 1.19. The diversity at molecular level using 25 polymorphic and reproducible RAPD primers revealed that 19 out of 21 introgressed progenies grouped with B. carinata ˈPC5ˈ at a similarity coefficient of 0.68. The clusters in general represent a wide range of genetic diversity in the back cross lines of B. carinata as a result of introgression of genes from elite lines of B. napus and B. juncea parents.

  2. A high-density SNP map for accurate mapping of seed fibre QTL in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Liezhao Liu

    Full Text Available A high density genetic linkage map for the complex allotetraploid crop species Brassica napus (oilseed rape was constructed in a late-generation recombinant inbred line (RIL population, using genome-wide single nucleotide polymorphism (SNP markers assayed by the Brassica 60 K Infinium BeadChip Array. The linkage map contains 9164 SNP markers covering 1832.9 cM. 1232 bins account for 7648 of the markers. A subset of 2795 SNP markers, with an average distance of 0.66 cM between adjacent markers, was applied for QTL mapping of seed colour and the cell wall fiber components acid detergent lignin (ADL, cellulose and hemicellulose. After phenotypic analyses across four different environments a total of 11 QTL were detected for seed colour and fiber traits. The high-density map considerably improved QTL resolution compared to the previous low-density maps. A previously identified major QTL with very high effects on seed colour and ADL was pinpointed to a narrow genome interval on chromosome A09, while a minor QTL explaining 8.1% to 14.1% of variation for ADL was detected on chromosome C05. Five and three QTL accounting for 4.7% to 21.9% and 7.3% to 16.9% of the phenotypic variation for cellulose and hemicellulose, respectively, were also detected. To our knowledge this is the first description of QTL for seed cellulose and hemicellulose in B. napus, representing interesting new targets for improving oil content. The high density SNP genetic map enables navigation from interesting B. napus QTL to Brassica genome sequences, giving useful new information for understanding the genetics of key seed quality traits in rapeseed.

  3. Ozone affects growth and development of Pieris brassicae on the wild host plant Brassica nigra

    International Nuclear Information System (INIS)

    Khaling, Eliezer; Papazian, Stefano; Poelman, Erik H.; Holopainen, Jarmo K.; Albrectsen, Benedicte R.; Blande, James D.

    2015-01-01

    When plants are exposed to ozone they exhibit changes in both primary and secondary metabolism, which may affect their interactions with herbivorous insects. Here we investigated the performance and preferences of the specialist herbivore Pieris brassicae on the wild plant Brassica nigra under elevated ozone conditions. The direct and indirect effects of ozone on the plant-herbivore system were studied. In both cases ozone exposure had a negative effect on P. brassicae development. However, in dual-choice tests larvae preferentially consumed plant material previously fumigated with the highest concentration tested, showing a lack of correlation between larval preference and performance on ozone exposed plants. Metabolomic analysis of leaf material subjected to combinations of ozone and herbivore-feeding, and focussing on known defence metabolites, indicated that P. brassicae behaviour and performance were associated with ozone-induced alterations to glucosinolate and phenolic pools. - Highlights: • We examined the effects of ozone on Pieris brassicae performance and preference. • We studied ozone and herbivore induced changes in the metabolome of Brassica nigra. • The performance of P. brassicae did not correlate with preference of ozonated plants. • Ozone and herbivore-feeding stress changes the phytochemical pools of B. nigra. - Ozone indirectly reduces herbivore performance, which is associated with change in phytochemical pools, but does not correlate with host plant preference

  4. Antioxidant Activities and Oxidative Stabilities of Some Unconventional Oilseeds.

    Science.gov (United States)

    Uluata, Sibel; Ozdemir, Nurhayat

    2012-04-01

    The oils of some unconventional oilseeds (hemp, radish, terebinth, stinging nettle, laurel) were obtained by a cold-press method in which the total oil content, fatty acids, tocopherol isomers, some metal contents (Ca, Mg, Fe, Cu), antioxidant activity and oxidative stability were determined. The total oil content was determined ranging between 30.68 and 43.12%, and the oil samples had large amounts of unsaturated fatty acids, with oleic acid and linoleic acid. Of all the oils, terebinth seed oil had the highest α-tocopherol content (102.21 ± 1.01 mg/kg oil). Laurel oilseed had the highest antiradical activity in both the DPPH and ABTS assays. The peroxide value of the non-oxidized oils ranged between 0.51 and 3.73 mequiv O(2)/kg oil. The TBARS value of the non-oxidized oils ranged between 0.68 ± 0.02 and 6.43 ± 0.48 mmol MA equiv/g oil. At 110 °C, the Rancimat induction period of the oils ranged between 1.32 and 43.44 h. The infrared spectra of the samples were recorded by FTIR spectroscopy. The absorbance values of the spectrum bands were observed and it was determined that some of the chemical groups of oxidized oils caused changes in absorbance. As a result of the present research, the analyzed oils could be evaluated as an alternative to traditionally consumed vegetable oils or as additives to them.

  5. Standardized gene nomenclature for the Brassica genus

    Directory of Open Access Journals (Sweden)

    King Graham J

    2008-05-01

    Full Text Available Abstract The genus Brassica (Brassicaceae, Brassiceae is closely related to the model plant Arabidopsis, and includes several important crop plants. Against the background of ongoing genome sequencing, and in line with efforts to standardize and simplify description of genetic entities, we propose a standard systematic gene nomenclature system for the Brassica genus. This is based upon concatenating abbreviated categories, where these are listed in descending order of significance from left to right (i.e. genus – species – genome – gene name – locus – allele. Indicative examples are provided, and the considerations and recommendations for use are discussed, including outlining the relationship with functionally well-characterized Arabidopsis orthologues. A Brassica Gene Registry has been established under the auspices of the Multinational Brassica Genome Project that will enable management of gene names within the research community, and includes provisional allocation of standard names to genes previously described in the literature or in sequence repositories. The proposed standardization of Brassica gene nomenclature has been distributed to editors of plant and genetics journals and curators of sequence repositories, so that it can be adopted universally.

  6. Unleashing the genome of Brassica rapa

    Directory of Open Access Journals (Sweden)

    Haibao eTang

    2012-07-01

    Full Text Available The completion and release of the Brassica rapa genome is of great benefit to researchers of the Brassicas, Arabidopsis, and genome evolution. While its lineage is closely related to the model organism Arabidopsis thaliana, the Brassicas experienced a whole genome triplication subsequent to their divergence. This event contemporaneously created three copies of its ancestral genome, which had diploidized through the process of homeologous gene loss known as fractionation. By the fractionation of homeologous gene content and genetic regulatory binding sites, Brassica’s genome is well placed to use comparative genomic techniques to identify syntenic regions, homeologous gene duplications, and putative regulatory sequences. Here, we use the comparative genomics platform CoGe to perform several different genomic analyses with which to study structural changes of its genome and dynamics of various genetic elements. Starting with whole genome comparisons, the Brassica paleohexaploidy is characterized, syntenic regions with Arabidopsis thaliana are identified, and the TOC1 gene in the circadian rhythm pathway from Arabidopsis thaliana is used to find duplicated orthologs in Brassica rapa. These TOC1 genes are further analyzed to identify conserved noncoding sequences that contain cis-acting regulatory elements and promoter sequences previously implicated in circadian rhythmicity. Each 'cookbook style' analysis includes a step-by-step walkthrough with links to CoGe to quickly reproduce each step of the analytical process.

  7. Presence and Distribution of Oilseed Pumpkin Viruses and Molecular Detection of Zucchini Yellow Mosaic Virus

    OpenAIRE

    Ana Vučurović; Aleksandra Bulajić; Ivana Đekić; Danijela Ristić; Janoš Berenji; Branka Krstić

    2009-01-01

    Over the past decade, intensive spread of virus infections of oilseed pumpkin has resulted in significant economic losses in pumpkin crop production, which is currently expanding in our country. In 2007 and 2008, a survey for the presence and distribution of oilseed pumpkin viruses was carried out in order to identify viruses responsible for epidemics and incidences of very destructive symptoms on cucurbit leaves and fruits. Monitoring and collecting samples of oil pumpkin, as well as other s...

  8. Gene expression profiling via LongSAGE in a non-model plant species: a case study in seeds of Brassica napus

    Directory of Open Access Journals (Sweden)

    Friedt Wolfgang

    2009-07-01

    Full Text Available Abstract Background Serial analysis of gene expression (LongSAGE was applied for gene expression profiling in seeds of oilseed rape (Brassica napus ssp. napus. The usefulness of this technique for detailed expression profiling in a non-model organism was demonstrated for the highly complex, neither fully sequenced nor annotated genome of B. napus by applying a tag-to-gene matching strategy based on Brassica ESTs and the annotated proteome of the closely related model crucifer A. thaliana. Results Transcripts from 3,094 genes were detected at two time-points of seed development, 23 days and 35 days after pollination (DAP. Differential expression showed a shift from gene expression involved in diverse developmental processes including cell proliferation and seed coat formation at 23 DAP to more focussed metabolic processes including storage protein accumulation and lipid deposition at 35 DAP. The most abundant transcripts at 23 DAP were coding for diverse protease inhibitor proteins and proteases, including cysteine proteases involved in seed coat formation and a number of lipid transfer proteins involved in embryo pattern formation. At 35 DAP, transcripts encoding napin, cruciferin and oleosin storage proteins were most abundant. Over both time-points, 18.6% of the detected genes were matched by Brassica ESTs identified by LongSAGE tags in antisense orientation. This suggests a strong involvement of antisense transcript expression in regulatory processes during B. napus seed development. Conclusion This study underlines the potential of transcript tagging approaches for gene expression profiling in Brassica crop species via EST matching to annotated A. thaliana genes. Limits of tag detection for low-abundance transcripts can today be overcome by ultra-high throughput sequencing approaches, so that tag-based gene expression profiling may soon become the method of choice for global expression profiling in non-model species.

  9. Occurrence of Xanthomonas campestris pv. campestris (Pammel, 1895) Dowson 1939, on brassicas in Montenegro

    OpenAIRE

    Radunović Dragana; Balaž Jelica

    2012-01-01

    Brassicas form the most important group of vegetable crops in Montenegro. The cabbage (Brassica oleracea var. capitata) is most commonly grown, although other brassicas, particularly kale, Brussels sprout, cauliflower and broccoli, have been increasingly produced since recently. One of the specialties of vegetable production in Montenegro is growing of collard (Brassica oleracea var. acephala), which is the simplest variety of the Brassica oleracea species ...

  10. Remote Estimation of Vegetation Fraction and Yield in Oilseed Rape with Unmanned Aerial Vehicle Data

    Science.gov (United States)

    Peng, Y.; Fang, S.; Liu, K.; Gong, Y.

    2017-12-01

    This study developed an approach for remote estimation of Vegetation Fraction (VF) and yield in oilseed rape, which is a crop species with conspicuous flowers during reproduction. Canopy reflectance in green, red, red edge and NIR bands was obtained by a camera system mounted on an unmanned aerial vehicle (UAV) when oilseed rape was in the vegetative growth and flowering stage. The relationship of several widely-used Vegetation Indices (VI) vs. VF was tested and found to be different in different phenology stages. At the same VF when oilseed rape was flowering, canopy reflectance increased in all bands, and the tested VI decreased. Therefore, two algorithms to estimate VF were calibrated respectively, one for samples during vegetative growth and the other for samples during flowering stage. During the flowering season, we also explored the potential of using canopy reflectance or VIs to estimate Flower Fraction (FF) in oilseed rape. Based on FF estimates, rape yield can be estimated using canopy reflectance data. Our model was validated in oilseed rape planted under different nitrogen fertilization applications and in different phenology stages. The results showed that it was able to predict VF and FF accurately in oilseed rape with estimation error below 6% and predict yield with estimation error below 20%.

  11. Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.

    Science.gov (United States)

    Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki

    2010-04-01

    Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did

  12. in transgenic cucumber

    African Journals Online (AJOL)

    Jane

    2011-07-18

    Jul 18, 2011 ... College of Horticulture, South China Agriculture University, Guangzhou 510642, Guangdong ... The pattern of expression vector pBI-PacPAP. ..... Disease scale ... These transgenic T0 plants were self-pollinated and the.

  13. Transgene mus som sygdomsmodeller

    DEFF Research Database (Denmark)

    Schuster, Mikkel Bruhn; Porse, Bo Torben

    2003-01-01

    Transgenic animal models have proven to be useful tools in understanding both basic biology and the events associated with disease. Recent technical advances in the area of genomic manipulation in combination with the availability of the human and murine genomic sequences now allow the precise...... tailoring of the mouse genome. In this review we describe a few systems in which transgenic animal models have been employed for the purpose of studying the etiology of human diseases. Udgivelsesdato: 2003-Feb-17...

  14. Transcriptomic basis for drought-resistance in Brassica napus L.

    Science.gov (United States)

    Wang, Pei; Yang, Cuiling; Chen, Hao; Song, Chunpeng; Zhang, Xiao; Wang, Daojie

    2017-01-01

    Based on transcriptomic data from four experimental settings with drought-resistant and drought-sensitive cultivars under drought and well-watered conditions, statistical analysis revealed three categories encompassing 169 highly differentially expressed genes (DEGs) in response to drought in Brassica napus L., including 37 drought-resistant cultivar-related genes, 35 drought-sensitive cultivar-related genes and 97 cultivar non-specific ones. We provide evidence that the identified DEGs were fairly uniformly distributed on different chromosomes and their expression patterns are variety specific. Except commonly enriched in response to various stimuli or stresses, different categories of DEGs show specific enrichment in certain biological processes or pathways, which indicated the possibility of functional differences among the three categories. Network analysis revealed relationships among the 169 DEGs, annotated biological processes and pathways. The 169 DEGs can be classified into different functional categories via preferred pathways or biological processes. Some pathways might simultaneously involve a large number of shared DEGs, and these pathways are likely to cross-talk and have overlapping biological functions. Several members of the identified DEGs fit to drought stress signal transduction pathway in Arabidopsis thaliana. Finally, quantitative real-time PCR validations confirmed the reproducibility of the RNA-seq data. These investigations are profitable for the improvement of crop varieties through transgenic engineering.

  15. Complete mitochondrial genome sequence of black mustard (Brassica nigra; BB) and comparison with Brassica oleracea (CC) and Brassica carinata (BBCC).

    Science.gov (United States)

    Yamagishi, Hiroshi; Tanaka, Yoshiyuki; Terachi, Toru

    2014-11-01

    Crop species of Brassica (Brassicaceae) consist of three monogenomic species and three amphidiploid species resulting from interspecific hybridizations among them. Until now, mitochondrial genome sequences were available for only five of these species. We sequenced the mitochondrial genome of the sixth species, Brassica nigra (nuclear genome constitution BB), and compared it with those of Brassica oleracea (CC) and Brassica carinata (BBCC). The genome was assembled into a 232 145 bp circular sequence that is slightly larger than that of B. oleracea (219 952 bp). The genome of B. nigra contained 33 protein-coding genes, 3 rRNA genes, and 17 tRNA genes. The cox2-2 gene present in B. oleracea was absent in B. nigra. Although the nucleotide sequences of 52 genes were identical between B. nigra and B. carinata, the second exon of rps3 showed differences including an insertion/deletion (indel) and nucleotide substitutions. A PCR test to detect the indel revealed intraspecific variation in rps3, and in one line of B. nigra it amplified a DNA fragment of the size expected for B. carinata. In addition, the B. carinata lines tested here produced DNA fragments of the size expected for B. nigra. The results indicate that at least two mitotypes of B. nigra were present in the maternal parents of B. carinata.

  16. Components of a rice-oilseed rape production system augmented with trichoderma sp. Tri-1 control sclerotinia sclerotiorum on oilseed rape

    Science.gov (United States)

    Sclerotinia sclerotiorum causes serious yield losses on many crops throughout the world. In two field trials conducted at the same location in consecutive years, a treatment containing formulated Trichoderma harzianum-1 (Tri-1) resulted in oilseed rape seed yield that was significantly greater than...

  17. Cloning of genes and developing transgenic crops with enhanced tolerance to salinity and drought (abstract)

    International Nuclear Information System (INIS)

    Bansal, K.C.; Chinnusamy, V.; Tayal, D.; Das, A.; Goel, D.; Yadav, V.; Singh, A.K.; Lakhshmi, K.

    2005-01-01

    Abiotic stresses represent the most limiting factors affecting agricultural productivity. In India more than 60% of total cultivated land is still rainfed and crops experience frequent droughts. Thus, we need to develop transgenic crops tolerant to drought, and other related abiotic stress factors such as salinity, low and high temperature stresses. At the National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute (ICAR), we have initiated a programme on developing transgenic crops tolerant to a range of abiotic stresses. The major emphasis is on developing transgenic potato, tomato, mustard, rice and wheat. While, transgenic plants of potato. tomato and mustard have already been generated with osmotin gene and are at different stages of testing, other key genes imparting tolerance to abiotic stresses are being isolated from different species for producing transgenic rice and wheat cultivars tolerant to multiple stresses. Genes that have been isolated in our laboratory include ascorbate peroxidase gene (TaApx) and genes encoding transcription factor, CBFs (TaCBF2 and TaCBP3) from a drought tolerant wheat cultivar (C306), Lea1 cDNA from Brassica species, codA from Arthrobacter globiformis, and otsBA operon from E. coli. Apart from these stress-related genes, we have isolated a few stress-inducible promoters for deploying them in gene stacking in developing transgenic crops with enhanced tolerance to multiple abiotic stresses. The results will be presented. (author)

  18. Carbon dioxide concentrations are very high in developing oilseeds.

    Science.gov (United States)

    Goffman, Fernando D; Ruckle, Mike; Ohlrogge, John; Shachar-Hill, Yair

    2004-09-01

    A new method has been developed to rapidly determine the total inorganic carbon concentration (gaseous [CO2] + aqueous [CO(2)] + [HCO3-] + [CO3(2)-]) in developing seeds. Seeds are rapidly dissected and homogenized in 1 N HCl in gas-tight vials. The headspace gas is then analyzed by infrared gas analysis. Developing rapeseed (Brassica napus L.) and soybean [Glycine max (L.) Merr.] seeds were analyzed and found to have up to 40 and 12 mM total inorganic carbon, respectively. These concentrations are ca. 600-2000-fold higher than in ambient air or values reported for leaves. Carbon dioxide concentrations in rapeseed peaked during the stage of maximum oil synthesis and declined as seeds matured. The consequences for seed metabolism, physiology and carbon economy are discussed.

  19. Brassica rapa L. seed development in hypergravity

    NARCIS (Netherlands)

    Musgrave, M.E.; Kuang, A.; Allen, J.; Blasiak, J.; van Loon, J.J.W.A.

    2009-01-01

    Previous experiments had shown that microgravity adversely affected seed development in Brassica rapa L. We tested the hypothesis that gravity controls seed development via modulation of gases around the developing seeds, by studying how hypergravity affects the silique microenvironment and seed

  20. Attack modes and defence reactions in pathosystems involving Sclerotinia sclerotiorum, Brassica carinata, B. juncea and B. napus.

    Science.gov (United States)

    Uloth, Margaret B; Clode, Peta L; You, Ming Pei; Barbetti, Martin J

    2016-01-01

    Sclerotinia stem rot (SSR, Sclerotinia sclerotiorum) is a damaging disease of oilseed brassicas world-wide. Host resistance is urgently needed to achieve control, yet the factors that contribute to stem resistance are not well understood. This study investigated the mechanisms of resistance to SSR. Stems of 5-week-old Brassica carinata, B. juncea and B. napus of known resistance were infected via filter paper discs impregnated with S. sclerotiorum mycelium under controlled conditions. Transverse sections of the stem and portions of the stem surface were examined using optical and scanning electron microscopy. The association of anatomical features with the severity of disease (measured by mean lesion length) was determined. Several distinct resistance mechanisms were recorded for the first time in these Brassica-pathogen interactions, including hypersensitive reactions and lignification within the stem cortex, endodermis and in tissues surrounding the lesions. Genotypes showing a strong lignification response 72 h post-infection (hpi) tended to have smaller lesions. Extensive vascular invasion by S. sclerotiorum was observed only in susceptible genotypes, especially in the vascular fibres and xylem. Mean lesion length was negatively correlated with the number of cell layers in the cortex, suggesting progress of S. sclerotiorum is impeded by more cell layers. Hyphae in the centre of lesions became highly vacuolate 72 hpi, reflecting an ageing process in S. sclerotiorum hyphal networks that was independent of host resistance. The infection process of S. sclerotiorum was analogous in B. carinata and B. napus. Infection cushions of the highly virulent isolate of S. sclerotiorum MBRS-1 were grouped together in dense parallel bundles, while hyphae in the infection cushions of a less aggressive isolate WW-3 were more diffuse, and this was unaffected by host genotype. A variety of mechanisms contribute to host resistance against S. sclerotiorum across the three

  1. Flowering Dynamics and Pollinator Visitation of Oilseed Echium (Echium plantagineum)

    Science.gov (United States)

    Eberle, Carrie A.; Forcella, Frank; Gesch, Russ; Weyers, Sharon; Peterson, Dean; Eklund, James

    2014-01-01

    Echium (Echium plantagineum L.) is an alternative oilseed crop in summer-wet temperate regions that provides floral resources to pollinators. Its seed oil is rich in omega-3 fatty acids, such as stearidonic acid, which is desired highly by the cosmetic industry. Seeds were sown in field plots over three years in western Minnesota in spring (early-sown) or early summer (late-sown), and flower abundance, pollinator visitation, and seed yields were studied. Initial flowering commenced 41 to 55 d after sowing, and anthesis duration (first flowering to harvest) was 34 to 70 d. Late sowing dates delayed anthesis, but increased the intensity of visitation by pollinators. Cumulative flower densities ranged from 1 to 4.5 billion ha−1. Flowers attracted numerous honey bees (Apis mellifera L.), as many as 35 per minute of observation, which represented about 50% of all insect visitors. Early-sown echium produced seed yields up to 750 kg ha−1, which were 2–29 times higher than those of late-sown echium. Early sowing of echium in Minnesota provides abundant floral resources for pollinators for up to two months and simultaneously produces seed yields whose profits rival those of corn (Zea mays L.). PMID:25427071

  2. Flowering dynamics and pollinator visitation of oilseed echium (Echium plantagineum.

    Directory of Open Access Journals (Sweden)

    Carrie A Eberle

    Full Text Available Echium (Echium plantagineum L. is an alternative oilseed crop in summer-wet temperate regions that provides floral resources to pollinators. Its seed oil is rich in omega-3 fatty acids, such as stearidonic acid, which is desired highly by the cosmetic industry. Seeds were sown in field plots over three years in western Minnesota in spring (early-sown or early summer (late-sown, and flower abundance, pollinator visitation, and seed yields were studied. Initial flowering commenced 41 to 55 d after sowing, and anthesis duration (first flowering to harvest was 34 to 70 d. Late sowing dates delayed anthesis, but increased the intensity of visitation by pollinators. Cumulative flower densities ranged from 1 to 4.5 billion ha-1. Flowers attracted numerous honey bees (Apis mellifera L., as many as 35 per minute of observation, which represented about 50% of all insect visitors. Early-sown echium produced seed yields up to 750 kg ha-1, which were 2-29 times higher than those of late-sown echium. Early sowing of echium in Minnesota provides abundant floral resources for pollinators for up to two months and simultaneously produces seed yields whose profits rival those of corn (Zea mays L..

  3. Antioxidant Enzyme Activities of some Brassica Species

    Directory of Open Access Journals (Sweden)

    Rodica SOARE

    2017-11-01

    Full Text Available This paper set out to comparatively study five species: white cabbage (Brassica oleracea L. var. capitata alba Alef., red cabbage (Brassica oleracea L. var. capitata f. rubra Alef., Kale (Brassica oleracea L. var. Acephala, cauliflower (Brassica oleracea var. botrytis and broccoli (Brassica oleracea var. cymosa in order to identify those with high enzymatic and antioxidant activities. The enzymatic activity of superoxide dismutase (SOD, catalase (CAT and soluble peroxidase (POX as well as the antioxidant activity against 2.2’-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid (ABTS radical cation were determined. Total superoxide dismutase activity was measured spectrophotometrically based on inhibition in the photochemical reduction of nitroblue tetrazolium. Total soluble peroxidase was assayed by measuring the increase in A436 due to the guaiacol oxidation and the catalase activity was assayed through the colorimetric method. The capacity of extracts to scavenge the ABTS radical cation was assessed colorimetric using Trolox as a standard. The obtained results show that studied enzymatic activities and the antioxidant activity against ABTS vary depending on the analyzed species. So, among the studied Brassicaceae species, it emphasize red cabbage with the highest enzymatic activity (CAT 22.54 mM H2O2/min/g and POX 187.2 mM ΔA/1min/1g f.w. and kale with highest antioxidant activity, of 767 μmol TE/100g f.w. The results of this study recommendintroducing the studied varieties in diet due to the rich antioxidant properties.

  4. You reap what you sow - or do you? volunteers in organic row-sown and broadcast-sown oilseed rape fields

    DEFF Research Database (Denmark)

    Andersen, Naja Steen; Rasmussen, Jesper; Bagger Jørgensen, Rikke

    2010-01-01

    The frequency and origin of oilseed rape volunteers in organic row and broadcast-sown oilseed rape fields was evaluated using DNA markers (ISSR) for analysis of potential volunteers in nine organic oilseed rape fields with different history. Using the software AFLPOP, the potential volunteers wer...

  5. Cadmium uptake and speciation changes in the rhizosphere of cadmium accumulator and non-accumulator oilseed rape varieties

    Institute of Scientific and Technical Information of China (English)

    SU Dechun; XING Jianping; JIAO Weiping; WONG Woonchung

    2009-01-01

    Characteristics of cadmium (Cd) uptake kinetics and distribution of Cd speciation in the rhizosphere for Cd accumulator and non-accumulator oilseed rape varieties were investigated under nutrient solution and rhizobox soil culture conditions.The results showed that the maximal influx (Vmax) for Cd2+ and Km were significantly different for the two oilseed rape varieties.The value of Vmax for Cd accumulator oilseed rape Zhucang Huazi was two-fold greater than that for oilseed rape Chuangyou II-93.The exchangeable Cd concentration in the rhizosphere was significantly lower than in non-rhizospheric soils supplemented with Cd as CdSO4 for both the varieties.Carbonate-bound Cd in the rhizosphere of Cd accumulator oilseed rape was significantly higher than that in the rhizosphere of non-accumulator oilseed rape and non-rhizospheric soil.Cd accumulator oilseed rape had a higher Cd2+ affinity and more ability to uptake insoluble Cd in the soil than the non-accumulator oilseed rape.

  6. Plasticity of seed weight compensates reductions in seed number of oilseed rape in response to shading at flowering

    NARCIS (Netherlands)

    Labra Fernandez, Marcelo; Struik, Paul C.; Evers, Jochem B.; Calderini, Daniel F.

    2017-01-01

    Understanding the response of the number of seeds and seed weight to the availability of assimilates is crucial for designing breeding strategies aimed to increase seed and oil yield in oilseed rape. This study aims to answer the questions: i) do seed number and seed weight in oilseed rape differ

  7. BraLTP1, a lipid transfer protein gene involved in epicuticular wax deposition, cell proliferation and flower development in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Fang Liu

    Full Text Available Plant non-specific lipid transfer proteins (nsLTPs constitute large multigene families that possess complex physiological functions, many of which remain unclear. This study isolated and characterized the function of a lipid transfer protein gene, BraLTP1 from Brassica rapa, in the important oilseed crops Brassica napus. BraLTP1 encodes a predicted secretory protein, in the little known VI Class of nsLTP families. Overexpression of BnaLTP1 in B. napus caused abnormal green coloration and reduced wax deposition on leaves and detailed wax analysis revealed 17-80% reduction in various major wax components, which resulted in significant water-loss relative to wild type. BnaLTP1 overexpressing leaves exhibited morphological disfiguration and abaxially curled leaf edges, and leaf cross-sections revealed cell overproliferation that was correlated to increased cytokinin levels (tZ, tZR, iP, and iPR in leaves and high expression of the cytokinin biosynthsis gene IPT3. BnaLTP1-overexpressing plants also displayed morphological disfiguration of flowers, with early-onset and elongated carpel development and outwardly curled stamen. This was consistent with altered expression of a a number of ABC model genes related to flower development. Together, these results suggest that BraLTP1 is a new nsLTP gene involved in wax production or deposition, with additional direct or indirect effects on cell division and flower development.

  8. Transgenics in Agriculture

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 2. Transgenics in Agriculture. D Rex Arunraj B Gajendra Babu. Classroom Volume 6 Issue 2 February 2001 pp 83-92. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/006/02/0083-0092 ...

  9. Optimization of an Efficient Non-Tissue Culture Transformation Method for Brassica Juncea

    International Nuclear Information System (INIS)

    Naeem, I.; Munir, I.; Iqbal, A.; Ullah, F.

    2016-01-01

    The major hurdles in successful in vitro transformation of Brassica juncea through standard tissue culture (STC) method are: culture contamination, somaclonal variations, and lack of expertise. Moreover, the current STC method is time consuming and needs continuous electricity. In the present study, the in planta transformation method through floral dip with or without vacuum infiltration was optimized for successful transformation of B. juncea. The B. juncea CV RAYA Anmol was used for transformation through Agrobacterium tumefaciens strain GV3101 harboring the binary vector plasmid pBinGlyBar4-EADcT. Based on the resistance reaction to the herbicide Basta, 20 and 40 resistant seedlings were obtained from 2000 seed germinated from the plants transformed through floral dip and vacuum infiltration methods, respectively. The PCR analyses further confirmed the presence of transgene in 3 floral dipped plants without vacuum infiltration and 17 floral dipped plants with vacuum infiltration, giving the transformation frequencies of 1.5*10/sup -3/ and 8.5*10/sup -3/, respectively. This method, which avoids tissue culture, will reduce the somaclonal variation accompanying prolonged culture of cells in a dedifferentiated state, will facilitate functional genomics and improvement of Brassica juncea with novel desirable traits while reducing time and expense. (author)

  10. Remote Estimation of Vegetation Fraction and Flower Fraction in Oilseed Rape with Unmanned Aerial Vehicle Data

    Directory of Open Access Journals (Sweden)

    Shenghui Fang

    2016-05-01

    Full Text Available This study developed an approach for remote estimation of Vegetation Fraction (VF and Flower Fraction (FF in oilseed rape, which is a crop species with conspicuous flowers during reproduction. Canopy reflectance in green, red, red edge and NIR bands was obtained by a camera system mounted on an unmanned aerial vehicle (UAV when oilseed rape was in the vegetative growth and flowering stage. The relationship of several widely-used Vegetation Indices (VI vs. VF was tested and found to be different in different phenology stages. At the same VF when oilseed rape was flowering, canopy reflectance increased in all bands, and the tested VI decreased. Therefore, two algorithms to estimate VF were calibrated respectively, one for samples during vegetative growth and the other for samples during flowering stage. The results showed that the Visible Atmospherically Resistant Index (VARIgreen worked most accurately for estimating VF in flower-free samples with an Root Mean Square Error (RMSE of 3.56%, while the Enhanced Vegetation Index (EVI2 was the best in flower-containing samples with an RMSE of 5.65%. Based on reflectance in green and NIR bands, a technique was developed to identify whether a sample contained flowers and then to choose automatically the appropriate algorithm for its VF estimation. During the flowering season, we also explored the potential of using canopy reflectance or VIs to estimate FF in oilseed rape. No significant correlation was observed between VI and FF when soil was visible in the sensor’s field of view. Reflectance at 550 nm worked well for FF estimation with coefficient of determination (R2 above 0.6. Our model was validated in oilseed rape planted under different nitrogen fertilization applications and in different phenology stages. The results showed that it was able to predict VF and FF accurately in oilseed rape with RMSE below 6%.

  11. Specifics of soil temperature under winter oilseed rape canopy

    Science.gov (United States)

    Krčmářová, Jana; Středa, Tomáš; Pokorný, Radovan

    2014-09-01

    The aim of this study was to evaluate the course of soil temperature under the winter oilseed rape canopy and to determine relationships between soil temperature, air temperature and partly soil moisture. In addition, the aim was to describe the dependence by means of regression equations usable for pests and pathogens prediction, crop development, and yields models. The measurement of soil and near the ground air temperatures was performed at the experimental field Žabiče (South Moravia, the Czech Republic). The course of temperature was determined under or in the winter oilseed rape canopy during spring growth season in the course of four years (2010 - 2012 and 2014). In all years, the standard varieties (Petrol, Sherpa) were grown, in 2014 the semi-dwarf variety PX104 was added. Automatic soil sensors were positioned at three depths (0.05, 0.10 and 0.20 m) under soil surface, air temperature sensors in 0.05 m above soil surfaces. The course of soil temperature differs significantly between standard (Sherpa and Petrol) and semi-dwarf (PX104) varieties. Results of the cross correlation analysis showed, that the best interrelationships between air and soil temperature were achieved in 2 hours delay for the soil temperature in 0.05 m, 4 hour delay for 0.10 m and 7 hour delay for 0.20 m for standard varieties. For semi-dwarf variety, this delay reached 6 hour for the soil temperature in 0.05 m, 7 hour delay for 0.10 m and 11 hour for 0.20 m. After the time correction, the determination coefficient (R2) reached values from 0.67 to 0.95 for 0.05 m, 0.50 to 0.84 for 0.10 m in variety Sherpa during all experimental years. For variety PX104 this coefficient reached values from 0.51 to 0.72 in 0.05 m depth and from 0.39 to 0.67 in 0.10 m depth in the year 2014. The determination coefficient in the 0.20 m depth was lower for both varieties; its values were from 0.15 to 0.65 in variety Sherpa. In variety PX104 the values of R2 from 0.23 to 0.57 were determined. When using

  12. How Different Genetically Manipulated Brassica Genotypes Affect Life Table Parameters of Plutella xylostella (Lepidoptera: Plutellidae).

    Science.gov (United States)

    Nikooei, Mehrnoosh; Fathipour, Yaghoub; Jalali Javaran, Mokhtar; Soufbaf, Mahmoud

    2015-04-01

    The fitness of Plutella xylostella L. on different genetically manipulated Brassica plants, including canola's progenitor (Brassica rapa L.), two cultivated canola cultivars (Opera and RGS003), one hybrid (Hyula401), one gamma-ray mutant-RGS003, and one transgenic (PF) genotype was compared using two-sex and female-based life table parameters. All experiments were conducted in a growth chamber at 25±1°C, 65±5% relative humidity, and a photoperiod of 16:8 (L:D) h. There were significant differences in duration of different life stages of P. xylostella on different plant genotypes. The shortest (13.92 d) and longest (24.61 d) total developmental time were on Opera and PF, respectively. The intrinsic rate of increase of P. xylostella ranged between 0.236 (Opera) and 0.071 day(-1) (PF). The highest (60.79 offspring) and lowest (7.88 offspring) net reproductive rates were observed on Opera and PF, respectively. Comparison of intrinsic rate of increase, net reproductive rates, finite rate of increase, mean generation time, fecundity, and survivorship of P. xylostella on the plant genotypes suggested that this pest performed well on cultivars (RGS003 and Opera) and performed poorly on the other manipulated genotypes especially on mutant-RGS003 and PF. Glucosinolate levels were significantly higher in damaged plants than undamaged ones and the lowest and highest concentrations of glucosinolates were found in transgenic genotype and canola's progenitor, respectively. Interestingly, our results showed that performance and fitness of this pest was better on canola's progenitor and cultivated plants, which had high levels of glucosinolate. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Identification and expression analysis of glucosinolate biosynthetic genes and estimation of glucosinolate contents in edible organs of Brassica oleracea subspecies.

    Science.gov (United States)

    Yi, Go-Eun; Robin, Arif Hasan Khan; Yang, Kiwoung; Park, Jong-In; Kang, Jong-Goo; Yang, Tae-Jin; Nou, Ill-Sup

    2015-07-20

    Glucosinolates are anti-carcinogenic, anti-oxidative biochemical compounds that defend plants from insect and microbial attack. Glucosinolates are abundant in all cruciferous crops, including all vegetable and oilseed Brassica species. Here, we studied the expression of glucosinolate biosynthesis genes and determined glucosinolate contents in the edible organs of a total of 12 genotypes of Brassica oleracea: three genotypes each from cabbage, kale, kohlrabi and cauliflower subspecies. Among the 81 genes analyzed by RT-PCR, 19 are transcription factor-related, two different sets of 25 genes are involved in aliphatic and indolic biosynthesis pathways and the rest are breakdown-related. The expression of glucosinolate-related genes in the stems of kohlrabi was remarkably different compared to leaves of cabbage and kale and florets of cauliflower as only eight genes out of 81 were expressed in the stem tissues of kohlrabi. In the stem tissue of kohlrabi, only one aliphatic transcription factor-related gene, Bol036286 (MYB28) and one indolic transcription factor-related gene, Bol030761 (MYB51), were expressed. The results indicated the expression of all genes is not essential for glucosinolate biosynthesis. Using HPLC analysis, a total of 16 different types of glucosinolates were identified in four subspecies, nine of them were aliphatic, four of them were indolic and one was aromatic. Cauliflower florets measured the highest number of 14 glucosinolates. Among the aliphatic glucosinolates, only gluconapin was found in the florets of cauliflower. Glucoiberverin and glucobrassicanapin contents were the highest in the stems of kohlrabi. The indolic methoxyglucobrassicin and aromatic gluconasturtiin accounted for the highest content in the florets of cauliflower. A further detailed investigation and analyses is required to discern the precise roles of each of the genes for aliphatic and indolic glucosinolate biosynthesis in the edible organs.

  14. Identification and Expression Analysis of Glucosinolate Biosynthetic Genes and Estimation of Glucosinolate Contents in Edible Organs of Brassica oleracea Subspecies

    Directory of Open Access Journals (Sweden)

    Go-Eun Yi

    2015-07-01

    Full Text Available Glucosinolates are anti-carcinogenic, anti-oxidative biochemical compounds that defend plants from insect and microbial attack. Glucosinolates are abundant in all cruciferous crops, including all vegetable and oilseed Brassica species. Here, we studied the expression of glucosinolate biosynthesis genes and determined glucosinolate contents in the edible organs of a total of 12 genotypes of Brassica oleracea: three genotypes each from cabbage, kale, kohlrabi and cauliflower subspecies. Among the 81 genes analyzed by RT-PCR, 19 are transcription factor-related, two different sets of 25 genes are involved in aliphatic and indolic biosynthesis pathways and the rest are breakdown-related. The expression of glucosinolate-related genes in the stems of kohlrabi was remarkably different compared to leaves of cabbage and kale and florets of cauliflower as only eight genes out of 81 were expressed in the stem tissues of kohlrabi. In the stem tissue of kohlrabi, only one aliphatic transcription factor-related gene, Bol036286 (MYB28 and one indolic transcription factor-related gene, Bol030761 (MYB51, were expressed. The results indicated the expression of all genes is not essential for glucosinolate biosynthesis. Using HPLC analysis, a total of 16 different types of glucosinolates were identified in four subspecies, nine of them were aliphatic, four of them were indolic and one was aromatic. Cauliflower florets measured the highest number of 14 glucosinolates. Among the aliphatic glucosinolates, only gluconapin was found in the florets of cauliflower. Glucoiberverin and glucobrassicanapin contents were the highest in the stems of kohlrabi. The indolic methoxyglucobrassicin and aromatic gluconasturtiin accounted for the highest content in the florets of cauliflower. A further detailed investigation and analyses is required to discern the precise roles of each of the genes for aliphatic and indolic glucosinolate biosynthesis in the edible organs.

  15. Construction of an integrated genetic linkage map for the A genome of Brassica napus using SSR markers derived from sequenced BACs in B. rapa

    Directory of Open Access Journals (Sweden)

    King Graham J

    2010-10-01

    Full Text Available Abstract Background The Multinational Brassica rapa Genome Sequencing Project (BrGSP has developed valuable genomic resources, including BAC libraries, BAC-end sequences, genetic and physical maps, and seed BAC sequences for Brassica rapa. An integrated linkage map between the amphidiploid B. napus and diploid B. rapa will facilitate the rapid transfer of these valuable resources from B. rapa to B. napus (Oilseed rape, Canola. Results In this study, we identified over 23,000 simple sequence repeats (SSRs from 536 sequenced BACs. 890 SSR markers (designated as BrGMS were developed and used for the construction of an integrated linkage map for the A genome in B. rapa and B. napus. Two hundred and nineteen BrGMS markers were integrated to an existing B. napus linkage map (BnaNZDH. Among these mapped BrGMS markers, 168 were only distributed on the A genome linkage groups (LGs, 18 distrubuted both on the A and C genome LGs, and 33 only distributed on the C genome LGs. Most of the A genome LGs in B. napus were collinear with the homoeologous LGs in B. rapa, although minor inversions or rearrangements occurred on A2 and A9. The mapping of these BAC-specific SSR markers enabled assignment of 161 sequenced B. rapa BACs, as well as the associated BAC contigs to the A genome LGs of B. napus. Conclusion The genetic mapping of SSR markers derived from sequenced BACs in B. rapa enabled direct links to be established between the B. napus linkage map and a B. rapa physical map, and thus the assignment of B. rapa BACs and the associated BAC contigs to the B. napus linkage map. This integrated genetic linkage map will facilitate exploitation of the B. rapa annotated genomic resources for gene tagging and map-based cloning in B. napus, and for comparative analysis of the A genome within Brassica species.

  16. Changes in soil bacterial community structure as a result of incorporation of Brassica plants compared with continuous planting eggplant and chemical disinfection in greenhouses.

    Science.gov (United States)

    Li, Tianzhu; Liu, Tongtong; Zheng, Chengyu; Kang, Chunsheng; Yang, Zichao; Yao, Xiaotong; Song, Fengbin; Zhang, Runzhi; Wang, Xuerong; Xu, Ning; Zhang, Chunyi; Li, Wei; Li, Shumin

    2017-01-01

    Greenhouse eggplant monocropping in China has contributed to the aggravation of soil-borne diseases, reductions in crop quality and yield, and the degradation of physical and chemical soil properties. Crop rotation is one effective way of alleviating the problems of continuous cropping worldwide; however, few studies have reported changes in soil bacterial community structures and physical and chemical soil properties after Brassica vegetables had been rotated with eggplant in greenhouses. In this experiment, mustard-eggplant (BFN) and oilseed rape-eggplant (BFC) rotations were studied to identify changes in the physicochemical properties and bacterial community structure in soil that was previously subject to monocropping. Samples were taken after two types of Brassica plants incorporated into soil for 15 days to compare with continually planted eggplant (control, CN) and chemical disinfection of soil (CF) in greenhouses. MiSeq pyrosequencing was used to analyze soil bacterial diversity and structure in the four different treatments. A total of 55,129 reads were identified, and rarefaction analysis showed that the soil treatments were equally sampled. The bacterial richness of the BFC treatment and the diversity of the BFN treatment were significantly higher than those of the other treatments. Further comparison showed that the bacterial community structures of BFC and BFN treatments were also different from CN and CF treatments. The relative abundance of several dominant bacterial genera in the BFC and BFN treatments (such as Flavobacteria, Stenotrophomonas, Massilia and Cellvibrio, which played different roles in improving soil fertility and advancing plant growth) was distinctly higher than the CN or CF treatments. Additionally, the total organic matter and Olsen-P content of the BFC and BFN treatments were significantly greater than the CN treatment. We conclude that Brassica vegetables-eggplant crop rotations could provide a more effective means of solving

  17. Can we stop transgenes from taking a walk on the wild side?

    Science.gov (United States)

    Dlugosch, Katrina M; Whitton, Jeannette

    2008-03-01

    Whether the potential costs associated with broad-scale use of genetically modified organisms (GMOs) outweigh possible benefits is highly contentious, including within the scientific community. Even among those generally in favour of commercialization of GM crops, there is nonetheless broad recognition that transgene escape into the wild should be minimized. But is it possible to achieve containment of engineered genetic elements in the context of large scale agricultural production? In a previous study, Warwick et al. (2003) documented transgene escape via gene flow from herbicide resistant (HR) canola (Brassica napus) into neighbouring weedy B. rapa populations (Fig. 1) in two agricultural fields in Quebec, Canada. In a follow-up study in this issue of Molecular Ecology, Warwick et al. (2008) show that the transgene has persisted and spread within the weedy population in the absence of selection for herbicide resistance. Certainly a trait like herbicide resistance is expected to spread when selected through the use of the herbicide, despite potentially negative epistatic effects on fitness. However, Warwick et al.'s findings suggest that direct selection favouring the transgene is not required for its persistence. So is there any hope of preventing transgene escape into the wild?

  18. Salt tolerance potential of brassica juncea Linn

    Energy Technology Data Exchange (ETDEWEB)

    Ibrar, M; Jabeen, M; Tabassum, J [University of Peshawar (Pakistan). Dept. of Botany; Hussain, F; Ilahi, I [University of Peshawar (Pakistan). Dept. of Pharmacy

    2003-07-01

    The present study showed that percent germination, radicle and plumule lengths of Brassica juncea were adversely affected by increasing the level of salinity. As compared to 95 per cent germination of the control, there were 92.50. 90.00. 90.00, 85.00, 87.50 and 80.00 per cent germinations respectively at 2.5, 5.0, 7.5. 10.0. 12.5 and 15.0 dSm/sup -1/ NaCI salinity levels. Similarly. all the parameters tested in the pot experiments showed gradual decline with the corresponding increasing levels of NaCl salinity. At lower levels of salinity (2.5 and 5.0 dSm/sup -l/), Brassica juncea had reasonably good growth and productivity. It showed greatly reduced growth and at 7.5 and 10.0 dSm/sup -1/ while at 12.5 and 15.0 10.0 dSm/sup -1/ salinity levels it was severely production affected. It is concluded from the present work that Brassica juncea can be grown fairly on mild saline soils for a food, fodder and seed production. (author)

  19. Salt tolerance potential of brassica juncea Linn

    International Nuclear Information System (INIS)

    Ibrar, M.; Jabeen, M.; Tabassum, J.; Hussain, F.; Ilahi, I.

    2003-01-01

    The present study showed that percent germination, radicle and plumule lengths of Brassica juncea were adversely affected by increasing the level of salinity. As compared to 95 per cent germination of the control, there were 92.50. 90.00. 90.00, 85.00, 87.50 and 80.00 per cent germinations respectively at 2.5, 5.0, 7.5. 10.0. 12.5 and 15.0 dSm/sup -1/ NaCI salinity levels. Similarly. all the parameters tested in the pot experiments showed gradual decline with the corresponding increasing levels of NaCl salinity. At lower levels of salinity (2.5 and 5.0 dSm/sup -l/), Brassica juncea had reasonably good growth and productivity. It showed greatly reduced growth and at 7.5 and 10.0 dSm/sup -1/ while at 12.5 and 15.0 10.0 dSm/sup -1/ salinity levels it was severely production affected. It is concluded from the present work that Brassica juncea can be grown fairly on mild saline soils for a food, fodder and seed production. (author)

  20. A review of mechanisms underlying anticarcinogenicity by brassica vegetables

    NARCIS (Netherlands)

    Verhoeven, D.T.H.; Verhagen, H.; Goldbohm, R.A.; Brandt, P.A. van den; Poppel, G. van

    1997-01-01

    The mechanisms by which brassica vegetables might decrease the risk of cancer are reviewed in this paper. Brassicas, including all types of cabbages, broccoli, cauliflower and Brussels sprouts, may be protective against cancer due to their relatively high glucosinolate content. Glucosinolates are

  1. Identification and evolutionary dynamics of cacta DNA transposons in brassica

    International Nuclear Information System (INIS)

    Nouroz, F.; Noreen, S.; Harrison, J.S.H.

    2017-01-01

    Transposable elements are the major drivers of genome evolution and plasticity. Due to their transposition mode, they are classified into two major classes as Retrotransposons and DNA transposons. The En/Spm or CACTA elements are diverse group of DNA transposons proliferating in plant genomes. Various bioinformatics and molecular approaches were used for identification and distribution of CACTA transposons in Brassica genome. A combination of dot plot analysis and BLASTN searches yielded 35 autonomous and 7 non-autonomous CACTA elements in Brassica. The elements ranged in sizes from 1.2 kb non-autonomous elements to 11kb autonomous elements, terminated by 3 bp Target Site Duplication (TSD) and ~15 bp conserved Terminal Inverted Repeat (TIR) motifs (5'-CACTACAAGAAAACA-3'), with heterogeneous internal regions. The transposase (TNP) was identified from autonomous CACTA elements, while other protein domains from Brassica and other plants CACTA revealed similar organizations with minor differences. Both transposases (TNPD, TNPA) are present in most CACTA, while a few CACTA harboured an additional ATHILA ORF1-like domain. The PCR analysis amplified the CACTA transposases from 40 Brassica accessions (A, B, and C-genome) suggesting their distribution among various Brassica crops. A detailed characterization and evolutionary analysis of the identified CACTA elements allowed some to be placed in genome-specific groups, while most of them (Brassica-Arabidopsis elements) have followed the same evolutionary line. The distribution of CACTA in Brassica concluded that 3 bp TSDs generating CACTA transposons contributed significantly to genome size and evolution of Brassica genome. (author)

  2. Epidemiological studies on Brassica vegetables and cancer risk

    NARCIS (Netherlands)

    Verhoeven, D.T.H.; Goldbohm, R.A.; Poppel, G. van; Verhagen, H.; Brandt, P.A. van den

    1996-01-01

    This paper gives an overview of the epidemiological data concerning the cancer-preventive effect of brassica vegetables, including cabbage, kale, broccoli, Brussels sprouts, and cauliflower. The protective effect of brassicas against cancer may be due to their relatively high content of

  3. Brassica oleracea: the dog of the plant world

    Science.gov (United States)

    The horticultural crop Brassica oleracea L. plays an important role in global food systems. Brassica oleracea is unique in that it has been domesticated into several morphotypes (cultivars), including broccoli, Brussels sprout, cabbage, cauliflower, kale, kohlrabi, and several lesser well known morp...

  4. Brassica oleracea; The dog of the plant world

    Science.gov (United States)

    The horticultural crop Brassica oleracea L. plays an important role in global food systems. Brassica oleracea is unique in that it has been domesticated into several morphotypes (cultivars), including broccoli, Brussels sprout, cabbage, cauliflower, kale, kohlrabi, and several lesser well known morp...

  5. Improvement of oil-seed and industrial crops by induced mutations

    International Nuclear Information System (INIS)

    1982-01-01

    Out of 22 papers presented, seven dealing with the genetic improvement of crops using ionizing radiations, fall within the INIS subject scope. Other topics covered were oil-seed quality requirements for industrial processing and concepts of improving biomass production from higher plants

  6. Oilseed rape in energetic circle; Uljana repica u energetsko proizvodnom krugu

    Energy Technology Data Exchange (ETDEWEB)

    Pliestic, S; Kricka, T [Agronomski fakultet, Zavod za poljoprivrednu tehnologiju, skladistenje i transport, Zagreb (Croatia)

    1997-12-31

    The usage of methyl-ester (biofuel) on the basis of oilseed rape in some countries of West Europe is investigated as energy source, and a few years ago was in experimental application. Oilseed rape is one of the major oilseed crops intended for the production of methyl-ester, especially for internal combustion engines. But, except for primary methyl-ester, secondary produces are: 1. Oil cakes or crushed oil seeds - usage value is enormous, especially if it is used as a feed for all livestock categories. 2. Oilseed rape hay -its use as a means of energy source is gaining in importance. 3. Remains of the plant are used for activating the soil fauna and improving the whole soil structure. New `00` cultivars have high - quality oil and improved meal quality; also, then have reduced amount of glucosinolates - below 5 mmol/g, and ERUCA acid, which enabled their use as feed in serve quantity. (author). 5 tabs., 2 figs., 7 refs.

  7. Effect of unconventional oilseeds (safflower, poppy, hemp, camelina) on in vitro ruminal methane production and fermentation.

    Science.gov (United States)

    Wang, Shaopu; Kreuzer, Michael; Braun, Ueli; Schwarm, Angela

    2017-08-01

    Dietary supplementation with oilseeds can reduce methane emission in ruminants, but only a few common seeds have been tested so far. This study tested safflower (Carthamus tinctorius), poppy (Papaver somniferum), hemp (Cannabis sativa), and camelina (Camelina sativa) seeds in vitro using coconut (Cocos nucifera) oil and linseed (Linum usitatissimum) as positive controls. All the tested oilseeds suppressed methane yield (mL g -1 dry matter, up to 21%) compared to the non-supplemented control when provided at 70 g oil kg -1 dry matter, and they were as effective as coconut oil. Safflower and hemp were more effective than linseed (21% and 18% vs. 10%), whereas the effects of poppy and camelina were similar to linseed. When methane was related to digestible organic matter, only hemp and safflower seeds and coconut oil were effective compared to the non-supplemented control (up to 11%). The level of methanogenesis and the ratios of either the n-6:n-3 fatty acids or C 18 :2 :C 18 :3 in the seed lipids were not related. Unconventional oilseeds widen the spectrum of oilseeds that can be used in dietary methane mitigation. In vivo confirmation of their methane mitigating effect is still needed, and their effects on animal performance still must be determined. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  8. Biowaste-derived hydrolysates as plant disease suppressants for oilseed rape

    Czech Academy of Sciences Publication Activity Database

    Jindřichová, Barbora; Burketová, Lenka; Montoneri, E.; Francavilla, M.

    2018-01-01

    Roč. 183, MAY 10 (2018), s. 335-342 ISSN 0959-6526 R&D Projects: GA MŠk(CZ) LD14056 Institutional support: RVO:61389030 Keywords : Biogas digestate * Compost * Induced resistance * Leptosphaeria maculans * Oilseed rape Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection OBOR OECD: Plant sciences, botany Impact factor: 5.715, year: 2016

  9. Oilseed Radish (Raphanus Sativus) Effects on Soil Structure and Soil Water Relations

    Science.gov (United States)

    Oilseed radish (Raphanus sativus spp. oleifera) reduces nematode populations. Fall-incorporated radish biomass may also improve soil physical and hydraulic properties to increase the yield and quality of subsequently grown sugarbeet (Beta vulgaris L.). This field study determined radish effects on...

  10. Gas assisted mechanical expression of cocoa butter from cocoa nibs and edible oils from oilseeds

    NARCIS (Netherlands)

    Venter, M.J.; Willems, P.; Kuipers, N.J.M.; Haan, de A.B.

    2006-01-01

    The current methods used to recover high quality oil from oilseeds have low yields (mechanical expression, aqueous extraction), require the use of toxic chemicals and rigorous purification processes that can reduce the quality of the oil (solvent extraction with hexane) or are unsuitable for the

  11. Feasibility of cuphea as a new oilseed crop to climate and soil environments

    Science.gov (United States)

    Cuphea, a new oilseed crop rich in medium-chain fatty acids (C8:0 to C14:0), may serve as a renewable, biodegradable source of oil for lubricants, motor oil, and aircraft fuel. Impacts of climate and soil environment on cuphea growth and development are not well understood. The objective of this stu...

  12. Investigation into the prospects of five novel oilseed crops within Europe

    NARCIS (Netherlands)

    Marvin, H.J.P.; Mastebroek, H.D.; Becu, D.M.S.; Janssens, R.J.J.

    2000-01-01

    The economic potential in Europe of five novel oilseed crops for applications within the chemical industry, particularly in paints and lubricants, was investigated within a multidisciplinary integrated research and development project. The entire production chain was subjected to a study. The

  13. Effect of Enzymatic Hydrolysis on the Antioxidant Properties of Alcoholic Extracts of Oilseed Cakes

    Directory of Open Access Journals (Sweden)

    Jacek Arct

    2013-01-01

    Full Text Available The aim of the present study is to compare changes in the total phenolic, flavonoid and reducing sugar content and antioxidant activity of alcoholic extracts of Oenothera biennis, Borago officinalis and Nigella sativa oilseed cakes before and after enzymatic hydrolysis. Extraction with ethanol and hydrolysis with different commercially available glycosidases: α-amylase, β-glucosidase, β-glucanase and their combinations in a ratio of 1:1:1 were investigated. Total phenolic, flavonoid and reducing sugar content, iron-chelating activity and antioxidant activity according to DPPH and ABTS tests were measured in non-hydrolysed extracts and compared with the results obtained for the extracts after the application of immobilised enzymes. As a result, the hydrolysed extracts had a higher phenolic and reducing sugar content as well as higher iron-chelating and antioxidant activities. Total phenolic content of Oenothera biennis, Borago officinalis and Nigella sativa oilseed cake extracts after enzymatic hydrolysis was higher in comparison with non-hydrolysed extracts, i.e. 2 times (for the enzyme combination, and 1.5 and 2 times (for β-glucanase (p<0.05, respectively. The best results in increasing the flavonoid and sugar content as well as in iron-chelating activity were obtained after enzymatic hydrolysis of oilseed cake extracts by β-glucanase. Oilseed cake extracts after hydrolysis with an enzyme combination in a ratio of 1:1:1 had the highest increase in antioxidant activity.

  14. Different waves of effector genes with contrasted genomic location are expressed by Leptosphaeria maculans during cotyledon and stem colonization of oilseed rape.

    Science.gov (United States)

    Gervais, Julie; Plissonneau, Clémence; Linglin, Juliette; Meyer, Michel; Labadie, Karine; Cruaud, Corinne; Fudal, Isabelle; Rouxel, Thierry; Balesdent, Marie-Hélène

    2017-10-01

    Leptosphaeria maculans, the causal agent of stem canker disease, colonizes oilseed rape (Brassica napus) in two stages: a short and early colonization stage corresponding to cotyledon or leaf colonization, and a late colonization stage during which the fungus colonizes systemically and symptomlessly the plant during several months before stem canker appears. To date, the determinants of the late colonization stage are poorly understood; L. maculans may either successfully escape plant defences, leading to stem canker development, or the plant may develop an 'adult-stage' resistance reducing canker incidence. To obtain an insight into these determinants, we performed an RNA-sequencing (RNA-seq) pilot project comparing fungal gene expression in infected cotyledons and in symptomless or necrotic stems. Despite the low fraction of fungal material in infected stems, sufficient fungal transcripts were detected and a large number of fungal genes were expressed, thus validating the feasibility of the approach. Our analysis showed that all avirulence genes previously identified are under-expressed during stem colonization compared with cotyledon colonization. A validation RNA-seq experiment was then performed to investigate the expression of candidate effector genes during systemic colonization. Three hundred and seven 'late' effector candidates, under-expressed in the early colonization stage and over-expressed in the infected stems, were identified. Finally, our analysis revealed a link between the regulation of expression of effectors and their genomic location: the 'late' effector candidates, putatively involved in systemic colonization, are located in gene-rich genomic regions, whereas the 'early' effector genes, over-expressed in the early colonization stage, are located in gene-poor regions of the genome. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  15. Unraveling the genetic basis of seed tocopherol content and composition in rapeseed (Brassica napus L.).

    Science.gov (United States)

    Wang, Xingxing; Zhang, Chunyu; Li, Lingjuan; Fritsche, Steffi; Endrigkeit, Jessica; Zhang, Wenying; Long, Yan; Jung, Christian; Meng, Jinling

    2012-01-01

    Tocopherols are important antioxidants in vegetable oils; when present as vitamin E, tocopherols are an essential nutrient for humans and livestock. Rapeseed (Brassica napus L, AACC, 2 n = 38) is one of the most important oil crops and a major source of tocopherols. Although the tocopherol biosynthetic pathway has been well elucidated in the model photosynthetic organisms Arabidopsis thaliana and Synechocystis sp. PCC6803, knowledge about the genetic basis of tocopherol biosynthesis in seeds of rapeseed is scant. This project was carried out to dissect the genetic basis of seed tocopherol content and composition in rapeseed through quantitative trait loci (QTL) detection, genome-wide association analysis, and homologous gene mapping. We used a segregating Tapidor × Ningyou7 doubled haploid (TNDH) population, its reconstructed F(2) (RC-F(2)) population, and a panel of 142 rapeseed accessions (association panel). Genetic effects mainly contributed to phenotypic variations in tocopherol content and composition; environmental effects were also identified. Thirty-three unique QTL were detected for tocopherol content and composition in TNDH and RC-F(2) populations. Of these, seven QTL co-localized with candidate sequences associated with tocopherol biosynthesis through in silico and linkage mapping. Several near-isogenic lines carrying introgressions from the parent with higher tocopherol content showed highly increased tocopherol content compared with the recurrent parent. Genome-wide association analysis was performed with 142 B. napus accessions. Sixty-one loci were significantly associated with tocopherol content and composition, 11 of which were localized within the confidence intervals of tocopherol QTL. This joint QTL, candidate gene, and association mapping study sheds light on the genetic basis of seed tocopherol biosynthesis in rapeseed. The sequences presented here may be used for marker-assisted selection of oilseed rape lines with superior tocopherol

  16. SAXS and other spectroscopic analysis of 12S cruciferin isolated from the seeds of Brassica nigra

    Science.gov (United States)

    Khaliq, Binish; Falke, Sven; Negm, Amr; Buck, Friedrich; Munawar, Aisha; Saqib, Maria; Mahmood, Seema; Ahmad, Malik Shoaib; Betzel, Christian; Akrem, Ahmed

    2017-06-01

    Oilseeds of the plant family Brassicaceae are important for providing both lipid and protein contents to human nutrition. Cruciferins (12S globulins) are seed storage proteins, which are getting attention due to their allergenic and pathogenicity related nature. This study describes the purification and characterization of a trimeric (∼190 kDa) cruciferin protein from the seeds of Brassica nigra (L.). Cruciferin was first partially purified by ammonium sulfate precipitation (30% saturation constant) and further purified by size exclusion chromatography. The N-terminal amino-acid sequence analysis showed 82% sequence homology with cruciferin from Arabidopsis thaliana. The 50-55 kDa monomeric cruciferin produced multiple bands of two major molecular weight ranges (α-polypeptides of 28-32 kDa and β-polypeptides of 17-20 kDa) under reduced conditions of SDS-PAGE. The 2D gel electrophoretic analysis showed the further separation of the bands into their isoforms with major pI ranges between 5.7 and 8.0 (α-polypeptides) and 5.5-8.5 (β-polypeptides). The Dynamic Light Scattering (DLS) showed the monodisperse nature of the cruciferin with hydrodynamic radius of 5.8 ± 0.1 nm confirming the trimeric nature of the protein. The Circular Dichroism (CD) spectra showed both α-helices and β-sheets in the native conformation of the trimeric protein. The pure cruciferin protein (40 mg/ml) was successfully crystallized; however, the crystals diffracted only to low resolution data (8 Å). Small-angle x-ray scattering (SAXS) was applied to gain insights into the three-dimensional structure in solution. SAXS showed that the radius of gyration is 4.24 ± 0.25 nm and confirmed the nearly globular shape. The SAXS based ab initio dummy model of B. nigra cruciferin was compared with 11S globulins.

  17. Fatty Acid and Transcript Profiling in Developing Seeds of Three Brassica napus Cultivars

    Directory of Open Access Journals (Sweden)

    Petkova Mariana

    2015-12-01

    Full Text Available Fatty acid levels and gene expression profiles for selected genes associated with the synthesis of fatty acids (FA, triacylglycerol, and oil body proteins were examined in three oilseed rape (Brassica napus cultivars that have utility for cultivar development in our spring canola breeding program. The seed oil content of Bronowski, Q2, and Westar was 39.0, 40.1, and 40.6%, respectively at 40 days after flowering (DAF. During the 20 to 40 day period of seed development, cultivars had varying levels of palmitic, stearic, oleic, linoleic, α-linolenic, eicosenoic, and erucic acid. In general, the percentage of each FA was similar among the cultivars during seed development. However, the level of oleic acid was lower and the levels of eicosenoic acid and erucic acid were higher in Bronowski than in Q2 and Westar seeds; linoleic acid also tended to be lower in Bronowski. Gene expression among the cultivars was similar from 10 to 40 DAF. The few exceptions were that expression of KAS1 and SAD were higher in Westar and Q2 than in Bronowski at 25 DAF, SAD was highest in Q2, intermediate in Westar, and lowest in Bronowski at 35 DAF, FAD2 was higher in Q2 than in Bronowski at 35 DAF, FAD3 was higher in Q2 than in Bronowski at 15 DAF and Q2 and Westar at 25 and 30 DAF, and FAE1 was higher in Westar and Q2 than in Bronowski at 30 DAF. Correlation analysis for gene expression against DAF for each genotype supported a common trend in gene expression among the three cultivars with gene expression tending to decrease over time; except for LPAAT, which tended to increase. The correlation between the level of FAs and expression of genes by genotype indicated no general trend; rather correlations seem to depend on the genotype.

  18. Unraveling the genetic basis of seed tocopherol content and composition in rapeseed (Brassica napus L..

    Directory of Open Access Journals (Sweden)

    Xingxing Wang

    Full Text Available BACKGROUND: Tocopherols are important antioxidants in vegetable oils; when present as vitamin E, tocopherols are an essential nutrient for humans and livestock. Rapeseed (Brassica napus L, AACC, 2 n = 38 is one of the most important oil crops and a major source of tocopherols. Although the tocopherol biosynthetic pathway has been well elucidated in the model photosynthetic organisms Arabidopsis thaliana and Synechocystis sp. PCC6803, knowledge about the genetic basis of tocopherol biosynthesis in seeds of rapeseed is scant. This project was carried out to dissect the genetic basis of seed tocopherol content and composition in rapeseed through quantitative trait loci (QTL detection, genome-wide association analysis, and homologous gene mapping. METHODOLOGY/PRINCIPAL FINDINGS: We used a segregating Tapidor × Ningyou7 doubled haploid (TNDH population, its reconstructed F(2 (RC-F(2 population, and a panel of 142 rapeseed accessions (association panel. Genetic effects mainly contributed to phenotypic variations in tocopherol content and composition; environmental effects were also identified. Thirty-three unique QTL were detected for tocopherol content and composition in TNDH and RC-F(2 populations. Of these, seven QTL co-localized with candidate sequences associated with tocopherol biosynthesis through in silico and linkage mapping. Several near-isogenic lines carrying introgressions from the parent with higher tocopherol content showed highly increased tocopherol content compared with the recurrent parent. Genome-wide association analysis was performed with 142 B. napus accessions. Sixty-one loci were significantly associated with tocopherol content and composition, 11 of which were localized within the confidence intervals of tocopherol QTL. CONCLUSIONS/SIGNIFICANCE: This joint QTL, candidate gene, and association mapping study sheds light on the genetic basis of seed tocopherol biosynthesis in rapeseed. The sequences presented here may be used

  19. Radio-sensitivity analysis and selection of useful mutants of rape (Brassica napus L.) by gamma irradiation

    International Nuclear Information System (INIS)

    Goh, Eun Jeong; Kim, Wook Jin; Kim, Jin Baek; Kim, Dong Sub; Kim, Sang Hoon; Kang, Si Yong

    2010-01-01

    Rape (Brassica napus L.) plants are one of the major oilseed crops. The main components of rapeseed are oil (35 to 47%) and protein (15 to 32%). For the biodiesel production, the development of a new variety of rape plant with high biomass and/or oleic acid contents is required. In order to determine the optimum dose of gamma-ray irradiation, the rape seeds of cvs. Hanra (Hr), Youngsan (Ys), Tammi (Tm), and Tamra (Tr) were irradiated with a 100 ∼ 4,000 Gy dose range of gamma-rays. Considering the growth factors, the optimum doses were determined to be within the range of 600 ∼ 1,000 Gy for the selection of useful mutant lines. Six-hundred and eighty eight (688) M 2 mutant lines were obtained from 600 ∼ 1,000 Gy gamma-ray-irradiated M 1 plants through selfing. The growth characteristics, leaf shape, early flowering, and flower color were all investigated. The selected mutant numbers of early flowering, leaf shape, and flower color were 34, 52, and 3 from the four cultivars, respectively. These mutant lines will be used for the development of a new variety of rape plant with high biomass and oleic acid contents

  20. Overexpression of Three Glucosinolate Biosynthesis Genes in Brassica napus Identifies Enhanced Resistance to Sclerotinia sclerotiorum and Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Yuanyuan Zhang

    Full Text Available Sclerotinia sclerotiorum and Botrytis cinerea are notorious plant pathogenic fungi with an extensive host range including Brassica crops. Glucosinolates (GSLs are an important group of secondary metabolites characteristic of the Brassicales order, whose degradation products are proving to be increasingly important in plant protection. Enhancing the defense effect of GSL and their associated degradation products is an attractive strategy to strengthen the resistance of plants by transgenic approaches. We generated the lines of Brassica napus with three biosynthesis genes involved in GSL metabolic pathway (BnMAM1, BnCYP83A1 and BnUGT74B1, respectively. We then measured the foliar GSLs of each transgenic lines and inoculated them with S. sclerotiorum and B. cinerea. Compared with the wild type control, over-expressing BnUGT74B1 in B. napus increased the aliphatic and indolic GSL levels by 1.7 and 1.5 folds in leaves respectively; while over-expressing BnMAM1 or BnCYP83A1 resulted in an approximate 1.5-fold higher only in the aliphatic GSL level in leaves. The results of plant inoculation demonstrated that BnUGT74B1-overexpressing lines showed less severe disease symptoms and tissue damage compared with the wild type control, but BnMAM1 or BnCYP83A1-overexpressing lines showed no significant difference in comparison to the controls. These results suggest that the resistance to S. sclerotiorum and B. cinerea in B. napus could be enhanced through tailoring the GSL profiles by transgenic approaches or molecular breeding, which provides useful information to assist plant breeders to design improved breeding strategies.

  1. Transgenic algae engineered for higher performance

    Science.gov (United States)

    Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

    2014-10-21

    The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

  2. Cluster Analysis in Rapeseed (Brassica Napus L.)

    International Nuclear Information System (INIS)

    Mahasi, J.M

    2002-01-01

    With widening edible deficit, Kenya has become increasingly dependent on imported edible oils. Many oilseed crops (e.g. sunflower, soya beans, rapeseed/mustard, sesame, groundnuts etc) can be grown in Kenya. But oilseed rape is preferred because it very high yielding (1.5 tons-4.0 tons/ha) with oil content of 42-46%. Other uses include fitting in various cropping systems as; relay/inter crops, rotational crops, trap crops and fodder. It is soft seeded hence oil extraction is relatively easy. The meal is high in protein and very useful in livestock supplementation. Rapeseed can be straight combined using adjusted wheat combines. The priority is to expand domestic oilseed production, hence the need to introduce improved rapeseed germplasm from other countries. The success of any crop improvement programme depends on the extent of genetic diversity in the material. Hence, it is essential to understand the adaptation of introduced genotypes and the similarities if any among them. Evaluation trials were carried out on 17 rapeseed genotypes (nine Canadian origin and eight of European origin) grown at 4 locations namely Endebess, Njoro, Timau and Mau Narok in three years (1992, 1993 and 1994). Results for 1993 were discarded due to severe drought. An analysis of variance was carried out only on seed yields and the treatments were found to be significantly different. Cluster analysis was then carried out on mean seed yields and based on this analysis; only one major group exists within the material. In 1992, varieties 2,3,8 and 9 didn't fall in the same cluster as the rest. Variety 8 was the only one not classified with the rest of the Canadian varieties. Three European varieties (2,3 and 9) were however not classified with the others. In 1994, varieties 10 and 6 didn't fall in the major cluster. Of these two, variety 10 is of Canadian origin. Varieties were more similar in 1994 than 1992 due to favorable weather. It is evident that, genotypes from different geographical

  3. Plant biotechnology: transgenic crops.

    Science.gov (United States)

    Shewry, Peter R; Jones, Huw D; Halford, Nigel G

    2008-01-01

    Transgenesis is an important adjunct to classical plant breeding, in that it allows the targeted manipulation of specific characters using genes from a range of sources. The current status of crop transformation is reviewed, including methods of gene transfer, the selection of transformed plants and control of transgene expression. The application of genetic modification technology to specific traits is then discussed, including input traits relating to crop production (herbicide tolerance and resistance to insects, pathogens and abiotic stresses) and output traits relating to the composition and quality of the harvested organs. The latter include improving the nutritional quality for consumers as well as the improvement of functional properties for food processing.

  4. A Phylogenetic Analysis of Chloroplast Genomes Elucidates the Relationships of the Six Economically Important Brassica Species Comprising the Triangle of U

    NARCIS (Netherlands)

    Li, Peirong; Zhang, Shujiang; Li, Fei; Zhang, Shifan; Zhang, Hui; Wang, Xiaowu; Sun, Rifei; Bonnema, Guusje; Borm, Theo J.A.

    2017-01-01

    The Brassica genus comprises many economically important worldwide cultivated crops. The well-established model of the Brassica genus, U’s triangle, consists of three basic diploid plant species (Brassica rapa, Brassica oleracea, and Brassica nigra) and three amphidiploid species (Brassica napus,

  5. [TSA improve transgenic porcine cloned embryo development and transgene expression].

    Science.gov (United States)

    Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

    2011-07-01

    Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

  6. Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

    Science.gov (United States)

    Rao, Suryadevara S; Hildebrand, David

    2009-10-01

    The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

  7. Transcriptome analysis of Brassica juncea var. tumida Tsen responses to Plasmodiophora brassicae primed by the biocontrol strain Zhihengliuella aestuarii.

    Science.gov (United States)

    Luo, Yuanli; Dong, Daiwen; Su, Yu; Wang, Xuyi; Peng, Yumei; Peng, Jiang; Zhou, Changyong

    2018-05-01

    Mustard clubroot, caused by Plasmodiophora brassicae, is a serious disease that affects Brassica juncea var. tumida Tsen, a mustard plant that is the raw material for a traditional fermented food manufactured in Chongqing, China. In our laboratory, we screened the antagonistic bacteria Zhihengliuella aestuarii against P. brassicae. To better understand the biocontrol mechanism, three transcriptome analyses of B. juncea var. tumida Tsen were conducted using Illumina HiSeq 4000, one from B. juncea only inoculated with P. brassicae (P), one inoculated with P. brassica and the biocontrol agent Z. aestuarii at the same time (P + B), and the other was the control (H), in which P. brassicae was replaced by sterile water. A total of 19.94 Gb was generated by Illumina HiSeq sequencing. The sequence data were de novo assembled, and 107,617 unigenes were obtained. In total, 5629 differentially expressed genes between biocontrol-treated (P + B) and infected (P) samples were assigned to 126 KEGG pathways. Using multiple testing corrections, 20 pathways were significantly enriched with Qvalue ≤ 0.05. The resistance-related genes, involved in the production of pathogenesis-related proteins, pathogen-associated molecular pattern-triggered immunity, and effector-triggered immunity signaling pathways, calcium influx, salicylic acid pathway, reactive oxygen intermediates, and mitogen-activated protein kinase cascades, and cell wall modification, were obtained. The various defense responses induced by the biocontrol strain combatted the P. brassicae infection. The genes and pathways involved in plant resistance were induced by a biocontrol strain. The transcriptome data explained the molecular mechanism of the potential biocontrol strain against P. brassicae. The data will also serve as an important public information platform to study B. juncea var. tumida Tsen and will be useful for breeding mustard plants resistant to P. brassicae.

  8. The variability of processes involved in transgene dispersal - case studies from Brassica and related genera

    DEFF Research Database (Denmark)

    Bagger Jørgensen, Rikke; Hauser, Thure Pavlo; D'Hertefeldt, T.

    2009-01-01

    Background, aim, and scope We strive to predict consequences of genetically modified plants (GMPs) being cultivated openly in the environment, as human and animal health, biodiversity, agricultural practise and farmers’ economy could be affected. Therefore, it is unfortunate that the risk assessm...

  9. TL transgenic mouse strains

    International Nuclear Information System (INIS)

    Obata, Y.; Matsudaira, Y.; Hasegawa, H.; Tamaki, H.; Takahashi, T.; Morita, A.; Kasai, K.

    1993-01-01

    As a result of abnormal development of the thymus of these mice, TCR αβ lineage of the T cell differentiation is disturbed and cells belonging to the TCR γδ CD4 - CD8 - double negative (DN) lineage become preponderant. The γδ DN cells migrate into peripheral lymphoid organs and constitute nearly 50% of peripheral T cells. Immune function of the transgenic mice is severely impaired, indicating that the γδ cells are incapable of participating in these reactions. Molecular and serological analyses of T-cell lymphomas reveal that they belong to the γδ lineage. Tg.Tla a -3-1 mice should be useful in defining the role of TL in normal and abnormal T cell differentiation as well as in the development of T-cell lymphomas, and further they should facilitate studies on the differentiation and function of γδ T cells. We isolated T3 b -TL gene from B6 mice and constructed a chimeric gene in which T3 b -TL is driven by the promoter of H-2K b . With the chimeric gene, two transgenic mouse strains, Tg. Con.3-1 and -2 have been derived in C3H background. Both strains express TL antigen in various tissues including skin. The skin graft of transgenic mice on C3H and (B6 X C3H)F 1 mice were rejected. In the mice which rejected the grafts, CD8 + TCRαβ cytotoxic T cells (CTL) against TL antigens were recognized. The recognition of TL by CTL did not require the antigen presentation by H-2 molecules. The results indicated that TL antigen in the skin becomes a transplantation antigen and behaves like a typical allogeneic MHC class I antigen. The facts that (B6 X C3H)F 1 mice rejected the skin expressing T3 b -TL antigen and induced CTL that killed TL + lymphomas of B6 origin revealed that TL antigen encoded by T3 b -TL is recognized as non-self in B6 mice. Experiments are now extended to analyze immune responses to TL antigen expressed on autochthonous T cell lymphomas. (J.P.N.)

  10. Phytochemistry and Agro-Industrial Potential of Native Oilseeds from West Africa: African Grape (Lannea microcarpa), Marula (Sclerocarya birrea), and Butter Tree (Pentadesma butyracea)

    OpenAIRE

    Adama Hilou; Adjima Bougma; Mamoudou H. Dicko

    2017-01-01

    Ethnobotanical investigations on local oilseed species in Burkina Faso revealed that oils from tree oilseeds are frequently used for food, cosmetics and traditional medicine by local people. To test the bio-preservative capacity, the effect of the oilseed extracts on the stabilization of Shea butter was evaluated. Levels of bioactive phyto-components were evaluated through several methods. Some aspects of the quality of oilcakes were evaluated based on their inhibitory capacity on the endogen...

  11. Effects of Field Conditions on Emergence of Oilseed Rape Seed lots Grown in Khorasan Province

    Directory of Open Access Journals (Sweden)

    A Yanegh

    2014-07-01

    Full Text Available Nineteen irrigated farms of canola from six cities of Khorasan selected to assess the seedling emergence one month after sowing in 2009. Soil texture of each farm determined using the Hydrometer method. The results showed that weather conditions of sowing areas had no significant effect on emergence of oilseed rape. With increasing the temperature (within the range of 19.5 to 21.5 ˚C emergence percentage was not increased significantly. Rainfall also caused no significant effect on seedling emergence. The percentage of emergence in machine-sowing and hand-sowing were 38.4% and 28%, respectively. Soils with loam silt, silt clay loam and loam texture had emergence of 27.2%, 31.2% and 47% respectively. It seems soil texture plays a great roll on the emergence of oilseed rape with epigeal seedlings.

  12. Engineering oilseeds for sustainable production of industrial and nutritional feedstocks: solving bottlenecks in fatty acid flux.

    Science.gov (United States)

    Cahoon, Edgar B; Shockey, Jay M; Dietrich, Charles R; Gidda, Satinder K; Mullen, Robert T; Dyer, John M

    2007-06-01

    Oilseeds provide a unique platform for the production of high-value fatty acids that can replace non-sustainable petroleum and oceanic sources of specialty chemicals and aquaculture feed. However, recent efforts to engineer the seeds of crop and model plant species to produce new types of fatty acids, including hydroxy and conjugated fatty acids for industrial uses and long-chain omega-3 polyunsaturated fatty acids for farmed fish feed, have met with only modest success. The collective results from these studies point to metabolic 'bottlenecks' in the engineered plant seeds that substantially limit the efficient or selective flux of unusual fatty acids between different substrate pools and ultimately into storage triacylglycerol. Evidence is emerging that diacylglycerol acyltransferase 2, which catalyzes the final step in triacylglycerol assembly, is an important contributor to the synthesis of unusual fatty acid-containing oils, and is likely to be a key target for future oilseed metabolic engineering efforts.

  13. Dispersal of solitary bees and bumblebees in a winter oilseed rape field

    DEFF Research Database (Denmark)

    Calabuig, Isabel

    2000-01-01

    Dispersal distributions of solitary bees and bumblebees were studied in a winter oilseed rape field. Window-traps were placed in the rape field along a line transect perpendicular to the field edge. 19 species of solitary bees were recorded and all but four species are polylectic, including...... Brassicaceae as host-plant family. Through non-linear regression, the decline in solitary bee individuals versus distance from field edge significantly fitted a steep two-parameter exponential decay function. Activity of solitary bees was clearly highest within 30 metres from the field edge. Apparently......, solitary bees do not play any noteworthy role in the pollination of winter oilseed rape in Denmark. The traps yielded ten species of bumblebees, and a significant linear correlation was found between numbers of individuals and distance from the field edge. This result is attributed to bumblebee foraging...

  14. Ethanol production from rape straw: Part of an oilseed rape biorefinery

    DEFF Research Database (Denmark)

    Arvaniti, Efthalia

    The aim of this study was 1) present an oilseed rape whole crop biorefinery; 2) to investigate the best available experimental conditions for production of cellulosic ethanol from rape straw, and included the processes of thermo-chemical pretreatment, enzymatic hydrolysis, and C6 fermentation......, and 3) to couple cellulosic ethanol production to production of cellulolytic enzymes that are needed for cellulosic ethanol production, inside a rape straw biorefinery. For the first is based less on available experiments, and more on literature review. The second and third study conclusions were drawn...... rapeseed biodiesel plant of Europe to an oilseed rape whole-crop biorefinery by 2020 is envisioned and discussed. The description and discussion of this biorefinery is based partly on literature review, and partly on own experimental data, especially on pretreatment of rape straw, and production...

  15. Kinetic models for supercritical CO2 extraction of oilseeds - a review

    Directory of Open Access Journals (Sweden)

    B. Nagy

    2011-01-01

    Full Text Available The supercritical fluid extraction of oilseeds is gaining increasing interest in commercial application for the last few decades, most particularly thanks to technical and environmental advantages of supercritical fluid extraction technology compared to current extraction methods with organic solvents. Furthermore, CO2 as a solvent is generally recognized as safe (GRAS. At present moment, supercritical fluid extractions on a commercial scale are limited to decaffeination, production of soluble hops extracts, sesame seed oil production and extraction of certain petroleum products. When considering industrial application, it is essential to test the applicability of the appropriate model for supercritical fluid extraction of oilseeds used for scale up of laboratory data to industrial design purposes. The aim of this paper is to review the most significant kinetic models reported in the literature for supercritical fluid extraction.

  16. Origin of new Brassica types from a single intergeneric hybrid ...

    Indian Academy of Sciences (India)

    Origin of new Brassica types from a single intergeneric hybrid between B. rapa and Orychophragmus ... The morphological and genetic divergence of these novel types derived from a single hybrid is probably due ... Journal of Genetics | News.

  17. Yield performance of brassica varieties under rainfed condition

    International Nuclear Information System (INIS)

    Hassan, M.Z.U.; Wahla, A.J.; Waqar, M.Q.

    2014-01-01

    A field study was conducted to evaluate crop growth and seed yield performance of Brassica varieties under Rainfed conditions. The varieties, included in the study, were BSA, Zafar-2000, Pakola, Con.1, Con.2, Abaseen, Rainbow, SPS-5, Bard-1, and KJ-119. KJ-119 (2500.0 KG/HA) among Brassica juncea L. varieties and Abaseen (2425.9 kg/ha) among Brassica napusL. Varieties produced with maximum seed yield as compared to rest of varieties. Significantly, minimum seed yield was observed in check variety BSA. The significant difference in seed yield of Brassica varieties, Abaseen and KJ 119, was attributed to improve yield components over other varieties. Maximum pods per plant and seeds per pod led these varieties to attain maximum yield. Inspite of weather variations existence during years 2007-09,the same varieties produced with maximum seed yield. (author)

  18. Identification of novel QTLs for isolate-specific partial resistance to Plasmodiophora brassicae in Brassica rapa.

    Directory of Open Access Journals (Sweden)

    Jingjing Chen

    Full Text Available Plasmodiophora brassicae, the causal agent of clubroot disease of the Brassica crops, is widespread in the world. Quantitative trait loci (QTLs for partial resistance to 4 different isolates of P. brassicae (Pb2, Pb4, Pb7, and Pb10 were investigated using a BC1F1 population from a cross between two subspecies of Brassica rapa, i.e. Chinese cabbage inbred line C59-1 as a susceptible recurrent parent and turnip inbred line ECD04 as a resistant donor parent. The BC1F2 families were assessed for resistance under controlled conditions. A linkage map constructed with simple sequence repeats (SSR, unigene-derived microsatellite (UGMS markers, and specific markers linked to published clubroot resistance (CR genes of B. rapa was used to perform QTL mapping. A total of 6 QTLs residing in 5 CR QTL regions of the B. rapa chromosomes A01, A03, and A08 were identified to account for 12.2 to 35.2% of the phenotypic variance. Two QTL regions were found to be novel except for 3 QTLs in the respective regions of previously identified Crr1, Crr2, and Crr3. QTL mapping results indicated that 1 QTL region was common for partial resistance to the 2 isolates of Pb2 and Pb7, whereas the others were specific for each isolate. Additionally, synteny analysis between B. rapa and Arabidopsis thaliana revealed that all CR QTL regions were aligned to a single conserved crucifer blocks (U, F, and R on 3 Arabidopsis chromosomes where 2 CR QTLs were detected in A. thaliana. These results suggest that some common ancestral genomic regions were involved in the evolution of CR genes in B. rapa.

  19. A continuum of research projects to improve extraction of oil and proteins in oilseed plants

    Directory of Open Access Journals (Sweden)

    Miquel Martine

    2011-05-01

    Full Text Available A key challenge in the actual context of fossil sources rarefaction, global warming, and of increase of the world global population, is to promote the use of molecules derived from renewable sources such as plants. Among these molecules, lipids and proteins are targets of interest. Plant lipids from oilseeds are attractive substitutes to the use of fossil oil. Till the beginning of the 20th century, numerous products used in the daily life were derived from natural renewable products. For instance, plant oil was commonly used as fuel for vehicles and was entering in the composition of paintings, lubricants etc. Unfortunately, natural oils have been progressively replaced by cheaper fossil oil in the fabrication of these products. Nowadays, fossil oils are becoming increasingly expensive being a finite comodity. It is thus important to reduce our dependence from fossil oil and develop substitution industries. Oilseeds contain important amounts of proteins which are mainly used in feed. As several kilograms of plant protein are needed to obtain one kilogram of animal protein, the interest toward using plant protein in food is reinforced. The developments of the use of plant lipids, as well as proteins are a major stakes for the competitiveness of European agriculture and industry, as well as for sustainable development. Extraction of oil and proteins from rapeseed has a significant cost, in term of energy and solvent uses, and finally affects the ultimate quality of the products (protein digestibility. In order to quantitatively extract seed reserves under mild conditions, it will be necessary to limit the amount of energy needed, and avoid any use of solvents. Ideally, seeds should be processed in a bio refinery. In this paper, we will describe how oilseeds store their reserves, and roadblocks for improving actual oilseed extraction processes. A continuum of research projects aimed at answering targeted questions will be presented, with selected

  20. Combination of existing and alternative technologies to promote oilseeds and pulses proteins in food applications

    OpenAIRE

    Chéreau Denis; Videcoq Pauline; Ruffieux Cécile; Pichon Lisa; Motte Jean-Charles; Belaid Saliha; Ventureira Jorge; Lopez Michel

    2016-01-01

    The continuous world population growth induces a total protein demand increase based mainly on plant sources. To meet these global nutritional challenges, existing and innovative dry and wet fractionation processes will have to be combined to better valorise plant protein fraction from pulses and oilseeds. The worldwide success of soy protein isolates originate from the intrinsic qualities of soybean proteins but also from a con...

  1. Oilseeds native to the Cerrado have fatty acid profile beneficial for cardiovascular health

    Directory of Open Access Journals (Sweden)

    Aline Medeiros ALVES

    Full Text Available ABSTRACT Objective: To assess and compare the fatty acid composition of edible seeds and a nut native to the Cerrado (Brazilian savannah to that of traditional oilseeds. Methods: Baru almonds, Cerrado cashew nuts, and pequi almonds were extracted from the fruits using appropriate equipment. All edible seeds and nuts were roasted, except for the Brazil nut. The sample lipids were extracted via cold pressing. The fatty acids were esterified, and the fatty acid esters were analyzed by gas chromatography. Results: The native and traditional edible seeds and nuts contain mostly monounsaturated fatty acids (42.72 g to 63.44 g/100 g, except for the Brazil nut, which showed predominance of polyunsaturated fatty acids (45.48 g/100 g. Pequi almond had the highest saturated fatty acid content (36.14 g/100 g. The fatty acids with the highest concentration were oleic and linoleic acids, and palmitic acid was also found in considerable concentration in the oilseeds studied. The Cerrado cashew nut and the traditional cashew nut have similar fatty acid profiles. As for the ratio of ω-6 to ω-3, the baru almond showed the highest ratio, 9:1, which was the closest to the recommended intake of these fatty acids. Conclusion: The fatty acid profile of the edible seeds and nuts native to the cerrado is similar to those of traditional oilseeds. We suggest the inclusion of native oilseeds in the diet aiming at reducing the risk of cardiovascular disease, especially the baru almond and the cerrado cashew nut, due to the fact they have high ratio of monounsaturated fatty acids to saturated fatty acids.

  2. Sensory evaluation of commercial fat spreads based on oilseeds and walnut

    OpenAIRE

    Dimić, Etelka B.; Vujasinović, Vesna B.; Radočaj, Olga F.; Borić, Bojan D.

    2013-01-01

    The main focus of this study was on the sensory evaluation of commercial oilseeds spreads, as the most significant characteristic of this type of product from the consumers’ point of view. Sensory analysis was conducted by five experts using a quantitative descriptive and sensory profile test, applying a scoring method according to the standard procedure. Five different spreads were evaluated: sunflower, pumpkin, sesame, peanut, and walnut. Oil content and ...

  3. Metabolic profiling and biological capacity of Pieris brassicae fed with kale (Brassica oleracea L. var. acephala).

    Science.gov (United States)

    Ferreres, Federico; Fernandes, Fátima; Oliveira, Jorge M A; Valentão, Patrícia; Pereira, José A; Andrade, Paula B

    2009-06-01

    Phenolic and organic acid profiles of aqueous extracts from Pieris brassicae material and the host kale (Brassica oleracea L. var. acephala) leaves were determined by HPLC/UV-DAD/MS(n)-ESI and HPLC-UV, respectively. The identified phenolics included acylated and nonacylated flavonoid glycosides, hydroxycinnamic acyl gentiobiosides, and sulphate phenolics. Kale exhibited the highest content (11g/kg lyophilized extract), while no phenolics were identified in the butterflies or exuviae. Nine different organic acids were characterized in the materials, with kale showing the highest amount (112g/kg lyophilized extract). With the exception of the exuviae extract, the rest were screened for bioactivity. Using spectrophotometric microassays, all exhibited antiradical capacity against DPPH and NO in a concentration-dependent way, whereas only kale and excrement extracts were active against superoxide. All displayed activity on intestinal smooth muscle, albeit with distinct relaxation-contraction profiles. Larvae and butterfly extracts were more efficacious for intestinal relaxation than was kale extract, whereas excrement extract evoked only contractions, thus evidencing their different compositions. Collectively, these results show that P. brassicae sequesters and metabolizes kale's phenolic compounds. Moreover, the extract's bioactivities suggest that they may constitute an interesting source of bioactive compounds whose complex chemical structures preclude either synthesis or isolation.

  4. Influence of top dressing on yield and seed quality components of oilseed rape

    Directory of Open Access Journals (Sweden)

    Vujaković Milka

    2010-01-01

    Full Text Available Oilseed rape is an agronomically important species grown for seed that contains 40-48% oil and 18-25% proteins. Oilseed rape has high demands for nitrogen. The research was performed on four varieties of oilseed rape (Banaćanka, Valeska, Slavica and Express developed at Institute of Field and Vegetable Crops in Novi Sad, during vegetative seasons 2007-2008 and 2008-2009. During vegetation, top dressing was applied with different amounts of KAN: control (0 kg N ha-1, 50 kg N ha-1, 100 kg N ha-1, 150 kg N ha-1 and the N quantity determination were performed applying the balancing method (also known as N-min method. Yield, 1000-seed weight, seed germination, oil and protein content were determined after harvest. Yield and seed germination depended on seed production year. 1000-seed weight depended on seed production year and genotype. Oil and protein content in seed depended on production year, genotype and amount of the N-fertilizer applied by top dressing.

  5. The agronomic traits of foreign cultivars and domestic populations of oilseed poppy

    Directory of Open Access Journals (Sweden)

    Marina Brčić

    2016-12-01

    Full Text Available For the past few years, a rising interest for the production of oil poppy (Papaver somniferum L. on bigger areas in the Republic of Croatia has been noticed. The aim of this study was to determine seed yield and other agronomic traits of foreign cultivars and domestic populations of oilseed poppy in the environmental conditions of northwestern Croatia and select the best varieties for this area, considering the obtained results. The research was conducted in 2013 and 2015 at the experimental field of University of Zagreb, Faculty of Agriculture. The research involved four foreign cultivars (Opal, Lazur, Major, and Matis and two domestic populations of oilseed poppy named after locations where they had been collected: Gornji Bogićevci (IND00042 and Beli Manastir (IND00043. According to the obtained results, it can be concluded that the examined cultivars and domestic populations of oilseed poppy differed significantly in seed yield, capsule number per plant, seed weight per capsule, seed weight per plant, and thousand seed weight only in the year of 2013. On average, cultivars/populations with the highest yield were Opal (847 kg/ha, Beli Manastir (834 kg/ha, and Major (816 kg/ha. Oil content in poppy seed ranged from 42.5% (Lazur to 46.3% (Opal. Linoleic, oleic, and palmitic acids prevailed in examined cultivars and populations.

  6. Application of Hyperspectral Imaging to Detect Sclerotinia sclerotiorum on Oilseed Rape Stems

    Directory of Open Access Journals (Sweden)

    Wenwen Kong

    2018-01-01

    Full Text Available Hyperspectral imaging covering the spectral range of 384–1034 nm combined with chemometric methods was used to detect Sclerotinia sclerotiorum (SS on oilseed rape stems by two sample sets (60 healthy and 60 infected stems for each set. Second derivative spectra and PCA loadings were used to select the optimal wavelengths. Discriminant models were built and compared to detect SS on oilseed rape stems, including partial least squares-discriminant analysis, radial basis function neural network, support vector machine and extreme learning machine. The discriminant models using full spectra and optimal wavelengths showed good performance with classification accuracies of over 80% for the calibration and prediction set. Comparing all developed models, the optimal classification accuracies of the calibration and prediction set were over 90%. The similarity of selected optimal wavelengths also indicated the feasibility of using hyperspectral imaging to detect SS on oilseed rape stems. The results indicated that hyperspectral imaging could be used as a fast, non-destructive and reliable technique to detect plant diseases on stems.

  7. Dedicated Industrial Oilseed Crops as Metabolic Engineering Platforms for Sustainable Industrial Feedstock Production.

    Science.gov (United States)

    Zhu, Li-Hua; Krens, Frans; Smith, Mark A; Li, Xueyuan; Qi, Weicong; van Loo, Eibertus N; Iven, Tim; Feussner, Ivo; Nazarenus, Tara J; Huai, Dongxin; Taylor, David C; Zhou, Xue-Rong; Green, Allan G; Shockey, Jay; Klasson, K Thomas; Mullen, Robert T; Huang, Bangquan; Dyer, John M; Cahoon, Edgar B

    2016-02-26

    Feedstocks for industrial applications ranging from polymers to lubricants are largely derived from petroleum, a non-renewable resource. Vegetable oils with fatty acid structures and storage forms tailored for specific industrial uses offer renewable and potentially sustainable sources of petrochemical-type functionalities. A wide array of industrial vegetable oils can be generated through biotechnology, but will likely require non-commodity oilseed platforms dedicated to specialty oil production for commercial acceptance. Here we show the feasibility of three Brassicaceae oilseeds crambe, camelina, and carinata, none of which are widely cultivated for food use, as hosts for complex metabolic engineering of wax esters for lubricant applications. Lines producing wax esters >20% of total seed oil were generated for each crop and further improved for high temperature oxidative stability by down-regulation of fatty acid polyunsaturation. Field cultivation of optimized wax ester-producing crambe demonstrated commercial utility of these engineered crops and a path for sustainable production of other industrial oils in dedicated specialty oilseeds.

  8. Mutation breeding for quality improvement a case study for oilseed crops

    International Nuclear Information System (INIS)

    Roebbelen, G.

    1990-01-01

    The effectiveness of mutation breeding depends on the nature of the genetic system in question, on the availability of efficient screening techniques and on an intelligent integration of the novel genetic variation into an appropriate breeding programme. Oil storage in seeds offer an outstanding example of a biosynthetic process, the end products of which are diverse and sufficiently flexible in their genetic control to allow for improvements of product quality such as economically desired. Sophisticated analytical methods have been developed during the recent decades to quantify relevant steps in seedoil storage even in early generations and in large numbers of small samples. Genetic selection for oilseed quality has been of low intensity in nature; but it has also been one-sided only durign the earlier decades of plant breeding because of the predominantly nutritional consumption of vegetable oils. Today an expanding array of new breeding goals for oleochemical and technical uses is developing. In addition, biotechnical innovations offer promising support to mutation breeding for the domestication or even construction of virtually new oilseed crops for application in both food and non-food uses. The purpose of this paper is to exemplify recent advances and to outline future prospects of mutation breeding for the improvement of oilseed quality. (author). 136 refs, 8 figs, 12 tabs

  9. Comparative Transcriptome Analysis between Broccoli (Brassica oleracea var. italica) and Wild Cabbage (Brassica macrocarpa Guss.) in Response to Plasmodiophora brassicae during Different Infection Stages.

    Science.gov (United States)

    Zhang, Xiaoli; Liu, Yumei; Fang, Zhiyuan; Li, Zhansheng; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao

    2016-01-01

    Clubroot, one of the most devastating diseases to the Brassicaceae family, is caused by the obligate biotrophic pathogen Plasmodiophora brassicae . However, studies of the molecular basis of disease resistance are still poor especially in quantitative resistance. In the present paper, two previously identified genotypes, a clubroot-resistant genotype (wild cabbage, B2013) and a clubroot-susceptible genotype (broccoli, 90196) were inoculated by P. brassicae for 0 (T0), 7 (T7), and 14 (T14) day after inoculation (DAI). Gene expression pattern analysis suggested that response changes in transcript level of two genotypes under P. brassicae infection were mainly activated at the primary stage (T7). Based on the results of DEGs functional enrichments from two infection stages, genes associated with cell wall biosynthesis, glucosinolate biosynthesis, and plant hormone signal transduction showed down-regulated at T14 compared to T7, indicating that defense responses to P. brassicae were induced earlier, and related pathways were repressed at T14. In addition, the genes related to NBS-LRR proteins, SA signal transduction, cell wall and phytoalexins biosynthesis, chitinase, Ca 2+ signals and RBOH proteins were mainly up-regulated in B2013 by comparing those of 90196, indicating the pathways of response defense to clubroot were activated in the resistant genotype. This is the first report about comparative transcriptome analysis for broccoli and its wild relative during the different stages of P. brassicae infection and the results should be useful for molecular assisted screening and breeding of clubroot-resistant genotypes.

  10. Transgenics, agroindustry and food sovereignty

    Directory of Open Access Journals (Sweden)

    Xavier Alejandro León Vega

    2014-10-01

    Full Text Available Food sovereignty has been implemented constitutionally in Ecuador; however, many of the actions and policies are designed to benefit the dominant model of food production, based in agroindustry, intensive monocultures, agrochemicals and transgenics. This article reflects upon the role of family farming as a generator of food sovereignty, and secondly the threat to them by agroindustry agriculture based in transgenic. The role played by food aid in the introduction of transgenic in Latin America and other regions of the world is also analyzed.

  11. The compact genome of the plant pathogen Plasmodiophora brassicae is adapted to intracellular interactions with host Brassica spp.

    Science.gov (United States)

    Rolfe, Stephen A; Strelkov, Stephen E; Links, Matthew G; Clarke, Wayne E; Robinson, Stephen J; Djavaheri, Mohammad; Malinowski, Robert; Haddadi, Parham; Kagale, Sateesh; Parkin, Isobel A P; Taheri, Ali; Borhan, M Hossein

    2016-03-31

    The protist Plasmodiophora brassicae is a soil-borne pathogen of cruciferous species and the causal agent of clubroot disease of Brassicas including agriculturally important crops such as canola/rapeseed (Brassica napus). P. brassicae has remained an enigmatic plant pathogen and is a rare example of an obligate biotroph that resides entirely inside the host plant cell. The pathogen is the cause of severe yield losses and can render infested fields unsuitable for Brassica crop growth due to the persistence of resting spores in the soil for up to 20 years. To provide insight into the biology of the pathogen and its interaction with its primary host B. napus, we produced a draft genome of P. brassicae pathotypes 3 and 6 (Pb3 and Pb6) that differ in their host range. Pb3 is highly virulent on B. napus (but also infects other Brassica species) while Pb6 infects only vegetable Brassica crops. Both the Pb3 and Pb6 genomes are highly compact, each with a total size of 24.2 Mb, and contain less than 2 % repetitive DNA. Clustering of genome-wide single nucleotide polymorphisms (SNP) of Pb3, Pb6 and three additional re-sequenced pathotypes (Pb2, Pb5 and Pb8) shows a high degree of correlation of cluster grouping with host range. The Pb3 genome features significant reduction of intergenic space with multiple examples of overlapping untranslated regions (UTRs). Dependency on the host for essential nutrients is evident from the loss of genes for the biosynthesis of thiamine and some amino acids and the presence of a wide range of transport proteins, including some unique to P. brassicae. The annotated genes of Pb3 include those with a potential role in the regulation of the plant growth hormones cytokinin and auxin. The expression profile of Pb3 genes, including putative effectors, during infection and their potential role in manipulation of host defence is discussed. The P. brassicae genome sequence reveals a compact genome, a dependency of the pathogen on its host for some

  12. Feeding behaviour of generalist pests on Brassica juncea: implication for manipulation of glucosinolate biosynthesis pathway for enhanced resistance.

    Science.gov (United States)

    Kumar, Pawan; Augustine, Rehna; Singh, Amarjeet Kumar; Bisht, Naveen C

    2017-10-01

    Differential accumulation of plant defence metabolites has been suggested to have important ecological consequence in the context of plant-insect interactions. Feeding of generalist pests on Brassica juncea showed a distinct pattern with selective exclusion of leaf margins which are high in glucosinolates. Molecular basis of this differential accumulation of glucosinolates could be explained based on differential expression profile of BjuMYB28 homologues, the major biosynthetic regulators of aliphatic glucosinolates, as evident from quantitative real-time PCR and promoter:GUS fusion studies in allotetraploid B. juncea. Constitutive overexpression of selected BjuMYB28 homologues enhanced accumulation of aliphatic glucosinolates in B. juncea. Performance of two generalist pests, Helicoverpa armigera and Spodoptera litura larvae, on transgenic B. juncea plants were poor compared to wild-type plants in a no-choice experiment. Correlation coefficient analysis suggested that weight gain of H. armigera larvae was negatively correlated with gluconapin (GNA) and glucobrassicanapin (GBN), whereas that of S. litura larvae was negatively correlated with GNA, GBN and sinigrin (SIN). Our study explains the significance and possible molecular basis of differential distribution of glucosinolates in B. juncea leaves and shows the potential of overexpressing BjuMYB28 for enhanced resistance of Brassica crops against the tested generalist pests. © 2017 John Wiley & Sons Ltd.

  13. Chitosan oligosaccharides-triggered innate immunity contributes to oilseed rape resistance against Sclerotinia sclerotiorum

    DEFF Research Database (Denmark)

    Yin, Heng; Yan, Li; HongYan, Zhang

    2013-01-01

    Chitosan oligosaccharides (collectively, oligochitosan, or COS) are considered to be potent plant immunity elicitors. In this article, the induction of resistance to Sclerotinia sclerotiorum in Brassica napus L. var. Huyou 15 by COS is studied. Even though COS (50 mg mL1) did not affect radial...

  14. Transgene teknikker erstatter problematisk avl

    DEFF Research Database (Denmark)

    Alstrup, Aage Kristian Olsen; Hansen, Axel Kornerup

    2016-01-01

    Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder.......Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder....

  15. Could nitrile derivatives of turnip (Brassica rapa) glucosinolates be Hepato-and/or cholangiotoxic in cattle?

    Science.gov (United States)

    Turnip (Brassica rapa ssp. rapa) and rape (Brassica napus ssp. biennis) and other brassica forage crops are generally regarded as “safe” feed for cattle during late summer and fall in New Zealand. However, when Pithomyces chartarum spore counts are high there are epidemics of sporidesmin toxicity (...

  16. Variations in fatty acid composition, glucosinolate profile and some phyto chemical contents in selected oil seed rape (Brassica napus L.) cultivars

    Energy Technology Data Exchange (ETDEWEB)

    El-Din Saad El-Beltag, H.; Mohamed, A. A.

    2010-07-01

    Rapeseed (Brassica napus L.) is now the third most important source of edible oil in the world after soybean and palm oil. In this study seeds of five different rapeseed cultivars namely; pactol, silvo, topas, serw 4 and serw 6 were evaluated for their fatty acid composition, glucosinolate profile, amino acids, total tocopherols and phenolic content. Among all cultivars significant variability in fatty acids were observed. The oleic acid (C18:1) ranged from 56.31% to 58.67%, linoleic acid (C18:2) from 10.52% to 13.74%, {alpha}-linolenic acid (C18:3) from 8.83% to 10.32% and erucic acid (22:1) from 0.15% to 0.91%. The glucosinolate profile of rapeseed was also separated and identified using high-performance liquid chromatography. Small variations in the glucosinolate profile were observed among all tested cultivars; however, progoitrin and gluconapin were the major glucosinolate found. Additionally, silvo cultivar showed the highest total glucosinolate contents (5.97 {mu}mol/g dw). Generally, the contents of aspartic, glutamic, arginine and leucine were high, while the contents of tyrosine and isoleucine were low among all cultivars. For total tocopherols, the results indicated that both serw 6 and pactol cultivars had the highest total tocopherol contents (138.3 and 102.8 mg/100 g oil, respectively). Total phenolic contents varied from 28.0 to 35.4 mg/g dw. The highest total phenolic content was found in topas while the lowest value was detected in serw 6. These parameters; fatty acid contents, glucosinolate profile and amino acids together with total tocopherols and phenolic contents, could be taken into consideration by oilseed rape breeders as selection criteria for developing genotypes with modified seed quality traits in Brassica napus L. (Author)

  17. Development of three full-length infectious cDNA clones of distinct brassica yellows virus genotypes for agrobacterium-mediated inoculation.

    Science.gov (United States)

    Zhang, Xiao-Yan; Dong, Shu-Wei; Xiang, Hai-Ying; Chen, Xiang-Ru; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2015-02-02

    Brassica yellows virus is a newly identified species in the genus of Polerovirus within the family Luteoviridae. Brassica yellows virus (BrYV) is prevalently distributed throughout Mainland China and South Korea, is an important virus infecting cruciferous crops. Based on six BrYV genomic sequences of isolates from oilseed rape, rutabaga, radish, and cabbage, three genotypes, BrYV-A, BrYV-B, and BrYV-C, exist, which mainly differ in the 5' terminal half of the genome. BrYV is an aphid-transmitted and phloem-limited virus. The use of infectious cDNA clones is an alternative means of infecting plants that allows reverse genetic studies to be performed. In this study, full-length cDNA clones of BrYV-A, recombinant BrYV5B3A, and BrYV-C were constructed under control of the cauliflower mosaic virus 35S promoter. An agrobacterium-mediated inoculation system of Nicotiana benthamiana was developed using these cDNA clones. Three days after infiltration with full-length BrYV cDNA clones, necrotic symptoms were observed in the inoculated leaves of N. benthamiana; however, no obvious symptoms appeared in the upper leaves. Reverse transcription-PCR (RT-PCR) and western blot detection of samples from the upper leaves showed that the maximum infection efficiency of BrYVs could reach 100%. The infectivity of the BrYV-A, BrYV-5B3A, and BrYV-C cDNA clones was further confirmed by northern hybridization. The system developed here will be useful for further studies of BrYV, such as host range, pathogenicity, viral gene functions, and plant-virus-vector interactions, and especially for discerning the differences among the three genotypes. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Potential environmental impacts associated with large-scale herbicide-tolerant GM oilseed rape crops

    Directory of Open Access Journals (Sweden)

    Fellous Marc

    2004-07-01

    Full Text Available The Biomolecular Engineering Commission considers that the knowledge acquired in the last three years has provided significant information in reply to the points raised in its review dated 16 February 2001. The Commission has studied the potential environmental impacts associated with large-scale herbicidetolerantGMoilseed rape crops, making a distinction between direct and indirect impacts. Direct impacts stem from the intrinsic properties of herbicide-tolerant GM oilseed rape crops whereas indirect impacts result from practices associated with the farming of these crops. The Commission considers that, in the absence of the use of the herbicide in question in and outside of farmed land, there is no direct environmental risk (development of invasive crops per se associated with the presence of a herbicide-tolerance gene in oilseed rape (or related species. Nevertheless, since the interest of these tolerant crops lies in the use of the herbicide in question, indirect effects, to varying extents, have been identified and must be taken into account: the use of the herbicide in question, applied to agricultural fields containing the herbicide-tolerant crop could lead to an increase in oilseed rape volunteer populations in crop rotations; the selective pressure exerted by non-specific herbicides (to which the crops have been rendered tolerant may be very high in cases of continuous and uncontrolled use of these herbicides, and may result in the persistence of rare events such as the reproduction of fertile interspecies hybrids; the change to the range of herbicides used should be conveyed by more effective weed control and, like any change in farming practices, induce indirect effects on the agri-ecosystem, particularly in terms of changes to weeds and the associated animal life. Accordingly, the Biomolecular Engineering Commission recommends a global approach in terms of the large-scale farming of herbicide-tolerant crops that: accounts for the

  19. Comparative response of wheat and oilseed rape to nitrogen supply: absorption and utilisation efficiency of radiation and nitrogen during the reproductive stages determining yield

    NARCIS (Netherlands)

    Dreccer, M.F.; Schapendonk, A.H.C.M.; Slafer, G.A.; Rabbinge, R.

    2000-01-01

    We investigated the response of spring wheat and oilseed rape to nitrogen (N) supply, focusing on the critical period for grain number definition and grain filling. Crops were grown in containers under a shelter and treated with five combinations of applied N. Wheat and oilseed rape produced

  20. Use of formulated Trichoderma sp. Tri-1 in combination with reduced rates of chemical pesticide for control of Sclerotinia sclerotiorium on oilseed rape

    Science.gov (United States)

    Sustainable strategies for control of Sclerotinia sclerotiorum on oilseed rape are needed. Here we tested combinations of Trichoderma sp. Tri-1, formulated with oilseed rape seedcake and straw, with reduced application rates of the chemical pesticide Carbendazim for control of this pathogen on oils...

  1. Non-destructive in vitro selection of microspore-derived embryos with the fertility restorer gene for CMS Ogu-INRA in winter oilseed rape (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Lenka Havlíčková

    2015-01-01

    Conclusion: Technique developed in this study provides early and non-destructive sampling of embryonic tissue and the use of new markers for simple and efficient control of the presence of Rfo gene in all accessions.

  2. The effect of endo- and exogenous factors on growth and maturation of oilseed rape (Brassica napus cv. Jet Neuf siliques cultured in vitro

    Directory of Open Access Journals (Sweden)

    Lucyna Drozdowska

    2014-01-01

    Full Text Available The effect of developmental stage of siliques, growth regulators, agar and sucrose concentrations in the medium was investigated on the morphogenesis of the silliques and seed maturation. Regeneration of shoots, roots and callus occurred at the base of siliques during their growth. The developmental stage of the incubated siliques was the most important factor affecting the number of seeds, while the conditions of culture (agar and growth regulators constituted a secondary factor. The reasons for the insignificant number of seeds produced could be the lack of fertilization of some of the ovules, limited ability of siliques to take up nutrients and the unspecific composition of the medium.

  3. Partial characterization, antioxidative properties and hypolipidemic effects of oilseed cake of Allanblackia floribunda and Jatropha curcas.

    Science.gov (United States)

    Boudjeko, Thaddée; Ngomoyogoli, Judith Emery Kanemoto; Woguia, Alice Louise; Yanou, Nicolas Njintang

    2013-12-11

    High fat diet is known to induce oxidative stress and abnormal changes in lipid metabolism. Many traditional plants have been shown to possess antioxidant and lipid-lowering activities, improving on oxidative status and lipid profile. In this paper, we characterized and examined the antioxidative properties of the oilseed cake of A. floribunda and J. curcas. We also evaluated their effect on lipid profile in the plasma and liver of experimental rats placed on a high fat diet. For a partial characterization, the qualitative and quantitative analyses of storage proteins, dietary fibre and polyphenol content were evaluated. Four extracts (aqueous, ethanolic, methanolic and 0.1 N HCl) were evaluated for their antioxidant properties and scavenging activities. The effect on lipid profile was evaluated after the administration of the crude extracts to albino rats placed on a high fat diet. Our results showed that J. curcas contains 10 times more storage proteins than A. floribunda while A. floribunda contains twice as much total dietary fibre than J. curcas. An evaluation of the different families of storage proteins showed that J. curcas has glutelins as the major storage proteins in its seeds (61.65 mg/g d.m), followed by globulins (25.30 mg/g d.m) and albumins (18.30 mg/g d.m). The electrophoretic analyses revealed a diversity of bands at the level of the different families and for both species. The evaluation of the in vitro antioxidant activities showed that A. floribunda extracts had higher antioxidant properties. Although the composition of A. floribunda and J. curcas oilseed cake are different, they lowered serum triglycerides (TG), total cholesterol (TC) and blood glucose level. These results show that the oilseed cake of A. floribunda and J. curcas possess antioxidant properties with an effect on blood glucose level and lipid profile.

  4. Combination of existing and alternative technologies to promote oilseeds and pulses proteins in food applications

    Directory of Open Access Journals (Sweden)

    Chéreau Denis

    2016-07-01

    Full Text Available The continuous world population growth induces a total protein demand increase based mainly on plant sources. To meet these global nutritional challenges, existing and innovative dry and wet fractionation processes will have to be combined to better valorise plant protein fraction from pulses and oilseeds. The worldwide success of soy protein isolates originate from the intrinsic qualities of soybean proteins but also from a continuous R&D effort since mid-twenty century. Therefore, the soy protein development model can be applied to protein isolates from diverse pulses and oilseeds meals as rapeseed which has already been recognised as novel food protein in Europe. To boost the delivery of plant proteins, agrofood-industries and academics must pool their respective expertise. Innovative and issue solving R&D projects have to be launched to better valorise pulses and oilseed proteins by (i creating oil extraction processes which preserve native proteins structure; (ii developing novel protein extraction processes from lab up to industrial pilot scale; (iii producing plant protein isolates having comparable foaming, emulsifying or gelling functionality than animal; and (iv generating hydrolysed proteins with high digestibility adapted to human nutrition. It is also essential to initiate research programs to innovate in wet and dry fractionations of plants or to design in vitro models to evaluate proteins digestibility and allergenicity. The increased awareness regarding plant protein valorisation resulted in the creation by agro-industries and academics of the open platform IMPROVE which propose a combination of competencies and equipment to boost market uptake of Plant Based Proteins.

  5. Large-scale monitoring of effects of clothianidin-dressed oilseed rape seeds on pollinating insects in Northern Germany: effects on honey bees (Apis mellifera).

    Science.gov (United States)

    Rolke, Daniel; Fuchs, Stefan; Grünewald, Bernd; Gao, Zhenglei; Blenau, Wolfgang

    2016-11-01

    Possible effects of clothianidin seed-treated oilseed rape on honey bee colonies were investigated in a large-scale monitoring project in Northern Germany, where oilseed rape usually comprises 25-33 % of the arable land. For both reference and test sites, six study locations were selected and eight honey bee hives were placed at each location. At each site, three locations were directly adjacent to oilseed rape fields and three locations were situated 400 m away from the nearest oilseed rape field. Thus, 96 hives were exposed to fully flowering oilseed rape crops. Colony sizes and weights, the amount of honey harvested, and infection with parasites and diseases were monitored between April and September 2014. The percentage of oilseed rape pollen was determined in pollen and honey samples. After oilseed rape flowering, the hives were transferred to an extensive isolated area for post-exposure monitoring. Total numbers of adult bees and brood cells showed seasonal fluctuations, and there were no significant differences between the sites. The honey, which was extracted at the end of the exposure phase, contained 62.0-83.5 % oilseed rape pollen. Varroa destructor infestation was low during most of the course of the study but increased at the end of the study due to flumethrin resistance in the mite populations. In summary, honey bee colonies foraging in clothianidin seed-treated oilseed rape did not show any detrimental symptoms as compared to colonies foraging in clothianidin-free oilseed rape. Development of colony strength, brood success as well as honey yield and pathogen infection were not significantly affected by clothianidin seed-treatment during this study.

  6. miR395 is involved in detoxification of cadmium in Brassica napus

    International Nuclear Information System (INIS)

    Zhang, Liu Wei; Song, Jian Bo; Shu, Xia Xia; Zhang, Yun; Yang, Zhi Min

    2013-01-01

    Highlights: ► Involvement of miR395 in sulfate uptake and assimilation in B. napus. ► miR395 regulation of Cd accumulation and distribution in B. napus. ► Depression of Cd-induced oxidative stress by miR395. -- Abstract: The toxic metal cadmium (Cd) constitutes one of the major inorganic contaminants in environments. microRNAs (miRNAs) are a class of endogenous non-coding small RNAs. miR395 is conserved and regulates sulfate assimilation and distribution in higher plants, but whether it is involved in detoxification of Cd in plants has not been described. In this study, transgenic rapeseed (Brassica napus) over-expressing miR395 was identified under Cd stress. miR395-over-expressing plants showed a lower degree of Cd-induced oxidative stress than wild type. By contrast, chlorophyll, glutathione and non-protein thiols contents were higher in the transformants than wild type. Determination of growth response showed that 35S::MIR395 plants accumulated higher levels of biomass and sulfur than wild type under Cd exposure. miR395 transgenic plants had higher levels of Cd in plants, particularly at the high supply of Cd in the medium, but they tended to repress Cd translocation from roots to shoots. Simultaneously, expression of metal-tolerance genes such as BnPCS1, BnHO1 and Sultr1;1 was up-regulated under Cd stress, and the expression of the genes was more pronounced in 35S::MIR395 plants than in wild type. These results suggest that miR395 would be involved in detoxification of Cd in B. napus

  7. miR395 is involved in detoxification of cadmium in Brassica napus

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Liu Wei; Song, Jian Bo; Shu, Xia Xia; Zhang, Yun [Department of Biochemistry and Molecular Biology, College of Life Science, Nanjing Agricultural University, Nanjing 210095 (China); Yang, Zhi Min, E-mail: zmyang@njau.edu.cn [Department of Biochemistry and Molecular Biology, College of Life Science, Nanjing Agricultural University, Nanjing 210095 (China)

    2013-04-15

    Highlights: ► Involvement of miR395 in sulfate uptake and assimilation in B. napus. ► miR395 regulation of Cd accumulation and distribution in B. napus. ► Depression of Cd-induced oxidative stress by miR395. -- Abstract: The toxic metal cadmium (Cd) constitutes one of the major inorganic contaminants in environments. microRNAs (miRNAs) are a class of endogenous non-coding small RNAs. miR395 is conserved and regulates sulfate assimilation and distribution in higher plants, but whether it is involved in detoxification of Cd in plants has not been described. In this study, transgenic rapeseed (Brassica napus) over-expressing miR395 was identified under Cd stress. miR395-over-expressing plants showed a lower degree of Cd-induced oxidative stress than wild type. By contrast, chlorophyll, glutathione and non-protein thiols contents were higher in the transformants than wild type. Determination of growth response showed that 35S::MIR395 plants accumulated higher levels of biomass and sulfur than wild type under Cd exposure. miR395 transgenic plants had higher levels of Cd in plants, particularly at the high supply of Cd in the medium, but they tended to repress Cd translocation from roots to shoots. Simultaneously, expression of metal-tolerance genes such as BnPCS1, BnHO1 and Sultr1;1 was up-regulated under Cd stress, and the expression of the genes was more pronounced in 35S::MIR395 plants than in wild type. These results suggest that miR395 would be involved in detoxification of Cd in B. napus.

  8. Potential bioetanol and biogas production using lignocellulosic biomass from winter rye, oilseed rape and faba bean

    DEFF Research Database (Denmark)

    Petersson, Anneli; Thomsen, Mette Hedegaard; Hauggaard-Nielsen, Henrik

    2007-01-01

    ) faba bean straw (Viciafaba L.). Their composition with regard to cellulose, hemicellulose, lignin, extractives and ash was evaluated, as well as their potential as raw materials for ethanol and biogas production. The materials were pretreated by wet oxidation using parameters previously found...... to be optimal for pretreatment of corn stover (195 degrees C, 15 min, 2 g l(-1) Na2CO3 and 12 bar oxygen). It was shown that pretreatment was necessary for ethanol production from all raw materials and gave increased biogas yield from winter rye straw. Neither biogas productivity nor yield from oilseed rape...

  9. Digestibility and postprandial ammonia excretion in Nile tilapia (Oreochromis niloticus) fed diets containing different oilseed by-products

    DEFF Research Database (Denmark)

    Obirikorang, Kwasi Adu; Amisah, Stephen; Fialor, Simon Cudjoe

    2015-01-01

    The present study was undertaken to evaluate the potential for using oilseed by-products (soybean, copra and palm kernel meals) as partial replacements of fishmeal in feeds for Nile tilapia (Oreochromis niloticus). Nutrient digestibility and postprandial ammonia excretion rates were examined....... A fishmeal-based diet served as control against three test diets in which 30 % of each of the oilseed by-products was included. Diets were randomly assigned to triplicate groups of fish (similar to 1 kg bulk weight) for the digestibility trials which spanned a total of 9 days. The partial inclusion...

  10. Light influence in the nutritional composition of Brassica oleracea sprouts.

    Science.gov (United States)

    Vale, A P; Santos, J; Brito, N V; Peixoto, V; Carvalho, Rosa; Rosa, E; Oliveira, M Beatriz P P

    2015-07-01

    Brassica sprouts are considered a healthy food product, whose nutritional quality can be influenced by several factors. The aim of this work was to monitor the nutritional composition changes promoted by different sprouting conditions of four varieties of Brassica oleracea (red cabbage, broccoli, Galega kale and Penca cabbage). Sprouts were grown under light/darkness cycles and complete darkness. Standard AOAC methods were applied for nutritional value evaluation, while chromatographic methods with UV-VIS and FID detection were used to determine the free amino acids and fatty acids, respectively. Mineral content was analyzed by atomic absorption spectrometry. Sprouts composition revealed them as an excellent source of protein and dietary fiber. Selenium content was one of the most distinctive feature of sprouts, being the sprouting conditions determinant for the free amino acid and fatty acids profile. The use of complete darkness was beneficial to the overall nutritional quality of the brassica sprouts studied. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. QTL for phytosterol and sinapate ester content in Brassica napus L. collocate with the two erucic acid genes

    Science.gov (United States)

    Amar, Samija; Ecke, Wolfgang; Becker, Heiko C.

    2008-01-01

    Improving oil and protein quality for food and feed purposes is an important goal in rapeseed (Brassica napus L.) breeding programs. Rapeseed contains phytosterols, used to enrich food products, and sinapate esters, which are limiting the utilization of rapeseed proteins in the feed industry. Increasing the phytosterol content of oil and lowering sinapate ester content of meal could increase the value of the oilseed rape crop. The objective of the present study was to identify quantitative trait loci (QTL) for phytosterol and sinapate ester content in a winter rapeseed population of 148 doubled haploid lines, previously found to have a large variation for these two traits. This population also segregated for the two erucic acid genes. A close negative correlation was found between erucic acid and phytosterol content (Spearman’s rank correlation, rs = −0.80**). For total phytosterol content, three QTL were detected, explaining 60% of the genetic variance. The two QTL with the strongest additive effects were mapped on linkage groups N8 and N13 within the confidence intervals of the two erucic acid genes. For sinapate ester content four QTL were detected, explaining 53% of the genetic variance. Again, a close negative correlation was found between erucic acid and sinapate ester content (rs = −0.66**) and the QTL with the strongest additive effects mapped on linkage groups N8 and N13 within the confidence intervals of the two erucic acid genes. The results suggests, that there is a pleiotropic effect of the two erucic acid genes on phytosterol and sinapate ester content; the effect of the alleles for low erucic acid content is to increase phytosterol and sinapate ester content. Possible reasons for this are discussed based on known biosynthetic pathways. Electronic supplementary material The online version of this article (doi:10.1007/s00122-008-0734-2) contains supplementary material, which is available to authorized users. PMID:18335203

  12. Effects of Glucosinolates and Flavonoids on Colonization of the Roots of Brassica napus by Azorhizobium caulinodans ORS571

    Science.gov (United States)

    O'Callaghan, Kenneth J.; Stone, Philip J.; Hu, Xiaojia; Griffiths, D. Wynne; Davey, Michael R.; Cocking, Edward C.

    2000-01-01

    Plants of Brassica napus were assessed quantitatively for their susceptibility to lateral root crack colonization by Azorhizobium caulinodans ORS571(pXLGD4) (a rhizobial strain carrying the lacZ reporter gene) and for the concentration of glucosinolates in their roots by high-pressure liquid chromatography (HPLC). High- and low-glucosinolate-seed (HGS and LGS) varieties exhibited a relatively low and high percentage of colonized lateral roots, respectively. HPLC showed that roots of HGS plants contained a higher concentration of glucosinolates than roots of LGS plants. One LGS variety showing fewer colonized lateral roots than other LGS varieties contained a higher concentration of glucosinolates than other LGS plants. Inoculated HGS plants treated with the flavonoid naringenin showed significantly more colonization than untreated HGS plants. This increase was not mediated by a naringenin-induced lowering of the glucosinolate content of HGS plant roots, nor did naringenin induce bacterial resistance to glucosinolates or increase the growth of bacteria. The erucic acid content of seed did not appear to influence colonization by azorhizobia. Frequently, leaf assays are used to study glucosinolates and plant defense; this study provides data on glucosinolates and bacterial colonization in roots and describes a bacterial reporter gene assay tailored easily to the study of ecologically important phytochemicals that influence bacterial colonization. These data also form a basis for future assessments of the benefits to oilseed rape plants of interaction with plant growth-promoting bacteria, especially diazotrophic bacteria potentially able to extend the benefits of nitrogen fixation to nonlegumes. PMID:10788398

  13. Phosphate-assisted phytoremediation of arsenic by Brassica napus and Brassica juncea: Morphological and physiological response.

    Science.gov (United States)

    Niazi, Nabeel Khan; Bibi, Irshad; Fatimah, Ayesha; Shahid, Muhammad; Javed, Muhammad Tariq; Wang, Hailong; Ok, Yong Sik; Bashir, Safdar; Murtaza, Behzad; Saqib, Zulfiqar Ahmad; Shakoor, Muhammad Bilal

    2017-07-03

    In this study, we examined the potential role of phosphate (P; 0, 50, 100 mg kg -1 ) on growth, gas exchange attributes, and photosynthetic pigments of Brassica napus and Brassica juncea under arsenic (As) stress (0, 25, 50, 75 mg kg -1 ) in a pot experiment. Results revealed that phosphate supplementation (P100) to As-stressed plants significantly increased shoot As concentration, dry biomass yield, and As uptake, in addition to the improved morphological and gas exchange attributes and photosynthetic pigments over P0. However, phosphate-assisted increase in As uptake was substantially (up to two times) greater for B. napus, notably due to higher shoot As concentration and dry biomass yield, compared to B. juncea at the P100 level. While phosphate addition in soil (P100) led to enhanced shoot As concentration in B. juncea, it reduced shoot dry biomass, primarily after 50 and 75 mg kg -1 As treatments. The translocation factor and bioconcentration factor values of B. napus were higher than B. juncea for all As levels in the presence of phosphate. This study demonstrates that phosphate supplementation has a potential to improve As phytoextraction efficiency, predominantly for B. napus, by minimizing As-induced damage to plant growth, as well as by improving the physiological and photosynthetic attributes.

  14. PECTATE LYASE-LIKE10 is associated with pollen wall development in Brassica campestris.

    Science.gov (United States)

    Jiang, Jingjing; Yao, Lina; Yu, Youjian; Lv, Meiling; Miao, Ying; Cao, Jiashu

    2014-11-01

    PECTATE LYASE-LIKE10 (PLL10) was previously identified as one of the differentially expressed genes both in microspores during the late pollen developmental stages and in pistils during the fertilization process in Chinese cabbage (Brassica campestris ssp. chinensis). Here, antisense-RNA was used to study the functions of BcPLL10 in Chinese cabbage. Abnormal pollen was identified in the transgenic lines (bcpll10-4, -5, and -6). In fertilization experiments, fewer seeds were harvested when the antisense-RNA lines were used as pollen donor. In vivo and in vitro pollen germination assays less germinated pollen tubes were observed in bcpll10 lines. Scanning electron microscopy observation verified that the tryphine materials were over accumulated around the pollen surface and sticked them together in bcpll10. Moreover, transmission electron microscopy observation revealed that the internal endintine was overdeveloped and predominantly occupied the intine, and disturbed the normal proportional distribution of the two layers in the non-germinal furrow region; and no obvious demarcation existed between them in the germinal furrow region in the bcpll10 pollen. Collectively, this study presented a novel PLL gene that played an important role during the pollen wall development in B. campestris, which may also possess potential importance for male sterility usage in agriculture. © 2014 Institute of Botany, Chinese Academy of Sciences.

  15. Induced polyploidization in Brassica campestris L. (Brassicaceae).

    Science.gov (United States)

    Kumar, G; Dwivedi, K

    2014-01-01

    Present experimental design has been made up to obtain crop with higher ploidy level via synthetic polyploidization. Since ploidy manipulation is generally associated with the obtainment of some increased enviable traits of the crop and also provides them greater adaptability to unfavorable or harsh circumstances as compared to its diploids counterparts. Thus, herein present research autotetraploids of Brassica campestris L. have been lucratively achieved by the application of colchicine. Two methods of treatment were utilized i.e. seed treatment and seedling treatment. No polyploidy could be obtained through seed treatment while seedling treatment responded well towards polyploidy. However, the status of autotetraploidy has been confirmed by cytomorphological investigations of treated plants as against its diploids counterparts. For the purpose, morphological parameters such as increased stomata size, pollen diameter, flower size, reproductive organs whereas reduction in plant height, leaf length, leaf breadth, stomata frequency, number of flowers/inflorescence etc. were appraised. Further, cytological observations were made that had clearly revealed the doubling of genome in the autotetraploids as compared to diploids. Meanwhile, pollen fertility and size of pollen grains were evaluated as well.

  16. Profiling Gene Expression in Germinating Brassica Roots.

    Science.gov (United States)

    Park, Myoung Ryoul; Wang, Yi-Hong; Hasenstein, Karl H

    2014-01-01

    Based on previously developed solid-phase gene extraction (SPGE) we examined the mRNA profile in primary roots of Brassica rapa seedlings for highly expressed genes like ACT7 (actin7), TUB (tubulin1), UBQ (ubiquitin), and low expressed GLK (glucokinase) during the first day post-germination. The assessment was based on the mRNA load of the SPGE probe of about 2.1 ng. The number of copies of the investigated genes changed spatially along the length of primary roots. The expression level of all genes differed significantly at each sample position. Among the examined genes ACT7 expression was most even along the root. UBQ was highest at the tip and root-shoot junction (RS). TUB and GLK showed a basipetal gradient. The temporal expression of UBQ was highest in the MZ 9 h after primary root emergence and higher than at any other sample position. Expressions of GLK in EZ and RS increased gradually over time. SPGE extraction is the result of oligo-dT and oligo-dA hybridization and the results illustrate that SPGE can be used for gene expression profiling at high spatial and temporal resolution. SPGE needles can be used within two weeks when stored at 4 °C. Our data indicate that gene expression studies that are based on the entire root miss important differences in gene expression that SPGE is able to resolve for example growth adjustments during gravitropism.

  17. The broccoli (Brassica oleracea) phloem tissue proteome.

    Science.gov (United States)

    Anstead, James A; Hartson, Steven D; Thompson, Gary A

    2013-11-07

    The transport of sugars, hormones, amino acids, proteins, sugar alcohols, and other organic compounds from the sites of synthesis to the sites of use or storage occurs through the conducting cells of the phloem. To better understand these processes a comprehensive understanding of the proteins involved is required. While a considerable amount of data has been obtained from proteomic analyses of phloem sap, this has mainly served to identify the soluble proteins that are translocated through the phloem network. In order to obtain more comprehensive proteomic data from phloem tissue we developed a simple dissection procedure to isolate phloem tissue from Brassica oleracea. The presence of a high density of phloem sieve elements was confirmed using light microscopy and fluorescently labeled sieve element-specific antibodies. To increase the depth of the proteomic analysis for membrane bound and associated proteins, soluble proteins were extracted first and subsequent extractions were carried out using two different detergents (SDS and CHAPSO). Across all three extractions almost four hundred proteins were identified and each extraction method added to the analysis demonstrating the utility of an approach combining several extraction protocols. The phloem was found to be enriched in proteins associated with biotic and abiotic stress responses and structural proteins. Subsequent expression analysis identified a number of genes that appear to be expressed exclusively or at very high levels in phloem tissue, including genes that are known to express specifically in the phloem as well as novel phloem genes.

  18. How To Produce and Characterize Transgenic Plants.

    Science.gov (United States)

    Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

    2002-01-01

    Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

  19. Increased Agrobacterium-mediated transformation and rooting efficiencies in canola (Brassica napus L.) from hypocotyl segment explants

    Science.gov (United States)

    Cardoza, V.; Stewart, C. N.

    2003-01-01

    An efficient protocol for the production of transgenic Brassica napus cv. Westar plants was developed by optimizing two important parameters: preconditioning time and co-cultivation time. Agrobacterium tumefaciens-mediated transformation was performed using hypocotyls as explant tissue. Two variants of a green fluorescent protein (GFP)-encoding gene--mGFP5-ER and eGFP--both under the constitutive expression of the cauliflower mosaic virus 35S promoter, were used for the experiments. Optimizing the preconditioning time to 72 h and co-cultivation time with Agrobacterium to 48 h provided the increase in the transformation efficiency from a baseline of 4% to 25%. With mGFP5-ER, the transformation rate was 17% and with eGFP it was 25%. Transgenic shoots were selected on 200 mg/l kanamycin. Rooting efficiency was 100% on half-strength Murashige and Skoog medium with 10 g/l sucrose and 0.5 mg/l indole butyric acid in the presence of kanamycin.

  20. Characterization of Oilseed Lipids from “DHA-Producing Camelina sativa”: A New Transformed Land Plant Containing Long-Chain Omega-3 Oils

    Directory of Open Access Journals (Sweden)

    Maged P. Mansour

    2014-02-01

    Full Text Available New and sustainable sources of long-chain (LC, ≥C20 omega-3 oils containing DHA (docosahexaenoic acid, 22:6ω3 are required to meet increasing demands. The lipid content of the oilseed of a novel transgenic, DHA-producing land plant, Camelina sativa, containing microalgal genes able to produce LC omega-3 oils, contained 36% lipid by weight with triacylglycerols (TAG as the major lipid class in hexane extracts (96% of total lipid. Subsequent chloroform-methanol (CM extraction recovered further lipid (~50% polar lipid, comprising glycolipids and phospholipids and residual TAG. The main phospholipid species were phosphatidyl choline and phosphatidyl ethanolamine. The % DHA was: 6.8% (of total fatty acids in the TAG-rich hexane extract and 4.2% in the polar lipid-rich CM extract. The relative level of ALA (α-linolenic acid, 18:3ω3 in DHA-camelina seed was higher than the control. Major sterols in both DHA- and control camelina seeds were: sitosterol, campesterol, cholesterol, brassicasterol and isofucosterol. C16–C22 fatty alcohols, including iso-branched and odd-chain alcohols were present, including high levels of iso-17:0, 17:0 and 19:0. Other alcohols present were: 16:0, iso-18:0, 18:0 and 18:1 and the proportions varied between the hexane and CM extracts. These iso-branched odd-chain fatty alcohols, to our knowledge, have not been previously reported. These components may be derived from wax esters, or free fatty alcohols.

  1. Environmental aspects and challenges of oilseed produced biodiesel in Southeast Asia

    Energy Technology Data Exchange (ETDEWEB)

    Jayed, M.H.; Masjuki, H.H.; Saidur, R.; Kalam, M.A.; Jahirul, M.I. [Department of Mechanical Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia)

    2009-12-15

    Research on alternative fuel for the vehemently growing number of automotivesis intensified due to environmental reasons rather than turmoil in energy price and supply. From the policy and steps to emphasis the use of biofuel by governments all around the world, this can be comprehended that biofuel have placed itself as a number one substitute for fossil fuels. These phenomena made Southeast Asia a prominent exporter of biodiesel. But thrust in biodiesel production from oilseeds of palm and Jatropha curcas in Malaysia, Indonesia and Thailand is seriously threatening environmental harmony. This paper focuses on this critical issue of biodiesels environmental impacts, policy, standardization of this region as well as on the emission of biodiesel in automotive uses. To draw a bottom line on feasibilities of different feedstock of biodiesel, a critical analysis on oilseed yield rate, land use, engine emissions and oxidation stability is reviewed. Palm oil based biodiesel is clearly ahead in all these aspects of feasibility, except in the case of NO{sub x} where it lags from conventional petro diesel. (author)

  2. Meat and bone meal as nitrogen and phosphorus supplier to cereals and oilseed rape

    Directory of Open Access Journals (Sweden)

    Anna Nogalska

    2014-02-01

    Full Text Available The purpose of this study was to evaluate the effect of meat and bone meal (MBM on cultivation of winter triticale, winter oilseed rape, winter wheat and maize. The average annual yields and protein yield achieved in crop rotation were studied. The field trials were carried out in north-eastern Poland in 2006–2010. The factor was dose of MBM: 1.0, 1.5, 2.0 and 2.5 t ha-1 year-1 or 2.0, 3.0, 4.0 and 5.0 t ha-1 every other year. The four-year experiment has proven that MBM is a valuable nitrogen and phosphorus fertilizer in cultivation of cereals and oilseed rape. By amendment of the tested meal into the soil it produced crop yield and protein yield similar to that achieved by mineral fertilization. However, the crude fat yield of rape was significantly higher under the influence of all the MBM doses. The yield-stimulating effect of MBM did not depend on the frequency of its application; therefore it is more convenient to apply it once every two years. Increasing MBM from 1.5 to 2.5 t ha-1 did not significantly increase any of the four crop yields, therefore for soils that had satisfactory nutrients content, 1 or 1.5 t ha-1 MBM is enough and increasing MBM will only increase economic burden for farmers and environmental risks.

  3. Genetic diversity in Carthamus tinctorius (Asteraceae; safflower), an underutilized oilseed crop.

    Science.gov (United States)

    Pearl, Stephanie A; Burke, John M

    2014-10-01

    • Underutilized crops are potentially valuable resources for meeting increasing food demands. Safflower, an oilseed crop, is an example of one such underutilized crop that thrives in moisture-limited areas. Characterization of the genetic diversity maintained within the gene pools of underutilized crops such as safflower is an important step in their further development.• A total of 190 safflower individuals, including 134 USDA accessions, 48 breeding lines from two private North American safflower breeding companies, and eight wild safflower individuals, were genotyped using 133 single nucleotide polymorphism (SNP) markers. We then used the resulting data to assess the amount and distribution of genetic diversity within and among these collections of safflower.• Although just a modest reduction in gene diversity was observed in the commercial breeding lines (relative to the other safflower groupings), safflower domestication was accompanied by a significant decrease in allelic richness. Further, our results suggest that most safflower breeding lines originated from a single pool of diversity within the Old World safflower germplasm.• Taken together, our results suggest that both the safflower germplasm collection and related, wild species harbor previously undocumented genetic diversity that could help fuel future improvement efforts. Paired with analyses of functional diversity, the molecular resources described herein will be thus be useful in the continued development of safflower as an oilseed crop. © 2014 Botanical Society of America, Inc.

  4. Camelina as a sustainable oilseed crop: contributions of plant breeding and genetic engineering.

    Science.gov (United States)

    Vollmann, Johann; Eynck, Christina

    2015-04-01

    Camelina is an underutilized Brassicaceae oilseed plant with a considerable agronomic potential for biofuel and vegetable oil production in temperate regions. In contrast to most Brassicaceae, camelina is resistant to alternaria black spot and other diseases and pests. Sequencing of the camelina genome revealed an undifferentiated allohexaploid genome with a comparatively large number of genes and low percentage of repetitive DNA. As there is a close relationship between camelina and the genetic model plant Arabidopsis, this review aims at exploring the potential of translating basic Arabidopsis results into a camelina oilseed crop for food and non-food applications. Recently, Arabidopsis genes for drought resistance or increased photosynthesis and overall productivity have successfully been expressed in camelina. In addition, gene constructs affecting lipid metabolism pathways have been engineered into camelina for synthesizing either long-chain polyunsaturated fatty acids, hydroxy fatty acids or high-oleic oils in particular camelina strains, which is of great interest in human food, industrial or biofuel applications, respectively. These results confirm the potential of camelina to serve as a biotechnology platform in biorefinery applications thus justifying further investment in breeding and genetic research for combining agronomic potential, unique oil quality features and biosafety into an agricultural production system. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Guizotia abyssinica (L.f.) cass.: An untapped oilseed resource for the future

    International Nuclear Information System (INIS)

    Yadav, Sangita; Kumar, Sandeep; Hussain, Zakir; Suneja, Poonam; Yadav, Shiv K.; Nizar, M.A.; Dutta, M.

    2012-01-01

    Amongst minor oilseed crops, niger has not been given considerable importance as compared to the sunflower, safflower, linseed and sesame. A study on 35 niger genotypes was conducted to evaluate their potential in terms of oil quantity, quality and biodiesel traits. Oil quality was determined by fatty acid composition for two consecutive years and the results were compared with other minor oilseed crops. Niger oil has four major fatty acids namely palmitic, stearic, oleic and linoleic acid. Genotypes which showed consistent fatty acid profile for the 2 consecutive years were also reported. Oleic and linoleic fatty acids showed high variability ranging from 23.52 to 53.05% and 32.03–58.28%, respectively. High oleic (IC372586) and linoleic acid (IC211078, IC211080 and IC259393) containing genotypes were also identified. Total unsaturated fatty acid (81.79–85.06%) was found to be higher than total saturated fatty acid (14.94–18.21%). Based on saponification number (200.16–202.16) and Iodine value (105.69–126.7 g I 2 100 g −1 ) the niger oil finds its application in various industries while cetane number confirmed the use of it as biodiesel. -- Highlights: ► High variability in oil quality. ► TUSFA higher than TSFA. ► Niger oil- a biodiesel source.

  6. Environmental aspects and challenges of oilseed produced biodiesel in Southeast Asia

    International Nuclear Information System (INIS)

    Jayed, M.H.; Masjuki, H.H.; Saidur, R.; Kalam, M.A.; Jahirul, M.I.

    2009-01-01

    Research on alternative fuel for the vehemently growing number of automotivesis intensified due to environmental reasons rather than turmoil in energy price and supply. From the policy and steps to emphasis the use of biofuel by governments all around the world, this can be comprehended that biofuel have placed itself as a number one substitute for fossil fuels. These phenomena made Southeast Asia a prominent exporter of biodiesel. But thrust in biodiesel production from oilseeds of palm and Jatropha curcas in Malaysia, Indonesia and Thailand is seriously threatening environmental harmony. This paper focuses on this critical issue of biodiesels environmental impacts, policy, standardization of this region as well as on the emission of biodiesel in automotive uses. To draw a bottom line on feasibilities of different feedstock of biodiesel, a critical analysis on oilseed yield rate, land use, engine emissions and oxidation stability is reviewed. Palm oil based biodiesel is clearly ahead in all these aspects of feasibility, except in the case of NO x where it lags from conventional petro diesel. (author)

  7. Antioxidant Potential of the Extracts, Fractions and Oils Derived from Oilseeds

    Directory of Open Access Journals (Sweden)

    Shagufta Ishtiaque

    2013-10-01

    Full Text Available The polyphenolic extracts and oils were obtained from ajwain, mustard, fenugreek and poppy seeds. The extracts were partitioned into acidic and neutral polyphenolic fractions and following estimation of total phenolics in the crude extract, acidic and neutral fractions and oil, all were analyzed for their DPPH (2,2-diphenyl-1-picrylhydrazyl scavenging potential, ferric reducing ability and chelating power. The highest amount of polyphenols was found in ajwain (8330 ± 107, then in mustard seeds (2844 ± 56.00 and in fenugreek (1130 ± 29.00, and least in poppy seeds (937 ± 18.52. The higher amounts of polyphenols were estimated in neutral fraction compared to acidic (p fenugreek and least by poppy seed extracts (p < 0.05. The reducing power and the chelating effect of the oilseeds followed the same order as DPPH, but higher % chelation was shown by neutral than acidic fraction (p < 0.05. Though low in polyphenols, the oil fractions were as strong antioxidants as the acidic one. Though oilseeds are used in very small quantity in food, they are potential sources of natural antioxidants and may replace synthetic ones.

  8. Progress on researches of transgenic alfalfa

    International Nuclear Information System (INIS)

    Guo Huiqin; Wang Mi; Ren Weibo; Xu Zhu; Chen Libo

    2010-01-01

    In this paper, the progress on the researches of transgenic alfalfa in the past two decades had been reviewed in the aspects of regeneration system, transformation, improvement of the important traits and so on. Moreover, such problems as variation of transgene expression and safety of transgenic plant had also been discussed and propose had been given for the future research work. (authors)

  9. What limits production of unusual monoenoic fatty acids in transgenic plants?

    Science.gov (United States)

    Suh, Mi Chung; Schultz, David J; Ohlrogge, John B

    2002-08-01

    Unusual monounsaturated fatty acids are major constituents (greater than 80%) in seeds of Coriandrum sativum L. (coriander) and Thunbergia alata Bojer, as well as in glandular trichomes (greater than 80% derived products) of Pelargonium x hortorum (geranium). These diverged fatty acid structures are produced via distinct plastidial acyl-acyl carrier protein (ACP) desaturases. When expressed in Arabidopsis thaliana (L.) Heynh. under strong seed-specific promoters the unusual acyl-ACP desaturases resulted in accumulation of unusual monoene fatty acids at 1-15% of seed fatty acid mass. In this study, we have examined several factors that potentially limit higher production of unusual monoenes in transgenic oilseeds. (i) Immunoblots indicated that the introduced desaturases were expressed at levels equivalent to or higher than the endogenous delta9 18:0-ACP desaturase. However, the level of unusual fatty acid produced in transgenic plants was not correlated with the level of desaturase expression. (ii) The unusual desaturases were expressed in several backgrounds, including antisense 18:0-ACP desaturase plants, in fab1 mutants, and co-expressed with specialized ACP or ferredoxin isoforms. None of these experiments led to high production of expected products. (iii) No evidence was found for degradation of the unusual fatty acids during seed development. (iv) Petroselinic acid added to developing seeds was incorporated into triacylglycerol as readily as oleic acid, suggesting no major barriers to its metabolism by enzymes of glycerolipid assembly. (v) In vitro and in situ assay of acyl-ACP desaturases revealed a large discrepancy of activity when comparing unusual acyl-ACP desaturases with the endogenous delta9 18:0-ACP desaturase. The combined results, coupled with the sensitivity of acyl-ACP desaturase activity to centrifugation and low salt or detergent suggests low production of unusual monoenes in transgenic plants may be due to the lack of, or incorrect assemble of

  10. Genome-wide microsatellite characterization and marker development in the sequenced Brassica crop species.

    Science.gov (United States)

    Shi, Jiaqin; Huang, Shunmou; Zhan, Jiepeng; Yu, Jingyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong

    2014-02-01

    Although much research has been conducted, the pattern of microsatellite distribution has remained ambiguous, and the development/utilization of microsatellite markers has still been limited/inefficient in Brassica, due to the lack of genome sequences. In view of this, we conducted genome-wide microsatellite characterization and marker development in three recently sequenced Brassica crops: Brassica rapa, Brassica oleracea and Brassica napus. The analysed microsatellite characteristics of these Brassica species were highly similar or almost identical, which suggests that the pattern of microsatellite distribution is likely conservative in Brassica. The genomic distribution of microsatellites was highly non-uniform and positively or negatively correlated with genes or transposable elements, respectively. Of the total of 115 869, 185 662 and 356 522 simple sequence repeat (SSR) markers developed with high frequencies (408.2, 343.8 and 356.2 per Mb or one every 2.45, 2.91 and 2.81 kb, respectively), most represented new SSR markers, the majority had determined physical positions, and a large number were genic or putative single-locus SSR markers. We also constructed a comprehensive database for the newly developed SSR markers, which was integrated with public Brassica SSR markers and annotated genome components. The genome-wide SSR markers developed in this study provide a useful tool to extend the annotated genome resources of sequenced Brassica species to genetic study/breeding in different Brassica species.

  11. Control of slug damage to oilseed rape and wheat with imidacloprid seed dressings in laboratory and field experiments

    NARCIS (Netherlands)

    Simms, L.C.; Ester, A.; Wilson, M.J.

    2006-01-01

    Slugs are common pests of oilseed and cereal crops in Europe and are currently controlled using bait pellets that often fail to give adequate protection: Here we investigate the potential of the broad-spectrum insecticide imidacloprid, previously suggested to have activity against slugs, to control

  12. Genetic variability among advanced lines of brassica

    International Nuclear Information System (INIS)

    Ullah, N.; Farhatullah, A.; Rahman, H.U.; Fayyaz, L.

    2015-01-01

    Genetic variability for morphological and biochemical traits among six advanced lines (F10:11) of brassica was studied at The University of Agriculture Peshawar during crop season of 2012-13. These lines were developed through interspecific hybridization. Significant differences at (p=0.01) for plant height, main, pods main raceme-1, pod length, seed yield plant-1 and protein content at (p=0.05) for 100-seed weight, oil content were recorded. The advanced line, AUP-05 produced the maximum seed yield plant-1 (19.73 g), protein content (24.56%), 100-seed weight (0.64 g). Advanced line AUP-04 had the highest erucic acid (50.31%), linolenic acid (10.60%) and was late maturing (179.33). Advanced line AUP-06 produced the high oil content (48.82%). Advanced line AUP-03 produced comparatively longer main raceme (69.32 cm). Environmental variance was smaller than genotypic variance for majority of the traits. Genotypic and phenotypic coefficients of variation ranged from 2.45 to 25.67% and 2.50 to 27.68%, respectively. Heritability was high for majority of the traits. The maximum heritability was recorded for plant height (0.61), main raceme length (0.81), pods main raceme-1 (0.74), seed yield plant-1 (0.86) and protein content (0.77). Moderate heritability was observed for oil (0.58) contents. Heritability for 100-seed weight (0.30) was the lowest. These lines may be released as new improved varieties for specific parameters. (author)

  13. Oxygen dependency of germinating Brassica seeds

    Science.gov (United States)

    Park, Myoung Ryoul; Hasenstein, Karl H.

    2016-02-01

    Establishing plants in space, Moon or Mars requires adaptation to altered conditions, including reduced pressure and composition of atmospheres. To determine the oxygen requirements for seed germination, we imbibed Brassica rapa seeds under varying oxygen concentrations and profiled the transcription patterns of genes related to early metabolism such as starch degradation, glycolysis, and fermentation. We also analyzed the activity of lactate dehydrogenase (LDH) and alcohol dehydrogenase (ADH), and measured starch degradation. Partial oxygen pressure (pO2) greater than 10% resulted in normal germination (i.e., protrusion of radicle about 18 hours after imbibition) but lower pO2 delayed and reduced germination. Imbibition in an oxygen-free atmosphere for three days resulted in no germination but subsequent transfer to air initiated germination in 75% of the seeds and the root growth rate was transiently greater than in roots germinated under ambient pO2. In hypoxic seeds soluble sugars degraded faster but the content of starch after 24 h was higher than at ambient oxygen. Transcription of genes related to starch degradation, α-amylase (AMY) and Sucrose Synthase (SUS), was higher under ambient O2 than under hypoxia. Glycolysis and fermentation pathway-related genes, glucose phosphate isomerase (GPI), 6-phosphofructokinase (PFK), fructose 1,6-bisphosphate aldolase (ALD), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), pyruvate decarboxylase (PDC), LDH, and ADH, were induced by low pO2. The activity of LDH and ADH was the highest in anoxic seeds. Germination under low O2 conditions initiated ethanolic fermentation. Therefore, sufficient oxygen availability is important for germination before photosynthesis provides necessary oxygen and the determination of an oxygen carrying capacity is important for uniform growth in space conditions.

  14. Plant regeneration of Brassica oleracea subsp. italica (Broccoli) CV ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-03

    Jun 3, 2009 ... Department of Agriculture Technology, Faculty of Agriculture, Universiti Putra Malaysia, 43400 Serdang, Selangor Darul. Ehsan, Malaysia. Accepted 20 March, 2009. Hypocotyls and shoot tips were used as explants in in vitro plant regeneration of broccoli (Brassica oleracea subsp.italica) cv. Green Marvel.

  15. Processing of Brassica seeds for feedstock in biofuels production

    Science.gov (United States)

    Several Brassica species are currently being evaluated to develop regionalized production systems based on their suitability to the environment and with the prevailing practices of growing commodity food crops like wheat, corn, and soybeans. This integrated approach to farming will provide high qual...

  16. Genetic diversity analysis of mustard ( Brassica spp.) germplasm ...

    African Journals Online (AJOL)

    Molecular characterization of 16 mustard (Brassica spp.) genotypes by using 12 RAPD markers revealed that three primers GLA-11, OPB-04 and OPD-02 showed good technical resolution and sufficient variations among different genotypes. A total of 40 RAPD bands were scored of which 38 (94.87%) polymorphic ...

  17. Phytotoxicity assay for seed production using Brassica rapa L.

    Science.gov (United States)

    Although pesticide drift can affect crop yield adversely, current plant testing protocols emphasize only the potential impacts on vegetative plant growth. The present study was conducted to determine whether a plant species with a short life cycle, such as Brassica rapa L. Wiscon...

  18. Phenotyping of Brassica napus for high oil content

    Science.gov (United States)

    Multi-trait and multi-growth stage phenotyping may improve our ability to assess the dynamic changes in the B. napus phenome under spatiotemporal field conditions. A minimum set of phenotypic traits that can integrate ontogeny and architecture of Brassica napus L. is required for breeding and select...

  19. Study of total seed storage protein in indigenous Brassica species ...

    African Journals Online (AJOL)

    hope&shola

    2010-11-08

    Nov 8, 2010 ... Brassica napus. Acc. No Location. Acc. No Location. Acc. No Location. Acc. No Location. 500. Islamsbad. 522. Hassan Abdal. 544. Naseer abad. 566. Rawalpindi. 501. Islamsbad. 523. Bannu. 545. Jaglot. 567. Karak. 502. Rawalakot. 524. Karak. 546. Haripur North. 568. Akora Khattack. 503. Sibi. 525.

  20. Mineral, vitamin C and crude protein contents in kale ( Brassica ...

    African Journals Online (AJOL)

    This study compares mineral, vitamin C and crude protein contents at different harvesting stages in kale (Brassica oleraceae var. acephala). Three different harvest periods as first harvest stage (at the rosette stage), second harvest stage (at the budding stage) and third harvest stage (at the flowering/blooming stage) were ...

  1. Suitability of an artificial diet for rape aphid, Brevicoryne brassicae ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-15

    Sep 15, 2009 ... Brevicoryne brassicae, using life table parameters. A. Balvasi1* ... In this work, suitability of an artificial diet was studied through age-specific life tables. Development ... In large measure, the success of entomology over the past century is ..... balance on the improvement of an artificial diet for a biotype of.

  2. Molecular phylogenetic implications in Brassica napus based on ...

    Indian Academy of Sciences (India)

    Brassica napus L. (canola, rapeseed) is one of the most important oil crops in many countries (Abdelmigid 2012;. Fayyaz et al. 2014), and thought to have originated from a cross where the maternal donor was closely related to two diploid species, B. oleracea (CC, 2n = 18) and B. rapa (AA, 2n = 20). Here, molecular ...

  3. Occurrence of Escherichia coli in Brassica rapa L. chinensis ...

    African Journals Online (AJOL)

    Low quality water has become valuable resource with restricted or unrestricted use in food production depending on its quality. This study has quantified the occurrence of Escherichia coli in Brassica rapa L. chinensis (Chinese cabbage) vegetables and low quality irrigation water. A total of 106 samples including Chinese ...

  4. Glucosinolates during preparation of Brassica vegetables in Indonesia

    NARCIS (Netherlands)

    Nugrahedi, P.Y.

    2015-01-01

    Title:

    Glucosinolates during preparation of Brassica vegetables in Indonesia

    Dutch translation of title:

    Effecten van Indonesische bereidingsmethoden op gezondheidsbevorderende stoffen in groenten

    Title/description

  5. Molecular characterization of some local and exotic Brassica juncea ...

    African Journals Online (AJOL)

    SERVER

    2007-07-18

    Jul 18, 2007 ... 1Institute of Biotechnology and Genetic Engineering (IBGE) NWFP Agricultural University, Peshawar, Pakistan. 2Department of Plant Breeding and Genetics, NWFP Agricultural University Peshawar, Pakistan. Accepted 14 June, 2007. The production of Brassica germplasm with a wider genetic base is ...

  6. Local cabbage ( Brassica oleracea var. capitata L.) populations from ...

    African Journals Online (AJOL)

    In previous experiments, we were able to augment cabbages (Brassica oleracea L. var. capitata L.) with two new local open pollinated (OP) populations and one cultivar. The type of use indicated that these are cabbages with thinner and juicier leaves, which predisposes their heads for fine grating and also makes their ...

  7. Identification of seed-related QTL in Brassica rapa

    NARCIS (Netherlands)

    Bagheri, H.; Pino del Carpio, D.; Hanhart, C.J.; Bonnema, A.B.; Keurentjes, J.J.B.; Aarts, M.G.M.

    2013-01-01

    To reveal the genetic variation, and loci involved, for a range of seed-related traits, a new F2 mapping population was developed by crossing Brassica rapa ssp. parachinensis L58 (CaiXin) with B. rapa ssp. trilocularis R-o-18 (spring oil seed), both rapid flowering and self-compatible. A linkage map

  8. Factors affecting the density of Brassica napus seeds

    NARCIS (Netherlands)

    Young, L.; Jalink, H.; Denkert, R.; Reaney, M.

    2006-01-01

    Brassica napus seed is composed of low density oil (0.92 g.cm(-3)) and higher density solids (1.3-1.45 g.cm(-3)). Seed buoyant density may potentially be used to determine seed oil content and to separate seeds with different oil contents, however, we have found that seeds with the lowest buoyant

  9. Immunopurification and characterization of a rape ( Brassica napus L.)

    African Journals Online (AJOL)

    Lipase or triacylglycerol acylhydrolase (E.C.3.1.1.3) was purified to homogeneity from rapeseed-germinated cotyledons (Brassica napus L.). The purification scheme involved homogenization, centrifugation, ultracentrifugation and affinity chromatography using polyclonal antibodies raised against porcine pancreatic lipase.

  10. Respon Tiga Varietas Sawi (Brassica Rapa L.) Terhadap Cekaman Air

    OpenAIRE

    Moctava, Mohammad Aries; Koesriharti, Koesriharti; Maghfoer, Mochammad Dawam

    2013-01-01

    Kebutuhan air tanaman berbeda-beda tergantung pada jenis tanamannya. Ketersediaan air bagi tanaman yang tidak mencukupi akan mempengaruhi morfologi dan fisiologis sehingga pertumbuhan dan hasil tanaman. Tujuan dari penelitian mendapatkan varietas sawi (Brassica rapa L.) yang tahan terhadap cekaman air. Penelitian dilaksanakan pada bulan Oktober sampai dengan Desember 2012. Tempat penelitian Kebun Percobaan Fakultas Pertanian Brawijaya, Desa Jatikerto, Kabupaten Malang.Penelitian menggunakan ...

  11. Biotechnology network promotes knowledge of transgenics

    International Nuclear Information System (INIS)

    Blanco Picado, Patricia; Valdez Melara, Marta

    2015-01-01

    Red de Ingenieria Genetica Aplicada al Mejoramiento de Cultivos Tropicales (Rigatrop) integrated by a group of scientists from the Universidad de Costa Rica (UCR), Universidad Nacional (UNA) and of the Instituto Tecnologico de Costa Rica (TEC) have organized two forums on the topic of transgenics. The first forum has shown successful experiences of development of transgenic crops in Latin America, as for example: the transgenic bean, project realized in Brazil and transgenic eggplant in Bangladesh. The second forum has been about transgenics and environment effected at the UCR, on the occasion of World Environment Day. Rigatrop members are working currently in two projects applying biotechnological tools to coffee [es

  12. Atmospheric H2S and SO2 as sulfur sources for Brassica juncea and Brassica rapa: Regulation of sulfur uptake and assimilation

    NARCIS (Netherlands)

    Aghajanzadeh, T.; Hawkesford, M.J.; De Kok, L.J.

    2016-01-01

    Brassica juncea and Brassica rapa were able to utilize foliarly absorbed H2S and SO2 as sulfur source for growth and resulted in a decreased sink capacity of the shoot for sulfur supplied by the root and subsequently in a partial decrease in sulfate uptake capacity of the roots. Sulfate-deprived

  13. Functional analysis and tissue-differential expression of four FAD2 genes in amphidiploid Brassica napus derived from Brassica rapa and Brassica oleracea.

    Science.gov (United States)

    Lee, Kyeong-Ryeol; In Sohn, Soo; Jung, Jin Hee; Kim, Sun Hee; Roh, Kyung Hee; Kim, Jong-Bum; Suh, Mi Chung; Kim, Hyun Uk

    2013-12-01

    Fatty acid desaturase 2 (FAD2), which resides in the endoplasmic reticulum (ER), plays a crucial role in producing linoleic acid (18:2) through catalyzing the desaturation of oleic acid (18:1) by double bond formation at the delta 12 position. FAD2 catalyzes the first step needed for the production of polyunsaturated fatty acids found in the glycerolipids of cell membranes and the triacylglycerols in seeds. In this study, four FAD2 genes from amphidiploid Brassica napus genome were isolated by PCR amplification, with their enzymatic functions predicted by sequence analysis of the cDNAs. Fatty acid analysis of budding yeast transformed with each of the FAD2 genes showed that whereas BnFAD2-1, BnFAD2-2, and BnFAD2-4 are functional enzymes, and BnFAD2-3 is nonfunctional. The four FAD2 genes of B. napus originated from synthetic hybridization of its diploid progenitors Brassica rapa and Brassica oleracea, each of which has two FAD2 genes identical to those of B. napus. The BnFAD2-3 gene of B. napus, a nonfunctional pseudogene mutated by multiple nucleotide deletions and insertions, was inherited from B. rapa. All BnFAD2 isozymes except BnFAD2-3 localized to the ER. Nonfunctional BnFAD2-3 localized to the nucleus and chloroplasts. Four BnFAD2 genes can be classified on the basis of their expression patterns. © 2013.

  14. Transgenic Epigenetics: Using Transgenic Organisms to Examine Epigenetic Phenomena

    Directory of Open Access Journals (Sweden)

    Lori A. McEachern

    2012-01-01

    Full Text Available Non-model organisms are generally more difficult and/or time consuming to work with than model organisms. In addition, epigenetic analysis of model organisms is facilitated by well-established protocols, and commercially-available reagents and kits that may not be available for, or previously tested on, non-model organisms. Given the evolutionary conservation and widespread nature of many epigenetic mechanisms, a powerful method to analyze epigenetic phenomena from non-model organisms would be to use transgenic model organisms containing an epigenetic region of interest from the non-model. Interestingly, while transgenic Drosophila and mice have provided significant insight into the molecular mechanisms and evolutionary conservation of the epigenetic processes that target epigenetic control regions in other model organisms, this method has so far been under-exploited for non-model organism epigenetic analysis. This paper details several experiments that have examined the epigenetic processes of genomic imprinting and paramutation, by transferring an epigenetic control region from one model organism to another. These cross-species experiments demonstrate that valuable insight into both the molecular mechanisms and evolutionary conservation of epigenetic processes may be obtained via transgenic experiments, which can then be used to guide further investigations and experiments in the species of interest.

  15. BnEPFL6, an EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) secreted peptide gene, is required for filament elongation in Brassica napus.

    Science.gov (United States)

    Huang, Yi; Tao, Zhangsheng; Liu, Qiong; Wang, Xinfa; Yu, Jingyin; Liu, Guihua; Wang, Hanzhong

    2014-07-01

    Inflorescence architecture, pedicel length and stomata patterning in Arabidopsis thaliana are specified by inter-tissue communication mediated by ERECTA and its signaling ligands in the EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) family of secreted cysteine-rich peptides. Here, we identified and characterized BnEPFL6 from Brassica napus. Heterologous expression of this gene under the double enhanced CaMV promoter (D35S) in Arabidopsis resulted in shortened stamen filaments, filaments degradation, and reduced filament cell size that displayed down-regulated expression of AHK2, in which phenotypic variation of ahk2-1 mutant presented highly consistent with that of BnEPFL6 transgenic lines. Especially, the expression level of BnEPFL6 in the shortened filaments of four B. napus male sterile lines (98A, 86A, SA, and Z11A) was similar to that of BnEPFL6 in the transgenic Arabidopsis lines. The activity of pBnEPFL6.2::GUS was intensive in the filaments of transgenic lines. These observations reveal that BnEPFL6 plays an important role in filament elongation and may also affect organ morphology and floral organ specification via a BnEPFL6-mediated cascade.

  16. Molecular breeding in Brassica for salt tolerance: importance of microsatellite (SSR) markers for molecular breeding in Brassica

    Science.gov (United States)

    Kumar, Manu; Choi, Ju-Young; Kumari, Nisha; Pareek, Ashwani; Kim, Seong-Ryong

    2015-01-01

    Salinity is one of the important abiotic factors for any crop management in irrigated as well as rainfed areas, which leads to poor harvests. This yield reduction in salt affected soils can be overcome by improving salt tolerance in crops or by soil reclamation. Salty soils can be reclaimed by leaching the salt or by cultivation of salt tolerance crops. Salt tolerance is a quantitative trait controlled by several genes. Poor knowledge about mechanism of its inheritance makes slow progress in its introgression into target crops. Brassica is known to be a good reclamation crop. Inter and intra specific variation within Brassica species shows potential of molecular breeding to raise salinity tolerant genotypes. Among the various molecular markers, SSR markers are getting high attention, since they are randomly sparsed, highly variable and show co-dominant inheritance. Furthermore, as sequencing techniques are improving and softwares to find SSR markers are being developed, SSR markers technology is also evolving rapidly. Comparative SSR marker studies targeting Arabidopsis thaliana and Brassica species which lie in the same family will further aid in studying the salt tolerance related QTLs and subsequent identification of the “candidate genes” and finding out the origin of important QTLs. Although, there are a few reports on molecular breeding for improving salt tolerance using molecular markers in Brassica species, usage of SSR markers has a big potential to improve salt tolerance in Brassica crops. In order to obtain best harvests, role of SSR marker driven breeding approaches play important role and it has been discussed in this review especially for the introgression of salt tolerance traits in crops. PMID:26388887

  17. Molecular breeding in Brassica for salt tolerance: importance of microsatellite (SSR) markers for molecular breeding in Brassica.

    Science.gov (United States)

    Kumar, Manu; Choi, Ju-Young; Kumari, Nisha; Pareek, Ashwani; Kim, Seong-Ryong

    2015-01-01

    Salinity is one of the important abiotic factors for any crop management in irrigated as well as rainfed areas, which leads to poor harvests. This yield reduction in salt affected soils can be overcome by improving salt tolerance in crops or by soil reclamation. Salty soils can be reclaimed by leaching the salt or by cultivation of salt tolerance crops. Salt tolerance is a quantitative trait controlled by several genes. Poor knowledge about mechanism of its inheritance makes slow progress in its introgression into target crops. Brassica is known to be a good reclamation crop. Inter and intra specific variation within Brassica species shows potential of molecular breeding to raise salinity tolerant genotypes. Among the various molecular markers, SSR markers are getting high attention, since they are randomly sparsed, highly variable and show co-dominant inheritance. Furthermore, as sequencing techniques are improving and softwares to find SSR markers are being developed, SSR markers technology is also evolving rapidly. Comparative SSR marker studies targeting Arabidopsis thaliana and Brassica species which lie in the same family will further aid in studying the salt tolerance related QTLs and subsequent identification of the "candidate genes" and finding out the origin of important QTLs. Although, there are a few reports on molecular breeding for improving salt tolerance using molecular markers in Brassica species, usage of SSR markers has a big potential to improve salt tolerance in Brassica crops. In order to obtain best harvests, role of SSR marker driven breeding approaches play important role and it has been discussed in this review especially for the introgression of salt tolerance traits in crops.

  18. Transgenic Arabidopsis Gene Expression System

    Science.gov (United States)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  19. Effects of prepartum diets supplemented with rolled oilseeds on calf birth weight, postpartum health, feed intake, milk yield, and reproductive performance of dairy cows.

    Science.gov (United States)

    Salehi, R; Colazo, M G; Oba, M; Ambrose, D J

    2016-05-01

    The objectives were to determine the effects of supplemental fat (no oilseed vs. oilseed) during late gestation and the source of fat (canola vs. sunflower seed), on dry matter intake (DMI), plasma metabolite concentrations, milk production and composition, calf birth weight, postpartum health disorders, ovarian function and reproductive performance in dairy cows. Pregnant Holstein cows, blocked by body condition and parity, were assigned to 1 of 3 diets containing rolled canola seed (high in oleic acid; n=43) or sunflower (high in linoleic acid; n=45) at 8% of dry matter, or no oilseed (control; n=43), for the last 35±2 d of pregnancy. After calving, all cows received a common lactation diet. Blood samples were collected at wk -3 (i.e., 2 wk after initiation of prepartum diets) and at wk +1, +2, +3, +4 and +5 postpartum to determine the concentration of fatty acids (mEq/dL), β-hydroxybutyrate (mg/dL), and glucose (mg/dL). Ovarian ultrasonography was performed twice weekly to determine the first appearance of dominant (10mm) and preovulatory-size (≥16mm) follicles, and ovulation. Uterine inflammatory status based on the proportion of polymorphonuclear leukocytes (PMN; subclinical endometritis: >8% PMN) was assessed at d 25±1 postpartum. Significant parity by treatment interactions were observed for DMI and milk yield. Prepartum oilseed supplementation, more specifically sunflower seed supplementation, increased postpartum DMI in primiparous cows without affecting prepartum DMI or milk yield. Contrarily, in multiparous cows, prepartum oilseed supplementation decreased both prepartum and postpartum DMI and milk yield during the first 2 wk. Regardless of parity, prepartum feeding of canola reduced postpartum DMI compared with those fed sunflower. Mean fatty acids concentrations at wk -3 were greater in cows given supplemental oilseed than those fed no oilseeds. Gestation length and calf birth weight were increased in cows given supplemental oilseed prepartum

  20. Radiation effects on Brassica seeds and seedlings

    Science.gov (United States)

    Deoli, Naresh; Hasenstein, Karl H.

    2016-07-01

    Space radiation consists of high energy charged particles and affects biological systems, but because of its stochastic, non-directional nature is difficult to replicate on Earth. Radiation damages biological systems acutely at high doses or cumulatively at low doses through progressive changes in DNA organization. These damages lead to death or cause of mutations. While radiation biology typically focuses on mammalian or human systems, little is known as to how radiation affects plants. In addition, energetic ion beams are widely used to generate new mutants in plants considering their high-LET (Linear Energy Transfer) as compared to gamma rays and X-rays. Understanding the effect of ionizing radiation on plant provides a basis for studying effects of radiation on biological systems and will help mitigate (space) radiation damage in plants. We exposed dry and imbibed Brassica rapa seeds and seedling roots to proton beams of varying qualities and compared the theoretical penetration range of different energy levels with observable growth response. We used 1, 2 and 3 MeV protons in air at the varying fluences to investigate the effect of direct irradiation on the seeds (1012 - 1015 ions/cm2) and seedlings (1013 ions/cm2). The range of protons in the tissue was calculated using Monte-Carlo based SRIM (Stopping and Range of Ions in Matter) software. The simulation and biological results indicate that ions did not penetrate the tissue of dry or hydrated seeds at all used ion energies. Therefore the entire energy was transferred to the treated tissue. Irradiated seeds were germinated vertically under dim light and roots growth was observed for two days after imbibition. The LD50 of the germination was about 2×1014 ions/cm2 and about 5×1014 ions/cm2 for imbibed and dry seeds, respectively. Since seedlings are most sensitive to gravity, the change in gravitropic behavior is a convenient means to assess radiation damage on physiological responses other than direct tissue

  1. Characterization and expression patterns of small RNAs in synthesized Brassica hexaploids.

    Science.gov (United States)

    Shen, Yanyue; Zhao, Qin; Zou, Jun; Wang, Wenliang; Gao, Yi; Meng, Jinling; Wang, Jianbo

    2014-06-01

    Polyploidy has played an important role in promoting plant evolution through genomic merging and doubling. We used high-throughput sequencing to compare miRNA expression profiles between Brassica hexaploid and its parents. A total of 613, 784 and 742 known miRNAs were identified in Brassica rapa, Brassica carinata, and Brassica hexaploid, respectively. We detected 618 miRNAs were differentially expressed (log(2)Ratio ≥ 1, P ≤ 0.05) between Brassica hexaploid and its parents, and 425 miRNAs were non-additively expressed in Brassica hexaploid, which suggest a trend of non-additive miRNA regulation following hybridization and polyploidization. Remarkably, majority of the non-additively expressed miRNAs in the Brassica hexaploid are repressed, and there was a bias toward repression of B. rapa miRNAs, which is consistent with the progenitor-biased gene repression in the synthetic allopolyploids. In addition, we identified 653 novel mature miRNAs in Brassica hexaploid and its parents. Finally, we found that almost all the non-additive accumulation of siRNA clusters exhibited a low-parent pattern in Brassica hexaploid. Non-additive small RNA regulation is involved in a range of biological pathways, probably providing a driving force for variation and adaptation in allopolyploids.

  2. Oilseed cultivars developed from induced mutations and mutations altering fatty acid composition

    International Nuclear Information System (INIS)

    Bhatia, C.R.; Nichterlein, K.; Maluszynski, M.

    1999-01-01

    One hundred and sixty-three cultivars of annual oilseed crops, developed using induced mutations, have been officially approved and released for cultivation in 26 countries. The maximum number of cultivars have been released in soybean (58), followed by groundnut (44), sesame (16), linseed (15), rapeseed (14), Indian mustard (8), castorbean (4), white mustard (3) and sunflower (1). The majority (118 of 163) of the cultivars have been developed as direct mutants and 45 of 163 by using the induced mutants in a crossing programme. While in soybean 53 out of 58 cultivars were selected as direct mutants, in groundnut 22 from 44 were developed after hybridization. Eighty-three cultivars were developed directly by exposing seeds to gamma or X-rays. Attempts have been made to infer the successful dose range, defined as the range which led to the development, registration and release of the maximum number of mutant cultivars for gamma and X-rays. The successful dose ranges in Gy for the main oilseed crops are: soybean 100-200, groundnut 150-250, rapeseed 600-800, Indian mustard 700 and sesame 100-200. The main characteristics of the new cultivars, besides higher yield, are altered plant type, early flowering and maturity and oil content. Mutants altering fatty acid composition have been isolated in soybean, rapeseed, sunflower, linseed and minor oil crops. New cultivars having altered fatty acid composition have been released in rapeseed, sunflower and linseed. The latter, previously grown for non-edible oil, has been converted to a new edible oil crop. (author)

  3. The influence of roasting and baking on fatty acids composition of consumer oilseeds

    Directory of Open Access Journals (Sweden)

    Natalia Mikołajczak

    2017-09-01

    Full Text Available Introduction and aim: Foods rich in nutrients have a positive effect on the human body. They are beneficial both for the health and the mind of human. Good sources of essential fatty acids and other biologically active compounds are oilseeds. It is important to include them in your daily diet. They can be added to dishes or serve as a snack. Brief description of the state of knowledge: The aim of this study was to evaluate of fatty acid composition in selected consumer oilseeds: sunflower, sesame, flax after application of typical technological processes such as roasting and baking, in different temperature, power and time ranges. In the research materials (before and after modification, the fatty acid composition was determined by gas chromatography. Summary: Based on obtained results, it was found that roasting and baking have an influence on the change in the content and composition of fatty acids. The strength of influence was dependent on the parameters (e.g. type of seed, temperature, time, power, which were used in the research. The roasting in the oven caused changes in the composition of saturated and unsaturated fatty acids, both in flax and sunflower seeds. The roasting in the microwave at 900 W affected on saturated fatty acids composition in flax seeds, similarly sunflower. In the case of sesame seeds, the influence of time on the content of mono- and polyunsaturated fatty acids was noted. The baking process caused significant changes in the fatty acid composition in the seeds from the crust of bread (flax seeds, sunflower seeds.

  4. Sensory evaluation of commercial fat spreads based on oilseeds and walnut

    Directory of Open Access Journals (Sweden)

    Dimić Etelka B.

    2013-01-01

    Full Text Available The main focus of this study was on the sensory evaluation of commercial oilseeds spreads, as the most significant characteristic of this type of product from the consumers’ point of view. Sensory analysis was conducted by five experts using a quantitative descriptive and sensory profile test, applying a scoring method according to the standard procedure. Five different spreads were evaluated: sunflower, pumpkin, sesame, peanut, and walnut. Oil content and amounts of separated oil on the surface were determined for each spread. The results have shown that the color of spreads was very different, depending on the oilseed: gray for sunflower, brown for walnut, yellowish-brown for peanut butter, ivory for sesame and profoundly dark green for pumpkin seeds spread. The flavor and odor of the spreads were characteristic for the raw materials used; however, the sunflower and walnut spreads had a slight rancid flavor. Generally, the spreadability of all spreads was good, but their mouth feel was not acceptable. During the consumption, all of them were sticking immensely to the roof of the mouth, which made the swallowing harder. The highest total score of 16.20 points (max. 20 was obtained for the peanut butter, while the lowest (10.38 was achieved by the sunflower butter. Oil separation (various degrees was noticed in all spreads, which negatively influenced the appearance and entire sensorial quality of the products. The quantity of separated oil depended on the age and total amount of oil in the spreads, and was between 1.13% in the peanut butter and 12.15% in the walnut spread in reference to the net weight of the product. [Projekat Ministarstva nauke Republike Srbije, br. TR 31014: Development of the new functional confectionery products based on oil crops

  5. A Distributed Model of Oilseed Biorefining, via Integrated Industrial Ecology Exchanges

    Science.gov (United States)

    Ferrell, Jeremy C.

    As the demand for direct petroleum substitutes increases, biorefineries are poised to become centers for conversion of biomass into fuels, energy, and biomaterials. A distributed model offers reduced transportation, tailored process technology to available feedstock, and increased local resilience. Oilseeds are capable of producing a wide variety of useful products additive to food, feed, and fuel needs. Biodiesel manufacturing technology lends itself to smaller-scale distributed facilities able to process diverse feedstocks and meet demand of critical diesel fuel for basic municipal services, safety, sanitation, infrastructure repair, and food production. Integrating biodiesel refining facilities as tenants of eco-industrial parks presents a novel approach for synergistic energy and material exchanges whereby environmental and economic metrics can be significantly improved upon compared to stand alone models. This research is based on the Catawba County NC EcoComplex and the oilseed crushing and biodiesel processing facilities (capacity-433 tons biodiesel per year) located within. Technical and environmental analyses of the biorefinery components as well as agronomic and economic models are presented. The life cycle assessment for the two optimal biodiesel feedstocks, soybeans and used cooking oil, resulted in fossil energy ratios of 7.19 and 12.1 with carbon intensity values of 12.51 gCO2-eq/MJ and 7.93 gCO2-eq/MJ, respectively within the industrial ecology system. Economic modeling resulted in a biodiesel conversion cost of 1.43 per liter of fuel produced with used cooking oil, requiring a subsidy of 0.58 per liter to reach the break-even point. As subsidies continue significant fluctuation, metrics other than operating costs are required to justify small-scale biofuel projects.

  6. Use of swine wastewater in oilseed radish crop: agronomic and environmental aspects

    Directory of Open Access Journals (Sweden)

    Thaisa Pegoraro

    2014-12-01

    Full Text Available Swine effluent has been applied to soils to promote nutrient cycling and reduce the uncontrolled disposal of effluents into bodies of water. However, the use of these effluents on various crops has raised environmental and public health concerns. Oilseed radish crop (Raphanus sativus L. is a winter crop planted in no-tillage systems as a green fertilizer that also can be used for biodiesel, and it requires high levels of nutrients for its development. Thus, the present study aimed to evaluate the environmental and agronomic effects of the application of swine wastewater on oilseed radish. The experiment was conducted in a 0.162 ha area with the following treatments: unirrigated (rainfed, irrigated, and fertilized with swine wastewater (370 m3 ha-1 cycle-1. After each rainfall event, analyses were conducted for the main macro and micronutrients in the runoff and percolated material from drainage lysimeters. Changes in the physical and chemical characteristics of the soil were also analyzed, as were the agronomic and nutritional indices of the dry crop phytomass in full blooming stage. Application of swine wastewater at a level of 370 m3 ha-1 produces a crop with better agronomic quality. Over the long term, however, caution should be taken regarding the surface runoff of NO3-, P, K, Mn and total salts and the percolation of NO3-, Na and Cu. Moreover, the rainfall occurred one day after fertigation contributed to the increase of the levels of P, K, Na, Cu, Zn and Mn in the percolated material.

  7. Bioactive properties of faveleira (Cnidoscolus quercifolius) seeds, oil and press cake obtained during oilseed processing.

    Science.gov (United States)

    Ribeiro, Penha Patrícia Cabral; Silva, Denise Maria de Lima E; Assis, Cristiane Fernandes de; Correia, Roberta Targino Pinto; Damasceno, Karla Suzanne Florentino da Silva Chaves

    2017-01-01

    To the best of our knowledge, this is the first report in the literature concerning the bioactive properties of faveleira products. This work focuses on the physicochemical evaluation of faveleira oil, as well as it investigates the bioactive properties of faveleira seeds, faveleira oil and the press cake obtained during the oilseed processing. The seeds were cold pressed and the following tests were performed: physicochemical characteristics (acidity, peroxide values, moisture and volatile matter, density and viscosity) and fatty acid profile of faveleira oil; total phenolic and flavonoid content of faveleira seed and press cake; antibacterial activity of seed, oil and press cake; and antioxidant activity (DPPH radical scavenging activity, reducing power assay, total antioxidant capacity, superoxide radical scavenging assay and oxygen radical absorbance capacity) of seed, oil and press cake. Our work demonstrated that the faveleira seed oil has low acidity (0.78 ± 0.03% oleic acid) and peroxide value (1.13 ± 0.12 mEq/1000g), associated with the relevant concentration of linoleic acid (53.56%). It was observed that important phenolics (398.89 ± 6.34 mg EAG/100 g), especially flavonoids (29.81 ± 0.71 mg RE/g) remain in the press cake, which indicates that the by-product of the faveleira oilseed production constitutes a rich residual source of bioactive compounds. No bacterial growth inhibition was detected, but all samples including faveleira seeds, press cake, oil and its fractions have potent antioxidant activities, mainly the press cake, with oxygen radical absorbance capacity of 28.39 ± 4.36 μM TE/g. Our results also show that faveleira oil has potential to be used as edible oil and the press cake should be used to contain the most antioxidants from seed.

  8. Kale BoRACK1 is involved in the plant response to salt stress and Peronospora brassicae Gaumann.

    Science.gov (United States)

    Li, Da-Hong; Shen, Fu-Jia; Li, Hong-Yan; Li, Wei

    2017-06-01

    The receptor for activated C kinase 1 (RACK1) belongs to a protein subfamily containing a tryptophan-aspartic acid-domain (WD) repeat structure. Compelling evidence indicates that RACK1 can interact with many signal molecules and affect different signal transduction pathways. In this study, a kale (Brassica oleracea var. acephala f.tricolor) RACK1 gene (BoRACK1) was cloned by RT-PCR. The amino acid sequence of BoRACK1 had seven WD repeats in which there were typical GH (glycine-histidine) and WD dipeptides. Comparison with AtRACK1 from Arabidopsis revealed 87.1% identity at the amino acid level. Expression pattern analysis by RT-PCR showed that BoRACK1 was expressed in all analyzed tissues of kale and that its transcription in leaves was down-regulated by salt, abscisic acid, and H 2 O 2 at a high concentration. Overexpression of BoRACK1 in kale led to a reduction in symptoms caused by Peronospora brassicae Gaumann on kale leaves. The expression levels of the pathogenesis-related protein genes, PR-1 and PRB-1, increased 2.5-4-fold in transgenic kale, and reactive oxygen species production was more active than in the wild-type. They also exhibited increased tolerance to salt stress in seed germination. H 2 O 2 may also be involved in the regulation of BoRACK1 during seed germination under salt stress. Quantitative real-time PCR analyses showed that the transcript levels of BoRbohs genes were significantly higher in overexpression of BoRACK1 transgenic lines. Yeast two-hybrid assays showed that BoRACK1 could interact with WNK8, eIF6, RAR1, and SGT1. This study and previous work lead us to believe that BoRACK1 may form a complex with regulators of plant salt and disease resistance to coordinate kale reactions to pathogens. Copyright © 2017 Elsevier GmbH. All rights reserved.

  9. Tracing the Transcriptomic Changes in Synthetic Trigenomic allohexaploids of Brassica Using an RNA-Seq Approach

    Science.gov (United States)

    Zhao, Qin; Zou, Jun; Meng, Jinling; Mei, Shiyong; Wang, Jianbo

    2013-01-01

    Polyploidization has played an important role in plant evolution and speciation, and newly formed allopolyploids have experienced rapid transcriptomic changes. Here, we compared the transcriptomic differences between a synthetic Brassica allohexaploid and its parents using a high-throughput RNA-Seq method. A total of 35,644,409 sequence reads were generated, and 32,642 genes were aligned from the data. Totals of 29,260, 29,060, and 29,697 genes were identified in Brassica rapa , Brassica carinata , and Brassica allohexaploid, respectively. We compared 7,397 differentially expressed genes (DEGs) between Brassica hexaploid and its parents, as well as 2,545 nonadditive genes of Brassica hexaploid. We hypothesized that the higher ploidy level as well as secondary polyploidy might have influenced these changes. The majority of the 3,184 DEGs between Brassica hexaploid and its paternal parent, B . rapa , were involved in the biosynthesis of secondary metabolites, plant–pathogen interactions, photosynthesis, and circadian rhythm. Among the 2,233 DEGs between Brassica hexaploid and its maternal parent, B . carinata , several played roles in plant–pathogen interactions, plant hormone signal transduction, ribosomes, limonene and pinene degradation, photosynthesis, and biosynthesis of secondary metabolites. There were more significant differences in gene expression between the allohexaploid and its paternal parent than between it and its maternal parent, possibly partly because of cytoplasmic and maternal effects. Specific functional categories were enriched among the 2,545 nonadditive genes of Brassica hexaploid compared with the additive genes; the categories included response to stimulus, immune system process, cellular process, metabolic process, rhythmic process, and pigmentation. Many transcription factor genes, methyltransferases, and methylation genes showed differential expression between Brassica hexaploid and its parents. Our results demonstrate that the

  10. Comparison of nutrition composition of transgenic maize (chitinase gene) with its non-transgenic counterpart

    OpenAIRE

    Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun

    2011-01-01

    In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...

  11. Intraspecific Variation in Carotenoids of Brassica oleracea var. sabellica.

    Science.gov (United States)

    Mageney, Vera; Baldermann, Susanne; Albach, Dirk C

    2016-04-27

    Carotenoids are best known as a source of natural antioxidants. Physiologically, carotenoids are part of the photoprotection in plants as they act as scavengers of reactive oxygen species (ROS). An important source of carotenoids in European food is Brassica oleracea. Focusing on the most abundant carotenoids, we estimated the contents of ß-carotene, (9Z)-neoxanthin, zeaxanthin, and lutein as well as those of chlorophylls a and b to assess their variability in Brassica oleracea var. sabellica. Our analyses included more than 30 cultivars categorized in five distinct sets grouped according to morphological characteristics or geographical origin. Our results demonstrated specific carotenoid patterns characteristic for American, Italian, and red-colored kale cultivars. Moreover, we demonstrated a tendency of high zeaxanthin proportions under traditional harvest conditions, which accord to low-temperature regimes. We also compared the carotenoid patterns of self-generated hybrid lines. Corresponding findings indicated that crossbreeding has a high potential for carotenoid content optimization in kale.

  12. Erosion of Brassica incana Genetic Resources: Causes and Effects

    Science.gov (United States)

    Muscolo, A.; Settineri, G.; Mallamaci, C.; Papalia, T.; Sidari, M.

    2017-07-01

    Brassica incana Ten., possessing a number of useful agronomic traits, represents a precious genetic resource to be used in plant breeding programs to broaden the genetic base in most Brassica crop species. B. incana that grows on limestone cliffs is at risk of genetic erosion for environmental constraints and human activities. We studied the pedological conditions of a Calabrian site where the B. incana grows, and we correlated the soil properties to the physiological and biochemical aspects of B. incana to identify the causes and effects of the genetic erosion of this species. Our results evidenced that physical soil conditions did not affect B. incana growth and nutraceutical properties; conversely, biological soil properties modified its properties. We identified leaf pigments and secondary metabolites that can be used routinely as early warning indicators of plant threat, to evaluate in a short term the dynamic behavior of plants leading to species extinction.

  13. Effect of Heavy Metals in Plants of the Genus Brassica

    Science.gov (United States)

    Mourato, Miguel P.; Moreira, Inês N.; Leitão, Inês; Pinto, Filipa R.; Sales, Joana R.; Louro Martins, Luisa

    2015-01-01

    Several species from the Brassica genus are very important agricultural crops in different parts of the world and are also known to be heavy metal accumulators. There have been a large number of studies regarding the tolerance, uptake and defense mechanism in several of these species, notably Brassica juncea and B. napus, against the stress induced by heavy metals. Numerous studies have also been published about the capacity of these species to be used for phytoremediation purposes but with mixed results. This review will focus on the latest developments in the study of the uptake capacity, oxidative damage and biochemical and physiological tolerance and defense mechanisms to heavy metal toxicity on six economically important species: B. juncea, B. napus, B. oleracea, B. carinata, B. rapa and B. nigra. PMID:26247945

  14. The effect of oilseed consumption on appetite and on the risk of developing type 2 diabetes mellitus.

    Science.gov (United States)

    Neves Ribeiro, Daniela; Gonçalves Alfenas, Rita de Cássia; Bressan, Josefina; Brunoro Costa, Neuza Maria

    2013-01-01

    The prevalence of diabetes mellitus (DM) has rapidly increased worldwide. Excess body fat is an important risk factor for the disease. Strategies have been indicated for the prevention and treatment of DM. Recent studies have associated the consumption of oilseeds resulting in a lower risk of developing obesity and diabetes. It is believed that this effect is associated with low glycemic index and the high fiber content, the unsaturated fatty acids and the magnesium oilseeds. However, the mechanisms involved in appetite and type 2 diabetes control have not been fully elucidated among researchers yet. Thus, the objective of the present article was to critically analyze the articles published on this subject aiming at identifying strategies which may be used in the dietary treatment of diabetes. Copyright © AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

  15. Evaluation of physicochemical and biodegradability properties of selected nigerian non-edible oilseeds as potential cutting fluids

    International Nuclear Information System (INIS)

    Jayeoye, T.J.

    2015-01-01

    This paper reports evaluation of physicochemical and biodegradability properties of selectednon edible Nigerian oilseeds as a potential cutting fluid. Oil extraction process was carried on the oilseeds, with physicochemical parameters and biodegradability of the extracts were equally assessed. The established physicochemical parameters were percentage oil yield (5.58-61.8%), specific gravity (0.86-0.94), acid value (2.89-18.2 mgKOH/g), iodine value (15.7-104 mg iodine/g), peroxide value (1.35-10.9 mg/g oil), saponification value (173-286 mg KOH/g) and viscosity (37.9-53.1centipoises), while biodegradability ranged between (50.0-63.8%) in comparison with the mineral oil with values less than 20%. Based on this study, the oil extracts of Caesalpinia bonduc and Calophyllum inophyllum appeared to be the most suitable as potential cutting fluids for further formulation studies and machining trials. (author)

  16. Catalytic properties of three catalases from Kohlrabi ( Brassica ...

    African Journals Online (AJOL)

    Catalase (EC 1.11.1.6) was extracted from kohlrabi bulbs (Brassica oleracea gongylodes) with 0.05 M phosphate buffer, pH 7.0. On the basis of kinetic studies and activity stain for catalase, only three isoenzymes of catalases were detected in kohlrabi bulbs extract with pH optima at 4.5, 6.5 and 10. Highest catalytic ...

  17. Cadmium uptake potential of Brassica napus cocropped with Brassica parachinensis and Zea mays

    International Nuclear Information System (INIS)

    Selvam, Ammaiyappan; Wong, Jonathan Woon-Chung

    2009-01-01

    Cadmium uptake potential of Brassica napus cocropped with B. parachinensis or Zea mays plants in split pot (allow the solutes to pass but prevent the interaction of roots between compartments) experiments was evaluated. Plants were grown in split pots filled with soil spiked at 0, 3, 6, 12, 25 and 50 mg Cd/kg soil. Biomass and Cd uptake were detemined after 6 weeks, and rhizospheric soil solutions, extracted using soil probes, were analyzed for pH and water soluble Cd at weekly intervals. Cadmium treatments affected the biomass. Cadmium concentration in the shoots of B. napus was higher when cocropped with B. parachinensis and significantly higher with Z. mays; however, the biomass was negatively affected implying the higher nutrient apportionment to the crop plants than B. napus. Concentration of Cd in B. napus was higher in shoots than in roots as revealed by shoot/root Cd quotient and was always >1; the quotient for B. parachinensis was ∼1 and that of Z. mays was <1, indicating the potential of Brassicaceae members to translocate the Cd to aboveground tissue. Results indicate the feasibility of cocropping method to clean the Cd contaminated soils.

  18. Cadmium uptake potential of Brassica napus cocropped with Brassica parachinensis and Zea mays

    Energy Technology Data Exchange (ETDEWEB)

    Selvam, Ammaiyappan [Sino-Forest Applied Research Centre for Pearl River Delta Environment, Department of Biology, Hong Kong Baptist University, Hong Kong, (Hong Kong); Wong, Jonathan Woon-Chung, E-mail: jwcwong@hkbu.edu.hk [Sino-Forest Applied Research Centre for Pearl River Delta Environment, Department of Biology, Hong Kong Baptist University, Hong Kong (Hong Kong)

    2009-08-15

    Cadmium uptake potential of Brassica napus cocropped with B. parachinensis or Zea mays plants in split pot (allow the solutes to pass but prevent the interaction of roots between compartments) experiments was evaluated. Plants were grown in split pots filled with soil spiked at 0, 3, 6, 12, 25 and 50 mg Cd/kg soil. Biomass and Cd uptake were detemined after 6 weeks, and rhizospheric soil solutions, extracted using soil probes, were analyzed for pH and water soluble Cd at weekly intervals. Cadmium treatments affected the biomass. Cadmium concentration in the shoots of B. napus was higher when cocropped with B. parachinensis and significantly higher with Z. mays; however, the biomass was negatively affected implying the higher nutrient apportionment to the crop plants than B. napus. Concentration of Cd in B. napus was higher in shoots than in roots as revealed by shoot/root Cd quotient and was always >1; the quotient for B. parachinensis was {approx}1 and that of Z. mays was <1, indicating the potential of Brassicaceae members to translocate the Cd to aboveground tissue. Results indicate the feasibility of cocropping method to clean the Cd contaminated soils.

  19. Genetic diversity assessment in brassica germplasm based on morphological attributes

    International Nuclear Information System (INIS)

    Ali, I.; Ali, N.; Ali, S.; Hussain, I.; Khan, S. A.; Tahira, R.

    2015-01-01

    Genetic diversity of 28 Brassica genotypes was studied using different morphological attributes. Data were recorded on days to maturity (DM), plant height (PH), primary branches plant (PBPP), pod length (PL), seed pod (SP), 1000 - seed weight (1000 - SW), yield plant (YPP) and oil (percentage). Three checks (Pakola, CM and TA), were used to check the performance of collected materials with already available brassica varieties. significant statistical differences were observed among the tested genotypes based on the studied morphological traits. Among the tested genotypes, genotype keelboat proved to be superior as compared to other studied genotypes due to maximum level of studied traits like pod length (7.03 cm), seed pod (32.33), 1000 - seed weight (5.38 g), seed yield plant (110.8 g) and oil content (52.9 percentage. The highest level of performance recorded by kalabat in terms of branches plant, pod length (cm), number of seed pod, seed yield plant (g), 1000 - seed weight (g) and oil content (percentage), indicates that this genotype is genetically different and superior than the other studied genotype. Therefore, genotype kalabat can be either used as variety after adaptability trials over a larger area or included in Brassica breeding programmes as a good source of genetic variation. (author)

  20. Isolate dependency of Brassica rapa resistance QTLs to Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Wei eZhang

    2016-02-01

    Full Text Available Generalist necrotrophic pathogens including Botrytis cinerea cause significant yield and financial losses on Brassica crops. However, there is little knowledge about the mechanisms underlying the complex interactions encoded by both host and pathogen genomes in this interaction. This potentially includes multiple layers of plant defense and pathogen virulence mechanisms that could complicate in breeding broad spectrum resistance within Brassica species. Glucosinolates are a diverse group of defense metabolites that play a key role in interaction between Brassica and biotic attackers. In this study, we utilized a collection of diverse B. cinerea isolates to investigate resistance within the B. rapa R500 x IMB211 recombinant inbred line population. We tested variation on lesion development and glucosinolate accumulation in parental lines and all population lines. We then mapped quantitative trait loci (QTL for both resistances to B. cinerea and defense metabolites in this population. Phenotypic analysis and QTL mapping demonstrate that the genetic basis of resistance to B. cinerea in B. rapa is isolate specific and polygenic with transgressive segregation that both parents contribute resistance alleles. QTLs controlling defensive glucosinolates are highly dependent on pathogen infection. An overlap of two QTLs identified between resistance to B. cinerea and defense metabolites also showed isolate specific effects. This work suggests that directly searching for resistance loci may not be the best approach at improving resistance in B. rapa to necrotrophic pathogen.

  1. NEW ACCESSIONS OF BRASSICA OLERACEA L. IN VIR PLANT COLLECTION

    Directory of Open Access Journals (Sweden)

    A. M. Artemieva

    2017-01-01

    Full Text Available Varieties of Brassica oleracea L. are widespread and favorite crops, where among them the head cabbage and cauliflower are the most economically important. Russia takes third place after India and Chine among countries with largest production areas and gross yield for the crop. In Russia, the area sown to cabbage is about 27 thousand hectares. 728 cultivars and hybrids of eight cabbage crops including 528 hybrids have been added in State Register of Breeding Achievements of Russian Federation in 2017. The collection of Brassica oleracea L. totally contains of 2421 accessions and takes first place at number of collected items among the world’s plant genbanks. The phenotyping, genotyping, passportization, development of core collection and trait collection as well as initial breeding accessions, covering all genetic diversity have been carried out at department of genetic resources of vegetables and melons at VIR. Selection of most promising accessions is performed to find genes and sources for economically valuable traits to develop proper lines and hybrids. There are the enrichment of the collection by means of ordering and gathering in expeditions, the improvement of methods of phenotyping and development of database for all biological accessions studied at the department. In 2007-2016, 255 accessions of Brassica oleracea L. have been included into collection to be used in different national breeding programs.

  2. Optimization of in vitro regeneration and Agrobacterium tumefaciens-mediated transformation with heat-resistant cDNA in Brassica oleracea subsp. italica cv. Green Marvel.

    Science.gov (United States)

    Ravanfar, Seyed Ali; Aziz, Maheran Abdul; Saud, Halimi Mohd; Abdullah, Janna Ong

    2015-11-01

    An efficient system for shoot regeneration and Agrobacterium tumefaciens-mediated transformation of Brassica oleracea cv. Green Marvel cultivar is described. This study focuses on developing shoot regeneration from hypocotyl explants of broccoli cv. Green Marvel using thidiazuron (TDZ), zeatin, and kinetin, the optimization of factors affecting Agrobacterium-mediated transformation of the hypocotyl explants with heat-resistant cDNA, followed by the confirmation of transgenicity of the regenerants. High shoot regeneration was observed in 0.05-0.1 mg dm(-3) TDZ. TDZ at 0.1 mg dm(-3) produced among the highest percentage of shoot regeneration (96.67 %) and mean number of shoot formation (6.17). The highest percentage (13.33 %) and mean number (0.17) of putative transformant production were on hypocotyl explants subjected to preculture on shoot regeneration medium (SRM) with 200 µM acetosyringone. On optimization of bacterial density and inoculation time, the highest percentage and mean number of putative transformant production were on hypocotyl explants inoculated with a bacterial dilution of 1:5 for 30 min. Polymerase chain reaction (PCR) assay indicated a transformation efficiency of 8.33 %. The luciferase assay showed stable integration of the Arabidopsis thaliana HSP101 (AtHSP101) cDNA in the transgenic broccoli regenerants. Three out of five transgenic lines confirmed through PCR showed positive hybridization bands of the AtHSP101 cDNA through Southern blot analysis. The presence of AtHSP101 transcripts in the three transgenic broccoli lines indicated by reverse transcription-PCR (RT-PCR) confirmed the expression of the gene. In conclusion, an improved regeneration system has been established from hypocotyl explants of broccoli followed by successful transformation with AtHSP101 for resistance to high temperature.

  3. The effect of water and salt stresses on the phosphorus content and acid phosphatase activity in oilseed rape

    Directory of Open Access Journals (Sweden)

    Stanisław Flasiński

    2014-01-01

    Full Text Available Oilseed rape plants responded to water and salt stresses (-0.5 MPa, PEG 6000 and NaCI by reduction of the fresh and dry weights of shoots and roots. When PEG was used, the ratio of dry weights of roots:shoots surpassed that of controls. The leaf protein content increased considerably. The phosphorus content decreased only in the roots, most significantly after three days of stress. Immediately after the stresses were induced, an increase in the acid phosphatase (AP activity was noted. Water and salt stresses caused four- and two-fold increases in AP activity in leaves, respectively. Changes in the enzyme activity were negligible in stems and roots. There are nine forms of AP in young leaves of oilseed rape. In the stressed plants, from No. 5 revealed lower activity and forms Nos 8 and 9, higher activities than in the control. The increase in AP activity was directly accompanied by the decrease in the water potential of the tissues. Oilseed rape is considerably less sensitive to salt stress than to water stress, which is manifested as the lower inhibition of plant growth and also by a smaller increase in acid phosphatase activity.

  4. Effects of exposure to winter oilseed rape grown from thiamethoxam-treated seed on the red mason bee Osmia bicornis.

    Science.gov (United States)

    Ruddle, Natalie; Elston, Charlotte; Klein, Olaf; Hamberger, Anja; Thompson, Helen

    2018-04-01

    There has been increasing interest in the effects of neonicotinoid insecticides on wild bees. In solitary bee species the direct link between each individual female and reproductive success offers the opportunity to evaluate effects on individuals. The present study investigated effects of exposure to winter oilseed rape grown from thiamethoxam-treated seed on reproductive behavior and output of solitary red mason bees (Osmia bicornis) released in 6 pairs of fields over a 2-yr period and confined to tunnels in a single year. After adjustment to the number of females released, there was significantly lower production of cells and cocoons/female in tunnels than in open field conditions. This difference may be because of the lack of alternative forage within the tunnels. Under open field conditions, palynology of the pollen provisions within the nests demonstrated a maximum average of 31% oilseed rape pollen at any site, with Quercus (oak) contributing up to 86% of the pollen. There were no significant effects from exposure to oilseed rape grown from thiamethoxam-treated seed from nest establishment through cell production to emergence under tunnel or field conditions. Environ Toxicol Chem 2018;37:1071-1083. © 2017 SETAC. © 2017 SETAC.

  5. COMPETITIVE POSITION OF THE MAIN PRODUCERS AND EXPORTERS OF OILSEEDS AND VEGETABLE OILS IN THE INTRA-EU TRADE

    Directory of Open Access Journals (Sweden)

    Karolina Pawlak

    2014-09-01

    Full Text Available The aim of the paper was to assess the competitive position of the main producers and exporters of oilseeds and vegetable oils in the intra-EU trade in 2004 and 2012. The competitiveness was assessed with the use of a selected set of quantitative measures of international competitive position. Moreover, some shares of the analysed countries in the intra-EU trade, as well as relative export intensity of oilseeds and vegetable oils in these countries were estimated. On the basis of the conducted analyses it is possible to conclude that apart from Germany in trade in rapeseed and soya beans, as well as the Netherlands in trade in rapeseed and sunflower-seed, the main producers and exporters of oilseeds were competitive on the Single European Market. Excluding soya-bean oil produced in the EU mainly from imported raw material, competitive advantage of most of the countries decreased together with the level of processing and was lower in trade in vegetable oils.

  6. Field trial evaluation of the accumulation of omega-3 long chain polyunsaturated fatty acids in transgenic Camelina sativa: Making fish oil substitutes in plants

    Directory of Open Access Journals (Sweden)

    Sarah Usher

    2015-12-01

    Full Text Available The global consumption of fish oils currently exceeds one million tonnes, with the natural de novo source of these important fatty acids forming the base of marine foodwebs. Here we describe the first field-based evaluation of a terrestrial source of these essential nutrients, synthesised in the seeds of transgenic Camelina sativa plants via the heterologous reconstitution of the omega-3 long chain polyunsaturated fatty acid biosynthetic pathway. Our data demonstrate the robust nature of this novel trait, and the feasibility of making fish oils in genetically modified crops. Moreover, to our knowledge, this is the most complex example of plant genetic engineering to undergo environmental release and field evaluation. Keywords: Plant metabolic engineering, GM field trials, Omega-3 long chain polyunsaturated fatty acids, Fish oils, Camelina, Oilseeds

  7. Productivity and nutritive quality of three brassica varieties for use in pasture-based systems

    Science.gov (United States)

    Brassicas are gaining popularity among pasture-based livestock producers to extend grazing during the ‘summer slump’ and throughout the fall. A 2-yr study was conducted to compare biomass production and nutrient composition of ‘Barisca’ rapeseed (RAP; Brassica napus L.), ‘Inspiration’ canola (CAN; B...

  8. Effect of seed-irradiation on morphological characters yield components of brassica campestris var. sarson

    International Nuclear Information System (INIS)

    Bokhari, F.S.; Ahmad, S.

    1996-01-01

    Seed of Brassica campestris (var. Sarson) were used to study the effect of radiation of different morphological and yield parameters. Survival percentage showed drastic decrease at higher doses (75 Kr and 100 Kr). Similarly all characters showed a trend of decrease with increasing dose. LD50 for Brassica was about 50 Kr. (author)

  9. Enteric methane production and ruminal fermentation from forage brassica diets fed in continuous culture

    Science.gov (United States)

    Brassicas provide forage for livestock during the late fall when traditional perennial cool-season forages are not productive. However, little research exists on ruminal fermentation and methane(CH4) production of brassicas fed as forage. A continuous culture fermentor system was used to assess nutr...

  10. The genome of the mesopolyploid crop species Brassica rapa

    DEFF Research Database (Denmark)

    Wang, Xiaowu; Wang, Hanzhong; Wang, Jun

    2011-01-01

    We report the annotation and analysis of the draft genome sequence of Brassica rapa accession Chiifu-401-42, a Chinese cabbage. We modeled 41,174 protein coding genes in the B. rapa genome, which has undergone genome triplication. We used Arabidopsis thaliana as an outgroup for investigating...... of Brassica oil and vegetable crops....

  11. Variation and Distribution of Glucosinolates in 42 Cultivars of Brassica oleracea Vegetable Crops

    NARCIS (Netherlands)

    Verkerk, R.; Tebbenhoff, S.; Dekker, M.

    2010-01-01

    Brassica vegetables are known to contain glucosinolates that are precursors for bioactive compounds like isothiocyanates that have been shown to play an important role in human health. This study reports the results of a screening of 11 Brassica oleracea crops consisting of 42 cultivars (6 white

  12. Database derived microsatellite markers (SSRs) for cultivar differentiation in Brassica oleracea

    DEFF Research Database (Denmark)

    Louarn, Sébastien Jean Yves; Torp, Anna Maria; Holme, I.B.

    2007-01-01

     Fifty-nine Brassica oleracea cultivars, belonging to five botanical varieties, were evaluated for microsatellite (SSR) polymorphisms using 11 database sequence derived primer pairs. The cultivars represented 12 broccoli (Brassica oleracea var. italica), ten Brussels sprouts (B. o. var. gemmifera...

  13. Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana

    NARCIS (Netherlands)

    Ji, X.

    2014-01-01

    Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana.

    I studied numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and

  14. Recent progress on technologies and applications of transgenic ...

    African Journals Online (AJOL)

    USER

    2010-06-14

    Jun 14, 2010 ... this, the methods for producing transgenic poultry must become routine. ... and spermatogonial stem cells (SSCs) have been developed to generate transgenic chickens. ... any procedure aimed at generating transgenic birds.

  15. Integration of linkage maps for the Amphidiploid Brassica napus and comparative mapping with Arabidopsis and Brassica rapa

    Directory of Open Access Journals (Sweden)

    Delourme Régine

    2011-02-01

    Full Text Available Abstract Background The large number of genetic linkage maps representing Brassica chromosomes constitute a potential platform for studying crop traits and genome evolution within Brassicaceae. However, the alignment of existing maps remains a major challenge. The integration of these genetic maps will enhance genetic resolution, and provide a means to navigate between sequence-tagged loci, and with contiguous genome sequences as these become available. Results We report the first genome-wide integration of Brassica maps based on an automated pipeline which involved collation of genome-wide genotype data for sequence-tagged markers scored on three extensively used amphidiploid Brassica napus (2n = 38 populations. Representative markers were selected from consolidated maps for each population, and skeleton bin maps were generated. The skeleton maps for the three populations were then combined to generate an integrated map for each LG, comparing two different approaches, one encapsulated in JoinMap and the other in MergeMap. The BnaWAIT_01_2010a integrated genetic map was generated using JoinMap, and includes 5,162 genetic markers mapped onto 2,196 loci, with a total genetic length of 1,792 cM. The map density of one locus every 0.82 cM, corresponding to 515 Kbp, increases by at least three-fold the locus and marker density within the original maps. Within the B. napus integrated map we identified 103 conserved collinearity blocks relative to Arabidopsis, including five previously unreported blocks. The BnaWAIT_01_2010a map was used to investigate the integrity and conservation of order proposed for genome sequence scaffolds generated from the constituent A genome of Brassica rapa. Conclusions Our results provide a comprehensive genetic integration of the B. napus genome from a range of sources, which we anticipate will provide valuable information for rapeseed and Canola research.

  16. Nematode neuropeptides as transgenic nematicides.

    Directory of Open Access Journals (Sweden)

    Neil D Warnock

    2017-02-01

    Full Text Available Plant parasitic nematodes (PPNs seriously threaten global food security. Conventionally an integrated approach to PPN management has relied heavily on carbamate, organophosphate and fumigant nematicides which are now being withdrawn over environmental health and safety concerns. This progressive withdrawal has left a significant shortcoming in our ability to manage these economically important parasites, and highlights the need for novel and robust control methods. Nematodes can assimilate exogenous peptides through retrograde transport along the chemosensory amphid neurons. Peptides can accumulate within cells of the central nerve ring and can elicit physiological effects when released to interact with receptors on adjoining cells. We have profiled bioactive neuropeptides from the neuropeptide-like protein (NLP family of PPNs as novel nematicides, and have identified numerous discrete NLPs that negatively impact chemosensation, host invasion and stylet thrusting of the root knot nematode Meloidogyne incognita and the potato cyst nematode Globodera pallida. Transgenic secretion of these peptides from the rhizobacterium, Bacillus subtilis, and the terrestrial microalgae Chlamydomonas reinhardtii reduce tomato infection levels by up to 90% when compared with controls. These data pave the way for the exploitation of nematode neuropeptides as a novel class of plant protective nematicide, using novel non-food transgenic delivery systems which could be deployed on farmer-preferred cultivars.

  17. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... production of flowers, apomixis (Nassar et al., 2000; ... In order to increase the stress tolerance capacity of ... stress-related procedure due to the activities of auxin ... the evaluation of the transgenic lines for rate of OES .... Some transgenic lines carrying the 35S-AOX fragment amplified using 35S303F1 and.

  18. [Progress in transgenic fish techniques and application].

    Science.gov (United States)

    Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying

    2011-05-01

    Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.

  19. [New advances in animal transgenic technology].

    Science.gov (United States)

    Sun, Zhen-Hong; Miao, Xiang-Yang; Zhu, Rui-Liang

    2010-06-01

    Animal transgenic technology is one of the fastest growing biotechnology in the 21st century. It is used to integrate foreign genes into the animal genome by genetic engineering technology so that foreign genes can be expressed and inherited to the offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors on preparation of transgenic animals. A variety of transgenic techniques are available, each of which has its own advantages and disadvantages and still needs further study because of unresolved technical and safety issues. With the in-depth research, the transgenic technology will have broad application prospects in the fields of exploration of gene function, animal genetic improvement, bioreactor, animal disease models, organ transplantation and so on. This article reviews the recently developed animal gene transfer techniques, including germline stem cell mediated method to improve the efficiency, gene targeting to improve the accuracy, RNA interference (RNAi)-mediated gene silencing technology, and the induced pluripotent stem cells (iPS) transgenic technology. The new transgenic techniques can provide a better platform for the study of trans-genic animals and promote the development of medical sciences, livestock production, and other fields.

  20. [Prediction of SPAD value in oilseed rape leaves using hyperspectral imaging technique].

    Science.gov (United States)

    Ding, Xi-bin; Liu, Fei; Zhang, Chu; He, Yong

    2015-02-01

    In the present work, prediction models of SPAD value (Soil and Plant Analyzer Development, often used as a parameter to indicate chlorophyll content) in oilseed rape leaves were successfully built using hyperspectral imaging technique. The hy perspectral images of 160 oilseed rape leaf samples in the spectral range of 380-1030 nm were acquired. Average spectrum was extracted from the region of interest (ROI) of each sample. We chose spectral data in the spectral range of 500-900 nm for analysis. Using Monte Carlo partial least squares(MC-PLS) algorithm, 13 samples were identified as outliers and eliminated. Based on the spectral information and measured SPAD values of the rest 147 samples, several estimation models have been built based on different parameters using different algorithms for comparison, including: (1) a SPAD value estimation model based on partial least squares(PLS) in the whole wavelength region of 500-900 nm; (2) a SPAD value estimation model based on successive projections algorithmcombined with PLS(SPA-PLS); (3) 4 kind of simple experience SPAD value estimation models in which red edge position was used as an argument; (4) 4 kind of simple experience SPAD value estimation models in which three vegetation indexes R710/R760, (R750-R705)/(R750-R705) and R860/(R550 x R708), which all have been proved to have a good relevance with chlorophyll content, were used as an argument respectively; (5) a SPAD value estimation model based on PLS using the 3 vegetation indexes mentioned above. The results indicate that the optimal prediction performance is achieved by PLS model in the whole wavelength region of 500-900 nm, which has a correlation coefficient(r(p)) of 0.8339 and a root mean squares error of predicted (RMSEP) of 1.52. The SPA-PLS model can provide avery close prediction result while the calibration computation has been significantly reduced and the calibration speed has been accelerated sharply. For simple experience models based on red edge

  1. Presence and Distribution of Oilseed Pumpkin Viruses and Molecular Detection of Zucchini Yellow Mosaic Virus

    Directory of Open Access Journals (Sweden)

    Ana Vučurović

    2009-01-01

    Full Text Available Over the past decade, intensive spread of virus infections of oilseed pumpkin has resulted in significant economic losses in pumpkin crop production, which is currently expanding in our country. In 2007 and 2008, a survey for the presence and distribution of oilseed pumpkin viruses was carried out in order to identify viruses responsible for epidemics and incidences of very destructive symptoms on cucurbit leaves and fruits. Monitoring andcollecting samples of oil pumpkin, as well as other species such as winter and butternut squash and buffalo and bottle gourd with viral infection symptoms, was conducted in several localities of Vojvodina Province. The collected plant samples were tested by DAS-ELISA using polyclonal antisera specific for the detection of six most economically harmful pumpkin viruses: Cucumber mosaic virus (CMV, Zucchini yellow mosaic virus (ZYMV, Watermelon mosaic virus (WMW, Squash mosaic virus (SqMV, Papaya ringspot virus (PRSV and Tobaccoringspot virus (TRSV that are included in A1 quarantine list of harmful organisms in Serbia.Identification of viruses in the collected samples indicated the presence of three viruses, ZYMV, WMV and CMV, in individual and mixed infections. Frequency of the identified viruses varied depending on locality and year of investigations. In 2007, WMV was the most frequent virus (94.2%, while ZYMV was prevalent (98.04% in 2008. High frequency of ZYMV determined in both years of investigation indicated the need for its rapid and reliable molecular detection. During this investigation, a protocol for ZYMVdetection was developed and optimized using specific primers CPfwd/Cprev and commercial kits for total RNA extraction, as well as for RT-PCR. In RT-PCR reaction using these primers, a DNA fragment of approximately 1100 bp, which included coat protein gene, was amplified in the samples of infected pumkin leaves. Although serological methods are still useful for large-scale testing of a great number of

  2. Altered lipid composition and enhanced lipid production in green microalga by introduction of brassica diacylglycerol acyltransferase 2.

    Science.gov (United States)

    Ahmad, Irshad; Sharma, Anil K; Daniell, Henry; Kumar, Shashi

    2015-05-01

    Higher lipid biosynthesis and accumulation are important to achieve economic viability of biofuel production via microalgae. To enhance lipid content, Chlamydomonas reinhardtii was genetically engineered with a key enzyme diacylglycerol acyltransferase (BnDGAT2) from Brassica napus, responsible for neutral lipid biosynthesis. The transformed colonies harbouring aph7 gene, screened on hygromycin-supplemented medium, achieved transformation frequency of ~120 ± 10 colonies/1 × 10(6) cells. Transgene integration and expression were confirmed by PCR, Southern blots, staining lipid droplets, proteins and spectro-fluorometric analysis of Nile red-stained cells. The neutral lipid is a major class (over 80% of total lipids) and most significant requirement for biodiesel production; this was remarkably higher in the transformed alga than the untransformed control. The levels of saturated fatty acids in the transformed alga decreased to about 7% while unsaturated fatty acids increased proportionately when compared to wild type cells. Polyunsaturated fatty acids, especially α-linolenic acid, an essential omega-3 fatty acid, were enhanced up to 12% in the transformed line. Nile red staining confirmed formation of a large number of lipid globules in the transformed alga. Evaluation of long-term stability and vitality of the transgenic alga revealed that cryopreservation produced significantly higher quantity of lipid than those maintained continuously over 128 generations on solid medium. The overexpression of BnDGAT2 significantly altered the fatty acids profile in the transformed alga. Results of this study offer a valuable strategy of genetic manipulation for enhancing polyunsaturated fatty acids and neutral lipids for biofuel production in algae. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  3. The Large Subunit rDNA Sequence of Plasmodiophora brassicae Does not Contain Intra-species Polymorphism.

    Science.gov (United States)

    Schwelm, Arne; Berney, Cédric; Dixelius, Christina; Bass, David; Neuhauser, Sigrid

    2016-12-01

    Clubroot disease caused by Plasmodiophora brassicae is one of the most important diseases of cultivated brassicas. P. brassicae occurs in pathotypes which differ in the aggressiveness towards their Brassica host plants. To date no DNA based method to distinguish these pathotypes has been described. In 2011 polymorphism within the 28S rDNA of P. brassicae was reported which potentially could allow to distinguish pathotypes without the need of time-consuming bioassays. However, isolates of P. brassicae from around the world analysed in this study do not show polymorphism in their LSU rDNA sequences. The previously described polymorphism most likely derived from soil inhabiting Cercozoa more specifically Neoheteromita-like glissomonads. Here we correct the LSU rDNA sequence of P. brassicae. By using FISH we demonstrate that our newly generated sequence belongs to the causal agent of clubroot disease. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

  4. Determination of Flowering Phenology, Number of Flowers, Nectar and Pollen Potential of Oil Rape (Brassica napus L., Plant in Black Sea Coastal Region

    Directory of Open Access Journals (Sweden)

    Necda Çankaya

    2017-11-01

    Full Text Available This research was carried out in 2011 and 2012 in order to determine the flowering phenology, number of flowers, nectar and pollen potential in the Samsun province of the oilseed rape (Brassica napus L., which is widely used in agriculture in our country. In the first year of the study (2011, it was determined that the rapeseed plant was in flower for 44 days, there were 2.694 flowers per plant, 1.89 kg/da nectar per day and 1330 kg/da pollen production. In the second year of the research (2012, it was revealed that the rapeseed plant was in flower for 39 days, there were 701 plants/flower in the plant, 0.38 kg/da nectar secreted daily and 331.57 kg/da pollen. According to the results of two years, the yield of rapeseed was found to be 41.5 days, the daily nectar production was 0.23 mg/flower/day, the nectar dry matter level was 20.25% and the pollen production was 0.48 mg/flower/day. In Samsun province, it was determined that rapeseed plants flowered before the flowering of many plants in the vicinity in the early spring, and provided honey bees, Apis mellifera L., and many other honey bees, nectar and pollen. It has been demonstrated that the cultivation of rapeseed is cultivated in the early spring, and it can be a convenient source of food for honey bees and other dusty insects.

  5. The Vascular Pathogen Verticillium longisporum Does Not Affect Water Relations and Plant Responses to Drought Stress of Its Host, Brassica napus.

    Science.gov (United States)

    Lopisso, Daniel Teshome; Knüfer, Jessica; Koopmann, Birger; von Tiedemann, Andreas

    2017-04-01

    Verticillium longisporum is a host-specific vascular pathogen of oilseed rape (Brassica napus L.) that causes economic crop losses by impairing plant growth and inducing premature senescence. This study investigates whether plant damage through Verticillium stem striping is due to impaired plant water relations, whether V. longisporum affects responses of a susceptible B. napus variety to drought stress, and whether drought stress, in turn, affects plant responses to V. longisporum. Two-factorial experiments on a susceptible cultivar of B. napus infected or noninfected with V. longisporum and exposed to three watering levels (30, 60, and 100% field capacity) revealed that drought stress and V. longisporum impaired plant growth by entirely different mechanisms. Although both stresses similarly affected plant growth parameters (plant height, hypocotyl diameter, and shoot and root dry matter), infection of B. napus with V. longisporum did not affect any drought-related physiological or molecular genetic plant parameters, including transpiration rate, stomatal conductance, photosynthesis rate, water use efficiency, relative leaf water content, leaf proline content, or the expression of drought-responsive genes. Thus, this study provides comprehensive physiological and molecular genetic evidence explaining the lack of wilt symptoms in B. napus infected with V. longisporum. Likewise, drought tolerance of B. napus was unaffected by V. longisporum, as was the level of disease by drought conditions, thus excluding a concerted action of both stresses in the field. Although it is evident that drought and vascular infection with V. longisporum impair plant growth by different mechanisms, it remains to be determined by which other factors V. longisporum causes crop loss.

  6. Introgressing subgenome components from Brassica rapa and B. carinata to B. juncea for broadening its genetic base and exploring intersubgenomic heterosis

    Directory of Open Access Journals (Sweden)

    Zili Wei

    2016-11-01

    Full Text Available Brassica juncea (AjAjBjBj, is an allotetraploid that arose from two diploid species, B. rapa (ArAr and B. nigra (BnBn. It is an old oilseed crop with unique favorable traits, but the genetic improvement on this species is limited. We developed an approach to broaden its genetic base within several generations by intensive selection. The Ar subgenome from the Asian oil crop B. rapa (ArAr and the Bc subgenome from the African oil crop B. carinata (BcBcCcCc were combined in a synthesized allohexaploid (ArArBcBcCcCc, which was crossed with traditional B. juncea to generate pentaploid F1 hybrids (ArAjBcBjCc, with subsequent self-pollination to obtain newly synthesized B. juncea (Ar/jAr/jBc/jBc/j. After intensive cytological screening and phenotypic selection of fertility and agronomic traits, a population of new-type B. juncea was obtained and was found to be genetically stable at the F6 generation. The new-type B. juncea possesses good fertility and rich genetic diversity and is distinctly divergent but not isolated from traditional B. juncea, as revealed by population genetic analysis with molecular markers. More than half of its genome was modified, showing exotic introgression and novel variation. In addition to the improvement in some traits of the new-type B. juncea lines, a considerable potential for heterosis was observed in inter-subgenomic hybrids between new-type B. juncea lines and traditional B. juncea accessions. The new-type B. juncea exhibited a stable chromosome number and a novel genome composition through multiple generations, providing insight into how to significantly broaden the genetic base of crops with subgenome introgression from their related species and the potential of exploring inter-subgenomic heterosis for hybrid breeding.

  7. Application of Endophytic Pseudomonas fluorescens and a Bacterial Consortium to Brassica napus Can Increase Plant Height and Biomass under Greenhouse and Field Conditions

    Directory of Open Access Journals (Sweden)

    Richard D. Lally

    2017-12-01

    Full Text Available Plant associated bacteria with plant growth promotion (PGP properties have been proposed for use as environmentally friendly biofertilizers for sustainable agriculture; however, analysis of their efficacy in the field is often limited. In this study, greenhouse and field trials were carried out using individual endophytic Pseudomonas fluorescens strains, the well characterized rhizospheric P. fluorescens F113 and an endophytic microbial consortium of 10 different strains. These bacteria had been previously characterized with respect to their PGP properties in vitro and had been shown to harbor a range of traits associated with PGP including siderophore production, 1-aminocyclopropane-1-carboxylic acid (ACC deaminase activity, and inorganic phosphate solubilization. In greenhouse experiments individual strains tagged with gfp and Kmr were applied to Brassica napus as a seed coat and were shown to effectively colonize the rhizosphere and root of B. napus and in addition they demonstrated a significant increase in plant biomass compared with the non-inoculated control. In the field experiment, the bacteria (individual and consortium were spray inoculated to winter oilseed rape B. napus var. Compass which was grown under standard North Western European agronomic conditions. Analysis of the data provides evidence that the application of the live bacterial biofertilizers can enhance aspects of crop development in B. napus at field scale. The field data demonstrated statistically significant increases in crop height, stem/leaf, and pod biomass, particularly, in the case of the consortium inoculated treatment. However, although seed and oil yield were increased in the field in response to inoculation, these data were not statistically significant under the experimental conditions tested. Future field trials will investigate the effectiveness of the inoculants under different agronomic conditions.

  8. The receptor-like kinase SOBIR1 interacts with Brassica napus LepR3 and is required for Leptosphaeria maculans AvrLm1-triggered immunity

    Directory of Open Access Journals (Sweden)

    Lisong eMa

    2015-10-01

    Full Text Available AbstractThe fungus Leptosphaeria maculans (L. maculans is the causal agent of blackleg disease of canola/oilseed rape (Brassica napus worldwide. We previously reported cloning of the B. napus blackleg resistance gene, LepR3, which encodes a receptor-like protein. LepR3 triggers localised cell death upon recognition of its cognate Avr protein, AvrLm1. Here, we exploited the Nicotiana benthamiana model plant to investigate the recognition mechanism of AvrLm1 by LepR3. Co-expression of the LepR3/AvrLm1 gene pair in N. benthamiana resulted in development of a hypersensitive response (HR. However, a truncated AvrLm1 lacking its indigenous signal peptide was compromised in its ability to induce LepR3-mediated HR, indicating that AvrLm1 is perceived by LepR3 extracellularly. Structure-function analysis of the AvrLm1 protein revealed that the C-terminal region of AvrLm1 was required for LepR3-mediated HR in N. benthamiana and for resistance to L. maculans in B. napus. LepR3 was shown to be physically interacting with the B. napus receptor like kinase, SOBIR1 (BnSOBIR1. Silencing of NbSOBIR1 or NbSERK3 (BAK1 compromised LepR3-AvrLm1-dependent HR in N. benthamiana, suggesting that LepR3-mediated resistance to L. maculans in B. napus requires SOBIR1 and BAK1/SERK3. Using this model system, we determined that BnSOBIR1 and SERK3/BAK1 are essential partners in the LepR3 signalling complex and were able to define the AvrLm1 effector domain.

  9. Genome-wide Investigation of microRNAs and Their Targets in Brassica rapa ssp. pekinensis Root with Plasmodiophora brassicae Infection

    Directory of Open Access Journals (Sweden)

    Xiaochun Wei

    2016-07-01

    Full Text Available Increasing evidence has revealed that microRNAs play a pivotal role in the post transcriptional regulation of gene expression in response to pathogens in plants. However, there is little information available about the expression patterns of miRNAs and their targets in Chinese cabbage (Brassica rapa ssp. pekinensis under Plasmodiophora brassicae stress. In the present study, using deep sequencing and degradome analysis, a genome-wide identification of miRNAs and their targets during P. brassicae stress was performed. A total of 221 known and 93 potentially novel miRNAs were successfully identified from two root libraries of one control (635-10CK and P. brassicae-treated Chinese cabbage samples (635-10T. Of these, 14 known and 10 potentially novel miRNAs were found to be differentially expressed after P. brassicae treatment. Degradome analysis revealed that the 223 target genes of the 75 miRNAs could be potentially cleaved. KEGG (Kyoto Encyclopedia of Genes and Genomes pathway analysis suggested that the putative target genes of the miRNAs were predominately involved in selenocompound metabolism and plant hormone signal transduction. Then the expression of 12 miRNAs was validated by quantitative real-time PCR (qRT-PCR. These results provide insights into the miRNA-mediated regulatory networks underlying the stress response to the plant pathogen P. brassicae.

  10. Progress and Bottlenecks in the Early Domestication of the Perennial Oilseed Silphium integrifolium, a Sunflower Substitute

    Directory of Open Access Journals (Sweden)

    Alejandra Vilela

    2018-02-01

    Full Text Available Silflower (Silphium integrifolium Michx. is in the early stages of domestication as a perennial version of oilseed sunflower, its close relative. Grain crops with deep perennial root systems will provide farmers with new alternatives for managing soil moisture and limiting or remediating soil erosion, fertilizer leaching, and loss of soil biota. Several cycles of selection for increased seed production potential following initial germplasm evaluation in 2002 have provided opportunities to document the botany and ecology of this relatively obscure species, to compare agronomic practices for improving its propagation and management, and to evaluate the differences between semi-domesticated and wild accessions that have accrued over this time through intentional and unintentional genetic processes. Key findings include: domestication has increased aboveground biomass at seedling and adult stages; seed yield has increased more, achieving modest improvement in harvest index. Harvest index decreases with nitrogen fertilization. Silflower acquires nitrogen and water from greater depth than typical crops. In agricultural silflower stands within its native range, we found that Puccinia silphii (rust and Eucosma giganteana (moth populations build up to unacceptable levels, but we also found genetic variation for traits contributing to resistance or tolerance. Breeding or management for reduced height and vegetative plasticity should be top priorities for future silflower research outside its native range.

  11. Costs of growing wheat and oilseed rape in slovakia and other V4 countries

    Directory of Open Access Journals (Sweden)

    Lenka Hudáková Stašová

    2017-01-01

    Full Text Available This paper deals with the issue of cost in primary agricultural production. In this paper, we assess the trends in the costs of agricultural products in the V4 countries and compare them with each other. The subject of the analysis is the evaluation of the structure and development of costs and benefits for agricultural production as a whole, partially for crop and for livestock production and also for two specifically selected products. The purpose is to find out whether the costs incurred for the cultivation of wheat and oilseed rape in Slovakia are adequate as they are compared with the surrounding countries. Following the evaluation of the development of total costs, we define the substantive issues in overhead costs and evaluate their development. Based on the results of the analyses we have defined the proportion of overhead costs in agriculture as an important component of total production costs. The paper points to the need to innovate and modernise the way we think about overheads and the method of their calculation. We also look for the answer to how modern cost management methods could influence their height and development. We propose to improve the calculation system of agricultural enterprises in the analysed countries by introducing of non-traditional calculation method which removes the inaccuracy of the traditional methods and the non-targeted allocation of high overheads to the products.

  12. Camelina sativa, an oilseed at the nexus between model system and commercial crop.

    Science.gov (United States)

    Malik, Meghna R; Tang, Jihong; Sharma, Nirmala; Burkitt, Claire; Ji, Yuanyuan; Mykytyshyn, Marie; Bohmert-Tatarev, Karen; Peoples, Oliver; Snell, Kristi D

    2018-06-07

    The rapid assessment of metabolic engineering strategies in plants is aided by crops that provide simple, high throughput transformation systems, a sequenced genome, and the ability to evaluate the resulting plants in field trials. Camelina sativa provides all of these attributes in a robust oilseed platform. The ability to perform field evaluation of Camelina is a useful, and in some studies essential benefit that allows researchers to evaluate how traits perform outside the strictly controlled conditions of a greenhouse. In the field the plants are subjected to higher light intensities, seasonal diurnal variations in temperature and light, competition for nutrients, and watering regimes dictated by natural weather patterns, all which may affect trait performance. There are difficulties associated with the use of Camelina. The current genetic resources available for Camelina pale in comparison to those developed for the model plant Arabidopsis thaliana; however, the sequence similarity of the Arabidopsis and Camelina genomes often allows the use of Arabidopsis as a reference when additional information is needed. Camelina's genome, an allohexaploid, is more complex than other model crops, but the diploid inheritance of its three subgenomes is straightforward. The need to navigate three copies of each gene in genome editing or mutagenesis experiments adds some complexity but also provides advantages for gene dosage experiments. The ability to quickly engineer Camelina with novel traits, advance generations, and bulk up homozygous lines for small-scale field tests in less than a year, in our opinion, far outweighs the complexities associated with the crop.

  13. Induction of shoot regeneration in cotyledon explants of the oilseed crop Sesamum indicum L.

    Directory of Open Access Journals (Sweden)

    Masochon Zimik

    2017-12-01

    Full Text Available Sesamum indicum is an ancient oilseed crop known for its high quality edible oil and its medicinally important lignans. The crop is said to be recalcitrant to plant tissue culture thus limiting the use of modern biotechnology for its genetic improvement. We present here a protocol describing plant regeneration through adventitious shoot formation from cotyledons dissected from sesame seeds soaked for four hours in water. Subculturing of the cotyledons after two weeks of culture on to a fresh Murashige and Skoog medium leads to differentiation of adventitious shoots from the proximal cut end of the explant. Culture of cotyledons on a medium containing 9% sucrose for a couple of weeks prior to transfer to MS medium supplemented with 3% sucrose induced a higher frequency of shoot regeneration. The highest frequency of 25% adventitious shoot regeneration was observed for S. indicum variety UMA. This variety also turned out to be the best among the ten genotypes tested for shoot regeneration through tissue culture. While addition of IAA marginally improved regeneration, silver nitrate was found essential for enhancing the frequency of shoot regeneration. The regenerated shoots formed roots on full strength MS medium supplemented with 1 mg/l IBA and the rooted plants were established in soil.

  14. Energetic balance from biodiesel production of oilseed radish (Raphanus sativus L.)

    Energy Technology Data Exchange (ETDEWEB)

    Siqueira, Rubens [Parana Agronomical Institute (IAPAR), Londrina, PR (Brazil)], E-mail: siqueira@iapar.br; Gamero, Carlos Antonio [Universidade Estadual Paulista (FCA/UNESP), Botucatu, SP (Brazil). Fac. de Ciencias Agronomicas; Boller, Walter [University of Passo Fundo (UPF), RS (Brazil). Agronomical and Veterinary College

    2008-07-01

    It was evaluated the energetic balance and the energetic efficiency of the oilseed radish (Raphanus sativus L.) crop under the no-tillage system. The energy input totalized 6,718 MJ ha{sup -1} where the industrial processing, the fertilizer and the herbicide had participation of 30.7; 23.0 and 20.2 %, respectively. The energy production was 56,650.94 MJ ha{sup -1} and the produced grains have represented 33.2 % of the total. The energetic demand for the production of one kg of biomass of the aerial part, one kg of oil and one kg of biodiesel were respectively 1,829; 19,000 and 27,422 kJ. There was a return of 8.44 for each energy unit used in the process. The net gain of energy was 49,932 MJ ha{sup -1} which is equivalent in energy to 1,295 L diesel oil. (author)

  15. Storage stability of screwpress-extracted oils and residual meals from CELSS candidate oilseed crops

    Science.gov (United States)

    Stephens, S. D.; Watkins, B. A.; Nielsen, S. S.

    1997-01-01

    The efficacy of using screwpress extraction for oil was studied with three Controlled Ecological Life-Support System (CELSS) candidate oilseed crops (soybean, peanut, and canola), since use of volatile organic solvents for oil extraction likely would be impractical in a closed system. Low oil yields from initial work indicated that a modification of the process is necessary to increase extraction efficiency. The extracted oil from each crop was tested for stability and sensory characteristics. When stored at 23 degC, canola oil and meal were least stable to oxidative rancidity, whereas peanut oil and meal were least stable to hydrolytic rancidity. When stored at 65 degC, soybean oil and canola meal were least stable to oxidative rancidity, whereas peanut oil and meal were least stable to hydrolytic rancidity. Sensory evaluation of the extracted oils used in bread and salad dressing indicated that flavor, odor intensity, acceptability, and overall preference may be of concern for screwpress-extracted canola oil when it is used in an unrefined form. Overall results with screwpress-extracted crude oils indicated that soybean oil may be more stable and acceptable than canola or peanut under typical storage conditions.

  16. Effects of insecticides intended for Ceutorhynchus napi Gyll. control in oilseed rape on ground beetles

    Directory of Open Access Journals (Sweden)

    Sivčev Lazar

    2017-01-01

    Full Text Available The effects of insecticides that are commonly used for conventional and integrated oilseed rape (OSR management on ground beetles were studied. Monitoring of harmful species showed that only insecticides intended against Ceutorhynchus napi should be applied. There were no differences in beetle numbers and phenology of settling of C. napi in the OSR fields that received different management practices. The type of OSR management has a primary and significant impact on ground beetles abundance. Early in the spring, ground beetles settled more massively on the non-tilled OSR field with abundant weed cover and mulch on soil surface. However, there were no significant differences in species richness between the OSR fields managed differently. A total of 22 species were recorded. Early in the spring, the granivorous ground beetles Amara aenea (47.3% and Harpalus distinguendus (32.5% were dominant. When insecticides were applied, immigration of ground beetles began, so that their adverse effect was minimal. In both management systems the number of ground beetles and their diversity increased after spraying. In conclusion, no significant harmful effects of the insecticides on ground beetles were detected in OSR fields managed in two different ways.

  17. Mathematical modeling of a biogenous filter cake and identification of oilseed material parameters

    Directory of Open Access Journals (Sweden)

    Očenášek J.

    2009-12-01

    Full Text Available Mathematical modeling of the filtration and extrusion process inside a linear compression chamber has gained a lot of attention during several past decades. This subject was originally related to mechanical and hydraulic properties of soils (in particular work of Terzaghi and later was this approach adopted for the modeling of various technological processes in the chemical industry (work of Shirato. Developed mathematical models of continuum mechanics of porous materials with interstitial fluid were then applied also to the problem of an oilseed expression. In this case, various simplifications and partial linearizations are introduced in models for the reason of an analytical or numerical solubility; or it is not possible to generalize the model formulation into the fully 3D problem of an oil expression extrusion with a complex geometry such as it has a screw press extruder.We proposed a modified model for the oil seeds expression process in a linear compression chamber. The model accounts for the rheological properties of the deformable solid matrix of compressed seed, where the permeability of the porous solid is described by the Darcy's law. A methodology of the experimental work necessary for a material parameters identification is presented together with numerical simulation examples.

  18. Evidence for pollinator cost and farming benefits of neonicotinoid seed coatings on oilseed rape

    Science.gov (United States)

    Budge, G. E.; Garthwaite, D.; Crowe, A.; Boatman, N. D.; Delaplane, K. S.; Brown, M. A.; Thygesen, H. H.; Pietravalle, S.

    2015-08-01

    Chronic exposure to neonicotinoid insecticides has been linked to reduced survival of pollinating insects at both the individual and colony level, but so far only experimentally. Analyses of large-scale datasets to investigate the real-world links between the use of neonicotinoids and pollinator mortality are lacking. Moreover, the impacts of neonicotinoid seed coatings in reducing subsequent applications of foliar insecticide sprays and increasing crop yield are not known, despite the supposed benefits of this practice driving widespread use. Here, we combine large-scale pesticide usage and yield observations from oilseed rape with those detailing honey bee colony losses over an 11 year period, and reveal a correlation between honey bee colony losses and national-scale imidacloprid (a neonicotinoid) usage patterns across England and Wales. We also provide the first evidence that farmers who use neonicotinoid seed coatings reduce the number of subsequent applications of foliar insecticide sprays and may derive an economic return. Our results inform the societal discussion on the pollinator costs and farming benefits of prophylactic neonicotinoid usage on a mass flowering crop.

  19. WHAT IS BEHIND BIASED TECHNICAL CHANGE IN PRODUCTION OF CEREAL AND OILSEED CROPS IN SLOVAKIA?

    Directory of Open Access Journals (Sweden)

    Peter FANDEL

    2014-11-01

    Full Text Available This study investigates the productivity change in the production of cereal and oilseed crops in Slovakia with special emphasis on technical change analysis. It employs a non-parametric distance function approach to measure Malmquist productivity index which is decomposed into technical efficiency change and technical change. Technical change is further decomposed into technical change magnitude and input- and output-bias indices. The productivity change components provide more detailed information about character of productivity change itself and its sources. Our results indicate that productivity in the analysed sector decreased approximately by 20% within the examined period of 1998-2007. The decrease was caused mostly by worsening the technical change (-41,6%. Indices of input- and output bias of technical change were various from unity what suggests that technical change was not Hicks’- neutral. Results of further analysis of the direction of technical change bias indicate that farms in average tend to apply fertilizers-using/seed-saving, seed-using/labour-saving, and fertilizers-using/labour-saving technical change bias over the whole sample period, as well as in the EU pre-accession and EU post-accession periods.

  20. Copper phytoextraction in tandem with oilseed production using commercial cultivars and mutant lines of sunflower.

    Science.gov (United States)

    Kolbas, A; Mench, M; Herzig, R; Nehnevajova, E; Bes, C M

    2011-01-01

    Use of sunflower (Helianthus annuus L.) for Cu phytoextraction and oilseed production on Cu-contaminated topsoils was investigated in afield trial at a former wood preservation site. Six commercial cultivars and two mutant lines were cultivated in plots with and without the addition of compost (5% w/w) and dolomitic limestone (0.2% w/w). Total soil Cu ranged from 163 to 1170 mg kg(-1). In soil solutions, Cu concentration varied between 0.16-0.93 mg L(-1). The amendment increased soil pH, reduced Cu exposure and promoted sunflower growth. Stem length, shoot and capitulum biomasses, seed yield, and shoot and leaf Cu concentrations were measured. At low total soil Cu, shoot Cu mineralomass was higher in commercial cultivars, Le., Salut, Energic, and Countri, whereas competition and shading affected morphological traits of mutants. Based on shoot yield (7 Mg DW ha(-1)) and Cu concentration, the highest removal was 59 g Cu ha(-1). At high total soil Cu, shoot Cu mineralomass peaked for mutants (e.g., 52 g Cu ha(-1) for Mutant 1 line) and cultivars Energic and Countri. Energic seed yield (3.9 Mg air-DW ha(-1)) would be sufficient to produce oil Phenotype traits and shoot Cu removal depended on sunflower types and Cu exposure.

  1. Biotechnological applications in in vitro plant regeneration studies of broccoli (Brassica oleracea L. var. italica), an important vegetable crop.

    Science.gov (United States)

    Kumar, Pankaj; Srivastava, Dinesh Kumar

    2016-04-01

    Biotechnology holds promise for genetic improvement of important vegetable crops. Broccoli (Brassica oleracea L. var. italica) is an important vegetable crop of the family Brassicaceae. However, various biotic and abiotic stresses cause enormous crop yield losses during commercial cultivation of broccoli. Establishment of a reliable, reproducible and efficient in vitro plant regeneration system with cell and tissue culture is a vital prerequisite for biotechnological application of crop improvement programme. An in vitro plant regeneration technique refers to culturing, cell division, cell multiplication, de-differentiation and differentiation of cells, protoplasts, tissues and organs on defined liquid/solid medium under aseptic and controlled environment. Recent progress in the field of plant tissue culture has made this area one of the most dynamic and promising in experimental biology. There are many published reports on in vitro plant regeneration studies in broccoli including direct organogenesis, indirect organogenesis and somatic embryogenesis. This review summarizes those plant regeneration studies in broccoli that could be helpful in drawing the attention of the researchers and scientists to work on it to produce healthy, biotic and abiotic stress resistant plant material and to carry out genetic transformation studies for the production of transgenic plants.

  2. Large-scale monitoring of effects of clothianidin-dressed oilseed rape seeds on pollinating insects in Northern Germany: effects on red mason bees (Osmia bicornis).

    Science.gov (United States)

    Peters, Britta; Gao, Zhenglei; Zumkier, Ulrich

    2016-11-01

    The aim of this study was to investigate the effects of Elado® (10 g clothianidin & 2 g beta-cyfluthrin/kg seed)-dressed oilseed rape on the development and reproduction of mason bees (Osmia bicornis) as part of a large-scale monitoring field study in Northern Germany, where oilseed rape is usually cultivated at 25-33 % of the arable land. Both reference and test sites comprised 65 km 2 in which no other crops attractive to pollinating insects were present. Six study locations were selected per site and three nesting shelters were placed at each location. Of these locations, three locations were directly adjacent to oilseed rape fields, while the other three locations were situated 100 m distant from the nearest oilseed rape field. At each location, 1500 cocoons of O. bicornis were placed into the central nesting shelter. During the exposure phase, nest building activities and foraging behaviour were assessed repeatedly. Cocoons were harvested in autumn to assess parasitization and reproduction including larval development. The following spring, the emergence of the next generation of adults from cocoons was monitored. High reproductive output and low parasitization rates indicated that Elado ® -dressed oilseed rape did not cause any detrimental effects on the development or reproduction of mason bees.

  3. Radiation and nitrogen use at the leaf and canopy level by wheat and oilseed rape during the critical period for grain number definition

    International Nuclear Information System (INIS)

    Dreccer, M.F.; Schapendonk, H.C.M.; Oijen, M. van; Pot, C.S.; Rabbinge, R.

    2000-01-01

    During the critical period for grain number definition, the amount of biomass produced per unit absorbed radiation is more sensitive to nitrogen (N) supply in oilseed rape than in wheat, and reaches a higher value at high N. This response was investigated by combining experimental and modelling work. Oilseed rape and wheat were grown at three levels of N supply, combined with two levels of plant density at high N supply. Canopy photosynthesis and daytime radiation use efficiency (RUE A ) were calculated with a model based on observed N-dependent leaf photosynthesis and observed canopy vertical distribution of light and leaf N. In oilseed rape, RUE A was higher than in wheat and, in contrast to wheat, the sensitivity to canopy leaf N content increased from the start to the end of the critical period. These results were partly explained by the higher leaf photosynthesis in oilseed rape vs wheat. In addition, oilseed rape leaves were increasingly shaded by the inflorescence. Thus, RUE A increased because more leaves were operating at non-saturating light levels. In both species, the vertical distribution of leaf N was close to that optimising canopy photosynthesis. The results are discussed in relation to possibilities for improvement of N productivity in these crops. (author)

  4. Advances in Agronomic Management of Indian Mustard (Brassica juncea (L. Czernj. Cosson: An Overview

    Directory of Open Access Journals (Sweden)

    Kapila Shekhawat

    2012-01-01

    Full Text Available India is the fourth largest oilseed economy in the world. Among the seven edible oilseeds cultivated in India, rapeseed-mustard contributes 28.6% in the total oilseeds production and ranks second after groundnut sharing 27.8% in the India’s oilseed economy. The mustard growing areas in India are experiencing the vast diversity in the agro climatic conditions and different species of rapeseed-mustard are grown in some or other part of the country. Under marginal resource situation, cultivation of rapeseed-mustard becomes less remunerative to the farmers. This results in a big gap between requirement and production of mustard in India. Therefore site-specific nutrient management through soil-test recommendation based should be adopted to improve upon the existing yield levels obtained at farmers field. Effective management of natural resources, integrated approach to plant-water, nutrient and pest management and extension of rapeseed-mustard cultivation to newer areas under different cropping systems will play a key role in further increasing and stabilizing the productivity and production of rapeseed-mustard. The paper reviews the advances in proper land and seedbed preparation, optimum seed and sowing, planting technique, crop geometry, plant canopy, appropriate cropping system, integrated nutrient management and so forth to meet the ever growing demand of oil in the country and to realize the goal of production of 24 million tonnes of oilseed by 2020 AD through these advanced management techniques.

  5. Rapid characterization of transgenic and non-transgenic soybean oils by chemometric methods using NIR spectroscopy

    Science.gov (United States)

    Luna, Aderval S.; da Silva, Arnaldo P.; Pinho, Jéssica S. A.; Ferré, Joan; Boqué, Ricard

    Near infrared (NIR) spectroscopy and multivariate classification were applied to discriminate soybean oil samples into non-transgenic and transgenic. Principal Component Analysis (PCA) was applied to extract relevant features from the spectral data and to remove the anomalous samples. The best results were obtained when with Support Vectors Machine-Discriminant Analysis (SVM-DA) and Partial Least Squares-Discriminant Analysis (PLS-DA) after mean centering plus multiplicative scatter correction. For SVM-DA the percentage of successful classification was 100% for the training group and 100% and 90% in validation group for non transgenic and transgenic soybean oil samples respectively. For PLS-DA the percentage of successful classification was 95% and 100% in training group for non transgenic and transgenic soybean oil samples respectively and 100% and 80% in validation group for non transgenic and transgenic respectively. The results demonstrate that NIR spectroscopy can provide a rapid, nondestructive and reliable method to distinguish non-transgenic and transgenic soybean oils.

  6. Expression of multiple proteins in transgenic plants

    Science.gov (United States)

    Vierstra, Richard D.; Walker, Joseph M.

    2002-01-01

    A method is disclosed for the production of multiple proteins in transgenic plants. A DNA construct for introduction into plants includes a provision to express a fusion protein of two proteins of interest joined by a linking domain including plant ubiquitin. When the fusion protein is produced in the cells of a transgenic plant transformed with the DNA construction, native enzymes present in plant cells cleave the fusion protein to release both proteins of interest into the cells of the transgenic plant. Since the proteins are produced from the same fusion protein, the initial quantities of the proteins in the cells of the plant are approximately equal.

  7. Variations in fatty acid composition, glucosinolate profile and some phytochemical contents in selected oil seed rape (Brassica napus L. cultivars

    Directory of Open Access Journals (Sweden)

    Amin Mohamed, Amal

    2010-06-01

    Full Text Available Rapeseed (Brassica napus L. is now the third most important source of edible oil in the world after soybean and palm oil. In this study seeds of five different rapeseed cultivars namely; pactol, silvo, topas, serw 4 and serw 6 were evaluated for their fatty acid composition, glucosinolate profile, amino acids, total tocopherols and phenolic content. Among all cultivars significant variability in fatty acids were observed. The oleic acid (C18:1 ranged from 56.31% to 58.67%, linoleic acid (C18:2 from 10.52% to 13.74%, α-linolenic acid (C18:3 from 8.83% to 10.32% and erucic acid (22:1 from 0.15% to 0.91%. The glucosinolate profile of rapeseed was also separated and identified using high-performance liquid chromatography. Small variations in the glucosinolate profile were observed among all tested cultivars; however, progoitrin and gluconapin were the major glucosinolate found. Additionally, silvo cultivar showed the highest total glucosinolate c ontents (5.97 μmol/g dw. Generally, the contents of aspartic, glutamic, arginine and leucine were high, while the contents of tyrosine and isoleucine were low among all cultivars. For total tocopherols, the results indicated that both serw 6 and pactol cultivars had the highest total tocopherol contents (138.3 and 102.8 mg/100 g oil, respectively. Total phenolic contents varied from 28.0 to 35.4 mg/g dw. The highest total phenolic content was found in topas while the lowest value was detected in serw 6. These parameters; fatty acid contents, glucosinolate profile and amino acids together with total tocopherols and phenolic contents, could be taken into consideration by oilseed rape breeders as selection criteria for developing genotypes with modified seed quality traits in Brassica napus L.La colza (Brassica napus L. es hoy en día el tercer cultivo más importante de aceites comestibles en el mundo tras el aceite de soja y de palma. En este estudio semillas de cinco cultivos diferentes de colza

  8. EFFECT OF EXTRACTS FROM GERANIACEAE PLANTS ON PIERIS BRASSICAE L.

    Directory of Open Access Journals (Sweden)

    MARIA WAWRZYNIAK

    2010-06-01

    Full Text Available The conducted studies comprised the analyses of activity of extracts derived from selected plants of the Geranium family on some processes of large white butterfly (Pieris brassicae development (oviposition, survival of eggs and caterpillar feeding. The results proved that all tested extracts showed activity against large white butterfly. Geranium pratense L. and Geranium senquineum L. showed better activity than other Geranium plants. Water extracts from these species protected cabbage plants against laying eggs, while applied on eggs caused their mortality. Alcohol and water extracts from G. pratense L. and water extracts from G. senquineum L. increased an amount of food put on mass gain of caterpillars.

  9. Alternaria resistance of Brassicae campestris L. improved by induced mutations

    International Nuclear Information System (INIS)

    Das, M.L.; Rahman, A.

    1989-01-01

    Full text: Seeds of 'YS 52', a cultivar susceptible to Alternaria brassicae (Berk.) Sacc., were exposed to gamma rays (30-90 kR). Eight more resistant mutants were selected in M3 and subjected to further field evaluation. The best mutant '17-5-83' appeared resistant and gave 44% higher yield than the parent, mutant '70-7-82' was found to be moderately resistant and gave a yield 21% higher than the parent. The yield increases seem to be connected with plant architecture changes. (author)

  10. Tracing the transcriptomic changes in synthetic Trigenomic allohexaploids of Brassica using an RNA-Seq approach.

    Directory of Open Access Journals (Sweden)

    Qin Zhao

    Full Text Available Polyploidization has played an important role in plant evolution and speciation, and newly formed allopolyploids have experienced rapid transcriptomic changes. Here, we compared the transcriptomic differences between a synthetic Brassica allohexaploid and its parents using a high-throughput RNA-Seq method. A total of 35,644,409 sequence reads were generated, and 32,642 genes were aligned from the data. Totals of 29,260, 29,060, and 29,697 genes were identified in Brassicarapa, Brassicacarinata, and Brassica allohexaploid, respectively. We compared 7,397 differentially expressed genes (DEGs between Brassica hexaploid and its parents, as well as 2,545 nonadditive genes of Brassica hexaploid. We hypothesized that the higher ploidy level as well as secondary polyploidy might have influenced these changes. The majority of the 3,184 DEGs between Brassica hexaploid and its paternal parent, B. rapa, were involved in the biosynthesis of secondary metabolites, plant-pathogen interactions, photosynthesis, and circadian rhythm. Among the 2,233 DEGs between Brassica hexaploid and its maternal parent, B. carinata, several played roles in plant-pathogen interactions, plant hormone signal transduction, ribosomes, limonene and pinene degradation, photosynthesis, and biosynthesis of secondary metabolites. There were more significant differences in gene expression between the allohexaploid and its paternal parent than between it and its maternal parent, possibly partly because of cytoplasmic and maternal effects. Specific functional categories were enriched among the 2,545 nonadditive genes of Brassica hexaploid compared with the additive genes; the categories included response to stimulus, immune system process, cellular process, metabolic process, rhythmic process, and pigmentation. Many transcription factor genes, methyltransferases, and methylation genes showed differential expression between Brassica hexaploid and its parents. Our results demonstrate that the

  11. Expression of bgt gene in transgenic birch (Betula platyphylla Suk ...

    African Journals Online (AJOL)

    Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch plants indicated that the ...

  12. Expression of bgt gene in transgenic birch (Betula platyphylla Suk.)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-08-04

    Aug 4, 2009 ... Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch.

  13. Genome-wide identification of aquaporin encoding genes in Brassica oleracea and their phylogenetic sequence comparison to Brassica crops and Arabidopsis

    Science.gov (United States)

    Diehn, Till A.; Pommerrenig, Benjamin; Bernhardt, Nadine; Hartmann, Anja; Bienert, Gerd P.

    2015-01-01

    Aquaporins (AQPs) are essential channel proteins that regulate plant water homeostasis and the uptake and distribution of uncharged solutes such as metalloids, urea, ammonia, and carbon dioxide. Despite their importance as crop plants, little is known about AQP gene and protein function in cabbage (Brassica oleracea) and other Brassica species. The recent releases of the genome sequences of B. oleracea and Brassica rapa allow comparative genomic studies in these species to investigate the evolution and features of Brassica genes and proteins. In this study, we identified all AQP genes in B. oleracea by a genome-wide survey. In total, 67 genes of four plant AQP subfamilies were identified. Their full-length gene sequences and locations on chromosomes and scaffolds were manually curated. The identification of six additional full-length AQP sequences in the B. rapa genome added to the recently published AQP protein family of this species. A phylogenetic analysis of AQPs of Arabidopsis thaliana, B. oleracea, B. rapa allowed us to follow AQP evolution in closely related species and to systematically classify and (re-) name these isoforms. Thirty-three groups of AQP-orthologous genes were identified between B. oleracea and Arabidopsis and their expression was analyzed in different organs. The two selectivity filters, gene structure and coding sequences were highly conserved within each AQP subfamily while sequence variations in some introns and untranslated regions were frequent. These data suggest a similar substrate selectivity and function of Brassica AQPs compared to Arabidopsis orthologs. The comparative analyses of all AQP subfamilies in three Brassicaceae species give initial insights into AQP evolution in these taxa. Based on the genome-wide AQP identification in B. oleracea and the sequence analysis and reprocessing of Brassica AQP information, our dataset provides a sequence resource for further investigations of the physiological and molecular functions of

  14. AN APPROACH TO TRANSGENIC CROP MONITORING

    Science.gov (United States)

    Remote sensing by aerial or satellite images may provide a method of identifying transgenic pesticidal crop distribution in the landscape. Genetically engineered crops containing bacterial gene(s) that express an insecticidal protein from Bacillus thuringiensis (Bt) are regulated...

  15. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2018-01-09

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  16. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2016-09-06

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  17. Accumulation of nickel in transgenic tobacco

    Science.gov (United States)

    Sidik, Nik Marzuki; Othman, Noor Farhan

    2013-11-01

    The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TFtransgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

  18. Development of transgenic finger millet (Eleusine coracana (L ...

    Indian Academy of Sciences (India)

    2012-01-18

    Jan 18, 2012 ... plants engineered with chitinase gene have been found to be effective in .... primers (forward: 5′ GCTTCTACACCTACGACGCCTT 3′; reverse: ..... and Toppan A 1996 Field tolerance to fungal pathogens of. Brassica napus ...

  19. Ethanol production from rape straw: Part of an oilseed rape biorefinery

    Energy Technology Data Exchange (ETDEWEB)

    Arvaniti, E

    2010-12-15

    Agricultural residues from rapeseed biodiesel industry (rapeseed cake, rape straw, crude glycerol), which represent the 82%wt. of the oilseed rape, currently have only low-grade applications in the market. For this, a scenario was built on exploiting qualities of rapeseed biodiesel residues for forming added-value products, and expanding and upgrading an existing biodiesel plant, to an oilseed rape biorefinery by 2020 in European ground. Selection of products was based on a technological feasibility study given the time frame, while priority was given to Low-Value-High-Volume readily marketed products, like production of energy and feed. Products selected except rapeseed biodiesel, were ethanol, biogas, enzymes energy, chemical building blocks, and superior quality animal fodder. The production lines were analyzed and prospects for 2020 were projected on a critical basis. Particular merit was given to two products, ethanol from cellulose, and cellulolytic enzymes from rape straw. Cellulosic ethanol from rape straw was optimized for all production steps, i.e. for thermo-chemical pretreatment, enzyme hydrolysis, and fermentation of C6 sugars. Thermo-chemical pretreatment was studied with Wet oxidation technique at different conditions of temperature, reaction time, and oxygen pressure, but also factors like pre-soaking straw in warm water, or recycling liquid were also studied. Wet oxidation has been extensively tested in the past for different substrates, and gives promising results with indicators that are important for cellulosic ethanol production; C6 sugars recovery, high digestibility for enzymes, and limited formed degradation products. Here, optimal pretreatment conditions for rape straw were first presoaking rape straw at 80 deg. C for 20 minutes, and then wet-oxidize with 12 bar of oxygen at 205 deg. C for 3 minutes. Recovery of cellulose and hemicellulose under these conditions was 105% and 106% respectively, while recovery of lignin was 86%. When this

  20. Ethanol production from rape straw: Part of an oilseed rape biorefinery

    Energy Technology Data Exchange (ETDEWEB)

    Arvaniti, E.

    2010-12-15

    Agricultural residues from rapeseed biodiesel industry (rapeseed cake, rape straw, crude glycerol), which represent the 82%wt. of the oilseed rape, currently have only low-grade applications in the market. For this, a scenario was built on exploiting qualities of rapeseed biodiesel residues for forming added-value products, and expanding and upgrading an existing biodiesel plant, to an oilseed rape biorefinery by 2020 in European ground. Selection of products was based on a technological feasibility study given the time frame, while priority was given to Low-Value-High-Volume readily marketed products, like production of energy and feed. Products selected except rapeseed biodiesel, were ethanol, biogas, enzymes energy, chemical building blocks, and superior quality animal fodder. The production lines were analyzed and prospects for 2020 were projected on a critical basis. Particular merit was given to two products, ethanol from cellulose, and cellulolytic enzymes from rape straw. Cellulosic ethanol from rape straw was optimized for all production steps, i.e. for thermo-chemical pretreatment, enzyme hydrolysis, and fermentation of C6 sugars. Thermo-chemical pretreatment was studied with Wet oxidation technique at different conditions of temperature, reaction time, and oxygen pressure, but also factors like pre-soaking straw in warm water, or recycling liquid were also studied. Wet oxidation has been extensively tested in the past for different substrates, and gives promising results with indicators that are important for cellulosic ethanol production; C6 sugars recovery, high digestibility for enzymes, and limited formed degradation products. Here, optimal pretreatment conditions for rape straw were first presoaking rape straw at 80 deg. C for 20 minutes, and then wet-oxidize with 12 bar of oxygen at 205 deg. C for 3 minutes. Recovery of cellulose and hemicellulose under these conditions was 105% and 106% respectively, while recovery of lignin was 86%. When this

  1. A Transgenic Tri-Modality Reporter Mouse

    OpenAIRE

    Yan, Xinrui; Ray, Pritha; Paulmurugan, Ramasamy; Tong, Ricky; Gong, Yongquan; Sathirachinda, Ataya; Wu, Joseph C.; Gambhir, Sanjiv S.

    2013-01-01

    Transgenic mouse with a stably integrated reporter gene(s) can be a valuable resource for obtaining uniformly labeled stem cells, tissues, and organs for various applications. We have generated a transgenic mouse model that ubiquitously expresses a tri-fusion reporter gene (fluc2-tdTomato-ttk) driven by a constitutive chicken β-actin promoter. This "Tri-Modality Reporter Mouse" system allows one to isolate most cells from this donor mouse and image them for bioluminescent (fluc2), fluorescent...

  2. Ethics and Transgenic Crops: a Review

    OpenAIRE

    Robinson, Jonathan

    1999-01-01

    This article represents a review of some of the ethical dilemmas that have arisen as a result of the development and deployment of transgenic crop plants. The potential for transgenic crops to alleviate human hunger and the possible effects on human health are discussed. Risks and benefits to the environment resulting from genetic engineering of crops for resistance to biotic and abiotic stresses are considered, in addition to effects on biodiversity. The socio-economic impacts and distributi...

  3. Transgenic Wheat, Barley and Oats: Future Prospects

    Science.gov (United States)

    Dunwell, Jim M.

    Following the success of transgenic maize and rice, methods have now been developed for the efficient introduction of genes into wheat, barley and oats. This review summarizes the present position in relation to these three species, and also uses information from field trial databases and the patent literature to assess the future trends in the exploitation of transgenic material. This analysis includes agronomic traits and also discusses opportunities in expanding areas such as biofuels and biopharming.

  4. Transgenic animals and their application in medicine

    OpenAIRE

    Bagle TR, Kunkulol RR, Baig MS, More SY

    2013-01-01

    Transgenic animals are animals that are genetically altered to have traits that mimic symptoms of specific human pathologies. They provide genetic models of various human diseases which are important in understanding disease and developing new targets. In early 1980 Gordon and co-workers described the first gene addition experiment using the microinjection technology and since then the impact of transgenic technology on basic research has been significant. Within 20 years of its inception, AT...

  5. The Emerging Oilseed Crop Sesamum indicum Enters the “Omics” Era

    Directory of Open Access Journals (Sweden)

    Komivi Dossa

    2017-06-01

    Full Text Available Sesame (Sesamum indicum L. is one of the oldest oilseed crops widely grown in Africa and Asia for its high-quality nutritional seeds. It is well adapted to harsh environments and constitutes an alternative cash crop for smallholders in developing countries. Despite its economic and nutritional importance, sesame is considered as an orphan crop because it has received very little attention from science. As a consequence, it lags behind the other major oil crops as far as genetic improvement is concerned. In recent years, the scenario has considerably changed with the decoding of the sesame nuclear genome leading to the development of various genomic resources including molecular markers, comprehensive genetic maps, high-quality transcriptome assemblies, web-based functional databases and diverse daft genome sequences. The availability of these tools in association with the discovery of candidate genes and quantitative trait locis for key agronomic traits including high oil content and quality, waterlogging and drought tolerance, disease resistance, cytoplasmic male sterility, high yield, pave the way to the development of some new strategies for sesame genetic improvement. As a result, sesame has graduated from an “orphan crop” to a “genomic resource-rich crop.” With the limited research teams working on sesame worldwide, more synergic efforts are needed to integrate these resources in sesame breeding for productivity upsurge, ensuring food security and improved livelihood in developing countries. This review retraces the evolution of sesame research by highlighting the recent advances in the “Omics” area and also critically discusses the future prospects for a further genetic improvement and a better expansion of this crop.

  6. Growth and Yield Stimulation of Winter Oilseed Rape (Brasssica Napus L. by Mg-Titanit Fertiliser

    Directory of Open Access Journals (Sweden)

    Kováčik Peter

    2014-12-01

    Full Text Available The effort to achieve higher yields at the required qualitative level has led to the intensive studying the problems of the rational usage of the titanium containing fertilisers by the agricultural research in the course the previous thirty years. Therefore, the objective of the experiment was to evaluate the impact of two doses of Mg-Titanit (0.2 l/ha and 0.4 l/ha on the formation of the aboveground and underground phytomass, also on the total chlorophyll in leaves, on the titanium and nitrogen content in the seeds and straw, on the quantity and quality of winter rape yield. The doses were applied two or three times on the leaves of winter rape (BBCH 50-52, BBCH 59, BBCH 66-67. The experiment was realized on the Haplic Chernozem (48°42´ N, 17°70´ E - Western Slovakia during two farming years (2009/2010 and 2010/2011. The results showed that all three applications of Mg-Titanit in both doses stimulated the formation of aboveground and underground phytomass of winter rape. The highest growth of phytomass was detected after the second application. The application of Mg-Titanit in the growth phases BBCH 50-52 and BBCH 59 increased the contents of both chlorophylls (a and b, where the growth of chlorophyll b content was more considerable than the growth of chlorophyll a content. The third spraying by Mg-Titanit decreased the content of the total chlorophyll. The application of Mg-Titanit had the positive impact on the yield of seeds, straw and fat content in the winter oilseed rape seeds.

  7. Plant-Herbivore and Plant-Pollinator Interactions of the Developing Perennial Oilseed Crop, Silphium integrifolium.

    Science.gov (United States)

    Prasifka, J R; Mallinger, R E; Hulke, B S; Larson, S R; Van Tassel, D

    2017-12-08

    Sampling in Kansas and North Dakota documented the plant-herbivore and plant-pollinator interactions of the developing perennial oilseed crop, Silphium integrifolium Michx. The larva of the tortricid moth, Eucosma giganteana (Riley), was the most damaging floret- and seed-feeding pest in Kansas, with infested heads producing ≈85% (2015) or ≈45% (2016) fewer seeds than apparently undamaged heads. Necrosis of apical meristems caused stunting and delayed bloom in Kansas; though the source of the necrosis is not known, observations of the tarnished plant bug, Lygus lineolaris (Palisot de Beauvois; Hemiptera: Miridae), in S. integrifolium terminals suggest a possible cause. In North Dakota, E. giganteana larvae were not found, but pupae of Neotephritis finalis (Loew; Diptera: Tephritidae), a minor pest of cultivated sunflower, were common in the heads of S. integrifolium. Bees appeared highly attracted to S. integrifolium, and in all but one observation, bees were seen actively collecting pollen. The most common bees included large apids (Apis mellifera L., Svastra obliqua [Say], Melissodes spp.) and small-bodied halictids (Lasioglossum [Dialictus] spp.). Controlled pollination experiments demonstrated that S. integrifolium is pollinator dependent, due to both mechanical barriers (imperfect florets and protogyny) and genetic self-incompatibility. Subsequent greenhouse tests and AFLP confirmation of putative self-progeny show that a low (<1%) level of self-pollination is possible. If genetic self-incompatibility is eventually reduced through breeding, mechanical barriers would maintain a reliance on bees to move pollen between male and female florets. Collectively, observations on S. integrifolium show that both herbivore and pollinator management are important to maximize seed production. Published by Oxford University Press on behalf of Entomological Society of America 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  8. Large-scale monitoring of effects of clothianidin-dressed oilseed rape seeds on pollinating insects in northern Germany: residues of clothianidin in pollen, nectar and honey

    OpenAIRE

    Rolke, Daniel; Persigehl, Markus; Peters, Britta; Sterk, Guido; Blenau, Wolfgang

    2016-01-01

    This study was part of a large-scale monitoring project to assess the possible effects of Elado® (10 g clothianidin & 2 g β-cyfluthrin/kg seed)-dressed oilseed rape seeds on different pollinators in Northern Germany. Firstly, residues of clothianidin and its active metabolites thiazolylnitroguanidine and thiazolylmethylurea were measured in nectar and pollen from Elado®-dressed (test site, T) and undressed (reference site, R) oilseed rape collected by honey bees confined within tunnel tents. ...

  9. Comparison of nutritional value of transgenic peanut expressing bar and rcg3 genes with non-transgenic counterparts

    International Nuclear Information System (INIS)

    Robab, U.E.; )

    2014-01-01

    The transgenic peanut plants expressing bar and rcg3 genes were subjected to assessment of any change in nutritional value of the crop at various locations. The protein and fat contents of transgenic lines were compared with the non-transgenic parent varieties. Protein content in the transgenic lines was higher as compared to that in non-transgenic counterparts and differences among locations for fat and protein content were significant. No differences among fatty acids were recorded for genes, events and locations. Irrespective of small differences, all the values were in range described for this crop and transgenic lines appeared to be substantially equivalent to non-transgenic parent varieties. (author)

  10. Identification of seed-related QTL in Brassica rapa

    Directory of Open Access Journals (Sweden)

    H. Bagheri

    2013-10-01

    Full Text Available To reveal the genetic variation, and loci involved, for a range of seed-related traits, a new F2 mapping population was developed by crossing Brassica rapa ssp. parachinensis L58 (CaiXin with B. rapa ssp. trilocularis R-o-18 (spring oil seed, both rapid flowering and self-compatible. A linkage map was constructed using 97 AFLPs and 21 SSRs, covering a map distance of 757 cM with an average resolution of 6.4 cM, and 13 quantitative trait loci (QTL were detected for nine traits. A strong seed colour QTL (LOD 26 co-localized with QTL for seed size (LOD 7, seed weight (LOD 4.6, seed oil content (LOD 6.6, number of siliques (LOD 3 and number of seeds per silique (LOD 3. There was only a significant positive correlation between seed colour and seed oil content in the yellow coloured classes. Seed coat colour and seed size were controlled by the maternal plant genotype. Plants with more siliques tended to have more, but smaller, seeds and higher seed oil content. Seed colour and seed oil content appeared to be controlled by two closely linked loci in repulsion phase. Thus, it may not always be advantageous to select for yellow-seededness when breeding for high seed oil content in Brassicas.

  11. A proteomic analysis of seed development in Brassica campestri L.

    Directory of Open Access Journals (Sweden)

    Wenlan Li

    Full Text Available To gain insights into the protein dynamics during seed development, a proteomic study on the developing Brassica campestri L. seeds with embryos in different embryogenesis stages was carried out. The seed proteins at 10, 16, 20, 25 and 35 DAP (days after pollination, respectively, were separated using two-dimensional gel electrophoresis and identities of 209 spots with altered abundance were determined by matrix-assisted laser desorption ionization time-of-flight/time-of-flight mass spectrometry (MALDI-TOF/TOF MS. These proteins were classified into 16 groups according to their functions. The most abundant proteins were related to primary metabolism, indicating the heavy demand of materials for rapid embryo growth. Besides, the high amount of proteins involved in protein processing and destination indicated importance of protein renewal during seed development. The remaining were those participated in oxidation/detoxification, energy, defense, transcription, protein synthesis, transporter, cell structure, signal transduction, secondary metabolism, transposition, DNA repair, storage and so on. Protein abundance profiles of each functional class were generated and hierarchical cluster analysis established 8 groups of dynamic patterns. Our results revealed novel characters of protein dynamics in seed development in Brassica campestri L. and provided valuable information about the complex process of seed development in plants.

  12. Nitrogen and Sulphur Relations in Effecting Yield and Quality of Cereals and Oilseed Crops

    Directory of Open Access Journals (Sweden)

    B.K. Nad

    2001-01-01

    Full Text Available Nitrogen and sulphur, both vital structural elements, are especially needed for the synthesis of proteins and oils. Investigations revealed the required application of sulphur is one half to one third the amount of nitrogen, and the ratio becomes narrower in mustard (Brassica juncea L., followed by wheat and rice. The efficiency of an increased level of nitrogen required a proportionately higher amount of sulphur. A critical investigation on the effective utilization of applied vis-à-vis absorbed nitrogen in wheat and mustard envisaged accumulation of NO3-N in vegetative parts when sulphur remained proportionately low. Application of sulphur hastened the chemical reduction of absorbed NO3– for its effective utilization. The effect was more pronounced in mustard than in wheat. Easily available forms of sulphur, like ammonium sulphate and gypsum, as compared to pyrite or elemental sulphur, maintained adequate N to S ratio in rice, resulting in a reduction in the percent of unfilled grain, a major consideration in rice yield. A narrow N to S ratio, with both at higher levels, increased the oil content but raised the saponification value of the oil, a measure of free fatty acids. Whereas, a proportionately narrow N to S ratio at moderate dose resulted in adequately higher seed and oil yield with relatively low saponification value, associated with increased iodine value of the oil, indicating respectively low free fatty acids and higher proportion of unsaturated fatty acids, an index for better quality of the oil.

  13. Reaction of winter oilseed rape varieties to elevated concentrations of lead

    Directory of Open Access Journals (Sweden)

    Oreščanin Bojana

    2012-01-01

    Full Text Available Remediation methods allow the removal of metals from contaminated soil, and phytoremediation a technology for cleaning contaminated soil and waste material by plants, is becoming increasingly used. Brassica napus L., as one of the main oilcrops and high-biomass producing species, is becoming more and more interesting for the use in phytoextraction as it is proved to be tolerant to higher concentrations of heavy metals. The aim of this study was to examine the specific responses of three commercial winter rapeseed varieties, Banaćanka, Slavica and Kata, to the increased concentrations of lead in vitro. Significant reduction in root length of plants treated with lead was observed only in the variety Slavica, indicating susceptibility of this variety to the increased concentrations of this heavy metal. As in variety Kata a significant reduction in the length of the above-ground part due to the treatment with lead was detected, it could be concluded that the variety Banaćanka is the most tolerant to the applied concentrations of lead since there were no significant changes in the growth and biomass accumulation in all treatments except one, and could be recommended for further use in phytoremediation studies. [Projekat Ministarstva nauke Republike Srbije, br. TR31025 i br. III43007

  14. Conserved microstructure of the Brassica B Genome of Brassica nigra in relation to homologous regions of Arabidopsis thaliana, B. rapa and B. oleracea

    Science.gov (United States)

    2013-01-01

    Background The Brassica B genome is known to carry several important traits, yet there has been limited analyses of its underlying genome structure, especially in comparison to the closely related A and C genomes. A bacterial artificial chromosome (BAC) library of Brassica nigra was developed and screened with 17 genes from a 222 kb region of A. thaliana that had been well characterised in both the Brassica A and C genomes. Results Fingerprinting of 483 apparently non-redundant clones defined physical contigs for the corresponding regions in B. nigra. The target region is duplicated in A. thaliana and six homologous contigs were found in B. nigra resulting from the whole genome triplication event shared by the Brassiceae tribe. BACs representative of each region were sequenced to elucidate the level of microscale rearrangements across the Brassica species divide. Conclusions Although the B genome species separated from the A/C lineage some 6 Mya, comparisons between the three paleopolyploid Brassica genomes revealed extensive conservation of gene content and sequence identity. The level of fractionation or gene loss varied across genomes and genomic regions; however, the greatest loss of genes was observed to be common to all three genomes. One large-scale chromosomal rearrangement differentiated the B genome suggesting such events could contribute to the lack of recombination observed between B genome species and those of the closely related A/C lineage. PMID:23586706

  15. Survival of pathogens of Brussels sprouts (Brassica oleracea Gemifera group) in crop residues

    NARCIS (Netherlands)

    Köhl, J.; Vlaswinkel, M.E.T.; Groenenboom-de Haas, B.H.; Kastelein, P.; Hoof, van R.A.; Wolf, van der J.M.; Krijger, M.C.

    2011-01-01

    Mycosphaerella brassicicola (ringspot), Alternaria brassicicola and A. brassicae (dark leaf spot) and Xanthomonas campestris pv. campestris (black spot) can infect leaves of Brussels sprouts resulting in yield losses. Infections of outer leaves of sprouts cause severe losses in quality. Crop

  16. Genetic variation in the hTAS2R38 taste receptor and brassica vegetable intake

    DEFF Research Database (Denmark)

    Gorovic, Nela; Afzal, Shoaib; Tjonneland, Anne

    2011-01-01

    The human TAS2R38 receptor is believed to be partly responsible for the ability to taste phenylthiocarbamide (PTC), a bitter compound very similar to the bitter glucosinolates found in brassica vegetables. These vegetables and their active compounds have chemo-protective properties. This study...... investigated the relationship between genetic variation in the hTAS2R38 receptor and the actual consumption of brassica vegetables with the hypothesis that taster status was associated with intake of these vegetables. Furthermore, secondary intake information on alcohol, chocolate, coffee, smoking, BMI...... on their brassica vegetables intake from the upper quartile (>= a parts per thousand yen23 g/day) and the lower quartile (brassicas from a randomly selected sub-cohort of DCH. DNA was analysed for three functional SNPs in the hTAS2R38 gene. The hTAS2R38...

  17. Seasonal Effects on Bioactive Compounds and Antioxidant Capacity of Six Economically Important Brassica Vegetables

    Directory of Open Access Journals (Sweden)

    Eduardo A.S. Rosa

    2011-08-01

    Full Text Available Research on natural and bioactive compounds is increasingly focused on their effects on human health, but there are unexpectedly few studies evaluating the relationship between climate and natural antioxidants. The aim of this study was analyze the biological role of six different Brassica vegetables (Brassica oleracea L. and Brassica rapa L. as a natural source of antioxidant compounds. The antioxidant activity may be assigned to high levels of L-ascorbic acid, total phenolics and total flavonoids of each sample. The climate seasons affected directly the concentration of bioactive components and the antioxidant activity. Broccoli inflorescences and Portuguese kale showed high antioxidant activity in Spring-Summer whilst turnip leaves did so in Summer-Winter. The Brassica vegetables can provide considerable amounts of bioactive compounds and thus may constitute an important natural source of dietary antioxidants.

  18. Varietal improvement of Brassica species through introduction, hybridization and mutation breeding techniques

    International Nuclear Information System (INIS)

    Rhaman, A.

    1988-11-01

    Germplasm of Brassica campestris and Brassica juncea was collected from various parts of Bangladesh and evaluated for yield, oil content etc. prior to the breeding programme. Seeds of the B. campestris variety YS-52, possessing good agronomic characteristics, were treated with mutagens (gamma rays and sodium azide) to widen the genetic variation. Mutants were selected for higher yield and resistance against Alternaria brassicae. The two mutant lines BINA 1 and BINA 2 were selected exceeding the parent variety considerably in yield and disease resistance. They are candidates for recommended varieties. Brassica juncea variety RCM 625 was treated with gamma rays and EMS. Four higher yielding and earlier maturing mutants are being evaluated further. 6 tabs

  19. Identification and characterization of mobile genetic elements LINEs from Brassica genome.

    Science.gov (United States)

    Nouroz, Faisal; Noreen, Shumaila; Khan, Muhammad Fiaz; Ahmed, Shehzad; Heslop-Harrison, J S Pat

    2017-09-05

    Among transposable elements (TEs), the LTR retrotransposons are abundant followed by non-LTR retrotransposons in plant genomes, the lateral being represented by LINEs and SINEs. Computational and molecular approaches were used for the characterization of Brassica LINEs, their diversity and phylogenetic relationships. Four autonomous and four non-autonomous LINE families were identified and characterized from Brassica. Most of the autonomous LINEs displayed two open reading frames, ORF1 and ORF2, where ORF1 is a gag protein domain, while ORF2 encodes endonuclease (EN) and a reverse transcriptase (RT). Three of four families encoded an additional RNase H (RH) domain in pol gene common to 'R' and 'I' type of LINEs. The PCR analyses based on LINEs RT fragments indicate their high diversity and widespread occurrence in tested 40 Brassica cultivars. Database searches revealed the homology in LINE sequences in closely related genera Arabidopsis indicating their origin from common ancestors predating their separation. The alignment of 58 LINEs RT sequences from Brassica, Arabidopsis and other plants depicted 4 conserved domains (domain II-V) showing similarity to previously detected domains. Based on RT alignment of Brassica and 3 known LINEs from monocots, Brassicaceae LINEs clustered in separate clade, further resolving 4 Brassica-Arabidopsis specific families in 2 sub-clades. High similarities were observed in RT sequences in the members of same family, while low homology was detected in members across the families. The investigation led to the characterization of Brassica specific LINE families and their diversity across Brassica species and their cultivars. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Evolvement of transgenic male-sterility and fertility-restoration system in rice for production of hybrid varieties.

    Science.gov (United States)

    Rao, Gundra Sivakrishna; Deveshwar, Priyanka; Sharma, Malini; Kapoor, Sanjay; Rao, Khareedu Venkateswara

    2018-01-01

    We have developed a unique male-sterility and fertility-restoration system in rice by combining Brassica napus cysteine-protease gene (BnCysP1) with anther-specific P12 promoter of rice for facilitating production of hybrid varieties. In diverse crop plants, male-sterility has been exploited as a useful approach for production of hybrid varieties to harness the benefits of hybrid vigour. The promoter region of Os12bglu38 gene of rice has been isolated from the developing panicles and was designated as P12. The promoter was fused with gusA reporter gene and was expressed in Arabidopsis and rice systems. Transgenic plants exhibited GUS activity in tapetal cells and pollen of the developing anthers indicating anther/pollen-specific expression of the promoter. For engineering nuclear male sterility, the coding region of Brassica napus cysteine protease1 (BnCysP1) was isolated from developing seeds and fused to P12 promoter. Transgenic rice plants obtained with P12-BnCysP1 failed to produce functional pollen grains. The F 1 seeds obtained from BnCysP1 male-sterile plants and untransformed controls showed 1:1 (tolerant:sensitive) ratio when germinated on the MS medium supplemented with phosphinothricin (5 mg/l), confirming that the male sterility has been successfully engineered in rice. For male fertility restoration, transgenic rice plants carrying BnCysP1Si silencing system were developed. The pollination of BnCysP1 male-sterile (female-fertile) plants with BnCysP1Si pollen resulted in normal grain filling. The F 1 seeds of BnCysP1 × BnCysP1Si when germinated on the MS basal medium containing PPT (5 mg/l) and hygromycin (70 mg/l) exhibited 1:1 (tolerant:sensitive) ratio and the tolerant plants invariably showed normal grain filling. The overall results clearly suggest that the customized male-sterility & fertility-restoration system can be exploited for quality hybrid seed production in various crops.

  1. Mitigation of greenhouse gas emissions in the French winter oilseed rape in order to produce sustainable biodiesel

    Directory of Open Access Journals (Sweden)

    Flénet Francis

    2012-05-01

    Full Text Available The objectives of the study were (1 to evaluate the possibility for the French winter oilseed rape to achieve the 50% greenhouse gas (GHG saving criteria of the European Directive on the promotion of renewable energy (2009/28/EC, and (2 to investigate mitigation options. The agricultural GHG emissions were calculated with the actual seed yields and cultural operations of more than 5000 winter oilseed rape fields producing seeds collected by 27 grain storage companies (GSC, while the same values of GHG emissions for transport and biodiesel processing were used for all GSC. The study clearly showed that the 50% GHG saving criteria could not be achieved each year, by each of the grain storage company, without improvements of crop management. The possibility to reduce the GHG emissions by improving the efficiency of mineral N fertilization was demonstrated. Improving seed yields without increasing the amount of N application on the fields would also decrease GHG emissions. On the contrary, the application of organic matter appeared to be largely ineffective because of the way N2O emissions were calculated in the study (tier 1 method of International Panel on Climate Change.

  2. Mitochondrial genome sequencing helps show the evolutionary mechanism of mitochondrial genome formation in Brassica

    Science.gov (United States)

    2011-01-01

    Background Angiosperm mitochondrial genomes are more complex than those of other organisms. Analyses of the mitochondrial genome sequences of at least 11 angiosperm species have showed several common properties; these cannot easily explain, however, how the diverse mitotypes evolved within each genus or species. We analyzed the evolutionary relationships of Brassica mitotypes by sequencing. Results We sequenced the mitotypes of cam (Brassica rapa), ole (B. oleracea), jun (B. juncea), and car (B. carinata) and analyzed them together with two previously sequenced mitotypes of B. napus (pol and nap). The sizes of whole single circular genomes of cam, jun, ole, and car are 219,747 bp, 219,766 bp, 360,271 bp, and 232,241 bp, respectively. The mitochondrial genome of ole is largest as a resulting of the duplication of a 141.8 kb segment. The jun mitotype is the result of an inherited cam mitotype, and pol is also derived from the cam mitotype with evolutionary modifications. Genes with known functions are conserved in all mitotypes, but clear variation in open reading frames (ORFs) with unknown functions among the six mitotypes was observed. Sequence relationship analysis showed that there has been genome compaction and inheritance in the course of Brassica mitotype evolution. Conclusions We have sequenced four Brassica mitotypes, compared six Brassica mitotypes and suggested a mechanism for mitochondrial genome formation in Brassica, including evolutionary events such as inheritance, duplication, rearrangement, genome compaction, and mutation. PMID:21988783

  3. In vitro activity of glucosinolates and their degradation products against brassica-pathogenic bacteria and fungi.

    Science.gov (United States)

    Sotelo, T; Lema, M; Soengas, P; Cartea, M E; Velasco, P

    2015-01-01

    Glucosinolates (GSLs) are secondary metabolites found in Brassica vegetables that confer on them resistance against pests and diseases. Both GSLs and glucosinolate hydrolysis products (GHPs) have shown positive effects in reducing soil pathogens. Information about their in vitro biocide effects is scarce, but previous studies have shown sinigrin GSLs and their associated allyl isothiocyanate (AITC) to be soil biocides. The objective of this work was to evaluate the biocide effects of 17 GSLs and GHPs and of leaf methanolic extracts of different GSL-enriched Brassica crops on suppressing in vitro growth of two bacterial (Xanthomonas campestris pv. campestris and Pseudomonas syringae pv. maculicola) and two fungal (Alternaria brassicae and Sclerotinia scletoriorum) Brassica pathogens. GSLs, GHPs, and methanolic leaf extracts inhibited the development of the pathogens tested compared to the control, and the effect was dose dependent. Furthermore, the biocide effects of the different compounds studied were dependent on the species and race of the pathogen. These results indicate that GSLs and their GHPs, as well as extracts of different Brassica species, have potential to inhibit pathogen growth and offer new opportunities to study the use of Brassica crops in biofumigation for the control of multiple diseases. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. A comparative map viewer integrating genetic maps for Brassica and Arabidopsis

    Directory of Open Access Journals (Sweden)

    Erwin Timothy A

    2007-07-01

    Full Text Available Abstract Background Molecular genetic maps provide a means to link heritable traits with underlying genome sequence variation. Several genetic maps have been constructed for Brassica species, yet to date, there has been no simple means to compare this information or to associate mapped traits with the genome sequence of the related model plant, Arabidopsis. Description We have developed a comparative genetic map database for the viewing, comparison and analysis of Brassica and Arabidopsis genetic, physical and trait map information. This web-based tool allows users to view and compare genetic and physical maps, search for traits and markers, and compare genetic linkage groups within and between the amphidiploid and diploid Brassica genomes. The inclusion of Arabidopsis data enables comparison between Brassica maps that share no common markers. Analysis of conserved syntenic blocks between Arabidopsis and collated Brassica genetic maps validates the application of this system. This tool is freely available over the internet on http://bioinformatics.pbcbasc.latrobe.edu.au/cmap. Conclusion This database enables users to interrogate the relationship between Brassica genetic maps and the sequenced genome of A. thaliana, permitting the comparison of genetic linkage groups and mapped traits and the rapid identification of candidate genes.

  5. Cytological and morphological analysis of hybrids between Brassicoraphanus, and Brassica napus for introgression of clubroot resistant trait into Brassica napus L.

    Science.gov (United States)

    Zhan, Zongxiang; Nwafor, Chinedu Charles; Hou, Zhaoke; Gong, Jianfang; Zhu, Bin; Jiang, Yingfen; Zhou, Yongming; Wu, Jiangsheng; Piao, Zhongyun; Tong, Yue; Liu, Chao; Zhang, Chunyu

    2017-01-01

    Interspecific hybridization is a powerful tool for improvement of crop species, it has the potential to broaden the genetic base and create new plant forms for breeding programs. Synthetic allopolyploid is a widely-used model for the study of genetic recombination and fixed heterosis in Brassica. In Brassica napus breeding, identification and introgression of new sources of clubroot resistance trait from wild or related species into it by hybridization is a long-term crop management strategy for clubroot disease. Radish (Raphanus sativus L.) is a close relative of the Brassica and most radish accessions are immune to the clubroot disease. A synthesized allotetraploid Brassicoraphanus (RRCC, 2n = 36) between R. sativus cv. HQ-04 (2n = 18, RR) and Brassica oleracea var. alboglabra (L.H Bailey) (2n = 18, CC) proved resistant of multiple clubroot disease pathogen P. brassicae. To predict the possibility to transfer the clubroot resistance trait from the RR subgenome of allotetraploid Brassicoraphanus (RRCC, 2n = 36) into Brassica napus (AACC, 2n = 38), we analyzed the frequency of chromosome pairings in the F1 hybrids produced from a cross between B. napus cv. HS5 and the allotetraploid, characterize the genomic composition of some backcrossed progeny (BC1) using GISH, BAC-FISH and AFLP techniques. The level of intergenomic pairing between A and R genomes in the F1 hybrid was high, allosyndetic bivalents formed in 73.53% PMCs indicative of significant level of homeologous recombination between two genomes and high probability of incorporating chromosomal segments/genes from R-genome into A/C-genomes. The BC1 plants inherited variant extra R chromosomes or fragments from allotetraploid as revealed by GISH and AFLP analysis. 13.51% BC2 individuals were resistant to clubroot disease, and several resistance lines had high pollen fertility, Overall, the genetic material presented in this work represents a potential new genetic resource for practical use in breeding B. napus

  6. The ecological risks of transgenic plants.

    Science.gov (United States)

    Giovannetti, Manuela

    2003-01-01

    Biotechnologies have been utilized "ante litteram" for thousands of years to produce food and drink and genetic engineering techniques have been widely applied to produce many compounds for human use, from insulin to other medicines. The debate on genetically modified (GM) organisms broke out all over the world only when GM crops were released into the field. Plant ecologists, microbiologists and population geneticists carried out experiments aimed at evaluating the environmental impact of GM crops. The most significant findings concern: the spread of transgenes through GM pollen diffusion and its environmental impact after hybridisation with closely related wild species or subspecies; horizontal gene transfer from transgenic plants to soil microbes; the impact of insecticide proteins released into the soil by transformed plants on non-target microbial soil communities. Recent developments in genetic engineering produced a technology, dubbed "Terminator", which protects patented genes introduced in transgenic plants by killing the seeds in the second generation. This genetic construct, which interferes so heavily with fundamental life processes, is considered dangerous and should be ex-ante evaluated taking into account the data on "unexpected events", as here discussed, instead of relying on the "safe until proven otherwise" claim. Awareness that scientists, biotechnologists and genetic engineers cannot answer the fundamental question "how likely is that transgenes will be transferred from cultivated plants into the natural environment?" should foster long-term studies on the ecological risks and benefits of transgenic crops.

  7. Oilseed rape as feedstock for biodiesel production in relation to the environment and human health

    Directory of Open Access Journals (Sweden)

    Marek Angelovič

    2013-05-01

    Full Text Available Oilseed rape is one of the most important crops in cultivation process. A current developmental trend in non-food rapeseed production on agricultural land shows that this new course is irreversible and is a great opportunity for agriculture. Non-food rapeseed production is focused on the production of biodiesel. Biodiesel has good environmental properties. Lower emissions are produced by the combustion of biodiesel than for diesel. In content of exhaust gas is observed a significant decrease of polycyclic aromatic hydrocarbons, particulate matter and etc. The analysis of the literary knowledge on impacts of biodiesel on exhaust emissions, on regulated emissions, shows a reduction of 10.1% for particulate matter, of 21.1% for hydrocarbons, and 11.0% for carbon monoxide with the use of B20. Nitrogen oxides (NOx increased by 2.0%. Biodiesel was introduced into the European market in the 1988s as B100. The use of blends with content up to 5% biodiesel has no significant impact on the emissions and their toxicity. An increased mutagenicity was observed with blends containing 20%. Nevertheless, increased mutagenic effects were observed under specific conditions. Accordingly, the problem concerning blends of diesel fuel with biodiesel (B20 should be investigated with high priority. No comprehensive risk assessment for diesel engine emissions from biodiesel and its blends is possible In regard to a comprehensive hazard characterization it is urged to develop a panel of standardized and internationally accepted protocols which allow a reliable assessment of possible health hazards which may arise from the combustion of new fuels compared to conventional diesel fuel. These methods should be robust and should reflect the various health hazards associated with diesel engine emissions to supplement data on regulated emissions. Methods for the generation of the exhaust and sample preparation should be harmonized. There is sufficient evidence supporting a

  8. Linkage mapping in the oilseed crop Jatropha curcas L. reveals a locus controlling the biosynthesis of phorbol esters which cause seed toxicity

    NARCIS (Netherlands)

    King, A.J.; Montes, L.R.; Clarke, J.G.; Affleck, J.; Li, Y.; Witsenboer, H.; Vossen, van der E.; Linde, van der P.; Tripathi, Y.; Tavares, E.; Shukla, P.; Rajasekaran, T.; Loo, van E.N.; Graham, I.A.

    2013-01-01

    Current efforts to grow the tropical oilseed crop Jatropha curcas L. economically are hampered by the lack of cultivars and the presence of toxic phorbol esters (PE) within the seeds of most provenances. These PE restrict the conversion of seed cake into animal feed, although naturally occurring

  9. Formulations of the endophytic bacterium Bacillus subtilis Tu-100 suppress Sclerotinia sclerotiorum on oilseed rape and improve plant vigor in field trials conducted at separate locations

    Science.gov (United States)

    Sclerotinia sclerotiorum causes serious yield losses in crops in The People’s Republic of China. Two formulations of oilseed rape seed containing the endophytic bacterium Bacillus subtilis Tu-100 were evaluated for suppression of this pathogen in field trials conducted at two independent locations....

  10. Radiation and nitrogen use at the leaf and canopy level by wheat and oilseed rape during the critical period for grain number definition

    NARCIS (Netherlands)

    Dreccer, M.F.; Schapendonk, A.H.C.M.; Oijen, van M.; Pot, C.S.; Rabbinge, R.

    2000-01-01

    During the critical period for grain number definition, the amount of biomass produced per unit absorbed radiation is more sensitive to nitrogen (N) supply in oilseed rape than in wheat, and reaches a higher value at high N. This response was investigated by combining experimental and modelling

  11. Ascorbate peroxidase gene from Brassica napus enhances salt and ...

    African Journals Online (AJOL)

    Moreover, under the drought stress, BnAPX transgenic seeds displayed higher germination rate and the seedlings showed reduced wither and apoptosis phenomena. Therefore, our studies revealed that BnAPX was able to enhance the environmental tolerance of Arabidopsis to salt and drought stresses. In addition ...

  12. An oil containing EPA and DHA from transgenic Camelina sativa to replace marine fish oil in feeds for Atlantic salmon (Salmo salar L.: Effects on intestinal transcriptome, histology, tissue fatty acid profiles and plasma biochemistry.

    Directory of Open Access Journals (Sweden)

    Mónica B Betancor

    Full Text Available New de novo sources of omega 3 (n-3 long chain polyunsaturated fatty acids (LC-PUFA are required as alternatives to fish oil in aquafeeds in order to maintain adequate levels of the beneficial fatty acids, eicosapentaenoic and docosahexaenoic (EPA and DHA, respectively. The present study investigated the use of an EPA+DHA oil derived from transgenic Camelina sativa in Atlantic salmon (Salmo salar feeds containing low levels of fishmeal (35% and fish oil (10%, reflecting current commercial formulations, to determine the impacts on tissue fatty acid profile, intestinal transcriptome, and health of farmed salmon. Post-smolt Atlantic salmon were fed for 12-weeks with one of three experimental diets containing either a blend of fish oil/rapeseed oil (FO, wild-type camelina oil (WCO or transgenic camelina oil (DCO as added lipid source. The DCO diet did not affect any of the fish performance or health parameters studied. Analyses of the mid and hindgut transcriptomes showed only mild effects on metabolism. Flesh of fish fed the DCO diet accumulated almost double the amount of n-3 LC-PUFA than fish fed the FO or WCO diets, indicating that these oils from transgenic oilseeds offer the opportunity to increase the n-3 LC-PUFA in farmed fish to levels comparable to those found a decade ago.

  13. Effects of gamma radiation in cauliflower (Brassica spp) minimally processed

    International Nuclear Information System (INIS)

    Nunes, Thaise C.F.; Rogovschi, Vladimir D.; Thomaz, Fernanda S.; Trindade, Reginaldo A.; Villavicencio, Anna L.C.H.; Alencar, Severino M.

    2007-01-01

    Consumers demand for health interests and the latest diet trends. The consumption of vegetables worldwide has increased every year over the past decade, consequently, less extreme treatments or additives are being required. Minimally processed foods have fresh-like characteristics and satisfy the new consumer demand. Food irradiation is an exposure process of the product to controlled sources of gamma radiation with the intention to destroy pathogens and to extend the shelf life. Minimally processed cauliflower (Brassica oleraceae) exposed to low dose of gamma radiation does not show any change in sensory attributes. The aim of this study was to analyze the effects of the low doses of gamma radiation on sensorial aspects like appearance, texture and flavor of minimally processed cauliflower. (author)

  14. Metabolic engineering of the omega-3 long chain polyunsaturated fatty acid biosynthetic pathway into transgenic plants.

    Science.gov (United States)

    Ruiz-López, Noemi; Sayanova, Olga; Napier, Johnathan A; Haslam, Richard P

    2012-04-01

    Omega-3 (ω-3) very long chain polyunsaturated fatty acids (VLC-PUFAs) such as eicosapentaenoic acid (EPA; 20:5 Δ5,8,11,14,17) and docosahexaenoic acid (DHA; 22:6 Δ4,7,10,13,16,19) have been shown to have significant roles in human health. Currently the primary dietary source of these fatty acids are marine fish; however, the increasing demand for fish and fish oil (in particular the expansion of the aquaculture industry) is placing enormous pressure on diminishing marine stocks. Such overfishing and concerns related to pollution in the marine environment have directed research towards the development of a viable alternative sustainable source of VLC-PUFAs. As a result, the last decade has seen many genes encoding the primary VLC-PUFA biosynthetic activities identified and characterized. This has allowed the reconstitution of the VLC-PUFA biosynthetic pathway in oilseed crops, producing transgenic plants engineered to accumulate ω-3 VLC-PUFAs at levels approaching those found in native marine organisms. Moreover, as a result of these engineering activities, knowledge of the fundamental processes surrounding acyl exchange and lipid remodelling has progressed. The application of new technologies, for example lipidomics and next-generation sequencing, is providing a better understanding of seed oil biosynthesis and opportunities for increasing the production of unusual fatty acids. Certainly, it is now possible to modify the composition of plant oils successfully, and, in this review, the most recent developments in this field and the challenges of producing VLC-PUFAs in the seed oil of higher plants will be described.

  15. Efficiency of wheat brassica mixtures with different seed rates in rainfed areas of potohar-pakistan

    International Nuclear Information System (INIS)

    Khan, S.; Khan, M.A.; Akmal, M.; Jabeen, A.

    2014-01-01

    Mixed over sole cropping is advantageous under the rainfed conditions in Pakistan. This avoids risk of complete crop failure and may returns higher income. The study aimed to investigate appropriate seed-rates combination for wheat-Brassica as mixed- or intercropped in rainfed conditions. Experiments were conducted at National Agricultural Research Center (NARC), Islamabad Pakistan during winter 2004-05 and 2005-06 using 10 treatments for wheat and Brassica as sole and mixed- or intercropped with 100 and 5 kg ha/sup -1/ for sole crop and 100 kg ha/sup -1/ for wheat with 40, 50, 60, and 70% lower than the recommended for Brassica. Sowing was done in 3rd week of October each year, in lines spaced 30cm. Fertilizer was applied N 48, P/sub 2/O/sub 5/ 34 and K/sub 2/O 18 (kg ha/sup -1/). Brassica was manually removed for fodder at flowering. Seed rate (SR) significantly (p<0.05) affected wheat grain yield. Cropping system (CS) significantly (p<0.05) affected grain yield of Brassica. Interactions of CS and SR were also significant (p<0.05) for both species. Planned mean comparison for grain yield was found significant (p<0.05) for wheat and brassica. Grain yield for sole wheat was 4.28t ha/sup -1/ but reported higher in mixed than intercropped. Grain yield of wheat decreased with increase in seed rate of Brassica as intercropped. Higher grain yield (4.39 t ha/sup -1/) of wheat was recorded for seed rates combinations 100:50 (%) as wheat: Brassica intercropped. The land equivalent ratio (LER) for mixed or intercropped system was higher than the sole crop and it increased with increase in the seed rate of Brassica as mixed crop but decreased as intercropped. The high LER was associated to treatment 100:50 (%) seed rates combination for wheat:Brassica as intercropped. Intercropped resulted the greater LER (1.78) than the mixed crop (1.66) and was found most effective for sustainable production in the rainfed areas for a higher net return. (author)

  16. Toxins for Transgenic Resistance to Hemipteran Pests

    Science.gov (United States)

    Chougule, Nanasaheb P.; Bonning, Bryony C.

    2012-01-01

    The sap sucking insects (Hemiptera), which include aphids, whiteflies, plant bugs and stink bugs, have emerged as major agricultural pests. The Hemiptera cause direct damage by feeding on crops, and in some cases indirect damage by transmission of plant viruses. Current management relies almost exclusively on application of classical chemical insecticides. While the development of transgenic crops expressing toxins derived from the bacterium Bacillus thuringiensis (Bt) has provided effective plant protection against some insect pests, Bt toxins exhibit little toxicity against sap sucking insects. Indeed, the pest status of some Hemiptera on Bt-transgenic plants has increased in the absence of pesticide application. The increased pest status of numerous hemipteran species, combined with increased prevalence of resistance to chemical insecticides, provides impetus for the development of biologically based, alternative management strategies. Here, we provide an overview of approaches toward transgenic resistance to hemipteran pests. PMID:22822455

  17. Ecological Variation in Response to Mass-Flowering Oilseed Rape and Surrounding Landscape Composition by Members of a Cryptic Bumblebee Complex.

    Directory of Open Access Journals (Sweden)

    Dara A Stanley

    Full Text Available The Bombus sensu stricto species complex is a widespread group of cryptic bumblebee species which are important pollinators of many crops and wild plants. These cryptic species have, until now, largely been grouped together in ecological studies, and so little is known about their individual colony densities, foraging ranges or habitat requirements, which can be influenced by land use at a landscape scale. We used mass-flowering oilseed rape fields as locations to sample bees of this complex, as well as the second most common visitor to oilseed rape B. lapidarius, and molecular RFLP methods to distinguish between the cryptic species. We then used microsatellite genotyping to identify sisters and estimate colony densities, and related both proportions of cryptic species and their colony densities to the composition of the landscape surrounding the fields. We found B. lucorum was the most common member of the complex present in oilseed rape followed by B. terrestris. B. cryptarum was also present in all but one site, with higher proportions found in the east of the study area. High numbers of bumblebee colonies were estimated to be using oilseed rape fields as a forage resource, with B. terrestris colony numbers higher than previous estimates from non-mass-flowering fields. We also found that the cryptic species responded differently to surrounding landscape composition: both relative proportions of B. cryptarum in samples and colony densities of B. lucorum were negatively associated with the amount of arable land in the landscape, while proportions and colony densities of other species did not respond to landscape variables at the scale measured. This suggests that the cryptic species have different ecological requirements (which may be scale-dependent and that oilseed rape can be an important forage resource for many colonies of bumblebees. Given this, we recommend sustainable management of this crop to benefit bumblebees.

  18. Rice Yield and the Fate of Fertilizer Nitrogen as Affected by Addition of Earthworm Casts Collected from Oilseed Rape Fields: A Pot Experiment.

    Science.gov (United States)

    Huang, Min; Zhou, Xuefeng; Xie, Xiaobing; Zhao, Chunrong; Chen, Jiana; Cao, Fangbo; Zou, Yingbin

    2016-01-01

    The mechanism associated with improvement of soil nutritional status by oilseed rape crop, leading to better performance of rice crop, in rice-oilseed rape cropping systems is little known. The present study was aimed to test the hypothesis that earthworm casts produced during oilseed rape-growing season have positive effects on grain yield and fertilizer nitrogen (N) utilization in the subsequent flooded rice crop. A 15N-tracing pot experiment was conducted to determine the effects of earthworm casts collected from oilseed rape fields on yield attributes in rice and the fate of fertilizer N. Soil treated with earthworm casts (soil: earthworm casts = 4: 1, w/w) (EC1) produced 39% higher grain yield than soil only (EC0). EC1 had 18% more panicle number and 10% higher spikelet filling percentage than EC0. Aboveground biomass and harvest index were higher in EC1 than in EC0 by 20% and 15%, respectively. SPAD values in flag leaves were 10% and 22% higher under EC1 than EC0 at 15 and 20 days after heading, respectively. EC1 had 19% higher total N uptake and 18% higher physiological N-use efficiency than EC0. These positive effects of earthworm casts on yield attributes offset negative effects of decreasing N rate from 0.74 g pot-1 (equivalent to the recommended field rate of 150 kg ha-1) to 0.44 g pot-1 (equivalent to 60% of the recommended rate). Fertilizer N retention rate was 7% higher while fertilizer N loss rate was 6% lower in EC1 than in EC0. Our study suggests that earthworm casts produced during oilseed rape-growing season are expected to have the following benefits on the subsequent flooded rice system: (1) improving growth and physiological processes in rice plants and consequently increasing rice grain yield, and (2) increasing fertilizer N retention rate and hence decreasing fertilizer N loss rate and reducing environmental risk.

  19. Large-scale monitoring of effects of clothianidin-dressed oilseed rape seeds on pollinating insects in northern Germany: residues of clothianidin in pollen, nectar and honey.

    Science.gov (United States)

    Rolke, Daniel; Persigehl, Markus; Peters, Britta; Sterk, Guido; Blenau, Wolfgang

    2016-11-01

    This study was part of a large-scale monitoring project to assess the possible effects of Elado ® (10 g clothianidin & 2 g β-cyfluthrin/kg seed)-dressed oilseed rape seeds on different pollinators in Northern Germany. Firstly, residues of clothianidin and its active metabolites thiazolylnitroguanidine and thiazolylmethylurea were measured in nectar and pollen from Elado ® -dressed (test site, T) and undressed (reference site, R) oilseed rape collected by honey bees confined within tunnel tents. Clothianidin and its metabolites could not be detected or quantified in samples from R fields. Clothianidin concentrations in samples from T fields were 1.3 ± 0.9 μg/kg and 1.7 ± 0.9 μg/kg in nectar and pollen, respectively. Secondly, pollen and nectar for residue analyses were sampled from free flying honey bees, bumble bees and mason bees, placed at six study locations each in the R and T sites at the start of oilseed rape flowering. Honey samples were analysed from all honey bee colonies at the end of oilseed rape flowering. Neither clothianidin nor its metabolites were detectable or quantifiable in R site samples. Clothianidin concentrations in samples from the T site were below the limit of quantification (LOQ, 1.0 µg/kg) in most pollen and nectar samples collected by bees and 1.4 ± 0.5 µg/kg in honey taken from honey bee colonies. In summary, the study provides reliable semi-field and field data of clothianidin residues in nectar and pollen collected by different bee species in oilseed rape fields under common agricultural conditions.

  20. Rice Yield and the Fate of Fertilizer Nitrogen as Affected by Addition of Earthworm Casts Collected from Oilseed Rape Fields: A Pot Experiment.

    Directory of Open Access Journals (Sweden)

    Min Huang

    Full Text Available The mechanism associated with improvement of soil nutritional status by oilseed rape crop, leading to better performance of rice crop, in rice-oilseed rape cropping systems is little known. The present study was aimed to test the hypothesis that earthworm casts produced during oilseed rape-growing season have positive effects on grain yield and fertilizer nitrogen (N utilization in the subsequent flooded rice crop. A 15N-tracing pot experiment was conducted to determine the effects of earthworm casts collected from oilseed rape fields on yield attributes in rice and the fate of fertilizer N. Soil treated with earthworm casts (soil: earthworm casts = 4: 1, w/w (EC1 produced 39% higher grain yield than soil only (EC0. EC1 had 18% more panicle number and 10% higher spikelet filling percentage than EC0. Aboveground biomass and harvest index were higher in EC1 than in EC0 by 20% and 15%, respectively. SPAD values in flag leaves were 10% and 22% higher under EC1 than EC0 at 15 and 20 days after heading, respectively. EC1 had 19% higher total N uptake and 18% higher physiological N-use efficiency than EC0. These positive effects of earthworm casts on yield attributes offset negative effects of decreasing N rate from 0.74 g pot-1 (equivalent to the recommended field rate of 150 kg ha-1 to 0.44 g pot-1 (equivalent to 60% of the recommended rate. Fertilizer N retention rate was 7% higher while fertilizer N loss rate was 6% lower in EC1 than in EC0. Our study suggests that earthworm casts produced during oilseed rape-growing season are expected to have the following benefits on the subsequent flooded rice system: (1 improving growth and physiological processes in rice plants and consequently increasing rice grain yield, and (2 increasing fertilizer N retention rate and hence decreasing fertilizer N loss rate and reducing environmental risk.

  1. Growth and "1"3"7Cs uptake and accumulation among 56 Japanese cultivars of Brassica rapa, Brassica juncea and Brassica napus grown in a contaminated field in Fukushima: Effect of inoculation with a Bacillus pumilus strain

    International Nuclear Information System (INIS)

    Djedidi, Salem; Kojima, Katsuhiro; Ohkama-Ohtsu, Naoko; Bellingrath-Kimura, Sonoko Dorothea; Yokoyama, Tadashi

    2016-01-01

    Fifty six local Japanese cultivars of Brassica rapa (40 cultivars), Brassica juncea (10 cultivars) and Brassica napus (6 cultivars) were assessed for variability in growth and "1"3"7Cs uptake and accumulation in association with a Bacillus pumilus strain. Field trial was conducted at a contaminated farmland in Nihonmatsu city, in Fukushima prefecture. Inoculation resulted in different responses of the cultivars in terms of growth and radiocesium uptake and accumulation. B. pumilus induced a significant increase in shoot dry weight in 12 cultivars that reached up to 40% in one B. rapa and three B. juncea cultivars. Differences in radiocesium uptake were observed between the cultivars of each Brassica species. Generally, inoculation resulted in a significant increase in "1"3"7Cs uptake in 22 cultivars, while in seven cultivars it was significantly decreased. Regardless of plant cultivar and bacterial inoculation, the transfer of "1"3"7Cs to the plant shoots (TF) varied by a factor of up to 5 and it ranged from to 0.011 to 0.054. Five inoculated cultivars, showed enhanced shoot dry weights and decreased "1"3"7Cs accumulations, among which two B. rapa cultivars named Bitamina and Nozawana had a significantly decreased "1"3"7Cs accumulation in their shoots. Such cultivars could be utilized to minimize the entry of radiocesium into the food chain; however, verifying the consistency of their radiocesium accumulation in other soils is strongly required. Moreover, the variations in growth and radiocesium accumulation, as influenced by Bacillus inoculation, could help selecting well grown inoculated Brassica cultivars with low radiocesium accumulation in their shoots. - Highlights: • Out of 56 Brassica cultivars, inoculation significantly increased shoot dry weight in 12 cultivars. • Inoculation triggered a significant increase and decrease in "1"3"7Cs uptake, respectively in 22 and 7 cultivars. • Five cultivars had an enhanced shoot dry weight and decreased "1"3"7Cs

  2. Transgenic cultures: from the economic viewpoint

    Directory of Open Access Journals (Sweden)

    Mauricio Mosquera

    2001-01-01

    Full Text Available The introduction of transgenic seeds for agricultural purposes poses modification to their production, due to the potential for reaching desired characteristics such as greater yield, this being fundamental in an economic environment characterised by open market conditions. However, acceptance of products resulting from genetic engineering is far from becoming a simple process; discussion relating to the predominance of private sector interests, the monopoly of knowledge and the safety of such seeds/food is currently in the spotlight. This article presents the main points of debate regarding adoption of transgenic cultures, contributing to discussion about this topic for Colombia.

  3. Generation of BAC transgenic epithelial organoids.

    Directory of Open Access Journals (Sweden)

    Gerald Schwank

    Full Text Available Under previously developed culture conditions, mouse and human intestinal epithelia can be cultured and expanded over long periods. These so-called organoids recapitulate the three-dimensional architecture of the gut epithelium, and consist of all major intestinal cell types. One key advantage of these ex vivo cultures is their accessibility to live imaging. So far the establishment of transgenic fluorescent reporter organoids has required the generation of transgenic mice, a laborious and time-consuming process, which cannot be extended to human cultures. Here we present a transfection protocol that enables the generation of recombinant mouse and human reporter organoids using BAC (bacterial artificial chromosome technology.

  4. Breeding strategy for the improvement of mustard (Brassica Juncea Coss.)

    International Nuclear Information System (INIS)

    Nayar, G.G.

    1980-01-01

    Mutants having desirable agronomic characters were obtained in the high yielding, recommended mustard (B. juncea) varieties Rai 5, RL 9 and Varuna (T 59). Following hybridizations between induced mutants or mutants with other promising varieties, recombinants having superior agronomic traits have been developed. The parent varieties are characterised by open pod arrangement and blackish brown seeds. The mutants and the recombinants have desirable agronomic characters like compact plant type, appressed pods with less shattering nature, yellow seeds, higher oil content and lighter coloured oil. Among the 12 new strains developed at this centre, five have been tested at various locations in the country. At many places, TM-(Trombay Mustard-) cultures outyielded or were at par with the local check varieties. TM-2-11 (Appressed pod mutant) and TM-4 (Yellow bold seeded Mutant) have also been included in the Initial Evaluation Trial of the All India Co-ordinated Research Project in Oilseeds (AICORPO) improvement. Reports so far received from various locations in the country indicate that TM-strains, being relatively early cultures, are suited more for states of Rajasthan, Gujarat, U.P. and Bihar. (author)

  5. Lectin cDNA and transgenic plants derived therefrom

    Science.gov (United States)

    Raikhel, Natasha V.

    2000-10-03

    Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

  6. Wybrane zagadnienia z biologii grzyba Plasmodiophora brassicae Wor. [Some problems in the life-cycle of fungus Plasmodiophora brassicae, Wor.

    Directory of Open Access Journals (Sweden)

    B. Nowicki

    2015-06-01

    Full Text Available The quickest loss of infectivity of Plasmodiophora brassicae Wor. resting spores was observed in acid soil. Jnlectivity was ratained longer in neutral and alkaline soils. The infection of cabbage seedlings took place in a broad pH range from 3.3 to 8.1, the optimum soil pH for infection being at 5.3 - 5.7. When the number of spores in the soil increased the infection took place in the infection took place in the broader pH range. The plants which were planted as seedlings in infested soil were infected in a broader pH range than plants which were grown from seeds in infested soil.

  7. Contribution of Ruminal Fungi, Archaea, Protozoa, and Bacteria to the Methane Suppression Caused by Oilseed Supplemented Diets

    Directory of Open Access Journals (Sweden)

    Shaopu Wang

    2017-09-01

    Full Text Available Dietary lipids can suppress methane emission from ruminants, but effects are variable. Especially the role of bacteria, archaea, fungi and protozoa in mediating the lipid effects is unclear. In the present in vitro study, archaea, fungi and protozoa were selectively inhibited by specific agents. This was fully or almost fully successful for fungi and protozoa as well as archaeal activity as determined by the methyl-coenzyme M reductase alpha subunit gene. Five different microbial treatments were generated: rumen fluid being intact (I, without archaea (–A, without fungi (–F, without protozoa (–P and with bacteria only (–AFP. A forage-concentrate diet given alone or supplemented with crushed full-fat oilseeds of either safflower (Carthamus tinctorius or poppy (Papaver somniferum or camelina (Camelina sativa at 70 g oil kg−1 diet dry matter was incubated. This added up to 20 treatments with six incubation runs per treatment. All oilseeds suppressed methane emission compared to the non-supplemented control. Compared to the non-supplemented control, –F decreased organic matter (OM degradation, and short-chain fatty acid concentration was greater with camelina and safflower seeds. Methane suppression per OM digested in –F was greater with camelina seeds (−12 vs.−7% with I, P = 0.06, but smaller with poppy seeds (−4 vs. −8% with I, P = 0.03, and not affected with safflower seeds. With –P, camelina seeds decreased the acetate-to-propionate ratio and enhanced the methane suppression per gram dry matter (18 vs. 10% with I, P = 0.08. Hydrogen recovery was improved with –P in any oilseeds compared to non-supplemented control. No methane emission was detected with the –A and –AFP treatments. In conclusion, concerning methanogenesis, camelina seeds seem to exert effects only on archaea and bacteria. By contrast, with safflower and poppy seeds methane was obviously reduced mainly through the interaction with protozoa or archaea

  8. Contribution of Ruminal Fungi, Archaea, Protozoa, and Bacteria to the Methane Suppression Caused by Oilseed Supplemented Diets.

    Science.gov (United States)

    Wang, Shaopu; Giller, Katrin; Kreuzer, Michael; Ulbrich, Susanne E; Braun, Ueli; Schwarm, Angela

    2017-01-01

    Dietary lipids can suppress methane emission from ruminants, but effects are variable. Especially the role of bacteria, archaea, fungi and protozoa in mediating the lipid effects is unclear. In the present in vitro study, archaea, fungi and protozoa were selectively inhibited by specific agents. This was fully or almost fully successful for fungi and protozoa as well as archaeal activity as determined by the methyl-coenzyme M reductase alpha subunit gene. Five different microbial treatments were generated: rumen fluid being intact (I), without archaea (-A), without fungi (-F), without protozoa (-P) and with bacteria only (-AFP). A forage-concentrate diet given alone or supplemented with crushed full-fat oilseeds of either safflower ( Carthamus tinctorius ) or poppy ( Papaver somniferum ) or camelina ( Camelina sativa ) at 70 g oil kg -1 diet dry matter was incubated. This added up to 20 treatments with six incubation runs per treatment. All oilseeds suppressed methane emission compared to the non-supplemented control. Compared to the non-supplemented control, -F decreased organic matter (OM) degradation, and short-chain fatty acid concentration was greater with camelina and safflower seeds. Methane suppression per OM digested in -F was greater with camelina seeds (-12 vs.-7% with I, P = 0.06), but smaller with poppy seeds (-4 vs. -8% with I, P = 0.03), and not affected with safflower seeds. With -P, camelina seeds decreased the acetate-to-propionate ratio and enhanced the methane suppression per gram dry matter (18 vs. 10% with I, P = 0.08). Hydrogen recovery was improved with -P in any oilseeds compared to non-supplemented control. No methane emission was detected with the -A and -AFP treatments. In conclusion, concerning methanogenesis, camelina seeds seem to exert effects only on archaea and bacteria. By contrast, with safflower and poppy seeds methane was obviously reduced mainly through the interaction with protozoa or archaea associated with protozoa. This

  9. Insect resistance to Nilaparvata lugens and Cnaphalocrocis medinalis in transgenic indica rice and the inheritance of gna+sbti transgenes.

    Science.gov (United States)

    Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin

    2005-04-01

    Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants. Copyright 2005 Society of Chemical Industry.

  10. Molecular mapping of QTL alleles of Brassica oleracea affecting days to flowering and photosensitivity in spring Brassica napus.

    Science.gov (United States)

    Rahman, Habibur; Bennett, Rick A; Kebede, Berisso

    2018-01-01

    Earliness of flowering and maturity are important traits in spring Brassica napus canola-whether grown under long- or short-day condition. By use of a spring B. napus mapping population carrying the genome content of B. oleracea and testing this population under 10 to 18 h photoperiod and 18 to 20 0C (day) temperature conditions, we identified a major QTL on the chromosome C1 affecting flowering time without being influenced by photoperiod and temperature, and a major QTL on C9 affecting flowering time under a short photoperiod (10 h); in both cases, the QTL alleles reducing the number of days to flowering in B. napus were introgressed from the late flowering species B. oleracea. Additive effect of the C1 QTL allele at 14 to18 h photoperiod was 1.1 to 2.9 days; however, the same QTL allele exerted an additive effect of 6.2 days at 10 h photoperiod. Additive effect of the C9 QTL at 10 h photoperiod was 2.8 days. These two QTL also showed significant interaction in the control of flowering only under a short-day (10 h photoperiod) condition with an effect of 2.3 days. A few additional QTL were also detected on the chromosomes C2 and C8; however, none of these QTL could be detected under all photoperiod and temperature conditions. BLASTn search identified several putative flowering time genes on the chromosomes C1 and C9 and located the physical position of the QTL markers in the Brassica genome; however, only a few of these genes were found within the QTL region. Thus, the molecular markers and the genomic regions identified in this research could potentially be used in breeding for the development of early flowering photoinsensitive B. napus canola cultivars, as well as for identification of candidate genes involved in flowering time variation and photosensitivity.

  11. Comparative Analysis of Disease-Linked Single Nucleotide Polymorphic Markers from Brassica rapa for Their Applicability to Brassica oleracea

    Science.gov (United States)

    Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun

    2015-01-01

    Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH—developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP—based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS—derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species. PMID:25790283

  12. Introgression of Black Rot Resistance from Brassica carinata to Cauliflower (Brassica oleracea botrytis Group) through Embryo Rescue

    Science.gov (United States)

    Sharma, Brij B.; Kalia, Pritam; Singh, Dinesh; Sharma, Tilak R.

    2017-01-01

    Black rot caused by Xanthomonas campestris pv. campestris (Xcc) is a very important disease of cauliflower (Brassica oleracea botrytis group) resulting into 10–50% yield losses every year. Since there is a dearth of availability of resistance to black rot disease in B. oleracea (C genome), therefore exploration of A and B genomes was inevitable as they have been reported to be potential reservoirs of gene(s) for resistance to black rot. To utilize these sources, interspecific hybrid and backcross progeny (B1) were generated between cauliflower “Pusa Sharad” and Ethiopian mustard “NPC-9” employing in vitro embryo rescue technique. Direct ovule culture method was better than siliqua culture under different temperature regime periods. Hybridity testing of F1 inter-specific plants was carried out using co-dominant SSR marker and Brassica B and C genome-specific (DB and DC) primers. Meiosis in the di-genomic (BCC) interspecific hybrid of B. oleracea botrytis group (2n = 18, CC) × B. carinata (2n = 4x = 34, BBCC) was higly disorganized and cytological analysis of pollen mother cells revealed chromosomes 2n = 26 at metaphase-I. Fertile giant pollen grain formation was observed frequently in interspecific F1 hybrid and BC1 plants. The F1 inter-specific plants were found to be resistant to Xcc race 1. Segregation distortion was observed in BC1 generation for black rot resistance and different morphological traits. The At1g70610 marker analysis confirmed successful introgression of black rot resistance in interspecific BC1 population. This effort will go a long way in pyramiding gene(s) for resistance against black rot in Cole crops, especially cauliflower and cabbage for developing durable resistance, thus minimize dependency on bactericides. PMID:28769959

  13. Introgression of Black Rot Resistance from Brassica carinata to Cauliflower (Brassica oleracea botrytis Group through Embryo Rescue

    Directory of Open Access Journals (Sweden)

    Brij B. Sharma

    2017-07-01

    Full Text Available Black rot caused by Xanthomonas campestris pv. campestris (Xcc is a very important disease of cauliflower (Brassica oleracea botrytis group resulting into 10–50% yield losses every year. Since there is a dearth of availability of resistance to black rot disease in B. oleracea (C genome, therefore exploration of A and B genomes was inevitable as they have been reported to be potential reservoirs of gene(s for resistance to black rot. To utilize these sources, interspecific hybrid and backcross progeny (B1 were generated between cauliflower “Pusa Sharad” and Ethiopian mustard “NPC-9” employing in vitro embryo rescue technique. Direct ovule culture method was better than siliqua culture under different temperature regime periods. Hybridity testing of F1 inter-specific plants was carried out using co-dominant SSR marker and Brassica B and C genome-specific (DB and DC primers. Meiosis in the di-genomic (BCC interspecific hybrid of B. oleracea botrytis group (2n = 18, CC × B. carinata (2n = 4x = 34, BBCC was higly disorganized and cytological analysis of pollen mother cells revealed chromosomes 2n = 26 at metaphase-I. Fertile giant pollen grain formation was observed frequently in interspecific F1 hybrid and BC1 plants. The F1 inter-specific plants were found to be resistant to Xcc race 1. Segregation distortion was observed in BC1 generation for black rot resistance and different morphological traits. The At1g70610 marker analysis confirmed successful introgression of black rot resistance in interspecific BC1 population. This effort will go a long way in pyramiding gene(s for resistance against black rot in Cole crops, especially cauliflower and cabbage for developing durable resistance, thus minimize dependency on bactericides.

  14. Introgression of Black Rot Resistance from Brassica carinata to Cauliflower (Brassica oleracea botrytis Group) through Embryo Rescue.

    Science.gov (United States)

    Sharma, Brij B; Kalia, Pritam; Singh, Dinesh; Sharma, Tilak R

    2017-01-01

    Black rot caused by Xanthomonas campestris pv. campestris ( Xcc ) is a very important disease of cauliflower ( Brassica oleracea botrytis group) resulting into 10-50% yield losses every year. Since there is a dearth of availability of resistance to black rot disease in B. oleracea (C genome), therefore exploration of A and B genomes was inevitable as they have been reported to be potential reservoirs of gene(s) for resistance to black rot. To utilize these sources, interspecific hybrid and backcross progeny (B 1 ) were generated between cauliflower "Pusa Sharad" and Ethiopian mustard "NPC-9" employing in vitro embryo rescue technique. Direct ovule culture method was better than siliqua culture under different temperature regime periods. Hybridity testing of F 1 inter-specific plants was carried out using co-dominant SSR marker and Brassica B and C genome-specific (DB and DC) primers. Meiosis in the di-genomic (BCC) interspecific hybrid of B. oleracea botrytis group (2 n = 18, CC) × B. carinata (2 n = 4x = 34, BBCC) was higly disorganized and cytological analysis of pollen mother cells revealed chromosomes 2 n = 26 at metaphase-I. Fertile giant pollen grain formation was observed frequently in interspecific F 1 hybrid and BC 1 plants. The F 1 inter-specific plants were found to be resistant to Xcc race 1. Segregation distortion was observed in BC 1 generation for black rot resistance and different morphological traits. The At1g70610 marker analysis confirmed successful introgression of black rot resistance in interspecific BC 1 population. This effort will go a long way in pyramiding gene(s) for resistance against black rot in Cole crops, especially cauliflower and cabbage for developing durable resistance, thus minimize dependency on bactericides.

  15. IDENTIFICATION OF ESCAPED TRANSGENIC CREEPING BENTGRASS IN OREGON

    Science.gov (United States)

    When transgenic plants are cultivated near wild species that are sexually compatible with the crop, gene flow between the crop and wild plants is possible. A resultant concern is that transgene flow and transgene introgression within wild populations could have unintended ecologi...

  16. Atmospheric H2S and SO2 as sulfur source for Brassica juncea and Brassica rapa: Impact on the glucosinolate composition

    NARCIS (Netherlands)

    Aghajanzadeh, T.; Kopriva, S; Hawkesford, M.J.; Koprivova, A.; De Kok, L.J.

    2015-01-01

    The impact of sulfate deprivation and atmospheric H2S and SO2 nutrition on the content and composition of glucosinolates was studied in Brassica juncea and Brasscia rapa. Both species contained a number of aliphatic and indolic glucosinolates. The total glucosinolate content was more than 5.5-fold

  17. Filmcoating the seed of cabbage (Brassica oleracea L. convar. Capitata L.) and cauliflower (Brassica oleracea L. var. Botrytis L.) with imidacloprid and spinosad to control insect pests

    NARCIS (Netherlands)

    Ester, A.; Putter, de H.; Bilsen, van J.G.P.M.

    2003-01-01

    Four field experiments were carried out between 1999 and 2001, to assess the protection against cabbage root fly larvae (Delia radicum), flea beetle (Phyllotreta nemorum and P. undulata), cabbage aphid (Brevicoryne brassicae) and caterpillars achieved in white cabbage and cauliflower crops by

  18. Epidemiology of dark leaf spot caused by Alternaria brassicicola and Alternaria brassicae in organic seed production of cauliflower

    NARCIS (Netherlands)

    Köhl, J.; Tongeren, van C.A.M.; Groenenboom-de Haas, B.H.; Hoof, van R.A.; Driessen, R.; Heijden, van der L.

    2010-01-01

    In organic seed production of Brassica vegetables, infections by Alternaria brassicicola and A. brassicae can cause severe losses of yield and seed quality. Four field experiments with or without artificial inoculation with A. brassicicola were conducted in organically managed seed-production crops

  19. Impact of selenium supply on Se-methylselenocysteine and glucosinolate accumulation in selenium-biofortified Brassica sprouts.

    Science.gov (United States)

    Avila, Fabricio William; Yang, Yong; Faquin, Valdemar; Ramos, Silvio Junio; Guilherme, Luiz Roberto G; Thannhauser, Theodore W; Li, Li

    2014-12-15

    Brassica sprouts are widely marketed as functional foods. Here we examined the effects of Se treatment on the accumulation of anticancer compound Se-methylselenocysteine (SeMSCys) and glucosinolates in Brassica sprouts. Cultivars from the six most extensively consumed Brassica vegetables (broccoli, cauliflower, green cabbage, Chinese cabbage, kale, and Brussels sprouts) were used. We found that Se-biofortified Brassica sprouts all were able to synthesize significant amounts of SeMSCys. Analysis of glucosinolate profiles revealed that each Brassica crop accumulated different types and amounts of glucosinolates. Cauliflower sprouts had high total glucosinolate content. Broccoli sprouts contained high levels of glucoraphanin, a precursor for potent anticancer compound. Although studies have reported an inverse relationship between accumulation of Se and glucosinolates in mature Brassica plants, Se supply generally did not affect glucosinolate accumulation in Brassica sprouts. Thus, Brassica vegetable sprouts can be biofortified with Se for the accumulation of SeMSCys without negative effects on chemopreventive glucosinolate contents. Published by Elsevier Ltd.

  20. JST Thesaurus Headwords and Synonyms: Brassica rapa var. peruviridis [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Brassica rapa var. peruviridis 名詞... 一般 * * * * コマツナ コマツナ コマツナ Thesaurus2015 200906099324987960 C LS06/LS72 UNKNOWN_2 Brassica rapa var . peruviridis