WorldWideScience

Sample records for transgenic lines representing

  1. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... production of flowers, apomixis (Nassar et al., 2000; ... In order to increase the stress tolerance capacity of ... stress-related procedure due to the activities of auxin ... the evaluation of the transgenic lines for rate of OES .... Some transgenic lines carrying the 35S-AOX fragment amplified using 35S303F1 and.

  2. A comparative study on pathological features of transgenic rat lines expressing either three or four repeat misfolded tau.

    Science.gov (United States)

    Valachova, Bernadeta; Brezovakova, Veronika; Bugos, Ondrej; Jadhav, Santosh; Smolek, Tomas; Novak, Petr; Zilka, Norbert

    2018-08-01

    Human tauopathies represent a heterogeneous group of neurodegenerative disorders characterized by distinct clinical features, typical histopathological structures, and defined ratio(s) of three-repeat and four-repeat tau isoforms within pathological aggregates. How the optional microtubule-binding repeat of tau influences this differentiation of pathologies is understudied. We have previously generated and characterized transgenic rodent models expressing human truncated tau aa151-391 with either three (SHR24) or four microtubule-binding repeats (SHR72). Here, we compare the behavioral and neuropathological hallmarks of these two transgenic lines using a battery of tests for sensorimotor, cognitive, and neurological functions over the age range of 3.5-15 months. Progression of sensorimotor and neurological deficits was similar in both transgenic lines; however, the lifespan of transgenic line SHR72 expressing truncated four-repeat tau was markedly shorter than SHR24. Moreover, the expression of three or four-repeat tau induced distinct neurofibrillary pathology in these lines. Transgenic lines displayed different distribution of tau pathology and different type of neurofibrillary tangles. Our results suggest that three- and four-repeat isoforms of tau may display different modes of action in the diseased brain. © 2018 Wiley Periodicals, Inc.

  3. Establishment and characterization of CAG/EGFP transgenic rabbit line.

    Science.gov (United States)

    Takahashi, Ri-ichi; Kuramochi, Takashi; Aoyagi, Kazuki; Hashimoto, Shu; Miyoshi, Ichiro; Kasai, Noriyuki; Hakamata, Yoji; Kobayashi, Eiji; Ueda, Masatsugu

    2007-02-01

    Cell marking is a very important procedure for identifying donor cells after cell and/or organ transplantation in vivo. Transgenic animals expressing marker proteins such as enhanced green fluorescent protein (EGFP) in their tissues are a powerful tool for research in fields of tissue engineering and regenerative medicine. The purpose of this study was to establish transgenic rabbit lines that ubiquitously express EGFP under the control of the cytomegalovirus immediate early enhancer/beta-actin promoter (CAG) to provide a fluorescent transgenic animal as a bioresource. We microinjected the EGFP expression vector into 945 rabbit eggs and 4 independent transgenic candidate pups were obtained. Two of them died before sexual maturation and one was infertile. One transgenic male candidate founder rabbit was obtained and could be bred by artificial insemination. The rabbit transmitted the transgene in a Mendelian manner. Using fluorescence in situ hybridization analysis, we detected the transgene at 7q11 on chromosome 7 as a large centromeric region in two F1 offspring (one female and one male). Eventually, one transgenic line was established. Ubiquitous EGFP fluorescence was confirmed in all examined organs. There were no gender-related differences in fluorescence. The established CAG/EGFP transgenic rabbit will be an important bioresource and a useful tool for various studies in tissue engineering and regenerative medicine.

  4. Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specific recognition of foreign DNA in transgenic plants.

    Science.gov (United States)

    Meyer, P; Heidmann, I

    1994-05-25

    We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.

  5. Stability of transgene expression, field performance and recombination breeding of transformed barley lines

    DEFF Research Database (Denmark)

    Horvath, H.; Jensen, L.G.; Wong, O.T.

    2001-01-01

    in homozygous transgenic T-3 plants, and these remained constant over a 3-year period. In micro-malting experiments, the heat-stable enzyme reached levels of up to 1.4 mug.mg(-1) protein and survived kiln drying at levels of 70-100%. In the field trials of 1997 and 1998 the transgenic lines had a reduced 1000...... lines yielded approximately 6 t.ha(-1) and Golden Promise 7.7 t.ha(-1). Cross-breeding was carried out to transfer the transgene into a more suitable genetic background. Crosses of the semi-dwarf ari-e mutant Golden Promise gave rise to the four morphological phenotypes nutans, high erect, erect...... transformants were observed in some F-4 lines homozygous for the morphological phenotypes and for the transgene. In the case of a homozygous nutans line, the transgenic plants had a higher 1000-grain weight than those lacking the transgene. Like mutants providing useful output traits, transgenic plants...

  6. A human beta cell line with drug inducible excision of immortalizing transgenes

    Science.gov (United States)

    Benazra, Marion; Lecomte, Marie-José; Colace, Claire; Müller, Andreas; Machado, Cécile; Pechberty, Severine; Bricout-Neveu, Emilie; Grenier-Godard, Maud; Solimena, Michele; Scharfmann, Raphaël; Czernichow, Paul; Ravassard, Philippe

    2015-01-01

    Objectives Access to immortalized human pancreatic beta cell lines that are phenotypically close to genuine adult beta cells, represent a major tool to better understand human beta cell physiology and develop new therapeutics for Diabetes. Here we derived a new conditionally immortalized human beta cell line, EndoC-βH3 in which immortalizing transgene can be efficiently removed by simple addition of tamoxifen. Methods We used lentiviral mediated gene transfer to stably integrate a tamoxifen inducible form of CRE (CRE-ERT2) into the recently developed conditionally immortalized EndoC βH2 line. The resulting EndoC-βH3 line was characterized before and after tamoxifen treatment for cell proliferation, insulin content and insulin secretion. Results We showed that EndoC-βH3 expressing CRE-ERT2 can be massively amplified in culture. We established an optimized tamoxifen treatment to efficiently excise the immortalizing transgenes resulting in proliferation arrest. In addition, insulin expression raised by 12 fold and insulin content increased by 23 fold reaching 2 μg of insulin per million cells. Such massive increase was accompanied by enhanced insulin secretion upon glucose stimulation. We further observed that tamoxifen treated cells maintained a stable function for 5 weeks in culture. Conclusions EndoC βH3 cell line represents a powerful tool that allows, using a simple and efficient procedure, the massive production of functional non-proliferative human beta cells. Such cells are close to genuine human beta cells and maintain a stable phenotype for 5 weeks in culture. PMID:26909308

  7. Line 63-1: A New Virus-resistant Transgenic Papaya

    NARCIS (Netherlands)

    Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.

    2005-01-01

    The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment

  8. Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

    Science.gov (United States)

    Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2013-01-01

    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

  9. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... Organized embryogenic callus development: In our experiment, somatic embryos were developed from leaf lobes collected from transgenic cassava lines carrying the AtAOX1a gene. Immature leaf lobes measuring about 1 to 6 mm obtained from about six weeks old in vitro derived plants were used.

  10. N. plumbaginifolia zeaxanthin epoxidase transgenic lines have unaltered baseline ABA accumulations in roots and xylem sap, but contrasting sensitivities of ABA accumulation to water deficit.

    Science.gov (United States)

    Borel, C; Audran, C; Frey, A; Marion-Poll, A; Tardieu, F; Simonneau, T

    2001-03-01

    A series of transgenic lines of Nicotiana plumbaginifolia with modified expression of zeaxanthin epoxidase gene (ZEP) provided contrasting ABA accumulation in roots and xylem sap. For mild water stress, concentration of ABA in the xylem sap ([ABA](xylem)) was clearly lower in plants underexpressing ZEP mRNA (complemented mutants and antisense transgenic lines) than in wild-type. In well-watered conditions, all lines presented similar [ABA](xylem) and similar ABA accumulation rates in detached roots. Plants could, therefore, be grown under normal light intensities and evaporative demand. Both ZEP mRNA abundance and ABA accumulation rate in roots increased with water deficit in all transgenic lines, except in complemented aba2-s1 mutants in which the ZEP gene was controlled by a constitutive promoter which does not respond to water deficit. These lines presented no change in root ABA content either with time or dehydration. The increase in ZEP mRNA abundance in roots with decreasing RWC was more pronounced in detached roots than in whole plants, suggesting a difference in mechanism. In all transgenic lines, a linear relationship was observed between predawn leaf water potential and [ABA](xylem), which could be reproduced in several experiments in the greenhouse and in the growth chamber. It is therefore possible to represent the effect of the transformation by a single parameter, thereby allowing the use of a quantitative approach to assist understanding of the behaviour of transgenic lines.

  11. Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines

    Directory of Open Access Journals (Sweden)

    Allah BAKHSH

    2012-11-01

    Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.

  12. Characterization of gastric adenocarcinoma cell lines established from CEA424/SV40 T antigen-transgenic mice with or without a human CEA transgene

    International Nuclear Information System (INIS)

    Nöckel, Jessica; Engel, Natasja K van den; Winter, Hauke; Hatz, Rudolf A; Zimmermann, Wolfgang; Kammerer, Robert

    2006-01-01

    Gastric carcinoma is one of the most frequent cancers worldwide. Patients with gastric cancer at an advanced disease stage have a poor prognosis, due to the limited efficacy of available therapies. Therefore, the development of new therapies, like immunotherapy for the treatment of gastric cancer is of utmost importance. Since the usability of existing preclinical models for the evaluation of immunotherapies for gastric adenocarcinomas is limited, the goal of the present study was to establish murine in vivo models which allow the stepwise improvement of immunotherapies for gastric cancer. Since no murine gastric adenocarcinoma cell lines are available we established four cell lines (424GC, mGC3, mGC5, mGC8) from spontaneously developing tumors of CEA424/SV40 T antigen (CEA424/Tag) mice and three cell lines derived from double-transgenic offsprings of CEA424/Tag mice mated with human carcinoembryonic antigen (CEA)-transgenic (CEA424/Tag-CEA) mice (mGC2 CEA , mGC4 CEA , mGC11 CEA ). CEA424/Tag is a transgenic C57BL/6 mouse strain harboring the Tag under the control of a -424/-8 bp CEA gene promoter which leads to the development of invasive adenocarcinoma in the glandular stomach. Tumor cell lines established from CEA424/Tag-CEA mice express the well defined tumor antigen CEA under the control of its natural regulatory elements. The epithelial origin of the tumor cells was proven by morphological criteria including the presence of mucin within the cells and the expression of the cell adhesion molecules EpCAM and CEACAM1. All cell lines consistently express the transgenes CEA and/or Tag and MHC class I molecules leading to their susceptibility to lysis by Tag-specific CTL in vitro. Despite the presentation of CTL-epitopes derived from the transgene products the tumor cell lines were tumorigenic when grafted into C57BL/6, CEA424/Tag or CEA424/Tag-CEA-transgenic hosts and no significant differences in tumor take and tumor growth were observed in the different hosts

  13. Case Study: Polycystic Livers in a Transgenic Mouse Line

    Energy Technology Data Exchange (ETDEWEB)

    Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.; Diekwisch, Thomas G. H.; Ito, Yoshihiro; Fortman, Jeffrey D.

    2014-04-01

    Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycystic livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.

  14. Evaluation of the agronomic performance of atrazine-tolerant transgenic japonica rice parental lines for utilization in hybrid seed production.

    Directory of Open Access Journals (Sweden)

    Luhua Zhang

    Full Text Available Currently, the purity of hybrid seed is a crucial limiting factor when developing hybrid japonica rice (Oryza sativa L.. To chemically control hybrid seed purity, we transferred an improved atrazine chlorohydrolase gene (atzA from Pseudomonas ADP into hybrid japonica parental lines (two maintainers, one restorer, and Nipponbare, by using Agrobacterium-mediated transformation. We subsequently selected several transgenic lines from each genotype by using PCR, RT-PCR, and germination analysis. In the presence of the investigated atrazine concentrations, particularly 150 µM atrazine, almost all of the transgenic lines produced significantly larger seedlings, with similar or higher germination percentages, than did the respective controls. Although the seedlings of transgenic lines were taller and gained more root biomass compared to the respective control plants, their growth was nevertheless inhibited by atrazine treatment compared to that without treatment. When grown in soil containing 2 mg/kg or 5 mg/kg atrazine, the transgenic lines were taller, and had higher total chlorophyll contents than did the respective controls; moreover, three of the strongest transgenic lines completely recovered after 45 days of growth. After treatment with 2 mg/kg or 5 mg/kg of atrazine, the atrazine residue remaining in the soil was 2.9-7.0% or 0.8-8.7% respectively, for transgenic lines, and 44.0-59.2% or 28.1-30.8%, respectively, for control plants. Spraying plants at the vegetative growth stage with 0.15% atrazine effectively killed control plants, but not transgenic lines. Our results indicate that transgenic atzA rice plants show tolerance to atrazine, and may be used as parental lines in future hybrid seed production.

  15. Development of putative transgenic lines of cassava variety H-226 ...

    African Journals Online (AJOL)

    CMD) caused by the Indian cassava mosaic virus (ICMV) and Sri Lankan cassava mosaic virus (SLCMV). An attempt was done to develop transgenic cassava lines resistant to SLCMV through RNAi vector targeting a conserved 440 bp of 5' end ...

  16. Inheritance and effectiveness of two transgenes determining PVY resistance in progeny from crossing independently transformed tobacco lines.

    Science.gov (United States)

    Czubacka, Anna; Sacco, Ermanno; Olszak-Przybyś, Hanna; Doroszewska, Teresa

    2017-05-01

    Genetic transformation of plants allows us to obtain improved genotypes enriched with the desired traits. However, if transgenic lines were to be used in breeding programs the stability of inserted transgenes is essential. In the present study, we followed the inheritance of transgenes in hybrids originated from crossing two transgenic tobacco lines resistant to Potato virus Y (PVY): MN 944 LMV with the transgene containing Lettuce mosaic virus coat protein gene (LMV CP) and AC Gayed ROKY2 with PVY replicase gene (ROKY2). Progeny populations generated by successive self-pollination were analyzed with respect to the transgene segregation ratio and resistance to Potato virus Y in tests carried out under greenhouse conditions. The presence of the virus in inoculated plants was detected by DAS-ELISA method. The results demonstrated the Mendelian fashion of inheritance of transgenes which were segregated independently and stably. As a result, we obtained T 4 generation of hybrid with both transgenes stacked and which was highly resistant to PVY.

  17. Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines

    Directory of Open Access Journals (Sweden)

    Joanne G. Bartlett

    2014-01-01

    Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.

  18. Simplified methodology for large scale isolation of homozygous transgenic lines of lettuce

    Directory of Open Access Journals (Sweden)

    Flavia S. Darqui

    2018-01-01

    Conclusions: This protocol allows a simplified scaling-up of the production of multiple homozygous transgenic progeny lines in the early generations avoiding expensive and time-consuming molecular assays.

  19. Adaptability and stability of transgenic soybean lines and cultivars in ...

    African Journals Online (AJOL)

    Subsequently, genotypic adaptability and stability were evaluated by the methods of Eberhart and Russel (1966), Lin and Binns modified by Carneiro, Annicchiarico and Centroid. All methods presented partial coherence on classifying the best genotypes and allowed the identification of the transgenic lines L1 and L4, and ...

  20. Hybridization of downregulated-COMT transgenic switchgrass lines with field selected switchgrass for improved biomass traits

    Science.gov (United States)

    Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. Downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In the present study we sought to further...

  1. [Obtaining the transgenic lines of finger millet Eleusine coracana (L.) Gaertn. With dinitroaniline resistance].

    Science.gov (United States)

    Baer, G Ia; Emets, A I; Blium, Ia B

    2014-01-01

    The current data is dedicated to the study of bioballistic and Agrobacterium-mediated transformation of finger millet with the constructs carrying the mutant alpha-tubulin gene (TUAm 1), isolated from R-biotype goosegrass (Eleusine indica L.), for the decision of problem of dinitroaniline-resistance. It was found that 10 microM of trifluralin is optimal for the selection of transgene plants of finger millet. PCR analysis of transformed lines confirmed the transgene nature of plants. The analysis of seed of T1 oftransgene lines confirmed heterozygous character of inheritance of the resistance.

  2. GENETIC TRANSFORMATION AND ANALYSIS OF WHEAT TRANSGENIC CELL LINES BY IRAP-PCR

    Directory of Open Access Journals (Sweden)

    Bavol A. V.

    2013-12-01

    Full Text Available The transgenic wheat cell lines were obtained via biolistic transformation of the callus cultures initiated from the 3-day-old sterile seedling shoot apexes. The pAHC25 vector construction used for 14- and 28-day-old callus cultures transformation carried the selective phosphinothricin-N-acetyltransferase (bar gene and reporter ?-glucuronidase gene. The cell line selection was carried out on the media with phosphinothricin by means of graduated cell selection. The transgenic status of the obtained forms was proved by PCR-analysis. The presence of new relatively high molecular (more than 1 000 bp amplicons were found out for three transformed lines by means of IRAP PCRanalysis with the primers coding for long termainal repeats sequences of SIRE 1 retrotransposon. This fact may prove transposition of this mobile genetic element. The new DNA fragments were detected for three of the seven analyzed lines but for the control callus. It is possible to assume at induction of SIRE 1 transposition bis probably caused by the genomic stress of foreign DNA inserting or associated with the transformation process (mechanical wounding, cultivation on selective media.

  3. Insect resistance to Nilaparvata lugens and Cnaphalocrocis medinalis in transgenic indica rice and the inheritance of gna+sbti transgenes.

    Science.gov (United States)

    Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin

    2005-04-01

    Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants. Copyright 2005 Society of Chemical Industry.

  4. Expression levels of antimicrobial peptide tachyplesin I in transgenic Ornithogalum lines affect the resistance to Pectobacterium infection.

    Science.gov (United States)

    Lipsky, Alexander; Joshi, Janak Raj; Carmi, Nir; Yedidia, Iris

    2016-11-20

    The genus Ornithogalum includes several ornamental species that suffer substantial losses from bacterial soft rot caused by Pectobacteria. The absence of effective control measures for use against soft rot bacteria led to the initiation of a project in which a small antimicrobial peptide from an Asian horseshoe crab, tachyplesin (tpnI), was introduced into two commercial cultivars: O. dubium and O. thyrsoides. Disease severity and bacterial colonization were examined in transgenic lines expressing this peptide. Disease resistance was evaluated in six lines of each species by measuring bacterial proliferation in the plant tissue. Three transgenic lines of each species were subjected to further analysis in which the expression level of the transgene was evaluated using RT-PCR and qRT-PCR. The development of disease symptoms and bacterial colonization of the plant tissue were also examined using GFP-expressing strain of P. carotovorum subsp. brasiliense Pcb3. Confocal-microscopy imaging revealed significantly reduced quantities of bacterial cells in the transgenic plant lines that had been challenged with the bacterium. The results clearly demonstrate that tpnI expression reduces bacterial proliferation, colonization and disease symptom (reduced by 95-100%) in the transgenic plant tissues. The quantity of tpnI transcripts, as measured by qRT-PCR, was negatively correlated with the protection afforded to the plants, as measured by the reduced severity of disease symptoms in the tissue. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Establishment of a pig fibroblast-derived cell line for locus-directed transgene expression in cell cultures and blastocysts

    DEFF Research Database (Denmark)

    Jakobsen, Jannik E; Li, Juan; Moldt, Brian

    2011-01-01

    We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon-based do......We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon...

  6. Investigating the application of a nitroreductase-expressing transgenic zebrafish line for high-throughput toxicity testing

    Directory of Open Access Journals (Sweden)

    Anna C. Chlebowski

    Full Text Available Nitroreductase enzymes are responsible for the reduction of nitro functional groups to amino functional groups, and are found in a range of animal models, zebrafish (Danio rerio excluded. Transgenic zebrafish models have been developed for tissue-specific cell ablation, which use nitroreductase to ablate specific tissues or cell types following exposure to the non-toxic pro-drug metronidazole (MTZ. When metabolized by nitroreductase, MTZ produces a potent cytotoxin, which specifically ablates the tissue in which metabolism occurs. Uses, beyond tissue-specific cell ablation, are possible for the hepatocyte-specific Tg(l-fabp:CFP-NTRs891 zebrafish line, including investigations of the role of nitroreductase in the toxicity of nitrated compounds. The hepatic ablation characteristics of this transgenic line were explored, in order to expand its potential uses. Embryos were exposed at 48, 72, or 96 h post fertilization (hpf to a range of MTZ concentrations, and the ablation profiles were compared. Ablation occurred at a 10-fold lower concentration than previously reported. Embryos were exposed to a selection of other compounds, with and without MTZ, in order to investigate alternative uses for this transgenic line. Test compounds were selected based on: their ability to undergo nitroreduction, known importance of hepatic metabolism to toxicity, and known pharmaceutical hepatotoxins. Selected compounds included nitrated polycyclic aromatic hydrocarbons (nitro-PAHs, the PAHs retene and benzo[a]pyrene, and the pharmaceuticals acetaminophen and flutamide. The results suggest a range of potential roles of the liver in the toxicity of these compounds, and highlight the additional uses of this transgenic model in toxicity testing. Keywords: Zebrafish, Transgenic, Nitroreductase, Nitrated polycyclic aromatic hydrocarbon, Tissue ablation, Pharmaceuticals

  7. Effect of transgenic Bacillus thuringiensis rice lines on mortality and feeding behavior of rice stem borers (Lepidoptera: Crambidae).

    Science.gov (United States)

    Chen, Hao; Zhang, Guoan; Zhang, Qifa; Lin, Yongjun

    2008-02-01

    Ten transgenic Bacillus thuringiensis Bt rice, Oryza sativa L., lines with different Bt genes (two Cry1Ac lines, three Cry2A lines, and five Cry9C lines) derived from the same variety Minghui 63 were evaluated in both the laboratory and the field. Bioassays were conducted by using the first instars of two main rice lepidopteran insect species: yellow stem borer, Scirpophaga incertulas (Walker) and Asiatic rice borer, Chilo suppressalis (Walker). All transgenic lines exhibited high toxicity to these two rice borers. Field evaluation results also showed that all transgenic lines were highly insect resistant with both natural infestation and manual infestation of the neonate larvae of S. incertulas compared with the nontransformed Minghui63. Bt protein concentrations in leaves of 10 transgenic rice lines were estimated by the sandwich enzyme-linked immunosorbent assay. The cry9C gene had the highest expression level, next was cry2A gene, and the cry1Ac gene expressed at the lowest level. The feeding behavior of 7-d-old Asiatic rice borer to three classes of Bt transgenic rice lines also was detected by using rice culm cuttings. The results showed that 7-d-old larvae of Asiatic rice borer have the capacity to distinguish Bt and non-Bt culm cuttings and preferentially fed on non-Bt cuttings. When only Bt culm cuttings with three classes of different Bt proteins (CrylAc, Cry2A, and Cry9C) were fed, significant distribution difference of 7-d-old Asiatic rice borer in culm cuttings of different Bt proteins also was found. In the current study, we evaluate different Bt genes in the same rice variety in both the laboratory and the field, and also tested feeding behavior of rice insect to these Bt rice. These data are valuable for the further development of two-toxin Bt rice and establishment of appropriate insect resistance management in the future.

  8. Comparison of nutritional value of transgenic peanut expressing bar and rcg3 genes with non-transgenic counterparts

    International Nuclear Information System (INIS)

    Robab, U.E.; )

    2014-01-01

    The transgenic peanut plants expressing bar and rcg3 genes were subjected to assessment of any change in nutritional value of the crop at various locations. The protein and fat contents of transgenic lines were compared with the non-transgenic parent varieties. Protein content in the transgenic lines was higher as compared to that in non-transgenic counterparts and differences among locations for fat and protein content were significant. No differences among fatty acids were recorded for genes, events and locations. Irrespective of small differences, all the values were in range described for this crop and transgenic lines appeared to be substantially equivalent to non-transgenic parent varieties. (author)

  9. Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene

    DEFF Research Database (Denmark)

    Efrat, S; Linde, S; Kofod, Hans

    1988-01-01

    Three pancreatic beta-cell lines have been established from insulinomas derived from transgenic mice carrying a hybrid insulin-promoted simian virus 40 tumor antigen gene. The beta tumor cell (beta TC) lines maintain the features of differentiated beta cells for about 50 passages in culture. The ...... both to immortalize a rare cell type and to provide a selection for the maintenance of its differentiated phenotype....

  10. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    International Nuclear Information System (INIS)

    Wang Tiegu; Huang Qunce; Feng Weisen

    2007-01-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning

  11. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    Science.gov (United States)

    Wang, Tiegu; Huang, Qunce; Feng, Weisen

    2007-10-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  12. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    Energy Technology Data Exchange (ETDEWEB)

    Tiegu, Wang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Qunce, Huang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Weisen, Feng [Luoyang Institute of Agricultural Science, Luoyang 471022 (China)

    2007-10-15

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  13. Generation of Pet1210-Cre Transgenic Mouse Line Reveals Non-Serotonergic Expression Domains of Pet1 Both in CNS and Periphery

    Science.gov (United States)

    Pelosi, Barbara; Migliarini, Sara; Pacini, Giulia; Pratelli, Marta; Pasqualetti, Massimo

    2014-01-01

    Neurons producing serotonin (5-hydroxytryptamine, 5-HT) constitute one of the most widely distributed neuronal networks in the mammalian central nervous system (CNS) and exhibit a profuse innervation throughout the CNS already at early stages of development. Serotonergic neuron specification is controlled by a combination of secreted molecules and transcription factors such as Shh, Fgf4/8, Nkx2.2, Lmx1b and Pet1. In the mouse, Pet1 mRNA expression appears between 10 and 11 days post coitum (dpc) in serotonergic post-mitotic precursors and persists in serotonergic neurons up to adulthood, where it promotes the expression of genes defining the mature serotonergic phenotype such as tryptophan hydroxylase 2 (Tph2) and serotonin transporter (SERT). Hence, the generation of genetic tools based on Pet1 specific expression represents a valuable approach to study the development and function of the serotonergic system. Here, we report the generation of a Pet1210-Cre transgenic mouse line in which the Cre recombinase is expressed under the control of a 210 kb fragment from the Pet1 genetic locus to ensure a reliable and faithful control of somatic recombination in Pet1 cell lineage. Besides Cre-mediated recombination accurately occurred in the serotonergic system as expected and according to previous studies, Pet1210-Cre transgenic mouse line allowed us to identify novel, so far uncharacterized, Pet1 expression domains. Indeed, we showed that in the raphe Pet1 is expressed also in a non-serotonergic neuronal population intermingled with Tph2-expressing cells and mostly localized in the B8 and B9 nuclei. Moreover, we detected Cre-mediated recombination also in the developing pancreas and in the ureteric bud derivatives of the kidney, where it reflected a specific Pet1 expression. Thus, Pet1210-Cre transgenic mouse line faithfully drives Cre-mediated recombination in all Pet1 expression domains representing a valuable tool to genetically manipulate serotonergic and non

  14. Two types of Tet-On transgenic lines for doxycycline-inducible gene expression in zebrafish rod photoreceptors and a gateway-based tet-on toolkit.

    Directory of Open Access Journals (Sweden)

    Leah J Campbell

    Full Text Available The ability to control transgene expression within specific tissues is an important tool for studying the molecular and cellular mechanisms of development, physiology, and disease. We developed a Tet-On system for spatial and temporal control of transgene expression in zebrafish rod photoreceptors. We generated two transgenic lines using the Xenopus rhodopsin promoter to drive the reverse tetracycline-controlled transcriptional transactivator (rtTA, one with self-reporting GFP activity and one with an epitope tagged rtTA. The self-reporting line includes a tetracycline response element (TRE-driven GFP and, in the presence of doxycycline, expresses GFP in larval and adult rods. A time-course of doxycycline treatment demonstrates that maximal induction of GFP expression, as determined by the number of GFP-positive rods, is reached within approximately 24 hours of drug treatment. The epitope-tagged transgenic line eliminates the need for the self-reporting GFP activity by expressing a FLAG-tagged rtTA protein. Both lines demonstrate strong induction of TRE-driven transgenes from plasmids microinjected into one-cell embryos. These results show that spatial and temporal control of transgene expression can be achieved in rod photoreceptors. Additionally, system components are constructed in Gateway compatible vectors for the rapid cloning of doxycycline-inducible transgenes and use in other areas of zebrafish research.

  15. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line using 18S and ITS rDNA Sequences over Four Seasons

    Directory of Open Access Journals (Sweden)

    Xiemin Qi

    2016-07-01

    Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.

  16. Transgenic Xenopus laevis Line for In Vivo Labeling of Nephrons within the Kidney

    Directory of Open Access Journals (Sweden)

    Mark E. Corkins

    2018-04-01

    Full Text Available Xenopus laevis embryos are an established model for studying kidney development. The nephron structure and genetic pathways that regulate nephrogenesis are conserved between Xenopus and humans, allowing for the study of human disease-causing genes. Xenopus embryos are also amenable to large-scale screening, but studies of kidney disease-related genes have been impeded because assessment of kidney development has largely been limited to examining fixed embryos. To overcome this problem, we have generated a transgenic line that labels the kidney. We characterize this cdh17:eGFP line, showing green fluorescent protein (GFP expression in the pronephric and mesonephric kidneys and colocalization with known kidney markers. We also demonstrate the feasibility of live imaging of embryonic kidney development and the use of cdh17:eGFP as a kidney marker for secretion assays. Additionally, we develop a new methodology to isolate and identify kidney cells for primary culture. We also use morpholino knockdown of essential kidney development genes to establish that GFP expression enables observation of phenotypes, previously only described in fixed embryos. Taken together, this transgenic line will enable primary kidney cell culture and live imaging of pronephric and mesonephric kidney development. It will also provide a simple means for high-throughput screening of putative human kidney disease-causing genes.

  17. Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

    Science.gov (United States)

    Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

    2018-07-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

  18. FLAX OIL FROM TRANSGENIC LINUM USITATISSIMUM SELECTIVELY INHIBITS IN VITRO PROLIFERATION OF HUMAN CANCER CELL LINES.

    Science.gov (United States)

    Gebarowski, Tomasz; Gebczak, Katarzyna; Wiatrak, Benita; Kulma, Anna; Pelc, Katarzyna; Czuj, Tadeusz; Szopa, Jan; Gasiorowski, Kazimierz

    2017-03-01

    Emulsions made of oils from transgenic flaxseeds significantly decreased in vitro proliferation of six tested human cancer cell lines in 48-h cultures, as assessed with the standard sulforhodamine assay. However, the emulsions also increased proliferation rate of normal human dermal fibroblasts and, to a lower extend, of keratinocytes. Both inhibition of in vitro proliferation of human cancer cell lines and stimulation of proliferation of normal dermal fibroblasts and keratinocytes were especially strong with the emulsion type B and with emulsion type M. Oils from seeds of transgenic flax type B and M should be considered as valuable adjunct to standard cytostatic therapy of human cancers and also could be applied to improve the treatment of skin lesions in wound healing.

  19. Accumulation of nickel in transgenic tobacco

    Science.gov (United States)

    Sidik, Nik Marzuki; Othman, Noor Farhan

    2013-11-01

    The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TFtransgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

  20. Transgenic Pm3 multilines of wheat show increased powdery mildew resistance in the field.

    Science.gov (United States)

    Brunner, Susanne; Stirnweis, Daniel; Diaz Quijano, Carolina; Buesing, Gabriele; Herren, Gerhard; Parlange, Francis; Barret, Pierre; Tassy, Caroline; Sautter, Christof; Winzeler, Michael; Keller, Beat

    2012-05-01

    Resistance (R) genes protect plants very effectively from disease, but many of them are rapidly overcome when present in widely grown cultivars. To overcome this lack of durability, strategies that increase host resistance diversity have been proposed. Among them is the use of multilines composed of near-isogenic lines (NILs) containing different disease resistance genes. In contrast to classical R-gene introgression by recurrent backcrossing, a transgenic approach allows the development of lines with identical genetic background, differing only in a single R gene. We have used alleles of the resistance locus Pm3 in wheat, conferring race-specific resistance to wheat powdery mildew (Blumeria graminis f. sp. tritici), to develop transgenic wheat lines overexpressing Pm3a, Pm3c, Pm3d, Pm3f or Pm3g. In field experiments, all tested transgenic lines were significantly more resistant than their respective nontransformed sister lines. The resistance level of the transgenic Pm3 lines was determined mainly by the frequency of virulence to the particular Pm3 allele in the powdery mildew population, Pm3 expression levels and most likely also allele-specific properties. We created six two-way multilines by mixing seeds of the parental line Bobwhite and transgenic Pm3a, Pm3b and Pm3d lines. The Pm3 multilines were more resistant than their components when tested in the field. This demonstrates that the difference in a single R gene is sufficient to cause host-diversity effects and that multilines of transgenic Pm3 wheat lines represent a promising strategy for an effective and sustainable use of Pm3 alleles. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  1. Transgene inheritances and genetic similarities of near isogenic lines of genetically modified common beans Herança de transgenes e similaridade genética de linhagens quase isogênicas de feijoeiro-comum geneticamente modificado

    Directory of Open Access Journals (Sweden)

    Patrícia Valle Pinheiro

    2009-09-01

    Full Text Available The objective of the present work was to determine the inheritance and stability of transgenes of a transgenic bean line expressing the genes rep-trap-ren from Bean golden mosaic virus and the bar gene. Crosses were done between the transgenic line and four commercial bean cultivars, followed by four backcrosses to the commercial cultivars. Progenies from each cross were evaluated for the presence of the transgenes by brushing the leaves with glufosinate ammonium and by polymerase chain reaction using specific oligonucleotides. Advanced generations were rub-inoculated with an isolate of Bean common mosaic necrosis virus (BCMNV. The transgenes were inherited consistently in a Mendelian pattern in the four crosses studied. The analyzed lines recovered close to 80% of the characteristics of the recurrent parent, as determined by the random amplified DNA markers used, besides maintaining important traits such as resistance to BCMNV. The presence of the transgene did not cause any detectable undesirable effect in the evaluated progenies.O objetivo do presente trabalho foi determinar a herança e a estabilidade de transgenes de uma linhagem de feijoeiro-comum com expressão dos genes rep-trap-ren, do Bean golden mosaic virus, e do gene bar. Foram realizados cruzamentos entre a linhagem transgênica e quatro cultivares comerciais de feijão, seguidos de quatro retrocruzamentos. As progênies de cada cruzamento foram avaliadas quanto à presença dos transgenes, com aplicação do glifosinato de amônia nas folhas e por meio da reação da polimerase em cadeia com uso de oligonucleotídeos específicos. O vírus do mosaico comum necrótico do feijoeiro, Bean common mosaic necrosis virus (BCMNV, foi inoculado mecanicamente nas gerações avançadas. Os transgenes foram herdados em padrão mendeliano nos quatro cruzamentos estudados. As linhagens analisadas apresentaram cerca de 80% das características do parental recorrente, conforme determinado por an

  2. Transgenic mice produced by retroviral transduction of male germ-line stem cells

    OpenAIRE

    Nagano, Makoto; Brinster, Clayton J.; Orwig, Kyle E.; Ryu, Buom-Yong; Avarbock, Mary R.; Brinster, Ralph L.

    2001-01-01

    Male germ-line stem cells are the only cell type in postnatal mammals that have the capability to self-renew and to contribute genes to the next generation. Genetic modification of these cells would provide an opportunity to study the biology of their complex self-renewal and differentiation processes, as well as enable the generation of transgenic animals in a wide range of species. Although retroviral vectors have been used as an efficient method to introduce genes into a variety of cell ty...

  3. Development of transgenic Brassica juncea lines for reduced seed sinapine content by perturbing phenylpropanoid pathway genes.

    Directory of Open Access Journals (Sweden)

    Sachin Kajla

    Full Text Available Sinapine is a major anti-nutritive compound that accumulates in the seeds of Brassica species. When ingested, sinapine imparts gritty flavuor in meat and milk of animals and fishy odor to eggs of brown egg layers, thereby compromising the potential use of the valuable protein rich seed meal. Sinapine content in Brassica juncea germplasm ranges from 6.7 to 15.1 mg/g of dry seed weight (DSW which is significantly higher than the prescribed permissible level of 3.0 mg/g of DSW. Due to limited natural genetic variability, conventional plant breeding approach for reducing the sinapine content has largely been unsuccessful. Hence, transgenic approach for gene silencing was adopted by targeting two genes-SGT and SCT, encoding enzymes UDP- glucose: sinapate glucosyltransferase and sinapoylglucose: choline sinapoyltransferase, respectively, involved in the final two steps of sinapine biosynthetic pathway. These two genes were isolated from B. juncea and eight silencing constructs were developed using three different RNA silencing approaches viz. antisense RNA, RNAi and artificial microRNA. Transgenics in B. juncea were developed following Agrobacterium-mediated transformation. From a total of 1232 independent T0 transgenic events obtained using eight silencing constructs, 25 homozygous lines showing single gene inheritance were identified in the T2 generation. Reduction of seed sinapine content in these lines ranged from 15.8% to 67.2%; the line with maximum reduction had sinapine content of 3.79 mg/g of DSW. The study also revealed that RNAi method was more efficient than the other two methods used in this study.

  4. Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression.

    Science.gov (United States)

    Nocarova, Eva; Fischer, Lukas

    2009-04-22

    Phenotypic characterization of transgenic cell lines, frequently used in plant biology studies, is complicated because transgene expression in individual cells is often heterogeneous and unstable. To identify the sources and to reduce this heterogeneity, we transformed tobacco (Nicotiana tabacum L.) BY-2 cells with a gene encoding green fluorescent protein (GFP) using Agrobacterium tumefaciens, and then introduced a simple cloning procedure to generate cell lines derived from the individual transformed cells. Expression of the transgene was monitored by analysing GFP fluorescence in the cloned lines and also in lines obtained directly after transformation. The majority ( approximately 90%) of suspension culture lines derived from calli that were obtained directly from transformation consisted of cells with various levels of GFP fluorescence. In contrast, nearly 50% of lines generated by cloning cells from the primary heterogeneous suspensions consisted of cells with homogenous GFP fluorescence. The rest of the lines exhibited "permanent heterogeneity" that could not be resolved by cloning. The extent of fluorescence heterogeneity often varied, even among genetically identical clones derived from the primary transformed lines. In contrast, the offspring of subsequent cloning of the cloned lines was uniform, showing GFP fluorescence intensity and heterogeneity that corresponded to the original clone. The results demonstrate that, besides genetic heterogeneity detected in some lines, the primary lines often contained a mixture of epigenetically different cells that could be separated by cloning. This indicates that a single integration event frequently results in various heritable expression patterns, which are probably accidental and become stabilized in the offspring of the primary transformed cells early after the integration event. Because heterogeneity in transgene expression has proven to be a serious problem, it is highly advisable to use transgenes tagged with

  5. Condensation of chromatin in transcriptional regions of an inactivated plant transgene: evidence for an active role of transcription in gene silencing.

    Science.gov (United States)

    van Blokland, R; ten Lohuis, M; Meyer, P

    1997-12-01

    The chromatin structures of two epigenetic alleles of a transgene were investigated by measuring the local accessibility of transgene chromatin to endonucleases. The two epialleles represented the active, hypomethylated state of a transgene in line 17-I of Petunia hybrida, and a transcriptionally inactive, hypermethylated derivative of the same transgene in line 17-IV. In nuclear preparations the inactive epiallele was significantly less sensitive to DNasel digestion and nuclease S7 digestion than the transcriptionally active epiallele, whereas no significant differences in accessibility were observed between naked DNA samples of the two epialleles. Our data suggest that a condensed chromatin structure is specifically imposed on transcribed regions of the construct in line 17-IV. In contrast, in both epialleles the plasmid region of the transgene, which is not transcriptionally active in plants, retains the same accessibility to endonucleases as the chromosomal integration site. These data suggest that transcriptional inactivation is linked to the process of transcription, and imply that control of transgene expression via the use of inducible or tissue-specific promoters might prevent transgene silencing and conserve the active state of transgenes during sexual propagation.

  6. Promoter, transgene, and cell line effects in the transfection of mammalian cells using PDMAEMA-based nano-stars

    Directory of Open Access Journals (Sweden)

    Alexander Raup

    2016-09-01

    Full Text Available Non-viral transfection protocols are typically optimized using standard cells and reporter proteins, potentially underestimating cellular or transgene effects. Here such effects were studied for two human (Jurkat, HEK-293 and two rodent (CHO-K1, L929 cell lines and three fluorescent reporter proteins. Expression of the enhanced green fluorescent protein (EGFP was studied under the control of the human elongation factor 1 alpha promoter and three viral promoters (SV40, SV40/enhancer, CMV, that of ZsYellow1 (yellow fluorescence and mCherry (red fluorescence for the CMV promoter. Results varied with the cell line, in particular for the Jurkat cells. Pair-wise co-transfection of the CMV controlled transgenes resulted in a significant fraction of monochromatic cells (EGFP for EGFP/YFP and EGFP/RFP co-transfections, YFP in case of YFP/RFP co-transfections. Only Jurkat cells were almost incapable of expressing YFP. Dilution of the plasmid DNA with a non-expressed plasmid showed cell line dependent effects on transfection efficiency and/or expression levels.

  7. Increased yield of heterologous viral glycoprotein in the seeds of homozygous transgenic tobacco plants cultivated underground.

    Science.gov (United States)

    Tackaberry, Eilleen S; Prior, Fiona; Bell, Margaret; Tocchi, Monika; Porter, Suzanne; Mehic, Jelica; Ganz, Peter R; Sardana, Ravinder; Altosaar, Illimar; Dudani, Anil

    2003-06-01

    The use of transgenic plants in the production of recombinant proteins for human therapy, including subunit vaccines, is being investigated to evaluate the efficacy and safety of these emerging biopharmaceutical products. We have previously shown that synthesis of recombinant glycoprotein B (gB) of human cytomegalovirus can be targeted to seeds of transgenic tobacco when directed by the rice glutelin 3 promoter, with gB retaining critical features of immunological reactivity (E.S. Tackaberry et al. 1999. Vaccine, 17: 3020-3029). Here, we report development of second generation transgenic plant lines (T1) homozygous for the transgene. Twenty progeny plants from two lines (A23T(1)-2 and A24T(1)-3) were grown underground in an environmentally contained mine shaft. Based on yields of gB in their seeds, the A23T(1)-2 line was then selected for scale-up in the same facility. Analyses of mature seeds by ELISA showedthat gB specific activity in A23T(1)-2 seeds was over 30-fold greater than the best T0 plants from the same transformation series, representing 1.07% total seed protein. These data demonstrate stable inheritance, an absence of transgene inactivation, and enhanced levels of gB expression in a homozygous second generation plant line. They also provide evidence for the suitability of using this environmentally secure facility to grow transgenic plants producing therapeutic biopharmaceuticals.

  8. Representativeness of the LifeLines Cohort Study.

    Directory of Open Access Journals (Sweden)

    Bart Klijs

    Full Text Available LifeLines is a large prospective population-based three generation cohort study in the north of the Netherlands. Different recruitment strategies were adopted: recruitment of an index population via general practitioners, subsequent inclusion of their family members, and online self-registration. Our aim was to investigate the representativeness of the adult study population at baseline and to evaluate differences in the study population according to recruitment strategy.Demographic characteristics of the LifeLines study population, recruited between 2006-2013, were compared with the total adult population in the north of the Netherlands as registered in the Dutch population register. Socioeconomic characteristics, lifestyle, chronic diseases, and general health were further compared with participants of the Permanent Survey of Living Conditions within the region (2005-2011, N = 6,093. Differences according to recruitment strategy were assessed.Compared with the population of the north of the Netherlands, LifeLines participants were more often female, middle aged, married, living in a semi-urban place and Dutch native. Adjusted for differences in demographic composition, in LifeLines a smaller proportion had a low educational attainment (5% versus 14% or had ever smoked (54% versus 66%. Differences in the prevalence of various chronic diseases and low general health scores were mostly smaller than 3%. The age profiles of the three recruitment groups differed due to age related inclusion criteria of the recruitment groups. Other differences according to recruitment strategy were small.Our results suggest that, adjusted for differences in demographic composition, the LifeLines adult study population is broadly representative for the adult population of the north of the Netherlands. The recruitment strategy had a minor effect on the level of representativeness. These findings indicate that the risk of selection bias is low and that risk estimates

  9. Role of the durum wheat dehydrin in the function of proteases conferring salinity tolerance in Arabidopsis thaliana transgenic lines.

    Science.gov (United States)

    Saibi, Walid; Zouari, Nabil; Masmoudi, Khaled; Brini, Faiçal

    2016-04-01

    Dehydrins are claimed to stabilize macromolecules against freezing damage, dehydration, ionic or osmotic stresses, thermal stress and re-folding yield. However, their precise function remains unknown. In this context, we report the behavior of protease activities in dehydrin transgenic Arabidopsis lines against the wild type plant under salt stress (100mM NaCl). Indeed, proteases play key roles in plants, maintaining strict protein quality control and degrading specific sets of proteins in response to diverse environmental and developmental stimuli. We proved that durum wheat DHN-5 modulates the activity of some proteases, summarized on the promotion of the Cysteinyl protease and the decrease of the Aspartyl protease activity. This fact is also upgraded in salt stress conditions. We conclude that the dehydrin transgenic context encodes salinity tolerance in transgenic lines through the modulation of the interaction not only at transcriptional level but also at protein level and also with the impact of salt stress as an endogenous and exogenous effector on some biocatalysts like proteases. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Competitive performance of transgenic wheat resistant to powdery mildew.

    Directory of Open Access Journals (Sweden)

    Olena Kalinina

    Full Text Available Genetically modified (GM plants offer an ideal model system to study the influence of single genes that confer constitutive resistance to pathogens on the ecological behaviour of plants. We used phytometers to study competitive interactions between GM lines of spring wheat Triticum aestivum carrying such genes and control lines. We hypothesized that competitive performance of GM lines would be reduced due to enhanced transgene expression under pathogen levels typically encountered in the field. The transgenes pm3b from wheat (resistance against powdery mildew Blumeria graminis or chitinase and glucanase genes from barley (resistance against fungi in general were introduced with the ubiquitin promoter from maize (pm3b and chitinase genes or the actin promoter from rice (glucanase gene. Phytometers of 15 transgenic and non-transgenic wheat lines were transplanted as seedlings into plots sown with the same 15 lines as competitive environments and subject to two soil nutrient levels. Pm3b lines had reduced mildew incidence compared with control lines. Chitinase and chitinase/glucanase lines showed the same high resistance to mildew as their control in low-nutrient treatment and slightly lower mildew rates than the control in high-nutrient environment. Pm3b lines were weaker competitors than control lines. This resulted in reduced yield and seed number. The Pm3b line with the highest transgene expression had 53.2% lower yield than the control whereas the Pm3b line which segregated in resistance and had higher mildew rates showed only minor costs under competition. The line expressing both chitinase and glucanase genes also showed reduced yield and seed number under competition compared with its control. Our results suggest that single transgenes conferring constitutive resistance to pathogens can have ecological costs and can weaken plant competitiveness even in the presence of the pathogen. The magnitude of these costs appears related to the degree

  11. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    Directory of Open Access Journals (Sweden)

    Jacobs Jeanne ME

    2011-10-01

    Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

  12. Use of the viral 2A peptide for bicistronic expression in transgenic mice

    Directory of Open Access Journals (Sweden)

    Trichas Georgios

    2008-09-01

    that the transgene has integrated into the X chromosome in this line. Conclusion The 2A peptide efficiently mediates co-translational cleavage in transgenic mice in which it has been inherited through the germ-line. Mice expressing it ubiquitously throughout development and into adulthood appear normal. It is therefore a viable tool for use in genetically engineered mice and represents a superior alternative to the widely used internal ribosomal entry site.

  13. Characterisation of the p53 pathway in cell lines established from TH-MYCN transgenic mouse tumours.

    Science.gov (United States)

    Chen, Lindi; Esfandiari, Arman; Reaves, William; Vu, Annette; Hogarty, Michael D; Lunec, John; Tweddle, Deborah A

    2018-03-01

    Cell lines established from the TH-MYCN transgenic murine model of neuroblastoma are a valuable preclinical, immunocompetent, syngeneic model of neuroblastoma, for which knowledge of their p53 pathway status is important. In this study, the Trp53 status and functional response to Nutlin-3 and ionising radiation (IR) were determined in 6 adherent TH-MYCN transgenic cell lines using Sanger sequencing, western blot analysis and flow cytometry. Sensitivity to structurally diverse MDM2 inhibitors (Nutlin-3, MI-63, RG7388 and NDD0005) was determined using XTT proliferation assays. In total, 2/6 cell lines were Trp53 homozygous mutant (NHO2A and 844MYCN+/+) and 1/6 (282MYCN+/-) was Trp53 heterozygous mutant. For 1/6 cell lines (NHO2A), DNA from the corresponding primary tumour was found to be Trp53 wt. In all cases, the presence of a mutation was consistent with aberrant p53 signalling in response to Nutlin-3 and IR. In comparison to TP53 wt human neuroblastoma cells, Trp53 wt murine control and TH-MYCN cell lines were significantly less sensitive to growth inhibition mediated by MI-63 and RG7388. These murine Trp53 wt and mutant TH-MYCN cell lines are useful syngeneic, immunocompetent neuroblastoma models, the former to test p53-dependent therapies in combination with immunotherapies, such as anti-GD2, and the latter as models of chemoresistant relapsed neuroblastoma when aberrations in the p53 pathway are more common. The spontaneous development of Trp53 mutations in 3 cell lines from TH-MYCN mice may have arisen from MYCN oncogenic driven and/or ex vivo selection. The identified species-dependent selectivity of MI-63 and RG7388 should be considered when interpreting in vivo toxicity studies of MDM2 inhibitors.

  14. Enhanced salt stress tolerance in transgenic potato plants expressing IbMYB1, a sweet potato transcription factor.

    Science.gov (United States)

    Cheng, Yu-Jie; Kim, Myoung-Duck; Deng, Xi-Ping; Kwak, Sang-Soo; Chen, Wei

    2013-12-01

    IbMYB1, a transcription factor (TF) for R2R3-type MYB TFs, is a key regulator of anthocyanin biosynthesis during storage of sweet potatoes. Anthocyanins provide important antioxidants of nutritional value to humans, and also protect plants from oxidative stress. This study aimed to increase transgenic potatoes' (Solanum tuberosum cv. LongShu No.3) tolerance to environmental stress and enhance their nutritional value. Transgenic potato plants expressing IbMYB1 genes under the control of an oxidative stress-inducible peroxidase (SWPA2) promoter (referred to as SM plants) were successfully generated through Agrobacterium-mediated transformation. Two representative transgenic SM5 and SM12 lines were evaluated for enhanced tolerance to salinity, UV-B rays, and drought conditions. Following treatment of 100 mM NaCl, seedlings of SM5 and SM12 lines showed less root damage and more shoot growth than control lines expressing only an empty vector. Transgenic potato plants in pots treated with 400 mM NaCl showed high amounts of secondary metabolites, including phenols, anthocyanins, and flavonoids, compared with control plants. After treatment of 400 mM NaCl, transgenic potato plants also showed high DDPH radical scavenging activity and high PS II photochemical efficiency compared with the control line. Furthermore, following treatment of NaCl, UV-B, and drought stress, the expression levels of IbMYB1 and several structural genes in the flavonoid biosynthesis such as CHS, DFR, and ANS in transgenic plants were found to be correlated with plant phenotype. The results suggest that enhanced IbMYB1 expression affects secondary metabolism, which leads to improved tolerance ability in transgenic potatoes.

  15. Heterogeneous transgene expression in the retinas of the TH-RFP, TH-Cre, TH-BAC-Cre and DAT-Cre mouse lines.

    Science.gov (United States)

    Vuong, H E; Pérez de Sevilla Müller, L; Hardi, C N; McMahon, D G; Brecha, N C

    2015-10-29

    Transgenic mouse lines are essential tools for understanding the connectivity, physiology and function of neuronal circuits, including those in the retina. This report compares transgene expression in the retina of a tyrosine hydroxylase (TH)-red fluorescent protein (RFP) mouse line with three catecholamine-related Cre recombinase mouse lines [TH-bacterial artificial chromosome (BAC)-, TH-, and dopamine transporter (DAT)-Cre] that were crossed with a ROSA26-tdTomato reporter line. Retinas were evaluated and immunostained with commonly used antibodies including those directed to TH, GABA and glycine to characterize the RFP or tdTomato fluorescent-labeled amacrine cells, and an antibody directed to RNA-binding protein with multiple splicing to identify ganglion cells. In TH-RFP retinas, types 1 and 2 dopamine (DA) amacrine cells were identified by their characteristic cellular morphology and type 1 DA cells by their expression of TH immunoreactivity. In the TH-BAC-, TH-, and DAT-tdTomato retinas, less than 1%, ∼ 6%, and 0%, respectively, of the fluorescent cells were the expected type 1 DA amacrine cells. Instead, in the TH-BAC-tdTomato retinas, fluorescently labeled AII amacrine cells were predominant, with some medium diameter ganglion cells. In TH-tdTomato retinas, fluorescence was in multiple neurochemical amacrine cell types, including four types of polyaxonal amacrine cells. In DAT-tdTomato retinas, fluorescence was in GABA immunoreactive amacrine cells, including two types of bistratified and two types of monostratified amacrine cells. Although each of the Cre lines was generated with the intent to specifically label DA cells, our findings show a cellular diversity in Cre expression in the adult retina and indicate the importance of careful characterization of transgene labeling patterns. These mouse lines with their distinctive cellular labeling patterns will be useful tools for future studies of retinal function and visual processing. Published by Elsevier

  16. 2013 North Dakota Transgenic Barley Research and FHB Nursery Report

    Science.gov (United States)

    Research continues to develop and test new transgenic plants using genes provided by collaborators. As lines are developed in Golden Promise, they are crossed to Conlon for field testing. Transgenic lines developed in Conlon are being crossed to resistant lines developed by the breeding programs. ...

  17. Calls to Teen Line: Representative Concerns of Adolescents.

    Science.gov (United States)

    Boehm, Kathryn E.; Schondel, Connie K.; Ivoska, William J.; Marlowe, Alison L.; Manke-Mitchell, Laurie

    1998-01-01

    Study examines whether the concerns of teenagers calling a peer listening service are representative of the concerns of teenagers in the area served. Results indicate that students' biggest concerns involve family problems, peer relationships, self-esteem, and school problems. Concludes that calls to the teen line are representative. (Author/GCP)

  18. Comparison of the rhizosphere bacterial communities of Zigongdongdou soybean and a high-methionine transgenic line of this cultivar.

    Directory of Open Access Journals (Sweden)

    Jingang Liang

    Full Text Available Previous studies have shown that methionine from root exudates affects the rhizosphere bacterial population involved in soil nitrogen fixation. A transgenic line of Zigongdongdou soybean cultivar (ZD91 that expresses Arabidopsis cystathionine γ-synthase resulting in an increased methionine production was examined for its influence to the rhizosphere bacterial population. Using 16S rRNA gene-based pyrosequencing analysis of the V4 region and DNA extracted from bacterial consortia collected from the rhizosphere of soybean plants grown in an agricultural field at the pod-setting stage, we characterized the populational structure of the bacterial community involved. In total, 87,267 sequences (approximately 10,908 per sample were analyzed. We found that Acidobacteria, Proteobacteria, Bacteroidetes, Actinobacteria, Chloroflexi, Planctomycetes, Gemmatimonadetes, Firmicutes, and Verrucomicrobia constitute the dominant taxonomic groups in either the ZD91 transgenic line or parental cultivar ZD, and that there was no statistically significant difference in the rhizosphere bacterial community structure between the two cultivars.

  19. Transgenic Chinese hamster V79 cell lines which exhibit variable levels of gpt mutagenesis

    International Nuclear Information System (INIS)

    Klein, C.B.; Rossman, T.G.

    1990-01-01

    The Escherichia coli gpt gene coding for xanthine-guanine phosphoribosyl transferase has been stably transfected into HPRT - Chinese hamster V79 cells. Several gpt - cell lines have been established, which retain the sequence(s) even after long-term culture without selection for gpt. While spontaneous mutagenesis to gpt - occurs rather frequently for most cell lines, it cannot be correlated with either the number of plasmid integration sites or deletion of the plasmid sequence(s). One transgenic cell line (g12), which continuously maintains a low spontaneous mutation frequency was used in comparative mutagenesis studies with wild-type V79 cells (gpt vs. hprt). Alkylating agents such as N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) and β-propiolactone (BPL) are shown to be equally toxic and mutagenic in both g12 and V79 cells. UV and X-rays are also equally toxic to both cell lines. The data presented here suggests that g12 cells may be useful to study mammalian mutagenesis by agents which yield limited response at the hprt locus

  20. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  1. Cry1Ac Protein expression in tissues of potato (solanumtuberosum spp. andigena) transgenic lines var. Diacol Capiro

    International Nuclear Information System (INIS)

    Vanegas Araujo, Pablo Andres; Blanco Martinez, Jennifer Teresa; Chaparro Giraldo, Alejandro

    2010-01-01

    The potato plant is the fourth most important crop in the world. In Colombia around 2.8 million tons are produced annually economically supporting 90000 families. In the country, the major economic impact in the crop is caused by Tecia solanivora that originates loses up to 100% in the tuber production. The genetic plant breeding related to the introduction of Cry genes which codify insecticidal crystal proteins is an alternative for reducing the insect attack in commercial crops. In this work, the insertion, transcription and expression of Cry1Ac gen was characterized in different tissues and three development stages of two transgenic lines of Solanum tuberosum variety Diacol Capiro that were previously transformed by Agrobacterium tumefaciens method. The characterization was realized by PCR, RT-PCR and ELISA techniques. The gen insertion and transcription was confirmed using primers for Cry1Ac gen that amplified a specific band of 766 bp. The protein expression levels were higher than 45 µg/g and were not significantly different between the analyzed lines or the three development stages. Furthermore, taking into account some relevant phenotypic features, no significant differences were found between transgenic lines and controls. The results suggest that monitoring and biosecurity assays are necessary with this vegetal material because their high level expression inside all the tissues analyzed that could affect non-targeted insects.

  2. Overexpression of host plant urease in transgenic silkworms.

    Science.gov (United States)

    Jiang, Liang; Huang, Chunlin; Sun, Qiang; Guo, Huizhen; Peng, Zhengwen; Dang, Yinghui; Liu, Weiqiang; Xing, Dongxu; Xu, Guowen; Zhao, Ping; Xia, Qingyou

    2015-06-01

    Bombyx mori and mulberry constitute a model of insect-host plant interactions. Urease hydrolyzes urea to ammonia and is important for the nitrogen metabolism of silkworms because ammonia is assimilated into silk protein. Silkworms do not synthesize urease and acquire it from mulberry leaves. We synthesized the artificial DNA sequence ureas using the codon bias of B. mori to encode the signal peptide and mulberry urease protein. A transgenic vector that overexpresses ure-as under control of the silkworm midgut-specific P2 promoter was constructed. Transgenic silkworms were created via embryo microinjection. RT-PCR results showed that urease was expressed during the larval stage and qPCR revealed the expression only in the midgut of transgenic lines. Urea concentration in the midgut and hemolymph of transgenic silkworms was significantly lower than in a nontransgenic line when silkworms were fed an artificial diet. Analysis of the daily body weight and food conversion efficiency of the fourth and fifth instar larvae and economic characteristics indicated no differences between transgenic silkworms and the nontransgenic line. These results suggested that overexpression of host plant urease promoted nitrogen metabolism in silkworms.

  3. Recombineering strategies for developing next generation BAC transgenic tools for optogenetics and beyond.

    Science.gov (United States)

    Ting, Jonathan T; Feng, Guoping

    2014-01-01

    The development and application of diverse BAC transgenic rodent lines has enabled rapid progress for precise molecular targeting of genetically-defined cell types in the mammalian central nervous system. These transgenic tools have played a central role in the optogenetic revolution in neuroscience. Indeed, an overwhelming proportion of studies in this field have made use of BAC transgenic Cre driver lines to achieve targeted expression of optogenetic probes in the brain. In addition, several BAC transgenic mouse lines have been established for direct cell-type specific expression of Channelrhodopsin-2 (ChR2). While the benefits of these new tools largely outweigh any accompanying challenges, many available BAC transgenic lines may suffer from confounds due in part to increased gene dosage of one or more "extra" genes contained within the large BAC DNA sequences. Here we discuss this under-appreciated issue and propose strategies for developing the next generation of BAC transgenic lines that are devoid of extra genes. Furthermore, we provide evidence that these strategies are simple, reproducible, and do not disrupt the intended cell-type specific transgene expression patterns for several distinct BAC clones. These strategies may be widely implemented for improved BAC transgenesis across diverse disciplines.

  4. Expression of bgt gene in transgenic birch (Betula platyphylla Suk.)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-08-04

    Aug 4, 2009 ... Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch.

  5. Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System

    Directory of Open Access Journals (Sweden)

    Zhanqi Dong

    2018-02-01

    Full Text Available The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV immediate early-1 (ie-1 gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-/sgRNA(-, Cas9(+/sgRNA(-, Cas9(-/sgRNA(+, and Cas9(+/sgRNA(+. We demonstrated that the Cas9(+/sgRNA(+ transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+/sgRNA(+ transgenic lines shows that the median lethal dose (LD50 is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+/sgRNA(+ transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.

  6. Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System.

    Science.gov (United States)

    Dong, Zhanqi; Dong, Feifan; Yu, Xinbo; Huang, Liang; Jiang, Yaming; Hu, Zhigang; Chen, Peng; Lu, Cheng; Pan, Minhui

    2018-01-01

    The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV) immediate early-1 ( ie-1 ) gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-)/sgRNA(-), Cas9(+)/sgRNA(-), Cas9(-)/sgRNA(+), and Cas9(+)/sgRNA(+). We demonstrated that the Cas9(+)/sgRNA(+) transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+)/sgRNA(+) transgenic lines shows that the median lethal dose (LD50) is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+)/sgRNA(+) transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.

  7. Expression of bgt gene in transgenic birch (Betula platyphylla Suk ...

    African Journals Online (AJOL)

    Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch plants indicated that the ...

  8. Field performance of transgenic citrus trees: assessment of the long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and phenotypic characteristics.

    Science.gov (United States)

    Pons, Elsa; Peris, Josep E; Peña, Leandro

    2012-07-15

    The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the selectable marker genes that are most

  9. Expression of an osmotin-like protein from Solanum nigrum confers drought tolerance in transgenic soybean.

    Science.gov (United States)

    Weber, Ricardo Luís Mayer; Wiebke-Strohm, Beatriz; Bredemeier, Christian; Margis-Pinheiro, Márcia; de Brito, Giovani Greigh; Rechenmacher, Ciliana; Bertagnolli, Paulo Fernando; de Sá, Maria Eugênia Lisei; Campos, Magnólia de Araújo; de Amorim, Regina Maria Santos; Beneventi, Magda Aparecida; Margis, Rogério; Grossi-de-Sa, Maria Fátima; Bodanese-Zanettini, Maria Helena

    2014-12-10

    Drought is by far the most important environmental factor contributing to yield losses in crops, including soybeans [Glycine max (L.) Merr.]. To address this problem, a gene that encodes an osmotin-like protein isolated from Solanum nigrum var. americanum (SnOLP) driven by the UBQ3 promoter from Arabidopsis thaliana was transferred into the soybean genome by particle bombardment. Two independently transformed soybean lines expressing SnOLP were produced. Segregation analyses indicated single-locus insertions for both lines. qPCR analysis suggested a single insertion of SnOLP in the genomes of both transgenic lines, but one copy of the hpt gene was inserted in the first line and two in the second line. Transgenic plants exhibited no remarkable phenotypic alterations in the seven analyzed generations. When subjected to water deficit, transgenic plants performed better than the control ones. Leaf physiological measurements revealed that transgenic soybean plants maintained higher leaf water potential at predawn, higher net CO2 assimilation rate, higher stomatal conductance and higher transpiration rate than non-transgenic plants. Grain production and 100-grain weight were affected by water supply. Decrease in grain productivity and 100-grain weight were observed for both transgenic and non-transgenic plants under water deficit; however, it was more pronounced for non-transgenic plants. Moreover, transgenic lines showed significantly higher 100-grain weight than non-transgenic plants under water shortage. This is the first report showing that expression of SnOLP in transgenic soybeans improved physiological responses and yield components of plants when subjected to water deficit, highlighting the potential of this gene for biotechnological applications.

  10. Transgene Expression and Repression in Transgenic Rats Bearing the Phosphoenolpyruvate Carboxykinase-Simian Virus 40 T Antigen or the Phosphoenolpyruvate Carboxykinase-Transforming Growth Factor-α Constructs

    Science.gov (United States)

    Haas, Michael J.; Dragan, Yvonne P.; Hikita, Hiroshi; Shimel, Randee; Takimoto, Koichi; Heath, Susan; Vaughan, Jennifer; Pitot, Henry C.

    1999-01-01

    Transgenic Sprague-Dawley rats expressing either human transforming growth factor-α (TGFα) or simian virus 40 large and small T antigen (TAg), each under the control of the phosphoenolpyruvate carboxykinase (PEPCK) promoter, were developed as an approach to the study of the promotion of hepatocarcinogenesis in the presence of a transgene regulatable by diet and/or hormones. Five lines of PEPCK-TGFα transgenic rats were established, each genetic line containing from one to several copies of the transgene per haploid genome. Two PEPCK-TAg transgenic founder rats were obtained, each with multiple copies of the transgene. Expression of the transgene was undetectable in the TGFα transgenic rats and could not be induced when the animals were placed on a high-protein, low-carbohydrate diet. The transgene was found to be highly methylated in all of these lines. No pathological alterations in the liver and intestine were observed at any time (up to 2 years) during the lives of these rats. One line of transgenic rats expressing the PEPCK-TAg transgene developed pancreatic islet cell hyperplasias and carcinomas, with few normal islets evident in the pancreas. This transgene is integrated as a hypomethylated tandem array of 10 to 12 copies on chromosome 8q11. Expression of large T antigen is highest in pancreatic neoplasms, but is also detectable in the normal brain, kidney, and liver. Mortality is most rapid in males, starting at 5 months of age and reaching 100% by 8 months. Morphologically, islet cell differentiation in the tumors ranges from poor to well differentiated, with regions of necrosis and fibrosis. Spontaneous metastasis of TAg-positive tumor cells to regional lymph nodes was observed. These studies indicate the importance of DNA methylation in the repression of specific transgenes in the rat. However, the expression of the PEPCK-TAg induces neoplastic transformation in islet cells, probably late in neuroendocrine cell differentiation. T antigen expression

  11. Lactation Defect in a Widely Used MMTV-Cre Transgenic Line of Mice

    Science.gov (United States)

    Yuan, Taichang; Wang, Yongping; Pao, Lily; Anderson, Steve M.; Gu, Haihua

    2011-01-01

    Background MMTV-Cre mouse lines have played important roles in our understanding about the functions of numerous genes in mouse mammary epithelial cells during mammary gland development and tumorigenesis. However, numerous studies have not included MMTV-Cre mice as controls, and many investigators have not indicated which of the different MMTV-Cre founder lines were used in their studies. Here, we describe a lactation defect that severely limits the use of one of the most commonly used MMTV-Cre founder lines. Methodology/Principal Findings To explore the role of protein tyrosine phosphatase Shp1 in mammary gland development, mice bearing the floxed Shp1 gene were crossed with MMTV-Cre mice and mammary gland development was examined by histological and biochemical techniques, while lactation competency was assessed by monitoring pup growth. Surprisingly, both the Shp1fl/+;MMTV-Cre and MMTV-Cre female mice displayed a severe lactation defect when compared to the Shp1 fl/+ control mice. Histological and biochemical analyses reveal that female mice expressing the MMTV-Cre transgene, either alone or in combination with floxed genes, exhibit defects in lobuloalveolar expansion, presence of large cytoplasmic lipid droplets in luminal alveolar epithelial cells postpartum, and precocious induction of involution. Using a PCR-based genotyping method, the three different founder lines can be distinguished, and we determined that the MMTV-Cre line A, the most widely used MMTV-Cre founder line, exhibits a profound lactation defect that limits its use in studies on mammary gland development. Conclusions/Significance The identification of a lactation defect in the MMTV-Cre line A mice indicates that investigators must use MMTV-Cre alone mice as control in studies that utilize Cre recombinase to excise genes of interest from mammary epithelial cells. Our results also suggest that previous results obtained in studies using the MMTV-Cre line A line should be re-evaluated if the

  12. A wheat calreticulin gene (TaCRT1) contributes to drought tolerance in transgenic arabidopsis

    International Nuclear Information System (INIS)

    Xiang, V.; Du, C.; Jia, H.; Song, M.; Wang, Y.; Ma, Z.

    2018-01-01

    The TaCRT1 gene is a member of calreticulin (CRT) family in wheat. In our previous study, we showed that transgenic tobacco lines over expressing wheat TaCRT1 showed enhanced tolerance to salt stress. This study aimed to determine whether TaCRT1 over expression would increase drought tolerance in transgenic Arabidopsis. Over expression of TaCRT1 in Arabidopsis plants enhances tolerance to drought stress. However, the transgenic line was found to retard the growth. Moreover, the transgenic line showed decreased water loss but higher sensitivity to exogenous abscisic acid (ABA) compared with the wild type (Col-0). Meanwhile, the transgenic line had the elevated endogenous ABA level. The semi-quantitative RT-PCR (sqRT-PCR) analysis showed that transcription levels of ABA-biosynthesizing gene (NCED3) and ABA-responsive gene (ABF3) were higher in the transgenic line than that in the Col-0 under normal condition. The above results implied that the TaCRT1 might be able to used as a potential target to improve the drought tolerance in crops. (author)

  13. Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus.

    Science.gov (United States)

    Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide

    2015-01-01

    Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.

  14. Establishment of a transgenic zebrafish line for superficial skin ablation and functional validation of apoptosis modulators in vivo.

    Directory of Open Access Journals (Sweden)

    Chi-Fang Chen

    Full Text Available BACKGROUND: Zebrafish skin is composed of enveloping and basal layers which form a first-line defense system against pathogens. Zebrafish epidermis contains ionocytes and mucous cells that aid secretion of acid/ions or mucous through skin. Previous studies demonstrated that fish skin is extremely sensitive to external stimuli. However, little is known about the molecular mechanisms that modulate skin cell apoptosis in zebrafish. METHODOLOGY/PRINCIPAL FINDINGS: This study aimed to create a platform to conduct conditional skin ablation and determine if it is possible to attenuate apoptotic stimuli by overexpressing potential apoptosis modulating genes in the skin of live animals. A transgenic zebrafish line of Tg(krt4:NTR-hKikGR(cy17 (killer line, which can conditionally trigger apoptosis in superficial skin cells, was first established. When the killer line was incubated with the prodrug metrodinazole, the superficial skin displayed extensive apoptosis as judged by detection of massive TUNEL- and active caspase 3-positive signals. Great reductions in NTR-hKikGR(+ fluorescent signals accompanied epidermal cell apoptosis. This indicated that NTR-hKikGR(+ signal fluorescence can be utilized to evaluate apoptotic events in vivo. After removal of metrodinazole, the skin integrity progressively recovered and NTR-hKikGR(+ fluorescent signals gradually restored. In contrast, either crossing the killer line with testing lines or transiently injecting the killer line with testing vectors that expressed human constitutive active Akt1, mouse constitutive active Stat3, or HPV16 E6 element displayed apoptosis-resistant phenotypes to cytotoxic metrodinazole as judged by the loss of reduction in NTR-hKikGR(+ fluorescent signaling. CONCLUSION/SIGNIFICANCE: The killer/testing line binary system established in the current study demonstrates a nitroreductase/metrodinazole system that can be utilized to conditionally perform skin ablation in a real-time manner, and

  15. Transgenic Cavendish bananas with resistance to Fusarium wilt tropical race 4.

    Science.gov (United States)

    Dale, James; James, Anthony; Paul, Jean-Yves; Khanna, Harjeet; Smith, Mark; Peraza-Echeverria, Santy; Garcia-Bastidas, Fernando; Kema, Gert; Waterhouse, Peter; Mengersen, Kerrie; Harding, Robert

    2017-11-14

    Banana (Musa spp.) is a staple food for more than 400 million people. Over 40% of world production and virtually all the export trade is based on Cavendish banana. However, Cavendish banana is under threat from a virulent fungus, Fusarium oxysporum f. sp. cubense tropical race 4 (TR4) for which no acceptable resistant replacement has been identified. Here we report the identification of transgenic Cavendish with resistance to TR4. In our 3-year field trial, two lines of transgenic Cavendish, one transformed with RGA2, a gene isolated from a TR4-resistant diploid banana, and the other with a nematode-derived gene, Ced9, remain disease free. Transgene expression in the RGA2 lines is strongly correlated with resistance. Endogenous RGA2 homologs are also present in Cavendish but are expressed tenfold lower than that in our most resistant transgenic line. The expression of these homologs can potentially be elevated through gene editing, to provide non-transgenic resistance.

  16. Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

    Science.gov (United States)

    Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

    2012-10-01

    Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

  17. Generation of FGF reporter transgenic zebrafish and their utility in chemical screens

    Directory of Open Access Journals (Sweden)

    Tsang Michael

    2007-06-01

    Full Text Available Abstract Background Fibroblast Growth Factors (FGFs represent a large family of secreted proteins that are required for proper development and physiological processes. Mutations in mouse and zebrafish FGFs result in abnormal embryogenesis and lethality. A key to understanding the precise role for these factors is to determine their spatial and temporal activity during embryogenesis. Results Expression of Dual Specificity Phosphatase 6 (dusp6, also known as Mkp3 is controlled by FGF signalling throughout development. The Dusp6 promoter was isolated from zebrafish and used to drive expression of destabilized green fluorescent protein (d2EGFP in transgenic embryos (Tg(Dusp6:d2EGFP. Expression of d2EGFP is initiated as early as 4 hours post-fertilization (hpf within the future dorsal region of the embryo, where fgf3 and fgf8 are initially expressed. At later stages, d2EGFP is detected within structures that correlate with the expression of Fgf ligands and their receptors. This includes the mid-hindbrain boundary (MHB, pharyngeal endoderm, otic vesicle, hindbrain, and Kupffer's vesicle. The expression of d2EGFP is under the control of FGF signalling as treatment with FGF Receptor (FGFR inhibitors results in the suppression of d2EGFP expression. In a pilot screen of commercially available small molecules we have evaluated the effectiveness of the transgenic lines to identify specific FGF inhibitors within the class of indolinones. These compounds were counter screened with the transgenic line Tg(Fli1:EGFPy1, that serves as an indirect read-out for Vascular Endothelial Growth Factor (VEGF signalling in order to determine the specificity between related receptor tyrosine kinases (RTKs. From these assays it is possible to determine the specificity of these indolinones towards specific RTK signalling pathways. This has enabled the identification of compounds that can block specifically the VEGFR or the FGFR signalling pathway. Conclusion The generation of

  18. Pyramiding of transgenic Pm3 alleles in wheat results in improved powdery mildew resistance in the field.

    Science.gov (United States)

    Koller, Teresa; Brunner, Susanne; Herren, Gerhard; Hurni, Severine; Keller, Beat

    2018-04-01

    The combined effects of enhanced total transgene expression level and allele-specificity combination in transgenic allele-pyramided Pm3 wheat lines result in improved powdery mildew field resistance without negative pleiotropic effects. Allelic Pm3 resistance genes of wheat confer race-specific resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) and encode nucleotide-binding domain, leucine-rich repeat (NLR) receptors. Transgenic wheat lines overexpressing alleles Pm3a, b, c, d, f, and g have previously been generated by transformation of cultivar Bobwhite and tested in field trials, revealing varying degrees of powdery mildew resistance conferred by the transgenes. Here, we tested four transgenic lines each carrying two pyramided Pm3 alleles, which were generated by crossbreeding of lines transformed with single Pm3 alleles. All four allele-pyramided lines showed strongly improved powdery mildew resistance in the field compared to their parental lines. The improved resistance results from the two effects of enhanced total transgene expression levels and allele-specificity combinations. In contrast to leaf segment tests on greenhouse-grown seedlings, no allelic suppression was observed in the field. Plant development and yield scores of the pyramided lines were similar to the mean scores of the corresponding parental lines, and thus, the allele pyramiding did not cause any negative effects. On the contrary, in pyramided line, Pm3b × Pm3f normal plant development was restored compared to the delayed development and reduced seed set of parental line Pm3f. Allele-specific RT qPCR revealed additive transgene expression levels of the two Pm3 alleles in the pyramided lines. A positive correlation between total transgene expression level and powdery mildew field resistance was observed. In summary, allele pyramiding of Pm3 transgenes proved to be successful in enhancing powdery mildew field resistance.

  19. Transgene x environment interactions in genetically modified wheat.

    Science.gov (United States)

    Zeller, Simon L; Kalinina, Olena; Brunner, Susanne; Keller, Beat; Schmid, Bernhard

    2010-07-12

    The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM) plants. We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology.

  20. Transgene x environment interactions in genetically modified wheat.

    Directory of Open Access Journals (Sweden)

    Simon L Zeller

    Full Text Available BACKGROUND: The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM plants. METHODS AND FINDINGS: We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. CONCLUSIONS: Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology.

  1. The assembly of metals chelation by thiols and vacuolar compartmentalization conferred increased tolerance to and accumulation of cadmium and arsenic in transgenic Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Guo, Jiangbo; Xu, Wenzhong; Ma, Mi

    2012-01-01

    Highlights: ► Simultaneous transformation of AsPCS1 and ScYCF1 into Arabidopsis thaliana which is sensitive to heavy metals, leads to transgenic plants tolerant to Arsenic and cadmium. ► Dual-gene transgenic Arabidopsis showed higher accumulation of Arsenic and cadmium than single and non-transgenic plants. ► Our results proved that improved thiol peptides synthesis and vacuolar compartmentation in plant dramatically boosted the survival rates of plants when exposed to heavy metals. ► A new strategy for efficient phytoremediation of heavy metals by stacking genes transformation in plants was developed in this article. - Abstract: Transgenic Arabidopsis thaliana were developed to increase tolerance for and accumulation of heavy metals and metalloids by simultaneous overexpression of AsPCS1 and YCF1 (derived from garlic and baker's yeast) based on the fact that chelation of metals and vacuolar compartmentalization are the main strategies for heavy metals/metalloids detoxification and tolerance in plants. Dual-gene transgenic lines had the longest roots and the highest accumulation of Cd and As than single-gene transgenic lines and wildtype. When grown on cadmium or arsenic (arsenite/arsenate), Dual-gene transgenic lines accumulated over 2–10 folds cadmium/arsenite and 2–3 folds arsenate than wild type or plants expressing AsPCS1 or YCF1 alone. Such stacking modified genes involved in chelation of toxic metals and vacuolar compartmentalization represents a highly promising new tool for use in phytoremediation efforts.

  2. [Induced expression of Serratia marcescens ribonuclease III gene in transgenic Nicotiana tabacum L. cv. SR1 tobacco plants].

    Science.gov (United States)

    Zhirnov, I V; Trifonova, E A; Romanova, A V; Filipenko, E A; Sapotsky, M V; Malinovsky, V I; Kochetov, A V; Shumny, V K

    2016-11-01

    Transgenic Nicotiana tabacum L. cv. SR1 plants, characterized by an increase in the level of dsRNA-specific hydrolytic activity after induction by wounding, were obtained. The Solanum lycopersicum anionic peroxidase gene promoter (new for plant genetic engineering) was for the first time used for the induced expression of the target Serratia marcescens RNase III gene. Upon infection with the tobacco mosaic virus (TMV), the transgenic plants of the obtained lines did not differ significantly from the control group in the level of TMV capsid protein accumulation. In general, no delay in the development of the infection symptoms was observed in transgenic plants as compared with the control group. The obtained transgenic plants represent a new model for the study of the biological role of endoribonucleases from the RNase III family, including in molecular mechanisms of resistance to pathogens.

  3. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2018-01-09

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  4. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2016-09-06

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  5. RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea.

    Science.gov (United States)

    Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L; Mukherjee, Sunil Kumar; Sahoo, Lingaraj

    2017-01-01

    Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea.

  6. An analysis of representative heating load lines for residential HSPF ratings

    Energy Technology Data Exchange (ETDEWEB)

    Rice, C. Keith [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Shen, Bo [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Shrestha, Som S. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2015-07-01

    This report describes an analysis to investigate representative heating loads for single-family detached homes using current EnergyPlus simulations (DOE 2014a). Hourly delivered load results are used to determine binned load lines using US Department of Energy (DOE) residential prototype building models (DOE 2014b) developed by Pacific Northwest National Laboratory (PNNL). The selected residential single-family prototype buildings are based on the 2006 International Energy Conservation Code (IECC 2006) in the DOE climate regions. The resulting load lines are compared with the American National Standards Institute (ANSI)/Air-Conditioning, Heating, and Refrigeration Institute (AHRI) Standard 210/240 (AHRI 2008) minimum and maximum design heating requirement (DHR) load lines of the heating seasonal performance factor (HSPF) ratings procedure for each region. The results indicate that a heating load line closer to the maximum DHR load line, and with a lower zero load ambient temperature, is more representative of heating loads predicted for EnergyPlus prototype residential buildings than the minimum DHR load line presently used to determine HSPF ratings. An alternative heating load line equation was developed and compared to binned load lines obtained from the EnergyPlus simulation results. The effect on HSPF of the alternative heating load line was evaluated for single-speed and two-capacity heat pumps, and an average HSPF reduction of 16% was found. The alternative heating load line relationship is tied to the rated cooling capacity of the heat pump based on EnergyPlus autosizing, which is more representative of the house load characteristics than the rated heating capacity. The alternative heating load line equation was found to be independent of climate for the six DOE climate regions investigated, provided an adjustable zero load ambient temperature is used. For Region IV, the default DOE climate region used for HSPF ratings, the higher load line results in an ~28

  7. An α-smooth muscle actin (acta2/αsma zebrafish transgenic line marking vascular mural cells and visceral smooth muscle cells.

    Directory of Open Access Journals (Sweden)

    Thomas R Whitesell

    Full Text Available Mural cells of the vascular system include vascular smooth muscle cells (SMCs and pericytes whose role is to stabilize and/or provide contractility to blood vessels. One of the earliest markers of mural cell development in vertebrates is α smooth muscle actin (acta2; αsma, which is expressed by pericytes and SMCs. In vivo models of vascular mural cell development in zebrafish are currently lacking, therefore we developed two transgenic zebrafish lines driving expression of GFP or mCherry in acta2-expressing cells. These transgenic fish were used to trace the live development of mural cells in embryonic and larval transgenic zebrafish. acta2:EGFP transgenic animals show expression that largely mirrors native acta2 expression, with early pan-muscle expression starting at 24 hpf in the heart muscle, followed by skeletal and visceral muscle. At 3.5 dpf, expression in the bulbus arteriosus and ventral aorta marks the first expression in vascular smooth muscle. Over the next 10 days of development, the number of acta2:EGFP positive cells and the number of types of blood vessels associated with mural cells increases. Interestingly, the mural cells are not motile and remain in the same position once they express the acta2:EGFP transgene. Taken together, our data suggests that zebrafish mural cells develop relatively late, and have little mobility once they associate with vessels.

  8. Chitinase activities, scab resistance, mycorrhization rates and biomass of own-rooted and grafted transgenic apple

    Directory of Open Access Journals (Sweden)

    Tina Schäfer

    2012-01-01

    Full Text Available This study investigated the impact of constitutively expressed Trichoderma atroviride genes encoding exochitinase nag70 or endochitinase ech42 in transgenic lines of the apple cultivar Pinova on the symbiosis with arbuscular mycorrhizal fungi (AMF. We compared the exo- and endochitinase activities of leaves and roots from non-transgenic Pinova and the transgenic lines T386 and T389. Local and systemic effects were examined using own-rooted trees and trees grafted onto rootstock M9. Scab susceptibility was also assessed in own-rooted and grafted trees. AMF root colonization was assessed microscopically in the roots of apple trees cultivated in pots with artificial substrate and inoculated with the AMF Glomus intraradices and Glomus mosseae. Own-rooted transgenic lines had significantly higher chitinase activities in their leaves and roots compared to non-transgenic Pinova. Both of the own-rooted transgenic lines showed significantly fewer symptoms of scab infection as well as significantly lower root colonization by AMF. Biomass production was significantly reduced in both own-rooted transgenic lines. Rootstock M9 influenced chitinase activities in the leaves of grafted scions. When grafted onto M9, the leaf chitinase activities of non-transgenic Pinova (M9/Pinova and transgenic lines (M9/T386 and M9/T389 were not as different as when grown on their own roots. M9/T386 and M9/T389 were only temporarily less infected by scab than M9/Pinova. M9/T386 and M9/T389 did not differ significantly from M9/Pinova in their root chitinase activities, AMF root colonization and biomass.

  9. The Relationship between Insect Resistance and Tree Age of Transgenic Triploid Populus tomentosa Plants.

    Science.gov (United States)

    Ren, Yachao; Zhang, Jun; Wang, Guiying; Liu, Xiaojie; Li, Li; Wang, Jinmao; Yang, Minsheng

    2018-01-01

    To explore the stability of insect resistance during the development of transgenic insect-resistant trees, this study investigated how insect resistance changes as transgenic trees age. We selected 19 transgenic insect-resistant triploid Populus tomentosa lines as plant material. The presence of exogenous genes and Cry1Ac protein expression were verified using polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) analyses. The toxicity for Clostera anachoreta and Lymantria dispar was evaluated by feeding fresh leaves to first instar larvae after the trees were planted in the field for 2 years and after the sixth year. Results of PCR showed that the exogenous genes had a long-term presence in the poplar genome. ELISA analyses showed significant differences existed on the 6-year-old transgenic lines. The insect-feeding experiment demonstrated significant differences in the mortality rates of C. anachoreta and L. dispar among different transgenic lines. The average corrected mortality rates of C. anachoreta and L. dispar ranged from 5.6-98.7% to 35.4-7.2% respectively. The larval mortality rates differed significantly between the lines at different ages. Up to 52.6% of 1-year-old transgenic lines and 42.1% of 2-year-old transgenic lines caused C. anachoreta larval mortality rates to exceed 80%, whereas only 26.3% of the 6-year-old transgenic lines. The mortality rates of L. dispar exhibited the same trend: 89.5% of 1-year-old transgenic lines and 84.2% of 2-year-old transgenic lines caused L. dispar larval mortality rates to exceed 80%; this number decreased to 63.2% for the 6-year-old plants. The proportion of 6-year-old trees with over 80% larval mortality rates was clearly lower than that of the younger trees. The death distribution of C. anachoreta in different developmental stages also showed the larvae that fed on the leaves of 1-year-old trees were killed mostly during L 1 and L 2 stages, whereas the proportion of larvae that died in L 3

  10. Enhanced virus resistance in transgenic maize expressing a dsRNA-specific endoribonuclease gene from E. coli.

    Directory of Open Access Journals (Sweden)

    Xiuling Cao

    Full Text Available Maize rough dwarf disease (MRDD, caused by several Fijiviruses in the family Reoviridae, is a global disease that is responsible for substantial yield losses in maize. Although some maize germplasm have low levels of polygenic resistance to MRDD, highly resistant cultivated varieties are not available for agronomic field production in China. In this work, we have generated transgenic maize lines that constitutively express rnc70, a mutant E. coli dsRNA-specific endoribonuclease gene. Transgenic lines were propagated and screened under field conditions for 12 generations. During three years of evaluations, two transgenic lines and their progeny were challenged with Rice black-streaked dwarf virus (RBSDV, the causal agent of MRDD in China, and these plants exhibited reduced levels of disease severity. In two normal years of MRDD abundance, both lines were more resistant than non-transgenic plants. Even in the most serious MRDD year, six out of seven progeny from one line were resistant, whereas non-transgenic plants were highly susceptible. Molecular approaches in the T12 generation revealed that the rnc70 transgene was integrated and expressed stably in transgenic lines. Under artificial conditions permitting heavy virus inoculation, the T12 progeny of two highly resistant lines had a reduced incidence of MRDD and accumulation of RBSDV in infected plants. In addition, we confirmed that the RNC70 protein could bind directly to RBSDV dsRNA in vitro. Overall, our data show that RNC70-mediated resistance in transgenic maize can provide efficient protection against dsRNA virus infection.

  11. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    Science.gov (United States)

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.

  12. Complex genomic rearrangement in CCS-LacZ transgenic mice.

    Science.gov (United States)

    Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

    2007-02-01

    The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

  13. Bt-transgenic oilseed rape hybridization with its weedy relative, Brassica rapa.

    Science.gov (United States)

    Halfhill, Matthew D; Millwood, Reginald J; Raymer, Paul L; Stewart, C Neal

    2002-10-01

    The movement of transgenes from crops to weeds and the resulting consequences are concerns of modern agriculture. The possible generation of "superweeds" from the escape of fitness-enhancing transgenes into wild populations is a risk that is often discussed, but rarely studied. Oilseed rape, Brassica napus (L.), is a crop with sexually compatible weedy relatives, such as birdseed rape (Brassica rapa (L.)). Hybridization of this crop with weedy relatives is an extant risk and an excellent interspecific gene flow model system. In laboratory crosses, T3 lines of seven independent transformation events of Bacillus thuringiensis (Bt) oilseed rape were hybridized with two weedy accessions of B. rapa. Transgenic hybrids were generated from six of these oilseed rape lines, and the hybrids exhibited an intermediate morphology between the parental species. The Bt transgene was present in the hybrids, and the protein was synthesized at similar levels to the corresponding independent oilseed rape lines. Insect bioassays were performed and confirmed that the hybrid material was insecticidal. The hybrids were backcrossed with the weedy parent, and only half the oilseed rape lines were able to produce transgenic backcrosses. After two backcrosses, the ploidy level and morphology of the resultant plants were indistinguishable from B. rapa. Hybridization was monitored under field conditions (Tifton, GA, USA) with four independent lines of Bt oilseed rape with a crop to wild relative ratio of 1200:1. When B. rapa was used as the female parent, hybridization frequency varied among oilseed rape lines and ranged from 16.9% to 0.7%.

  14. Germline transgenic pigs by Sleeping Beauty transposition in porcine zygotes and targeted integration in the pig genome.

    Directory of Open Access Journals (Sweden)

    Wiebke Garrels

    Full Text Available Genetic engineering can expand the utility of pigs for modeling human diseases, and for developing advanced therapeutic approaches. However, the inefficient production of transgenic pigs represents a technological bottleneck. Here, we assessed the hyperactive Sleeping Beauty (SB100X transposon system for enzyme-catalyzed transgene integration into the embryonic porcine genome. The components of the transposon vector system were microinjected as circular plasmids into the cytoplasm of porcine zygotes, resulting in high frequencies of transgenic fetuses and piglets. The transgenic animals showed normal development and persistent reporter gene expression for >12 months. Molecular hallmarks of transposition were confirmed by analysis of 25 genomic insertion sites. We demonstrate germ-line transmission, segregation of individual transposons, and continued, copy number-dependent transgene expression in F1-offspring. In addition, we demonstrate target-selected gene insertion into transposon-tagged genomic loci by Cre-loxP-based cassette exchange in somatic cells followed by nuclear transfer. Transposase-catalyzed transgenesis in a large mammalian species expands the arsenal of transgenic technologies for use in domestic animals and will facilitate the development of large animal models for human diseases.

  15. Design and Management of Field Trials of Transgenic Cereals

    Science.gov (United States)

    Bedő, Zoltán; Rakszegi, Mariann; Láng, László

    The development of gene transformation systems has allowed the introgression of alien genes into plant genomes, thus providing a mechanism for broadening the genetic resources available to plant breeders. The design and the management of field trials vary according to the purpose for which transgenic cereals are developed. Breeders study the phenotypic and genotypic stability of transgenic plants, monitor the increase in homozygosity of transgenic genotypes under field conditions, and develop backcross generations to transfer the introduced genes into secondary transgenic cereal genotypes. For practical purposes, they may also multiply seed of the transgenic lines to produce sufficient amounts of grain for the detailed analysis of trait(s) of interest, to determine the field performance of transgenic lines, and to compare them with the non-transformed parental genotypes. Prior to variety registration, the Distinctness, Uniformity and Stability (DUS) tests and Value for Cultivation and Use (VCU) experiments are carried out in field trials. Field testing includes specific requirements for transgenic cereals to assess potential environmental risks. The capacity of the pollen to survive, establish and disseminate in the field test environment, the potential for gene transfer, the effects of products expressed by the introduced sequences and phenotypic and genotypic instability that might cause deleterious effects must all be specifically monitored, as required by EU Directives 2003/701/EC (1) on the release of genetically modified higher plants in the environment.

  16. The assembly of metals chelation by thiols and vacuolar compartmentalization conferred increased tolerance to and accumulation of cadmium and arsenic in transgenic Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Jiangbo [Key Laboratory of Plant Resources, Institute of Botany, The Chinese Academy of Sciences, Beijing 100093 (China); Inner Mongolia Key Laboratory of Biomass-Energy Conversion, The Institute of Bioengineering and Technology, Inner Mongolia University of Science and Technology, Baotou 040100 (China); Xu, Wenzhong [Key Laboratory of Plant Resources, Institute of Botany, The Chinese Academy of Sciences, Beijing 100093 (China); Ma, Mi, E-mail: mami@ibcas.ac.cn [Key Laboratory of Plant Resources, Institute of Botany, The Chinese Academy of Sciences, Beijing 100093 (China)

    2012-01-15

    Highlights: Black-Right-Pointing-Pointer Simultaneous transformation of AsPCS1 and ScYCF1 into Arabidopsis thaliana which is sensitive to heavy metals, leads to transgenic plants tolerant to Arsenic and cadmium. Black-Right-Pointing-Pointer Dual-gene transgenic Arabidopsis showed higher accumulation of Arsenic and cadmium than single and non-transgenic plants. Black-Right-Pointing-Pointer Our results proved that improved thiol peptides synthesis and vacuolar compartmentation in plant dramatically boosted the survival rates of plants when exposed to heavy metals. Black-Right-Pointing-Pointer A new strategy for efficient phytoremediation of heavy metals by stacking genes transformation in plants was developed in this article. - Abstract: Transgenic Arabidopsis thaliana were developed to increase tolerance for and accumulation of heavy metals and metalloids by simultaneous overexpression of AsPCS1 and YCF1 (derived from garlic and baker's yeast) based on the fact that chelation of metals and vacuolar compartmentalization are the main strategies for heavy metals/metalloids detoxification and tolerance in plants. Dual-gene transgenic lines had the longest roots and the highest accumulation of Cd and As than single-gene transgenic lines and wildtype. When grown on cadmium or arsenic (arsenite/arsenate), Dual-gene transgenic lines accumulated over 2-10 folds cadmium/arsenite and 2-3 folds arsenate than wild type or plants expressing AsPCS1 or YCF1 alone. Such stacking modified genes involved in chelation of toxic metals and vacuolar compartmentalization represents a highly promising new tool for use in phytoremediation efforts.

  17. Generation of an ABCG2GFPn-puro transgenic line - A tool to study ABCG2 expression in mice

    International Nuclear Information System (INIS)

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen; Malas, Stavros

    2009-01-01

    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  18. Production of transgenic brassica juncea with the synthetic chitinase gene (nic) conferring resistance to alternaria brassicicola

    International Nuclear Information System (INIS)

    Munir, I.; Hussan, W.; Kazi, M.; Mian, A.

    2016-01-01

    Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)

  19. High blood pressure in transgenic mice carrying the rat angiotensinogen gene.

    Science.gov (United States)

    Kimura, S; Mullins, J J; Bunnemann, B; Metzger, R; Hilgenfeldt, U; Zimmermann, F; Jacob, H; Fuxe, K; Ganten, D; Kaling, M

    1992-01-01

    Transgenic mice were generated by injecting the entire rat angiotensinogen gene into the germline of NMRI mice. The resulting transgenic animals were characterized with respect to hemodynamics, parameters of the renin angiotension system, and expression of the transgene. The transgenic line TGM(rAOGEN)123 developed hypertension with a mean arterial blood pressure of 158 mmHg in males and 132 mmHg in females. In contrast, the transgenic line TGM(rAOGEN)92 was not hypertensive. Rat angiotensinogen was detectable only in plasma of animals of line 123. Total plasma angiotensinogen and plasma angiotensin II concentrations were about three times as high as those of negative control mice. In TGM(rAOGEN)123 the transgene was highly expressed in liver and brain. Transcripts were also detected in heart, kidney and testis. In TGM(rAOGEN)92 the brain was the main expressing organ. In situ hybridization revealed an mRNA distribution in the brain of TGM(rAOGEN)123 similar to the one in rat. In TGM(rAOGEN)92 the expression pattern in the brain was aberrant. These data indicate that overexpression of the angiotensinogen gene in liver and brain leads to the development of hypertension in transgenic mice. The TGM(rAOGEN)123 constitutes a high angiotensin II type of hypertension and may provide a new experimental animal model to study the kinetics and function of the renin angiotensin system. Images PMID:1547785

  20. Untranslatable tospoviral NSs fragment coupled with L conserved region enhances transgenic resistance against the homologous virus and a serologically unrelated tospovirus.

    Science.gov (United States)

    Yazhisai, Uthaman; Rajagopalan, Prem Anand; Raja, Joseph A J; Chen, Tsung-Chi; Yeh, Shyi-Dong

    2015-08-01

    Tospoviruses cause severe damages to important crops worldwide. In this study, Nicotiana benthamiana transgenic lines carrying individual untranslatable constructs comprised of the conserved region of the L gene (denoted as L), the 5' half of NSs coding sequence (NSs) or the antisense fragment of whole N coding sequence (N) of Watermelon silver mottle virus (WSMoV), individually or in combination, were generated. A total of 15-17 transgenic N. benthamiana lines carrying individual transgenes were evaluated against WSMoV and the serologically unrelated Tomato spotted wilt virus (TSWV). Among lines carrying single or chimeric transgenes, the level of resistance ranged from susceptible to completely resistant against WSMoV. From the lines carrying individual transgenes and highly resistant to WSMoV (56-63% of lines assayed), 30% of the L lines (3/10 lines assayed) and 11% of NSs lines (1/9 lines assayed) were highly resistant against TSWV. The chimeric transgenes provided higher degrees of resistance against WSMoV (80-88%), and the NSs fragment showed an additive effect to enhance the resistance to TSWV. Particularly, the chimeric transgenes with the triple combination of fragments, namely L/NSs/N or HpL/NSs/N (a hairpin construct), provided a higher degree of resistance (both 50%, with 7/14 lines assayed) against TSWV. Our results indicate that the untranslatable NSs fragment is able to enhance the transgenic resistance conferred by the L conserved region. The better performance of L/NSs/N and HpL/NSs/N in transgenic N. benthamiana lines suggests their potential usefulness in generating high levels of enhanced transgenic resistance against serologically unrelated tospoviruses in agronomic crops.

  1. Split-Cre complementation restores combination activity on transgene excision in hair roots of transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Mengling Wen

    Full Text Available The Cre/loxP system is increasingly exploited for genetic manipulation of DNA in vitro and in vivo. It was previously reported that inactive ''split-Cre'' fragments could restore Cre activity in transgenic mice when overlapping co-expression was controlled by two different promoters. In this study, we analyzed recombination activities of split-Cre proteins, and found that no recombinase activity was detected in the in vitro recombination reaction in which only the N-terminal domain (NCre of split-Cre protein was expressed, whereas recombination activity was obtained when the C-terminal (CCre or both NCre and CCre fragments were supplied. We have also determined the recombination efficiency of split-Cre proteins which were co-expressed in hair roots of transgenic tobacco. No Cre recombination event was observed in hair roots of transgenic tobacco when the NCre or CCre genes were expressed alone. In contrast, an efficient recombination event was found in transgenic hairy roots co-expressing both inactive split-Cre genes. Moreover, the restored recombination efficiency of split-Cre proteins fused with the nuclear localization sequence (NLS was higher than that of intact Cre in transgenic lines. Thus, DNA recombination mediated by split-Cre proteins provides an alternative method for spatial and temporal regulation of gene expression in transgenic plants.

  2. Testing Transgenic Aspen Plants with bar Gene for Herbicide Resistance under Semi-natural Conditions.

    Science.gov (United States)

    Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I

    2016-01-01

    Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity.

  3. Monitoring changes in anthocyanin and steroid alkaloid glycoside content in lines of transgenic potato plants using liquid chromatography/mass spectrometry.

    Science.gov (United States)

    Stobiecki, Maciej; Matysiak-Kata, Iwona; Frański, Rafał; Skała, Jacek; Szopa, Jan

    2003-03-01

    Transgenic potato plants overexpressing and repressing enzymes of flavonoids biosynthesis were created and analyzed. The selected plants clearly showed the expected changes in anthocyanins synthesis level. Overexpression of a DNA encoding dihydroflavonol 4-reductase (DFR) in sense orientation resulted in an increase in tuber anthocyanins, a 4-fold increase in petunidin and pelargonidin derivatives. A significant decrease in anthocyanin level was observed when the plant was transformed with a corresponding antisense construct. The transformation of potato plants was also accompanied by significant changes in steroid alkaloid glycosides (SAG) level in transgenic potato tuber. The changes in SAGs content was not dependent on flavonoid composition in transgenic potato. However, in an extreme situation where the highest (DFR11) or the lowest (DFRa3) anthocyanin level was detected the positive correlation with steroid alkaloid content was clearly visible. It is suggested that the changes in SAGs content resulted from chromatin stressed upon transformation. A liquid chromatography/mass spectrometry (LC/MS) system with electrospray ionization was applied for profiling qualitative and quantitative changes of steroid alkaloid glycosides in tubers of twelve lines of transgenic potato plants. Except alpha-chaconine and alpha-solanine, in the extracts from dried tuber skin alpha-solamargine and alpha-solasonine, triglycosides of solasonine, were identified in minor amounts, triglycosides of solanidine dehydrodimers were also recognized.

  4. Handling of human short-chain acyl-CoA dehydrogenase (SCAD) variant proteins in transgenic mice

    DEFF Research Database (Denmark)

    Kragh, Peter M; Pedersen, Christina B; Schmidt, Stine P

    2007-01-01

    Abstract To investigate the in vivo handling of human short-chain acyl-CoA dehydrogenase (SCAD) variant proteins, three transgenic mouse lines were produced by pronuclear injection of cDNA encoding the wild-type, hSCAD-wt, and two disease causing folding variants hSCAD-319C > T and hSCAD-625G > A....... The transgenic mice were mated with an SCAD-deficient mouse strain (BALB/cByJ) and, in the second generation, three mouse lines were obtained without endogenous SCAD expression but harboring hSCAD-wt, hSCAD-319C > T, and hSCAD-625G > A transgenes, respectively. All three lines had expression of the transgene...... developed for any of the lines transgenic for the hSCAD folding variants. The indicated remarkable efficiency of the mouse protein quality control system in the degradation of SCAD folding variants should be further substantiated and investigated, since it might indicate ways to prevent disease...

  5. Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

    Science.gov (United States)

    Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

    2013-11-01

    Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

  6. ZyFISH: a simple, rapid and reliable zygosity assay for transgenic mice.

    Directory of Open Access Journals (Sweden)

    Donal McHugh

    Full Text Available Microinjection of DNA constructs into fertilized mouse oocytes typically results in random transgene integration at a single genomic locus. The resulting transgenic founders can be used to establish hemizygous transgenic mouse lines. However, practical and experimental reasons often require that such lines be bred to homozygosity. Transgene zygosity can be determined by progeny testing assays which are expensive and time-consuming, by quantitative Southern blotting which is labor-intensive, or by quantitative PCR (qPCR which requires transgene-specific design. Here, we describe a zygosity assessment procedure based on fluorescent in situ hybridization (zyFISH. The zyFISH protocol entails the detection of transgenic loci by FISH and the concomitant assignment of homozygosity using a concise and unbiased scoring system. The method requires small volumes of blood, is scalable to at least 40 determinations per assay, and produces results entirely consistent with the progeny testing assay. This combination of reliability, simplicity and cost-effectiveness makes zyFISH a method of choice for transgenic mouse zygosity determinations.

  7. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster

    Science.gov (United States)

    Lin, Chun-Chieh; Potter, Christopher J.

    2016-01-01

    Gene conversions occur when genomic double-strand DNA breaks (DSBs) trigger unidirectional transfer of genetic material from a homologous template sequence. Exogenous or mutated sequence can be introduced through this homology-directed repair (HDR). We leveraged gene conversion to develop a method for genomic editing of existing transgenic insertions in Drosophila melanogaster. The clustered regularly-interspaced palindromic repeats (CRISPR)/Cas9 system is used in the homology assisted CRISPR knock-in (HACK) method to induce DSBs in a GAL4 transgene, which is repaired by a single-genomic transgenic construct containing GAL4 homologous sequences flanking a T2A-QF2 cassette. With two crosses, this technique converts existing GAL4 lines, including enhancer traps, into functional QF2 expressing lines. We used HACK to convert the most commonly-used GAL4 lines (labeling tissues such as neurons, fat, glia, muscle, and hemocytes) to QF2 lines. We also identified regions of the genome that exhibited differential efficiencies of HDR. The HACK technique is robust and readily adaptable for targeting and replacement of other genomic sequences, and could be a useful approach to repurpose existing transgenes as new genetic reagents become available. PMID:27334272

  8. Nucleocapsid Gene-Mediated Transgenic Resistance Provides Protection Against Tomato spotted wilt virus Epidemics in the Field.

    Science.gov (United States)

    Herrero, S; Culbreath, A K; Csinos, A S; Pappu, H R; Rufty, R C; Daub, M E

    2000-02-01

    ABSTRACT Transformation of plants with the nucleocapsid (N) gene of Tomato spotted wilt tospovirus (TSWV) provides resistance to disease development; however, information is lacking on the response of plants to natural inoculum in the field. Three tobacco cultivars were transformed with the N gene of a dahlia isolate of TSWV (TSWV-D), and plants were evaluated over several generations in the greenhouse. The resistant phenotype was more frequently observed in 'Burley 21' than in 'KY-14' or 'K-326', but highly resistant 'Burley 21' transgenic lines were resistant to only 44% of the heterologous TSWV isolates tested. Advanced generation (R(3) and R(4)) transgenic resistant lines of 'Burley 21' and a 'K-326' F(1) hybrid containing the N genes of two TSWV isolates were evaluated in the field near Tifton, GA, where TSWV is endemic. Disease development was monitored by symptom expression and enzyme-linked immunosorbent assay (ELISA) analysis. Whereas incidence of TSWV infection in 'Burley 21' susceptible controls was 20% in 1996 and 62% in 1997, the mean incidence in transgenic lines was reduced to 4 and 31%, respectively. Three transgenic 'Burley 21' lines were identified that had significantly lower incidence of disease than susceptible controls over the two years of the study. In addition, the rate of disease increase at the onset of the 1997 epidemic was reduced for all the 'Burley 21' transgenic lines compared with the susceptible controls. The 'K-326' F(1) hybrid was as susceptible as the 'K-326' nontransformed control. ELISA analysis demonstrated that symptomless plants from the most resistant 'Burley 21' transgenic lines accumulated detectable nucleocapsid protein, whereas symptomless plants from more susceptible lines did not. We conclude that transgenic resistance to TSWV is effective in reducing incidence of the disease in the field, and that accumulation of transgene protein may be important in broad-spectrum resistance.

  9. Accurate measure of transgene copy number in crop plants using droplet digital PCR

    Science.gov (United States)

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...

  10. Efficient genetic transformation of okra (Abelmoschus esculentus (L.) Moench) and generation of insect-resistant transgenic plants expressing the cry1Ac gene.

    Science.gov (United States)

    Narendran, M; Deole, Satish G; Harkude, Satish; Shirale, Dattatray; Nanote, Asaram; Bihani, Pankaj; Parimi, Srinivas; Char, Bharat R; Zehr, Usha B

    2013-08-01

    Agrobacterium -mediated transformation system for okra using embryos was devised and the transgenic Bt plants showed resistance to the target pest, okra shoot, and fruit borer ( Earias vittella ). Okra is an important vegetable crop and progress in genetic improvement via genetic transformation has been impeded by its recalcitrant nature. In this paper, we describe a procedure using embryo explants for Agrobacterium-mediated transformation and tissue culture-based plant regeneration for efficient genetic transformation of okra. Twenty-one transgenic okra lines expressing the Bacillus thuringiensis gene cry1Ac were generated from five transformation experiments. Molecular analysis (PCR and Southern) confirmed the presence of the transgene and double-antibody sandwich ELISA analysis revealed Cry1Ac protein expression in the transgenic plants. All 21 transgenic plants were phenotypically normal and fertile. T1 generation plants from these lines were used in segregation analysis of the transgene. Ten transgenic lines were selected randomly for Southern hybridization and the results confirmed the presence of transgene integration into the genome. Normal Mendelian inheritance (3:1) of cry1Ac gene was observed in 12 lines out of the 21 T0 lines. We selected 11 transgenic lines segregating in a 3:1 ratio for the presence of one transgene for insect bioassays using larvae of fruit and shoot borer (Earias vittella). Fruit from seven transgenic lines caused 100 % larval mortality. We demonstrate an efficient transformation system for okra which will accelerate the development of transgenic okra with novel agronomically useful traits.

  11. Arabidopsis EF-Tu receptor enhances bacterial disease resistance in transgenic wheat.

    Science.gov (United States)

    Schoonbeek, Henk-Jan; Wang, Hsi-Hua; Stefanato, Francesca L; Craze, Melanie; Bowden, Sarah; Wallington, Emma; Zipfel, Cyril; Ridout, Christopher J

    2015-04-01

    Perception of pathogen (or microbe)-associated molecular patterns (PAMPs/MAMPs) by pattern recognition receptors (PRRs) is a key component of plant innate immunity. The Arabidopsis PRR EF-Tu receptor (EFR) recognizes the bacterial PAMP elongation factor Tu (EF-Tu) and its derived peptide elf18. Previous work revealed that transgenic expression of AtEFR in Solanaceae confers elf18 responsiveness and broad-spectrum bacterial disease resistance. In this study, we developed a set of bioassays to study the activation of PAMP-triggered immunity (PTI) in wheat. We generated transgenic wheat (Triticum aestivum) plants expressing AtEFR driven by the constitutive rice actin promoter and tested their response to elf18. We show that transgenic expression of AtEFR in wheat confers recognition of elf18, as measured by the induction of immune marker genes and callose deposition. When challenged with the cereal bacterial pathogen Pseudomonas syringae pv. oryzae, transgenic EFR wheat lines had reduced lesion size and bacterial multiplication. These results demonstrate that AtEFR can be transferred successfully from dicot to monocot species, further revealing that immune signalling pathways are conserved across these distant phyla. As novel PRRs are identified, their transfer between plant families represents a useful strategy for enhancing resistance to pathogens in crops. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  12. Transgenic mosquitoes expressing a phospholipase A(2 gene have a fitness advantage when fed Plasmodium falciparum-infected blood.

    Directory of Open Access Journals (Sweden)

    Ryan C Smith

    Full Text Available Genetically modified mosquitoes have been proposed as an alternative strategy to reduce the heavy burden of malaria. In recent years, several proof-of-principle experiments have been performed that validate the idea that mosquitoes can be genetically modified to become refractory to malaria parasite development.We have created two transgenic lines of Anophelesstephensi, a natural vector of Plasmodium falciparum, which constitutively secrete a catalytically inactive phospholipase A2 (mPLA2 into the midgut lumen to interfere with Plasmodium ookinete invasion. Our experiments show that both transgenic lines expressing mPLA2 significantly impair the development of rodent malaria parasites, but only one line impairs the development of human malaria parasites. In addition, when fed on malaria-infected blood, mosquitoes from both transgenic lines are more fecund than non-transgenic mosquitoes. Consistent with these observations, cage experiments with mixed populations of transgenic and non-transgenic mosquitoes show that the percentage of transgenic mosquitoes increases when maintained on Plasmodium-infected blood.Our results suggest that the expression of an anti-Plasmodium effector gene gives transgenic mosquitoes a fitness advantage when fed malaria-infected blood. These findings have important implications for future applications of transgenic mosquito technology in malaria control.

  13. Gene flow from transgenic common beans expressing the bar gene.

    Science.gov (United States)

    Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L

    2010-01-01

    Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium.

  14. Generation of an ABCG2{sup GFPn-puro} transgenic line - A tool to study ABCG2 expression in mice

    Energy Technology Data Exchange (ETDEWEB)

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Malas, Stavros, E-mail: smalas@cing.ac.cy [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Department of Biological Sciences, University of Cyprus, P.O. Box 20537, 1678 Nicosia (Cyprus)

    2009-06-26

    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  15. Post-mortem re-cloning of a transgenic red fluorescent protein dog.

    Science.gov (United States)

    Hong, So Gun; Koo, Ok Jae; Oh, Hyun Ju; Park, Jung Eun; Kim, Minjung; Kim, Geon-A; Park, Eun Jung; Jang, Goo; Lee, Byeong-Chun

    2011-12-01

    Recently, the world's first transgenic dogs were produced by somatic cell nuclear transfer. However, cellular senescence is a major limiting factor for producing more advanced transgenic dogs. To overcome this obstacle, we rejuvenated transgenic cells using a re-cloning technique. Fibroblasts from post-mortem red fluorescent protein (RFP) dog were reconstructed with in vivo matured oocytes and transferred into 10 surrogate dogs. One puppy was produced and confirmed as a re-cloned dog. Although the puppy was lost during birth, we successfully established a rejuvenated fibroblast cell line from this animal. The cell line was found to stably express RFP and is ready for additional genetic modification.

  16. Expression of Recombinant Human Alpha-Lactalbumin in the Milk of Transgenic Goats Using a Hybrid Pomoter/Enhancer

    Directory of Open Access Journals (Sweden)

    Yu-Guo Yuan

    2014-01-01

    Full Text Available To improve nutrient content of goat milk, we describe the construction of a vector (pBLAC containing a hybrid goat β-lactoglobulin (BLG promoter/cytomegalovirus (CMV enhancer. We also describe the generation of transgenic goats expressing rhLA by somatic cell nuclear transfer (SCNT. Of 334 one-cell stage embryos derived from three transgenic cell lines and 99 embryos derived from non-transgenic (NT cells surgically transferred to the oviducts of 37 recipients, two recipients delivered two kids (2% from the non-transfected line and five recipients delivered six kids (1.8% from transgenic cell lines, three of which died within 2 days. Compared to the NT donor cells, transfection of donor cells does not negatively affect the development of nuclear transfer embryos into viable transgenic offspring. However, the clone efficiency in cell line number 1 was lower than that in numbers 2 and 3, and in the NT lines (0.9% versus 1.9% 2.4% and 2%; P<0.05. Two transgenic cloned goats expressed rhLA in the milk at 0.1–0.9 mg/mL. The mammary gland-specific expression vector pBLAC with hybrid BLG/CMV can drive the hLA gene to express in vitro and in vivo. These data establish the basis for use of a hybrid promoter/enhancer strategy to produce rhLA transgenic goats.

  17. Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.

    Science.gov (United States)

    Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di

    2015-07-01

    The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  18. Transgenic modification of potato pectic polysaccharides also affects type and level of cell wall xyloglucan

    NARCIS (Netherlands)

    Huang, Jie Hong; Jiang, Rui; Kortstee, Anne; Dees, Dianka C.T.; Trindade, Luisa M.; Gruppen, Harry; Schols, Henk A.

    2017-01-01

    BACKGROUND: Genes encoding pectic enzymes were introduced into wild-type potato Karnico. Cell wall materials were extracted from Karnico and transgenic lines expressing β-galactosidase (β-Gal-14) or rhamnogalacturonan lyase (RGL-18). Pectic polysaccharides from the β-Gal-14 transgenic line exhibited

  19. Effects of seed mixture sowing with transgenic Bt rice and its parental line on the population dynamics of target stemborers and leafrollers, and non-target planthoppers.

    Science.gov (United States)

    Li, Zhuo; Li, Li-Kun; Liu, Bin; Wang, Long; Parajulee, Megha N; Chen, Fa-Jun

    2018-01-24

    The widespread planting of insect-resistant crops has caused a dramatic shift in agricultural landscapes, thus raising concerns about the potential impacts on both target and non-target pests. In this study, we examined the potential effects of intra-specific seed mixture sowing with transgenic Bt rice (Bt) and its parental non-transgenic line (Nt) (100% Bt rice [Bt 100 ], 5% Nt+95% Bt [Nt 05 Bt 95 ], 10% Nt+90% Bt [Nt 10 Bt 90 ], 20% Nt+80% Bt [Nt 20 Bt 80 ], 40% Nt+60% Bt [Nt 40 Bt 60 ] and 100% Nt rice [Nt 100 ]) on target and non-target pests in a 2-year field trial in southern China. The occurrence of target pests, Sesamia inferens, Chilo suppressalis and Cnaphalocrocis medinalis, decreased with the increased ratio of Bt rice, and the mixture ratios with more than 90% Bt rice (Bt 100 and Nt 05 Bt 95 ) significantly increased the pest suppression efficiency, with the lowest occurrences of non-target planthoppers, Nilaparvata lugens and Sogatella furcifera in Nt 100 and Nt 05 Bt 95 . Furthermore, there were no significant differences in 1000-grain dry weight and grain dry weight per 100 plants between Bt 100 and Nt 05 Bt 95 . Seed mixture sowing of Bt rice with ≤10% (especially 5%) of its parent line was sufficient to overcome potential compliance issues that exist with the use of block or structured refuge to provide most effective control of both target and non-target pests without compromising the grain yield. It is also expected that the strategy of seed mixture sowing with transgenic Bt rice and the non-transgenic parental line would provide rice yield stability while decreasing the insecticide use frequency in rice production. © 2018 Institute of Zoology, Chinese Academy of Sciences.

  20. Modified expression of alternative oxidase in transgenic tomato and petunia affects the level of tomato spotted wilt virus resistance.

    Science.gov (United States)

    Ma, Hao; Song, Congfeng; Borth, Wayne; Sether, Diane; Melzer, Michael; Hu, John

    2011-10-20

    Tomato spotted wilt virus (TSWV) has a very wide host range, and is transmitted in a persistent manner by several species of thrips. These characteristics make this virus difficult to control. We show here that the over-expression of the mitochondrial alternative oxidase (AOX) in tomato and petunia is related to TSWV resistance. The open reading frame and full-length sequence of the tomato AOX gene LeAox1au were cloned and introduced into tomato 'Healani' and petunia 'Sheer Madness' using Agrobacterium-mediated transformation. Highly expressed AOX transgenic tomato and petunia plants were selfed and transgenic R1 seedlings from 10 tomato lines and 12 petunia lines were used for bioassay. For each assayed line, 22 to 32 tomato R1 progeny in three replications and 39 to 128 petunia progeny in 13 replications were challenged with TSWV. Enzyme-Linked Immunosorbent Assays showed that the TSWV levels in transgenic tomato line FKT4-1 was significantly lower than that of wild-type controls after challenge with TSWV. In addition, transgenic petunia line FKP10 showed significantly less lesion number and smaller lesion size than non-transgenic controls after inoculation by TSWV. In all assayed transgenic tomato lines, a higher percentage of transgenic progeny had lower TSWV levels than non-transgenic plants after challenge with TSWV, and the significantly increased resistant levels of tomato and petunia lines identified in this study indicate that altered expression levels of AOX in tomato and petunia can affect the levels of TSWV resistance.

  1. Modified expression of alternative oxidase in transgenic tomato and petunia affects the level of tomato spotted wilt virus resistance

    Directory of Open Access Journals (Sweden)

    Ma Hao

    2011-10-01

    Full Text Available Abstract Background Tomato spotted wilt virus (TSWV has a very wide host range, and is transmitted in a persistent manner by several species of thrips. These characteristics make this virus difficult to control. We show here that the over-expression of the mitochondrial alternative oxidase (AOX in tomato and petunia is related to TSWV resistance. Results The open reading frame and full-length sequence of the tomato AOX gene LeAox1au were cloned and introduced into tomato 'Healani' and petunia 'Sheer Madness' using Agrobacterium-mediated transformation. Highly expressed AOX transgenic tomato and petunia plants were selfed and transgenic R1 seedlings from 10 tomato lines and 12 petunia lines were used for bioassay. For each assayed line, 22 to 32 tomato R1 progeny in three replications and 39 to 128 petunia progeny in 13 replications were challenged with TSWV. Enzyme-Linked Immunosorbent Assays showed that the TSWV levels in transgenic tomato line FKT4-1 was significantly lower than that of wild-type controls after challenge with TSWV. In addition, transgenic petunia line FKP10 showed significantly less lesion number and smaller lesion size than non-transgenic controls after inoculation by TSWV. Conclusion In all assayed transgenic tomato lines, a higher percentage of transgenic progeny had lower TSWV levels than non-transgenic plants after challenge with TSWV, and the significantly increased resistant levels of tomato and petunia lines identified in this study indicate that altered expression levels of AOX in tomato and petunia can affect the levels of TSWV resistance.

  2. Single molecule Raman spectroscopic assay to detect transgene from GM plants.

    Science.gov (United States)

    Kadam, Ulhas S; Chavhan, Rahul L; Schulz, Burkhard; Irudayaraj, Joseph

    2017-09-01

    Substantial concerns have been raised for the safety of transgenics on human health and environment. Many organizations, consumer groups, and environmental agencies advocate for stringent regulations to avoid transgene products' contamination in food cycle or in nature. Here we demonstrate a novel approach using surface enhanced Raman spectroscopy (SERS) to detect and quantify transgene from GM plants. We show a highly sensitive and accurate quantification of transgene DNA from multiple transgenic lines of Arabidopsis. The assay allows us to detect and quantify the transgenes as low as 0.10 pg without need for PCR-amplification. This technology is relatively cheap, quick, simple, and suitable for detection at low target concentration. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Glycinebetaine synthesizing transgenic potato plants exhibit enhanced tolerance to salt and cold stresses

    International Nuclear Information System (INIS)

    Ahmad, R.; Hussain, J.

    2014-01-01

    Abiotic stresses are the most important contributors towards low productivity of major food crops. Various attempts have been made to enhance abiotic stress tolerance of crop plants by classical breeding and genetic transformation. Genetic transformation with glycinebetaine (GB) synthesizing enzymes' gene(s) in naturally non accumulating plants has resulted in enhanced tolerance against variety of abiotic stresses. Present study was aimed to evaluate the performance of GB synthesizing transgenic potato plants against salt and cold stresses. Transgenic potato plants were challenged against salt and cold stresses at whole plant level. Transgenic lines were characterized to determine the transgene copy number. Different parameters like integrity, chlorophyll contents, tuber yield and vegetative biomass were studied to monitor the stress tolerance of transgenic potato plants. The results were compared with Non-transgenic (NT) plants and statistically analyzed to evaluate significant differences. Multi-copy insertion of expression cassette was found in both transgenic lines. Upon salt stress, transgenic plants maintained better growth as compared to NT plants. The tuber yield of transgenic plants was significantly greater than NT plants in salt stress. Transgenic plants showed improved membrane integrity against cold stress by depicting appreciably reduced ion leakage as compared to NT plants. Moreover, transgenic plants showed significantly less chlorophyll bleaching than NT plants upon cold stress. In addition, NT plants accumulated significantly less biomass, and yielded fewer tubers as compared to transgenic plants after cold stress treatment. The study will be a committed step for field evaluation of transgenic plants with the aim of commercialization. (author)

  4. Welfare assessment in transgenic pigs expressing green fluorescent protein (GFP)

    DEFF Research Database (Denmark)

    Huber, Reinhard C.; Remuge, Liliana; Carlisle, Ailsa

    2012-01-01

    Since large animal transgenesis has been successfully attempted for the first time about 25 years ago, the technology has been applied in various lines of transgenic pigs. Nevertheless one of the concerns with the technology—animal welfare—has not been approached through systematic assessment...... and statements regarding the welfare of transgenic pigs have been based on anecdotal observations during early stages of transgenic programs. The main aim of the present study was therefore to perform an extensive welfare assessment comparing heterozygous transgenic animals expressing GFP with wildtype animals...... months. The absence of significant differences between GFP and wildtype animals in the parameters observed suggests that the transgenic animals in question are unlikely to suffer from deleterious effects of transgene expression on their welfare and thus support existing anecdotal observations of pigs...

  5. Dose-Dependent Rescue of KO Amelogenin Enamel by Transgenes in Vivo

    Directory of Open Access Journals (Sweden)

    Felicitas B. Bidlack

    2017-11-01

    Full Text Available Mice lacking amelogenin (KO have hypoplastic enamel. Overexpression of the most abundant amelogenin splice variant M180 and LRAP transgenes can substantially improve KO enamel, but only ~40% of the incisor thickness is recovered and the prisms are not as tightly woven as in WT enamel. This implies that the compositional complexity of the enamel matrix is required for different aspects of enamel formation, such as organizational structure and thickness. The question arises, therefore, how important the ratio of different matrix components, and in particular amelogenin splice products, is in enamel formation. Can optimal expression levels of amelogenin transgenes representing both the most abundant splice variants and cleavage product at protein levels similar to that of WT improve the enamel phenotype of KO mice? Addressing this question, our objective was here to understand dosage effects of amelogenin transgenes (Tg representing the major splice variants M180 and LRAP and cleavage product CTRNC on enamel properties. Amelogenin KO mice were mated with M180Tg, CTRNCTg and LRAPTg mice to generate M180Tg and CTRNCTg double transgene and M180Tg, CTRNCTg, LRAPTg triple transgene mice with transgene hemizygosity (on one allelle or homozygosity (on both alleles. Transgene homo- vs. hemizygosity was determined by qPCR and relative transgene expression confirmed by Western blot. Enamel volume and mineral density were analyzed by microCT, thickness and structure by SEM, and mechanical properties by Vickers microhardness testing. There were no differences in incisor enamel thickness between amelogenin KO mice with three or two different transgenes, but mice homozygous for a given transgene had significantly thinner enamel than mice hemizygous for the transgene (p < 0.05. The presence of the LRAPTg did not improve the phenotype of M180Tg/CTRNCTg/KO enamel. In the absence of endogenous amelogenin, the addition of amelogenin transgenes representing the most

  6. [Production of human proteins in the blood of transgenic animals

    NARCIS (Netherlands)

    Massoud, M.; Bischoff, Rainer; Dalemans, W.; Pointu, H.; Attal, J.; Schultz, H.; Clesse, D.; Stinnakre, M.G.; Pavirani, A.; Houdebine, L.M.

    1990-01-01

    The human alpha 1-antitrypsin gene has been microinjected into rabbit embryos. A line of transgenic rabbits has thus been established. Human alpha 1-antitrypsin was found in the blood of transgenic animals at the concentration of 1 mg/ml plasma. The human protein was active and separable from its

  7. Development of transgenic rats producing human β-amyloid precursor protein as a model for Alzheimer's disease: Transgene and endogenous APP genes are regulated tissue-specifically

    Directory of Open Access Journals (Sweden)

    Chan Anthony WS

    2008-02-01

    Full Text Available Abstract Background Alzheimer's disease (AD is a devastating neurodegenerative disorder that affects a large and growing number of elderly individuals. In addition to idiopathic disease, AD is also associated with autosomal dominant inheritance, which causes a familial form of AD (FAD. Some instances of FAD have been linked to mutations in the β-amyloid protein precursor (APP. Although there are numerous mouse AD models available, few rat AD models, which have several advantages over mice, have been generated. Results Fischer 344 rats expressing human APP driven by the ubiquitin-C promoter were generated via lentiviral vector infection of Fischer 344 zygotes. We generated two separate APP-transgenic rat lines, APP21 and APP31. Serum levels of human amyloid-beta (Aβ40 were 298 pg/ml for hemizygous and 486 pg/ml for homozygous APP21 animals. Serum Aβ42 levels in APP21 homozygous rats were 135 pg/ml. Immunohistochemistry in brain showed that the human APP transgene was expressed in neurons, but not in glial cells. These findings were consistent with independent examination of enhanced green fluorescent protein (eGFP in the brains of eGFP-transgenic rats. APP21 and APP31 rats expressed 7.5- and 3-times more APP mRNA, respectively, than did wild-type rats. Northern blots showed that the human APP transgene, driven by the ubiquitin-C promoter, is expressed significantly more in brain, kidney and lung compared to heart and liver. A similar expression pattern was also seen for the endogenous rat APP. The unexpected similarity in the tissue-specific expression patterns of endogenous rat APP and transgenic human APP mRNAs suggests regulatory elements within the cDNA sequence of APP. Conclusion This manuscript describes the generation of APP-transgenic inbred Fischer 344 rats. These are the first human AD model rat lines generated by lentiviral infection. The APP21 rat line expresses high levels of human APP and could be a useful model for AD. Tissue

  8. Indirect effect of a transgenic wheat on aphids through enhanced powdery mildew resistance.

    Directory of Open Access Journals (Sweden)

    Simone von Burg

    Full Text Available In agricultural ecosystems, arthropod herbivores and fungal pathogens are likely to colonise the same plant and may therefore affect each other directly or indirectly. The fungus that causes powdery mildew (Blumeria graminis tritici and cereal aphids are important pests of wheat but interactions between them have seldom been investigated. We studied the effects of powdery mildew of wheat on two cereal aphid species, Metopolophium dirhodum and Rhopalosiphum padi. We hypothesized that aphid number and size will be smaller on powdery mildew-infected plants than on non-infected plants. In a first experiment we used six commercially available wheat varieties whereas in the second experiment we used a genetically modified (GM mildew-resistant wheat line and its non-transgenic sister line. Because the two lines differed only in the presence of the transgene and in powdery mildew resistance, experiment 2 avoided the confounding effect of variety. In both experiments, the number of M. dirhodum but not of R. padi was reduced by powdery mildew infection. Transgenic mildew-resistant lines therefore harboured bigger aphid populations than the non-transgenic lines. For both aphid species individual size was mostly influenced by aphid number. Our results indicate that plants that are protected from a particular pest (powdery mildew became more favourable for another pest (aphids.

  9. Indirect effect of a transgenic wheat on aphids through enhanced powdery mildew resistance.

    Science.gov (United States)

    von Burg, Simone; Álvarez-Alfageme, Fernando; Romeis, Jörg

    2012-01-01

    In agricultural ecosystems, arthropod herbivores and fungal pathogens are likely to colonise the same plant and may therefore affect each other directly or indirectly. The fungus that causes powdery mildew (Blumeria graminis tritici) and cereal aphids are important pests of wheat but interactions between them have seldom been investigated. We studied the effects of powdery mildew of wheat on two cereal aphid species, Metopolophium dirhodum and Rhopalosiphum padi. We hypothesized that aphid number and size will be smaller on powdery mildew-infected plants than on non-infected plants. In a first experiment we used six commercially available wheat varieties whereas in the second experiment we used a genetically modified (GM) mildew-resistant wheat line and its non-transgenic sister line. Because the two lines differed only in the presence of the transgene and in powdery mildew resistance, experiment 2 avoided the confounding effect of variety. In both experiments, the number of M. dirhodum but not of R. padi was reduced by powdery mildew infection. Transgenic mildew-resistant lines therefore harboured bigger aphid populations than the non-transgenic lines. For both aphid species individual size was mostly influenced by aphid number. Our results indicate that plants that are protected from a particular pest (powdery mildew) became more favourable for another pest (aphids).

  10. Alteration of cell wall polysaccharides through transgenic expression of UDP-Glc 4-epimerase-encoding genes in potato tubers.

    Science.gov (United States)

    Huang, Jie-Hong; Kortstee, Anne; Dees, Dianka C T; Trindade, Luisa M; Schols, Henk A; Gruppen, Harry

    2016-08-01

    Uridine diphosphate (UDP)-glucose 4-epimerase (UGE) catalyzes the conversion of UDP-glucose to UDP-galactose. Cell wall materials from the cv. Kardal (wild-type, background) and two UGE transgenic lines (UGE 45-1 and UGE 51-16) were isolated and fractionated. The galactose (Gal) content (mg/100g tuber) from UGE 45-1 transgenic line was 38% higher than that of wild-type, and resulted in longer pectin side chains. The Gal content present in UGE 51-16 was 17% lower than that of wild-type, although most pectin populations maintained the same level of Gal. Both UGE transgenic lines showed unexpectedly a decrease in acetylation and an increase in methyl-esterification of pectin. Both UGE transgenic lines showed similar proportions of homogalacturonan and rhamnogalacturonan I within pectin backbone as the wild-type, except for the calcium-bound pectin fraction exhibiting relatively less rhamnogalacturonan I. Next to pectin modification, xyloglucan populations from both transgenic lines were altered resulting in different XSGG and XXGG proportion in comparison to wild-type. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Overexpression of CsANR increased flavan-3-ols and decreased anthocyanins in transgenic tobacco.

    Science.gov (United States)

    Kumar, Vinay; Yadav, Sudesh Kumar

    2013-06-01

    Anthocyanins and flavan-3-ols are distributed widely in plants and synthesized by a common biosynthetic pathway. Anthocyanin reductase (ANR) represents branching-point enzyme of this pathway converting anthocyanidins to flavan-3-ols. Since tea contains highest amount of flavonoids, a cDNA encoding anthocyanin reductase from tea (CsANR) was overexpressed in transgenic tobacco to check the influence on anthocyanin and flavan-3-ols. The transgenic tobacco was confirmed by genomic PCR and expression of transgene was analyzed through semiquantitative PCR. Interestingly flowers of transgenic tobacco were light pink/white in color instead of dark pink in wild tobacco, documenting the decrease in anthocyanins content. Upon measurement, flower anthocyanin content was found to be lesser. While flavan-3-ols (epicatechin and epigallocatechin) contents were increased in leaf tissue of transgenic lines. The expressions of other endogenous flavonoid biosynthetic pathway genes in different floral parts (sepal, petal, stamen, and carpel) of CsANR overexpressing tobacco as well as wild tobacco were analyzed. The transcript levels of PAL and CHI genes were downregulated, while transcript levels of F3H, FLS, CHS, ANR1, and ANR2 genes were upregulated in all floral parts of CsANR transgenic plants compared to wild tobacco. The expressions of DFR and ANS genes were also spatially modulated in different floral parts due to overexpression of CsANR. Thus, CsANR overexpression increased flavan-3-ols and decreased anthocyanin content by modulating the expressions of various flavonoid biosynthetic pathway genes in flower of tobacco. These changes might be responsible for the observed pollen tube in the pollens of CsANR overexpressing transgenic tobacco when they were still in the anther before pollination.

  12. [Progress in transgenic fish techniques and application].

    Science.gov (United States)

    Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying

    2011-05-01

    Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.

  13. Hepatic steatosis in transgenic mice overexpressing human histone deacetylase 1

    International Nuclear Information System (INIS)

    Wang, Ai-Guo; Seo, Sang-Beom; Moon, Hyung-Bae; Shin, Hye-Jun; Kim, Dong Hoon; Kim, Jin-Man; Lee, Tae-Hoon; Kwon, Ho Jeong; Yu, Dae-Yeul; Lee, Dong-Seok

    2005-01-01

    It is generally thought that histone deacetylases (HDACs) play important roles in the transcriptional regulation of genes. However, little information is available concerning the specific functions of individual HDACs in disease states. In this study, two transgenic mice lines were established which harbored the human HDAC1 gene. Overexpressed HDAC1 was detected in the nuclei of transgenic liver cells, and HDAC1 enzymatic activity was significantly higher in the transgenic mice than in control littermates. The HDAC1 transgenic mice exhibited a high incidence of hepatic steatosis and nuclear pleomorphism. Molecular studies showed that HDAC1 may contribute to nuclear pleomorphism through the p53/p21 signaling pathway

  14. Population dynamics of Sesamia inferens on transgenic rice expressing Cry1Ac and CpTI in southern China.

    Science.gov (United States)

    Han, Lanzhi; Liu, Peilei; Wu, Kongming; Peng, Yufa; Wang, Feng

    2008-10-01

    Genetically modified insect-resistant rice lines containing the cry1Ac gene from Bacillus thuringiensis (Bt) or the CpTI (cowpea trypsin inhibitor) gene developed for the management of lepidopterous pests are highly resistant to the major target pests, Chilo suppressalis (Walker), Cnaphalocrocis medinalis (Guenée), and Scirpophaga incertulas (Walker), in the main rice-growing areas of China. However, the effects of these transgenic lines on Sesamia inferens (Walker), an important lepidopterous rice pest, are currently unknown. Because different insect species have varying susceptibility to Bt insecticidal proteins that may affect population dynamics, research into the effects of these transgenic rice lines on the population dynamics of S. inferens was conducted in Fuzhou, southern China, in 2005 and 2006. The results of laboratory, field cage, and field plot experiments show that S. inferens has comparatively high susceptibility to the transgenic line during the early growing season, with significant differences observed in larval density and infestation levels between transgenic and control lines. Because of a decrease in Cry1Ac levels in the plant as it ages, the transgenic line provided only a low potential for population suppression late in the growing season. There is a correlation between the changing expression of Cry1Ac and the impact of transgenic rice on the population dynamics of S. inferens during the season. These results indicate that S. inferens may become a major pest in fields of prospective commercially released transgenic rice, and more attention should be paid to developing an effective alternative management strategy.

  15. Ethics and Transgenic Crops: a Review

    OpenAIRE

    Robinson, Jonathan

    1999-01-01

    This article represents a review of some of the ethical dilemmas that have arisen as a result of the development and deployment of transgenic crop plants. The potential for transgenic crops to alleviate human hunger and the possible effects on human health are discussed. Risks and benefits to the environment resulting from genetic engineering of crops for resistance to biotic and abiotic stresses are considered, in addition to effects on biodiversity. The socio-economic impacts and distributi...

  16. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    Science.gov (United States)

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  17. Recent advances in the development of new transgenic animal technology.

    Science.gov (United States)

    Miao, Xiangyang

    2013-03-01

    Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by genetic engineering technology so that these genes can be inherited and expressed by offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors in the production of transgenic animals. A variety of transgenic technologies are available. Each has its own advantages and disadvantages and needs further study because of unresolved technical and safety issues. Further studies will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. This article reviews the recently developed animal transgenic technologies, including the germ line stem cell-mediated method to improve efficiency, gene targeting to improve accuracy, RNA interference-mediated gene silencing technology, zinc-finger nuclease gene targeting technology and induced pluripotent stem cell technology. These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields.

  18. Intein-mediated Cre protein assembly for transgene excision in hybrid progeny of transgenic Arabidopsis.

    Science.gov (United States)

    Ge, Jia; Wang, Lijun; Yang, Chen; Ran, Lingyu; Wen, Mengling; Fu, Xianan; Fan, Di; Luo, Keming

    2016-10-01

    An approach for restoring recombination activity of complementation split-Cre was developed to excise the transgene in hybrid progeny of GM crops. Growing concerns about the biosafety of genetically modified (GM) crops has currently become a limited factor affecting the public acceptance. Several approaches have been developed to generate selectable-marker-gene-free GM crops. However, no strategy was reported to be broadly applicable to hybrid crops. Previous studies have demonstrated that complementation split-Cre recombinase restored recombination activity in transgenic plants. In this study, we found that split-Cre mediated by split-intein Synechocystis sp. DnaE had high recombination efficiency when Cre recombinase was split at Asp232/Asp233 (866 bp). Furthermore, we constructed two plant expression vectors, pCA-NCre-In and pCA-Ic-CCre, containing NCre866-In and Ic-CCre866 fragments, respectively. After transformation, parent lines of transgenic Arabidopsis with one single copy were generated and used for hybridization. The results of GUS staining demonstrated that the recombination activity of split-Cre could be reassembled in these hybrid progeny of transgenic plants through hybridization and the foreign genes flanked by two loxP sites were efficiently excised. Our strategy may provide an effective approach for generating the next generation of GM hybrid crops without biosafety concerns.

  19. T-DNA integration patterns in transgenic maize lines mediated by ...

    African Journals Online (AJOL)

    Jane

    2011-10-03

    Oct 3, 2011 ... locus can have profound effects on the level and stability of transgene ..... Thane N, Henke J, Wang T, Ruppert J, Shah N, Rotter K, Hodges J, ... Chia JM, Deragon JM, Estill JC, Fu Y, Jeddeloh JA, Han YJ, Lee H,. Li PH, Lisch ...

  20. Herbicidal and antioxidant responses of transgenic rice overexpressing Myxococcus xanthus protoporphyrinogen oxidase.

    Science.gov (United States)

    Jung, Sunyo; Back, Kyoungwhan

    2005-05-01

    We analyzed the herbicidal and antioxidant defense responses of transgenic rice plants that overexpressed the Myxococcus xanthus protoporphyrinogen oxidase gene. Leaf squares of the wild-type incubated with oxyfluorfen were characterized by necrotic leaf lesions and increases in conductivity and malonyldialdehyde levels, whereas transgenic lines M4 and M7 did not show any change with up to 100 microM oxyfluorfen. The wild-type had decreased F(v)/F(m) and produced a high level of H(2)O(2) at 18 h after foliar application of oxyfluorfen, whereas transgenic lines M4 and M7 were unaffected. In response to oxyfluorfen, violaxanthin, beta-carotene, and chlorophylls (Chls) decreased in wild-type plants, whereas antheraxanthin and zeaxanthin increased. Only a slight decline in Chls was observed in transgenic lines at 48 h after oxyfluorfen treatment. Noticeable increases of cytosolic Cu/Zn-superoxide dismutase, peroxidase isozymes 1 and 2, and catalase were observed after at 48 h of oxyfluorfen treatment in the wild-type. Non-enzymatic antioxidants appeared to respond faster to oxyfluorfen-induced photodynamic stress than did enzymatic antioxidants. Protective responses for the detoxification of active oxygen species were induced to counteract photodynamic stress in oxyfluorfen-treated, wild-type plants. However, oxyfluorfen-treated, transgenic plants suffered less oxidative stress, confirming increased herbicidal resistance resulted from dual expression of M. xanthus Protox in chloroplasts and mitochondria.

  1. A dominant-negative mutation within AtMYB90 blocks flower pigment production in transgenic tobacco.

    Science.gov (United States)

    During de novo shoot induction in cultured transgenic tobacco callus a spontaneous mutation within the coding region of a AtMYB90 transgene produced a plant line in which the original transgene-induced over-pigmented phenotype (dark red/purple from anthocyanin overproduction in most tissues) was los...

  2. A transgenic plant cell-suspension system for expression of epitopes on chimeric Bamboo mosaic virus particles.

    Science.gov (United States)

    Muthamilselvan, Thangarasu; Lee, Chin-Wei; Cho, Yu-Hsin; Wu, Feng-Chao; Hu, Chung-Chi; Liang, Yu-Chuan; Lin, Na-Sheng; Hsu, Yau-Heiu

    2016-01-01

    We describe a novel strategy to produce vaccine antigens using a plant cell-suspension culture system in lieu of the conventional bacterial or animal cell-culture systems. We generated transgenic cell-suspension cultures from Nicotiana benthamiana leaves carrying wild-type or chimeric Bamboo mosaic virus (BaMV) expression constructs encoding the viral protein 1 (VP1) epitope of foot-and-mouth disease virus (FMDV). Antigens accumulated to high levels in BdT38 and BdT19 transgenic cell lines co-expressing silencing suppressor protein P38 or P19. BaMV chimeric virus particles (CVPs) were subsequently purified from the respective cell lines (1.5 and 2.1 mg CVPs/20 g fresh weight of suspended biomass, respectively), and the resulting CVPs displayed VP1 epitope on the surfaces. Guinea pigs vaccinated with purified CVPs produced humoral antibodies. This study represents an important advance in the large-scale production of immunopeptide vaccines in a cost-effective manner using a plant cell-suspension culture system. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  3. Derivation of mouse embryonic stem cell lines from tyrosine hydroxylase reporter mice crossed with a human SNCA transgenic mouse model of Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Margarita Chumarina

    2017-03-01

    Full Text Available Mouse embryonic stem cell (mESC lines were derived by crossing heterozygous transgenic (tg mice expressing green fluorescent protein (GFP under the control of the rat tyrosine hydroxylase (TH promoter, with homozygous alpha-synuclein (aSYN mice expressing human mutant SNCAA53T under the control of the mouse Prion promoter (MoPrP, or wildtype (WT mice. The expression of GFP and human aSYN was validated by immunocytochemistry in midbrain neuron cultures upon differentiation of mESC lines using stromal cell-derived inducing activity. These mESC lines can help to study the impact of human aSYN expression in neurons and oligodendrocytes, and also trace GFP-expressing midbrain neurons.

  4. Comparative study of transgenic Brachypodium distachyon expressing sucrose:fructan 6-fructosyltransferases from wheat and timothy grass with different enzymatic properties.

    Science.gov (United States)

    Tamura, Ken-Ichi; Sanada, Yasuharu; Tase, Kazuhiro; Kawakami, Akira; Yoshida, Midori; Yamada, Toshihiko

    2014-04-01

    Fructans can act as cryoprotectants and contribute to freezing tolerance in plant species, such as in members of the grass subfamily Pooideae that includes Triticeae species and forage grasses. To elucidate the relationship of freezing tolerance, carbohydrate composition and degree of polymerization (DP) of fructans, we generated transgenic plants in the model grass species Brachypodium distachyon that expressed cDNAs for sucrose:fructan 6-fructosyltransferases (6-SFTs) with different enzymatic properties: one cDNA encoded PpFT1 from timothy grass (Phleum pratense), an enzyme that produces high-DP levans; a second cDNA encoded wft1 from wheat (Triticum aestivum), an enzyme that produces low-DP levans. Transgenic lines expressing PpFT1 and wft1 showed retarded growth; this effect was particularly notable in the PpFT1 transgenic lines. When grown at 22 °C, both types of transgenic line showed little or no accumulation of fructans. However, after a cold treatment, wft1 transgenic plants accumulated fructans with DP = 3-40, whereas PpFT1 transgenic plants accumulated fructans with higher DPs (20 to the separation limit). The different compositions of the accumulated fructans in the two types of transgenic line were correlated with the differences in the enzymatic properties of the overexpressed 6-SFTs. Transgenic lines expressing PpFT1 accumulated greater amounts of mono- and disaccharides than wild type and wft1 expressing lines. Examination of leaf blades showed that after cold acclimation, PpFT1 overexpression increased tolerance to freezing; by contrast, the freezing tolerance of the wft1 expressing lines was the same as that of wild type plants. These results provide new insights into the relationship of the composition of water-soluble carbohydrates and the DP of fructans to freezing tolerance in plants.

  5. [Transgenic wheat (Triticum aestivum L.) with increased resistance to the storage pest obtained by Agrobacterium tumefaciens--mediated].

    Science.gov (United States)

    Bi, Rui-Ming; Jia, Hai-Yan; Feng, De-Shun; Wang, Hong-Gang

    2006-05-01

    The transgenic wheat of improved resistance to the storage pest was production. We have introduced the cowpea trypsin inhibitor gene (CpTI) into cultured embryonic callus cells of immature embryos of wheat elite line by Agrobacterium-mediated method. Independent plantlets were obtained from the kanamycin-resistant calli after screening. PCR and real time PCR analysis, PCR-Southern and Southern blot hybridization indicated that there were 3 transgenic plants viz. transformed- I, II and III (T- I, T-II and T-III). The transformation frequencies were obviously affected by Agrobacterium concentration, the infection duration and transformation treatment. The segregations of CpTI in the transgenic wheat progenies were not easily to be elucidated, and some transgenic wheat lines (T- I and T-III) showed Mendelian segregations. The determinations of insect resistance to the stored grain insect of wheat viz. the grain moth (Sitotroga cerealella Olivier) indicated that the 3 transgenic wheat progeny seeds moth-resistance was improved significantly. The seed moth-eaten ratio of T- I, T-II, T-III and nontransformed control was 19.8%, 21.9%, 32.9% and 58.3% respectively. 3 transgenic wheat T1 PCR-positive plants revealed that the 3 transgenic lines had excellent agronomic traits. They supplied good germplasm resource of insect-resistance for wheat genetic improvement.

  6. Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.

    Science.gov (United States)

    Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki

    2010-04-01

    Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did

  7. Dehydrins Impart Protection against Oxidative Stress in Transgenic Tobacco Plants.

    Science.gov (United States)

    Halder, Tanmoy; Upadhyaya, Gouranga; Basak, Chandra; Das, Arup; Chakraborty, Chandrima; Ray, Sudipta

    2018-01-01

    Environmental stresses generate reactive oxygen species (ROS) which might be detrimental to the plants when produced in an uncontrolled way. However, the plants ameliorate such stresses by synthesizing antioxidants and enzymes responsible for the dismutation of ROS. Additionally, the dehydrins were also able to protect the inactivation of the enzyme lactate dehydrogenase against hydroxyl radicals (OH ⋅ ) generated during Fenton's reaction. SbDhn1 and SbDhn2 overexpressing transgenic tobacco plants were able to protect against oxidative damage. Transgenic tobacco lines showed better photosynthetic efficiency along with high chlorophyll content, soluble sugar and proline. However, the malonyl dialdehyde (MDA) content was significantly lower in transgenic lines. Experimental evidence demonstrates the protective effect of dehydrins on electron transport chain in isolated chloroplast upon methyl viologen (MV) treatment. The transgenic tobacco plants showed significantly lower superoxide radical generation () upon MV treatment. The accumulation of the H 2 O 2 was also lower in the transgenic plants. Furthermore, in the transgenic plants the expression of ROS scavenging enzymes was higher compared to non-transformed (NT) or vector transformed (VT) plants. Taken together these data, during oxidative stress dehydrins function by scavenging the () directly and also by rendering protection to the enzymes responsible for the dismutation of () thereby significantly reducing the amount of hydrogen peroxides formed. Increase in proline content along with other antioxidants might also play a significant role in stress amelioration. Dehydrins thus function co-operatively with other protective mechanisms under oxidative stress conditions rendering protection in stress environment.

  8. Dose-Dependent Rescue of KO Amelogenin Enamel by Transgenes in Vivo.

    Science.gov (United States)

    Bidlack, Felicitas B; Xia, Yan; Pugach, Megan K

    2017-01-01

    Mice lacking amelogenin (KO) have hypoplastic enamel. Overexpression of the most abundant amelogenin splice variant M180 and LRAP transgenes can substantially improve KO enamel, but only ~40% of the incisor thickness is recovered and the prisms are not as tightly woven as in WT enamel. This implies that the compositional complexity of the enamel matrix is required for different aspects of enamel formation, such as organizational structure and thickness. The question arises, therefore, how important the ratio of different matrix components, and in particular amelogenin splice products, is in enamel formation. Can optimal expression levels of amelogenin transgenes representing both the most abundant splice variants and cleavage product at protein levels similar to that of WT improve the enamel phenotype of KO mice? Addressing this question, our objective was here to understand dosage effects of amelogenin transgenes ( Tg ) representing the major splice variants M180 and LRAP and cleavage product CTRNC on enamel properties. Amelogenin KO mice were mated with M180 Tg , CTRNC Tg and LRAP Tg mice to generate M180 Tg and CTRNC Tg double transgene and M180 Tg , CTRNC Tg , LRAP Tg triple transgene mice with transgene hemizygosity (on one allelle) or homozygosity (on both alleles). Transgene homo- vs. hemizygosity was determined by qPCR and relative transgene expression confirmed by Western blot. Enamel volume and mineral density were analyzed by microCT, thickness and structure by SEM, and mechanical properties by Vickers microhardness testing. There were no differences in incisor enamel thickness between amelogenin KO mice with three or two different transgenes, but mice homozygous for a given transgene had significantly thinner enamel than mice hemizygous for the transgene ( p structure, but only up to a maximum of ~80% that of molar and ~40% that of incisor wild-type enamel.

  9. Transgenic expression of phytase in wheat endosperm increases bioavailability of iron and zinc in grains.

    Science.gov (United States)

    Abid, Nabeela; Khatoon, Asia; Maqbool, Asma; Irfan, Muhammad; Bashir, Aftab; Asif, Irsa; Shahid, Muhammad; Saeed, Asma; Brinch-Pedersen, Henrik; Malik, Kauser A

    2017-02-01

    Phytate is a major constituent of wheat seeds and chelates metal ions, thus reducing their bioavailability and so the nutritional value of grains. Transgenic plants expressing heterologous phytase are expected to enhance degradation of phytic acid stored in seeds and are proposed to increase the in vitro bioavailability of mineral nutrients. Wheat transgenic plants expressing Aspergillus japonicus phytase gene (phyA) in wheat endosperm were developed till T 3 generation. The transgenic lines exhibited 18-99 % increase in phytase activity and 12-76 % reduction of phytic acid content in seeds. The minimum phytic acid content was observed in chapatti (Asian bread) as compared to flour and dough. The transcript profiling of phyA mRNA indicated twofold to ninefold higher expression as compared to non transgenic controls. There was no significant difference in grain nutrient composition of transgenic and non-transgenic seeds. In vitro bioavailability assay for iron and zinc in dough and chapatti of transgenic lines revealed a significant increase in iron and zinc contents. The development of nutritionally enhanced cereals is a step forward to combat nutrition deficiency for iron and zinc in malnourished human population, especially women and children.

  10. The growth performance of F1 transgenic mutiara catfish

    Science.gov (United States)

    Iskandar; Buwono, I. D.; Agung, M. U. K.

    2018-04-01

    The growth of catfish (African or Sangkuriang strain) these days is tend to decreased. One of the solutions due to this problem is to improve the genetics of growth using transgenesis technology, toward more profitable. The specific objective of the research is to detect the transmission of exogenous GH (African catfish GH inserts) inside the F1 transgenic Mutiara catfish using PCR (Polymerase Chain Reaction) method and to evaluate the growth performance of transgenic Mutiara catfish made using the parameters of feed conversion (FCR = Feed Conversion Ratio). Transgenic catfish (strain mutiara) F0 and F1 carried African catfish GH (600 bp) can be produced. Superiority characters of transgenic catfish represented heritability (h2 ) and heterosis (H), indicating that the offspring of hybrid F1 transgenic mutiara catfish had phenotypes rapid growth (h2 = 17.55 % and H = 42.83 %) compared to non-transgenic catfish (h 2 = 10.07 % and H = 18.56 %). Evaluation of the efficiency of feed use parameters feed conversion ratio, shows that F1 transgenic mutiara catfish (FCR = 0.85) more efficient in converting feed into meat.

  11. Transgenic Expression of the Anti-parasitic Factor TEP1 in the Malaria Mosquito Anopheles gambiae.

    Directory of Open Access Journals (Sweden)

    Gloria Volohonsky

    2017-01-01

    Full Text Available Mosquitoes genetically engineered to be resistant to Plasmodium parasites represent a promising novel approach in the fight against malaria. The insect immune system itself is a source of anti-parasitic genes potentially exploitable for transgenic designs. The Anopheles gambiae thioester containing protein 1 (TEP1 is a potent anti-parasitic protein. TEP1 is secreted and circulates in the mosquito hemolymph, where its activated cleaved form binds and eliminates malaria parasites. Here we investigated whether TEP1 can be used to create malaria resistant mosquitoes. Using a GFP reporter transgene, we determined that the fat body is the main site of TEP1 expression. We generated transgenic mosquitoes that express TEP1r, a potent refractory allele of TEP1, in the fat body and examined the activity of the transgenic protein in wild-type or TEP1 mutant genetic backgrounds. Transgenic TEP1r rescued loss-of-function mutations, but did not increase parasite resistance in the presence of a wild-type susceptible allele. Consistent with previous reports, TEP1 protein expressed from the transgene in the fat body was taken up by hemocytes upon a challenge with injected bacteria. Furthermore, although maturation of transgenic TEP1 into the cleaved form was impaired in one of the TEP1 mutant lines, it was still sufficient to reduce parasite numbers and induce parasite melanization. We also report here the first use of Transcription Activator Like Effectors (TALEs in Anopheles gambiae to stimulate expression of endogenous TEP1. We found that artificial elevation of TEP1 expression remains moderate in vivo and that enhancement of endogenous TEP1 expression did not result in increased resistance to Plasmodium. Taken together, our results reveal the difficulty of artificially influencing TEP1-mediated Plasmodium resistance, and contribute to further our understanding of the molecular mechanisms underlying mosquito resistance to Plasmodium parasites.

  12. Impact of Transgenic Brassica napus Harboring the Antifungal Synthetic Chitinase (NiC Gene on Rhizosphere Microbial Diversity and Enzyme Activities

    Directory of Open Access Journals (Sweden)

    Mohammad S. Khan

    2017-07-01

    Full Text Available Transgenic Brassica napus harboring the synthetic chitinase (NiC gene exhibits broad-spectrum antifungal resistance. As the rhizosphere microorganisms play an important role in element cycling and nutrient transformation, therefore, biosafety assessment of NiC containing transgenic plants on soil ecosystem is a regulatory requirement. The current study is designed to evaluate the impact of NiC gene on the rhizosphere enzyme activities and microbial community structure. The transgenic lines with the synthetic chitinase gene (NiC showed resistance to Alternaria brassicicola, a common disease causing fungal pathogen. The rhizosphere enzyme analysis showed no significant difference in the activities of fivesoil enzymes: alkalyine phosphomonoestarase, arylsulphatase, β-glucosidase, urease and sucrase between the transgenic and non-transgenic lines of B. napus varieties, Durr-e-NIFA (DN and Abasyne-95 (AB-95. However, varietal differences were observed based on the analysis of molecular variance. Some individual enzymes were significantly different in the transgenic lines from those of non-transgenic but the results were not reproducible in the second trail and thus were considered as environmental effect. Genotypic diversity of soil microbes through 16S–23S rRNA intergenic spacer region amplification was conducted to evaluate the potential impact of the transgene. No significant diversity (4% for bacteria and 12% for fungal between soil microbes of NiC B. napus and the non-transgenic lines was found. However, significant varietal differences were observed between DN and AB-95 with 79% for bacterial and 54% for fungal diversity. We conclude that the NiC B. napus lines may not affect the microbial enzyme activities and community structure of the rhizosphere soil. Varietal differences might be responsible for minor changes in the tested parameters.

  13. Overexpression of GmDREB1 improves salt tolerance in transgenic wheat and leaf protein response to high salinity

    Directory of Open Access Journals (Sweden)

    Qiyan Jiang

    2014-04-01

    Full Text Available The transcription factor dehydration-responsive element binding protein (DREB is able to improve tolerance to abiotic stress in plants by regulating the expression of downstream genes involved in environmental stress resistance. The objectives of this study were to evaluate the salt tolerance of GmDREB1 transgenic wheat (Triticum aestivum L. and to evaluate its physiological and protein responses to salt stress. Compared with the wild type, the transgenic lines overexpressing GmDREB1 showed longer coleoptiles and radicles and a greater radicle number at the germination stage, as well as greater root length, fresh weight, and tiller number per plant at the seedling stage. The yield-related traits of transgenic lines were also improved compared with the wild type, indicating enhanced salt tolerance in transgenic lines overexpressing GmDREB1. Proteomics analysis revealed that osmotic- and oxidative-stress-related proteins were up-regulated in transgenic wheat leaves under salt stress conditions. Transgenic wheat had higher levels of proline and betaine and lower levels of malondialdehyde and relative electrolyte leakage than the wild type. These results suggest that GmDREB1 regulates the expression of osmotic- and oxidative-stress-related proteins that reduce the occurrence of cell injury caused by high salinity, thus improving the salt tolerance of transgenic wheat.

  14. Overexpression of TiERF1 enhances resistance to sharp eyespot in transgenic wheat

    OpenAIRE

    Chen, Liang; Zhang, ZengYan; Liang, HongXia; Liu, HongXia; Du, LiPu; Xu, Huijun; Xin, Zhiyong

    2008-01-01

    Wheat sharp eyespot, primarily caused by a soil-borne fungus Rhizoctonia cerealis, has become one of the most serious diseases of wheat in China. In this study, an ethylene response factor (ERF) gene from a wheat relative Thinopyrum intermedium, TiERF1, was characterized further, transgenic wheat lines expressing TiERF1 were developed, and the resistance of the transgenic wheat lines against R. cerealis was investigated. Southern blotting analysis indicated that at least two copies of the TiE...

  15. Overexpression of TaLEA gene from Tamarix androssowii improves salt and drought tolerance in transgenic poplar (Populus simonii × P. nigra.

    Directory of Open Access Journals (Sweden)

    Weidong Gao

    Full Text Available Late embryogenesis abundant (LEA genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA was transformed into Xiaohei poplar (Populussimonii × P. nigra via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR and ribonucleic acid (RNA gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11 showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.

  16. Overexpression of TaLEA gene from Tamarix androssowii improves salt and drought tolerance in transgenic poplar (Populus simonii × P. nigra).

    Science.gov (United States)

    Gao, Weidong; Bai, Shuang; Li, Qingmei; Gao, Caiqiu; Liu, Guifeng; Li, Guangde; Tan, Feili

    2013-01-01

    Late embryogenesis abundant (LEA) genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA) was transformed into Xiaohei poplar (Populussimonii × P. nigra) via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR) and ribonucleic acid (RNA) gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA) content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11) showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.

  17. PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation.

    Science.gov (United States)

    Nath, Manoj; Garg, Bharti; Sahoo, Ranjan Kumar; Tuteja, Narendra

    2015-01-01

    Salinity stress negatively affects the crop productivity worldwide, including that of rice. Coping with these losses is a major concern for all countries. The pea DNA helicase, PDH45 is a unique member of helicase family involved in the salinity stress tolerance. However, the exact mechanism of the PDH45 in salinity stress tolerance is yet to be established. Therefore, the present study was conducted to investigate the mechanism of PDH45-mediated salinity stress tolerance in transgenic tobacco and rice lines along with wild type (WT) plants using CoroNa Green dye based sodium localization in root and shoot sections. The results showed that under salinity stress root and shoot of PDH45 overexpressing transgenic tobacco and rice accumulated less sodium (Na(+)) as compared to their respective WT. The present study also reports salinity tolerant (FL478) and salinity susceptible (Pusa-44) varieties of rice accumulated lowest and highest Na(+) level, respectively. All the varieties and transgenic lines of rice accumulate differential Na(+) ions in root and shoot. However, roots accumulate high Na(+) as compared to the shoots in both tobacco and rice transgenic lines suggesting that the Na(+) transport in shoot is somehow inhibited. It is proposed that the PDH45 is probably involved in the deposition of apoplastic hydrophobic barriers and consequently inhibit Na(+) transport to shoot and therefore confers salinity stress tolerance to PDH45 overexpressing transgenic lines. This study concludes that tobacco (dicot) and rice (monocot) transgenic plants probably share common salinity tolerance mechanism mediated by PDH45 gene.

  18. Phytoremediation of the organic Xenobiotic simazine by p450-1a2 transgenic Arabidopsis thaliana plants.

    Science.gov (United States)

    Azab, Ehab; Hegazy, Ahmad K; El-Sharnouby, Mohamed E; Abd Elsalam, Hassan E

    2016-01-01

    The potential use of human P450-transgenic plants for phytoremediation of pesticide contaminated soils was tested in laboratory and greenhouse experiments. The transgenic P450 CYP1A2 gene Arabidopsis thaliana plants metabolize number of herbicides, insecticides and industrial chemicals. The P450 isozymes CYP1A2 expressed in A. thaliana were examined regarding the herbicide simazine (SIM). Transgenic A. thaliana plants expressing CYP1A2 gene showed significant resistance to SIM supplemented either in plant growth medium or sprayed on foliar parts. The results showed that SIM produces harmful effect on both rosette diameter and primary root length of the wild type (WT) plants. In transgenic A. thaliana lines, the rosette diameter and primary root length were not affected by SIM concentrations used in this experiment. The results indicate that CYP1A2 can be used as a selectable marker for plant transformation, allowing efficient selection of transgenic lines in growth medium and/or in soil-grown plants. The transgenic A. thaliana plants exhibited a healthy growth using doses of up to 250 μmol SIM treatments, while the non-transgenic A. thaliana plants were severely damaged with doses above 50 μmol SIM treatments. The transgenic A. thaliana plants can be used as phytoremediator of environmental SIM contaminants.

  19. Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

    Science.gov (United States)

    Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

    2014-12-01

    Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

  20. Inheritance and segregation of exogenous genes in transgenic cotton

    Indian Academy of Sciences (India)

    Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton. The transformed cotton varieties CCRI 30 and NewCott 33B expressing the Bt cryIA gene, and cotton line TFD expressing the tfdA gene were crossed with ...

  1. Expression of Pinellia pedatisecta Lectin Gene in Transgenic Wheat Enhances Resistance to Wheat Aphids

    Directory of Open Access Journals (Sweden)

    Xiaoliang Duan

    2018-03-01

    Full Text Available Wheat aphids are major pests during the seed filling stage of wheat. Plant lectins are toxic to sap-sucking pests such as wheat aphids. In this study, Pinellia pedatisecta agglutinin (ppa, a gene encoding mannose binding lectin, was cloned, and it shared 92.69% nucleotide similarity and 94% amino acid similarity with Pinellia ternata agglutinin (pta. The ppa gene, driven by the constitutive and phloem-specific ribulose bisphosphate carboxylase small subunit gene (rbcs promoter in pBAC-rbcs-ppa expression vector, was transferred into the wheat cultivar Baofeng104 (BF104 by particle bombardment transformation. Fifty-four T0 transgenic plants were generated. The inheritance and expression of the ppa gene were confirmed by PCR and RT-PCR analysis respectively, and seven homozygous transgenic lines were obtained. An aphid bioassay on detached leaf segments revealed that seven ppa transgenic wheat lines had lower aphid growth rates and higher inhibition rates than BF104. Furthermore, two-year aphid bioassays in isolated fields showed that aphid numbers per tiller of transgenic lines were significantly decreased, compared with wild type BF104. Therefore, ppa could be a strong biotechnological candidate to produce aphid-resistant wheat.

  2. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    Science.gov (United States)

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

  3. Transgenic engineering of male-specific muscular hypertrophy

    DEFF Research Database (Denmark)

    Pirottin, D.; Grobet, L.; Adamantidis, A.

    2005-01-01

    Using a two-step procedure involving insertional gene targeting and recombinase-mediated cassette exchange in ES cells, we have produced two lines of transgenic mice expressing a dominant-negative latency-associated myostatin propeptide under control of the myosin light chain 1F promoter and 1/3 ...

  4. Quantitative Comparison of Dense-Core Amyloid Plaque Accumulation in Amyloid-β Precursor Protein Transgenic Mice

    Science.gov (United States)

    Liu, Peng; Reichl, John H.; Rao, Eshaan R.; McNellis, Brittany M.; Huang, Eric S.; Hemmy, Laura S.; Forster, Colleen L.; Kuskowski, Michael A.; Borchelt, David R.; Vassar, Robert; Ashe, Karen H.; Zahs, Kathleen R.

    2016-01-01

    There exist several dozen lines of transgenic mice that express human amyloid-β precursor protein (AβPP) with Alzheimer’s disease (AD)-linked mutations. AβPP transgenic mouse lines differ in the types and amounts of Aβ that they generate and in their spatiotemporal patterns of expression of Aβ assemblies, providing a toolkit to study Aβ amyloidosis and the influence of Aβ aggregation on brain function. More complete quantitative descriptions of the types of Aβ assemblies present in transgenic mice and in humans during disease progression should add to our understanding of how Aβ toxicity in mice relates to the pathogenesis of AD. Here, we provide a direct quantitative comparison of amyloid plaque burdens and plaque sizes in four lines of AβPP transgenic mice. We measured the fraction of cortex and hippocampus occupied by dense-core plaques, visualized by staining with Thioflavin S, in mice from young adulthood through advanced age. We found that the plaque burdens among the transgenic lines varied by an order of magnitude: at 15 months of age, the oldest age studied, the median cortical plaque burden in 5XFAD mice was already ~4.5 times that of 21-month Tg2576 mice and ~15 times that of 21–24-month rTg9191 mice. Plaque-size distributions changed across the lifespan in a line- and region-dependent manner. We also compared the dense-core plaque burdens in the mice to those measured in a set of pathologically-confirmed AD cases from the Nun Study. Cortical plaque burdens in Tg2576, APPSwePS1ΔE9, and 5XFAD mice eventually far exceeded those measured in the human cohort. PMID:28059792

  5. Quantitative Comparison of Dense-Core Amyloid Plaque Accumulation in Amyloid-β Protein Precursor Transgenic Mice.

    Science.gov (United States)

    Liu, Peng; Reichl, John H; Rao, Eshaan R; McNellis, Brittany M; Huang, Eric S; Hemmy, Laura S; Forster, Colleen L; Kuskowski, Michael A; Borchelt, David R; Vassar, Robert; Ashe, Karen H; Zahs, Kathleen R

    2017-01-01

    There exist several dozen lines of transgenic mice that express human amyloid-β protein precursor (AβPP) with Alzheimer's disease (AD)-linked mutations. AβPP transgenic mouse lines differ in the types and amounts of Aβ that they generate and in their spatiotemporal patterns of expression of Aβ assemblies, providing a toolkit to study Aβ amyloidosis and the influence of Aβ aggregation on brain function. More complete quantitative descriptions of the types of Aβ assemblies present in transgenic mice and in humans during disease progression should add to our understanding of how Aβ toxicity in mice relates to the pathogenesis of AD. Here, we provide a direct quantitative comparison of amyloid plaque burdens and plaque sizes in four lines of AβPP transgenic mice. We measured the fraction of cortex and hippocampus occupied by dense-core plaques, visualized by staining with Thioflavin S, in mice from young adulthood through advanced age. We found that the plaque burdens among the transgenic lines varied by an order of magnitude: at 15 months of age, the oldest age studied, the median cortical plaque burden in 5XFAD mice was already ∼4.5 times that of 21-month-old Tg2576 mice and ∼15 times that of 21-24-month-old rTg9191 mice. Plaque-size distributions changed across the lifespan in a line- and region-dependent manner. We also compared the dense-core plaque burdens in the mice to those measured in a set of pathologically-confirmed AD cases from the Nun Study. Cortical plaque burdens in Tg2576, APPSwePS1ΔE9, and 5XFAD mice eventually far exceeded those measured in the human cohort.

  6. Silencing of omega-5 gliadins in transgenic wheat eliminates a major source of environmental variability and improves dough mixing properties of flour.

    Science.gov (United States)

    Altenbach, Susan B; Tanaka, Charlene K; Seabourn, Bradford W

    2014-12-24

    The end-use quality of wheat flour varies as a result of the growth conditions of the plant. Among the wheat gluten proteins, the omega-5 gliadins have been identified as a major source of environmental variability, increasing in proportion in grain from plants that receive fertilizer or are subjected to high temperatures during grain development. The omega-5 gliadins also have been associated with the food allergy wheat-dependent exercise-induced anaphylaxis (WDEIA). Recently, transgenic lines with reduced levels of omega-5 gliadins were developed using RNA interference (RNAi). These lines make it possible to determine whether changes in the levels of omega-5 gliadins in response to environmental conditions and agronomic inputs may be responsible for changes in flour end-use quality. Two transgenic wheat lines and a non-transgenic control were grown under a controlled temperature regimen with or without post-anthesis fertilizer and the protein composition of the resulting flour was analyzed by quantitative two-dimensional gel electrophoresis (2-DE). In one transgenic line, all 2-DE spots identified as omega-5 gliadins were substantially reduced without effects on other proteins. In the other transgenic line, the omega-5 gliadins were absent and there was a partial reduction in the levels of the omega-1,2 gliadins and the omega-1,2 chain-terminating gliadins as well as small changes in several other proteins. With the exception of the omega gliadins, the non-transgenic control and the transgenic plants showed similar responses to the fertilizer treatment. Protein contents of flour were determined by the fertilizer regimen and were similar in control and transgenic samples produced under each regimen while both mixing time and mixing tolerance were improved in flour from transgenic lines when plants received post-anthesis fertilizer. The data indicate that omega-5 gliadins have a negative effect on flour quality and suggest that changes in quality with the growth

  7. Field Trial and Molecular Characterization of RNAi-Transgenic Tomato Plants That Exhibit Resistance to Tomato Yellow Leaf Curl Geminivirus.

    Science.gov (United States)

    Fuentes, Alejandro; Carlos, Natacha; Ruiz, Yoslaine; Callard, Danay; Sánchez, Yadira; Ochagavía, María Elena; Seguin, Jonathan; Malpica-López, Nachelli; Hohn, Thomas; Lecca, Maria Rita; Pérez, Rosabel; Doreste, Vivian; Rehrauer, Hubert; Farinelli, Laurent; Pujol, Merardo; Pooggin, Mikhail M

    2016-03-01

    RNA interference (RNAi) is a widely used approach to generate virus-resistant transgenic crops. However, issues of agricultural importance like the long-term durability of RNAi-mediated resistance under field conditions and the potential side effects provoked in the plant by the stable RNAi expression remain poorly investigated. Here, we performed field trials and molecular characterization studies of two homozygous transgenic tomato lines, with different selection markers, expressing an intron-hairpin RNA cognate to the Tomato yellow leaf curl virus (TYLCV) C1 gene. The tested F6 and F4 progenies of the respective kanamycin- and basta-resistant plants exhibited unchanged field resistance to TYLCV and stably expressed the transgene-derived short interfering RNA (siRNAs) to represent 6 to 8% of the total plant small RNAs. This value outnumbered the average percentage of viral siRNAs in the nontransformed plants exposed to TYLCV-infested whiteflies. As a result of the RNAi transgene expression, a common set of up- and downregulated genes was revealed in the transcriptome profile of the plants selected from either of the two transgenic events. A previously unidentified geminivirus causing no symptoms of viral disease was detected in some of the transgenic plants. The novel virus acquired V1 and V2 genes from TYLCV and C1, C2, C3, and C4 genes from a distantly related geminivirus and, thereby, it could evade the repressive sequence-specific action of transgene-derived siRNAs. Our findings shed light on the mechanisms of siRNA-directed antiviral silencing in transgenic plants and highlight the applicability limitations of this technology as it may alter the transcriptional pattern of nontarget genes.

  8. Transgenic poplars with reduced lignin show impaired xylem conductivity, growth efficiency and survival

    Science.gov (United States)

    Steven L. Voelker; Barbara Lachenbruch; Frederick C. Meinzer; Peter Kitin; Steven H. Strauss

    2011-01-01

    We studied xylem anatomy and hydraulic architecture in 14 transgenic insertion events and a control line of hybrid poplar (Populus spp.) that varied in lignin content. Transgenic events had different levels of down-regulation of two genes encoding 4-coumarate:coenzyme A ligase (4CL). Two-year-old trees were characterized after...

  9. A transgenic mouse model for trilateral retinoblastoma

    NARCIS (Netherlands)

    O'Brien, J.M.; Marcus, D.M.; Bernards, R.A.; Carpenter, J.L.; Windle, J.J.; Mellon, P.; Albert, D.M.

    1990-01-01

    We present a murine model of trilateral retinoblastoma. Ocular retinoblastoma and central nervous system tumors are observed in a line of mice formed by the transgenic expression of SV40 T-antigen. An oncogenic protein known to bind to the retinoblastoma gene product (p105-Rb) is specifically

  10. Characterization of Agronomy, Grain Physicochemical Quality, and Nutritional Property of High-Lysine 35R Transgenic Rice with Simultaneous Modification of Lysine Biosynthesis and Catabolism.

    Science.gov (United States)

    Yang, Qingqing; Wu, Hongyu; Li, Qianfeng; Duan, Ruxu; Zhang, Changquan; Sun, Samuel Saiming; Liu, Qiaoquan

    2017-05-31

    Lysine is the first limiting essential amino acid in rice. We previously constructed a series of transgenic rice lines to enhance lysine biosynthesis (35S), down-regulate its catabolism (Ri), or simultaneously achieve both metabolic effects (35R). In this study, nine transgenic lines, three from each group, were selected for both field and animal feeding trials. The results showed that the transgene(s) caused no obvious effects on field performance and main agronomic traits. Mature seeds of transgenic line 35R-17 contained 48-60-fold more free lysine than in wild type and had slightly lower apparent amylose content and softer gel consistency. Moreover, a 35-day feeding experiment showed that the body weight gain, food efficiency, and protein efficiency ratio of rats fed the 35R-17 transgenic rice diet were improved when compared with those fed wild-type rice diet. These data will be useful for further evaluation and potential commercialization of 35R high-lysine transgenic rice.

  11. GmPGIP3 enhanced resistance to both take-all and common root rot diseases in transgenic wheat.

    Science.gov (United States)

    Wang, Aiyun; Wei, Xuening; Rong, Wei; Dang, Liang; Du, Li-Pu; Qi, Lin; Xu, Hui-Jun; Shao, Yanjun; Zhang, Zengyan

    2015-05-01

    Take-all (caused by the fungal pathogen Gaeumannomyces graminis var. tritici, Ggt) and common root rot (caused by Bipolaris sorokiniana) are devastating root diseases of wheat (Triticum aestivum L.). Development of resistant wheat cultivars has been a challenge since no resistant wheat accession is available. GmPGIP3, one member of polygalacturonase-inhibiting protein (PGIP) family in soybean (Glycine max), exhibited inhibition activity against fungal endopolygalacturonases (PGs) in vitro. In this study, the GmPGIP3 transgenic wheat plants were generated and used to assess the effectiveness of GmPGIP3 in protecting wheat from the infection of Ggt and B. sorokiniana. Four independent transgenic lines were identified by genomic PCR, Southern blot, and reverse transcription PCR (RT-PCR). The introduced GmPGIP3 was integrated into the genomes of these transgenic lines and could be expressed. The expressing GmPGIP3 protein in these transgenic wheat lines could inhibit the PGs produced by Ggt and B. sorokiniana. The disease response assessments postinoculation showed that the GmPGIP3-expressing transgenic wheat lines displayed significantly enhanced resistance to both take-all and common root rot diseases caused by the infection of Ggt and B. sorokiniana. These data suggested that GmPGIP3 is an attractive gene resource in improving resistance to both take-all and common root rot diseases in wheat.

  12. Accurate measurement of transgene copy number in crop plants using droplet digital PCR.

    Science.gov (United States)

    Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger

    2017-06-01

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one- and two-copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  13. Zebrafish transgenic line huORFZ is an effective living bioindicator for detecting environmental toxicants.

    Directory of Open Access Journals (Sweden)

    Hung-Chieh Lee

    Full Text Available Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50, huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+, cadmium (Cd2+ and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants.

  14. Zebrafish Transgenic Line huORFZ Is an Effective Living Bioindicator for Detecting Environmental Toxicants

    Science.gov (United States)

    Chu, Chien; Li, Hong-Ping; Tsai, Huai-Jen

    2014-01-01

    Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50), huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+), cadmium (Cd2+) and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants. PMID:24594581

  15. Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

    DEFF Research Database (Denmark)

    Fromont-Racine, M; Bucchini, D; Madsen, O

    1990-01-01

    Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....

  16. Durable field resistance to wheat yellow mosaic virus in transgenic wheat containing the antisense virus polymerase gene.

    Science.gov (United States)

    Chen, Ming; Sun, Liying; Wu, Hongya; Chen, Jiong; Ma, Youzhi; Zhang, Xiaoxiang; Du, Lipu; Cheng, Shunhe; Zhang, Boqiao; Ye, Xingguo; Pang, Junlan; Zhang, Xinmei; Li, Liancheng; Andika, Ida B; Chen, Jianping; Xu, Huijun

    2014-05-01

    Wheat yellow mosaic virus (WYMV) has spread rapidly and causes serious yield losses in the major wheat-growing areas in China. Because it is vectored by the fungus-like organism Polymyxa graminis that survives for long periods in soil, it is difficult to eliminate by conventional crop management or fungicides. There is also only limited resistance in commercial cultivars. In this research, fourteen independent transgenic events were obtained by co-transformation with the antisense NIb8 gene (the NIb replicase of WYMV) and a selectable gene bar. Four original transgenic lines (N12, N13, N14 and N15) and an offspring line (N12-1) showed high and durable resistance to WYMV in the field. Four resistant lines were shown to have segregated and only contain NIb8 (without bar) by PCR and herbicide resistance testing in the later generations. Line N12-1 showed broad-spectrum resistance to WYMV isolates from different sites in China. After growing in the infested soil, WYMV could not be detected by tissue printing and Western blot assays of transgenic wheat. The grain yield of transgenic wheat was about 10% greater than the wild-type susceptible control. Northern blot and small RNA deep sequencing analyses showed that there was no accumulation of small interfering RNAs targeting the NIb8 gene in transgenic wheat plants, suggesting that transgene RNA silencing, a common mechanism of virus-derived disease resistance, is not involved in the process of WYMV resistance. This durable and broad-spectrum resistance to WYMV in transgenic wheat will be useful for alleviating the damage caused by WYMV. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  17. Arabidopsis AtPAP1 transcription factor induces anthocyanin production in transgenic Taraxacum brevicorniculatum.

    Science.gov (United States)

    Qiu, Jian; Sun, Shuquan; Luo, Shiqiao; Zhang, Jichuan; Xiao, Xianzhou; Zhang, Liqun; Wang, Feng; Liu, Shizhong

    2014-04-01

    This study developed a new purple coloured Taraxacum brevicorniculatum plant through genetic transformation using the Arabidopsis AtPAP1 gene, which overproduced anthocyanins in its vegetative tissues. Rubber-producing Taraxacum plants synthesise high-quality natural rubber (NR) in their roots and so are a promising alternative global source of this raw material. A major factor in its commercialization is the need for multipurpose exploitation of the whole plant. To add value to the aerial tissues, red/purple plants of the rubber-producing Taraxacum brevicorniculatum species were developed through heterologous expression of the production of anthocyanin pigment 1 (AtPAP1) transcription factor from Arabidopsis thaliana. The vegetative tissue of the transgenic plants showed an average of a 48-fold increase in total anthocyanin content over control levels, but with the exception of pigmentation, the transgenic plants were phenotypically comparable to controls and displayed similar growth vigor. Southern blot analysis confirmed that the AtPAP1 gene had been integrated into the genome of the high anthocyanin Taraxacum plants. The AtPAP1 expression levels were estimated by quantitative real-time PCR and were highly correlated with the levels of total anthocyanins in five independent transgenic lines. High levels of three cyanidin glycosides found in the purple plants were characterized by high performance liquid chromatography-mass spectrum analysis. The presence of NR was verified by NMR and infrared spectroscopy, and confirmed that NR biosynthesis had not been affected in the transgenic Taraxacum lines. In addition, other major phenylpropanoid products such as chlorogenic acid and quercetin glycosides were also enhanced in the transgenic Taraxacum. The red/purple transgenic Taraxacum lines described in this study would increase the future application of the species as a rubber-producing crop due to its additional health benefits.

  18. Comparative Genomic Analysis of Transgenic Poplar Dwarf Mutant Reveals Numerous Differentially Expressed Genes Involved in Energy Flow

    Directory of Open Access Journals (Sweden)

    Su Chen

    2014-09-01

    Full Text Available In our previous research, the Tamarix androssowii LEA gene (Tamarix androssowii late embryogenesis abundant protein Mrna, GenBank ID: DQ663481 was transferred into Populus simonii × Populus nigra. Among the eleven transgenic lines, one exhibited a dwarf phenotype compared to the wild type and other transgenic lines, named dwf1. To uncover the mechanisms underlying this phenotype, digital gene expression libraries were produced from dwf1, wild-type, and other normal transgenic lines, XL-5 and XL-6. Gene expression profile analysis indicated that dwf1 had a unique gene expression pattern in comparison to the other two transgenic lines. Finally, a total of 1246 dwf1-unique differentially expressed genes were identified. These genes were further subjected to gene ontology and pathway analysis. Results indicated that photosynthesis and carbohydrate metabolism related genes were significantly affected. In addition, many transcription factors genes were also differentially expressed in dwf1. These various differentially expressed genes may be critical for dwarf mutant formation; thus, the findings presented here might provide insight for our understanding of the mechanisms of tree growth and development.

  19. Claviceps purpurea expressing polygalacturonases escaping PGIP inhibition fully infects PvPGIP2 wheat transgenic plants but its infection is delayed in wheat transgenic plants with increased level of pectin methyl esterification.

    Science.gov (United States)

    Volpi, Chiara; Raiola, Alessandro; Janni, Michela; Gordon, Anna; O'Sullivan, Donal M; Favaron, Francesco; D'Ovidio, Renato

    2013-12-01

    Claviceps purpurea is a biotrophic fungal pathogen of grasses causing the ergot disease. The infection process of C. purpurea on rye flowers is accompanied by pectin degradation and polygalacturonase (PG) activity represents a pathogenicity factor. Wheat is also infected by C. purpurea and we tested whether the presence of polygalacturonase inhibiting protein (PGIP) can affect pathogen infection and ergot disease development. Wheat transgenic plants expressing the bean PvPGIP2 did not show a clear reduction of disease symptoms when infected with C. purpurea. To ascertain the possible cause underlying this lack of improved resistance of PvPGIP2 plants, we expressed both polygalacturonases present in the C. purpurea genome, cppg1 and cppg2 in Pichia pastoris. In vitro assays using the heterologous expressed PGs and PvPGIP2 showed that neither PG is inhibited by this inhibitor. To further investigate the role of PG in the C. purpurea/wheat system, we demonstrated that the activity of both PGs of C. purpurea is reduced on highly methyl esterified pectin. Finally, we showed that this reduction in PG activity is relevant in planta, by inoculating with C. purpurea transgenic wheat plants overexpressing a pectin methyl esterase inhibitor (PMEI) and showing a high degree of pectin methyl esterification. We observed reduced disease symptoms in the transgenic line compared with null controls. Together, these results highlight the importance of pectin degradation for ergot disease development in wheat and sustain the notion that inhibition of pectin degradation may represent a possible route to control of ergot in cereals. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  20. Characterization of transgenic tobacco plants containing bacterial bphC gene and study of their phytoremediation ability.

    Science.gov (United States)

    Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas

    2014-01-01

    Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.

  1. Overexpression of wheat lipid transfer protein gene TaLTP5 increases resistances to Cochliobolus sativus and Fusarium graminearum in transgenic wheat.

    Science.gov (United States)

    Zhu, Xiuliang; Li, Zhao; Xu, Huijun; Zhou, Miaoping; Du, Lipu; Zhang, Zengyan

    2012-08-01

    The fungus Cochliobolus sativus is the main pathogen of common root rot, a serious soil-borne disease of wheat (Triticum aestivum L.). The fungus Fusarium graminearum is the primary pathogen of Fusarium head blight, a devastating disease of wheat worldwide. In this study, the wheat lipid transfer protein gene, TaLTP5, was cloned and evaluated for its ability to suppress disease development in transgenic wheat. TaLTP5 expression was induced after C. sativus infection. The TaLTP5 expression vector, pA25-TaLTP5, was constructed and bombarded into Chinese wheat variety Yangmai 18. Six TaLTP5 transgenic wheat lines were established and characterized. PCR and Southern blot analyses indicated that the introduced TaLTP5 gene was integrated into the genomes of six transgenic wheat lines by distinct patterns, and heritable. RT-PCR and real-time quantitative RT-PCR revealed that the TaLTP5 gene was over-expressed in the transgenic wheat lines compared to segregants lacking the transgene and wild-type wheat plants. Following challenge with C. sativus or F. graminearum, all six transgenic lines overexpressing TaLTP5 exhibited significantly enhanced resistance to both common root rot and Fusarium head blight compared to the untransformed wheat Yangmai 18.

  2. Transgene-induced gene silencing is not affected by a change in ploidy level.

    Directory of Open Access Journals (Sweden)

    Daniela Pignatta

    Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.

  3. Changes in oxidative stress in transgenic RNAi ACO1 tomato fruit during ripening

    Science.gov (United States)

    Eglous, Najat Mohamed; Ali, Zainon Mohd; Hassan, Maizom; Zainal, Zamri

    2013-11-01

    Tomato (Solanum Lycopersicum L.) is the second most cultivated vegetable in the world and widely used as a system for studying the role of ethylene during fruit ripening. Our objective was to study the oxidative stress and antioxidative metabolism during ripening of non transgenic tomato and transgenic line-21 tomato which reduced ethylene. The line-21 of transgenic tomato plants (RNAi ACO1) had lower ethylene production and longer shelf-life more than 32 days as compared to the wild-type fruits which have very short shelf-life. In this study, tomato fruit were divided into five different stages (MG: mature green 5%, B: breaker 25%, T: turning 50%, O: orange75%, RR: red ripe100%). The activity of lipoxygenase (LOX) and lipid peroxidation (MDA) were measured to assess changes in oxidative stress. The LOX activity and MDA content decreased significantly obtaining 2.6-fold and 1.2-fold, respectively, as compared to the wild type fruit. However, superoxide dismutase (SOD) and catalase (CAT) activities were increased to 1.9 and 1.2 folds from the mature green to the fully ripe stage in transgenic tomatoes. Furthermore, the wild type tomato increases 1.3 in SOD and 1.6 in CAT activities. The overall results indicate that the wild type tomato fruit showed a faster rate of ripening, parallel to decline in the rate of enzymatic antioxidative systems as compared to the transgenic line-21 tomato fruit. In addition, the results show that the antioxidant capacity is improved during the ripening process and is accompanied by an increase in the oxidative stress.

  4. Tetracycline-inducible system for regulation of skeletal muscle-specific gene expression in transgenic mice

    Science.gov (United States)

    Grill, Mischala A.; Bales, Mark A.; Fought, Amber N.; Rosburg, Kristopher C.; Munger, Stephanie J.; Antin, Parker B.

    2003-01-01

    Tightly regulated control of over-expression is often necessary to study one aspect or time point of gene function and, in transgenesis, may help to avoid lethal effects and complications caused by ubiquitous over-expression. We have utilized the benefits of an optimized tet-on system and a modified muscle creatine kinase (MCK) promoter to generate a skeletal muscle-specific, doxycycline (Dox) controlled over-expression system in transgenic mice. A DNA construct was generated in which the codon optimized reverse tetracycline transactivator (rtTA) was placed under control of a skeletal muscle-specific version of the mouse MCK promoter. Transgenic mice containing this construct expressed rtTA almost exclusively in skeletal muscles. These mice were crossed to a second transgenic line containing a bi-directional promoter centered on a tet responder element driving both a luciferase reporter gene and a tagged gene of interest; in this case the calpain inhibitor calpastatin. Compound hemizygous mice showed high level, Dox dependent muscle-specific luciferase activity often exceeding 10,000-fold over non-muscle tissues of the same mouse. Western and immunocytochemical analysis demonstrated similar Dox dependent muscle-specific induction of the tagged calpastatin protein. These findings demonstrate the effectiveness and flexibility of the tet-on system to provide a tightly regulated over-expression system in adult skeletal muscle. The MCKrtTA transgenic lines can be combined with other transgenic responder lines for skeletal muscle-specific over-expression of any target gene of interest.

  5. Development of marker-free transgenic lettuce resistant to Mirafiori lettuce big-vein virus.

    Science.gov (United States)

    Kawazu, Yoichi; Fujiyama, Ryoi; Imanishi, Shunsuke; Fukuoka, Hiroyuki; Yamaguchi, Hirotaka; Matsumoto, Satoru

    2016-10-01

    Lettuce big-vein disease caused by Mirafiori lettuce big-vein virus (MLBVV) is found in major lettuce production areas worldwide, but highly resistant cultivars have not yet been developed. To produce MLBVV-resistant marker-free transgenic lettuce that would have a transgene with a promoter and terminator of lettuce origin, we constructed a two T-DNA binary vector, in which the first T-DNA contained the selectable marker gene neomycin phosphotransferase II, and the second T-DNA contained the lettuce ubiquitin gene promoter and terminator and inverted repeats of the coat protein (CP) gene of MLBVV. This vector was introduced into lettuce cultivars 'Watson' and 'Fuyuhikari' by Agrobacterium tumefaciens-mediated transformation. Regenerated plants (T0 generation) that were CP gene-positive by PCR analysis were self-pollinated, and 312 T1 lines were analyzed for resistance to MLBVV. Virus-negative plants were checked for the CP gene and the marker gene, and nine lines were obtained which were marker-free and resistant to MLBVV. Southern blot analysis showed that three of the nine lines had two copies of the CP gene, whereas six lines had a single copy and were used for further analysis. Small interfering RNAs, which are indicative of RNA silencing, were detected in all six lines. MLBVV infection was inhibited in all six lines in resistance tests performed in a growth chamber and a greenhouse, resulting in a high degree of resistance to lettuce big-vein disease. Transgenic lettuce lines produced in this study could be used as resistant cultivars or parental lines for breeding.

  6. In vitro culture may be the major contributing factor for transgenic versus nontransgenic proteomic plant differences.

    Science.gov (United States)

    Fonseca, Cátia; Planchon, Sébastien; Serra, Tânia; Chander, Subhash; Saibo, Nelson J M; Renaut, Jenny; Oliveira, M Margarida; Batista, Rita

    2015-01-01

    Identification of differences between genetically modified plants and their original counterparts plays a central role in risk assessment strategy. Our main goal was to better understand the relevance of transgene presence, genetic, and epigenetic changes induced by transgene insertion, and in vitro culture in putative unintended differences between a transgenic and its comparator. Thus, we have used multiplex fluorescence 2DE coupled with MS to characterize the proteome of three different rice lines (Oryza sativa L. ssp. japonica cv. Nipponbare): a control conventional line (C), an Agrobacterium-transformed transgenic line (Ta) and a negative segregant (NSb). We observed that Ta and NSb appeared identical (with only one spot differentially abundant--fold difference ≥ 1.5), contrasting with the control (49 spots with fold difference ≥ 1.5, in both Ta and NSb vs. control). Given that in vitro culture was the only event in common between Ta and NSb, we hypothesize that in vitro culture stress was the most relevant condition contributing for the observed proteomic differences. MS protein identification support our hypothesis, indicating that Ta and NSb lines adjusted their metabolic pathways and altered the abundance of several stress related proteins in order to cope with in vitro culture. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. The better growth phenotype of DvGS1-transgenic arabidopsis thaliana is attributed to the improved efficiency of nitrogen assimilation

    Directory of Open Access Journals (Sweden)

    Zhu Chenguang

    2015-01-01

    Full Text Available The overexpression of the algal glutamine synthetase (GS gene DvGS1 in Arabidopsis thaliana resulted in higher plant biomass and better growth phenotype. The purpose of this study was to recognize the biological mechanism for the growth improvement of DvGS1-transgenic Arabidopsis. A series of molecular and biochemical investigations related to nitrogen and carbon metabolism in the DvGS1-transgenic line was conducted. Analysis of nitrogen use efficiency (NUE-related gene transcription and enzymatic activity revealed that the transcriptional level and enzymatic activity of the genes encoding GS, glutamate synthase, glutamate dehydrogenase, alanine aminotransferase and aspartate aminotransferase, were significantly upregulated, especially from leaf tissues of the DvGS1-transgenic line under two nitrate conditions. The DvGS1-transgenic line showed increased total nitrogen content and decreased carbon: nitrogen ratio compared to wild-type plants. Significant reduced concentrations of free nitrate, ammonium, sucrose, glucose and starch, together with higher concentrations of total amino acids, individual amino acids (glutamate, aspartate, asparagine, methionine, soluble proteins and fructose in leaf tissues confirmed that the DvGS1-transgenic line demonstrated a higher efficiency of nitrogen assimilation, which subsequently affected carbon metabolism. These improved metabolisms of nitrogen and carbon conferred the DvGS1-transgenic Arabidopsis higher NUE, more biomass and better growth phenotype compared with the wild-type plants.

  8. Characterisation of the nociceptive phenotype of suppressible galanin overexpressing transgenic mice

    Directory of Open Access Journals (Sweden)

    Wynick David

    2010-10-01

    Full Text Available Abstract The neuropeptide galanin is widely expressed in both the central and peripheral nervous systems and is involved in many diverse biological functions. There is a substantial data set that demonstrates galanin is upregulated after injury in the DRG, spinal cord and in many brain regions where it plays a predominantly antinociceptive role in addition to being neuroprotective and pro-regenerative. To further characterise the role of galanin following nerve injury, a novel transgenic line was created using the binary transgenic tet-off system, to overexpress galanin in galaninergic tissue in a suppressible manner. The double transgenic mice express significantly more galanin in the DRG one week after sciatic nerve section (axotomy compared to WT mice and this overexpression is suppressible upon administration of doxycycline. Phenotypic analysis revealed markedly attenuated allodynia when galanin is overexpressed and an increase in allodynia following galanin suppression. This novel transgenic line demonstrates that whether galanin expression is increased at the time of nerve injury or only after allodynia is established, the neuropeptide is able to reduce neuropathic pain behaviour. These new findings imply that administration of a galanin agonist to patients with established allodynia would be an effective treatment for neuropathic pain.

  9. Genetic load and transgenic mitigating genes in transgenic Brassica rapa (field mustard × Brassica napus (oilseed rape hybrid populations

    Directory of Open Access Journals (Sweden)

    Warwick Suzanne I

    2009-10-01

    Full Text Available Abstract Background One theoretical explanation for the relatively poor performance of Brassica rapa (weed × Brassica napus (crop transgenic hybrids suggests that hybridization imparts a negative genetic load. Consequently, in hybrids genetic load could overshadow any benefits of fitness enhancing transgenes and become the limiting factor in transgenic hybrid persistence. Two types of genetic load were analyzed in this study: random/linkage-derived genetic load, and directly incorporated genetic load using a transgenic mitigation (TM strategy. In order to measure the effects of random genetic load, hybrid productivity (seed yield and biomass was correlated with crop- and weed-specific AFLP genomic markers. This portion of the study was designed to answer whether or not weed × transgenic crop hybrids possessing more crop genes were less competitive than hybrids containing fewer crop genes. The effects of directly incorporated genetic load (TM were analyzed through transgene persistence data. TM strategies are proposed to decrease transgene persistence if gene flow and subsequent transgene introgression to a wild host were to occur. Results In the absence of interspecific competition, transgenic weed × crop hybrids benefited from having more crop-specific alleles. There was a positive correlation between performance and number of B. napus crop-specific AFLP markers [seed yield vs. marker number (r = 0.54, P = 0.0003 and vegetative dry biomass vs. marker number (r = 0.44, P = 0.005]. However under interspecific competition with wheat or more weed-like conditions (i.e. representing a situation where hybrid plants emerge as volunteer weeds in subsequent cropping systems, there was a positive correlation between the number of B. rapa weed-specific AFLP markers and seed yield (r = 0.70, P = 0.0001, although no such correlation was detected for vegetative biomass. When genetic load was directly incorporated into the hybrid genome, by inserting a

  10. Polycythemia in transgenic mice expressing the human erythropoietin gene

    International Nuclear Information System (INIS)

    Semenza, G.L.; Traystman, M.D.; Gearhart, J.D.; Antonarakis, S.E.

    1989-01-01

    Erythropoietin is a glycoprotein hormone that regulates mammalian erythropoiesis. To study the expression of the human erythropoietin gene, EPO, 4 kilobases of DNA encompassing the gene with 0.4 kilobase of 5' flanking sequence and 0.7 kilobase of 3' flanking sequence was microinjected into fertilized mouse eggs. Transgenic mice were generated that are polycythemic, with increased erythrocytic indices in peripheral blood, increased numbers of erythroid precursors in hematopoietic tissue, and increased serum erythropoietin levels. Transgenic homozygotes show a greater degree of polycythemia than do heterozygotes as well as striking extramedullary erythropoiesis. Human erythropoietin RNA was found not only in fetal liver, adult liver, and kidney but also in all other transgenic tissues analyzed. Anemia induced increased human erythropoietin RNA levels in liver but not kidney. These transgenic mice represent a unique model of polycythemia due to increased erythropoietin levels

  11. Cloning and functional characterization of MusaVND1 using transgenic banana plants.

    Science.gov (United States)

    Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

    2015-06-01

    Vascular related NAC (NAM, ATAF and CUC) domain-containing genes regulate secondary wall deposition and differentiation of xylem vessel elements. MusaVND1 is an ortholog of Arabidopsis VND1 and contains the highly conserved NAC domain. The expression of MusaVND1 is highest in developing corm and during lignification conditions, the increase in expression of MusaVND1 coincides with the expression of PAL, COMT and C4H genes. MusaVND1 encodes a nuclear localized protein as MusaVND1-GFP fusion protein gets localized to nucleus. Transient overexpression of MusaVND1 converts banana embryogenic cells to xylem vessel elements, with a final differentiation frequency of 33.54% at the end of tenth day. Transgenic banana plants overexpressing MusaVND1 showed stunted growth and were characterized by PCR and Southern blot analysis. Transgenic banana plants showed transdifferentiation of various types of cells into xylem vessel elements and ectopic deposition of lignin in cells of various plant organs such as leaf and corm. Tracheary element formation was seen in the cortical region of transgenic corm as well as in epidermal cells of leaves. Biochemical analysis indicates significantly higher levels of lignin and cellulose content in transgenic banana lines than control plants. MusaVND1 overexpressing transgenic banana plants showed elevated expression levels of genes involved in lignin and cellulose biosynthesis pathway. Further expression of different MYB transcription factors positively regulating secondary wall deposition was also up regulated in MusaVND1 transgenic lines.

  12. Transgenic tools to characterize neuronal properties of discrete populations of zebrafish neurons.

    Science.gov (United States)

    Satou, Chie; Kimura, Yukiko; Hirata, Hiromi; Suster, Maximiliano L; Kawakami, Koichi; Higashijima, Shin-ichi

    2013-09-01

    The developing nervous system consists of a variety of cell types. Transgenic animals expressing reporter genes in specific classes of neuronal cells are powerful tools for the study of neuronal network formation. We generated a wide variety of transgenic zebrafish that expressed reporter genes in specific classes of neurons or neuronal progenitors. These include lines in which neurons of specific neurotransmitter phenotypes expressed fluorescent proteins or Gal4, and lines in which specific subsets of the dorsal progenitor domain in the spinal cord expressed fluorescent proteins. Using these, we examined domain organization in the developing dorsal spinal cord, and found that there are six progenitor domains in zebrafish, which is similar to the domain organization in mice. We also systematically characterized neurotransmitter properties of the neurons that are produced from each domain. Given that reporter gene expressions occurs in a wide area of the nervous system in the lines generated, these transgenic fish should serve as powerful tools for the investigation of not only the neurons in the dorsal spinal cord but also neuronal structures and functions in many other regions of the nervous system.

  13. Overexpression of the IbMYB1 gene in an orange-fleshed sweet potato cultivar produces a dual-pigmented transgenic sweet potato with improved antioxidant activity.

    Science.gov (United States)

    Park, Sung-Chul; Kim, Yun-Hee; Kim, Sun Ha; Jeong, Yu Jeong; Kim, Cha Young; Lee, Joon Seol; Bae, Ji-Yeong; Ahn, Mi-Jeong; Jeong, Jae Cheol; Lee, Haeng-Soon; Kwak, Sang-Soo

    2015-04-01

    The R2R3-type protein IbMYB1 is a key regulator of anthocyanin biosynthesis in the storage roots of sweet potato [Ipomoea batatas (L.) Lam]. Previously, we demonstrated that IbMYB1 expression stimulated anthocyanin pigmentation in tobacco leaves and Arabidopsis. Here, we generated dual-pigmented transgenic sweet potato plants that accumulated high levels of both anthocyanins and carotenoids in a single sweet potato storage root. An orange-fleshed cultivar with high carotenoid levels was transformed with the IbMYB1 gene under the control of either the storage root-specific sporamin 1 (SPO1) promoter or the oxidative stress-inducible peroxidase anionic 2 (SWPA2) promoter. The SPO1-MYB transgenic lines exhibited higher anthocyanin levels in storage roots than empty vector control (EV) or SWPA2-MYB plants, but carotenoid content was unchanged. SWPA2-MYB transgenic lines exhibited higher levels of both anthocyanin and carotenoids than EV plants. Analysis of hydrolyzed anthocyanin extracts indicated that cyanidin and peonidin predominated in both overexpression lines. Quantitative reverse transcription-polymerase chain reaction analysis demonstrated that IbMYB1 expression in both IbMYB1 transgenic lines strongly induced the upregulation of several genes in the anthocyanin biosynthetic pathway, whereas the expression of carotenoid biosynthetic pathway genes varied between transgenic lines. Increased anthocyanin levels in transgenic plants also promoted the elevation of proanthocyanidin and total phenolic levels in fresh storage roots. Consequently, all IbMYB1 transgenic plants displayed much higher antioxidant activities than EV plants. In field cultivations, storage root yields varied between the transgenic lines. Taken together, our results indicate that overexpression of IbMYB1 is a highly promising strategy for the generation of transgenic plants with enhanced antioxidant capacity. © 2014 Scandinavian Plant Physiology Society.

  14. Nrl-Cre transgenic mouse mediates loxP recombination in developing rod photoreceptors.

    Science.gov (United States)

    Brightman, Diana S; Razafsky, David; Potter, Chloe; Hodzic, Didier; Chen, Shiming

    2016-03-01

    The developing mouse retina is a tractable model for studying neurogenesis and differentiation. Although transgenic Cre mouse lines exist to mediate conditional genetic manipulations in developing mouse retinas, none of them act specifically in early developing rods. For conditional genetic manipulations of developing retinas, a Nrl-Cre mouse line in which the Nrl promoter drives expression of Cre in rod precursors was created. The results showed that Nrl-Cre expression was specific to the retina where it drives rod-specific recombination with a temporal pattern similar to endogenous Nrl expression during retinal development. This Nrl-Cre transgene does not negatively impact retinal structure and function. Taken together, the data suggested that the Nrl-Cre mouse line was a valuable tool to drive Cre-mediated recombination specifically in developing rods. © 2016 Wiley Periodicals, Inc.

  15. Combination of Trichoderma harzianum endochitinase and a membrane-affecting fungicide on control of Alternaria leaf spot in transgenic broccoli plants.

    Science.gov (United States)

    Mora, A; Earle, E D

    2001-04-01

    Progeny from transgenic broccoli (cv. Green Comet) expressing a Trichoderma harzianum endochitinase gene were used to assess the interaction between endochitinase and the fungicide Bayleton in the control of Alternaria brassicicola. In vitro assays have shown synergistic effects of endochitinase and fungicides on fungal pathogens. Our study examined the in planta effects of endochitinase and Bayleton, individually and in combination. Two month old transgenic and non-transgenic plants were sprayed with ED50 levels of Bayleton and/or inoculated with an A. brassicicola spore suspension. Disease levels in non-sprayed transgenic plants were not statistically different from sprayed transgenic plants nor from sprayed non-transgenic controls. Thus endochitinase-transgenic plants alone provided a significant reduction of disease severity, comparable to the protection by fungicide on non-transgenic plants. Comparison of the expected additive and observed effects revealed no synergism between endochitinase and Bayleton (at ED50 level), and usually less than an additive effect. Some transgenic lines sprayed with fungicide at doses higher than ED50 showed resistance similar to the non-sprayed transgenic lines, again suggesting no synergistic effect. Lack of synergism may be due to incomplete digestion of the cell wall by endochitinase, so that the effect of Bayleton at the cell membrane is not enhanced.

  16. Expression of a radish defensin in transgenic wheat confers increased resistance to Fusarium graminearum and Rhizoctonia cerealis.

    Science.gov (United States)

    Li, Zhao; Zhou, Miaoping; Zhang, Zengyan; Ren, Lijuan; Du, Lipu; Zhang, Boqiao; Xu, Huijun; Xin, Zhiyong

    2011-03-01

    Fusarium head blight (scab), primarily caused by Fusarium graminearum, is a devastating disease of wheat (Triticum aestivum L.) worldwide. Wheat sharp eyespot, mainly caused by Rhizoctonia cerealis, is one of the major diseases of wheat in China. The defensin RsAFP2, a small cyteine-rich antifungal protein from radish (Raphanus sativus), was shown to inhibit growth in vitro of agronomically important fungal pathogens, such as F. graminearum and R. cerealis. The RsAFP2 gene was transformed into Chinese wheat variety Yangmai 12 via biolistic bombardment to assess the effectiveness of the defensin in protecting wheat from the fungal pathogens in multiple locations and years. The genomic PCR and Southern blot analyses indicated that RsAFP2 was integrated into the genomes of the transgenic wheat lines and heritable. RT-PCR and Western blot proved that the RsAFP2 was expressed in these transgenic wheat lines. Disease tests showed that four RsAFP2 transgenic lines (RA1-RA4) displayed enhanced resistance to F. graminearum compared to the untransformed Yangmai 12 and the null-segregated plants. Assays on Q-RT-PCR and disease severity showed that the express level of RsAFP2 was associated with the enhanced resistance degree. Two of these transgenic lines (RA1 and RA2) also exhibited enhanced resistance to R. cerealis. These results indicated that the expression of RsAFP2 conferred increased resistance to F. graminearum and R. cerealis in transgenic wheat.

  17. Enhanced salt tolerance of transgenic poplar plants expressing a manganese superoxide dismutase from Tamarix androssowii.

    Science.gov (United States)

    Wang, Yu Cheng; Qu, Guan Zheng; Li, Hong Yan; Wu, Ying Jie; Wang, Chao; Liu, Gui Feng; Yang, Chuan Ping

    2010-02-01

    Superoxide dismutases (SODs) play important role in stress tolerance of plants. In this study, an MnSOD gene (TaMnSOD) from Tamarix androssowii, under the control of the CaMV35S promoter, was introduced into poplar (Populus davidiana x P. bolleana). The physiological parameters, including SOD activity, malondialdehyde (MDA) content, relative electrical conductivity (REC) and relative weight gain, of transgenic lines and wild type (WT) plants, were measured and compared. The results showed that SOD activity was enhanced in transgenic plants, and the MDA content and REC were significantly decreased compared to WT plants when exposed to NaCl stress. In addition, the relative weight gains of the transgenic plants were 8- to 23-fold of those observed for WT plants after NaCl stress for 30 days. The data showed that the SOD activities that increased in transgenic lines are 1.3-4-folds of that increased in the WT plant when exposed to NaCl stress. Our analysis showed that increases in SOD activities as low as 0.15-fold can also significantly enhance salt tolerance in transgenic plants, suggesting an important role of increased SOD activity in plant salt tolerance

  18. Germline recombination in a novel Cre transgenic line, Prl3b1-Cre mouse.

    Science.gov (United States)

    Al-Soudy, Al-Sayed; Nakanishi, Tsuyoshi; Mizuno, Seiya; Hasegawa, Yoshikazu; Shawki, Hossam H; Katoh, Megumi C; Basha, Walaa A; Ibrahim, Abdelaziz E; El-Shemy, Hany A; Iseki, Hiroyoshi; Yoshiki, Atsushi; Hiromori, Youhei; Nagase, Hisamitsu; Takahashi, Satoru; Oishi, Hisashi; Sugiyama, Fumihiro

    2016-07-01

    Spermatogenesis is a complex and highly regulated process by which spermatogonial stem cells differentiate into spermatozoa. To better understand the molecular mechanisms of the process, the Cre/loxP system has been widely utilized for conditional gene knockout in mice. In this study, we generated a transgenic mouse line that expresses Cre recombinase under the control of the 2.5 kbp of the Prolactin family 3, subfamily b, member 1 (Prl3b1) gene promoter (Prl3b1-cre). Prl3b1 was initially reported to code for placental lactogen 2 (PL-2) protein in placenta along with increased expression toward the end of pregnancy. PL-2 was found to be expressed in germ cells in the testis, especially in spermatocytes. To analyze the specificity and efficiency of Cre recombinase activity in Prl3b1-cre mice, the mice were mated with reporter R26GRR mice, which express GFP ubiquitously before and tdsRed exclusively after Cre recombination. The systemic examination of Prl3b1-cre;R26GRR mice revealed that tdsRed-positive cells were detected only in the testis and epididymis. Fluorescence imaging of Prl3b1-cre;R26GRR testes suggested that Cre-mediated recombination took place in the germ cells with approximately 74% efficiency determined by in vitro fertilization. In conclusion, our results suggest that the Prl3b1-cre mice line provides a unique resource to understand testicular germ-cell development. genesis 54:389-397, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Tie-1-directed expression of Cre recombinase in endothelial cells of embryoid bodies and transgenic mice

    DEFF Research Database (Denmark)

    Gustafsson, E; Brakebusch, C; Hietanen, K

    2001-01-01

    Tissue-specific gene inactivation using the Cre-loxP system has become an important tool to unravel functions of genes when the conventional null mutation is lethal. We report here the generation of a transgenic mouse line expressing Cre recombinase in endothelial cells. In order to avoid...... the production and screening of multiple transgenic lines we used embryonic stem cell and embryoid body technology to identify recombinant embryonic stem cell clones with high, endothelial-specific Cre activity. One embryonic stem cell clone that showed high Cre activity in endothelial cells was used to generate...... germline chimeras. The in vivo efficiency and specificity of the transgenic Cre was analysed by intercrossing the tie-1-Cre line with the ROSA26R reporter mice. At initial stages of vascular formation (E8-9), LacZ staining was detected in almost all cells of the forming vasculature. Between E10 and birth...

  20. Transgenic Overexpression of the Proprotein Convertase Furin Enhances Skin Tumor Growth

    Directory of Open Access Journals (Sweden)

    Jian Fu

    2012-04-01

    Full Text Available Furin, one of the members of the family of proprotein convertases (PCs, ubiquitously expressed as a type I membrane-bound proteinase, activates several proteins that contribute to tumor progression. In vitro studies using cancer cell lines and clinical specimens demonstrated that furin processes important substrates such as insulin-like growth factor 1 receptor (IGF-1R and transforming growth factor β, leading to increased tumor growth and progression. Despite the numerous studies associating furin with tumor development, its effects in preclinical models has not been comprehensively studied. In this study, we sought to determine the protumorigenic role of furin in vivo after a two-stage chemical carcinogenesis protocol in transgenic mice in which furin expression was targeted to the epidermal basal layer. We found that processing of the PC substrate IGF-1R and the proliferation rate of mouse epidermis was enhanced in transgenic mice when compared with their WT counterparts. Histopathologic diagnoses of the tumors demonstrated that furin transgenic mice (line F47 developed twice as many squamous carcinomas as the control, WT mice (P < .002. Similarly, tumors cells from transgenic mice were able to process PC substrates more efficiently than tumor cells from WT mice. Furthermore, furin expression resulted in a higher SCC volume in transgenic mice as well as an increase in the percentage of high-grade SCC, including poorly differentiated and spindle cell carcinomas. In conclusion, expression of furin in the basal layer of the epidermis increased tumor development and enhanced tumor growth, supporting the consideration of furin as a potential target for cancer treatment.

  1. Overexpression of a modiifed AM79 aroA gene in transgenic maize confers high tolerance to glyphosate

    Institute of Scientific and Technical Information of China (English)

    REN Zhen-jing; CAO Gao-yi; ZHANG Yu-wen; LIU Yan; LIU Yun-jun

    2015-01-01

    It has previously been shown that a bacterial 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene AM79 aroA can be a candidate gene to develop glyphosate-tolerant transgenic crops (Cao et al. 2012). In this study, AM79 aroA was redesigned using the plant biased codons and eliminating the motifs which would lead to the instability of mRNA, to create a synthetic gene that would be expressed highly in plant cel s. The redesigned and artiifcial y synthesized gene, named as mAM79, was cloned into plant expression vector pM3301UbiSpAM79, where mAM79 is fused with signal peptide sequence of pea rib-1,5-bisphospate carboxylase (rbcS) smal subunit and control ed by ubiquitin promoter. The plasmid was transformed into maize (Zea mays) immature embryos using Agrobacterium-mediated transformation method. Total 74 regenerated plants were obtained and PCR analysis showed that these transgenic plants had the integration of mAM79. Southern blot analysis was performed on the genomic DNA from four transgenic lines, and the result showed that one or two copies of mAM79 were integrated into maize genome. RT-PCR analysis result indicated that mAM79 was highly transcribed in transgenic maize plants. When sprayed with glyphosate, transgenic maize line AM85 and AM72 could tolerate 4-fold of commercial usage of glyphosate;however, al the non-transgenic maize plants were kil ed by glyphosate. The results in this study conifrmed that mAM79 could be used to develop glyphosate-tolerant maize, and the obtained transgenic maize lines could be used for the breeding of glyphosate-tolerant maize.

  2. Cellular, molecular and functional characterisation of YAC transgenic mouse models of Friedreich ataxia.

    Directory of Open Access Journals (Sweden)

    Sara Anjomani Virmouni

    Full Text Available Friedreich ataxia (FRDA is an autosomal recessive neurodegenerative disorder, caused by a GAA repeat expansion mutation within intron 1 of the FXN gene. We have previously established and performed preliminary characterisation of several human FXN yeast artificial chromosome (YAC transgenic FRDA mouse models containing GAA repeat expansions, Y47R (9 GAA repeats, YG8R (90 and 190 GAA repeats and YG22R (190 GAA repeats.We now report extended cellular, molecular and functional characterisation of these FXN YAC transgenic mouse models. FXN transgene copy number analysis of the FRDA mice demonstrated that the YG22R and Y47R lines each have a single copy of the FXN transgene while the YG8R line has two copies. Single integration sites of all transgenes were confirmed by fluorescence in situ hybridisation (FISH analysis of metaphase and interphase chromosomes. We identified significant functional deficits, together with a degree of glucose intolerance and insulin hypersensitivity, in YG8R and YG22R FRDA mice compared to Y47R and wild-type control mice. We also confirmed increased somatic GAA repeat instability in the cerebellum and brain of YG22R and YG8R mice, together with significantly reduced levels of FXN mRNA and protein in the brain and liver of YG8R and YG22R compared to Y47R.Together these studies provide a detailed characterisation of our GAA repeat expansion-based YAC transgenic FRDA mouse models that will help investigations of FRDA disease mechanisms and therapy.

  3. Transgenic Brassica juncea plants expressing MsrA1, a synthetic cationic antimicrobial peptide, exhibit resistance to fungal phytopathogens.

    Science.gov (United States)

    Rustagi, Anjana; Kumar, Deepak; Shekhar, Shashi; Yusuf, Mohd Aslam; Misra, Santosh; Sarin, Neera Bhalla

    2014-06-01

    Cationic antimicrobial peptides (CAPs) have shown potential against broad spectrum of phytopathogens. Synthetic versions with desirable properties have been modeled on these natural peptides. MsrA1 is a synthetic chimera of cecropin A and melittin CAPs with antimicrobial properties. We generated transgenic Brassica juncea plants expressing the msrA1 gene aimed at conferring fungal resistance. Five independent transgenic lines were evaluated for resistance to Alternaria brassicae and Sclerotinia sclerotiorum, two of the most devastating pathogens of B. juncea crops. In vitro assays showed inhibition by MsrA1 of Alternaria hyphae growth by 44-62 %. As assessed by the number and size of lesions and time taken for complete leaf necrosis, the Alternaria infection was delayed and restricted in the transgenic plants with the protection varying from 69 to 85 % in different transgenic lines. In case of S. sclerotiorum infection, the lesions were more severe and spread profusely in untransformed control compared with transgenic plants. The sclerotia formed in the stem of untransformed control plants were significantly more in number and larger in size than those present in the transgenic plants where disease protection of 56-71.5 % was obtained. We discuss the potential of engineering broad spectrum biotic stress tolerance by transgenic expression of CAPs in crop plants.

  4. THE SEGREGATION PATTERN OF INSECT RESISTANCE GENES IN THE PROGENIES AND CROSSES OF TRANSGENIC ROJOLELE RICE

    Directory of Open Access Journals (Sweden)

    Satoto Satoto

    2016-10-01

    Full Text Available Successful application of genetic transformation technique, especially in developing rice variety resistant to brown plant hopper and stem borer, will depend on transgene being expressed and the gene inherited in a stable and predictable manner. This study aimed to analyse transgene segregation pattern of the progenies and the crosses of transgenic rice cv. Rojolele harboring cry1Ab and gna genes. The third generation (T2 of fivetransgenic Rojolele events containing gna and/or cry1Ab were evaluated for two generations to identify the homozygous lines and to study their inheritance. The homozygous lines were selected based on the result of PCR technique. The segregation patterns of gna and cry1Ab were studied in eight F2 populations derived from Rojolele x transgenic Rojolele homozygous for cry1Ab and or gna and their reciprocal crosses. Data  resulted from PCR of F2 population were analysed using a Chi Square test. The study obtained six homozygous lines for gna, namely A22- 1-32, A22-1-37, C72-1-9, F11-1-48, K21-1-39, K21-1-48, and two homozygous lines for cry1Ab, namely K21-1-39 and K21- 1-48. Both cry1Ab and gna transgenes had been inherited through selfing and crossing with their wild type as indicated from the F1 containing gna and cry1Ab as many as 48.4% and 47.4%, respectively. In six of the eight crosses, gna was inherited in a 3:1 ratio consistent with Mendelian inheritance of a single dominant locus, while in the remaining two crosses, gna was segregated in a 1:1 ratio. The presence of cry1Ab in F2 populations also showed a 3:1 segregation ratio in all crosses. In the F2 population derived from F1 plant containing cry1Ab and gna, both transgenes segregated in a 9:3:3:1 dihybrid segregation ratio. This study will add to the diversity of genetic sources for insect resistance and allow further use of these transgenic lines for pyramiding resistance to brown plant hopper and stem borer or  separately in rice breeding programs whenever

  5. Expression of a potato antimicrobial peptide SN1 increases resistance to take-all pathogen Gaeumannomyces graminis var. tritici in transgenic wheat.

    Science.gov (United States)

    Rong, Wei; Qi, Lin; Wang, Jingfen; Du, Lipu; Xu, Huijun; Wang, Aiyun; Zhang, Zengyan

    2013-08-01

    Take-all, caused by soil-borne fungus Gaeumannomyces graminis var. tritici (Ggt), is a devastating root disease of wheat (Triticum aestivum) worldwide. Breeding resistant wheat cultivars is the most promising and reliable approach to protect wheat from take-all. Currently, no resistant wheat germplasm is available to breed cultivars using traditional methods. In this study, gene transformation was carried out using Snakin-1 (SN1) gene isolated from potato (Solanum tuberosum) because the peptide shows broad-spectrum antimicrobial activity in vitro. Purified SN1 peptide also inhibits in vitro the growth of Ggt mycelia. By bombardment-mediated method, the gene SN1 was transformed into Chinese wheat cultivar Yangmai 18 to generate SN1 transgenic wheat lines, which were used to assess the effectiveness of the SN1 peptide in protecting wheat from Ggt. Genomic PCR and Southern blot analyses indicated that the alien gene SN1 was integrated into the genomes of five transgenic wheat lines and heritable from T₀ to T₄ progeny. Reverse transcription-PCR and Western blot analyses showed that the introduced SN1 gene was transcribed and highly expressed in the five transgenic wheat lines. Following challenging with Ggt, disease test results showed that compared to segregants lacking the transgene and untransformed wheat plants, these five transgenic wheat lines expressing SN1 displayed significantly enhanced resistance to take-all. These results suggest that SN1 may be a potentially transgenic tool for improving the take-all resistance of wheat.

  6. A transgenic approach to study argininosuccinate synthetase gene expression

    Science.gov (United States)

    2014-01-01

    Background Argininosuccinate synthetase (ASS) participates in urea, nitric oxide and arginine production. Besides transcriptional regulation, a post-transcriptional regulation affecting nuclear precursor RNA stability has been reported. To study whether such post-transcriptional regulation underlines particular temporal and spatial ASS expression, and to investigate how human ASS gene behaves in a mouse background, a transgenic mouse system using a modified bacterial artificial chromosome carrying the human ASS gene tagged with EGFP was employed. Results Two lines of ASS-EGFP transgenic mice were generated: one with EGFP under transcriptional control similar to that of the endogenous ASS gene, another with EGFP under both transcriptional and post-transcriptional regulation as that of the endogenous ASS mRNA. EGFP expression in the liver, the organ for urea production, and in the intestine and kidney that are responsible for arginine biosynthesis, was examined. Organs taken from embryos E14.5 stage to young adult were examined under a fluorescence microscope either directly or after cryosectioning. The levels of EGFP and endogenous mouse Ass mRNAs were also quantified by S1 nuclease mapping. EGFP fluorescence and EGFP mRNA levels in both the liver and kidney were found to increase progressively from embryonic stage toward birth. In contrast, EGFP expression in the intestine was higher in neonates and started to decline at about 3 weeks after birth. Comparison between the EGFP profiles of the two transgenic lines indicated the developmental and tissue-specific regulation was mainly controlled at the transcriptional level. The ASS transgene was of human origin. EGFP expression in the liver followed essentially the mouse Ass pattern as evidenced by zonation distribution of fluorescence and the level of EGFP mRNA at birth. However, in the small intestine, Ass mRNA level declined sharply at 3 week of age, and yet substantial EGFP mRNA was still detectable at this stage

  7. Genomic localization of the Z/EG transgene in the mouse genome.

    Science.gov (United States)

    Colombo, Sophie; Kumasaka, Mayuko; Lobe, Corrinne; Larue, Lionel

    2010-02-01

    The Z/EG transgenic mouse line, produced by Novak et al., displays tissue-specific EGFP expression after Cre-mediated recombination. The autofluorescence of EGFP allows the visualization of cells of interest displaying Cre recombination. The initial construct was designed such that cells without Cre recombination express the beta-galactosidase marker, facilitating counterselection. We used inverse PCR to identify the site of integration of the Z/EG transgene, to improve the efficiency of homozygous Z/EG mouse production. Recombined cells produced large amounts of EGFP protein, resulting in higher levels of fluorescence and therefore greater contrast with nonrecombined cells. We mapped the transgene to the G1 region of chromosome 5. This random insertion was found to have occurred 230-bp upstream from the start codon of the Rasa4 gene. The insertion of the Z/EG transgene in the C57BL/6 genetic background had no effect on Rasa4 expression. Homozygous Z/EG mice therefore had no obvious phenotype. (c) 2009 Wiley-Liss, Inc.

  8. Transgenic plants: from first successes to future applications.

    Science.gov (United States)

    Van Lijsebettens, Mieke; Angenon, Geert; De Block, Marc

    2013-01-01

    This dialogue was held between the Guest Editors of the Special Issue on "Plant Transgenesis" of the Int. J. Dev. Biol. and Marc De Block. He was one of the first scientists worldwide to obtain transgenic plants transformed with the chimeric selectable marker genes encoding neomycin phosphotransferase and bialaphos that confer resistance against the antibiotic kanamycin and the herbicide Basta®/glufosinate, respectively at the Department of Genetics of Ghent University and, later on, at the spin-off company, Plant Genetic Systems. Today, these two genes are still the most frequently utilized markers in transgene technology. Marc De Block chose to work on the improvement of crops in an industrial environment to help realize the production of superior seeds or products. He was part of the team that developed the male sterility/restorer system in canola (Brassica napus var. napus) that led to the first hybrid lines to be commercialized as successful products of transgene technology. In more than 30 years of research, he developed transformation procedures for numerous crops, designed histochemical, biochemical and physiological assays to monitor plant performance, and made original and innovative contributions to plant biology. Presently, he considers transgenic research part of the toolbox for plant improvement and essential for basic plant research.

  9. Comparative carcass and tissue nutrient composition of transgenic Yorkshire pigs expressing phytase in the saliva and conventional Yorkshire pigs.

    Science.gov (United States)

    Forsberg, C W; Meidinger, R G; Ajakaiye, A; Murray, D; Fan, M Z; Mandell, I B; Phillips, J P

    2014-10-01

    A transgenic line of Yorkshire (YK) pigs named the Cassie (CA) line was produced with a low copy number phytase transgene inserted in the genome. The transgenic line efficiently digests P, Ca, and other major minerals of plant dietary origin. The objectives of this study were to 1) compare carcass and tissue nutrient composition and meat quality traits for third generation hemizygous CA line market BW finisher pigs (n = 24) with age-matched conventional YK finisher pigs (n = 24) and 2) examine effects of outbreeding with high-index conventional YK boars on modifying carcass leanness from the third to sixth generations in CA line finisher boars (n = 73) and gilts (n = 103). Cassie boars (n = 12) and CA gilts (n = 12) were fed diets without supplemental P and comparable numbers of age-matched YK boars and gilts fed diets containing supplement P were raised throughout the finisher phase. The pigs were slaughtered and then fabricated into commercial pork primals before meat composition and quality evaluation. Proximate and major micronutrient composition was determined on tissues including fat, kidney, lean, liver, and skin. The main difference observed was greater (P = 0.033) crude fat content in CA boar carcasses and increased (P phytase action rather than to insertion of the transgene. However, from a meat composition perspective, transgenic expression of phytase in the CA line of YK pigs had little overall effect on meat composition. Outbreeding of high-index CA gilts with high-index commercial YK boars linearly reduced (P = 0.002) back fat thickness with a corresponding linear increase (P = 0.001) in lean yield in finisher CA gilts, although no change in these parameters was observed in CA finisher boars. The increase in lean yield in CA gilts by selective breeding without affecting the level of salivary phytase activity documents the value of conventional genetic selection in conjunction with genetic modification.

  10. Genome-Wide Analysis of a TaLEA-Introduced Transgenic Populus simonii × Populus nigra Dwarf Mutant

    Directory of Open Access Journals (Sweden)

    Jing Jiang

    2012-03-01

    Full Text Available A dwarf mutant (dwf1 was obtained among 15 transgenic lines, when TaLEA (Tamarix androssowii late embryogenesis abundant gene was introduced into Populus simonii × Populus nigra by Agrobacterium tumefaciens-mediated transformation. Under the same growth conditions, dwf1 height was significantly reduced compared with the wild type and the other transgenic lines. Because only one transgenic line (dwf1 displayed the dwarf phenotype, we considered that T-DNA insertion sites may play a role in the mutant formation. The mechanisms underlying this effect were investigated using TAIL-PCR (thermal asymmetric interlaced PCR and microarrays methods. According to the TAIL-PCR results, two flanking sequences located on chromosome IV and VIII respectively, were cloned. The results indicated the integration of two independent T-DNA copies. We searched for the potential genes near to the T-DNA insertions. The nearest gene was a putative poplar AP2 transcription factor (GI: 224073210. Expression analysis showed that AP2 was up-regulated in dwf1 compared with the wild type and the other transgenic lines. According to the microarrays results, a total of 537 genes involved in hydrolase, kinase and transcription factor activities, as well as protein and nucleotide binding, showed significant alterations in gene expression. These genes were expressed in more than 60 metabolic pathways, including starch, sucrose, galactose and glycerolipid metabolism and phenylpropanoids and flavonoid biosyntheses. Our transcriptome and T-DNA insertion sites analyses might provide some useful insights into the dwarf mutant formation.

  11. Towards Transgenic Primates: What can we learn from mouse genetics?

    Institute of Scientific and Technical Information of China (English)

    KUANG Hui; WANG Phillip L.; TSIEN Joe Z.

    2009-01-01

    Considering the great physiological and behavioral similarities with humans, monkeys represent the ideal models not only for the study of complex cognitive behavior but also for the precUnical research and development of novel therapeutics for treating human diseases. Various powerful genetic tech-nologies initially developed for making mouse models are being explored for generating transgenic primate models. We review the latest genetic engineering technologies and discuss the potentials and limitations for systematic production of transgenic primates.

  12. Towards Transgenic Primates:What can we learn from mouse genetics?

    Institute of Scientific and Technical Information of China (English)

    WANG; Phillip; L.; TSIEN; Joe; Z.

    2009-01-01

    Considering the great physiological and behavioral similarities with humans,monkeys represent the ideal models not only for the study of complex cognitive behavior but also for the preclinical research and development of novel therapeutics for treating human diseases.Various powerful genetic tech-nologies initially developed for making mouse models are being explored for generating transgenic primate models.We review the latest genetic engineering technologies and discuss the potentials and limitations for systematic production of transgenic primates.

  13. Generation of doubled haploid transgenic wheat lines by microspore transformation.

    Directory of Open Access Journals (Sweden)

    Rhoda A T Brew-Appiah

    Full Text Available Microspores can be induced to develop homozygous doubled haploid plants in a single generation. In the present experiments androgenic microspores of wheat have been genetically transformed and developed into mature homozygous transgenic plants. Two different transformation techniques were investigated, one employing electroporation and the other co-cultivation with Agrobacterium tumefaciens. Different tissue culture and transfection conditions were tested on nine different wheat cultivars using four different constructs. A total of 19 fertile transformants in five genotypes from four market classes of common wheat were recovered by the two procedures. PCR followed by DNA sequencing of the products, Southern blot analyses and bio/histo-chemical and histological assays of the recombinant enzymes confirmed the presence of the transgenes in the T0 transformants and their stable inheritance in homozygous T1∶2 doubled haploid progenies. Several decisive factors determining the transformation and regeneration efficiency with the two procedures were determined: (i pretreatment of immature spikes with CuSO4 solution (500 mg/L at 4°C for 10 days; (ii electroporation of plasmid DNA in enlarged microspores by a single pulse of ∼375 V; (iii induction of microspores after transfection at 28°C in NPB-99 medium and regeneration at 26°C in MMS5 medium; (iv co-cultivation with Agrobacterium AGL-1 cells for transfer of plasmid T-DNA into microspores at day 0 for <24 hours; and (v elimination of AGL-1 cells after co-cultivation with timentin (200-400 mg/L.

  14. Resistance to BmNPV via overexpression of an exogenous gene controlled by an inducible promoter and enhancer in transgenic silkworm, Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Liang Jiang

    Full Text Available The hycu-ep32 gene of Hyphantria cunea NPV can inhibit Bombyx mori nucleopolyhedrovirus (BmNPV multiplication in co-infected cells, but it is not known whether the overexpression of the hycu-ep32 gene has an antiviral effect in the silkworm, Bombyx mori. Thus, we constructed four transgenic vectors, which were under the control of the 39 K promoter of BmNPV (39 KP, Bombyx mori A4 promoter (A4P, hr3 enhancer of BmNPV combined with 39 KP, and hr3 combined with A4P. Transgenic lines were created via embryo microinjection using practical diapause silkworm. qPCR revealed that the expression level of hycu-ep32 could be induced effectively after BmNPV infection in transgenic lines where hycu-ep32 was controlled by hr3 combined with 39 KP (i.e., HEKG. After oral inoculation of BmNPV with 3 × 10(5 occlusion bodies per third instar, the mortality with HEKG-B was approximately 30% lower compared with the non-transgenic line. The economic characteristics of the transgenic lines remained unchanged. These results suggest that overexpression of an exogenous antiviral gene controlled by an inducible promoter and enhancer is a feasible method for breeding silkworms with a high antiviral capacity.

  15. UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

    Directory of Open Access Journals (Sweden)

    Emanuela Chiarella

    Full Text Available Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6 where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in

  16. UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

    Science.gov (United States)

    Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni

    2014-01-01

    Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and

  17. An extensive phenotypic characterization of the hTNFα transgenic mice

    Directory of Open Access Journals (Sweden)

    Tugusheva Marina

    2007-12-01

    Full Text Available Abstract Background Tumor necrosis factor alpha (TNFα is implicated in a wide variety of pathological and physiological processes, including chronic inflammatory conditions, coronary artery disease, diabetes, obesity, and cachexia. Transgenic mice expressing human TNFα (hTNFα have previously been described as a model for progressive rheumatoid arthritis. In this report, we describe extensive characterization of an hTNFα transgenic mouse line. Results In addition to arthritis, these hTNFα transgenic mice demonstrated major alterations in body composition, metabolic rate, leptin levels, response to a high-fat diet, bone mineral density and content, impaired fertility and male sexual function. Many phenotypes displayed an earlier onset and a higher degree of severity in males, pointing towards a significant degree of sexual dimorphism in response to deregulated expression of TNFα. Conclusion These results highlight the potential usefulness of this transgenic model as a resource for studying the progressive effects of constitutively expressed low levels of circulating TNFα, a condition mimicking that observed in a number of human pathological conditions.

  18. Heart-specific expression of laminopathic mutations in transgenic zebrafish.

    Science.gov (United States)

    Verma, Ajay D; Parnaik, Veena K

    2017-07-01

    Lamins are key determinants of nuclear organization and function in the metazoan nucleus. Mutations in human lamin A cause a spectrum of genetic diseases that affect cardiac muscle and skeletal muscle as well as other tissues. A few laminopathies have been modeled using the mouse. As zebrafish is a well established model for the study of cardiac development and disease, we have investigated the effects of heart-specific lamin A mutations in transgenic zebrafish. We have developed transgenic lines of zebrafish expressing conserved lamin A mutations that cause cardiac dysfunction in humans. Expression of zlamin A mutations Q291P and M368K in the heart was driven by the zebrafish cardiac troponin T2 promoter. Homozygous mutant embryos displayed nuclear abnormalities in cardiomyocyte nuclei. Expression analysis showed the upregulation of genes involved in heart regeneration in transgenic mutant embryos and a cell proliferation marker was increased in adult heart tissue. At the physiological level, there was deviation of up to 20% from normal heart rate in transgenic embryos expressing mutant lamins. Adult homozygous zebrafish were fertile and did not show signs of early mortality. Our results suggest that transgenic zebrafish models of heart-specific laminopathies show cardiac regeneration and moderate deviations in heart rate during embryonic development. © 2017 International Federation for Cell Biology.

  19. Development of a convenient in vivo hepatotoxin assay using a transgenic zebrafish line with liver-specific DsRed expression.

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhang

    Full Text Available Previously we have developed a transgenic zebrafish line (LiPan with liver-specific red fluorescent protein (DsRed expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine] caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics and chlorphenamine (pain killer did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry

  20. Development of a Convenient In Vivo Hepatotoxin Assay Using a Transgenic Zebrafish Line with Liver-Specific DsRed Expression

    Science.gov (United States)

    Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan

    2014-01-01

    Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid

  1. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Directory of Open Access Journals (Sweden)

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  2. Efficient Recombinase-Mediated Cassette Exchange in hPSCs to Study the Hepatocyte Lineage Reveals AAVS1 Locus-Mediated Transgene Inhibition

    Directory of Open Access Journals (Sweden)

    Laura Ordovás

    2015-11-01

    Full Text Available Tools for rapid and efficient transgenesis in “safe harbor” loci in an isogenic context remain important to exploit the possibilities of human pluripotent stem cells (hPSCs. We created hPSC master cell lines suitable for FLPe recombinase-mediated cassette exchange (RMCE in the AAVS1 locus that allow generation of transgenic lines within 15 days with 100% efficiency and without random integrations. Using RMCE, we successfully incorporated several transgenes useful for lineage identification, cell toxicity studies, and gene overexpression to study the hepatocyte lineage. However, we observed unexpected and variable transgene expression inhibition in vitro, due to DNA methylation and other unknown mechanisms, both in undifferentiated hESC and differentiating hepatocytes. Therefore, the AAVS1 locus cannot be considered a universally safe harbor locus for reliable transgene expression in vitro, and using it for transgenesis in hPSC will require careful assessment of the function of individual transgenes.

  3. Identification of Secretory Odontoblasts Using DMP1-GFP Transgenic Mice

    Science.gov (United States)

    Balic, Anamaria; Mina, Mina

    2011-01-01

    Terminal differentiation of odontoblasts from dental papilla is a long process involving several intermediate steps and changes in the transcriptional profile and expression of proteins secreted by cells in the odontoblast lineage. Transgenic mouse lines in which GFP expression is under the control of tissue-and stage specific promoters have provided powerful experimental tools for identification and isolation of cells at specific stages of differentiation along a lineage. Our previous studies showed utilization of pOBCol3.6GFP and pOBCol2.3GFP animals for identification of odontoblasts at early and late stages of polarization respectively. In the present study we used the DMP1-GFP transgenic animal as an experimental model to examine its expression during the differentiation of odontoblasts from progenitor cells in vivo and in vitro. Our observations showed that DMP1-GFP transgene is first activated in secretory/functional odontoblasts engaged in secretion of predentin and then transiently expressed at high levels in newly differentiated odontoblasts. Expression of DMP1-GFP was down-regulated in highly differentiated odontoblasts. The temporal and spatial pattern of expression of DMP1-GFP transgene closely mimics the expression of endogenous DMP1. This transgenic animal will facilitate studies of gene expression and biological functions in secretory/functional odontoblasts. PMID:21172466

  4. Transgenic rice plants harboring an introduced potato proteinase inhibitor II gene are insect resistant.

    Science.gov (United States)

    Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R

    1996-04-01

    We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.

  5. GABAB Receptor Constituents Revealed by Tandem Affinity Purification from Transgenic Mice

    DEFF Research Database (Denmark)

    Bartoi, Tudor; Rigbolt, Kristoffer T G; Du, Dan

    2010-01-01

    lines that allow a straightforward biochemical isolation of GABA(B) receptors. The transgenic mice express GABA(B1) isoforms that contain sequences for a two-step affinity purification, in addition to their endogenous subunit repertoire. Comparative analyses of purified samples from the transgenic mice...... and wild-type control animals revealed two novel components of the GABA(B1) complex. One of the identified proteins, potassium channel tetramerization domain-containing protein 12, associates with heterodimeric GABA(B) receptors via the GABA(B2) subunit. In transfected hippocampal neurons, potassium...

  6. Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

    Directory of Open Access Journals (Sweden)

    Giulia Breveglieri

    2015-01-01

    Full Text Available Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6 carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a the transgenic integration region is located in mouse chromosome 7; (b the expression of the transgene is tissue specific; (c as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin αmu-globin2/βhu-globin2 and, more importantly, (d the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia.

  7. Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

    Science.gov (United States)

    Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2015-01-01

    Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

  8. Transformation of pecan and regeneration of transgenic plants.

    Science.gov (United States)

    McGranahan, G H; Leslie, C A; Dandekar, A M; Uratsu, S L; Yates, I E

    1993-09-01

    A gene transfer system developed for walnut (Juglans regia L.) was successfully applied to pecan (Carya illinoensis [Wang] K. Koch). Repetitively embryogenic somatic embryos derived from open-pollinated seed of 'Elliott', 'Wichita', and 'Schley' were co-cultivated with Agrobacterium strain EHA 101/pCGN 7001, which contains marker genes for beta-glucuronidase activity and resistance to kanamycin. Several modifications of the standard walnut transformation techniques were tested, including a lower concentration of kanamycin and a modified induction medium, but these treatments had no measurable effect on efficiency of transformation. Nineteen of the 764 viable inoculated embryos produced transgenic subclones; 13 of these were from the line 'Elliott'6, 3 from 'Schley'5/3, and 3 from 'Wichita'9. Transgenic embryos of 'Wichita'9 germinated most readily and three subclones were successfully micropropagated. Three transgenic plants of one of these subclones were obtained by grafting the tissue cultured shoots to seedling pecan rootstock in the greenhouse. Gene insertion, initially detected by GUS activity, was confirmed by detection of integrated T-DNA sequences using Southern analysis.

  9. Segregation and expression of transgenes in the progenies of Bt ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-04-17

    Apr 17, 2012 ... segregation was observed in BC1F1, BC1F2 and F2 populations derived .... randomly chosen at the tillering stage respectively and were ground .... Figure 2. Southern blot of Hind III-digested DNA from Bt transgenic rice line ...

  10. Expression Analysis of CB2-GFP BAC Transgenic Mice.

    Science.gov (United States)

    Schmöle, Anne-Caroline; Lundt, Ramona; Gennequin, Benjamin; Schrage, Hanna; Beins, Eva; Krämer, Alexandra; Zimmer, Till; Limmer, Andreas; Zimmer, Andreas; Otte, David-Marian

    2015-01-01

    The endocannabinoid system (ECS) is a retrograde messenger system, consisting of lipid signaling molecules that bind to at least two G-protein-coupled receptors, Cannabinoid receptor 1 and 2 (CB1 and 2). As CB2 is primarily expressed on immune cells such as B cells, T cells, macrophages, dendritic cells, and microglia, it is of great interest how CB2 contributes to immune cell development and function in health and disease. Here, understanding the mechanisms of CB2 involvement in immune-cell function as well as the trafficking and regulation of CB2 expressing cells are crucial issues. Up to now, CB2 antibodies produce unclear results, especially those targeting the murine protein. Therefore, we have generated BAC transgenic GFP reporter mice (CB2-GFPTg) to trace CB2 expression in vitro and in situ. Those mice express GFP under the CB2 promoter and display GFP expression paralleling CB2 expression on the transcript level in spleen, thymus and brain tissue. Furthermore, by using fluorescence techniques we show that the major sources for GFP-CB2 expression are B cells in spleen and blood and microglia in the brain. This novel CB2-GFP transgenic reporter mouse line represents a powerful resource to study CB2 expression in different cell types. Furthermore, it could be used for analyzing CB2-mediated mobilization and trafficking of immune cells as well as studying the fate of recruited immune cells in models of acute and chronic inflammation.

  11. Improved forage digestibility of tall fescue (Festuca arundinacea) by transgenic down-regulation of cinnamyl alcohol dehydrogenase.

    Science.gov (United States)

    Chen, Lei; Auh, Chung-Kyoon; Dowling, Paul; Bell, Jeremey; Chen, Fang; Hopkins, Andrew; Dixon, Richard A; Wang, Zeng-Yu

    2003-11-01

    Lignification of cell walls during plant development has been identified as the major factor limiting forage digestibility and concomitantly animal productivity. cDNA sequences encoding a key lignin biosynthetic enzyme, cinnamyl alcohol dehydrogenase (CAD), were cloned from the widely grown monocotyledonous forage species tall fescue (Festuca arundinacea Schreb.). Recombinant tall fescue CAD expressed in E. coli exhibited the highest V(max)/K(m) values when coniferaldehyde and sinapaldehyde were used as substrates. Transgenic tall fescue plants carrying either sense or antisense CAD gene constructs were obtained by microprojectile bombardment of single genotype-derived embryogenic suspension cells. Severely reduced levels of mRNA transcripts and significantly reduced CAD enzymatic activities were found in two transgenic plants carrying sense and antisense CAD transgenes, respectively. These CAD down-regulated transgenic lines had significantly decreased lignin content and altered ratios of syringyl (S) to guaiacyl (G), G to p-hydroxyphenyl (H) and S to H units. No significant changes in cellulose, hemicellulose, neutral sugar composition, p-coumaric acid and ferulic acid levels were observed in the transgenic plants. Increases of in vitro dry matter digestibility of 7.2-9.5% were achieved in the CAD down-regulated lines, thus providing a novel germplasm to be used for the development of grass cultivars with improved forage quality.

  12. Generation of single-copy transgenic mouse embryos directly from ES cells by tetraploid embryo complementation

    Directory of Open Access Journals (Sweden)

    Zhao Roong

    2001-12-01

    Full Text Available Abstract Background Transgenic mice have been used extensively to analyze gene function. Unfortunately, traditional transgenic procedures have only limited use in analyzing alleles that cause lethality because lines of founder mice cannot be established. This is frustrating given that such alleles often reveal crucial aspects of gene function. For this reason techniques that facilitate the generation of embryos expressing such alleles would be of enormous benefit. Although the transient generation of transgenic embryos has allowed limited analysis of lethal alleles, it is expensive, time consuming and technically challenging. Moreover a fundamental limitation with this approach is that each embryo generated is unique and transgene expression is highly variable due to the integration of different transgene copy numbers at random genomic sites. Results Here we describe an alternative method that allows the generation of clonal mouse embryos harboring a single-copy transgene at a defined genomic location. This was facilitated through the production of Hprt negative embryonic stem cells that allow the derivation of embryos by tetraploid embryo complementation. We show that targeting transgenes to the hprt locus in these ES cells by homologous recombination can be efficiently selected by growth in HAT medium. Moreover, embryos derived solely from targeted ES cells containing a single copy LacZ transgene under the control of the α-myosin heavy chain promoter exhibited the expected cardiac specific expression pattern. Conclusion Our results demonstrate that tetraploid embryo complementation by F3 hprt negative ES cells facilitates the generation of transgenic mouse embryos containing a single copy gene at a defined genomic locus. This approach is simple, extremely efficient and bypasses any requirement to generate chimeric mice. Moreover embryos generated by this procedure are clonal in that they are all derived from a single ES cell lines. This

  13. Comparative Study on Growth Performance of Transgenic (Over-Expressed OsNHX1 and Wild-Type Nipponbare under Different Salinity Regimes

    Directory of Open Access Journals (Sweden)

    Nurul Kahrani ISHAK

    2015-11-01

    Full Text Available Transgenic Nipponbare which over-expressed a Na+/H+ antiporter gene OsNHX1 was used to compare its growth performance, water status and photosynthetic efficiency with its wild type under varying salinity regimes. Chlorophyll content, quantum yield and photosynthetic rate were measured to assess the impact of salinity stress on photosynthetic efficiency for transgenic and wild-type Nipponbare. Effects of salinity on water status and gas exchange to both lines were studied by measuring water use efficiency, instantaneous transpiration rate and stomatal conductance. Dry shoot weight and leaf area were determined after three months of growth to assess the impacts of salinity on the growth of those two lines. Our study showed that both lines were affected by salinity stress, however, the transgenic line showed higher photosynthetic efficiency, better utilization of water, and better growth due to low transpiration rate and stomatal conductance. Reduction of photosynthetic efficiency exhibited by the wild-type Nipponbare was correlated to its poor growth under salinity stress.

  14. [TSA improve transgenic porcine cloned embryo development and transgene expression].

    Science.gov (United States)

    Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

    2011-07-01

    Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

  15. Construction and Quality Analysis of Transgenic Rehmannia glutinosa Containing TMV and CMV Coat Protein

    Directory of Open Access Journals (Sweden)

    Zhongqiu Teng

    2016-08-01

    Full Text Available Plant viruses, especially tobacco mosaic virus (TMV and cucumber mosaic virus (CMV are serious threats to Rehmannia glutinosa which is a “top grade” herb in China. In the present study, TMV- and CMV-resistant Rehmannia glutinosa Libosch. plants were constructed by transforming the protein (CP genes of TMV and CMV into Rehmannia glutinosa via a modified procedure of Agrobacterium tumefaciens-mediated transformation. Integration and expression of TMV CP and CMV CP transgenes in 2 lines, LBA-1 and LBA-2, were confirmed by PCR, Southern blot and RT-PCR. Both LBA-1 and LBA-2 were resistant to infection of homologous TMV and CMV strains. The quality of transgenic Rehmanniae Radix was evaluated based on fingerprint analysis and components quantitative analysis comparing with control root tubes. These results showed that chemical composition of transgenic Rehmanniae Radix were similar to non-transgenic ones, which demonstrated that the medical quality and biosafety of transgenic Rehmanniae Radix were equivalent to non-transgenic material when consumed as traditional Chinese medicinal (TCM.

  16. Development of transgenic wheat (Triticum aestivum L.) expressing avidin gene conferring resistance to stored product insects.

    Science.gov (United States)

    Abouseadaa, Heba H; Osman, Gamal H; Ramadan, Ahmed M; Hassanein, Sameh E; Abdelsattar, Mohamed T; Morsy, Yasser B; Alameldin, Hussien F; El-Ghareeb, Doaa K; Nour-Eldin, Hanan A; Salem, Reda; Gad, Adel A; Elkhodary, Soheir E; Shehata, Maher M; Mahfouz, Hala M; Eissa, Hala F; Bahieldin, Ahmed

    2015-07-22

    Wheat is considered the most important cereal crop all over the world. The wheat weevil Sitophilus granarius is a serious insect pests in much of the wheat growing area worldwide and is responsible for significant loss of yield. Avidin proteins has been proposed to function as plant defense agents against insect pests. A synthetic avidin gene was introduced into spring wheat (Triticum aestivum L.) cv. Giza 168 using a biolistic bombardment protocol. The presence and expression of the transgene in six selected T0 transgenic wheat lines were confirmed at the molecular level. Accumulation of avidin protein was detected in transgenic plants compared to non-transgenic plants. Avidin transgene was stably integrated, transcribed and translated as indicated by Southern blot, ELISA, and dot blot analyses, with a high level of expression in transgenic wheat seeds. However, no expression was detected in untransformed wheat seeds. Functional integrity of avidin was confirmed by insect bioassay. The results of bioassay using transgenic wheat plants challenged with wheat weevil revealed 100 % mortality of the insects reared on transgenic plants after 21 days. Transgenic wheat plants had improved resistance to Sitophilus granarius.

  17. Heterologous production of a ginsenoside saponin (compound K) and its precursors in transgenic tobacco impairs the vegetative and reproductive growth.

    Science.gov (United States)

    Gwak, Yu Shin; Han, Jung Yeon; Adhikari, Prakash Babu; Ahn, Chang Ho; Choi, Yong Eui

    2017-06-01

    Production of compound K (a ginsenoside saponin) and its precursors in transgenic tobacco resulted in stunted growth and seed set failure, which may be caused by strong autotoxicity of heterologously produced phytochemicals against the tobacco itself. Panax ginseng roots contain various saponins (ginsenosides), which are major bioactive compounds. A monoglucosylated saponin, compound K (20-O-(β-D-glucopyranosyl)-20(S)-protopanaxadiol), has high medicinal and cosmetic values but is present in undetectable amounts in naturally grown ginseng roots. The production of compound K (CK) requires complicated deglycosylation of ginsenosides using physicochemical and/or enzymatic degradation. In this work, we report the production of CK in transgenic tobacco by co-overexpressing three genes (PgDDS, CYP716A47 and UGT71A28) isolated from P. ginseng. Introduction and expression of the transgenes in tobacco lines were confirmed by genomic PCR and RT-PCR. All the lines of transgenic tobacco produced CK including its precursors, protopanaxadiol and dammarenediol-II (DD). The concentrations of CK in the leaves ranged from 1.55 to 2.64 µg/g dry weight, depending on the transgenic line. Interestingly, production of CK in tobacco brought stunted plant growth and gave rise to seed set failure. This seed set failure was caused by both long-styled flowers and abnormal pollen development in transgenic tobacco. Both CK and DD treatments highly suppressed in vitro germination and tube growth in wild-type pollens. Based on these results, metabolic engineering for CK production in transgenic tobacco was successfully achieved, but the production of CK and its precursors in tobacco severely affects vegetative and reproductive growth due to the cytotoxicity of phytochemicals that are heterologously produced in transgenic tobacco.

  18. Identification of NY-BR-1-specific CD4(+) T cell epitopes using HLA-transgenic mice.

    Science.gov (United States)

    Gardyan, Adriane; Osen, Wolfram; Zörnig, Inka; Podola, Lilli; Agarwal, Maria; Aulmann, Sebastian; Ruggiero, Eliana; Schmidt, Manfred; Halama, Niels; Leuchs, Barbara; von Kalle, Christof; Beckhove, Philipp; Schneeweiss, Andreas; Jäger, Dirk; Eichmüller, Stefan B

    2015-06-01

    Breast cancer represents the second most common cancer type worldwide and has remained the leading cause of cancer-related deaths among women. The differentiation antigen NY-BR-1 appears overexpressed in invasive mammary carcinomas compared to healthy breast tissue, thus representing a promising target antigen for T cell based tumor immunotherapy approaches. Since efficient immune attack of tumors depends on the activity of tumor antigen-specific CD4(+) effector T cells, NY-BR-1 was screened for the presence of HLA-restricted CD4(+) T cell epitopes that could be included in immunological treatment approaches. Upon NY-BR-1-specific DNA immunization of HLA-transgenic mice and functional ex vivo analysis, a panel of NY-BR-1-derived library peptides was determined that specifically stimulated IFNγ secretion among splenocytes of immunized mice. Following in silico analyses, four candidate epitopes were determined which were successfully used for peptide immunization to establish NY-BR-1-specific, HLA-DRB1*0301- or HLA-DRB1*0401-restricted CD4(+) T cell lines from splenocytes of peptide immunized HLA-transgenic mice. Notably, all four CD4(+) T cell lines recognized human HLA-DR-matched dendritic cells (DC) pulsed with lysates of NY-BR-1 expressing human tumor cells, demonstrating natural processing of these epitopes also within the human system. Finally, CD4(+) T cells specific for all four CD4(+) T cell epitopes were detectable among PBMC of breast cancer patients, showing that CD4(+) T cell responses against the new epitopes are not deleted nor inactivated by self-tolerance mechanisms. Our results present the first NY-BR-1-specific HLA-DRB1*0301- and HLA-DRB1*0401-restricted T cell epitopes that could be exploited for therapeutic intervention against breast cancer. © 2014 UICC.

  19. The Grape VlWRKY3 Gene Promotes Abiotic and Biotic Stress Tolerance in Transgenic Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Rongrong Guo

    2018-04-01

    Full Text Available WRKY transcription factors are known to play important roles in plant responses to various abiotic and biotic stresses. The grape WRKY gene, WRKY3 was previously reported to respond to salt and drought stress, as well as methyl jasmonate and ethylene treatments in Vitis labrusca × V. vinifera cv. ‘Kyoho.’ In the current study, WRKY3 from the ‘Kyoho’ grape cultivar was constitutively expressed in Arabidopsis thaliana under control of the cauliflower mosaic virus 35S promoter. The 35S::VlWRKY3 transgenic A. thaliana plants showed improved salt and drought stress tolerance during the germination, seedling and the mature plant stages. Various physiological traits related to abiotic stress responses were evaluated to gain further insight into the role of VlWRKY3, and it was found that abiotic stress caused less damage to the transgenic seedlings than to the wild-type (WT plants. VlWRKY3 over-expression also resulted in altered expression levels of abiotic stress-responsive genes. Moreover, the 35S::VlWRKY3 transgenic A. thaliana lines showed improved resistance to Golovinomyces cichoracearum, but increased susceptibility to Botrytis cinerea, compared with the WT plants. Collectively, these results indicate that VlWRKY3 plays important roles in responses to both abiotic and biotic stress, and modification of its expression may represent a strategy to enhance stress tolerance in crops.

  20. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    Science.gov (United States)

    Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong

    2016-01-01

    Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.

  1. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    Directory of Open Access Journals (Sweden)

    Shanshan Dong

    Full Text Available Pollen-mediated gene flow (PMGF is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.

  2. Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.

    Directory of Open Access Journals (Sweden)

    Liping Ke

    Full Text Available Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel. In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L and bentazon (4.2 µmol. A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.

  3. Transgenic rice plants expressing a fused protein of Cry1Ab/Vip3H has resistance to rice stem borers under laboratory and field conditions.

    Science.gov (United States)

    Chen, Yang; Tian, Jun-Ce; Shen, Zhi-Chen; Peng, Yu-Fa; Hu, Cui; Guo, Yu-Yuan; Ye, Gong-Yin

    2010-08-01

    Six transgenic rice, Oryza sativa L., lines (G6H1, G6H2, G6H3, G6H4, G6H5, and G6H6) expressing a fused Cry1Ab/Vip3H protein, were evaluated for resistance against the Asiatic rice borer, Chilo suppressalis (Walker) (Lepidoptera: Crambidae), and the stem borer Sesamia inferens (Walker) (Lepidoptera: Noctuidae) in the laboratory and field. The bioassay results indicated that the mortality of Asiatic rice borer and S. inferens neonate larvae on six transgenic lines from seedling to filling stage was up to 100% at 168 h after infestation. The cumulative feeding area by Asiatic rice borer neonate larvae on all transgenic lines was significantly reduced compared with the untransformed parental 'Xiushui 110' rice. A 2-yr field evaluation showed that damage during the vegetative stage (deadheart) or during the reproductive stage (whitehead) caused by Asiatic rice borer and S. inferens for transgenic lines was much lower than the control. For three lines (G6H1, G6H2, and G6H6), no damage was found during the entire growing period. Estimation of fused Cry1Ab/Vip3H protein concentrations using PathoScreen kit for Bt-Cry1Ab/1Ac protein indicated that the expression levels of Cry1Ab protein both in main stems (within the average range of 0.006-0.073% of total soluble protein) and their flag leaves (within the average range of 0.001-0.038% of total soluble protein) were significantly different among six transgenic lines at different developmental stages. Both laboratory and field researches suggested that the transgenic rice lines have considerable potential for protecting rice from attack by both stem borers.

  4. Generation and characterization of gsuα:EGFP transgenic zebrafish for evaluating endocrine-disrupting effects

    International Nuclear Information System (INIS)

    Cheng, Xiaoxia; Chen, Xiaowen; Jin, Xia; He, Jiangyan; Yin, Zhan

    2014-01-01

    The glycoprotein subunit α (gsuα) gene encodes the shared α subunit of the three pituitary heterodimeric glycoprotein hormones: follicle-stimulating hormone β (Fshβ), luteinizing hormone β (Lhβ) and thyroid stimulating hormone β (Tshβ). In our current study, we identified and characterized the promoter region of zebrafish gsuα and generated a stable gsuα:EGFP transgenic line, which recapitulated the endogenous gsuα expression in the early developing pituitary gland. A relatively conserved regulatory element set is presented in the promoter regions of zebrafish and three other known mammalian gsuα promoters. Our results also demonstrated that the expression patterns of the gsuα:EGFP transgene were all identical to those expression patterns of the endogenous gsuα expression in the pituitary tissue when our transgenic fish were treated with various endocrine chemicals, including forskolin (FSK), SP600125, trichostatin A (TSA), KClO 4 , dexamethasone (Dex), β-estradiol and progesterone. Thus, this gsuα:EGFP transgenic fish reporter line provides another valuable tool for investigating the lineage development of gsuα-expressing gonadotrophins and the coordinated regulation of various glycoprotein hormone subunit genes. These reporter fish can serve as a novel platform to perform screenings of endocrine-disrupting chemicals (EDCs) in vivo as well. - Highlights: • Identification of the promoter of zebrafish glycoprotein subunit α (gsuα) gene • Generation of stable transmission gsuα:EGFP transgenic zebrafish reporter • Demonstration of the recapitulation of the gsuα:EGFP and endogenous gsuα expression • Suggestion of the gsuα:EGFP transgenic zebrafish as a novel platform for EDC study

  5. Generation and characterization of gsuα:EGFP transgenic zebrafish for evaluating endocrine-disrupting effects

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Xiaoxia [Key Laboratory of Aquatic Biodiversity and Conservation of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei (China); University of Chinese Academy of Sciences, Beijing (China); Chen, Xiaowen; Jin, Xia; He, Jiangyan [Key Laboratory of Aquatic Biodiversity and Conservation of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei (China); Yin, Zhan, E-mail: zyin@ihb.ac.cn [Key Laboratory of Aquatic Biodiversity and Conservation of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei (China); Ningbo Laboratory, State Key Laboratory of Freshwater Ecology and Biotechnology (China)

    2014-07-01

    The glycoprotein subunit α (gsuα) gene encodes the shared α subunit of the three pituitary heterodimeric glycoprotein hormones: follicle-stimulating hormone β (Fshβ), luteinizing hormone β (Lhβ) and thyroid stimulating hormone β (Tshβ). In our current study, we identified and characterized the promoter region of zebrafish gsuα and generated a stable gsuα:EGFP transgenic line, which recapitulated the endogenous gsuα expression in the early developing pituitary gland. A relatively conserved regulatory element set is presented in the promoter regions of zebrafish and three other known mammalian gsuα promoters. Our results also demonstrated that the expression patterns of the gsuα:EGFP transgene were all identical to those expression patterns of the endogenous gsuα expression in the pituitary tissue when our transgenic fish were treated with various endocrine chemicals, including forskolin (FSK), SP600125, trichostatin A (TSA), KClO{sub 4}, dexamethasone (Dex), β-estradiol and progesterone. Thus, this gsuα:EGFP transgenic fish reporter line provides another valuable tool for investigating the lineage development of gsuα-expressing gonadotrophins and the coordinated regulation of various glycoprotein hormone subunit genes. These reporter fish can serve as a novel platform to perform screenings of endocrine-disrupting chemicals (EDCs) in vivo as well. - Highlights: • Identification of the promoter of zebrafish glycoprotein subunit α (gsuα) gene • Generation of stable transmission gsuα:EGFP transgenic zebrafish reporter • Demonstration of the recapitulation of the gsuα:EGFP and endogenous gsuα expression • Suggestion of the gsuα:EGFP transgenic zebrafish as a novel platform for EDC study.

  6. Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

    Science.gov (United States)

    Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K

    2014-01-01

    Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

  7. Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

    Directory of Open Access Journals (Sweden)

    Nidhi Thakur

    Full Text Available BACKGROUND: Expression of double strand RNA (dsRNA designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi, thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci upon oral feeding. The v-ATPase subunit A (v-ATPaseA coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. METHODOLOGY/PRINCIPAL FINDINGS: Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. CONCLUSIONS/SIGNIFICANCE: Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

  8. Nestin Reporter Transgene Labels Multiple Central Nervous System Precursor Cells

    Directory of Open Access Journals (Sweden)

    Avery S. Walker

    2010-01-01

    Full Text Available Embryonic neuroepithelia and adult subventricular zone (SVZ stem and progenitor cells express nestin. We characterized a transgenic line that expresses enhanced green fluorescent protein (eGFP specified to neural tissue by the second intronic enhancer of the nestin promoter that had several novel features. During embryogenesis, the dorsal telencephalon contained many and the ventral telencephalon few eGFP+ cells. eGFP+ cells were found in postnatal and adult neurogenic regions. eGFP+ cells in the SVZ expressed multiple phenotype markers, glial fibrillary acidic protein, Dlx, and neuroblast-specific molecules suggesting the transgene is expressed through the lineage. eGFP+ cell numbers increased in the SVZ after cortical injury, suggesting this line will be useful in probing postinjury neurogenesis. In non-neurogenic regions, eGFP was strongly expressed in oligodendrocyte progenitors, but not in astrocytes, even when they were reactive. This eGFP+ mouse will facilitate studies of proliferative neuroepithelia and adult neurogenesis, as well as of parenchymal oligodendrocytes.

  9. Rapid characterization of transgenic and non-transgenic soybean oils by chemometric methods using NIR spectroscopy

    Science.gov (United States)

    Luna, Aderval S.; da Silva, Arnaldo P.; Pinho, Jéssica S. A.; Ferré, Joan; Boqué, Ricard

    Near infrared (NIR) spectroscopy and multivariate classification were applied to discriminate soybean oil samples into non-transgenic and transgenic. Principal Component Analysis (PCA) was applied to extract relevant features from the spectral data and to remove the anomalous samples. The best results were obtained when with Support Vectors Machine-Discriminant Analysis (SVM-DA) and Partial Least Squares-Discriminant Analysis (PLS-DA) after mean centering plus multiplicative scatter correction. For SVM-DA the percentage of successful classification was 100% for the training group and 100% and 90% in validation group for non transgenic and transgenic soybean oil samples respectively. For PLS-DA the percentage of successful classification was 95% and 100% in training group for non transgenic and transgenic soybean oil samples respectively and 100% and 80% in validation group for non transgenic and transgenic respectively. The results demonstrate that NIR spectroscopy can provide a rapid, nondestructive and reliable method to distinguish non-transgenic and transgenic soybean oils.

  10. A rice chloroplast transit peptide sequence does not alter the cytoplasmic localization of sheep serotonin N-acetyltransferase expressed in transgenic rice plants.

    Science.gov (United States)

    Byeon, Yeong; Lee, Hyoung Yool; Lee, Kyungjin; Back, Kyoungwhan

    2014-09-01

    Ectopic overexpression of melatonin biosynthetic genes of animal origin has been used to generate melatonin-rich transgenic plants to examine the functional roles of melatonin in plants. However, the subcellular localization of these proteins expressed in the transgenic plants remains unknown. We studied the localization of sheep (Ovis aries) serotonin N-acetyltransferase (OaSNAT) and a translational fusion of a rice SNAT transit peptide to OaSNAT (TS:OaSNAT) in plants. Laser confocal microscopy analysis revealed that both OaSNAT and TS:OaSNAT proteins were localized to the cytoplasm even with the addition of the transit sequence to OaSNAT. Transgenic rice plants overexpressing the TS:OaSNAT fusion transgene exhibited high SNAT enzyme activity relative to untransformed wild-type plants, but lower activity than transgenic rice plants expressing the wild-type OaSNAT gene. Melatonin levels in both types of transgenic rice plant corresponded well with SNAT enzyme activity levels. The TS:OaSNAT transgenic lines exhibited increased seminal root growth relative to wild-type plants, but less than in the OaSNAT transgenic lines, confirming that melatonin promotes root growth. Seed-specific OaSNAT expression under the control of a rice prolamin promoter did not confer high levels of melatonin production in transgenic rice seeds compared with seeds from transgenic plants expressing OaSNAT under the control of the constitutive maize ubiquitin promoter. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. mlo-based powdery mildew resistance in hexaploid bread wheat generated by a non-transgenic TILLING approach.

    Science.gov (United States)

    Acevedo-Garcia, Johanna; Spencer, David; Thieron, Hannah; Reinstädler, Anja; Hammond-Kosack, Kim; Phillips, Andrew L; Panstruga, Ralph

    2017-03-01

    Wheat is one of the most widely grown cereal crops in the world and is an important food grain source for humans. However, wheat yields can be reduced by many abiotic and biotic stress factors, including powdery mildew disease caused by Blumeria graminis f.sp. tritici (Bgt). Generating resistant varieties is thus a major effort in plant breeding. Here, we took advantage of the non-transgenic Targeting Induced Lesions IN Genomes (TILLING) technology to select partial loss-of-function alleles of TaMlo, the orthologue of the barley Mlo (Mildew resistance locus o) gene. Natural and induced loss-of-function alleles (mlo) of barley Mlo are known to confer durable broad-spectrum powdery mildew resistance, typically at the expense of pleiotropic phenotypes such as premature leaf senescence. We identified 16 missense mutations in the three wheat TaMlo homoeologues, TaMlo-A1, TaMlo-B1 and TaMlo-D1 that each lead to single amino acid exchanges. Using transient gene expression assays in barley single cells, we functionally analysed the different missense mutants and identified the most promising candidates affecting powdery mildew susceptibility. By stacking of selected mutant alleles we generated four independent lines with non-conservative mutations in each of the three TaMlo homoeologues. Homozygous triple mutant lines and surprisingly also some of the homozygous double mutant lines showed enhanced, yet incomplete, Bgt resistance without the occurrence of discernible pleiotropic phenotypes. These lines thus represent an important step towards the production of commercial non-transgenic, powdery mildew-resistant bread wheat varieties. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  12. Transgenic mice display hair loss and regrowth overexpressing mutant Hr gene.

    Science.gov (United States)

    Zhu, Kuicheng; Xu, Cunshuan; Zhang, Jintao; Chen, Yingying; Liu, Mengduan

    2017-10-30

    Mutations in the hairless (Hr) gene in both mice and humans have been implicated in the development of congenital atrichia, but the role of Hr in skin and hair follicle (HF) biology remains unknown. Here, we established transgenic mice (TG) overexpressing mutant Hr to investigate its specific role in the development of HF. Three transgenic lines were successfully constructed, and two of them (TG3 and TG8) displayed a pattern of hair loss and regrowth with alternation in the expression of HR protein. The mutant Hr gene inhibited the expression of the endogenous gene in transgenic individuals, which led to the development of alopecia. Interestingly, the hair regrew with the increase in the endogenous expression levels resulting from decreased mutant Hr expression. The findings of our study indicate that the changes in the expression of Hr result in hair loss or regrowth.

  13. Overexpression of rice thaumatin-like protein (Ostlp gene in transgenic cassava results in enhanced tolerance to Colletotrichum gloeosporioides f. sp. manihotis

    Directory of Open Access Journals (Sweden)

    Patroba Odeny Ojola

    2018-06-01

    Full Text Available Cassava (Manihot esculenta Crantz is the most important staple food for more than 300 million people in Africa, and anthracnose disease caused by Colletotrichum gloeosporioides f. sp. manihotis is the most destructive fungal disease affecting cassava production in sub-Saharan Africa. The main objective of this study was to improve anthracnose resistance in cassava through genetic engineering. Transgenic cassava plants harbouring rice thaumatin-like protein (Ostlp gene, driven by the constitutive CaMV35S promoter, were generated using Agrobacterium-mediated transformation of friable embryogenic calli (FEC of cultivar TMS 60444. Molecular analysis confirmed the presence, integration, copy number of the transgene all the independent transgenic events. Semi-quantitative RT-PCR confirmed high expression levels of Ostlp in six transgenic lines tested. The antifungal activity of the transgene against Colletotrichum gloeosporioides pathogen was evaluated using the leaves and stem cuttings bioassay. The results demonstrated significantly delayed disease development and reduced size of necrotic lesions in leaves and stem cuttings of all transgenic lines compared to the leaves and stem cuttingss of non-transgenic control plants. Therefore, constitutive overexpression of rice thaumatin-like protein in transgenic cassava confers enhanced tolerance to the fungal pathogen C. gloeosporioides f. sp. manihotis. These results can therefore serve as an initial step towards genetic engineering of farmer-preffered cassava cultivars for resistance to anthracnose disease. Keywords: Colletotrichum gloeosporioides f. sp. manihotis, Thaumatin-like protein, Transgenic cassava

  14. Rapid Integration of Multi-copy Transgenes Using Optogenetic Mutagenesis in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Kentaro Noma

    2018-06-01

    Full Text Available Stably transmitted transgenes are indispensable for labeling cellular components and manipulating cellular functions. In Caenorhabditis elegans, transgenes are generally generated as inheritable multi-copy extrachromosomal arrays, which can be stabilized in the genome through a mutagenesis-mediated integration process. Standard methods to integrate extrachromosomal arrays primarily use protocols involving ultraviolet light plus trimethylpsoralen or gamma- or X-ray irradiation, which are laborious and time-consuming. Here, we describe a one-step integration method, following germline-mutagenesis induced by mini Singlet Oxygen Generator (miniSOG. Upon blue light treatment, miniSOG tagged to histone (Histone-miniSOG generates reactive oxygen species (ROS and induces heritable mutations, including DNA double-stranded breaks. We demonstrate that we can bypass the need to first establish extrachromosomal transgenic lines by coupling microinjection of desired plasmids with blue light illumination on Histone-miniSOG worms to obtain integrants in the F3 progeny. We consistently obtained more than one integrant from 12 injected animals in two weeks. This optogenetic approach significantly reduces the amount of time and labor for transgene integration. Moreover, it enables to generate stably expressed transgenes that cause toxicity in animal growth.

  15. The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

    Science.gov (United States)

    Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

    1998-10-01

    The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

  16. Galactose-extended glycans of antibodies produced by transgenic plants

    NARCIS (Netherlands)

    Bakker, H.; Bardor, M.; Molthoff, J.W.; Gomord, V.; Elbers, I.; Stevens, L.H.; Jordi, W.; Lommen, A.; Faye, L.; Lerouge, P.; Bosch, D.

    2001-01-01

    Plant-specific N-glycosylation can represent an important limitation for the use of recombinant glycoproteins of mammalian origin produced by transgenic plants. Comparison of plant and mammalian N-glycan biosynthesis indicates that β1,4-galactosyltransferase is the most important enzyme that is

  17. Mixtures of genetically modified wheat lines outperform monocultures.

    Science.gov (United States)

    Zeller, Simon L; Kalinina, Olena; Flynn, Dan F B; Schmid, Bernhard

    2012-09-01

    Biodiversity research shows that diverse plant communities are more stable and productive than monocultures. Similarly, populations in which genotypes with different pathogen resistance are mixed may have lower pathogen levels and thus higher productivity than genetically uniform populations. We used genetically modified (GM) wheat as a model system to test this prediction, because it allowed us to use genotypes that differed only in the trait pathogen resistance but were otherwise identical. We grew three such genotypes or lines in monocultures or two-line mixtures. Phenotypic measurements were taken at the level of individual plants and of entire plots (population level). We found that resistance to mildew increased with both GM richness (0, 1, or 2 Pm3 transgenes with different resistance specificities per plot) and GM concentration (0%, 50%, or 100% of all plants in a plot with a Pm3 transgene). Plots with two transgenes had 34.6% less mildew infection and as a consequence 7.3% higher seed yield than plots with one transgene. We conclude that combining genetic modification with mixed cropping techniques could be a promising approach to increase sustainability and productivity in agricultural systems, as the fitness cost of stacking transgenes within individuals may thus be avoided.

  18. Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24.

    Science.gov (United States)

    Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin

    2013-10-01

    Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

  19. RNAi-mediated resistance to SMV and BYMV in transgenic tobacco

    Directory of Open Access Journals (Sweden)

    Lo Thi Mai Thu

    2016-09-01

    Full Text Available Soybean mosaic virus (SMV and bean yellow mosaic virus (BYMV are two typical types of viruses that cause mosaic in soybean plants. Multiple viral infections at the same site can lead to 66% to 80% yield reduction. We have aimed to improve SMV and BYMV resistance in Vietnamese soybeans using gene transfer techniques under the mechanism of RNAi. In this study, we present newly generated transgenic tobacco plants carrying RNAi [CPi (SMV-BYMV] resistance to the two types of viruses; 73.08% of transgenic tobacco lines proved to be fully resistant to SMV and BYMV. In addition, the number of virus copies in transgenic tobacco plants was reduced on average by more than 51% compared to the control plants (wild type. This promising result shows the potential of transerring the CPi (SMV-BYMV structure in soybean to increase resistance of soybean to SMV and BYMV and advance the aims of antiviral soybean breeding in Vietnam.

  20. Dominant dwarfism in transgenic rats by targeting human growth hormone (GH) expression to hypothalamic GH-releasing factor neurons.

    OpenAIRE

    Flavell, D M; Wells, T; Wells, S E; Carmignac, D F; Thomas, G B; Robinson, I C

    1996-01-01

    Expression of human growth hormone (hGH) was targeted to growth hormone-releasing (GRF) neurons in the hypothalamus of transgenic rats. This induced dominant dwarfism by local feedback inhibition of GRF. One line, bearing a single copy of a GRF-hGH transgene, has been characterized in detail, and has been termed Tgr (for Transgenic growth-retarded). hGH was detected by immunocytochemistry in the brain, restricted to the median eminence of the hypothalamus. Low levels were also detected in the...

  1. Age and lesion-induced increases of GDNF transgene expression in brain following intracerebral injections of DNA nanoparticles.

    Science.gov (United States)

    Yurek, D M; Hasselrot, U; Cass, W A; Sesenoglu-Laird, O; Padegimas, L; Cooper, M J

    2015-01-22

    In previous studies that used compacted DNA nanoparticles (DNP) to transfect cells in the brain, we observed higher transgene expression in the denervated striatum when compared to transgene expression in the intact striatum. We also observed that long-term transgene expression occurred in astrocytes as well as neurons. Based on these findings, we hypothesized that the higher transgene expression observed in the denervated striatum may be a function of increased gliosis. Several aging studies have also reported an increase of gliosis as a function of normal aging. In this study we used DNPs that encoded for human glial cell line-derived neurotrophic factor (hGDNF) and either a non-specific human polyubiquitin C (UbC) or an astrocyte-specific human glial fibrillary acidic protein (GFAP) promoter. The DNPs were injected intracerebrally into the denervated or intact striatum of young, middle-aged or aged rats, and glial cell line-derived neurotrophic factor (GDNF) transgene expression was subsequently quantified in brain tissue samples. The results of our studies confirmed our earlier finding that transgene expression was higher in the denervated striatum when compared to intact striatum for DNPs incorporating either promoter. In addition, we observed significantly higher transgene expression in the denervated striatum of old rats when compared to young rats following injections of both types of DNPs. Stereological analysis of GFAP+ cells in the striatum confirmed an increase of GFAP+ cells in the denervated striatum when compared to the intact striatum and also an age-related increase; importantly, increases in GFAP+ cells closely matched the increases in GDNF transgene levels. Thus neurodegeneration and aging may lay a foundation that is actually beneficial for this particular type of gene therapy while other gene therapy techniques that target neurons are actually targeting cells that are decreasing as the disease progresses. Copyright © 2014 IBRO. Published by

  2. Expression of the Galanthus nivalis agglutinin (GNA) gene in transgenic potato plants confers resistance to aphids.

    Science.gov (United States)

    Mi, Xiaoxiao; Liu, Xue; Yan, Haolu; Liang, Lina; Zhou, Xiangyan; Yang, Jiangwei; Si, Huaijun; Zhang, Ning

    2017-01-01

    Aphids, the largest group of sap-sucking pests, cause significant yield losses in agricultural crops worldwide every year. The massive use of pesticides to combat this pest causes severe damage to the environment, putting in risk the human health. In this study, transgenic potato plants expressing Galanthus nivalis agglutinin (GNA) gene were developed using CaMV 35S and ST-LS1 promoters generating six transgenic lines (35S1-35S3 and ST1-ST3 corresponding to the first and second promoter, respectively). Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the GNA gene was expressed in leaves, stems and roots of transgenic plants under the control of the CaMV 35S promoter, while it was only expressed in leaves and stems under the control of the ST-LS1 promoter. The levels of aphid mortality after 5 days of the inoculation in the assessed transgenic lines ranged from 20 to 53.3%. The range of the aphid population in transgenic plants 15 days after inoculation was between 17.0±1.43 (ST2) and 36.6±0.99 (35S3) aphids per plant, which corresponds to 24.9-53.5% of the aphid population in non-transformed plants. The results of our study suggest that GNA expressed in transgenic potato plants confers a potential tolerance to aphid attack, which appears to be an alternative against the use of pesticides in the future. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  3. Single-Event Transgene Product Levels Predict Levels in Genetically Modified Breeding Stacks.

    Science.gov (United States)

    Gampala, Satyalinga Srinivas; Fast, Brandon J; Richey, Kimberly A; Gao, Zhifang; Hill, Ryan; Wulfkuhle, Bryant; Shan, Guomin; Bradfisch, Greg A; Herman, Rod A

    2017-09-13

    The concentration of transgene products (proteins and double-stranded RNA) in genetically modified (GM) crop tissues is measured to support food, feed, and environmental risk assessments. Measurement of transgene product concentrations in breeding stacks of previously assessed and approved GM events is required by many regulatory authorities to evaluate unexpected transgene interactions that might affect expression. Research was conducted to determine how well concentrations of transgene products in single GM events predict levels in breeding stacks composed of these events. The concentrations of transgene products were compared between GM maize, soybean, and cotton breeding stacks (MON-87427 × MON-89034 × DAS-Ø15Ø7-1 × MON-87411 × DAS-59122-7 × DAS-40278-9 corn, DAS-81419-2 × DAS-44406-6 soybean, and DAS-21023-5 × DAS-24236-5 × SYN-IR102-7 × MON-88913-8 × DAS-81910-7 cotton) and their component single events (MON-87427, MON-89034, DAS-Ø15Ø7-1, MON-87411, DAS-59122-7, and DAS-40278-9 corn, DAS-81419-2, and DAS-44406-6 soybean, and DAS-21023-5, DAS-24236-5, SYN-IR102-7, MON-88913-8, and DAS-81910-7 cotton). Comparisons were made within a crop and transgene product across plant tissue types and were also made across transgene products in each breeding stack for grain/seed. Scatter plots were generated comparing expression in the stacks to their component events, and the percent of variability accounted for by the line of identity (y = x) was calculated (coefficient of identity, I 2 ). Results support transgene concentrations in single events predicting similar concentrations in breeding stacks containing the single events. Therefore, food, feed, and environmental risk assessments based on concentrations of transgene products in single GM events are generally applicable to breeding stacks composed of these events.

  4. New Wistar Kyoto and spontaneously hypertensive rat transgenic models with ubiquitous expression of green fluorescent protein

    Directory of Open Access Journals (Sweden)

    Ana Isabel Garcia Diaz

    2016-04-01

    Full Text Available The Wistar Kyoto (WKY rat and the spontaneously hypertensive (SHR rat inbred strains are well-established models for human crescentic glomerulonephritis (CRGN and metabolic syndrome, respectively. Novel transgenic (Tg strains add research opportunities and increase scientific value to well-established rat models. We have created two novel Tg strains using Sleeping Beauty transposon germline transgenesis, ubiquitously expressing green fluorescent protein (GFP under the rat elongation factor 1 alpha (EF1a promoter on the WKY and SHR genetic backgrounds. The Sleeping Beauty system functioned with high transgenesis efficiency; 75% of new rats born after embryo microinjections were transgene positive. By ligation-mediated PCR, we located the genome integration sites, confirming no exonic disruption and defining a single or low copy number of the transgenes in the new WKY-GFP and SHR-GFP Tg lines. We report GFP-bright expression in embryos, tissues and organs in both lines and show preliminary in vitro and in vivo imaging data that demonstrate the utility of the new GFP-expressing lines for adoptive transfer, transplantation and fate mapping studies of CRGN, metabolic syndrome and other traits for which these strains have been extensively studied over the past four decades.

  5. Transgenic plants as green factories for vaccine production | Vinod ...

    African Journals Online (AJOL)

    Edible vaccine technology represents an alternative to fermentation based vaccine production system. Transgenic plants are used for the production of plant derived specific vaccines with native immunogenic properties stimulating both humoral and mucosal immune responses. Keeping in view the practical need of new ...

  6. Transgenic wheat expressing Thinopyrum intermedium MYB transcription factor TiMYB2R-1 shows enhanced resistance to the take-all disease.

    Science.gov (United States)

    Liu, Xin; Yang, Lihua; Zhou, Xianyao; Zhou, Miaoping; Lu, Yan; Ma, Lingjian; Ma, Hongxiang; Zhang, Zengyan

    2013-05-01

    The disease take-all, caused by the fungus Gaeumannomyces graminis, is one of the most destructive root diseases of wheat worldwide. Breeding resistant cultivars is an effective way to protect wheat from take-all. However, little progress has been made in improving the disease resistance level in commercial wheat cultivars. MYB transcription factors play important roles in plant responses to environmental stresses. In this study, an R2R3-MYB gene in Thinopyrum intermedium, TiMYB2R-1, was cloned and characterized. The gene sequence includes two exons and an intron. The expression of TiMYB2R-1 was significantly induced following G. graminis infection. An in vitro DNA binding assay proved that TiMYB2R-1 protein could bind to the MYB-binding site cis-element ACI. Subcellular localization assays revealed that TiMYB2R-1 was localized in the nucleus. TiMYB2R-1 transgenic wheat plants were generated, characterized molecularly, and evaluated for take-all resistance. PCR and Southern blot analyses confirmed that TiMYB2R-1 was integrated into the genomes of three independent transgenic wheat lines by distinct patterns and the transgene was heritable. Reverse transcription-PCR and western blot analyses revealed that TiMYB2R-1 was highly expressed in the transgenic wheat lines. Based on disease response assessments for three successive generations, the significantly enhanced resistance to take-all was observed in the three TiMYB2R-1-overexpressing transgenic wheat lines. Furthermore, the transcript levels of at least six wheat defence-related genes were significantly elevated in the TiMYB2R-1 transgenic wheat lines. These results suggest that engineering and overexpression of TiMYB2R-1 may be used for improving take-all resistance of wheat and other cereal crops.

  7. Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

    Science.gov (United States)

    Rao, Suryadevara S; Hildebrand, David

    2009-10-01

    The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

  8. Sequence similarity between the viral cp gene and the transgene in transgenic papayas Similaridade de seqüência entre o gene cp do vírus e do transgene presente em mamoeiros transgênicos

    Directory of Open Access Journals (Sweden)

    Manoel Teixeira Souza Júnior

    2005-05-01

    Full Text Available The Papaya ringspot virus (PRSV coat protein transgene present in 'Rainbow' and 'SunUp' papayas disclose high sequence similarity (>89% to the cp gene from PRSV BR and TH. Despite this, both isolates are able to break down the resistance in 'Rainbow', while only the latter is able to do so in 'SunUp'. The objective of this work was to evaluate the degree of sequence similarity between the cp gene in the challenge isolate and the cp transgene in transgenic papayas resistant to PRSV. The production of a hybrid virus containing the genome backbone of PRSV HA up to the Apa I site in the NIb gene, and downstream from there, the sequence of PRSV TH was undertaken. This hybrid virus, PRSV HA/TH, was obtained and used to challenge 'Rainbow', 'SunUp', and an R2 population derived from line 63-1, all resistant to PRSV HA. PRSV HA/TH broke down the resistance in both papaya varieties and in the 63-1 population, demonstrating that sequence similarity is a major factor in the mechanism of resistance used by transgenic papayas expressing the cp gene. A comparative analysis of the cp gene present in line 55-1 and 63-1-derived transgenic plants and in PRSV HA, BR, and TH was also performed.O gene da capa protéica (cp do vírus da mancha anelar do mamoeiro (Papaya ringspot virus, PRSV, presente nos mamoeiros 'Rainbow' e 'SunUp', tem alta similaridade de seqüência (>89% com o gene cp dos isolados PRSV BR e TH. Apesar deste alto grau de similaridade, ambos isolados são capazes de quebrar a resistência observada em 'Rainbow', ao passo que TH quebra a resistência em 'SunUp'. O objetivo deste trabalho foi avaliar o grau de similaridade de seqüência entre o gene cp do vírus desafiante e do transgene em mamoeiros transgênicos resistentes a PRSV. Produziu-se um vírus híbrido contendo o genoma do isolado PRSV HA até o sítio de restrição Apa I no gene NIb, e, a partir deste ponto, este vírus continha o genoma do isolado PRSV TH. PRSV HA/TH foi utilizado

  9. Expression Analysis of CB2-GFP BAC Transgenic Mice.

    Directory of Open Access Journals (Sweden)

    Anne-Caroline Schmöle

    Full Text Available The endocannabinoid system (ECS is a retrograde messenger system, consisting of lipid signaling molecules that bind to at least two G-protein-coupled receptors, Cannabinoid receptor 1 and 2 (CB1 and 2. As CB2 is primarily expressed on immune cells such as B cells, T cells, macrophages, dendritic cells, and microglia, it is of great interest how CB2 contributes to immune cell development and function in health and disease. Here, understanding the mechanisms of CB2 involvement in immune-cell function as well as the trafficking and regulation of CB2 expressing cells are crucial issues. Up to now, CB2 antibodies produce unclear results, especially those targeting the murine protein. Therefore, we have generated BAC transgenic GFP reporter mice (CB2-GFPTg to trace CB2 expression in vitro and in situ. Those mice express GFP under the CB2 promoter and display GFP expression paralleling CB2 expression on the transcript level in spleen, thymus and brain tissue. Furthermore, by using fluorescence techniques we show that the major sources for GFP-CB2 expression are B cells in spleen and blood and microglia in the brain. This novel CB2-GFP transgenic reporter mouse line represents a powerful resource to study CB2 expression in different cell types. Furthermore, it could be used for analyzing CB2-mediated mobilization and trafficking of immune cells as well as studying the fate of recruited immune cells in models of acute and chronic inflammation.

  10. A non-specific effect associated with conditional transgene expression based on Cre-loxP strategy in mice.

    Directory of Open Access Journals (Sweden)

    Linghua Qiu

    Full Text Available Transgenes flanked by loxP sites have been widely used to generate transgenic mice where the transgene expression can be controlled spatially and temporally by Cre recombinase. Data from this approach has led to important conclusions in cancer, neurodevelopment and neurodegeneration. Using this approach to conditionally express micro RNAs (miRNAs in mice, we found that Cre-mediated recombination in neural progenitor cells caused microcephaly in five of our ten independent transgenic lines. This effect was not associated with the types or the quantity of miRNAs being expressed, nor was it associated with specific target knockdown. Rather, it was correlated with the presence of multiple tandem transgene copies and inverted (head-to-head or tail-to-tail transgene repeats. The presence of these inverted repeats caused a high level of cell death in the ventricular zone of the embryonic brain, where Cre was expressed. Therefore, results from this Cre-loxP approach to generate inducible transgenic alleles must be interpreted with caution and conclusions drawn in previous reports may need reexamination.

  11. Improved tolerance toward fungal diseases in transgenic Cavendish banana (Musa spp. AAA group) cv. Grand Nain.

    Science.gov (United States)

    Vishnevetsky, Jane; White, Thomas L; Palmateer, Aaron J; Flaishman, Moshe; Cohen, Yuval; Elad, Yigal; Velcheva, Margarita; Hanania, Uri; Sahar, Nachman; Dgani, Oded; Perl, Avihai

    2011-02-01

    The most devastating disease currently threatening to destroy the banana industry worldwide is undoubtedly Sigatoka Leaf spot disease caused by Mycosphaerella fijiensis. In this study, we developed a transformation system for banana and expressed the endochitinase gene ThEn-42 from Trichoderma harzianum together with the grape stilbene synthase (StSy) gene in transgenic banana plants under the control of the 35S promoter and the inducible PR-10 promoter, respectively. The superoxide dismutase gene Cu,Zn-SOD from tomato, under control of the ubiquitin promoter, was added to this cassette to improve scavenging of free radicals generated during fungal attack. A 4-year field trial demonstrated several transgenic banana lines with improved tolerance to Sigatoka. As the genes conferring Sigatoka tolerance may have a wide range of anti-fungal activities we also inoculated the regenerated banana plants with Botrytis cinerea. The best transgenic lines exhibiting Sigatoka tolerance were also found to have tolerance to B. cinerea in laboratory assays.

  12. Pyramiding expression of maize genes encoding phosphoenolpyruvate carboxylase (PEPC) and pyruvate orthophosphate dikinase (PPDK) synergistically improve the photosynthetic characteristics of transgenic wheat.

    Science.gov (United States)

    Zhang, HuiFang; Xu, WeiGang; Wang, HuiWei; Hu, Lin; Li, Yan; Qi, XueLi; Zhang, Lei; Li, ChunXin; Hua, Xia

    2014-09-01

    Using particle bombardment transformation, we introduced maize pepc cDNA encoding phosphoenolpyruvate carboxylase (PEPC) and ppdk cDNA encoding pyruvate orthophosphate dikinase (PPDK) into the C3 crop wheat to generate transgenic wheat lines carrying cDNA of pepc (PC lines), ppdk (PK lines) or both (PKC lines). The integration, transcription, and expression of the foreign genes were confirmed by Southern blot, Real-time quantitative reverse transcription PCR (Q-RT-PCR), and Western blot analysis. Q-RT-PCR results indicated that the average relative expression levels of pepc and ppdk in the PKC lines reached 10 and 4.6, respectively, compared to their expressions in untransformed plants (set to 1). The enzyme activities of PEPC and PPDK in the PKC lines were 4.3- and 2.1-fold higher, respectively, than in the untransformed control. The maximum daily net photosynthetic rates of the PKC, PC, and PK lines were enhanced by 26.4, 13.3, and 4.5%, respectively, whereas the diurnal accumulations of photosynthesis were 21.3, 13.9, and 6.9%, respectively, higher than in the control. The Fv/Fm of the transgenic plants decreased less than in the control under high temperature and high light conditions (2 weeks after anthesis), suggesting that the transgenic wheat transports more absorbed light energy into a photochemical reaction. The exogenous maize C4-specific pepc gene was more effective than ppdk at improving the photosynthetic performance and yield characteristics of transgenic wheat, while the two genes showed a synergistic effect when they were transformed into the same genetic background, because the PKC lines exhibited improved photosynthetic and physiological traits.

  13. Expression of multiple resistance genes enhances tolerance to environmental stressors in transgenic poplar (Populus × euramericana 'Guariento'.

    Directory of Open Access Journals (Sweden)

    Xiaohua Su

    Full Text Available Commercial and non-commercial plants face a variety of environmental stressors that often cannot be controlled. In this study, transgenic hybrid poplar (Populus × euramericana 'Guariento' harboring five effector genes (vgb, SacB, JERF36, BtCry3A and OC-I were subjected to drought, salinity, waterlogging and insect stressors in greenhouse or laboratory conditions. Field trials were also conducted to investigate long-term effects of transgenic trees on insects and salt tolerance in the transformants. In greenhouse studies, two transgenic lines D5-20 and D5-21 showed improved growth, as evidenced by greater height and basal diameter increments and total biomass relative to the control plants after drought or salt stress treatments. The improved tolerance to drought and salt was primarily attributed to greater instantaneous water use efficiency (WUEi in the transgenic trees. The chlorophyll concentrations tended to be higher in the transgenic lines under drought or saline conditions. Transformed trees in drought conditions accumulated more fructan and proline and had increased Fv/Fm ratios (maximum quantum yield of photosystem II under waterlogging stress. Insect-feeding assays in the laboratory revealed a higher total mortality rate and lower exuviation index of leaf beetle [Plagiodera versicolora (Laicharting] larvae fed with D5-21 leaves, suggesting enhanced insect resistance in the transgenic poplar. In field trials, the dominance of targeted insects on 2-year-old D5-21 transgenic trees was substantially lower than that of the controls, indicating enhanced resistance to Coleoptera. The average height and DBH (diameter at breast height of 2.5-year-old transgenic trees growing in naturally saline soil were 3.80% and 4.12% greater than those of the control trees, but these increases were not significant. These results suggested that multiple stress-resistance properties in important crop tree species could be simultaneously improved, although

  14. Constitutive expression of a fungus-inducible carboxylesterase improves disease resistance in transgenic pepper plants.

    Science.gov (United States)

    Ko, Moonkyung; Cho, Jung Hyun; Seo, Hyo-Hyoun; Lee, Hyun-Hwa; Kang, Ha-Young; Nguyen, Thai Son; Soh, Hyun Cheol; Kim, Young Soon; Kim, Jeong-Il

    2016-08-01

    Resistance against anthracnose fungi was enhanced in transgenic pepper plants that accumulated high levels of a carboxylesterase, PepEST in anthracnose-susceptible fruits, with a concurrent induction of antioxidant enzymes and SA-dependent PR proteins. A pepper esterase gene (PepEST) is highly expressed during the incompatible interaction between ripe fruits of pepper (Capsicum annuum L.) and a hemibiotrophic anthracnose fungus (Colletotrichum gloeosporioides). In this study, we found that exogenous application of recombinant PepEST protein on the surface of the unripe pepper fruits led to a potentiated state for disease resistance in the fruits, including generation of hydrogen peroxide and expression of pathogenesis-related (PR) genes that encode mostly small proteins with antimicrobial activity. To elucidate the role of PepEST in plant defense, we further developed transgenic pepper plants overexpressing PepEST under the control of CaMV 35S promoter. Molecular analysis confirmed the establishment of three independent transgenic lines carrying single copy of transgenes. The level of PepEST protein was estimated to be approximately 0.002 % of total soluble protein in transgenic fruits. In response to the anthracnose fungus, the transgenic fruits displayed higher expression of PR genes, PR3, PR5, PR10, and PepThi, than non-transgenic control fruits did. Moreover, immunolocalization results showed concurrent localization of ascorbate peroxidase (APX) and PR3 proteins, along with the PepEST protein, in the infected region of transgenic fruits. Disease rate analysis revealed significantly low occurrence of anthracnose disease in the transgenic fruits, approximately 30 % of that in non-transgenic fruits. Furthermore, the transgenic plants also exhibited resistance against C. acutatum and C. coccodes. Collectively, our results suggest that overexpression of PepEST in pepper confers enhanced resistance against the anthracnose fungi by activating the defense signaling

  15. Focal glomerulosclerosis in proviral and c-fms transgenic mice links Vpr expression to HIV-associated nephropathy

    International Nuclear Information System (INIS)

    Dickie, Peter; Roberts, Amanda; Uwiera, Richard; Witmer, Jennifer; Sharma, Kirti; Kopp, Jeffrey B.

    2004-01-01

    Clinical and morphologic features of human immunodeficiency virus (HIV)-associated nephropathy (HIVAN), such as proteinuria, sclerosing glomerulopathy, tubular degeneration, and interstitial disease, have been modeled in mice bearing an HIV proviral transgene rendered noninfectious through a deletion in gag/pol. Exploring the genetic basis of HIVAN, HIV transgenic mice bearing mutations in either or both of the accessory genes nef and vpr were created. Proteinuria and focal glomerulosclerosis (FGS) only developed in mice with an intact vpr gene. Transgenic mice bearing a simplified proviral DNA (encoding only Tat and Vpr) developed renal disease characterized by FGS in which Vpr protein was localized to glomerular and tubular epithelia by immunohistochemistry. The dual transgenic progeny of HIV[Tat/Vpr] mice bred to HIV[ΔVpr] proviral transgenic mice displayed a more severe nephropathy with no apparent increase in Vpr expression, implying that multiple viral genes contribute to HIVAN. However, the unique contribution of macrophage-specific Vpr expression in the development of glomerular disease was underscored by the induction of FGS in multiple murine lines bearing a c-fms/vpr transgene

  16. Highly phosphorylated functionalized rice starch produced by transgenic rice expressing the potato GWD1 gene

    DEFF Research Database (Denmark)

    Chen, Yaling; Sun, Xiao-Feng; Zhou, Xin

    2017-01-01

    Starch phosphorylation occurs naturally during starch metabolism in the plant and is catalysed by glucan water dikinases (GWD1) and phosphoglucan water dikinase/glucan water dikinase 3 (PWD/GWD3). We generated six stable individual transgenic lines by over-expressing the potato GWD1 in rice....... Transgenic rice grain starch had 9-fold higher 6-phospho (6-P) monoesters and double amounts of 3-phospho (3-P) monoesters, respectively, compared to control grain. The shape and topography of the transgenic starch granules were moderately altered including surface pores and less well defined edges...... content was positively correlated with short chains of DP6-12. The starch pasting temperature, peak viscosity and the breakdown were lower but the setback was higher for transgenic rice flour. The 6-P content was negatively correlated with texture adhesiveness but positively correlated...

  17. Development and drought tolerance assay of marker-free transgenic rice with OsAPX2 using biolistic particle-mediated co-transformation

    Directory of Open Access Journals (Sweden)

    Dan Feng

    2017-08-01

    Full Text Available Abiotic stresses such as drought, salinity, and low temperature cause–losses in rice production worldwide. The emergence of transgenic technology has enabled improvements in the drought resistance of rice plants and helped avert crop damage due to drought stress. Selectable marker genes conferring resistance to antibiotics or herbicides have been widely used to identify genetically modified plants. However, the use of such markers has limited the public acceptance of genetically modified organisms. Marker-free materials (i.e., those containing a single foreign gene may be more easily accepted by the public and more likely to find common use. In the present study, we created marker-free drought-tolerant transgenic rice plants using particle bombardment. Overall, 842 T0 plants overexpressing the rice ascorbate peroxidase-coding gene OsAPX2 were generated. Eight independent marker-free lines were identified from T1 seedlings using the polymerase chain reaction. The molecular characteristics of these lines were examined, including the expression level, copy number, and flanking sequences of OsAPX2, in the T2 progeny. A simulated drought test using polyethylene glycol and a drought-tolerance test of seedlings confirmed that the marker-free lines carrying OsAPX2 showed significantly improved drought tolerance in seedlings. In the field, the yield of the wild-type plant decreased by 60% under drought conditions compared with normal conditions. However, the transgenic line showed a yield loss of approximately 26%. The results demonstrated that marker-free transgenic lines significantly improved grain yield under drought-stressed conditions.

  18. The ability of current micro-velocity models to represent center-limb line profiles

    International Nuclear Information System (INIS)

    Evans, J.C.; Testerman, L.

    1975-01-01

    Results are presented on the ability of microturbulences, LTE line formation and a homogeneous thermal model to realistically represent the center-limb variation of temporally and spacially averaged solar line profiles. Three somewhat similar semi-empirical thermal models have been used in combination with five current microturbulence models which cover the gamut of homogeneous-isotropic to nonhomogeneous-anisotropic. From high resolution photoelectric data for (lambdalambda 5000-6000 at five μ-values(1,0.63,0.4,0.25,0.16) obtained at KPNO, were selected 17 Fe I and 5 Fe II line profiles to be unblended and symmetrized for study. An iterative scheme has been developed to calculate theoretical profiles for the various combination of models and compare them to the observed profile using the abundance at each limb position and the magnitude of the pressure broadening at the center of the disc as parameters. It was found that a microturbulence model, for which the radial and tangential components increase into deeper layers with xisub(tan)>xisub(rad), produces a reasonable good center-limb fit for lines less than 100mA. However for lines stronger than 140mA, microturbulence models with no depth dependence produce the best match between theory and observation. Thus there is reason to question the uniqueness of the microturbulence concept. (Auth.)

  19. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    Directory of Open Access Journals (Sweden)

    Shih Ping Yao

    2002-04-01

    Full Text Available Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C, is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57 of transgenic pigs (F0 generation. Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species.

  20. Transgenic algae engineered for higher performance

    Science.gov (United States)

    Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

    2014-10-21

    The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

  1. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    Science.gov (United States)

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

    2001-01-01

    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  2. A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis.

    Science.gov (United States)

    Lu, Pu; Magwanga, Richard Odongo; Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang

    2018-04-12

    Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 ( TOM1 ), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum , 9 in Gossypium arboreum , and 11 in Gossypium raimondii . The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H₂O₂. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton

  3. A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis

    Directory of Open Access Journals (Sweden)

    Pu Lu

    2018-04-01

    Full Text Available Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 (TOM1, a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum, 9 in Gossypium arboreum, and 11 in Gossypium raimondii. The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H2O2. The low malondialdehyde (MDA level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress

  4. Correction to: Generation and characterization of tissue-type plasminogen activator transgenic rats.

    Science.gov (United States)

    Ito, Yusuke; Noguchi, Kengo; Morishima, Yoshiyuki; Yamaguchi, Kyoji

    2018-01-01

    In the original publication of the article, the sentence in "Result" section have been incorrectly published as: "Three lines of tPA Tg rats were generated and analyzed by Southern blotting to confirm the presence of the transgene in genomic DNA. When rat DNA was digested with EcoRI and hybridized to the tPA probe described in "Materials and methods", a 1.0 kb band was detected (Fig. 1a, b). One founder line was selected because of its high copy number (about ten copies) of tPA gene and itansgene) and 4.4 kb (endogenous gene) reding appearance, body weight, hematology, and systematization." The corrected sentence should read as: "Three lines of tPA Tg rats were generated and analyzed by Southern blotting to confirm the presence of the transgene in genomic DNA. When rat DNA was digested with EcoRI and hybridized to the tPA probe described in "Materials and methods", a 1.0 kb band was detected (Fig. 1a, b). One founder line was selected because of its high copy number (about ten copies) of tPA gene and its lack of detectable abnormal findings, including appearance, body weight, hematology, and systematization." The original article has been corrected.

  5. Altered Baseline and Nicotine-Mediated Behavioral and Cholinergic Profiles in ChAT-Cre Mouse Lines.

    Science.gov (United States)

    Chen, Edison; Lallai, Valeria; Sherafat, Yasmine; Grimes, Nickolas P; Pushkin, Anna N; Fowler, J P; Fowler, Christie D

    2018-02-28

    The recent development of transgenic rodent lines expressing cre recombinase in a cell-specific manner, along with advances in engineered viral vectors, has permitted in-depth investigations into circuit function. However, emerging evidence has begun to suggest that genetic modifications may introduce unexpected caveats. In the current studies, we sought to extensively characterize male and female mice from both the ChAT (BAC) -Cre mouse line, created with the bacterial artificial chromosome (BAC) method, and ChAT (IRES) -Cre mouse line, generated with the internal ribosome entry site (IRES) method. ChAT (BAC) -Cre transgenic and wild-type mice did not differ in general locomotor behavior, anxiety measures, drug-induced cataplexy, nicotine-mediated hypolocomotion, or operant food training. However, ChAT (BAC) -Cre transgenic mice did exhibit significant deficits in intravenous nicotine self-administration, which paralleled an increase in vesicular acetylcholine transporter and choline acetyltransferase (ChAT) hippocampal expression. For the ChAT (IRES) -Cre line, transgenic mice exhibited deficits in baseline locomotor, nicotine-mediated hypolocomotion, and operant food training compared with wild-type and hemizygous littermates. No differences among ChAT (IRES) -Cre wild-type, hemizygous, and transgenic littermates were found in anxiety measures, drug-induced cataplexy, and nicotine self-administration. Given that increased cre expression was present in the ChAT (IRES) -Cre transgenic mice, as well as a decrease in ChAT expression in the hippocampus, altered neuronal function may underlie behavioral phenotypes. In contrast, ChAT (IRES) -Cre hemizygous mice were more similar to wild-type mice in both protein expression and the majority of behavioral assessments. As such, interpretation of data derived from ChAT-Cre rodents must consider potential limitations dependent on the line and/or genotype used in research investigations. SIGNIFICANCE STATEMENT Altered

  6. Regulation of Expression of the prb-1b / ACC Deaminase gene by UV-B in Transgenic tomatoes

    International Nuclear Information System (INIS)

    Tamot, B.K.; Pauls, K.P.; Glick, R.

    2003-01-01

    Transgenic tomato plants with 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase gene from Enterobacter cloacae UWA4 under the control of a pathogenesis-related promoter (prb-1b) from tobacco were challenged by abiotic stresses to determine the expression patterns of the transgene. No ACC deaminase RNA or protein was detected bu RT-PCR and in western blots prepared from leaf proteins of transgenic plants after wounding or treatment with alpha-amino butyric acid, xylanase, ethephon, salicylic acid, jasmonic acid , ethylene, or ethylene plus jasmonic acid. However, expression of the ACC deaminase transgene was observed in leaves and roots of transformed tomato lines exposed to UV light. The UV response required a minimum of 48 h of exposure and was specific to UV-B light

  7. A spontaneous dominant-negative mutation within a 35S::AtMYB90 transgene inhibits flower pigment production in tobacco.

    Science.gov (United States)

    Velten, Jeff; Cakir, Cahid; Cazzonelli, Christopher I

    2010-03-29

    In part due to the ease of visual detection of phenotypic changes, anthocyanin pigment production has long been the target of genetic and molecular research in plants. Specific members of the large family of plant myb transcription factors have been found to play critical roles in regulating expression of anthocyanin biosynthetic genes and these genes continue to serve as important tools in dissecting the molecular mechanisms of plant gene regulation. A spontaneous mutation within the coding region of an Arabidopsis 35S::AtMYB90 transgene converted the activator of plant-wide anthocyanin production to a dominant-negative allele (PG-1) that inhibits normal pigment production within tobacco petals. Sequence analysis identified a single base change that created a premature nonsense codon, truncating the encoded myb protein. The resulting mutant protein lacks 78 amino acids from the wild type C-terminus and was confirmed as the source of the white-flower phenotype. A putative tobacco homolog of AtMYB90 (NtAN2) was isolated and found to be expressed in flower petals but not leaves of all tobacco plants tested. Using transgenic tobacco constitutively expressing the NtAN2 gene confirmed the NtAN2 protein as the likely target of PG-1-based inhibition of tobacco pigment production. Messenger RNA and anthocyanin analysis of PG-1Sh transgenic lines (and PG-1Sh x purple 35S::NtAN2 seedlings) support a model in which the mutant myb transgene product acts as a competitive inhibitor of the native tobacco NtAN2 protein. This finding is important to researchers in the field of plant transcription factor analysis, representing a potential outcome for experiments analyzing in vivo protein function in test transgenic systems that over-express or mutate plant transcription factors.

  8. Transgenic Cotton Plants Expressing the HaHR3 Gene Conferred Enhanced Resistance to Helicoverpa armigera and Improved Cotton Yield.

    Science.gov (United States)

    Han, Qiang; Wang, Zhenzhen; He, Yunxin; Xiong, Yehui; Lv, Shun; Li, Shupeng; Zhang, Zhigang; Qiu, Dewen; Zeng, Hongmei

    2017-08-30

    RNA interference (RNAi) has been developed as an efficient technology. RNAi insect-resistant transgenic plants expressing double-stranded RNA (dsRNA) that is ingested into insects to silence target genes can affect the viability of these pests or even lead to their death. HaHR3 , a molt-regulating transcription factor gene, was previously selected as a target expressed in bacteria and tobacco plants to control Helicoverpa armigera by RNAi technology. In this work, we selected the dsRNA- HaHR3 fragment to silence HaHR3 in cotton bollworm for plant mediated-RNAi research. A total of 19 transgenic cotton lines expressing HaHR3 were successfully cultivated, and seven generated lines were used to perform feeding bioassays. Transgenic cotton plants expressing ds HaHR3 were shown to induce high larval mortality and deformities of pupation and adult eclosion when used to feed the newly hatched larvae, and 3rd and 5th instar larvae of H. armigera . Moreover, HaHR3 transgenic cotton also demonstrated an improved cotton yield when compared with controls.

  9. Heterologous Expression of Two Jatropha Aquaporins Imparts Drought and Salt Tolerance and Improves Seed Viability in Transgenic Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Kasim Khan

    Full Text Available Drought and high salinity are environmental conditions that cause adverse effects on the growth and productivity of crops. Aquaporins are small integral membrane proteins that belong to the family of the major intrinsic proteins (MIPs, with members in animals, plants and microbes, where they facilitate the transport of water and/or small neutral solutes thereby affecting water balance. In this study we characterized two aquaporin genes namely, plasma membrane intrinsic protein (PIP2;7 and tonoplast intrinsic protein TIP1;3 from Jatropha curcas that are localised to the plasma membrane and vacuole respectively. Transgenic Arabidopsis thaliana lines over-expressing JcPIP2;7 and JcTIP1;3 under a constitutive promoter show improved germination under high salt and mannitol compared to control seeds. These transgenic plants also show increased root length under abiotic stress conditions compared to wild type Col-0 plants. Transgenic lines exposed to drought conditions by withholding water for 20 days, were able to withstand water stress and attained normal growth after re-watering unlike control plants which could not survive. Transgenic lines also had better seed yield than control under salt stress. Importantly, seed viability of transgenic plants grown under high salt concentration was 35%-45% compared to less than 5% for control seeds obtained from plants growing under salt stress. The effect of JcPIP2;7 and JcTIP1;3 on improving germination and seed viability in drought and salinity make these important candidates for genetic manipulation of plants for growth in saline soils.

  10. Germ line transmission of a yeast artificial chromosome spanning the murine [alpha][sub 1](I) collagen locus

    Energy Technology Data Exchange (ETDEWEB)

    Strauss, W.M.; Dausman, J.; Beard, C.; Jaenisch, R. (Massachusetts Inst. of Technology, Cambridge (United States)); Johnson, C.; Lawrence, J.B. (Univ. of Massachusetts Medical School, Worcester (United States))

    1993-03-26

    Molecular complementation of mutant phenotypes by transgenic technology is a potentially important tool for gene identification. A technology was developed to allow the transfer of a physically intact yeast artificial chromosome (YAC) into the germ line of the mouse. A purified 150-kilobase YAC encompassing the murine gene Col1a1 was efficiently introduced into embryonic stem (ES) cells via lipofection. Chimeric founder mice were derived from two transfected ES cell clones. These chimeras transmitted the full length transgene through the germ line, generating two transgenic mouse strains. Transgene expression was visualized as nascent transcripts in interphase nuclei and quantitated by ribonuclease protection analysis. Both assays indicated that the transgene was expressed at levels comparable to the endogenous collagen gene. 32 refs., 3 figs., 1 tab.

  11. Generation and characterization of neurogenin1-GFP transgenic medaka with potential for rapid developmental neurotoxicity screening

    International Nuclear Information System (INIS)

    Fan Chunyang; Simmons, Steven O.; Law, Sheran H.W.; Jensen, Karl; Cowden, John; Hinton, David; Padilla, Stephanie; Ramabhadran, Ram

    2011-01-01

    Fish models such as zebrafish and medaka are increasingly used as alternatives to rodents in developmental and toxicological studies. These developmental and toxicological studies can be facilitated by the use of transgenic reporters that permit the real-time, noninvasive observation of the fish. Here we report the construction and characterization of transgenic medaka lines expressing green fluorescent protein (GFP) under the control of the zebrafish neurogenin 1 (ngn1) gene promoter. Neurogenin (ngn1) is a helix-loop-helix transcription factor expressed in proliferating neuronal progenitor cells early in neuronal differentiation and plays a crucial role in directing neurogenesis. GFP expression was detected from 24 h post-fertilization until hatching, in a spatial pattern consistent with the previously reported zebrafish ngn1 expression. Temporal expression of the transgene parallels the expression profile of the endogenous medaka ngn1 transcript. Further, we demonstrate that embryos from the transgenic line permit the non-destructive, real-time screening of ngn1 promoter-directed GFP expression in a 96-well format, enabling higher throughput studies of developmental neurotoxicants. This strain has been deposited with and maintained by the National BioResource Project and is available on request ( (http://www.shigen.nig.ac.jp/medaka/strainDetailAction.do?quickSearch=true and strainId=5660)).

  12. In Vivo Screening Using Transgenic Zebrafish Embryos Reveals New Effects of HDAC Inhibitors Trichostatin A and Valproic Acid on Organogenesis.

    Directory of Open Access Journals (Sweden)

    Ling Li

    Full Text Available The effects of endocrine disrupting chemicals (EDCs on reproduction are well known, whereas their developmental effects are much less characterized. However, exposure to endocrine disruptors during organogenesis may lead to deleterious and permanent problems later in life. Zebrafish (Danio rerio transgenic lines expressing the green fluorescent protein (GFP in specific organs and tissues are powerful tools to uncover developmental defects elicited by EDCs. Here, we used seven transgenic lines to visualize in vivo whether a series of EDCs and other pharmaceutical compounds can alter organogenesis in zebrafish. We used transgenic lines expressing GFP in pancreas, liver, blood vessels, inner ear, nervous system, pharyngeal tooth and pectoral fins. This screen revealed that four of the tested chemicals have detectable effects on different organs, which shows that the range of effects elicited by EDCs is wider than anticipated. The endocrine disruptor tetrabromobisphenol-A (TBBPA, as well as the three drugs diclofenac, trichostatin A (TSA and valproic acid (VPA induced abnormalities in the embryonic vascular system of zebrafish. Moreover, TSA and VPA induced specific alterations during the development of pancreas, an observation that was confirmed by in situ hybridization with specific markers. Developmental delays were also induced by TSA and VPA in the liver and in pharyngeal teeth, resulting in smaller organ size. Our results show that EDCs can induce a large range of developmental alterations during embryogenesis of zebrafish and establish GFP transgenic lines as powerful tools to screen for EDCs effects in vivo.

  13. Comparison of nutrition composition of transgenic maize (chitinase gene) with its non-transgenic counterpart

    OpenAIRE

    Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun

    2011-01-01

    In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...

  14. Physiological characteristics and metabolomics of transgenic wheat containing the maize C4 phosphoenolpyruvate carboxylase (PEPC) gene under high temperature stress.

    Science.gov (United States)

    Qi, Xueli; Xu, Weigang; Zhang, Jianzhou; Guo, Rui; Zhao, Mingzhong; Hu, Lin; Wang, Huiwei; Dong, Haibin; Li, Yan

    2017-03-01

    In this paper, two transgenic wheat lines, PC27 and PC51, containing the maize PEPC gene and its wild-type (WT) were used as experimental material to study the effects of high temperature on their photosynthetic physiological characteristics and metabolome. The results showed that transgenic wheat lines had higher photosynthetic rate (P n ) than WT under non-stress treatment (NT) and high temperature stress treatment (HT), and more significantly under HT. The change trends of F v /F m , Ф PSII , and q P were similar to P n , whereas that of non-photochemical quenching (NPQ) was the opposite. Compared with WT, no differences in chlorophyll content between the transgenic wheat and WT were observed under NT, but two transgenic lines had relatively higher contents than WT under HT. The change trends of Chlorophyll a/b radio, the decreased values of F m , W k , and V j , and the activity of the antioxidant enzyme were consistent with the chlorophyll content. Compared with WT, transgenic wheat lines exhibited lower rate of superoxide anion production, H 2 O 2 and malondialdehyde content under HT, and no significant differences were observed under NT. The expression pattern of the ZmPEPC gene and wheat endogenous photosynthesis-related genes were in agreement with that of P n . Compared with WT, about 13 different metabolites including one organic acid, six amino acids, four sugars, and two polyols were identified under NT; 25 different metabolites including six organic acids, 12 amino acids, four sugars, and three polyols were identified under HT. Collectively, our results indicate that ZmPEPC gene can enhance photochemical and antioxidant enzyme activity, upregulate the expression of photosynthesis-related genes, delay degradation of chlorophyll, change contents of proline and other metabolites in wheat, and ultimately improves its heat tolerance.

  15. Mice orally immunized with a transgenic plant expressing the glycoprotein of Crimean-Congo hemorrhagic fever virus

    DEFF Research Database (Denmark)

    Ghiasi, Seyed Mojtaba; Salmanian, A H; Chinikar, S

    2011-01-01

    in their serum and feces, respectively. The mice in the fed/boosted group showed a significant rise in specific IgG antibodies after a single boost. Our results imply that oral immunization of animals with edible materials from transgenic plants is feasible, and further assessments are under way. In addition......While Crimean-Congo hemorrhagic fever (CCHF) has a high mortality rate in humans, the associated virus (CCHFV) does not induce clinical symptoms in animals, but animals play an important role in disease transmission to humans. Our aim in this study was to examine the immunogenicity of the CCHFV...... glycoprotein when expressed in the root and leaf of transgenic plants via hairy roots and stable transformation of tobacco plants, respectively. After confirmatory analyses of transgenic plant lines and quantification of the expressed glycoprotein, mice were either fed with the transgenic leaves or roots, fed...

  16. Volatile Organic Compounds Induced by Herbivory of the Soybean Looper Chrysodeixis includens in Transgenic Glyphosate-Resistant Soybean and the Behavioral Effect on the Parasitoid, Meteorus rubens.

    Science.gov (United States)

    Strapasson, Priscila; Pinto-Zevallos, Delia M; Da Silva Gomes, Sandra M; Zarbin, Paulo H G

    2016-08-01

    Transgenic soybean plants (RR) engineered to express resistance to glyphosate harbor a variant of the enzyme EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) involved in the shikimic acid pathway, the biosynthetic route of three aromatic amino acids: phenylalanine, tyrosine, and tryptophan. The insertion of the variant enzyme CP4 EPSPS confers resistance to glyphosate. During the process of genetic engineering, unintended secondary effects are likely to occur. In the present study, we quantified volatile organic compounds (VOCs) emitted constitutively or induced in response to herbivory by the soybean looper Chrysodeixis includens in transgenic soybean and its isogenic (untransformed) line. Since herbivore-induced plant volatiles (HIPVs) are known to play a role in the recruitment of natural enemies, we assessed whether changes in VOC profiles alter the foraging behavior of the generalist endoparasitic larval parasitoid, Meteorus rubens in the transgenic line. Additionally, we assessed whether there was a difference in plant quality by measuring the weight gain of the soybean looper. In response to herbivory, several VOCs were induced in both the conventional and the transgenic line; however, larger quantities of a few compounds were emitted by transgenic plants. Meteorus rubens females were able to discriminate between the odors of undamaged and C. includens-damaged plants in both lines, but preferred the odors emitted by herbivore-damaged transgenic plants over those emitted by herbivore-damaged conventional soybean plants. No differences were observed in the weight gain of the soybean looper. Our results suggest that VOC-mediated tritrophic interactions in this model system are not negatively affected. However, as the preference of the wasps shifted towards damaged transgenic plants, the results also suggest that genetic modification affects that tritrophic interactions in multiple ways in this model system.

  17. Improved antioxidant activity in transgenic Perilla frutescens plants via overexpression of the γ-tocopherol methyltransferase (γ-tmt) gene.

    Science.gov (United States)

    Ghimire, Bimal Kumar; Seong, Eun Soo; Lee, Chan Ok; Lee, Jae Geun; Yu, Chang Yeon; Kim, Seung Hyun; Chung, Ill Min

    2015-09-01

    The main goal of this study was to generate transgenic Perilla frutescens with enhanced antioxidant properties by overexpressing the γ-tocopherol methyltransferase (γ-tmt) gene. In this study, the antioxidant activity of methanolic crude extracts of transgenic and non-transgenic control plants was investigated using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging method. Free radical scavenging activity was evaluated using α-tocopherol and butylated hydroxyl toluene as standard antioxidants. In general, the ethyl acetate fraction of transgenic P. frutescens showed stronger DPPH radical scavenging activity than the ethyl acetate fraction from non-transgenic control plants (IC50 2.00 ± 0.10 and 5.53 ± 0.40 μg ∙ ml(-1), respectively). High-performance liquid chromatography analysis of phenolic acids in leaf extracts confirmed increased levels of 16 individual phenolic compounds in two transgenic lines (pf47-5 and pf47-8) compared with control plants. Changes in the phenolic compound profile and α-tocopherol content were correlated with the antioxidant properties of transgenic plants, indicating that the introduction of transgene γ-tmt influenced the metabolism of phenolic compounds and subsequently produced biochemical changes in the transformants. There were no significant differences in photosynthetic rate in the transgenic plants as compared to the non-transgenic control plants, suggesting that the alteration of phenolic compounds and tocopherol composition had little impact on photosynthesis.

  18. Safety evaluation of transgenic low-gliadin wheat in Sprague Dawley rats: An alternative to the gluten free diet with no subchronic adverse effects.

    Science.gov (United States)

    Ozuna, Carmen Victoria; Barro, Francisco

    2017-09-01

    Gluten-associated pathologies have increased in recent years and there is a greater demand for low or gluten-free products. Transgenic low-gliadin wheat lines showed low T-cell response, good bread-making properties, and excellent sensory assets. The aim of this study was to evaluate the safety of the whole-wheat flour from one transgenic low-gliadin line (named E82) in a 90-day feeding study. In this study males (n = 50) and females (n = 50) SD rats were used. They were fed with doses of 1.42, 2.83 and 5.67 g/kg/day of the transgenic E82 line, 5.67 g/kg/day of the WT and a blank group. We found that there were no significant differences in the development of animals. Biochemistry for liver and kidney function were similar for males and females of all groups. Other haematological and metabolic blood parameters, as well as organ weight did not show significant differences in the five groups of animals. In the histopathological study performed for the higher dose of transgenic E82 line, WT and blank group no abnormalities were observed. The whole-wheat flour of E82 line administered to rats at tested doses for 90 days did not have any adverse effects and there was no difference with the rats which ate WT wheat. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. 9th Transgenic Technology Meeting (TT2010) in Berlin, Germany: a meeting report.

    Science.gov (United States)

    Saunders, Thomas L; Sobieszczuk, Peter

    2010-12-01

    The first Transgenic Technology (TT) Meeting was organized in 1999 by Johannes Wilbertz, Karolinska Institute, Stockholm, Sweden as a regional meeting. The TT Meetings continued in this way, constantly gathering additional practitioners of transgenic methodologies until the breakthrough in 2005 when the 6th TT Meeting in Barcelona, Spain, hosted by Lluis Montoliu (Centro Nacional de Biotecnologia, Madrid, Spain), generated the momentum to establish the International Society for Transgenic Technologies (ISTT). Since 2006, the ISTT has continued to promote the TT Meetings and provide its membership with a forum to discuss best practices and new methods in the field. The TT2010 Meeting was held at the Max Delbrück Center for Molecular Medicine (Berlin, Germany). Participation at the TT2010 Meeting exceeded the registration capacity and set a new attendance record. Session topics included methods for the generation of rat and mouse models of human disease, fundamental and advanced topics in rodent embryonic stem cells, and the newest transgenic technologies. Short presentations from selected abstracts were of especial interest. Roundtable discussions on transgenic facility establishment and cryoarchiving of mouse lines were favorably received. Students, technical staff, and professors participated in numerous discussions and came away with practical methods and new ideas for research.

  20. Interpreting a sequenced genome: toward a cosmid transgenic library of Caenorhabditis elegans.

    Science.gov (United States)

    Janke, D L; Schein, J E; Ha, T; Franz, N W; O'Neil, N J; Vatcher, G P; Stewart, H I; Kuervers, L M; Baillie, D L; Rose, A M

    1997-10-01

    We have generated a library of transgenic Caenorhabditis elegans strains that carry sequenced cosmids from the genome of the nematode. Each strain carries an extrachromosomal array containing a single cosmid, sequenced by the C. elegans Genome Sequencing Consortium, and a dominate Rol-6 marker. More than 500 transgenic strains representing 250 cosmids have been constructed. Collectively, these strains contain approximately 8 Mb of sequence data, or approximately 8% of the C. elegans genome. The transgenic strains are being used to rescue mutant phenotypes, resulting in a high-resolution map alignment of the genetic, physical, and DNA sequence maps of the nematode. We have chosen the region of chromosome III deleted by sDf127 and not covered by the duplication sDp8(III;I) as a starting point for a systematic correlation of mutant phenotypes with nucleotide sequence. In this defined region, we have identified 10 new essential genes whose mutant phenotypes range from developmental arrest at early larva, to maternal effect lethal. To date, 8 of these 10 essential genes have been rescued. In this region, these rescues represent approximately 10% of the genes predicted by GENEFINDER and considerably enhance the map alignment. Furthermore, this alignment facilitates future efforts to physically position and clone other genes in the region. [Updated information about the Transgenic Library is available via the Internet at http://darwin.mbb.sfu.ca/imbb/dbaillie/cos mid.html.

  1. Small RNAs were involved in homozygous state-associated silencing of a marker gene (Neomycin phosphotransferase II: nptII) in transgenic tomato plants.

    Science.gov (United States)

    Deng, Lei; Pan, Yu; Chen, Xuqing; Chen, Guoping; Hu, Zongli

    2013-07-01

    Homozygous state-associated co-suppression is not a very common phenomenon. In our experiments, two transgenic plants 3A29 and 1195A were constructed by being transformed with the constructs pBIN-353A and pBIN119A containing nptII gene as a marker respectively. The homozygous progeny from these two independent transgenic lines 3A29 and 1195A, displayed kanamycin-sensitivity and produced a short main root without any lateral roots as untransformed control (wild-type) seedlings when germinated on kanamycin media. For the seedlings derived from putative hemizygous plants, the percentage of the seedlings showing normal growth on kanamycin media was about 50% and lower than the expected percentage (75%). Southern analysis of the genomic DNA confirmed that the homozygous and hemizygous plants derived from the same lines contained the same multiple nptII transgenes, which were located on the same site of chromosome. Northern analysis suggested that the marker nptII gene was expressed in the primary and the hemizygous transformants, but it was silenced in the homozygous transgenic plants. Further Northern analysis indicated that antisense and sense small nptII-derived RNAs were present in the transgenic plants and the blotting signal of nptII-derived small RNA was much higher in the homozygous transgenic plants than that of hemizygous transgenic plants. Additionally, read-through transcripts from the TRAMP gene to the nptII gene were detected. These results suggest that the read-through transcripts may be involved in homozygous state-associated silencing of the nptII transgene in transgenic tomato plants and a certain threshold level of the nptII-derived small RNAs is required for the homozygous state-associated co-suppression of the nptII transgene. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  2. Transgenic nonhuman primates for neurodegenerative diseases

    Directory of Open Access Journals (Sweden)

    Chan Anthony WS

    2004-06-01

    Full Text Available Abstract Animal models that represent human diseases constitute an important tool in understanding the pathogenesis of the diseases, and in developing effective therapies. Neurodegenerative diseases are complex disorders involving neuropathologic and psychiatric alterations. Although transgenic and knock-in mouse models of Alzheimer's disease, (AD, Parkinson's disease (PD and Huntington's disease (HD have been created, limited representation in clinical aspects has been recognized and the rodent models lack true neurodegeneration. Chemical induction of HD and PD in nonhuman primates (NHP has been reported, however, the role of intrinsic genetic factors in the development of the diseases is indeterminable. Nonhuman primates closely parallel humans with regard to genetic, neuroanatomic, and cognitive/behavioral characteristics. Accordingly, the development of NHP models for neurodegenerative diseases holds greater promise for success in the discovery of diagnoses, treatments, and cures than approaches using other animal species. Therefore, a transgenic NHP carrying a mutant gene similar to that of patients will help to clarify our understanding of disease onset and progression. Additionally, monitoring disease onset and development in the transgenic NHP by high resolution brain imaging technology such as MRI, and behavioral and cognitive testing can all be carried out simultaneously in the NHP but not in other animal models. Moreover, because of the similarity in motor repertoire between NHPs and humans, it will also be possible to compare the neurologic syndrome observed in the NHP model to that in patients. Understanding the correlation between genetic defects and physiologic changes (e.g. oxidative damage will lead to a better understanding of disease progression and the development of patient treatments, medications and preventive approaches for high risk individuals. The impact of the transgenic NHP model in understanding the role which

  3. Thy1.2 driven expression of transgenic His₆-SUMO2 in the brain of mice alters a restricted set of genes.

    Science.gov (United States)

    Rossner, Moritz J; Tirard, Marilyn

    2014-08-05

    Protein SUMOylation is a post-translational protein modification with a key regulatory role in nerve cell development and function, but its function in mammals in vivo has only been studied cursorily. We generated two new transgenic mouse lines that express His6-tagged SUMO1 and SUMO2 driven by the Thy1.2 promoter. The brains of mice of the two lines express transgenic His6-SUMO peptides and conjugate them to substrates in vivo but cytoarchitecture and synaptic organization of adult transgenic mouse brains are indistinguishable from the wild-type situation. We investigated the impact of transgenic SUMO expression on gene transcription in the hippocampus by performing genome wide analyses using microarrays. Surprisingly, no changes were observed in Thy1.2::His6-SUMO1 transgenic mice and only a restricted set of genes were upregulated in Thy1.2::His6-SUMO2 mice. Among these, Penk1 (Preproenkephalin 1), which encodes Met-enkephalin neuropeptides, showed the highest degree of alteration. Accordingly, a significant increase in Met-enkephalin peptide levels in the hippocampus of Thy1.2::His6-SUMO2 was detected, but the expression levels and cellular localization of Met-enkephalin receptors were not changed. Thus, transgenic neuronal expression of His6-SUMO1 or His6-SUMO2 only induces very minor phenotypical changes in mice. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Transgenic rats overexpressing the human MrgX3 gene show cataracts and an abnormal skin phenotype

    International Nuclear Information System (INIS)

    Kaisho, Yoshihiko; Watanabe, Takuya; Nakata, Mitsugu; Yano, Takashi; Yasuhara, Yoshitaka; Shimakawa, Kozo; Mori, Ikuo; Sakura, Yasufumi; Terao, Yasuko; Matsui, Hideki; Taketomi, Shigehisa

    2005-01-01

    The human MrgX3 gene, belonging to the mrgs/SNSRs (mass related genes/sensory neuron specific receptors) family, was overexpressed in transgenic rats using the actin promoter. Two animal lines showed cataracts with liquification/degeneration and swelling of the lens fiber cells. The transient epidermal desquamation was observed in line with higher gene expression. Histopathology of the transgenic rats showed acanthosis and focal parakeratosis. In the epidermis, there was an increase in cellular keratin 14, keratin 10, and loricrin, as well as PGP 9.5 in innervating nerve fibers. These phenotypes accompanied an increase in the number of proliferating cells. These results suggest that overexpression of the human MrgX3 gene causes a disturbance of the normal cell-differentiation process

  5. The introgression of RNAi silencing of γ-gliadins into commercial lines of bread wheat changes the mixing and technological properties of the dough.

    Directory of Open Access Journals (Sweden)

    Javier Gil-Humanes

    Full Text Available In the present work the effects on dough quality by the down-regulation of γ-gliadins in different genetic backgrounds of bread wheat were investigated. RNAi-mediated silencing of γ-gliadins was introgressed by conventional crossing into three commercial bread wheat lines (namely 'Gazul', 'Podenco' and 'Arpain', and along with the transgenic line A1152 (cv. Bobwhite compared with their respective wild types. The protein fractions were quantified by RP-HPLC, whereas the technological and mixing properties were assessed by SDSS test and by the Mixograph instrument. Principal component analysis (PCA was carried out for both the wild types and the transgenic lines, showing differences in the factors affecting the technological and mixing properties of the dough as a consequence of the reduction of the γ-gliadins. In transgenic lines, the α- and ω-gliadins, and total gliadins negatively affected the dough strength and tolerance to over-mixing, whereas the L/H ratio showed the opposite effect, positively influencing the dough quality. The increase of the SDSS volume in the transgenic lines of 'Gazul', 'Podenco' and 'Arpain' indicates increased gluten strength and quality respect to the wild types. SDSS volume was found to be positively influenced by the amount of glutenins, which were also increased in the transgenic lines. In addition, a positive effect was observed in the MT, PR1 and RBD in some of the transgenic lines of 'Podenco' and 'Arpain'. In conclusion, the down-regulation of γ-gliadins resulted in stronger doughs and a better tolerance to over-mixing in some transgenic lines. Although the reduction of γ-gliadins seems not to have a direct effect on the mixing and bread-making properties, the compensatory effect on the synthesis of the other prolamins may result in stronger doughs with improved over-mixing resistance.

  6. The introgression of RNAi silencing of γ-gliadins into commercial lines of bread wheat changes the mixing and technological properties of the dough.

    Science.gov (United States)

    Gil-Humanes, Javier; Pistón, Fernando; Giménez, María J; Martín, Antonio; Barro, Francisco

    2012-01-01

    In the present work the effects on dough quality by the down-regulation of γ-gliadins in different genetic backgrounds of bread wheat were investigated. RNAi-mediated silencing of γ-gliadins was introgressed by conventional crossing into three commercial bread wheat lines (namely 'Gazul', 'Podenco' and 'Arpain'), and along with the transgenic line A1152 (cv. Bobwhite) compared with their respective wild types. The protein fractions were quantified by RP-HPLC, whereas the technological and mixing properties were assessed by SDSS test and by the Mixograph instrument. Principal component analysis (PCA) was carried out for both the wild types and the transgenic lines, showing differences in the factors affecting the technological and mixing properties of the dough as a consequence of the reduction of the γ-gliadins. In transgenic lines, the α- and ω-gliadins, and total gliadins negatively affected the dough strength and tolerance to over-mixing, whereas the L/H ratio showed the opposite effect, positively influencing the dough quality. The increase of the SDSS volume in the transgenic lines of 'Gazul', 'Podenco' and 'Arpain' indicates increased gluten strength and quality respect to the wild types. SDSS volume was found to be positively influenced by the amount of glutenins, which were also increased in the transgenic lines. In addition, a positive effect was observed in the MT, PR1 and RBD in some of the transgenic lines of 'Podenco' and 'Arpain'. In conclusion, the down-regulation of γ-gliadins resulted in stronger doughs and a better tolerance to over-mixing in some transgenic lines. Although the reduction of γ-gliadins seems not to have a direct effect on the mixing and bread-making properties, the compensatory effect on the synthesis of the other prolamins may result in stronger doughs with improved over-mixing resistance.

  7. The use of transgenic fruit trees as a resistance strategy for virus epidemics: the plum pox (sharka) model.

    Science.gov (United States)

    Ravelonandro, M; Scorza, R; Callahan, A; Levy, L; Jacquet, C; Monsion, M; Damsteegt, V

    2000-11-01

    Sharka or plum pox, caused by Plum pox virus (PPV: genus Potyvirus; Family Potyviridae), is the most serious disease of Prunus. Most cultivated Prunus species are highly susceptible and conventional breeding has not produced highly resistant and commercially acceptable varieties. Success in developing virus-resistant herbaceous crops through genetic engineering led us to investigate this approach for resistance to PPV. Our programme aims to develop a biotechnological approach to PPV control that is effective and shown to be environmentally safe. The programme began with the cloning of the PPV coat protein (CP) gene and the development of a transformation system for plum (Prunus domestica). The CP construct was first tested in Nicotiana benthamiana in which it proved effective in producing transgenic plants with varying levels of CP expression. Some of these plants, particularly low PPV CP expressers, were resistant to PPV, or recovered from initial infection. Based on these results plum was transformed using the Agrobacterium tumefaciens system and both low and high PPV CP-expressing transgenic plum lines were obtained. These were inoculated with PPV by bud grafts in the greenhouse. Line C-5 proved to be highly resistant. It contained multiple copies of the insert, produced low levels of PPV CP mRNA, no detectable CP and the insert appeared to be methylated. These characteristics all suggest that the resistance of the C-5 clone is based on post-transcriptional gene silencing (PTGS). Field tests of C-5 and other transgenic lines in Poland, Romania and Spain have demonstrated that such trees when inoculated by bud-grafts allow a low level of PPV multiplication, from which they rapidly recover. C-5 plants exposed to natural infection for 3 years did not become infected, whereas control trees were infected in the first year. Hybrid plums having the C-5 PPV CP insert inherited from C-5 are virus-resistant, demonstrating the usefulness of C-5 as a parent in developing

  8. The Reaumuria trigyna transcription factor RtWRKY1 confers tolerance to salt stress in transgenic Arabidopsis.

    Science.gov (United States)

    Du, Chao; Zhao, Pingping; Zhang, Huirong; Li, Ningning; Zheng, Linlin; Wang, Yingchun

    2017-08-01

    Reaumuria trigyna (R. trigyna) is an endangered small shrub endemic to the Eastern Alxa-Western Ordos area in Inner Mongolia, China. Based on R. trigyna transcriptome data, the Group I WRKY transcription factor gene RtWRKY1 was cloned from R. trigyna. The full-length RtWRKY1 gene was 2100bp, including a 1261-bp open reading frame (ORF) encoding 573 amino acids. RtWRKY1 was mainly expressed in the stem and was induced by salt, cold stress, and ABA treatment. Overexpression of RtWRKY1 in Arabidopsis significantly enhanced the chlorophyll content, root length, and fresh weight of the transgenic lines under salt stress. RtWRKY1 transgenic Arabidopsis exhibited higher proline content, GSH-PX, POD, SOD, and CAT activities, and lower MDA content, Na + content, and Na + /K + ratio than wild-type Arabidopsis under salt stress conditions. Salt stress affected the expression of ion transport, proline biosynthesis, and antioxidant related genes, including AtAPX1, AtCAT1, AtSOD1, AtP5CS1, AtP5CS2, AtPRODH1, AtPRODH2, and AtSOS1 in transgenic lines. RtWRKY1 confers tolerance to salt stress in transgenic Arabidopsis by regulating plant growth, osmotic balance, Na + /K + homeostasis, and the antioxidant system. Copyright © 2017 Elsevier GmbH. All rights reserved.

  9. Expression of Finger Millet EcDehydrin7 in Transgenic Tobacco Confers Tolerance to Drought Stress.

    Science.gov (United States)

    Singh, Rajiv Kumar; Singh, Vivek Kumar; Raghavendrarao, Sanagala; Phanindra, Mullapudi Lakshmi Venkata; Venkat Raman, K; Solanke, Amolkumar U; Kumar, Polumetla Ananda; Sharma, Tilak Raj

    2015-09-01

    One of the critical alarming constraints for agriculture is water scarcity. In the current scenario, global warming due to climate change and unpredictable rainfall, drought is going to be a master player and possess a big threat to stagnating gene pool of staple food crops. So it is necessary to understand the mechanisms that enable the plants to cope with drought stress. In this study, effort was made to prospect the role of EcDehydrin7 protein from normalized cDNA library of drought tolerance finger millet in transgenic tobacco. Biochemical and molecular analyses of T0 transgenic plants were done for stress tolerance. Leaf disc assay, seed germination test, dehydration assay, and chlorophyll estimation showed EcDehydrin7 protein directly link to drought tolerance. Northern and qRT PCR analyses shows relatively high expression of EcDehydrin7 protein compare to wild type. T0 transgenic lines EcDehydrin7(11) and EcDehydrin7(15) shows superior expression among all lines under study. In summary, all results suggest that EcDehydrin7 protein has a remarkable role in drought tolerance and may be used for sustainable crop breeding program in other food crops.

  10. Recombinant protein production from stable mammalian cell lines and pools.

    Science.gov (United States)

    Hacker, David L; Balasubramanian, Sowmya

    2016-06-01

    We highlight recent developments for the production of recombinant proteins from suspension-adapted mammalian cell lines. We discuss the generation of stable cell lines using transposons and lentivirus vectors (non-targeted transgene integration) and site-specific recombinases (targeted transgene integration). Each of these methods results in the generation of cell lines with protein yields that are generally superior to those achievable through classical plasmid transfection that depends on the integration of the transfected DNA by non-homologous DNA end-joining. This is the main reason why these techniques can also be used for the generation of stable cell pools, heterogenous populations of recombinant cells generated by gene delivery and genetic selection without resorting to single cell cloning. This allows the time line from gene transfer to protein production to be reduced. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Characterization of pancreatic lesions from MT-tgf alpha, Ela-myc and MT-tgf alpha/Ela-myc single and double transgenic mice.

    Science.gov (United States)

    Liao, Dezhong Joshua; Wang, Yong; Wu, Jiusheng; Adsay, Nazmi Volkan; Grignon, David; Khanani, Fayyaz; Sarkar, Fazlul H

    2006-07-05

    In order to identify good animal models for investigating therapeutic and preventive strategies for pancreatic cancer, we analyzed pancreatic lesions from several transgenic models and made a series of novel findings. Female MT-tgf alpha mice of the MT100 line developed pancreatic proliferation, acinar-ductal metaplasia, multilocular cystic neoplasms, ductal adenocarcinomas and prominent fibrosis, while the lesions in males were less severe. MT-tgf alpha-ES transgenic lines of both sexes developed slowly progressing lesions that were similar to what was seen in MT100 males. In both MT100 and MT-tgf alpha-ES lines, TGF alpha transgene was expressed mainly in proliferating ductal cells. Ela-myc transgenic mice with a mixed C57BL/6, SJL and FVB genetic background developed pancreatic tumors at 2-7 months of age, and half of the tumors were ductal adenocarcinomas, similar to what was reported originally by Sandgren et al 1. However, in 20% of the mice, the tumors metastasized to the liver. MT100/Ela-myc and MT-tgf alpha-ES/Ela-myc double transgenic mice developed not only acinar carcinomas and mixed carcinomas as previously reported but also various ductal-originated lesions, including multilocular cystic neoplasms and ductal adenocarcinomas. The double transgenic tumors were more malignant and metastasized to the liver at a higher frequency (33%) compared with the Ela-myc tumors. Sequencing of the coding region of p16ink4, k-ras and Rb cDNA in small numbers of pancreatic tumors did not identify mutations. The short latency for tumor development, the variety of tumor morphology and the liver metastases seen in Ela-myc and MT-tgf alpha/Ela-myc mice make these animals good models for investigating new therapeutic and preventive strategies for pancreatic cancer.

  12. Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

    Directory of Open Access Journals (Sweden)

    Vinciane Régnier

    Full Text Available The cystathionine β-synthase (CBS gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA metabolism, a pathway important for several brain physiological processes.Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1 expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line.We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

  13. Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

    Science.gov (United States)

    Régnier, Vinciane; Billard, Jean-Marie; Gupta, Sapna; Potier, Brigitte; Woerner, Stéphanie; Paly, Evelyne; Ledru, Aurélie; David, Sabrina; Luilier, Sabrina; Bizot, Jean-Charles; Vacano, Guido; Kraus, Jan P; Patterson, David; Kruger, Warren D; Delabar, Jean M; London, Jaqueline

    2012-01-01

    The cystathionine β-synthase (CBS) gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS) cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA) metabolism, a pathway important for several brain physiological processes. Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1) expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line. We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

  14. Effect of CRC::etr1-1 transgene expression on ethylene production, sex expression, fruit set and fruit ripening in transgenic melon (Cucumis melo L.).

    Science.gov (United States)

    Switzenberg, Jessica A; Beaudry, Randy M; Grumet, Rebecca

    2015-06-01

    Ethylene is a key factor regulating sex expression in cucurbits. Commercial melons (Cucumis melo L.) are typically andromonoecious, producing male and bisexual flowers. Our prior greenhouse studies of transgenic melon plants expressing the dominant negative ethylene perception mutant gene, etr1-1, under control of the carpel- and nectary-primordia targeted CRAB'S CLAW (CRC) promoter showed increased number and earlier appearance of carpel-bearing flowers. To further investigate this phenomenon which could be potentially useful for earlier fruit production, we observed CRC::etr1-1 plants in the field for sex expression, fruit set, fruit development, and ripening. CRC::etr1-1 melon plants showed increased number of carpel-bearing open flowers on the main stem and earlier onset by 7-10 nodes. Additional phenotypes observed in the greenhouse and field were conversion of approximately 50% of bisexual buds to female, and elongated ovaries and fruits. Earlier and greater fruit set occurred on the transgenic plants. However, CRC::etr1-1 plants had greater abscission of young fruit, and smaller fruit, so that final yield (kg/plot) was equivalent to wild type. Earlier fruit set in line M5 was accompanied by earlier appearance of ripe fruit. Fruit from line M15 frequently did not exhibit external ripening processes of rind color change and abscission, but when cut open, the majority showed a ripe or overripe interior accompanied by elevated internal ethylene. The non-ripening external phenotype in M15 fruit corresponded with elevated etr1-1 transgene expression in the exocarp. These results provide insight into the role of ethylene perception in carpel-bearing flower production, fruit set, and ripening.

  15. Glyphostate-drift but not herbivory alters the rate of transgene flow from single and stacked trait transgenic canola (Brassica napus L.) to non-transgenic B. napus and B. rapa

    Science.gov (United States)

    While transgenic plants can offer agricultural benefits, the escape of transgenes out of crop fields is a major environmental concern. Escape of transgenic herbicide resistance has occurred between transgenic Brassica napus (canola) and weedy species in numerous locations. In t...

  16. Competitive Expression of Endogenous Wheat CENH3 May Lead to Suppression of Alien ZmCENH3 in Transgenic Wheat × Maize Hybrids.

    Science.gov (United States)

    Chen, Wei; Zhu, Qilin; Wang, Haiyan; Xiao, Jin; Xing, Liping; Chen, Peidu; Jin, Weiwei; Wang, Xiu-E

    2015-11-20

    Uniparental chromosome elimination in wheat × maize hybrid embryos is widely used in double haploid production of wheat. Several explanations have been proposed for this phenomenon, one of which is that the lack of cross-species CENH3 incorporation may act as a barrier to interspecies hybridization. However, it is unknown if this mechanism applies universally. To study the role of CENH3 in maize chromosome elimination of wheat × maize hybrid embryos, maize ZmCENH3 and wheat αTaCENH3-B driven by the constitutive CaMV35S promoter were transformed into wheat variety Yangmai 158. Five transgenic lines for ZmCENH3 and six transgenic lines for αTaCENH3-B were identified. RT-PCR analysis showed that the transgene could be transcribed at a low level in all ZmCENH3 transgenic lines, whereas transcription of endogenous wheat CENH3 was significantly up-regulated. Interestingly, the expression levels of both wheat CENH3 and ZmCENH3 in the ZmCENH3 transgenic wheat × maize hybrid embryos were higher than those in the non-transformed Yangmai 158 × maize hybrid embryos. This indicates that the alien ZmCENH3 in wheat may induce competitive expression of endogenous wheat CENH3, leading to suppression of ZmCENH3 over-expression. Eliminations of maize chromosomes in hybrid embryos of ZmCENH3 transgenic wheat × maize and Yangmai 158 × maize were compared by observations on micronuclei presence, by marker analysis using maize SSRs (simple sequence repeats), and by FISH (fluorescence in situ hybridization) using 45S rDNA as a probe. The results indicate that maize chromosome elimination events in the two crosses are not significantly different. Fusion protein ZmCENH3-YFP could not be detected in ZmCENH3 transgenic wheat by either Western blotting or immnunostaining, whereas accumulation and loading of the αTaCENH3-B-GFP fusion protein was normal in αTaCENH3-B transgenic lines. As ZmCENH3-YFP did not accumulate after AM114 treatment, we speculate that low levels of Zm

  17. Expression of cold and drought regulatory protein (CcCDR) of pigeonpea imparts enhanced tolerance to major abiotic stresses in transgenic rice plants.

    Science.gov (United States)

    Sunitha, Mellacheruvu; Srinath, Tamirisa; Reddy, Vudem Dashavantha; Rao, Khareedu Venkateswara

    2017-06-01

    Transgenic rice expressing pigeonpea Cc CDR conferred high-level tolerance to different abiotic stresses. The multiple stress tolerance observed in CcCDR -transgenic lines is attributed to the modulation of ABA-dependent and-independent signalling-pathway genes. Stable transgenic plants expressing Cajanus cajan cold and drought regulatory protein encoding gene (CcCDR), under the control of CaMV35S and rd29A promoters, have been generated in indica rice. Different transgenic lines of CcCDR, when subjected to drought, salt, and cold stresses, exhibited higher seed germination, seedling survival rates, shoot length, root length, and enhanced plant biomass when compared with the untransformed control plants. Furthermore, transgenic plants disclosed higher leaf chlorophyll content, proline, reducing sugars, SOD, and catalase activities, besides lower levels of MDA. Localization studies revealed that the CcCDR-GFP fusion protein was mainly present in the nucleus of transformed cells of rice. The CcCDR transgenics were found hypersensitive to abscisic acid (ABA) and showed reduced seed germination rates as compared to that of control plants. When the transgenic plants were exposed to drought and salt stresses at vegetative and reproductive stages, they revealed larger panicles and higher number of filled grains compared to the untransformed control plants. Under similar stress conditions, the expression levels of P5CS, bZIP, DREB, OsLEA3, and CIPK genes, involved in ABA-dependent and-independent signal transduction pathways, were found higher in the transgenic plants than the control plants. The overall results amply demonstrate that the transgenic rice expressing CcCDR bestows high-level tolerance to drought, salt, and cold stress conditions. Accordingly, the CcCDR might be deployed as a promising candidate gene for improving the multiple stress tolerance of diverse crop plants.

  18. Quantitative analysis of lentiviral transgene expression in mice over seven generations.

    Science.gov (United States)

    Wang, Yong; Song, Yong-tao; Liu, Qin; Liu, Cang'e; Wang, Lu-lu; Liu, Yu; Zhou, Xiao-yang; Wu, Jun; Wei, Hong

    2010-10-01

    together, these data suggested that transgenic lines with long term stable expression and no position effect can be established by lentiviral transgenesis.

  19. Rapid method for identification of transgenic fish zygosity

    Directory of Open Access Journals (Sweden)

    . Alimuddin

    2007-07-01

    Full Text Available Identification of zygosity in transgenik fish is normally achieved by PCR analysis with genomic DNA template extracted from the tissue of progenies which are derived by mating the transgenic fish and wild-type counterpart.  This method needs relatively large amounts of fish material and is time- and labor-intensive. New approaches addressing this problem could be of great help for fish biotechnologists.  In this experiment, we applied a quantitative real-time PCR (qr-PCR method to analyze zygosity in a stable line of transgenic zebrafish (Danio rerio carrying masu salmon, Oncorhynchus masou D6-desaturase-like gene. The qr-PCR was performed using iQ SYBR Green Supermix in the iCycler iQ Real-time PCR Detection System (Bio-Rad Laboratories, USA.  Data were analyzed using the comparative cycle threshold method.  The results demonstrated a clear-cut identification of all transgenic fish (n=20 classified as a homozygous or heterozygous.  Mating of those fish with wild-type had revealed transgene transmission to the offspring following expected Mendelian laws. Thus, we found that the qTR-PCR to be effective for a rapid and precise determination of zygosity in transgenic fish. This technique could be useful in the establishment of breeding programs for mass transgenic fish production and in experiments in which zygosity effect could have a functional impact. Keywords: quantitative real-time PCR; zygosity; transgenic fish; mass production   ABSTRAK Identifikasi sigositas ikan transgenik biasanya dilakukan menggunakan analisa PCR dengan cetakan DNA genomik yang diekstraksi dari jaringan ikan hasil persilangan antara ikan transgenik dan ikan normal.   Metode ini memerlukan ikan dalam jumlah yang banyak, dan juga waktu serta tenaga.  Pendekatan baru untuk mengatasi masalah tersebut akan memberikan manfaat besar kepada peneliti bioteknologi perikanan.  Pada penelitian ini, kami menggunakan metode PCR real-time kuantitatif (krt-PCR untuk

  20. Expression of a pathogen-induced cysteine protease (AdCP) in tapetum results in male sterility in transgenic tobacco.

    Science.gov (United States)

    Shukla, Pawan; Singh, Naveen Kumar; Kumar, Dilip; Vijayan, Sambasivam; Ahmed, Israr; Kirti, Pulugurtha Bharadwaja

    2014-06-01

    Usable male sterility systems have immense potential in developing hybrid varieties in crop plants, which can also be used as a biological safety containment to prevent horizontal transgene flow. Barnase-Barstar system developed earlier was the first approach to engineer male sterility in plants. In an analogous situation, we have evolved a system of inducing pollen abortion and male sterility in transgenic tobacco by expressing a plant gene coding for a protein with known developmental function in contrast to the Barnase-Barstar system, which deploys genes of prokaryotic origin, i.e., from Bacillus amyloliquefaciens. We have used a plant pathogen-induced gene, cysteine protease for inducing male sterility. This gene was identified in the wild peanut, Arachis diogoi differentially expressed when it was challenged with the late leaf spot pathogen, Phaeoisariopsis personata. Arachis diogoi cysteine protease (AdCP) was expressed under the strong tapetum-specific promoter (TA29) and tobacco transformants were generated. Morphological and histological analysis of AdCP transgenic plants showed ablated tapetum and complete pollen abortion in three transgenic lines. Furthermore, transcript analysis displayed the expression of cysteine protease in these male sterile lines and the expression of the protein was identified in western blot analysis using its polyclonal antibody raised in the rabbit system.

  1. Beyond the bolus: transgenic tools for investigating the neurophysiology of learning and memory.

    Science.gov (United States)

    Lykken, Christine; Kentros, Clifford G

    2014-10-01

    Understanding the neural mechanisms underlying learning and memory in the entorhinal-hippocampal circuit is a central challenge of systems neuroscience. For more than 40 years, electrophysiological recordings in awake, behaving animals have been used to relate the receptive fields of neurons in this circuit to learning and memory. However, the vast majority of such studies are purely observational, as electrical, surgical, and pharmacological circuit manipulations are both challenging and relatively coarse, being unable to distinguish between specific classes of neurons. Recent advances in molecular genetic tools can overcome many of these limitations, enabling unprecedented control over neural activity in behaving animals. Expression of pharmaco- or optogenetic transgenes in cell-type-specific "driver" lines provides unparalleled anatomical and cell-type specificity, especially when delivered by viral complementation. Pharmacogenetic transgenes are specially designed neurotransmitter receptors exclusively activated by otherwise inactive synthetic ligands and have kinetics similar to traditional pharmacology. Optogenetic transgenes use light to control the membrane potential, and thereby operate at the millisecond timescale. Thus, activation of pharmacogenetic transgenes in specific neuronal cell types while recording from other parts of the circuit allows investigation of the role of those neurons in the steady state, whereas optogenetic transgenes allow one to determine the immediate network response. © 2014 Lykken and Kentros; Published by Cold Spring Harbor Laboratory Press.

  2. Global Screening of Antiviral Genes that Suppress Baculovirus Transgene Expression in Mammalian Cells.

    Science.gov (United States)

    Wang, Chia-Hung; Naik, Nenavath Gopal; Liao, Lin-Li; Wei, Sung-Chan; Chao, Yu-Chan

    2017-09-15

    Although baculovirus has been used as a safe and convenient gene delivery vector in mammalian cells, baculovirus-mediated transgene expression is less effective in various mammalian cell lines. Identification of the negative regulators in host cells is necessary to improve baculovirus-based expression systems. Here, we performed high-throughput shRNA library screening, targeting 176 antiviral innate immune genes, and identified 43 host restriction factor genes in a human A549 lung carcinoma cell line. Among them, suppression of receptor interaction protein kinase 1 (RIP1, also known as RIPK1) significantly increased baculoviral transgene expression without resulting in significant cell death. Silencing of RIP1 did not affect viral entry or cell viability, but it did inhibit nuclear translocation of the IRF3 and NF-κB transcription factors. Also, activation of downstream signaling mediators (such as TBK1 and IRF7) was affected, and subsequent interferon and cytokine gene expression levels were abolished. Further, Necrostatin-1 (Nec-1)-an inhibitor of RIP1 kinase activity-dramatically increased baculoviral transgene expression in RIP1-silenced cells. Using baculovirus as a model system, this study presents an initial investigation of large numbers of human cell antiviral innate immune response factors against a "nonadaptive virus." In addition, our study has made baculovirus a more efficient gene transfer vector for some of the most frequently used mammalian cell systems.

  3. Rapid transcriptional pulsing dynamics of high expressing retroviral transgenes in embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Mandy Y M Lo

    Full Text Available Single cell imaging studies suggest that transcription is not continuous and occurs as discrete pulses of gene activity. To study mechanisms by which retroviral transgenes can transcribe to high levels, we used the MS2 system to visualize transcriptional dynamics of high expressing proviral integration sites in embryonic stem (ES cells. We established two ES cell lines each bearing a single copy, self-inactivating retroviral vector with a strong ubiquitous human EF1α gene promoter directing expression of mRFP fused to an MS2-stem-loop array. Transfection of MS2-EGFP generated EGFP focal dots bound to the mRFP-MS2 stem loop mRNA. These transcription foci colocalized with the transgene integration site detected by immunoFISH. Live tracking of single cells for 20 minutes detected EGFP focal dots that displayed frequent and rapid fluctuations in transcription over periods as short as 25 seconds. Similarly rapid fluctuations were detected from focal doublet signals that colocalized with replicated proviral integration sites by immunoFISH, consistent with transcriptional pulses from sister chromatids. We concluded that retroviral transgenes experience rapid transcriptional pulses in clonal ES cell lines that exhibit high level expression. These events are directed by a constitutive housekeeping gene promoter and may provide precedence for rapid transcriptional pulsing at endogenous genes in mammalian stem cells.

  4. Vascular defects in gain-of-function fps/fes transgenic mice correlate with PDGF- and VEGF-induced activation of mutant Fps/Fes kinase in endothelial cells.

    Science.gov (United States)

    Sangrar, W; Mewburn, J D; Vincent, S G; Fisher, J T; Greer, P A

    2004-05-01

    Fps/Fes is a cytoplasmic tyrosine kinase that is abundantly expressed in the myeloid, endothelial, epithelial, neuronal and platelet lineages. Genetic manipulation in mice has uncovered potential roles for this kinase in hematopoiesis, innate immunity, inflammation and angiogenesis. We have utilized a genetic approach to explore the role of Fps/Fes in angiogenesis. A hypervascular line of mice generated by expression of a 'gain-of-function' human fps/fes transgene (fps(MF)) encoding a myristoylated variant of Fps (MFps) was used in these studies. The hypervascular phenotype of this line was extensively characterized by intravital microscopy and biochemical approaches. fps(MF) mice exhibited 1.6-1.7-fold increases in vascularity which was attributable to increases in the number of secondary vessels. Vessels were larger, exhibited varicosities and disorganized patterning, and were found to have defects in histamine-induced permeability. Biochemical characterization of endothelial cell (EC) lines derived from fps(MF) mice revealed that MFps was hypersensitive to activation by vascular endothelial growth factor (VEGF) and platelet-derived growth factor (PDGF). MFps mediates enhanced sensitization to VEGF and PDGF signaling in ECs. We propose that this hypersensitization contributes to excessive angiogenic signaling and that this underlies the observed hypervascular phenotype of fps(MF) mice. These phenotypes recapitulate important aspects of the vascular defects observed in both VEGF and angiopoietin-1 transgenic mice. The fps/fes proto-oncogene product therefore represents a novel player in the regulation of angiogenesis, and the fps(MF) line of mice constitutes a unique new murine model for the study of this process.

  5. [Abnormal floral meristem development in transgenic tomato plants do not depend on the expression of genes encoding defense-related PR-proteins and antimicrobial peptides].

    Science.gov (United States)

    Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu

    2014-01-01

    In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial

  6. Overexpression of GmDREB1 improves salt tolerance in transgenic wheat and leaf protein response to high salinity

    OpenAIRE

    Qiyan Jiang; Zheng Hu; Hui Zhang; Youzhi Ma

    2014-01-01

    The transcription factor dehydration-responsive element binding protein (DREB) is able to improve tolerance to abiotic stress in plants by regulating the expression of downstream genes involved in environmental stress resistance. The objectives of this study were to evaluate the salt tolerance of GmDREB1 transgenic wheat (Triticum aestivum L.) and to evaluate its physiological and protein responses to salt stress. Compared with the wild type, the transgenic lines overexpressing GmDREB1 showed...

  7. [New advances in animal transgenic technology].

    Science.gov (United States)

    Sun, Zhen-Hong; Miao, Xiang-Yang; Zhu, Rui-Liang

    2010-06-01

    Animal transgenic technology is one of the fastest growing biotechnology in the 21st century. It is used to integrate foreign genes into the animal genome by genetic engineering technology so that foreign genes can be expressed and inherited to the offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors on preparation of transgenic animals. A variety of transgenic techniques are available, each of which has its own advantages and disadvantages and still needs further study because of unresolved technical and safety issues. With the in-depth research, the transgenic technology will have broad application prospects in the fields of exploration of gene function, animal genetic improvement, bioreactor, animal disease models, organ transplantation and so on. This article reviews the recently developed animal gene transfer techniques, including germline stem cell mediated method to improve the efficiency, gene targeting to improve the accuracy, RNA interference (RNAi)-mediated gene silencing technology, and the induced pluripotent stem cells (iPS) transgenic technology. The new transgenic techniques can provide a better platform for the study of trans-genic animals and promote the development of medical sciences, livestock production, and other fields.

  8. Analysis of T-DNA integration and generative segregation in transgenic winter triticale (x Triticosecale Wittmack

    Directory of Open Access Journals (Sweden)

    Hensel Goetz

    2012-09-01

    Full Text Available Abstract Background While the genetic transformation of the major cereal crops has become relatively routine, to date only a few reports were published on transgenic triticale, and robust data on T-DNA integration and segregation have not been available in this species. Results Here, we present a comprehensive analysis of stable transgenic winter triticale cv. Bogo carrying the selectable marker gene HYGROMYCIN PHOSPHOTRANSFERASE (HPT and a synthetic green fluorescent protein gene (gfp. Progeny of four independent transgenic plants were comprehensively investigated with regard to the number of integrated T-DNA copies, the number of plant genomic integration loci, the integrity and functionality of individual T-DNA copies, as well as the segregation of transgenes in T1 and T2 generations, which also enabled us to identify homozygous transgenic lines. The truncation of some integrated T-DNAs at their left end along with the occurrence of independent segregation of multiple T-DNAs unintendedly resulted in a single-copy segregant that is selectable marker-free and homozygous for the gfp gene. The heritable expression of gfp driven by the maize UBI-1 promoter was demonstrated by confocal laser scanning microscopy. Conclusions The used transformation method is a valuable tool for the genetic engineering of triticale. Here we show that comprehensive molecular analyses are required for the correct interpretation of phenotypic data collected from the transgenic plants.

  9. Generation and characterization of a transgenic pig carrying a DsRed-monomer reporter gene.

    Directory of Open Access Journals (Sweden)

    Chih-Jen Chou

    Full Text Available Pigs are an optimal animal for conducting biomedical research because of their anatomical and physiological resemblance to humans. In contrast to the abundant resources available in the study of mice, few fluorescent protein-harboring porcine models are available for preclinical studies. In this paper, we report the successful generation and characterization of a transgenic DsRed-Monomer porcine model.The transgene comprised a CMV enhancer/chicken-beta actin promoter and DsRed monomeric cDNA. Transgenic pigs were produced by using pronuclear microinjection. PCR and Southern blot analyses were applied for identification of the transgene. Histology, blood examinations and computed tomography were performed to study the health conditions. The pig amniotic fluid progenitor/stem cells were also isolated to examine the existence of red fluorescence and differentiation ability.Transgenic pigs were successfully generated and transmitted to offspring at a germ-line transmission rate of 43.59% (17/39. Ubiquitous expression of red fluorescence was detected in the brain, eye, tongue, heart, lung, liver, pancreas, spleen, stomach, small intestine, large intestine, kidney, testis, and muscle; this was confirmed by histology and western blot analyses. In addition, we confirmed the differentiation potential of amniotic fluid progenitor stem cells isolated from the transgenic pig.This red fluorescent pig can serve as a host for other fluorescent-labeled cells in order to study cell-microenvironment interactions, and can provide optimal red-fluorescent-labeled cells and tissues for research in developmental biology, regenerative medicine, and xenotransplantation.

  10. Effective selection of transgenic papaya plants with the PMI/Man selection system.

    Science.gov (United States)

    Zhu, Yun J; Agbayani, Ricelle; McCafferty, Heather; Albert, Henrik H; Moore, Paul H

    2005-09-01

    The selectable marker gene phospho-mannose isomerase (pmi), which encodes the enzyme phospho-mannose isomerase (PMI) to enable selection of transformed cell lines on media containing mannose (Man), was evaluated for genetic transformation of papaya (Carica papaya L.). We found that papaya embryogenic calli have little or no PMI activity and cannot utilize Man as a carbon source; however, when calli were transformed with a pmi gene, the PMI activity was greatly increased and they could utilize Man as efficiently as sucrose. Plants regenerated from selected callus lines also exhibited PMI activity but at a lower specific activity level. Our transformation efficiency with Man selection was higher than that reported using antibiotic selection or with a visual marker. For papaya, the PMI/Man selection system for producing transgenic plants is a highly efficient addition to previously published methods for selection and may facilitate the stacking of multiple transgenes of interest. Additionally, since the PMI/Man selection system does not involve antibiotic or herbicide resistance genes, its use might reduce environmental concerns about the potential flow of those genes into related plant populations.

  11. Immunoglobulin gene expression and regulation of rearrangement in kappa transgenic mice

    International Nuclear Information System (INIS)

    Ritchie, K.A.

    1986-01-01

    Transgenic mice were produced by microinjection of the functionally rearranged immunoglobulin kappa gene from the myeloma MOPC-21 into the male pronucleus of fertilized mouse eggs, and implantation of the microinjected embryos into foster mothers. Mice that integrated the injected gene were detected by hybridizing tail DNA dots with radioactively labelled pBR322 plasmid DNA, which detects pBR322 sequences left as a tag on the microinjected DNA. Mice that integrated the injected gene (six males) were mated and the DNA, RNA and serum kappa chains of their offspring were analyzed. A rabbit anti-mouse kappa chain antiserum was also produced for use in detection of mouse kappa chains on protein blots. Hybridomas were produced from the spleen cells of these kappa transgenic mice to immortalize representative B cells and to investigate expression of the transgenic kappa gene, its effect on allelic exclusion, and its effect on the control of light chain gene rearrangement and expression. The results show that the microinjected DNA is integrated as concatamers in unique single or, rarely, two separate sites in the genome. The concatamers are composed of several copies (16 to 64) of injected DNA arranged in a head to tail fashion. The transgene is expressed into protein normally and in a tissue specific fashion. For the first time in these transgenic mice, all tissues contain a functionally rearranged and potentially expressible immunoglobulin gene. The transgene is expressed only in B cells and not in hepatocytes, for example. This indicates that rearrangement of immunoglobulin genes is necessary but not sufficient for the tissue specific expression of these genes by B cells

  12. The SbMT-2 gene from a halophyte confers abiotic stress tolerance and modulates ROS scavenging in transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Amit Kumar Chaturvedi

    Full Text Available Heavy metals are common pollutants of the coastal saline area and Salicornia brachiata an extreme halophyte is frequently exposed to various abiotic stresses including heavy metals. The SbMT-2 gene was cloned and transformed to tobacco for the functional validation. Transgenic tobacco lines (L2, L4, L6 and L13 showed significantly enhanced salt (NaCl, osmotic (PEG and metals (Zn++, Cu++ and Cd++ tolerance compared to WT plants. Transgenic lines did not show any morphological variation and had enhanced growth parameters viz. shoot length, root length, fresh weight and dry weight. High seed germination percentage, chlorophyll content, relative water content, electrolytic leakage and membrane stability index confirmed that transgenic lines performed better under salt (NaCl, osmotic (PEG and metals (Zn++, Cu++ and Cd++ stress conditions compared to WT plants. Proline, H2O2 and lipid peroxidation (MDA analyses suggested the role of SbMT-2 in cellular homeostasis and H2O2 detoxification. Furthermore in vivo localization of H2O2 and O2-; and elevated expression of key antioxidant enzyme encoding genes, SOD, POD and APX evident the possible role of SbMT-2 in ROS scavenging/detoxification mechanism. Transgenic lines showed accumulation of Cu++ and Cd++ in root while Zn++ in stem under stress condition. Under control (unstressed condition, Zn++ was accumulated more in root but accumulation of Zn++ in stem under stress condition suggested that SbMT-2 may involve in the selective translocation of Zn++ from root to stem. This observation was further supported by the up-regulation of zinc transporter encoding genes NtZIP1 and NtHMA-A under metal ion stress condition. The study suggested that SbMT-2 modulates ROS scavenging and is a potential candidate to be used for phytoremediation and imparting stress tolerance.

  13. The SbMT-2 gene from a halophyte confers abiotic stress tolerance and modulates ROS scavenging in transgenic tobacco.

    Science.gov (United States)

    Chaturvedi, Amit Kumar; Patel, Manish Kumar; Mishra, Avinash; Tiwari, Vivekanand; Jha, Bhavanath

    2014-01-01

    Heavy metals are common pollutants of the coastal saline area and Salicornia brachiata an extreme halophyte is frequently exposed to various abiotic stresses including heavy metals. The SbMT-2 gene was cloned and transformed to tobacco for the functional validation. Transgenic tobacco lines (L2, L4, L6 and L13) showed significantly enhanced salt (NaCl), osmotic (PEG) and metals (Zn++, Cu++ and Cd++) tolerance compared to WT plants. Transgenic lines did not show any morphological variation and had enhanced growth parameters viz. shoot length, root length, fresh weight and dry weight. High seed germination percentage, chlorophyll content, relative water content, electrolytic leakage and membrane stability index confirmed that transgenic lines performed better under salt (NaCl), osmotic (PEG) and metals (Zn++, Cu++ and Cd++) stress conditions compared to WT plants. Proline, H2O2 and lipid peroxidation (MDA) analyses suggested the role of SbMT-2 in cellular homeostasis and H2O2 detoxification. Furthermore in vivo localization of H2O2 and O2-; and elevated expression of key antioxidant enzyme encoding genes, SOD, POD and APX evident the possible role of SbMT-2 in ROS scavenging/detoxification mechanism. Transgenic lines showed accumulation of Cu++ and Cd++ in root while Zn++ in stem under stress condition. Under control (unstressed) condition, Zn++ was accumulated more in root but accumulation of Zn++ in stem under stress condition suggested that SbMT-2 may involve in the selective translocation of Zn++ from root to stem. This observation was further supported by the up-regulation of zinc transporter encoding genes NtZIP1 and NtHMA-A under metal ion stress condition. The study suggested that SbMT-2 modulates ROS scavenging and is a potential candidate to be used for phytoremediation and imparting stress tolerance.

  14. Transgenic chickens expressing human urokinase-type plasminogen activator.

    Science.gov (United States)

    Lee, Sung Ho; Gupta, Mukesh Kumar; Ho, Young Tae; Kim, Teoan; Lee, Hoon Taek

    2013-09-01

    Urokinase-type plasminogen activator is a serine protease that is clinically used in humans for the treatment of thrombolytic disorders and vascular diseases such as acute ischemic stroke and acute peripheral arterial occlusion. This study explored the feasibility of using chickens as a bioreactor for producing human urokinase-type plasminogen activator (huPA). Recombinant huPA gene, under the control of a ubiquitous Rous sarcoma virus promoter, was injected into the subgerminal cavity of freshly laid chicken eggs at stage X using the replication-defective Moloney murine leukemia virus (MoMLV)-based retrovirus vectors encapsidated with VSV-G (vesicular stomatitis virus G) glycoprotein. A total of 38 chicks, out of 573 virus-injected eggs, hatched and contained the huPA gene in their various body parts. The mRNA transcript of the huPA gene was present in various organs, including blood and egg, and was germ-line transmitted to the next generation. The level of active huPA protein was 16-fold higher in the blood of the transgenic chicken than in the nontransgenic chicken (P huPA protein in eggs increased from 7.82 IU/egg in the G0 generation to 17.02 IU/egg in the G1 generation. However, huPA-expressing embryos had reduced survival and hatchability at d 18 and 21 of incubation, respectively, and the blood clotting time was significantly higher in transgenic chickens than their nontransgenic counterparts (P huPA transgenic chickens could be successfully produced by the retroviral vector system. Transgenic chickens, expressing the huPA under the control of a ubiquitous promoter, may not only be used as a bioreactor for pharming of the huPA drug but also be useful for studying huPA-induced bleeding and other disorders.

  15. Neuroanatomy and transgenic technologies

    Science.gov (United States)

    This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

  16. Analyses of pancreas development by generation of gfp transgenic zebrafish using an exocrine pancreas-specific elastaseA gene promoter

    International Nuclear Information System (INIS)

    Wan Haiyan; Korzh, Svitlana; Li Zhen; Mudumana, Sudha Puttur; Korzh, Vladimir; Jiang Yunjin; Lin Shuo; Gong Zhiyuan

    2006-01-01

    In contrast to what we know on development of endocrine pancreas, the formation of exocrine pancreas remains poorly understood. To create an animal model that allows observation of exocrine cell differentiation, proliferation, and morphogenesis in living animals, we used the zebrafish elastaseA (elaA) regulatory sequence to develop transgenic zebrafish that display highly specific exocrine pancreas expression of GFP in both larvae and adult. By following GFP expression, we found that the pancreas in early development was a relatively compact organ and later extended posterior along the intestine. By transferring the elaA:gfp transgene into slow muscle omitted mutant that is deficient in receiving Hedgehog signals, we further showed that Hedgehog signaling is required for exocrine morphogenesis but not for cell differentiation. We also applied the morpholino knockdown and toxin-mediated cell ablation approaches to this transgenic line. We showed that the development of exocrine pancreas is Islet-1 dependent. Injection of the diphtheria toxin A (DTA) construct under the elastaseA promoter resulted in selective ablation of exocrine cells while the endocrine cells and other endodermal derivatives (liver and intestine) were not affected. Thus, our works demonstrated the new transgenic line provided a useful experimental tool in analyzing exocrine pancreas development

  17. Biotechnology network promotes knowledge of transgenics

    International Nuclear Information System (INIS)

    Blanco Picado, Patricia; Valdez Melara, Marta

    2015-01-01

    Red de Ingenieria Genetica Aplicada al Mejoramiento de Cultivos Tropicales (Rigatrop) integrated by a group of scientists from the Universidad de Costa Rica (UCR), Universidad Nacional (UNA) and of the Instituto Tecnologico de Costa Rica (TEC) have organized two forums on the topic of transgenics. The first forum has shown successful experiences of development of transgenic crops in Latin America, as for example: the transgenic bean, project realized in Brazil and transgenic eggplant in Bangladesh. The second forum has been about transgenics and environment effected at the UCR, on the occasion of World Environment Day. Rigatrop members are working currently in two projects applying biotechnological tools to coffee [es

  18. Analysis of Quality-Related Parameters in Mature Kernels of Polygalacturonase Inhibiting Protein (PGIP) Transgenic Bread Wheat Infected with Fusarium graminearum.

    Science.gov (United States)

    Masci, Stefania; Laino, Paolo; Janni, Michela; Botticella, Ermelinda; Di Carli, Mariasole; Benvenuto, Eugenio; Danieli, Pier Paolo; Lilley, Kathryn S; Lafiandra, Domenico; D'Ovidio, Renato

    2015-04-22

    Fusarium head blight, caused by the fungus Fusarium graminearum, has a detrimental effect on both productivity and qualitative properties of wheat. To evaluate its impact on wheat flour, we compared its effect on quality-related parameters between a transgenic bread wheat line expressing a bean polygalacturonase inhibiting protein (PGIP) and its control line. We have compared metabolic proteins, the amounts of gluten proteins and their relative ratios, starch content, yield, extent of pathogen contamination, and deoxynivalenol (DON) accumulation. These comparisons showed that Fusarium significantly decreases the amount of starch in infected control plants, but not in infected PGIP plants. The flour of PGIP plants contained also a lower amount of pathogen biomass and DON accumulation. Conversely, both gluten and metabolic proteins were not significantly influenced either by the transgene or by fungal infection. These results indicate that the transgenic PGIP expression reduces the level of infection, without changing significantly the wheat seed proteome and other quality-related parameters.

  19. Changes in melatonin levels in transgenic 'Micro-Tom' tomato overexpressing ovine AANAT and ovine HIOMT genes.

    Science.gov (United States)

    Wang, Lin; Zhao, Yu; Reiter, Russel J; He, Changjiu; Liu, Guoshi; Lei, Qiong; Zuo, Bixiao; Zheng, Xiao Dong; Li, Qingtian; Kong, Jin

    2014-03-01

    In animals, the melatonin biosynthesis pathway has been well defined after the isolation and identification of the four key genes that are involved in the conversion of tryptophan to melatonin. In plants, there are special alternative catalyzing steps, and plant genes share very low homology with the animal genes. It was of interest to examine the phenotype of transgenic Micro-Tom tomato plants overexpressing the homologous sheep oAANAT and oHIOMT genes responsible for the last two steps of melatonin synthesis. The oAANAT transgenic plants have higher melatonin levels and lower indoleacetic acid (IAA) contents than control due to the competition for tryptophan, the same precursor for both melatonin and IAA. Therefore, the oAANAT lines lose the 'apical dominance' inferring that melatonin likely lacks auxin activity. The significantly higher melatonin content in oHIOMT lines than oAANAT lines provides new proof for the important role of ASMT in plant melatonin synthesis. In addition, the enhanced drought tolerance of oHIOMT lines will also be an important contribution for plant engineering. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Highly phosphorylated functionalized rice starch produced by transgenic rice expressing the potato GWD1 gene

    DEFF Research Database (Denmark)

    Chen, Yaling; Sun, Xiao; Zhou, Xin Mao

    2017-01-01

    Starch phosphorylation occurs naturally during starch metabolism in the plant and is catalysed by glucan water dikinases (GWD1) and phosphoglucan water dikinase/glucan water dikinase 3 (PWD/GWD3). We generated six stable individual transgenic lines by over-expressing the potato GWD1 in rice....... Transgenic rice grain starch had 9-fold higher 6-phospho (6-P) monoesters and double amounts of 3-phospho (3-P) monoesters, respectively, compared to control grain. The shape and topography of the transgenic starch granules were moderately altered including surface pores and less well defined edges....... The gelatinization temperatures of both rice flour and extracted starch were significantly lower than those of the control and hence negatively correlated with the starch phosphate content. The 6-P content was positively correlated with amylose content and relatively long amylopectin chains with DP25-36, and the 3-P...

  1. Localization of introduced genes on the chromosomes of transgenic barley, wheat and triticale by fluorescence in situ hybridization

    DEFF Research Database (Denmark)

    Pedersen, C.; Zimny, J.; Becker, D.

    1997-01-01

    Using fluorescence in situ hybridization (FISH) we localized introduced genes on metaphase chromosomes of barley, wheat, and triticale transformed by microprojectile bombardment of microspores and scutellar tissue with the pDB1 plasmid containing the uidA and bar genes. Thirteen integration sites...... of single-copy integrations. There was a slight tendency towards the localization of transgenes in distal chromosome regions. Using the GAA-satellite sequence for chromosome banding, the chromosomes containing the inserted genes were identified in most cases. Two barley lines derived from the same...... transformant showed a totally different integration pattern. Southern analysis confirmed that the inserted genes were segregating independently, resulting in different integration patterns among the progeny lines. The application of the FISH technique for the analysis of transgenic plants is discussed....

  2. The responses of crop - wild Brassica hybrids to simulated herbivory and interspecific competition: implications for transgene introgression.

    Science.gov (United States)

    Sutherland, Jamie P; Justinova, Lenka; Poppy, Guy M

    2006-01-01

    Brassica rapa grows as a wild and weedy species throughout the world and is the most likely recipient of transgenes from GM oilseed rape. For transgene introgression to occur, the critical step which must be realized, is the formation of an F1 hybrid. Concerns exist that hybrid populations could be more vigorous and competitive compared to the parental species. This study examines the effect of simulated herbivory and interspecific competition on the vegetative and reproductive performance of non-transgenic F1 hybrids and their parental lines. Several vegetative and reproductive performance measures were used to determine the effect of simulated herbivory and competition on the Brassica lines, including leaf length and biomass for herbivory and seedling height and biomass for competition. For defoliation experiments, B. rapa showed little response in terms of leaf length but B. napus and the F1 hybrid responded negatively. Brassica rapa showed elevated biomass responses, but B. napus and the hybrid demonstrated negative responses to defoliation. Defoliation at the cotyledon stage had a slight effect upon final biomass with the F1 hybrid performing significantly worse than B. napus, although seed counts were not significantly different. For the series of competition experiments, hybrids seemed to be more similar to B. rapa in terms of early seedling growth and reproductive measures. The underperformance of hybrid plants when challenged by herbivory and competition, could potentially decrease survivorship and explain the rarity of hybrids in field surveys. However, should transgene introgression occur, the dynamics of hybrids could change radically thus increasing the risk of gene flow from a transgenic oilseed rape crop to the wild recipient.

  3. Efficient transformation and regeneration of transgenic cassava using the neomycin phosphotransferase gene as aminoglycoside resistance marker gene.

    Science.gov (United States)

    Niklaus, Michael; Gruissem, Wilhelm; Vanderschuren, Hervé

    2011-01-01

    Cassava is one of the most important crops in the tropics. Its industrial use for starch and biofuel production is also increasing its importance for agricultural production in tropical countries. In the last decade cassava biotechnology has emerged as a valuable alternative to the breeding constraints of this highly heterozygous crop for improved trait development of cassava germplasm. Cassava transformation remains difficult and time-consuming because of limitations in selecting transgenic tissues and regeneration of transgenic plantlets. We have recently reported an efficient and robust cassava transformation protocol using the hygromycin phosphotransferase II (hptII) gene as selection marker and the aminoglycoside hygromycin at optimal concentrations to maximize the regeneration of transgenic plantlets. In the present work, we expanded the transformation protocol to the use of the neomycin phosphotransferase II (nptII) gene as selection marker. Several aminoglycosides compatible with the use of nptII were tested and optimal concentrations for cassava transformation were determined. Given its efficiency equivalent to hptII as selection marker with the described protocol, the use of nptII opens new possibilities to engineer transgenic cassava lines with multiple T-DNA insertions and to produce transgenic cassava with a resistance marker gene that is already deregulated in several commercial transgenic crops.

  4. Comparative proteomics of milk fat globule membrane proteins from transgenic cloned cattle.

    Directory of Open Access Journals (Sweden)

    Shunchao Sui

    Full Text Available The use of transgenic livestock is providing new methods for obtaining pharmaceutically useful proteins. However, the protein expression profiles of the transgenic animals, including expression of milk fat globule membrane (MFGM proteins, have not been well characterized. In this study, we compared the MFGM protein expression profile of the colostrum and mature milk from three lines of transgenic cloned (TC cattle, i.e., expressing recombinant human α-lactalbumin (TC-LA, lactoferrin (TC-LF or lysozyme (TC-LZ in the mammary gland, with those from cloned non-transgenic (C and conventionally bred normal animals (N. We identified 1, 225 proteins in milk MFGM, 166 of which were specifically expressed only in the TC-LA group, 265 only in the TC-LF group, and 184 only in the TC-LZ group. There were 43 proteins expressed only in the transgenic cloned animals, but the concentrations of these proteins were below the detection limit of silver staining. Functional analysis also showed that the 43 proteins had no obvious influence on the bovine mammary gland. Quantitative comparison revealed that MFGM proteins were up- or down-regulated more than twofold in the TC and C groups compared to N group: 126 in colostrum and 77 in mature milk of the TC-LA group; 157 in colostrum and 222 in mature milk of the TC-LF group; 49 in colostrum and 98 in mature milk of the TC-LZ group; 98 in colostrum and 132 in mature milk in the C group. These up- and down-regulated proteins in the transgenic animals were not associated with a particular biological function or pathway, which appears that expression of certain exogenous proteins has no general deleterious effects on the cattle mammary gland.

  5. Mushroom body miscellanea: transgenic Drosophila strains expressing anatomical and physiological sensor proteins in Kenyon cells

    Science.gov (United States)

    Pech, Ulrike; Dipt, Shubham; Barth, Jonas; Singh, Priyanka; Jauch, Mandy; Thum, Andreas S.; Fiala, André; Riemensperger, Thomas

    2013-01-01

    The fruit fly Drosophila melanogaster represents a key model organism for analyzing how neuronal circuits regulate behavior. The mushroom body in the central brain is a particularly prominent brain region that has been intensely studied in several insect species and been implicated in a variety of behaviors, e.g., associative learning, locomotor activity, and sleep. Drosophila melanogaster offers the advantage that transgenes can be easily expressed in neuronal subpopulations, e.g., in intrinsic mushroom body neurons (Kenyon cells). A number of transgenes has been described and engineered to visualize the anatomy of neurons, to monitor physiological parameters of neuronal activity, and to manipulate neuronal function artificially. To target the expression of these transgenes selectively to specific neurons several sophisticated bi- or even multipartite transcription systems have been invented. However, the number of transgenes that can be combined in the genome of an individual fly is limited in practice. To facilitate the analysis of the mushroom body we provide a compilation of transgenic fruit flies that express transgenes under direct control of the Kenyon-cell specific promoter, mb247. The transgenes expressed are fluorescence reporters to analyze neuroanatomical aspects of the mushroom body, proteins to restrict ectopic gene expression to mushroom bodies, or fluorescent sensors to monitor physiological parameters of neuronal activity of Kenyon cells. Some of the transgenic animals compiled here have been published already, whereas others are novel and characterized here for the first time. Overall, the collection of transgenic flies expressing sensor and reporter genes in Kenyon cells facilitates combinations with binary transcription systems and might, ultimately, advance the physiological analysis of mushroom body function. PMID:24065891

  6. Expression of phytoene synthase1 and carotene desaturase crtI genes result in an increase in the total carotenoids content in transgenic elite wheat (Triticum aestivum L.).

    Science.gov (United States)

    Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan

    2009-09-23

    Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.

  7. Transgenic mice expressing human glucocerebrosidase variants: utility for the study of Gaucher disease.

    Science.gov (United States)

    Sanders, Angela; Hemmelgarn, Harmony; Melrose, Heather L; Hein, Leanne; Fuller, Maria; Clarke, Lorne A

    2013-08-01

    Gaucher disease is an autosomal recessively inherited storage disorder caused by deficiency of the lysosomal hydrolase, acid β-glucosidase. The disease manifestations seen in Gaucher patients are highly heterogeneous as is the responsiveness to therapy. The elucidation of the precise factors responsible for this heterogeneity has been challenging as the development of clinically relevant animal models of Gaucher disease has been problematic. Although numerous murine models for Gaucher disease have been described each has limitations in their specific utility. We describe here, transgenic murine models of Gaucher disease that will be particularly useful for the study of pharmacological chaperones. We have produced stable transgenic mouse strains that individually express wild type, N370S and L444P containing human acid β-glucosidase and show that each of these transgenic lines rescues the lethal phenotype characteristic of acid β-glucosidase null mice. Both the N370S and L444P transgenic models show early and progressive elevations of tissue sphingolipids with L444P mice developing progressive splenic Gaucher cell infiltration. We demonstrate the potential utility of these new transgenic models for the study of Gaucher disease pathogenesis. In addition, since these mice produce only human enzyme, they are particularly relevant for the study of pharmacological chaperones that are specifically targeted to human acid β-glucosidase and the common mutations underlying Gaucher disease. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Extracellular Secretion of Phytase from Transgenic Wheat Roots Allows Utilization of Phytate for Enhanced Phosphorus Uptake.

    Science.gov (United States)

    Mohsin, Samreen; Maqbool, Asma; Ashraf, Mehwish; Malik, Kauser Abdulla

    2017-08-01

    A significant portion of organic phosphorus comprises of phytates which are not available to wheat for uptake. Hence for enabling wheat to utilize organic phosphorus in form of phytate, transgenic wheat expressing phytase from Aspergillus japonicus under barley root-specific promoter was developed. Transgenic events were initially screened via selection media containing BASTA, followed by PCR and BASTA leaf paint assay after hardening. Out of 138 successfully regenerated T o events, only 12 had complete constructs and thus further analyzed. Positive T1 transgenic plants, grown in sand, exhibited 0.08-1.77, 0.02-0.67 and 0.44-2.14 fold increase in phytase activity in root extracts, intact roots and external root solution, respectively, after 4 weeks of phosphorus stress. Based on these results, T2 generation of four best transgenic events was further analyzed which showed up to 1.32, 56.89, and 15.40 fold increase in phytase activity in root extracts, intact roots and external root solution, respectively, while in case of real-time PCR, maximum fold increase of 19.8 in gene expression was observed. Transgenic lines showed 0.01-1.18 fold increase in phosphorus efficiency along with higher phosphorus content when supplied phytate or inorganic phosphorus than control plants. Thus, this transgenic wheat may aid in reducing fertilizer utilization and enhancing wheat yield.

  9. Wheat TaSP gene improves salt tolerance in transgenic Arabidopsis thaliana.

    Science.gov (United States)

    Ma, Xiaoli; Cui, Weina; Liang, Wenji; Huang, Zhanjing

    2015-12-01

    A novel salt-induced gene with unknown functions was cloned through analysis of gene expression profile of a salt-tolerant wheat mutant RH8706-49 under salt stress. The gene was named Triticum aestivum salt-related protein (TaSP) and deposited in GenBank (Accession No. KF307326). Quantitative polymerase chain reaction (qPCR) results showed that TaSP expression was induced under salt, abscisic acid (ABA), and polyethylene glycol (PEG) stresses. Subcellular localization revealed that TaSP was mainly localized in cell membrane. Overexpression of TaSP in Arabidopsis could improve salt tolerance of 35S::TaSP transgenic Arabidopsis. 35S::TaSP transgenic Arabidopsis lines after salt stress presented better physiological indexes than the control group. In the non-invasive micro-test (NMT), an evident Na(+) excretion was observed at the root tip of salt-stressed 35S::TaSP transgenic Arabidopsis. TaSP promoter was cloned, and its beta-glucuronidase (GUS) activities before and after ABA, salt, cold, heat, and salicylic acid (SA) stresses were determined. Full-length TaSP promoter contained ABA and salt response elements. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  10. Human anti-rhesus D IgG1 antibody produced in transgenic plants

    DEFF Research Database (Denmark)

    Bouquin, Thomas; Thomsen, Mads; Nielsen, Leif Kofoed

    2002-01-01

    antigen, which is responsible for alloimmunization of RhD- mothers carrying an RhD+ fetus. Anti-RhD extracted from plants specifically reacted with RhD+ cells in antiglobulin technique, and elicited a respiratory burst in human peripheral blood mononuclear cells. Plant-derived antibody had equivalent......Transgenic plants represent an alternative to cell culture systems for producing cheap and safe antibodies for diagnostic and therapeutic use. To evaluate the functional properties of a 'plantibody', we generated transgenic Arabidopsis plants expressing full-length human IgG1 against the Rhesus D...... properties to CHO cell-produced anti-RhD antibody, indicating its potential usefulness in diagnostic and therapeutic programs....

  11. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat.

    Science.gov (United States)

    Kaur, Jagdeep; Fellers, John; Adholeya, Alok; Velivelli, Siva L S; El-Mounadi, Kaoutar; Nersesian, Natalya; Clemente, Thomas; Shah, Dilip

    2017-02-01

    Rust fungi of the order Pucciniales are destructive pathogens of wheat worldwide. Leaf rust caused by the obligate, biotrophic basidiomycete fungus Puccinia triticina (Pt) is an economically important disease capable of causing up to 50 % yield losses. Historically, resistant wheat cultivars have been used to control leaf rust, but genetic resistance is ephemeral and breaks down with the emergence of new virulent Pt races. There is a need to develop alternative measures for control of leaf rust in wheat. Development of transgenic wheat expressing an antifungal defensin offers a promising approach to complement the endogenous resistance genes within the wheat germplasm for durable resistance to Pt. To that end, two different wheat genotypes, Bobwhite and Xin Chun 9 were transformed with a chimeric gene encoding an apoplast-targeted antifungal plant defensin MtDEF4.2 from Medicago truncatula. Transgenic lines from four independent events were further characterized. Homozygous transgenic wheat lines expressing MtDEF4.2 displayed resistance to Pt race MCPSS relative to the non-transgenic controls in growth chamber bioassays. Histopathological analysis suggested the presence of both pre- and posthaustorial resistance to leaf rust in these transgenic lines. MtDEF4.2 did not, however, affect the root colonization of a beneficial arbuscular mycorrhizal fungus Rhizophagus irregularis. This study demonstrates that the expression of apoplast-targeted plant defensin MtDEF4.2 can provide substantial resistance to an economically important leaf rust disease in transgenic wheat without negatively impacting its symbiotic relationship with the beneficial mycorrhizal fungus.

  12. Transgene mobilization and regulatory uncertainty for non-GE fruit products of transgenic rootstocks.

    Science.gov (United States)

    Haroldsen, Victor M; Chi-Ham, Cecilia L; Bennett, Alan B

    2012-10-31

    Genetically engineered (GE) rootstocks may offer some advantages for biotechnology applications especially in woody perennial crops such as grape or walnut. Transgrafting combines horticultural grafting practices with modern GE methods for crop improvement. Here, a non-GE conventional scion (upper stem portion) is grafted onto a transgenic GE rootstock. Thus, the scion does not contain the genetic modification present in the rootstock genome. We examined transgene presence in walnut and tomato GE rootstocks and non-GE fruit-bearing scions. Mobilization of transgene DNA, protein, and mRNA across the graft was not detected. Though transgenic siRNA mobilization was not observed in grafted tomatoes or walnut scions, transgenic siRNA signal was detected in walnut kernels. Prospective benefits from transgrafted plants include minimized risk of GE pollen flow (Lev-Yadun and Sederoff, 2001), possible use of more than one scion per approved GE rootstock which could help curb the estimated US$136 million (CropLife International, 2011) cost to bring a GE crop to international markets, as well as potential for improved consumer and market acceptance since the consumable product is not itself GE. Thus, transgrafting provides an alternative option for agricultural industries wishing to expand their biotechnology portfolio. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Overexpression of a Medicago truncatula stress-associated protein gene (MtSAP1) leads to nitric oxide accumulation and confers osmotic and salt stress tolerance in transgenic tobacco.

    Science.gov (United States)

    Charrier, Aurélie; Planchet, Elisabeth; Cerveau, Delphine; Gimeno-Gilles, Christine; Verdu, Isabelle; Limami, Anis M; Lelièvre, Eric

    2012-08-01

    The impact of Medicago truncatula stress-associated protein gene (MtSAP1) overexpression has been investigated in Nicotiana tabacum transgenic seedlings. Under optimal conditions, transgenic lines overexpressing MtSAP1 revealed better plant development and higher chlorophyll content as compared to wild type seedlings. Interestingly, transgenic lines showed a stronger accumulation of nitric oxide (NO), a signaling molecule involved in growth and development processes. This NO production seemed to be partially nitrate reductase dependent. Due to the fact that NO has been also reported to play a role in tolerance acquisition of plants to abiotic stresses, the responses of MtSAP1 overexpressors to osmotic and salt stress have been studied. Compared to the wild type, transgenic lines were less affected in their growth and development. Moreover, NO content in MtSAP1 overexpressors was always higher than that detected in wild seedlings under stress conditions. It seems that this better tolerance induced by MtSAP1 overexpression could be associated with this higher NO production that would enable seedlings to reach a high protection level to prepare them to cope with abiotic stresses.

  14. Transformation of Althaea officinalis L. by Agrobacterium rhizogenes for the production of transgenic roots expressing the anti-HIV microbicide cyanovirin-N.

    Science.gov (United States)

    Drake, Pascal M W; de Moraes Madeira, Luisa; Szeto, Tim H; Ma, Julian K-C

    2013-12-01

    The marshmallow plant (Althaea officinalis L.) has been used for centuries in medicine and other applications. Valuable secondary metabolites have previously been identified in Agrobacterium rhizogenes-generated transgenic 'hairy' roots in this species. In the present study, transgenic roots were produced in A. officinalis using A. rhizogenes. In addition to wild-type lines, roots expressing the anti-human immunodeficiency virus microbicide candidate, cyanovirin-N (CV-N), were generated. Wild-type and CV-N root lines were transferred to liquid culture and increased in mass by 49 and 19 % respectively over a 7 day culture period. In the latter, the concentration of CV-N present in the root tissue was 2.4 μg/g fresh weight, with an average secretion rate into the growth medium of 0.02 μg/ml/24 h. A. officinalis transgenic roots may therefore in the future be used not only as a source of therapeutic secondary metabolites, but also as an expression system for the production of recombinant pharmaceuticals.

  15. Ectopic expression of soybean gmsbh1 confers aba sensitivity during seed germination and early seedling establishment in transgenic arabidopsis

    International Nuclear Information System (INIS)

    Shu, Y.; Zhou, Y.; Huang, S.; Chen, M.; Huang, L.; Ma, H.

    2017-01-01

    The class I KNOX homeobox transcription factors are known to play an important role in maintenance of plant phenotype, especially leaves and flowers. In this study, a soybean KNOX I homeobox transcription factor, GmSBH1, was analyzed and confirmed to play important roles in the process of seed germination and developing. Real time quantitative PCR assay showed that the transcript level of GmSBH1 in soybean seedlings was modulated by plant hormones, such as IAA, GA, MeJA and ABA.Yeast one-hybrid assay showed that GmSBH1 could bind to the ABRE cis-element. Overexpression of GmSBH1 in Arabidopsis resulted in the abnormal phenotype of flowers and siliques. In GmSBH1 transgenic lines, both seed germination and seedlings growth showed hypersensitive to ABA. Moreover, the expression of ABA-responsive genes, such as ABI3 and ABI5, were increased in the transgenic line seedlings. Taken together, ectopic expression of GmSBH1 could alter the morphology and confer ABA sensitivity during seed germination and early seedling growth in transgenic Arabidopsis. (author)

  16. Chromosomal localisation of the CD4cre transgene in B6·Cg-Tg(Cd4-cre)1Cwi mice.

    Science.gov (United States)

    Westendorf, Kerstin; Durek, Pawel; Ayew, Samia; Mashreghi, Mir-Farzin; Radbruch, Andreas

    2016-09-01

    The B6·Cg-Tg(Cd4-cre)1Cwi line expresses CRE recombinase under the control of the promoter and regulatory elements of the Cd4 gene. Here we show that CRE recombinase expression reduces the number and frequencies of CD4 positive subsets in a dose-dependent manner and localize the integration site of the transgenic construct to position 60335693-60341285 (qD) of chromosome 3. The insert contains at least 15 complete sequential copies of the transgenic construct. Based on this information we describe a novel PCR assay for genetic typing of transgenic mice. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Impacts of elevated CO2 on exogenous Bacillus thuringiensis toxins and transgene expression in transgenic rice under different levels of nitrogen.

    Science.gov (United States)

    Jiang, Shoulin; Lu, Yongqing; Dai, Yang; Qian, Lei; Muhammad, Adnan Bodlah; Li, Teng; Wan, Guijun; Parajulee, Megha N; Chen, Fajun

    2017-11-07

    Recent studies have highlighted great challenges of transgene silencing for transgenic plants facing climate change. In order to understand the impacts of elevated CO 2 on exogenous Bacillus thuringiensis (Bt) toxins and transgene expression in transgenic rice under different levels of N-fertilizer supply, we investigated the biomass, exogenous Bt toxins, Bt-transgene expression and methylation status in Bt rice exposed to two levels of CO 2 concentrations and nitrogen (N) supply (1/8, 1/4, 1/2, 1 and 2 N). It is elucidated that the increased levels of global atmospheric CO 2 concentration will trigger up-regulation of Bt toxin expression in transgenic rice, especially with appropriate increase of N fertilizer supply, while, to some extent, the exogenous Bt-transgene expression is reduced at sub-N levels (1/4 and 1/2N), even though the total protein of plant tissues is reduced and the plant growth is restricted. The unpredictable and stochastic occurrence of transgene silencing and epigenetic alternations remains unresolved for most transgenic plants. It is expected that N fertilization supply may promote the expression of transgenic Bt toxin in transgenic Bt rice, particularly under elevated CO 2 .

  18. Metabolic regulation of carotenoid-enriched Golden rice line

    Directory of Open Access Journals (Sweden)

    Dipak Gayen

    2016-10-01

    Full Text Available Vitamin A deficiency (VAD is the leading cause of blindness among children and is associated with high risk of maternal mortality. In order to enhance the bioavailability of vitamin A, high carotenoid transgenic golden rice has been developed by manipulating enzymes, such as phytoene synthase (psy and phytoene desaturase (crtI. In this study, proteome and metabolite analyses were carried out to comprehend metabolic regulation and adaptation of transgenic golden rice after the manipulation of endosperm specific carotenoid pathways. The main alteration was observed in carbohydrate metabolism pathways of the transgenic seeds. The 2D based proteomic studies demonstrated that carbohydrate metabolism-related enzymes, such as pullulanase, UDP-glucose pyrophosphorylase and glucose-1-phosphate adenylyl transferase, were primarily up-regulated in transgenic rice seeds. In addition, the enzyme PPDK was also elevated in transgenic seeds thus enhancing pyruvate biosynthesis, which is the precursor in the carotenoids biosynthetic pathway. GC-MS based metabolite profiling demonstrated an increase in the levels of glyceric acid, fructo-furanose, and galactose, while decrease in galactonic acid and gentiobiose in the transgenic rice compared to WT. It is noteworthy to mention that the carotenoid content, especially β-carotene level in transgenic rice (4.3 µg/g was significantly enhanced. The present study highlights the metabolic adaptation process of a transgenic golden rice line (homozygous T4 progeny of SKBR-244 after enhancing carotenoid biosynthesis. The presented information would be helpful in the development of crops enriched in carotenoids by expressing metabolic flux of pyruvate biosynthesis.

  19. Constitutive over-expression of rice chymotrypsin protease inhibitor gene OCPI2 results in enhanced growth, salinity and osmotic stress tolerance of the transgenic Arabidopsis plants.

    Science.gov (United States)

    Tiwari, Lalit Dev; Mittal, Dheeraj; Chandra Mishra, Ratnesh; Grover, Anil

    2015-07-01

    Protease inhibitors are involved primarily in defense against pathogens. In recent years, these proteins have also been widely implicated in response of plants to diverse abiotic stresses. Rice chymotrypsin protease inhibitor gene OCPI2 is highly induced under salt and osmotic stresses. The construct containing the complete coding sequence of OCPI2 cloned downstream to CaMV35S promoter was transformed in Arabidopsis and single copy, homozygous transgenic lines were produced. The transgenic plants exhibited significantly enhanced tolerance to NaCl, PEG and mannitol stress as compared to wild type plants. Importantly, the vegetative and reproductive growth of transgenic plants under unstressed, control conditions was also enhanced: transgenic plants were more vigorous than wild type, resulting into higher yield in terms of silique number. The RWC values and membrane stability index of transgenic in comparison to wild type plants was higher. Higher proline content was observed in the AtOCPI2 lines, which was associated with higher transcript expression of pyrroline-5-carboxylate synthase and lowered levels of proline dehydrogenase genes. The chymotrypsin protease activities were lower in the transgenic as against wild type plants, under both unstressed, control as well as stressed conditions. It thus appears that rice chymotrypsin protease inhibitor gene OCPI2 is a useful candidate gene for genetic improvement of plants against salt and osmotic stress. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  20. Transgenic rice plants expressing synthetic cry2AX1 gene exhibits resistance to rice leaffolder (Cnaphalocrosis medinalis).

    Science.gov (United States)

    Manikandan, R; Balakrishnan, N; Sudhakar, D; Udayasuriyan, V

    2016-06-01

    Bacillus thuringiensis is a major source of insecticidal genes imparting insect resistance in transgenic plants. Level of expression of transgenes in transgenic plants is important to achieve desirable level of resistance against target insects. In order to achieve desirable level of expression, rice chloroplast transit peptide sequence was fused with synthetic cry2AX1 gene to target its protein in chloroplasts. Sixteen PCR positive lines of rice were generated by Agrobacterium mediated transformation using immature embryos. Southern blot hybridization analysis of T 0 transgenic plants confirmed the integration of cry2AX1 gene in two to five locations of rice genome and ELISA demonstrated its expression. Concentration of Cry2AX1 in transgenic rice events ranged 5.0-120 ng/g of fresh leaf tissue. Insect bioassay of T 0 transgenic rice plants against neonate larvae of rice leaffolder showed larval mortality ranging between 20 and 80 % in comparison to control plant. Stable inheritance and expression of cry2AX1 gene was demonstrated in T 1 progenies through Southern and ELISA. In T 1 progenies, the highest concentration of Cry2AX1 and mortality of rice leaffolder larvae were recorded as 150 ng/g of fresh leaf tissue and 80 %, respectively. The Cry2AX1 expression even at a very low concentration (120-150 ng/g) in transgenic rice plants was found effective against rice leaffolder larvae.

  1. Liver BCATm transgenic mouse model reveals the important role of the liver in maintaining BCAA homeostasis.

    Science.gov (United States)

    Ananieva, Elitsa A; Van Horn, Cynthia G; Jones, Meghan R; Hutson, Susan M

    2017-02-01

    Unlike other amino acids, the branched-chain amino acids (BCAAs) largely bypass first-pass liver degradation due to a lack of hepatocyte expression of the mitochondrial branched-chain aminotransferase (BCATm). This sets up interorgan shuttling of BCAAs and liver-skeletal muscle cooperation in BCAA catabolism. To explore whether complete liver catabolism of BCAAs may impact BCAA shuttling in peripheral tissues, the BCATm gene was stably introduced into mouse liver. Two transgenic mouse lines with low and high hepatocyte expression of the BCATm transgene (LivTg-LE and LivTg-HE) were created and used to measure liver and plasma amino acid concentrations and determine whether the first two BCAA enzymatic steps in liver, skeletal muscle, heart and kidney were impacted. Expression of the hepatic BCATm transgene lowered the concentrations of hepatic BCAAs while enhancing the concentrations of some nonessential amino acids. Extrahepatic BCAA metabolic enzymes and plasma amino acids were largely unaffected, and no growth rate or body composition differences were observed in the transgenic animals as compared to wild-type mice. Feeding the transgenic animals a high-fat diet did not reverse the effect of the BCATm transgene on the hepatic BCAA catabolism, nor did the high-fat diet cause elevation in plasma BCAAs. However, the high-fat-diet-fed BCATm transgenic animals experienced attenuation in the mammalian target of rapamycin (mTOR) pathway in the liver and had impaired blood glucose tolerance. These results suggest that complete liver BCAA metabolism influences the regulation of glucose utilization during diet-induced obesity. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Growth-Enhanced Transgenic Coho Salmon (Oncorhynchus kisutch Strains Have Varied Success in Simulated Streams: Implications for Risk Assessment.

    Directory of Open Access Journals (Sweden)

    Rosalind A Leggatt

    Full Text Available Growth hormone (GH transgenic fish have accelerated growth and could improve production efficiency in aquaculture. However, concern exists regarding potential environmental risks of GH transgenic fish should they escape rearing facilities. While environmental effects have been examined in some GH transgenic models, there is a lack of information on whether effects differ among different constructs or strains of transgenic fish. We compared growth and survival of wild-type coho salmon (Oncorhynchus kisutch fry, a fast-growing GH transgenic strain containing a metallothionein promoter (TMT, and three lines/strains containing a reportedly weaker histone-3 promoter (TH3 in hatchery conditions and semi-natural stream tanks with varying levels of natural food and predators. Rank order of genotype size and survival differed with varying environmental conditions, both within and among experiments. Despite accelerated growth in hatchery conditions, TMT fry gained little or no growth enhancement in stream conditions, had enhanced survival when food was limiting, and inconsistent survival under other conditions. Rank growth was inconsistent in TH3 strains, with one strain having highest, and two strains having the lowest growth in stream conditions, although all TH3 strains had consistently poor survival. These studies demonstrate the importance of determining risk estimates for each unique transgenic model independent of other models.

  3. Human CD68 promoter GFP transgenic mice allow analysis of monocyte to macrophage differentiation in vivo.

    Science.gov (United States)

    Iqbal, Asif J; McNeill, Eileen; Kapellos, Theodore S; Regan-Komito, Daniel; Norman, Sophie; Burd, Sarah; Smart, Nicola; Machemer, Daniel E W; Stylianou, Elena; McShane, Helen; Channon, Keith M; Chawla, Ajay; Greaves, David R

    2014-10-09

    The recruitment of monocytes and their differentiation into macrophages at sites of inflammation are key events in determining the outcome of the inflammatory response and initiating the return to tissue homeostasis. To study monocyte trafficking and macrophage differentiation in vivo, we have generated a novel transgenic reporter mouse expressing a green fluorescent protein (GFP) under the control of the human CD68 promoter. CD68-GFP mice express high levels of GFP in both monocyte and embryo-derived tissue resident macrophages in adult animals. The human CD68 promoter drives GFP expression in all CD115(+) monocytes of adult blood, spleen, and bone marrow; we took advantage of this to directly compare the trafficking of bone marrow-derived CD68-GFP monocytes to that of CX3CR1(GFP) monocytes in vivo using a sterile zymosan peritonitis model. Unlike CX3CR1(GFP) monocytes, which downregulate GFP expression on differentiation into macrophages in this model, CD68-GFP monocytes retain high-level GFP expression for 72 hours after differentiation into macrophages, allowing continued cell tracking during resolution of inflammation. In summary, this novel CD68-GFP transgenic reporter mouse line represents a powerful resource for analyzing monocyte mobilization and monocyte trafficking as well as studying the fate of recruited monocytes in models of acute and chronic inflammation. © 2014 by The American Society of Hematology.

  4. Ectopic accumulation of linalool confers resistance to Xanthomonas citri subsp. citri in transgenic sweet orange plants.

    Science.gov (United States)

    Shimada, Takehiko; Endo, Tomoko; Rodríguez, Ana; Fujii, Hiroshi; Goto, Shingo; Matsuura, Takakazu; Hojo, Yuko; Ikeda, Yoko; Mori, Izumi C; Fujikawa, Takashi; Peña, Leandro; Omura, Mitsuo

    2017-05-01

    In order to clarify whether high linalool content in citrus leaves alone induces strong field resistance to citrus canker caused by Xanthomonas citri subsp. citri (Xcc), and to assess whether this trait can be transferred to a citrus type highly sensitive to the bacterium, transgenic 'Hamlin' sweet orange (Citrus sinensis L. Osbeck) plants over-expressing a linalool synthase gene (CuSTS3-1) were generated. Transgenic lines (LIL) with the highest linalool content showed strong resistance to citrus canker when spray inoculated with the bacterium. In LIL plants inoculated by wounding (multiple-needle inoculation), the linalool level was correlated with the repression of the bacterial titer and up-regulation of defense-related genes. The exogenous application of salicylic acid, methyl jasmonate or linalool triggered responses similar to those constitutively induced in LIL plants. The linalool content in Ponkan mandarin leaves was significantly higher than that of leaves from six other representative citrus genotypes with different susceptibilities to Xcc. We propose that linalool-mediated resistance might be unique to citrus tissues accumulating large amounts of volatile organic compounds in oil cells. Linalool might act not only as a direct antibacterial agent, but also as a signal molecule involved in triggering a non-host resistance response against Xcc. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Inhibiting the Activity of CA1 Hippocampal Neurons Prevents the Recall of Contextual Fear Memory in Inducible ArchT Transgenic Mice.

    Directory of Open Access Journals (Sweden)

    Masanori Sakaguchi

    Full Text Available The optogenetic manipulation of light-activated ion-channels/pumps (i.e., opsins can reversibly activate or suppress neuronal activity with precise temporal control. Therefore, optogenetic techniques hold great potential to establish causal relationships between specific neuronal circuits and their function in freely moving animals. Due to the critical role of the hippocampal CA1 region in memory function, we explored the possibility of targeting an inhibitory opsin, ArchT, to CA1 pyramidal neurons in mice. We established a transgenic mouse line in which tetracycline trans-activator induces ArchT expression. By crossing this line with a CaMKIIα-tTA transgenic line, the delivery of light via an implanted optrode inhibits the activity of excitatory CA1 neurons. We found that light delivery to the hippocampus inhibited the recall of a contextual fear memory. Our results demonstrate that this optogenetic mouse line can be used to investigate the neuronal circuits underlying behavior.

  6. Overexpression of a Plasma Membrane-Localized SbSRP-Like Protein Enhances Salinity and Osmotic Stress Tolerance in Transgenic Tobacco

    Directory of Open Access Journals (Sweden)

    Avinash Mishra

    2017-04-01

    Full Text Available An obligate halophyte, Salicornia brachiata grows in salt marshes and is considered to be a potential resource of salt- and drought-responsive genes. It is important to develop an understanding of the mechanisms behind enhanced salt tolerance. To increase this understanding, a novel SbSRP gene was cloned, characterized, over-expressed, and functionally validated in the model plant Nicotiana tabacum. The genome of the halophyte S. brachiata contains two homologs of an intronless SbSRP gene of 1,262 bp in length that encodes for a stress-related protein. An in vivo localization study confirmed that SbSRP is localized on the plasma membrane. Transgenic tobacco plants (T1 that constitutively over-express the SbSRP gene showed improved salinity and osmotic stress tolerance. In comparison to Wild Type (WT and Vector Control (VC plants, transgenic lines showed elevated relative water and chlorophyll content, lower malondialdehyde content, lower electrolyte leakage and higher accumulation of proline, free amino acids, sugars, polyphenols, and starch under abiotic stress treatments. Furthermore, a lower build-up of H2O2 content and superoxide-radicals was found in transgenic lines compared to WT and VC plants under stress conditions. Transcript expression of Nt-APX (ascorbate peroxidase, Nt-CAT (catalase, Nt-SOD (superoxide dismutase, Nt-DREB (dehydration responsive element binding factor, and Nt-AP2 (apetala2 genes was higher in transgenic lines under stress compared to WT and VC plants. The results suggested that overexpression of membrane-localized SbSRP mitigates salt and osmotic stress in the transgenic tobacco plant. It was hypothesized that SbSRP can be a transporter protein to transmit the environmental stimuli downward through the plasma membrane. However, a detailed study is required to ascertain its exact role in the abiotic stress tolerance mechanism. Overall, SbSRP is a potential candidate to be used for engineering salt and osmotic

  7. Representativeness of the LifeLines Cohort Study

    NARCIS (Netherlands)

    Klijs, B.; Scholtens, S.; Mandemakers, J.J.; Snieder, H.; Stolk, R.P.; Smidt, N.

    2015-01-01

    Background LifeLines is a large prospective population-based three generation cohort study in the north of the Netherlands. Different recruitment strategies were adopted: recruitment of an index population via general practitioners, subsequent inclusion of their family members, and online

  8. Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

    Directory of Open Access Journals (Sweden)

    Jinlong Guo

    2015-01-01

    Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

  9. Antifungal genes expressed in transgenic pea (Pisum sativum L.) do not affect root colonization of arbuscular mycorrhizae fungi.

    Science.gov (United States)

    Kahlon, Jagroop Gill; Jacobsen, Hans-Jörg; Cahill, James F; Hall, Linda M

    2017-10-01

    Genetically modified crops have raised concerns about unintended consequences on non-target organisms including beneficial soil associates. Pea transformed with four antifungal genes 1-3 β glucanase, endochitinase, polygalacturonase-inhibiting proteins, and stilbene synthase is currently under field-testing for efficacy against fungal diseases in Canada. Transgenes had lower expression in the roots than leaves in greenhouse experiment. To determine the impact of disease-tolerant pea or gene products on colonization by non-target arbuscular mycorrhizae and nodulation by rhizobium, a field trial was established. Transgene insertion, as single gene or stacked genes, did not alter root colonization by arbuscular mycorrhiza fungus (AMF) or root nodulation by rhizobium inoculation in the field. We found no effect of transgenes on the plant growth and performance although, having a dual inoculant with both AMF and rhizobium yielded higher fresh weight shoot-to-root ratio in all the lines tested. This initial risk assessment of transgenic peas expressing antifungal genes showed no deleterious effect on non-target organisms.

  10. Cloning of genes and developing transgenic crops with enhanced tolerance to salinity and drought (abstract)

    International Nuclear Information System (INIS)

    Bansal, K.C.; Chinnusamy, V.; Tayal, D.; Das, A.; Goel, D.; Yadav, V.; Singh, A.K.; Lakhshmi, K.

    2005-01-01

    Abiotic stresses represent the most limiting factors affecting agricultural productivity. In India more than 60% of total cultivated land is still rainfed and crops experience frequent droughts. Thus, we need to develop transgenic crops tolerant to drought, and other related abiotic stress factors such as salinity, low and high temperature stresses. At the National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute (ICAR), we have initiated a programme on developing transgenic crops tolerant to a range of abiotic stresses. The major emphasis is on developing transgenic potato, tomato, mustard, rice and wheat. While, transgenic plants of potato. tomato and mustard have already been generated with osmotin gene and are at different stages of testing, other key genes imparting tolerance to abiotic stresses are being isolated from different species for producing transgenic rice and wheat cultivars tolerant to multiple stresses. Genes that have been isolated in our laboratory include ascorbate peroxidase gene (TaApx) and genes encoding transcription factor, CBFs (TaCBF2 and TaCBP3) from a drought tolerant wheat cultivar (C306), Lea1 cDNA from Brassica species, codA from Arthrobacter globiformis, and otsBA operon from E. coli. Apart from these stress-related genes, we have isolated a few stress-inducible promoters for deploying them in gene stacking in developing transgenic crops with enhanced tolerance to multiple abiotic stresses. The results will be presented. (author)

  11. Expression of a methionine-rich storage albumin from the Brazil nut (Bertholletia excelsa H.B.K., Lecythidaceae in transgenic bean plants (Phaseolus vulgaris L., Fabaceae

    Directory of Open Access Journals (Sweden)

    Aragão F.J.L.

    1999-01-01

    Full Text Available Bean (Phaseolus vulgaris, an important component in the diet of people in developing countries, has low levels of the essential amino acid, methionine. We have attempted to correct this deficiency by introducing a transgene coding for a methionine-rich storage albumin from the Brazil nut via biolistic methods. The transgene's coding sequence was driven by a doubled 35S CaMV promoter and AMV enhancer sequences. The transgene was stable and correctly expressed in homozygous R2 to R5 seeds. In two of the five transgenic lines the methionine content was significantly increased (14 and 23% over the values found in untransformed plants.

  12. Detection of Bar Transgenic Sugarcane with a Rapid and Visual Loop-Mediated Isothermal Amplification Assay.

    Science.gov (United States)

    Zhou, Dinggang; Wang, Chunfeng; Li, Zhu; Chen, Yun; Gao, Shiwu; Guo, Jinlong; Lu, Wenying; Su, Yachun; Xu, Liping; Que, Youxiong

    2016-01-01

    Genetic engineering offers an attractive alternative in sugarcane breeding for increasing cane and sugar yields as well as disease and insect resistance. Bar transgenic sugarcane employing the herbicide tolerance is a useful agronomical trait in weed control. In this study, a loop-mediated isothermal amplification (LAMP) assay for rapid detection of the bar gene in transgenic sugarcane has been developed and evaluated. A set of six primers was designed for LAMP-based amplification of the bar gene. The LAMP reaction conditions were optimized as follows: 5.25 mM of Mg(2+), 6:1 ratio of inner vs. outer primer, and 6.0 U of Bst DNA polymerase in a reaction volume of 25.0 μL. The detection limit of the recombinant plasmid 1Ac0229 was as low as 10 copies in the developed LAMP, which was 10-fold higher sensitive than that of conventional PCR. In 100 putative transgenic lines, the bar gene was detected in 100/100 cases (100%) by LAMP and 97/100 cases (97%) by conventional PCR, respectively. In conclusion, the developed LAMP assay is visual, rapid, sensitive, reliable, and cost-effective for detection of the bar specific transgenic sugarcane.

  13. Expression of a cystatin transgene in eggplant provides resistance to root-knot nematode, Meloidogyne incognita

    Directory of Open Access Journals (Sweden)

    Pradeep Kumar Papolu

    2016-07-01

    Full Text Available Root-knot nematodes (RKN cause substantial yield decline in eggplant and sustainable management options to minimize crop damage due to nematodes are still limited. A number of genetic engineering strategies have been developed to disrupt the successful plant-nematode interactions. Among them, delivery of proteinase inhibitors from the plant to perturb nematode development and reproduction is arguably the most effective strategy. In the present study, transgenic eggplant expressing a modified rice cystatin (OC-IΔD86 gene under the control of the root-specific promoter, TUB-1, was generated to evaluate the genetically modified nematode resistance. Five putative transformants were selected through PCR and genomic Southern blot analysis. Expression of the cystatin transgene was confirmed in all the events using western blotting, ELISA and qPCR assay. Upon challenge inoculation, all the transgenic events exhibited a detrimental effect on RKN development and reproduction. The best transgenic line (a single copy event showed 78.3% inhibition in reproductive success of RKN. Our results suggest that cystatins can play an important role for improving nematode resistance in eggplant and their deployment in gene pyramiding strategies with other proteinase inhibitors could ultimately enhance crop yield.

  14. Detection of bar transgenic sugarcane with a rapid and visual loop-mediated isothermal amplification assay

    Directory of Open Access Journals (Sweden)

    Dinggang eZhou

    2016-03-01

    Full Text Available Genetic engineering offers an attractive alternative in sugarcane breeding for increasing cane and sugar yields as well as disease and insect resistance. Bar transgenic sugarcane employing the herbicide tolerance is a useful agronomical trait in weed control. In this study, a loop-mediated isothermal amplification (LAMP assay for rapid detection of the bar gene in transgenic sugarcane has been developed and evaluated. A set of six primers was designed for LAMP-based amplification of the bar gene. The LAMP reaction conditions were optimized as follows: 5.25 mM of Mg2+, 6:1 ratio of inner vs outer primer, and 6.0 U of Bst DNA polymerase in a reaction volume of 25.0 μL. The detection limit of the recombinant plasmid 1Ac0229 was as low as 10 copies in the developed LAMP, which was ten-fold higher sensitive than that of conventional PCR. In 100 putative transgenic lines, the bar gene was detected in 100/100 cases (100% by LAMP and 97/100 cases (97% by conventional PCR, respectively. In conclusion, the developed LAMP assay is visual, rapid, sensitive, reliable and cost-effective for detection of the bar specific transgenic sugarcane.

  15. Identification of genomic insertion and flanking sequence of G2-EPSPS and GAT transgenes in soybean using whole genome sequencing method

    Directory of Open Access Journals (Sweden)

    Bingfu Guo

    2016-07-01

    Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.

  16. Development of transgenic finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast disease.

    Science.gov (United States)

    Ignacimuthu, S; Ceasar, S Antony

    2012-03-01

    Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.

  17. Osteocytes, not Osteoblasts or Lining Cells, are the Main Source of the RANKL Required for Osteoclast Formation in Remodeling Bone.

    Directory of Open Access Journals (Sweden)

    Jinhu Xiong

    Full Text Available The cytokine receptor activator of nuclear factor kappa B ligand (RANKL, encoded by the Tnfsf11 gene, is essential for osteoclastogenesis and previous studies have shown that deletion of the Tnfsf11 gene using a Dmp1-Cre transgene reduces osteoclast formation in cancellous bone by more than 70%. However, the Dmp1-Cre transgene used in those studies leads to recombination in osteocytes, osteoblasts, and lining cells making it unclear whether one or more of these cell types produce the RANKL required for osteoclast formation in cancellous bone. Because osteoblasts, osteocytes, and lining cells have distinct locations and functions, distinguishing which of these cell types are sources of RANKL is essential for understanding the orchestration of bone remodeling. To distinguish between these possibilities, we have now created transgenic mice expressing the Cre recombinase under the control of regulatory elements of the Sost gene, which is expressed in osteocytes but not osteoblasts or lining cells in murine bone. Activity of the Sost-Cre transgene in osteocytes, but not osteoblast or lining cells, was confirmed by crossing Sost-Cre transgenic mice with tdTomato and R26R Cre-reporter mice, which express tdTomato fluorescent protein or LacZ, respectively, only in cells expressing the Cre recombinase or their descendants. Deletion of the Tnfsf11 gene in Sost-Cre mice led to a threefold decrease in osteoclast number in cancellous bone and increased cancellous bone mass, mimicking the skeletal phenotype of mice in which the Tnfsf11 gene was deleted using the Dmp1-Cre transgene. These results demonstrate that osteocytes, not osteoblasts or lining cells, are the main source of the RANKL required for osteoclast formation in remodeling cancellous bone.

  18. 5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

    Science.gov (United States)

    Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

    2017-08-01

    Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

  19. Stable Skin-specific Overexpression of Human CTLA4-Ig in Transgenic Mice through Seven Generations

    Institute of Scientific and Technical Information of China (English)

    Yong WANG; Yong NI; Hong WEI; Feng-Chao WANG; Liang-Peng GE; Xiang GAO

    2006-01-01

    Skin graft rejection is a typical cellular immune response, mainly mediated by T cells. Cytotoxic T lymphocyte associated antigen 4-immunoglobin (CTLA4-Ig) extends graft survival by blocking the T cell co-stimulation pathway and inhibiting T cell activation. To investigate the efficacy of CTLA4-Ig in prolonging skin graft survival, human CTLA4-Ig (hCTLA4-Ig) was engineered to overexpress in mouse skin by transgenesis using the K14 promoter. Reverse transcription-polymerase chain reaction (RT-PCR) and Western blot assay indicated that the expression of CTLA4-Ig remained skin-specific and relatively constant compared to the internal control protein, AKT, through seven generations. The presence and concentration of the hCTLA4-Ig protein in transgenic mouse sera was determined by enzyme-linked immunosorbent assay (ELISA), and the results indicated that the serum CTLA4-Ig concentration also remained constant through generations. Survival of transgenic mouse skins grafted onto rat wounds was remarkably prolonged compared to that of wild-type skins from the same mouse strain, and remained comparable among all seven generations. This suggested that the bioactive hCTLA4-Ig protein was stably expressed in transgenical mice through at least seven generations, which was consistent with the stable skin-specific CTLA4-Ig expression.The results demonstrated that the transgenic expression of hCTLA4-Ig in skin driven by the K14 promoter remained constant through generations, and a transgenic line can be established to provide transgenic skin with extended survival reproducibly.

  20. Progress on researches of transgenic alfalfa

    International Nuclear Information System (INIS)

    Guo Huiqin; Wang Mi; Ren Weibo; Xu Zhu; Chen Libo

    2010-01-01

    In this paper, the progress on the researches of transgenic alfalfa in the past two decades had been reviewed in the aspects of regeneration system, transformation, improvement of the important traits and so on. Moreover, such problems as variation of transgene expression and safety of transgenic plant had also been discussed and propose had been given for the future research work. (authors)

  1. Infestation of transgenic powdery mildew-resistant wheat by naturally occurring insect herbivores under different environmental conditions.

    Directory of Open Access Journals (Sweden)

    Fernando Álvarez-Alfageme

    Full Text Available A concern associated with the growing of genetically modified (GM crops is that they could adversely affect non-target organisms. We assessed the impact of several transgenic powdery mildew-resistant spring wheat lines on insect herbivores. The GM lines carried either the Pm3b gene from hexaploid wheat, which confers race-specific resistance to powdery mildew, or the less specific anti-fungal barley seed chitinase and β-1,3-glucanase. In addition to the non-transformed control lines, several conventional spring wheat varieties and barley and triticale were included for comparison. During two consecutive growing seasons, powdery mildew infection and the abundance of and damage by naturally occurring herbivores were estimated under semi-field conditions in a convertible glasshouse and in the field. Mildew was reduced on the Pm3b-transgenic lines but not on the chitinase/glucanase-expressing lines. Abundance of aphids was negatively correlated with powdery mildew in the convertible glasshouse, with Pm3b wheat plants hosting significantly more aphids than their mildew-susceptible controls. In contrast, aphid densities did not differ between GM plants and their non-transformed controls in the field, probably because of low mildew and aphid pressure at this location. Likewise, the GM wheat lines did not affect the abundance of or damage by the herbivores Oulema melanopus (L. and Chlorops pumilionis Bjerk. Although a previous study has revealed that some of the GM wheat lines show pleiotropic effects under field conditions, their effect on herbivorous insects appears to be low.

  2. Transgenics, agroindustry and food sovereignty

    Directory of Open Access Journals (Sweden)

    Xavier Alejandro León Vega

    2014-10-01

    Full Text Available Food sovereignty has been implemented constitutionally in Ecuador; however, many of the actions and policies are designed to benefit the dominant model of food production, based in agroindustry, intensive monocultures, agrochemicals and transgenics. This article reflects upon the role of family farming as a generator of food sovereignty, and secondly the threat to them by agroindustry agriculture based in transgenic. The role played by food aid in the introduction of transgenic in Latin America and other regions of the world is also analyzed.

  3. Discrimination of Transgenic Rice Based on Near Infrared Reflectance Spectroscopy and Partial Least Squares Regression Discriminant Analysis

    Directory of Open Access Journals (Sweden)

    ZHANG Long

    2015-09-01

    Full Text Available Near infrared reflectance spectroscopy (NIRS, a non-destructive measurement technique, was combined with partial least squares regression discrimiant analysis (PLS-DA to discriminate the transgenic (TCTP and mi166 and wild type (Zhonghua 11 rice. Furthermore, rice lines transformed with protein gene (OsTCTP and regulation gene (Osmi166 were also discriminated by the NIRS method. The performances of PLS-DA in spectral ranges of 4 000–8 000 cm-1 and 4 000–10 000 cm-1 were compared to obtain the optimal spectral range. As a result, the transgenic and wild type rice were distinguished from each other in the range of 4 000–10 000 cm-1, and the correct classification rate was 100.0% in the validation test. The transgenic rice TCTP and mi166 were also distinguished from each other in the range of 4 000–10 000 cm-1, and the correct classification rate was also 100.0%. In conclusion, NIRS combined with PLS-DA can be used for the discrimination of transgenic rice.

  4. Influence of transgenic rice expressing a fused Cry1Ab/1Ac protein on frogs in paddy fields.

    Science.gov (United States)

    Wang, Jia-Mei; Chen, Xiu-Ping; Liang, Yu-Yong; Zhu, Hao-Jun; Ding, Jia-Tong; Peng, Yu-Fa

    2014-11-01

    As genetic engineering in plants is increasingly used to control agricultural pests, it is important to determine whether such transgenic plants adversely affect non-target organisms within and around cultivated fields. The cry1Ab/1Ac fusion gene from Bacillus thuringiensis (Bt) has insecticidal activity and has been introduced into rice line Minghui 63 (MH63). We evaluated the effect of transgenic cry1Ab/1Ac rice (Huahui 1, HH1) on paddy frogs by comparing HH1 and MH63 rice paddies with and without pesticide treatment. The density of tadpoles in rice fields was surveyed at regular intervals, and Cry1Ab/1Ac protein levels were determined in tissues of tadpoles and froglets collected from the paddy fields. In addition, Rana nigromaculata froglets were raised in purse nets placed within these experimental plots. The survival, body weight, feeding habits, and histological characteristics of the digestive tract of these froglets were analyzed. We found that the tadpole density was significantly decreased immediately after pesticide application, and the weight of R. nigromaculata froglets of pesticide groups was significantly reduced compared with no pesticide treatment, but we found no differences between Bt and non-Bt rice groups. Moreover, no Cry1Ab/1Ac protein was detected in tissue samples collected from 192 tadpoles and froglets representing all four experimental groups. In addition, R. nigromaculata froglets raised in purse seines fed primarily on stem borer and non-target insects, and showed no obvious abnormality in the microstructure of their digestive tracts. Based on these results, we conclude that cultivation of transgenic cry1Ab/1Ac rice does not adversely affect paddy frogs.

  5. Expression of hybrid fusion protein (Cry1Ac::ASAL) in transgenic rice plants imparts resistance against multiple insect pests.

    Science.gov (United States)

    Boddupally, Dayakar; Tamirisa, Srinath; Gundra, Sivakrishna Rao; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2018-05-31

    To evolve rice varieties resistant to different groups of insect pests a fusion gene, comprising DI and DII domains of Bt Cry1Ac and carbohydrate binding domain of garlic lectin (ASAL), was constructed. Transgenic rice lines were generated and evaluated to assess the efficacy of Cry1Ac::ASAL fusion protein against three major pests, viz., yellow stem borer (YSB), leaf folder (LF) and brown planthopper (BPH). Molecular analyses of transgenic plants revealed stable integration and expression of the fusion gene. In planta insect bioassays on transgenics disclosed enhanced levels of resistance compared to the control plants. High insect mortality of YSB, LF and BPH was observed on transgenics compared to that of control plants. Furthermore, honeydew assays revealed significant decreases in the feeding ability of BPH on transgenic plants as compared to the controls. Ligand blot analysis, using BPH insects fed on cry1Ac::asal transgenic rice plants, revealed a modified receptor protein-binding pattern owing to its ability to bind to additional receptors in insects. The overall results authenticate that Cry1Ac::ASAL protein is endowed with remarkable entomotoxic effects against major lepidopteran and hemipteran insects. As such, the fusion gene appears promising and can be introduced into various other crops to control multiple insect pests.

  6. Diversity of arthropod community in transgenic poplar-cotton ecosystems.

    Science.gov (United States)

    Zhang, D J; Lu, Z Y; Liu, J X; Li, C L; Yang, M S

    2015-12-02

    Poplar-cotton agro-ecosystems are the main agricultural planting modes of plain cotton fields in China. Here, we performed a systematic survey of the diversity and population of arthropod communities in four different combination of poplar-cotton eco-systems, including I) non-transgenic poplar and non-transgenic cotton fields; II) non-transgenic poplar and transgenic cotton fields [Bacillus thuringiensis (Bt) cotton]; III) Bt transgenic poplar (high insect resistant strain Pb29) and non-transgenic cotton; and IV) transgenic poplar and transgenic cotton fields, over a period of 3 years. Based on the statistical methods used to investigate community ecology, the effects of transgenic ecosystems on the whole structure of the arthropod community, on the structure of arthropods in the nutritive layer, and on the similarity of arthropod communities were evaluated. The main results were as follows: the transgenic poplar-cotton ecosystem has a stronger inhibitory effect on insect pests and has no impact on the structure of the arthropod community, and therefore, maintains the diversity of the arthropod community. The character index of the community indicated that the structure of the arthropod community of the transgenic poplar-cotton ecosystem was better than that of the poplar-cotton ecosystem, and that system IV had the best structure. As for the abundance of nutritional classes, the transgenic poplar-cotton ecosystem was also better than that of the non-transgenic poplar-cotton ecosystem. The cluster analysis and similarity of arthropod communities between the four different transgenic poplar-cotton ecosystems illustrated that the structure of the arthropod community excelled in the small sample of the transgenic poplar-cotton ecosystems.

  7. Transgenic biofortification of the starchy staple cassava (Manihot esculenta generates a novel sink for protein.

    Directory of Open Access Journals (Sweden)

    Mohammad Abhary

    Full Text Available Although calorie dense, the starchy, tuberous roots of cassava provide the lowest sources of dietary protein within the major staple food crops (Manihot esculenta Crantz. (Montagnac JA, Davis CR, Tanumihardjo SA. (2009 Compr Rev Food Sci Food Saf 8:181-194. Cassava was genetically modified to express zeolin, a nutritionally balanced storage protein under control of the patatin promoter. Transgenic plants accumulated zeolin within de novo protein bodies localized within the root storage tissues, resulting in total protein levels of 12.5% dry weight within this tissue, a fourfold increase compared to non-transgenic controls. No significant differences were seen for morphological or agronomic characteristics of transgenic and wild type plants in the greenhouse and field trials, but relative to controls, levels of cyanogenic compounds were reduced by up to 55% in both leaf and root tissues of transgenic plants. Data described here represent a proof of concept towards the potential transformation of cassava from a starchy staple, devoid of storage protein, to one capable of supplying inexpensive, plant-based proteins for food, feed and industrial applications.

  8. pOsNAR2.1:OsNAR2.1 expression enhances nitrogen uptake efficiency and grain yield in transgenic rice plants.

    Science.gov (United States)

    Chen, Jingguang; Fan, Xiaoru; Qian, Kaiyun; Zhang, Yong; Song, Miaoquan; Liu, Yu; Xu, Guohua; Fan, Xiaorong

    2017-10-01

    The nitrate (NO3-) transporter has been selected as an important gene maker in the process of environmental adoption in rice cultivars. In this work, we transferred another native OsNAR2.1 promoter with driving OsNAR2.1 gene into rice plants. The transgenic lines with exogenous pOsNAR2.1:OsNAR2.1 constructs showed enhanced OsNAR2.1 expression level, compared with wild type (WT), and 15 N influx in roots increased 21%-32% in response to 0.2 mm and 2.5 mm 15NO3- and 1.25 mm 15 NH 4 15 NO 3 . Under these three N conditions, the biomass of the pOsNAR2.1:OsNAR2.1 transgenic lines increased 143%, 129% and 51%, and total N content increased 161%, 242% and 69%, respectively, compared to WT. Furthermore in field experiments we found the grain yield, agricultural nitrogen use efficiency (ANUE), and dry matter transfer of pOsNAR2.1:OsNAR2.1 plants increased by about 21%, 22% and 21%, compared to WT. We also compared the phenotypes of pOsNAR2.1:OsNAR2.1 and pOsNAR2.1:OsNRT2.1 transgenic lines in the field, found that postanthesis N uptake differed significantly between them, and in comparison with the WT. Postanthesis N uptake (PANU) increased approximately 39% and 85%, in the pOsNAR2.1:OsNAR2.1 and pOsNAR2.1:OsNRT2.1 transgenic lines, respectively, possibly because OsNRT2.1 expression was less in the pOsNAR2.1:OsNAR2.1 lines than in the pOsNAR2.1:OsNRT2.1 lines during the late growth stage. These results show that rice NO 3 - uptake, yield and NUE were improved by increased OsNAR2.1 expression via its native promoter. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  9. Transgenic rice expressing a codon-modified synthetic CP4-EPSPS confers tolerance to broad-spectrum herbicide, glyphosate.

    Science.gov (United States)

    Chhapekar, Sushil; Raghavendrarao, Sanagala; Pavan, Gadamchetty; Ramakrishna, Chopperla; Singh, Vivek Kumar; Phanindra, Mullapudi Lakshmi Venkata; Dhandapani, Gurusamy; Sreevathsa, Rohini; Ananda Kumar, Polumetla

    2015-05-01

    Highly tolerant herbicide-resistant transgenic rice was developed by expressing codon-modified synthetic CP4--EPSPS. The transformants could tolerate up to 1% commercial glyphosate and has the potential to be used for DSR (direct-seeded rice). Weed infestation is one of the major biotic stress factors that is responsible for yield loss in direct-seeded rice (DSR). Herbicide-resistant rice has potential to improve the efficiency of weed management under DSR. Hence, the popular indica rice cultivar IR64, was genetically modified using Agrobacterium-mediated transformation with a codon-optimized CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) gene, with N-terminal chloroplast targeting peptide from Petunia hybrida. Integration of the transgenes in the selected rice plants was confirmed by Southern hybridization and expression by Northern and herbicide tolerance assays. Transgenic plants showed EPSPS enzyme activity even at high concentrations of glyphosate, compared to untransformed control plants. T0, T1 and T2 lines were tested by herbicide bioassay and it was confirmed that the transgenic rice could tolerate up to 1% of commercial Roundup, which is five times more in dose used to kill weeds under field condition. All together, the transgenic rice plants developed in the present study could be used efficiently to overcome weed menace.

  10. An Empirical Assessment of Transgene Flow from a Bt Transgenic Poplar Plantation.

    Directory of Open Access Journals (Sweden)

    Jianjun Hu

    Full Text Available To assess the possible impact of transgenic poplar plantations on the ecosystem, we analyzed the frequency and distance of gene flow from a mature male transgenic Populus nigra plantation carrying the Bacillus thuringiensis toxin gene (Bt poplar and the survival of Bt poplar seeds. The resultant Bt poplar seeds occurred at a frequency of ~0.15% at 0 m to ~0.02% at 500 m from the Bt poplar plantation. The germination of Bt poplar seeds diminished within three weeks in the field (germination rate from 68% to 0% compared to 48% after three weeks of storage at 4°C. The survival rate of seedlings in the field was 0% without any treatment but increased to 1.7% under the addition of four treatments (cleaning and trimming, watering, weeding, and covering with plastic film to maintain moisture after being seeded in the field for eight weeks. The results of this study indicate that gene flow originating from the Bt poplar plantation occurred at an extremely low level through pollen or seeds under natural conditions. This study provides first-hand field data on the extent of transgene flow in poplar plantations and offers guidance for the risk assessment of transgenic poplar plantations.

  11. Impacts of elevated CO2 on exogenous Bacillus thuringiensis toxins and transgene expression in transgenic rice under different levels of nitrogen

    OpenAIRE

    Jiang, Shoulin; Lu, Yongqing; Dai, Yang; Qian, Lei; Muhammad, Adnan Bodlah; Li, Teng; Wan, Guijun; Parajulee, Megha N.; Chen, Fajun

    2017-01-01

    Recent studies have highlighted great challenges of transgene silencing for transgenic plants facing climate change. In order to understand the impacts of elevated CO2 on exogenous Bacillus thuringiensis (Bt) toxins and transgene expression in transgenic rice under different levels of N-fertilizer supply, we investigated the biomass, exogenous Bt toxins, Bt-transgene expression and methylation status in Bt rice exposed to two levels of CO2 concentrations and nitrogen (N) supply (1/8, 1/4, 1/2...

  12. Isogenic transgenic homozygous fish induced by artificial parthenogenesis.

    Science.gov (United States)

    Nam, Y K; Cho, Y S; Kim, D S

    2000-12-01

    As a model system for vertebrate transgenesis, fish have many attractive advantages, especially with respect to the characteristics of eggs, allowing us to produce isogenic, transgenic, homozygous vertebrates by combining with chromosome-set manipulation. Here, we describe the large-scale production of isogenic transgenic homozygous animals using our experimental organism, the mud loach Misgurnus mizolepis, by the simple process of artificial parthenogenesis in a single generation. These isogenic fish have retained transgenic homozygous status in a stable manner during the subsequent 5 years, and exhibited increased levels of transgene expression. Furthermore, their isogenic nature was confirmed by cloned transgenic homozygous offspring produced via another step of parthenogenic reproduction of the isogenic homozygous transgenic fish. These results demonstrate that a combination of transgenesis and artificial parthenogenesis will make the rapid utilization of genetically pure homozygous transgenic system in vertebrate transgenesis possible.

  13. A bovine cell line that can be infected by natural sheep scrapie prions.

    Directory of Open Access Journals (Sweden)

    Anja M Oelschlegel

    Full Text Available Cell culture systems represent a crucial part in basic prion research; yet, cell lines that are susceptible to prions, especially to field isolated prions that were not adapted to rodents, are very rare. The purpose of this study was to identify and characterize a cell line that was susceptible to ruminant-derived prions and to establish a stable prion infection within it. Based on species and tissue of origin as well as PrP expression rate, we pre-selected a total of 33 cell lines that were then challenged with natural and with mouse propagated BSE or scrapie inocula. Here, we report the successful infection of a non-transgenic bovine cell line, a sub-line of the bovine kidney cell line MDBK, with natural sheep scrapie prions. This cell line retained the scrapie infection for more than 200 passages. Selective cloning resulted in cell populations with increased accumulation of PrPres, although this treatment was not mandatory for retaining the infection. The infection remained stable, even under suboptimal culture conditions. The resulting infectivity of the cells was confirmed by mouse bioassay (Tgbov mice, Tgshp mice. We believe that PES cells used together with other prion permissive cell lines will prove a valuable tool for ongoing efforts to understand and defeat prions and prion diseases.

  14. The effects of Fe2O3 nanoparticles on physiology and insecticide activity in non-transgenic and Bt-transgenic cotton

    Directory of Open Access Journals (Sweden)

    Nhan eLe Van

    2016-01-01

    Full Text Available As the demands for nanotechnology and nanoparticle (NP applications in agriculture increase, the ecological risk has drawn more attention because of the unpredictable results of interactions between NPs and transgenic crops. In this study, we investigated the effects of various concentrations of Fe2O3 NPs on Bt-transgenic cotton in comparison with conventional cotton for 10 days. Each treatment was conducted in triplicate, and each experiment was repeated three times. Results demonstrated that Fe2O3 nanoparticles (NPs inhibited the plant height and root length of Bt-transgenic cotton and promoted root hairs and biomass of non-transgenic cotton. Nutrients such as Na and K in Bt-transgenic cotton roots increased, while Zn contents decreased with Fe2O3 NPs. Most hormones in the roots of Bt-transgenic cotton increased at low Fe2O3 NP exposure (100 mg·L−1 but decreased at high concentrations of Fe2O3 NPs (1000 mg·L−1. Fe2O3 NPs increased the Bt-toxin in leaves and roots of Bt-transgenic cotton. Fe2O3 NPs were absorbed into roots, then transported to the shoots of both Bt-transgenic and non-transgenic cottons. The bioaccumulation of Fe2O3 NPs in plants might be a potential risk for agricultural crops and affect the environment and human health.

  15. Establishment and characterization of murine small cell lung carcinoma cell lines derived from HPV-16 E6/E7 transgenic mice.

    Science.gov (United States)

    Carraresi, Laura; Martinelli, Rosanna; Vannoni, Alessandro; Riccio, Massimo; Dembic, Maja; Tripodi, Sergio; Cintorino, Marcella; Santi, Spartaco; Bigliardi, Elisa; Carmellini, Mario; Rossini, Mara

    2006-01-08

    We have established two murine cell lines derived from Small Cell Lung Carcinomas (SCLCs) developed by HPV-E6/E7 transgenic mice. These cells named PPAP-9 and PPAP-10 were isolated from mice bearing tumors, 9 and 10 months old, respectively. The cells, 5 microm in diameter, express HPV oncoproteins and sustain tumor formation after subcutaneous injection in syngenic mice. A detailed analysis indicated the epithelial origin and the neuroendocrine differentiation of these cells. We showed by confocal immunofluorescence the expression of the epithelial marker cytokeratin 5, whose gene promoter was used to direct the expression of HPV E6/E. Cells express several neuroendocrine markers such as CGRP, MAP-2, Ash1, CgrA, Scg2. The neuroendocrine differentiation of these cells was further confirmed by electron microscopy demonstrating neuropeptides secreting granules in their cytoplasm. Furthermore, in agreement with the altered expression observed in the majority of human SCLC we showed in these cells the absence of both p53 and pRB and a dramatic reduction in the expression of Caveolin-1.

  16. Transgene flow: Facts, speculations and possible countermeasures

    Science.gov (United States)

    Ryffel, Gerhart U

    2014-01-01

    Convincing evidence has accumulated that unintended transgene escape occurs in oilseed rape, maize, cotton and creeping bentgrass. The escaped transgenes are found in variant cultivars, in wild type plants as well as in hybrids of sexually compatible species. The fact that in some cases stacked events are present that have not been planted commercially, implies unintended recombination of transgenic traits. As the consequences of this continuous transgene escape for the ecosystem cannot be reliably predicted, I propose to use more sophisticated approaches of gene technology in future. If possible GM plants should be constructed using either site-directed mutagenesis or cisgenic strategies to avoid the problem of transgene escape. In cases where a transgenic trait is needed, efficient containment should be the standard approach. Various strategies available or in development are discussed. Such a cautious approach in developing novel types of GM crops will enhance the sustainable potential of GM crops and thus increase the public trust in green gene technology. PMID:25523171

  17. Light-grown plants of transgenic tobacco expressing an introduced oat phytochrome A gene under the control of a constitutive viral promoter exhibit persistent growth inhibition by far-red light

    International Nuclear Information System (INIS)

    McCormac, A.; Whitelam, G.; Smith, H.

    1992-01-01

    A comparison of the photoregulation of development has been made for etiolated and light-grown plants of wild-type (WT) tobacco (Nicotiana tabacun L.) and an isogenic transgenic line which expresses an introduced oat phytochrome gene (phyA) under the control of a constitutive viral promoter. Etiolated seedlings of both the WT and transgenic line showed irradiance-dependent inhibition of hypocotyl growth under continuous far-red (FR) light; transgenic seedlings showed a greater level of inhibition under a given fluence rate and this is considered to be the result of the heterologous phytochrome protein (PhyA) functioning in a compatible manner with the native etiolated phytochrome. Deetiolation of WT seedlings resulted in a loss of responsiveness to prolonged FR. Light-grown transgenic seedlings, however, continued to respond in an irradiance-dependent manner to prolonged FR and it is proposed that this is a specific function of the constitutive PhyA. Mature green plants of the WT and transgenic lines showed a qualitatively similar growth promotion to a brief end-of-day FR-treatment but this response was abolished in the transgenic plants under prolonged irradiation by this same FR source. Growth inhibition (McCormac et al. 1991, Planta 185, 162-170) and enhanced levels of nitrate-reductase activity under irradiance of low red:far-red ratio, as achieved by the FR-supplementation of white light, emphasised that the introduced PhyA was eliciting an aberrant mode of photoresponse compared with the normal phytochrome population of light-grown plants. Total levels of the oat-encoded phytochrome in the etiolated transgenic tobacco were shown to be influenced by the wavelength of continuous irradiation in a manner which was qualitatively similar to that seen for the native, etiolated tobacco phytochrome, and distinct from that seen in etiolated oat tissues. These results are discussed in terms of the proposal that the constitutive oat-PhyA pool in the transgenic plants

  18. An overexpression of chalcone reductase of Pueraria montana var. lobata alters biosynthesis of anthocyanin and 5'-deoxyflavonoids in transgenic tobacco.

    Science.gov (United States)

    Joung, Jae-youl; Kasthuri, G Mangai; Park, Ji-young; Kang, Won-jin; Kim, Hyun-soon; Yoon, Bong-sik; Joung, Hyouk; Jeon, Jae-heung

    2003-03-28

    We isolated the chalcone reductase (pl-chr) gene of Pueraria montana var. lobata by using a PCR strategy from cDNA pools of storage roots. A high level of expression of RNA was found in both stems and roots. The genomic Southern blot result suggests that pl-chr exists as a member of a small gene family. By introducing a pl-chr gene under the control of the 35S CaMV promoter into the pink-flowering Xanthi line of Nicotiana tabacum, the flower color was changed from pink to white-to-pink. The contents of anthocyanin in the flowers of the transgenic lines were dramatically decreased by 40%, but the total UV absorption compounds remained unchanged. The production of liquiritigenin in pl-chr overexpressed transgenic tobacco lines was confirmed by HPLC and MS analysis. The introduction of pl-chr gene provides a method to redirect the flavonoid pathway into 5'-deoxyflavonoid production in non-legume crops, in order to manipulate the phenylpropanoid pathway for isoflavonoid production.

  19. Transgenic Epigenetics: Using Transgenic Organisms to Examine Epigenetic Phenomena

    Directory of Open Access Journals (Sweden)

    Lori A. McEachern

    2012-01-01

    Full Text Available Non-model organisms are generally more difficult and/or time consuming to work with than model organisms. In addition, epigenetic analysis of model organisms is facilitated by well-established protocols, and commercially-available reagents and kits that may not be available for, or previously tested on, non-model organisms. Given the evolutionary conservation and widespread nature of many epigenetic mechanisms, a powerful method to analyze epigenetic phenomena from non-model organisms would be to use transgenic model organisms containing an epigenetic region of interest from the non-model. Interestingly, while transgenic Drosophila and mice have provided significant insight into the molecular mechanisms and evolutionary conservation of the epigenetic processes that target epigenetic control regions in other model organisms, this method has so far been under-exploited for non-model organism epigenetic analysis. This paper details several experiments that have examined the epigenetic processes of genomic imprinting and paramutation, by transferring an epigenetic control region from one model organism to another. These cross-species experiments demonstrate that valuable insight into both the molecular mechanisms and evolutionary conservation of epigenetic processes may be obtained via transgenic experiments, which can then be used to guide further investigations and experiments in the species of interest.

  20. Towards Transgenic Primates: What can we learn from mouse genetics?

    OpenAIRE

    KUANG, Hui; WANG, Phillip L.; TSIEN, Joe Z.

    2009-01-01

    Considering the great physiological and behavioral similarities with humans, monkeys represent the ideal models not only for the study of complex cognitive behavior but also for the preclinical research and development of novel therapeutics for treating human diseases. Various powerful genetic technologies initially developed for making mouse models are being explored for generating transgenic primate models. We review the latest genetic engineering technologies and discuss the potentials and...

  1. Development of highly regenerable callus lines and biolistic transformation of turf-type common bermudagrass [Cynodon dactylon (L.) Pers.].

    Science.gov (United States)

    Li, L; Qu, R

    2004-01-01

    Common bermudagrass, Cynodon dactylon, is a widely used warm-season turf and forage species in the temperate and tropical regions of the world. Improvement of bermudagrass via biotechnology depends on improved tissue culture responses, especially in plant regeneration, and a successful scheme to introduce useful transgenes. When the concentration of 6-benzylaminopurine was adjusted in the culture medium, yellowish, compact calluses were observed from young inflorescence tissue culture of var. J1224. Nine long-term, highly regenerable callus lines (including a suspension-cultured line) were subsequently established, of which six were used for biolistic transformation. Five independent transgenic events, with four producing green plants, were obtained following hygromycin B selection from one callus line. Three transgenic events displayed resistance to the herbicide glufosinate, and one of these showed beta-glucuronidase activity since the co-transformation vector used in the experiments contained both the gusA and bar genes.

  2. Nuclear Expression of a Mitochondrial DNA Gene: Mitochondrial Targeting of Allotopically Expressed Mutant ATP6 in Transgenic Mice

    Directory of Open Access Journals (Sweden)

    David A. Dunn

    2012-01-01

    Full Text Available Nuclear encoding of mitochondrial DNA transgenes followed by mitochondrial targeting of the expressed proteins (allotopic expression; AE represents a potentially powerful strategy for creating animal models of mtDNA disease. Mice were created that allotopically express either a mutant (A6M or wildtype (A6W mt-Atp6 transgene. Compared to non-transgenic controls, A6M mice displayed neuromuscular and motor deficiencies (wire hang, pole, and balance beam analyses; P0.05. This study illustrates a mouse model capable of circumventing in vivo mitochondrial mutations. Moreover, it provides evidence supporting AE as a tool for mtDNA disease research with implications in development of DNA-based therapeutics.

  3. Constitutive expression of CaPLA1 conferred enhanced growth and grain yield in transgenic rice plants.

    Science.gov (United States)

    Park, Ki Youl; Kim, Eun Yu; Seo, Young Sam; Kim, Woo Taek

    2016-03-01

    Phospholipids are not only important components of cell membranes, but participate in diverse processes in higher plants. In this study, we generated Capsicum annuum phospholipiase A1 (CaPLA1) overexpressing transgenic rice (Oryza sativa L.) plants under the control of the maize ubiquitin promoter. The T4 CaPLA1-overexpressing rice plants (Ubi:CaPLA1) had a higher root:shoot mass ratio than the wild-type plants in the vegetative stage. Leaf epidermal cells from transgenic plants had more cells than wild-type plants. Genes that code for cyclin and lipid metabolic enzymes were up-regulated in the transgenic lines. When grown under typical paddy field conditions, the transgenic plants produced more tillers, longer panicles and more branches per panicle than the wild-type plants, all of which resulted in greater grain yield. Microarray analysis suggests that gene expressions that are related with cell proliferation, lipid metabolism, and redox state were widely altered in CaPLA1-overexpressing transgenic rice plants. Ubi:CaPLA1 plants had a reduced membrane peroxidation state, as determined by malondialdehyde and conjugated diene levels and higher peroxidase activity than wild-type rice plants. Furthermore, three isoprenoid synthetic genes encoding terpenoid synthase, hydroxysteroid dehydrogenase and 3-hydroxy-3-methyl-glutaryl-CoA reductase were up-regulated in CaPLA1-overexpressing plants. We suggest that constitutive expression of CaPLA1 conferred increased grain yield with enhanced growth in transgenic rice plants by alteration of gene activities related with cell proliferation, lipid metabolism, membrane peroxidation state and isoprenoid biosynthesis.

  4. Generation of NSE-MerCreMer transgenic mice with tamoxifen inducible Cre activity in neurons.

    Directory of Open Access Journals (Sweden)

    Mandy Ka Man Kam

    Full Text Available To establish a genetic tool for conditional deletion or expression of gene in neurons in a temporally controlled manner, we generated a transgenic mouse (NSE-MerCreMer, which expressed a tamoxifen inducible type of Cre recombinase specifically in neurons. The tamoxifen inducible Cre recombinase (MerCreMer is a fusion protein containing Cre recombinase with two modified estrogen receptor ligand binding domains at both ends, and is driven by the neural-specific rat neural specific enolase (NSE promoter. A total of two transgenic lines were established, and expression of MerCreMer in neurons of the central and enteric nervous systems was confirmed. Transcript of MerCreMer was detected in several non-neural tissues such as heart, liver, and kidney in these lines. In the background of the Cre reporter mouse strain Rosa26R, Cre recombinase activity was inducible in neurons of adult NSE-MerCreMer mice treated with tamoxifen by intragastric gavage, but not in those fed with corn oil only. We conclude that NSE-MerCreMer lines will be useful for studying gene functions in neurons for the conditions that Cre-mediated recombination resulting in embryonic lethality, which precludes investigation of gene functions in neurons through later stages of development and in adult.

  5. Overexpression of a cytosolic abiotic stress responsive universal stress protein (SbUSP mitigates salt and osmotic stress in transgenic tobacco plants

    Directory of Open Access Journals (Sweden)

    Pushpika eUdawat

    2016-04-01

    Full Text Available The Universal Stress Protein (USP is a ubiquitous protein and plays an indispensable role in plant abiotic stress tolerance. The genome of Salicornia brachiata contains two homologues of intron less SbUSP gene which encodes for salt and osmotic responsive universal stress protein. In vivo localization reveals that SbUSP is a membrane bound cytosolic protein. The role of the gene was functionally validated by developing transgenic tobacco and compared with control (wild type and vector control plants under different abiotic stress condition. Transgenic lines (T1 exhibited higher chlorophyll, relative water, proline, total sugar, reducing sugar, free amino acids, polyphenol contents, osmotic potential, membrane stability and lower electrolyte leakage and lipid peroxidation (malondialdehyde content under stress treatments than control (WT and VC plants. Lower accumulation of H2O2 and O2- radicals was also detected in transgenic lines compared to control plants under stress conditions. Present study confers that overexpression of the SbUSP gene enhances plant growth, alleviates ROS buildup, maintains ion homeostasis and improves the physiological status of the plant under salt and osmotic stresses. Principal component analysis (PCA exhibited a statistical distinction of plant response to salinity stress, and a significant response was observed for transgenic lines under stress, which provides stress endurance to the plant. A possible signaling role is proposed that some downstream genes may get activated by abiotic stress responsive cytosolic SbUSP, which leads to the protection of cell from oxidative damages. The study unveils that ectopic expression of the gene mitigates salt or osmotic stress by scavenging ROS and modulating the physiological process of the plant.

  6. Overexpression of a Cytosolic Abiotic Stress Responsive Universal Stress Protein (SbUSP) Mitigates Salt and Osmotic Stress in Transgenic Tobacco Plants

    Science.gov (United States)

    Udawat, Pushpika; Jha, Rajesh K.; Sinha, Dinkar; Mishra, Avinash; Jha, Bhavanath

    2016-01-01

    The universal stress protein (USP) is a ubiquitous protein and plays an indispensable role in plant abiotic stress tolerance. The genome of Salicornia brachiata contains two homologs of intron less SbUSP gene which encodes for salt and osmotic responsive USP. In vivo localization reveals that SbUSP is a membrane bound cytosolic protein. The role of the gene was functionally validated by developing transgenic tobacco and compared with control [wild-type (WT) and vector control (VC)] plants under different abiotic stress condition. Transgenic lines (T1) exhibited higher chlorophyll, relative water, proline, total sugar, reducing sugar, free amino acids, polyphenol contents, osmotic potential, membrane stability, and lower electrolyte leakage and lipid peroxidation (malondialdehyde content) under stress treatments than control (WT and VC) plants. Lower accumulation of H2O2 and O2− radicals was also detected in transgenic lines compared to control plants under stress conditions. Present study confers that overexpression of the SbUSP gene enhances plant growth, alleviates ROS buildup, maintains ion homeostasis and improves the physiological status of the plant under salt and osmotic stresses. Principal component analysis exhibited a statistical distinction of plant response to salinity stress, and a significant response was observed for transgenic lines under stress, which provides stress endurance to the plant. A possible signaling role is proposed that some downstream genes may get activated by abiotic stress responsive cytosolic SbUSP, which leads to the protection of cell from oxidative damages. The study unveils that ectopic expression of the gene mitigates salt or osmotic stress by scavenging ROS and modulating the physiological process of the plant. PMID:27148338

  7. Selectivity and Efficiency of Late Transgene Expression by Transcriptionally Targeted Oncolytic Adenoviruses Are Dependent on the Transgene Insertion Strategy

    Science.gov (United States)

    Quirin, Christina; Rohmer, Stanimira; Fernández-Ulibarri, Inés; Behr, Michael; Hesse, Andrea; Engelhardt, Sarah; Erbs, Philippe; Enk, Alexander H.

    2011-01-01

    Abstract Key challenges facing cancer therapy are the development of tumor-specific drugs and potent multimodal regimens. Oncolytic adenoviruses possess the potential to realize both aims by restricting virus replication to tumors and inserting therapeutic genes into the virus genome, respectively. A major effort in this regard is to express transgenes in a tumor-specific manner without affecting virus replication. Using both luciferase as a sensitive reporter and genetic prodrug activation, we show that promoter control of E1A facilitates highly selective expression of transgenes inserted into the late transcription unit. This, however, required multistep optimization of late transgene expression. Transgene insertion via internal ribosome entry site (IRES), splice acceptor (SA), or viral 2A sequences resulted in replication-dependent expression. Unexpectedly, analyses in appropriate substrates and with matching control viruses revealed that IRES and SA, but not 2A, facilitated indirect transgene targeting via tyrosinase promoter control of E1A. Transgene expression via SA was more selective (up to 1,500-fold) but less effective than via IRES. Notably, we also revealed transgene-dependent interference with splicing. Hence, the prodrug convertase FCU1 (a cytosine deaminase–uracil phosphoribosyltransferase fusion protein) was expressed only after optimizing the sequence surrounding the SA site and mutating a cryptic splice site within the transgene. The resulting tyrosinase promoter-regulated and FCU1-encoding adenovirus combined effective oncolysis with targeted prodrug activation therapy of melanoma. Thus, prodrug activation showed potent bystander killing and increased cytotoxicity of the virus up to 10-fold. We conclude that armed oncolytic viruses can be improved substantially by comparing and optimizing strategies for targeted transgene expression, thereby implementing selective and multimodal cancer therapies. PMID:20939692

  8. Hyperactivity and learning deficits in transgenic mice bearing a human mutant thyroid hormone beta1 receptor gene.

    Science.gov (United States)

    McDonald, M P; Wong, R; Goldstein, G; Weintraub, B; Cheng, S Y; Crawley, J N

    1998-01-01

    Resistance to thyroid hormone (RTH) is a human syndrome mapped to the thyroid receptor beta (TRbeta) gene on chromosome 3, representing a mutation of the ligand-binding domain of the TRbeta gene. The syndrome is characterized by reduced tissue responsiveness to thyroid hormone and elevated serum levels of thyroid hormones. A common behavioral phenotype associated with RTH is attention deficit hyperactivity disorder (ADHD). To test the hypothesis that RTH produces attention deficits and/or hyperactivity, transgenic mice expressing a mutant TRbeta gene were generated. The present experiment tested RTH transgenic mice from the PV kindred on behavioral tasks relevant to the primary features of ADHD: hyperactivity, sustained attention (vigilance), learning, and impulsivity. Male transgenic mice showed elevated locomotor activity in an open field compared to male wild-type littermate controls. Both male and female transgenic mice exhibited impaired learning of an autoshaping task, compared to wild-type controls. On a vigilance task in an operant chamber, there were no differences between transgenics and controls on the proportion of hits, response latency, or duration of stimulus tolerated. On an operant go/no-go task measuring sustained attention and impulsivity, there were no differences between controls and transgenics. These results indicate that transgenic mice bearing a mutant human TRbeta gene demonstrate several behavioral characteristics of ADHD and may serve a valuable heuristic role in elucidating possible candidate genes in converging pathways for other causes of ADHD.

  9. Hyperactivity and Learning Deficits in Transgenic Mice Bearing a Human Mutant Thyroid Hormone β1 Receptor Gene

    Science.gov (United States)

    McDonald, Michael P.; Wong, Rosemary; Goldstein, Gregory; Weintraub, Bruce; Cheng, Sheue-yann; Crawley, Jacqueline N.

    1998-01-01

    Resistance to thyroid hormone (RTH) is a human syndrome mapped to the thyroid receptor β (TRβ) gene on chromosome 3, representing a mutation of the ligandbinding domain of the TRβ gene. The syndrome is characterized by reduced tissue responsiveness to thyroid hormone and elevated serum levels of thyroid hormones. A common behavioral phenotype associated with RTH is attention deficit hyperactivity disorder (ADHD). To test the hypothesis that RTH produces attention deficits and/or hyperactivity, transgenic mice expressing a mutant TRβ gene were generated. The present experiment tested RTH transgenic mice from the PV kindred on behavioral tasks relevant to the primary features of ADHD: hyperactivity, sustained attention (vigilance), learning, and impulsivity. Male transgenic mice showed elevated locomotor activity in an open field compared to male wild-type littermate controls. Both male and female transgenic mice exhibited impaired learning of an autoshaping task, compared to wild-type controls. On a vigilance task in an operant chamber, there were no differences between transgenics and controls on the proportion of hits, response latency, or duration of stimulus tolerated. On an operant go/no-go task measuring sustained attention and impulsivity, there were no differences between controls and transgenics. These results indicate that transgenic mice bearing a mutant human TRβ gene demonstrate several behavioral characteristics of ADHD and may serve a valuable heuristic role in elucidating possible candidate genes in converging pathways for other causes of ADHD. PMID:10454355

  10. Recent progress on technologies and applications of transgenic ...

    African Journals Online (AJOL)

    USER

    2010-06-14

    Jun 14, 2010 ... this, the methods for producing transgenic poultry must become routine. ... and spermatogonial stem cells (SSCs) have been developed to generate transgenic chickens. ... any procedure aimed at generating transgenic birds.

  11. Assessment of the Allergenic Potential of Transgenic Wheat (Triticum aestivum) with Reduced Levels of ω5-Gliadins, the Major Sensitizing Allergen in Wheat-Dependent Exercise-Induced Anaphylaxis.

    Science.gov (United States)

    Altenbach, Susan B; Tanaka, Charlene K; Pineau, Florence; Lupi, Roberta; Drouet, Martine; Beaudouin, Etienne; Morisset, Martine; Denery-Papini, Sandra

    2015-10-28

    The ω5-gliadins are the major sensitizing allergens in wheat-dependent exercise-induced anaphylaxis (WDEIA). In this study, two-dimensional immunoblot analysis was used to assess the allergenic potential of two transgenic wheat lines in which ω5-gliadin genes were silenced by RNA interference. Sera from 7 of 11 WDEIA patients showed greatly reduced levels of immunoglobulin E (IgE) reactivity to ω5-gliadins in both transgenic lines. However, these sera also showed low levels of reactivity to other gluten proteins. Sera from three patients showed the greatest reactivity to proteins other than ω5-gliadins, either high-molecular-weight glutenin subunits (HMW-GSs), α-gliadins, or non-gluten proteins. The complexity of immunological responses among these patients suggests that flour from the transgenic lines would not be suitable for individuals already diagnosed with WDEIA. However, the introduction of wheat lacking ω5-gliadins could reduce the number of people sensitized to these proteins and thereby decrease the overall incidence of this serious food allergy.

  12. Importance of representing optical depth variability for estimates of global line-shaped contrail radiative forcing.

    Science.gov (United States)

    Kärcher, Bernd; Burkhardt, Ulrike; Ponater, Michael; Frömming, Christine

    2010-11-09

    Estimates of the global radiative forcing by line-shaped contrails differ mainly due to the large uncertainty in contrail optical depth. Most contrails are optically thin so that their radiative forcing is roughly proportional to their optical depth and increases with contrail coverage. In recent assessments, the best estimate of mean contrail radiative forcing was significantly reduced, because global climate model simulations pointed at lower optical depth values than earlier studies. We revise these estimates by comparing the probability distribution of contrail optical depth diagnosed with a climate model with the distribution derived from a microphysical, cloud-scale model constrained by satellite observations over the United States. By assuming that the optical depth distribution from the cloud model is more realistic than that from the climate model, and by taking the difference between the observed and simulated optical depth over the United States as globally representative, we quantify uncertainties in the climate model's diagnostic contrail parameterization. Revising the climate model results accordingly increases the global mean radiative forcing estimate for line-shaped contrails by a factor of 3.3, from 3.5 mW/m(2) to 11.6 mW/m(2) for the year 1992. Furthermore, the satellite observations and the cloud model point at higher global mean optical depth of detectable contrails than often assumed in radiative transfer (off-line) studies. Therefore, we correct estimates of contrail radiative forcing from off-line studies as well. We suggest that the global net radiative forcing of line-shaped persistent contrails is in the range 8-20 mW/m(2) for the air traffic in the year 2000.

  13. Establishment and evaluation of a transgenic mouse model of arthritis induced by overexpressing human tumor necrosis factor alpha

    Directory of Open Access Journals (Sweden)

    Ge Li

    2016-04-01

    Full Text Available Tumor necrosis factor alpha (TNFα plays a key role in the pathogenesis of rheumatoid arthritis (RA. Blockade of TNFα by monoclonal antibody has been widely used for the therapy of RA since the 1990s; however, its mechanism of efficacy, and potential safety concerns of the treatment are still not fully understood. This study sought to establish a transgenic arthritic mouse model by overexpressing human TNFα (hTNFα and to apply this model as a means to evaluate therapeutic consequences of TNFα inhibitors. The transgenic mouse line (TgTC with FVB background was generated by incorporating 3′-modified hTNFα gene sequences. A progressively erosive polyarthritis developed in the TgTC mice, with many characteristics observed in human rheumatoid arthritis, including polyarticular swelling, impairment of movement, synovial hyperplasia, and cartilage and bone erosion. Gene expression analysis demonstrated that hTNFα is not only expressed in hyperplastic synovial membrane, but also in tissues without lesions, including brain, lung and kidney. Treatment of the TgTC mice with anti-hTNFα monoclonal antibodies (mAb significantly decreased the level of hTNFα in the diseased joint and effectively prevented development of arthritis in a dose-dependent response fashion. Our results indicated that the TgTC mice represent a genetic model which can be used to comprehensively investigate the pathogenesis and therapeutics of TNFα-related diseases.

  14. ChR2 transgenic animals in peripheral sensory system: Sensing light as various sensations.

    Science.gov (United States)

    Ji, Zhi-Gang; Wang, Hongxia

    2016-04-01

    Since the introduction of Channelrhodopsin-2 (ChR2) to neuroscience, optogenetics technology was developed, making it possible to activate specific neurons or circuits with spatial and temporal precision. Various ChR2 transgenic animal models have been generated and are playing important roles in revealing the mechanisms of neural activities, mapping neural circuits, controlling the behaviors of animals as well as exploring new strategy for treating the neurological diseases in both central and peripheral nervous system. An animal including humans senses environments through Aristotle's five senses (sight, hearing, smell, taste and touch). Usually, each sense is associated with a kind of sensory organ (eyes, ears, nose, tongue and skin). Is it possible that one could hear light, smell light, taste light and touch light? When ChR2 is targeted to different peripheral sensory neurons by viral vectors or generating ChR2 transgenic animals, the animals can sense the light as various sensations such as hearing, touch, pain, smell and taste. In this review, we focus on ChR2 transgenic animals in the peripheral nervous system. Firstly the working principle of ChR2 as an optogenetic actuator is simply described. Then the current transgenic animal lines where ChR2 was expressed in peripheral sensory neurons are presented and the findings obtained by these animal models are reviewed. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. MYB and bHLH transcription factor transgenes increase anthocyanin pigmentation in petunia and lisianthus plants, and the petunia phenotypes are strongly enhanced under field conditions

    Directory of Open Access Journals (Sweden)

    Kathy E Schwinn

    2014-11-01

    Full Text Available Petunia line Mitchell [MP, Petunia axillaris × (P. axillaris × P. hybrida] and Eustoma grandiflorum (lisianthus plants were produced containing a transgene for over-expression of the R2R3-MYB transcription factor (ROSEA1 that up-regulates flavonoid biosynthesis in Antirrhinum majus. The petunia lines were also crossed with previously produced MP lines containing a Zea mays flavonoid-related bHLH transcription factor transgene (LEAF COLOR, LC, which induces strong vegetative pigmentation when these 35S:LC plants are exposed to high light levels. 35S:ROS1 lisianthus transgenics had limited changes in anthocyanin pigmentation, specifically, precocious pigmentation of flower petals and increased pigmentation of sepals. RNA transcript levels for two anthocyanin biosynthetic genes, chalcone synthase and anthocyanidin synthase, were increased in the 35S:ROS1 lisianthus petals compared to those of control lines. With MP, the 35S:ROS1 calli showed novel red pigmentation in culture, but this was generally not seen in tissue culture plantlets regenerated from the calli or young plants transferred to soil in the greenhouse. Anthocyanin pigmentation was enhanced in the stems of mature 35S:ROS1 MP plants, but the MP white-flower phenotype was not complemented. Progeny from a 35S:ROS1×35S:LC cross had novel pigmentation phenotypes that were not present in either parental line or MP. In particular, there was increased pigment accumulation in the petal throat region, and the anthers changed from yellow to purple colour. An outdoor field trial was conducted with the 35S:ROS1, 35S:LC, 35S:ROS1×35S:LC and control MP lines. Field conditions rapidly induced intense foliage pigmentation in 35S:LC plants, a phenotype not observed in control MP or equivalent 35S:LC plants maintained in a greenhouse. No difference in plant stature, seed germination, or plant survival was observed between transgenic and control plants.

  16. MYB and bHLH transcription factor transgenes increase anthocyanin pigmentation in petunia and lisianthus plants, and the petunia phenotypes are strongly enhanced under field conditions

    Science.gov (United States)

    Schwinn, Kathy E.; Boase, Murray R.; Bradley, J. Marie; Lewis, David H.; Deroles, Simon C.; Martin, Cathie R.; Davies, Kevin M.

    2014-01-01

    Petunia line Mitchell [MP, Petunia axillaris × (P. axillaris × P. hybrida)] and Eustoma grandiflorum (lisianthus) plants were produced containing a transgene for over-expression of the R2R3-MYB transcription factor [TF; ROSEA1 (ROS1)] that up-regulates flavonoid biosynthesis in Antirrhinum majus. The petunia lines were also crossed with previously produced MP lines containing a Zea mays flavonoid-related basic helix-loop-helix TF transgene (LEAF COLOR, LC), which induces strong vegetative pigmentation when these 35S:LC plants are exposed to high-light levels. 35S:ROS1 lisianthus transgenics had limited changes in anthocyanin pigmentation, specifically, precocious pigmentation of flower petals and increased pigmentation of sepals. RNA transcript levels for two anthocyanin biosynthetic genes, chalcone synthase and anthocyanidin synthase, were increased in the 35S:ROS1 lisianthus petals compared to those of control lines. With MP, the 35S:ROS1 calli showed novel red pigmentation in culture, but this was generally not seen in tissue culture plantlets regenerated from the calli or young plants transferred to soil in the greenhouse. Anthocyanin pigmentation was enhanced in the stems of mature 35S:ROS1 MP plants, but the MP white-flower phenotype was not complemented. Progeny from a 35S:ROS1 × 35S:LC cross had novel pigmentation phenotypes that were not present in either parental line or MP. In particular, there was increased pigment in the petal throat region, and the anthers changed from yellow to purple pigmentation. An outdoor field trial was conducted with the 35S:ROS1, 35S:LC, 35S:ROS1 × 35S:LC and control MP lines. Field conditions rapidly induced intense foliage pigmentation in 35S:LC plants, a phenotype not observed in control MP or equivalent 35S:LC plants maintained in a greenhouse. No difference in plant stature, seed germination, or plant survival was observed between transgenic and control plants. PMID:25414715

  17. Age-related changes in body composition of bovine growth hormone transgenic mice.

    Science.gov (United States)

    Palmer, Amanda J; Chung, Min-Yu; List, Edward O; Walker, Jennifer; Okada, Shigeru; Kopchick, John J; Berryman, Darlene E

    2009-03-01

    GH has a significant impact on body composition due to distinct anabolic and catabolic effects on lean and fat mass, respectively. Several studies have assessed body composition in mice expressing a GH transgene. Whereas all studies report enhanced growth of transgenic mice as compared with littermate controls, there are inconsistencies in terms of the relative proportion of lean mass to fat mass in these animals. The purpose of this study was to characterize the accumulation of adipose and lean mass with age and according to gender in a bovine (b) GH transgenic mouse line. Weight and body composition measurements were assessed in male and female bGH mice with corresponding littermate controls in the C57BL/6J genetic background. Body composition measurements began at 6 wk and continued through 1 yr of age. At the conclusion of the study, tissue weights were determined and triglyceride content was quantified in liver and kidney. Although body weights for bGH mice were significantly greater than their corresponding littermate controls at all time points, body composition measurements revealed an unexpected transition midway through analyses. That is, younger bGH mice had relatively more fat mass than nontransgenic littermates, whereas bGH mice became significantly leaner than controls by 4 months in males and 6 months in females. These results reveal the importance in timing and gender when conducting studies related to body composition or lean and fat tissue in GH transgenic mice or in other genetically manipulated mouse strains in which body composition may be impacted.

  18. [Biofuels, food security and transgenic crops].

    Science.gov (United States)

    Acosta, Orlando; Chaparro-Giraldo, Alejandro

    2009-01-01

    Soaring global food prices are threatening to push more poor people back below the poverty line; this will probably become aggravated by the serious challenge that increasing population and climate changes are posing for food security. There is growing evidence that human activities involving fossil fuel consumption and land use are contributing to greenhouse gas emissions and consequently changing the climate worldwide. The finite nature of fossil fuel reserves is causing concern about energy security and there is a growing interest in the use of renewable energy sources such as biofuels. There is growing concern regarding the fact that biofuels are currently produced from food crops, thereby leading to an undesirable competition for their use as food and feed. Nevertheless, biofuels can be produced from other feedstocks such as lingo-cellulose from perennial grasses, forestry and vegetable waste. Biofuel energy content should not be exceeded by that of the fossil fuel invested in its production to ensure that it is energetically sustainable; however, biofuels must also be economically competitive and environmentally acceptable. Climate change and biofuels are challenging FAO efforts aimed at eradicating hunger worldwide by the next decade. Given that current crops used in biofuel production have not been domesticated for this purpose, transgenic technology can offer an enormous contribution towards improving biofuel crops' environmental and economic performance. The present paper critically presents some relevant relationships between biofuels, food security and transgenic plant technology.

  19. Estimated environmental loads of alpha-amylase from transgenic high-amylase maize

    Energy Technology Data Exchange (ETDEWEB)

    Wolt, Jeffrey D. [Department of Agronomy, Iowa State University, Ames, IA 50011 (United States); Biosafety Institute for Genetically Modified Agricultural Products, 164 Seed Science, Iowa State University, Ames, IA 50011 (United States); Karaman, Sule [Biosafety Institute for Genetically Modified Agricultural Products, 164 Seed Science, Iowa State University, Ames, IA 50011 (United States)

    2007-11-15

    Environmental exposure of plants bioengineered to improve efficiencies of biofuel production is an important consideration for their adoption. High-amylase maize genetically engineered to produce thermostable alpha-amylase in seed endosperm is currently in development, and its successful adoption will entail >1000 km{sup 2} of annual production in the USA. Environmental exposure of thermostable amylase will occur in production fields from preharvest and harvest dropped grain, with minor additional contributions from stover and root biomass. Mass loadings of thermostable alpha-amylase are projected to be 16 kg km{sup -2} and represent a potential source of increased alpha-amylase activity in receiving soils. An understanding of the degradation, persistence, accumulation, and activity of thermostable alpha-amylase introduced from transgenic high-amylase maize will be necessary in order to effectively manage transgenic crop systems intended or biofeedstock production. (author)

  20. EXPRESSION OF GROWTH HORMONE (PhGH GENE AND ANALYSIS OF INSULINE-LIKE GROWTH FACTOR I (IGF-I PRODUCTION IN AFRICAN CATFISH (Clarias gariepinus TRANSGENIC F-1

    Directory of Open Access Journals (Sweden)

    Huria Marnis

    2013-12-01

    Full Text Available We have previously produced F-1 transgenic of African catfish from crosses between founder transgenic female and non transgenic male. The aim of this study was to evaluate distribution and expression PhGH growth hormone gene transgenic African catfish organs and to measure the concentration of IGF-I in plasma. Transgene was detected using the PCR method in various organs, namely pituitary, brain, liver, heart, spleen, kidney, intestine, stomach, muscle, gill, and eye. Transgene expression levels were analyzed using the method of quantitative Reverse Transcriptase-Polymerase Chain Reaction (qRT-PCR. Plasma samples were analyzed for Insuline-like Growth Factor (IGF-I using Enzyme Linked Immunosorbent Assay (ELISA method. The results showed that the PhGH was detected and expressed in all organs of the transgenic African catfish (F-1. Liver exhibited the highest level of PhGH mRNA (23 x 106 copies. The plasma IGF-I levels in transgenic individuals were not significant than non transgenic. The higher level of exogenous PhGH gene expression may not represent the production of IGF-1.

  1. Expression of a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase genes in transgenic potato plants

    NARCIS (Netherlands)

    Moravcikova, J.; Matusikova, I.; Libantova, J.; Bauer, M.; Mlynarova, L.

    2004-01-01

    The genes encoding for a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase were co-introduced into Slovak potato (Solanum tuberosum L.) breeding line 116/86 using Agrobacterium tumefaciens. For both transgenes the number of integrated copies and level of RNA expression

  2. AMT1;1 transgenic rice plants with enhanced NH4(+) permeability show superior growth and higher yield under optimal and suboptimal NH4(+) conditions.

    Science.gov (United States)

    Ranathunge, Kosala; El-Kereamy, Ashraf; Gidda, Satinder; Bi, Yong-Mei; Rothstein, Steven J

    2014-03-01

    The major source of nitrogen for rice (Oryza sativa L.) is ammonium (NH4(+)). The NH4(+) uptake of roots is mainly governed by membrane transporters, with OsAMT1;1 being a prominent member of the OsAMT1 gene family that is known to be involved in NH4(+) transport in rice plants. However, little is known about its involvement in NH4(+) uptake in rice roots and subsequent effects on NH4(+) assimilation. This study shows that OsAMT1;1 is a constitutively expressed, nitrogen-responsive gene, and its protein product is localized in the plasma membrane. Its expression level is under the control of circadian rhythm. Transgenic rice lines (L-2 and L-3) overexpressing the OsAMT1;1 gene had the same root structure as the wild type (WT). However, they had 2-fold greater NH4(+) permeability than the WT, whereas OsAMT1;1 gene expression was 20-fold higher than in the WT. Analogous to the expression, transgenic lines had a higher NH4(+) content in the shoots and roots than the WT. Direct NH4(+) fluxes in the xylem showed that the transgenic lines had significantly greater uptake rates than the WT. Higher NH4(+) contents also promoted higher expression levels of genes in the nitrogen assimilation pathway, resulting in greater nitrogen assimilates, chlorophyll, starch, sugars, and grain yield in transgenic lines than in the WT under suboptimal and optimal nitrogen conditions. OsAMT1;1 also enhanced overall plant growth, especially under suboptimal NH4(+) levels. These results suggest that OsAMT1;1 has the potential for improving nitrogen use efficiency, plant growth, and grain yield under both suboptimal and optimal nitrogen fertilizer conditions.

  3. AMT1;1 transgenic rice plants with enhanced NH4 + permeability show superior growth and higher yield under optimal and suboptimal NH4 + conditions

    Science.gov (United States)

    Rothstein, Steven J.

    2014-01-01

    The major source of nitrogen for rice (Oryza sativa L.) is ammonium (NH4 +). The NH4 + uptake of roots is mainly governed by membrane transporters, with OsAMT1;1 being a prominent member of the OsAMT1 gene family that is known to be involved in NH4 + transport in rice plants. However, little is known about its involvement in NH4 + uptake in rice roots and subsequent effects on NH4 + assimilation. This study shows that OsAMT1;1 is a constitutively expressed, nitrogen-responsive gene, and its protein product is localized in the plasma membrane. Its expression level is under the control of circadian rhythm. Transgenic rice lines (L-2 and L-3) overexpressing the OsAMT1;1 gene had the same root structure as the wild type (WT). However, they had 2-fold greater NH4 + permeability than the WT, whereas OsAMT1;1 gene expression was 20-fold higher than in the WT. Analogous to the expression, transgenic lines had a higher NH4 + content in the shoots and roots than the WT. Direct NH4 + fluxes in the xylem showed that the transgenic lines had significantly greater uptake rates than the WT. Higher NH4 + contents also promoted higher expression levels of genes in the nitrogen assimilation pathway, resulting in greater nitrogen assimilates, chlorophyll, starch, sugars, and grain yield in transgenic lines than in the WT under suboptimal and optimal nitrogen conditions. OsAMT1;1 also enhanced overall plant growth, especially under suboptimal NH4 + levels. These results suggest that OsAMT1;1 has the potential for improving nitrogen use efficiency, plant growth, and grain yield under both suboptimal and optimal nitrogen fertilizer conditions. PMID:24420570

  4. Development of porcine transgenic nuclear-transferred embryos derived from fibroblast cells transfected by the novel technique of nucleofection or standard lipofection.

    Science.gov (United States)

    Skrzyszowska, M; Samiec, M; Słomski, R; Lipiński, D; Mały, E

    2008-07-15

    The aim of our study was to determine the in vitro developmental potential of porcine nuclear-transferred (NT) embryos that had been reconstructed with Tg(pWAPhGH-GFPBsd) transgene-expressing fibroblast cells. The gene construct was introduced into fibroblast cells by the novel method of nucleofection or standard lipofection. NT oocytes derived from foetal and adult dermal fibroblast cells were stimulated by either simultaneous fusion and electrical activation (Groups IA and IB) or sequential electrical and chemical activation (Groups IIA and IIB). The percentages of cloned embryos that reached the morula and blastocyst stages were 152/254 (59.8%) and 77/254 (30.3%) or 139/276 (50.4%) and 45/276 (16.3%) in Groups IA or IB, respectively. The rates of NT embryos that developed to the morula and blastocyst stages were 103/179 (57.5%) and 41/179 (22.9%) or 84/193 (43.5%) and 27/193 (14.0%) in Groups IIA and IIB, respectively. In conclusion, the in vitro developmental competences of porcine transgenic NT embryos that had been reconstructed with the Tg(pWAPhGH-GFPBsd) gene-transfected fibroblast cells were relatively high. Further, the nucleofection efficiency of all the porcine fibroblast cell lines as estimated by intra-vitam fluorescent evaluation based on the index of reporter eGFP transgene expression was nearly 100%. However, PCR analysis for transgene screening confirmed the absence of Tg(pWAPhGH-GFPBsd) fusion gene in some of the nucleofected cell lines. To our knowledge, the novel method of nucleofection is the first to transfect nuclear donor cells in the production of transgenic cloned embryos.

  5. CONSTRUCTION AND STUDY OF Althaea officinalis TRANSGENIC ROOTS CULTURE WITH HUMAN INTERFERON α2B GENE

    Directory of Open Access Journals (Sweden)

    N. A. Matvieieva

    2013-04-01

    Full Text Available The aim of our work was to obtain Althaea officinalis L. «hairy» root culture with human interferon α2b gene (ifn-α2b, to measure fructans content and antiviral activity of extracts from the transgenic roots. Transformation of leaf and root explants was carried out by means of Agrobacterium rhizogenes-mediated transformation. Antiviral activity was measured by the reduction in cytopathic effect of vesicular stomatitis virus (Indiana strain in bovine kidney cells line MDBK. Transformation frequency was 100% for leaf and root explants. RT-PCR confirmed ifn- α2b gene transcription. The clones of transgenic roots differed in mass increasing from 0, 036 ± 0,008 up to 0,371 ± 0,019 g in 30 days cultivation and in fructan synthesis from 67,2± 4,47 up to 154,6 ± 6,62 mg/g roots dry weight. Extracts from «hairy»roots culture were characterized by high antiviral activity against vesicular stomatitis virus — up to 26 000 IU/ g of roots fresh weight. In some cases the genetic transformation shown to lead increasing the growth rate and increasing the level of fructan synthesis in transgenic A. officinalis roots. Extracts from cultivated in vitro marshmallow transgenic roots were characterized by high level of antiviral activity against vesicular stomatitis virus. Thus, there were obtained transgenic A. officinalis roots, characterized by high growth rate, significant accumulation of fructans and high antiviral activity.

  6. IDENTIFICATION OF ESCAPED TRANSGENIC CREEPING BENTGRASS IN OREGON

    Science.gov (United States)

    When transgenic plants are cultivated near wild species that are sexually compatible with the crop, gene flow between the crop and wild plants is possible. A resultant concern is that transgene flow and transgene introgression within wild populations could have unintended ecologi...

  7. Generation and phenotypic analysis of a transgenic line of rabbits secreting active recombinant human erythropoietin in the milk

    Czech Academy of Sciences Publication Activity Database

    Mikuš, Tomáš; Poplštein, M.; Sedláková, J.; Landa, Vladimír; Jeníková, Gabriela; Trefil, P.; Lidický, J.; Malý, Petr

    2004-01-01

    Roč. 13, č. 5 (2004), s. 487-498 ISSN 0962-8819 R&D Projects: GA ČR GA304/03/0090 Institutional research plan: CEZ:AV0Z5052915 Keywords : erythropoietin, mammary gland, transgenic rabbit Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.107, year: 2004

  8. Enhanced resistance to herpes simplex virus type 1 infection in transgenic mice expressing a soluble form of herpesvirus entry mediator

    International Nuclear Information System (INIS)

    Ono, Etsuro; Yoshino, Saori; Amagai, Keiko; Taharaguchi, Satoshi; Kimura, Chiemi; Morimoto, Junko; Inobe, Manabu; Uenishi, Tomoko; Uede, Toshimitsu

    2004-01-01

    Herpesvirus entry mediator (HVEM) is a member of the tumor necrosis factor (TNF) receptor family used as a cellular receptor by virion glycoprotein D (gD) of herpes simplex virus (HSV). Both human and mouse forms of HVEM can mediate entry of HSV-1 but have no entry activity for pseudorabies virus (PRV). To assess the antiviral potential of HVEM in vivo, three transgenic mouse lines expressing a soluble form of HVEM (HVEMIg) consisting of an extracellular domain of murine HVEM and the Fc portion of human IgG1 were generated. All of the transgenic mouse lines showed marked resistance to HSV-1 infection when the mice were challenged intraperitoneally with HSV-1, but not to PRV infection. The present results demonstrate that HVEMIg is able to exert a significant antiviral effect against HSV-1 infection in vivo

  9. Transgene mus som sygdomsmodeller

    DEFF Research Database (Denmark)

    Schuster, Mikkel Bruhn; Porse, Bo Torben

    2003-01-01

    Transgenic animal models have proven to be useful tools in understanding both basic biology and the events associated with disease. Recent technical advances in the area of genomic manipulation in combination with the availability of the human and murine genomic sequences now allow the precise...... tailoring of the mouse genome. In this review we describe a few systems in which transgenic animal models have been employed for the purpose of studying the etiology of human diseases. Udgivelsesdato: 2003-Feb-17...

  10. A proteomic study to identify soya allergens--the human response to transgenic versus non-transgenic soya samples.

    Science.gov (United States)

    Batista, Rita; Martins, Isabel; Jeno, Paul; Ricardo, Cândido Pinto; Oliveira, Maria Margarida

    2007-01-01

    In spite of being among the main foods responsible for allergic reactions worldwide, soybean (Glycine max)-derived products continue to be increasingly widespread in a variety of food products due to their well-documented health benefits. Soybean also continues to be one of the elected target crops for genetic modification. The aim of this study was to characterize the soya proteome and, specifically, IgE-reactive proteins as well as to compare the IgE response in soya-allergic individuals to genetically modified Roundup Ready soya versus its non-transgenic control. We performed two-dimensional gel electrophoresis of protein extracts from a 5% genetically modified Roundup Ready flour sample and its non-transgenic control followed by Western blotting with plasma from 5 soya-sensitive individuals. We used peptide tandem mass spectrometry to identify soya proteins (55 protein matches), specifically IgE-binding ones, and to evaluate differences between transgenic and non-transgenic samples. We identified 2 new potential soybean allergens--one is maturation associated and seems to be part of the late embryogenesis abundant proteins group and the other is a cysteine proteinase inhibitor. None of the individuals tested reacted differentially to the transgenic versus non-transgenic samples under study. Soybean endogenous allergen expression does not seem to be altered after genetic modification. Proteomics should be considered a powerful tool for functional characterization of plants and for food safety assessment. Copyright (c) 2007 S. Karger AG, Basel.

  11. Transgenic Alfalfa Plants Expressing the Sweetpotato Orange Gene Exhibit Enhanced Abiotic Stress Tolerance

    Science.gov (United States)

    Wang, Zhi; Ke, Qingbo; Kim, Myoung Duck; Kim, Sun Ha; Ji, Chang Yoon; Jeong, Jae Cheol; Lee, Haeng-Soon; Park, Woo Sung; Ahn, Mi-Jeong; Li, Hongbing; Xu, Bingcheng; Deng, Xiping; Lee, Sang-Hoon; Lim, Yong Pyo; Kwak, Sang-Soo

    2015-01-01

    Alfalfa (Medicago sativa L.), a perennial forage crop with high nutritional content, is widely distributed in various environments worldwide. We recently demonstrated that the sweetpotato Orange gene (IbOr) is involved in increasing carotenoid accumulation and enhancing resistance to multiple abiotic stresses. In this study, in an effort to improve the nutritional quality and environmental stress tolerance of alfalfa, we transferred the IbOr gene into alfalfa (cv. Xinjiang Daye) under the control of an oxidative stress-inducible peroxidase (SWPA2) promoter through Agrobacterium tumefaciens-mediated transformation. Among the 11 transgenic alfalfa lines (referred to as SOR plants), three lines (SOR2, SOR3, and SOR8) selected based on their IbOr transcript levels were examined for their tolerance to methyl viologen (MV)-induced oxidative stress in a leaf disc assay. The SOR plants exhibited less damage in response to MV-mediated oxidative stress and salt stress than non-transgenic plants. The SOR plants also exhibited enhanced tolerance to drought stress, along with higher total carotenoid levels. The results suggest that SOR alfalfa plants would be useful as forage crops with improved nutritional value and increased tolerance to multiple abiotic stresses, which would enhance the development of sustainable agriculture on marginal lands. PMID:25946429

  12. Transgenic expression of an unedited mitochondrial orfB gene product from wild abortive (WA) cytoplasm of rice (Oryza sativa L.) generates male sterility in fertile rice lines.

    Science.gov (United States)

    Chakraborty, Anirban; Mitra, Joy; Bhattacharyya, Jagannath; Pradhan, Subrata; Sikdar, Narattam; Das, Srirupa; Chakraborty, Saikat; Kumar, Sachin; Lakhanpaul, Suman; Sen, Soumitra K

    2015-06-01

    Over-expression of the unedited mitochondrial orfB gene product generates male sterility in fertile indica rice lines in a dose-dependent manner. Cytoplasmic male sterility (CMS) and nuclear-controlled fertility restoration are widespread developmental features in plant reproductive systems. In self-pollinated crop plants, these processes often provide useful tools to exploit hybrid vigour. The wild abortive CMS has been employed in the majority of the "three-line" hybrid rice production since 1970s. In the present study, we provide experimental evidence for a positive functional relationship between the 1.1-kb unedited orfB gene transcript, and its translated product in the mitochondria with male sterility. The generation of the 1.1-kb unedited orfB gene transcripts increased during flowering, resulting in low ATP synthase activity in sterile plants. Following insertion of the unedited orfB gene into the genome of male-fertile plants, the plants became male sterile in a dose-dependent manner with concomitant reduction of ATPase activity of F1F0-ATP synthase (complex V). Fertility of the transgenic lines and normal activity of ATP synthase were restored by down-regulation of the unedited orfB gene expression through RNAi-mediated silencing. The genetic elements deciphered in this study could further be tested for their use in hybrid rice development.

  13. An efficient and reproducible protocol for the production of salt tolerant transgenic wheat plants expressing the Arabidopsis AtNHX1 gene.

    Science.gov (United States)

    Moghaieb, Reda E A; Sharaf, Ahmed N; Soliman, Mohamed H; El-Arabi, Nagwa I; Momtaz, Osama A

    2014-01-01

    We present an efficient method for the production of transgenic salt tolerant hexaploid wheat plants expressing the Arabidopsis AtNHX1 gene. Wheat mature zygotic embryos were isolated from two hexaploid bread wheat (Triticum aestivum) cultivars (namely: Gemmeiza 9 and Gemmeiza 10) and were transformed with the A. tumefaciens LBA4404 harboring the pBI-121 vector containing the AtNHX1 gene. Transgenic wheat lines that express the gus intron was obtained and used as control. The results confirmed that npt-II gene could be transmitted and expressed in the T2 following 3:1 Mendelian segregation while the control plant couldn't. The data indicate that, the AtNHX1 gene was integrated in a stable manner into the wheat genome and the corresponding transcripts were expressed. The transformation efficiency was 5.7 and 7.5% for cultivars Gemmeiza 10 and Gemmeiza 9, respectively. A greenhouse experiment was conducted to investigate the effect of AtNHX1 gene in wheat salt tolerance. The transgenic wheat lines could maintain high growth rate under salt stress condition (350 mM NaCl) while the control plant couldn't. The results confirmed that Na(+)/H(+) antiporter gene AtNHX1 increased salt tolerance by increasing Na(+) accumulation and keeping K+/Na(+) balance. Thus, transgenic plants showed high tolerance to salt stress and can be considered as a new genetic resource in breeding programs.

  14. AβPP/PS1 Transgenic Mice Show Sex Differences in the Cerebellum Associated with Aging.

    Science.gov (United States)

    Ordoñez-Gutierrez, Lara; Fernandez-Perez, Ivan; Herrera, Jose Luis; Anton, Marta; Benito-Cuesta, Irene; Wandosell, Francisco

    2016-09-06

    Cerebellar pathology has been related to presenilin 1 mutations in certain pedigrees of familial Alzheimer's disease. However, cerebellum tissue has not been intensively analyzed in transgenic models of mutant presenilins. Furthermore, the effect of the sex of the mice was not systematically analyzed, despite the fact that important gender differences in the evolution of the disease in the human population have been described. We analyzed whether the progression of amyloidosis in a double transgenic mouse, AβPP/PS1, is susceptible to aging and differentially affects males and females. The accumulation of amyloid in the cerebellum differentially affects males and females of the AβPP/PS1 transgenic line, which was found to be ten-fold higher in 15-month-old females. Amyloid-β accumulation was more evident in the molecular layer of the cerebellum, but glia reaction was only observed in the granular layer of the older mice. The sex divergence was also observed in other neuronal, survival, and autophagic markers. The cerebellum plays an important role in the evolution of the pathology in this transgenic mouse model. Sex differences could be crucial for a complete understanding of this disease. We propose that the human population could be studied in this way. Sex-specific treatment strategies in human populations could show a differential response to the therapeutic approach.

  15. Molecular and Functional Characterization of GR2-R1 Event Based Backcross Derived Lines of Golden Rice in the Genetic Background of a Mega Rice Variety Swarna.

    Directory of Open Access Journals (Sweden)

    Haritha Bollinedi

    Full Text Available Homozygous Golden Rice lines developed in the background of Swarna through marker assisted backcross breeding (MABB using transgenic GR2-R1 event as a donor for the provitamin A trait have high levels of provitamin A (up to 20 ppm but are dwarf with pale green leaves and drastically reduced panicle size, grain number and yield as compared to the recurrent parent, Swarna. In this study, we carried out detailed morphological, biochemical and molecular characterization of these lines in a quest to identify the probable reasons for their abnormal phenotype. Nucleotide blast analysis with the primer sequences used to amplify the transgene revealed that the integration of transgene disrupted the native OsAux1 gene, which codes for an auxin transmembrane transporter protein. Real time expression analysis of the transgenes (ZmPsy and CrtI driven by endosperm-specific promoter revealed the leaky expression of the transgene in the vegetative tissues. We propose that the disruption of OsAux1 disturbed the fine balance of plant growth regulators viz., auxins, gibberellic acid and abscisic acid, leading to the abnormalities in the growth and development of the lines homozygous for the transgene. The study demonstrates the conserved roles of OsAux1 gene in rice and Arabidopsis.

  16. Starch characteristics of transgenic wheat (Triticum aestivum L.) overexpressing the Dx5 high molecular weight glutenin subunit are substantially equivalent to those in nonmodified wheat.

    Science.gov (United States)

    Beckles, Diane M; Tananuwong, Kanitha; Shoemaker, Charles F

    2012-04-01

    The effects of engineering higher levels of the High Molecular Weight Glutenin Dx5 subunit on starch characteristics in transgenic wheat (Triticum aestivum L.) grain were evaluated. This is important because of the interrelationship between starch and protein accumulation in grain, the strong biotechnological interest in modulating Dx5 levels and the increasing likelihood that transgenic wheat will be commercialized in the U.S. Unintended effects of Dx5 overexpression on starch could affect wheat marketability and therefore should be examined. Two controls with native levels of Dx5 were used: (i) the nontransformed Bobwhite cultivar, and (ii) a transgenic line (Bar-D) expressing a herbicide resistant (bar) gene, and they were compared with 2 transgenic lines (Dx5G and Dx5J) containing bar and additional copies of Dx5. There were few changes between Bar-D and Dx5G compared to Bobwhite. However, Dx5J, the line with the highest Dx5 protein (×3.5) accumulated 140% more hexose, 25% less starch and the starch had a higher frequency of longer amylopectin chains. These differences were not of sufficient magnitude to influence starch functionality, because granule morphology, crystallinity, amylose-to-amylopectin ratio, and the enthalpy of starch gelatinization and the amylose-lipid complex melting were similar to the control (P > 0.05). This overall similarity was borne out by Partial Least Squares-Discriminant Function Analysis, which could not distinguish among genotypes. Collectively our data imply that higher Dx5 can affect starch accumulation and some aspects of starch molecular structure but that the starches of the Dx5 transgenic wheat lines are substantially equivalent to the controls. Transgenic manipulation of biochemical pathways is an effective way to enhance food sensory quality, but it can also lead to unintended effects. These spurious changes are a concern to Government Regulatory Agencies and to those Industries that market the product. In this study we

  17. An Efficient Method for Generation of Transgenic Rats Avoiding Embryo Manipulation

    Directory of Open Access Journals (Sweden)

    Bhola Shankar Pradhan

    2016-01-01

    Full Text Available Although rats are preferred over mice as an animal model, transgenic animals are generated predominantly using mouse embryos. There are limitations in the generation of transgenic rat by embryo manipulation. Unlike mouse embryos, most of the rat embryos do not survive after male pronuclear DNA injection which reduces the efficiency of generation of transgenic rat by this method. More importantly, this method requires hundreds of eggs collected by killing several females for insertion of transgene to generate transgenic rat. To this end, we developed a noninvasive and deathless technique for generation of transgenic rats by integrating transgene into the genome of the spermatogonial cells by testicular injection of DNA followed by electroporation. After standardization of this technique using EGFP as a transgene, a transgenic disease model displaying alpha thalassemia was successfully generated using rats. This efficient method will ease the generation of transgenic rats without killing the lives of rats while simultaneously reducing the number of rats used for generation of transgenic animal.

  18. SP-LL-37, human antimicrobial peptide, enhances disease resistance in transgenic rice.

    Science.gov (United States)

    Lee, In Hye; Jung, Yu-Jin; Cho, Yong Gu; Nou, Ill Sup; Huq, Md Amdadul; Nogoy, Franz Marielle; Kang, Kwon-Kyoo

    2017-01-01

    Human LL-37 is a multifunctional antimicrobial peptide of cathelicidin family. It has been shown in recent studies that it can serve as a host's defense against influenza A virus. We now demonstrate in this study how signal peptide LL-37 (SP-LL-37) can be used in rice resistance against bacterial leaf blight and blast. We synthesized LL-37 peptide and subcloned in a recombinant pPZP vector with pGD1 as promoter. SP-LL-37 was introduced into rice plants by Agrobacterium mediated transformation. Stable expression of SP-LL-37 in transgenic rice plants was confirmed by RT-PCR and ELISA analyses. Subcellular localization of SP-LL-37-GFP fusion protein showed evidently in intercellular space. Our data on testing for resistance to bacterial leaf blight and blast revealed that the transgenic lines are highly resistant compared to its wildtype. Our results suggest that LL-37 can be further explored to improve wide-spectrum resistance to biotic stress in rice.

  19. The Transgenic RNAi Project at Harvard Medical School: Resources and Validation.

    Science.gov (United States)

    Perkins, Lizabeth A; Holderbaum, Laura; Tao, Rong; Hu, Yanhui; Sopko, Richelle; McCall, Kim; Yang-Zhou, Donghui; Flockhart, Ian; Binari, Richard; Shim, Hye-Seok; Miller, Audrey; Housden, Amy; Foos, Marianna; Randkelv, Sakara; Kelley, Colleen; Namgyal, Pema; Villalta, Christians; Liu, Lu-Ping; Jiang, Xia; Huan-Huan, Qiao; Wang, Xia; Fujiyama, Asao; Toyoda, Atsushi; Ayers, Kathleen; Blum, Allison; Czech, Benjamin; Neumuller, Ralph; Yan, Dong; Cavallaro, Amanda; Hibbard, Karen; Hall, Don; Cooley, Lynn; Hannon, Gregory J; Lehmann, Ruth; Parks, Annette; Mohr, Stephanie E; Ueda, Ryu; Kondo, Shu; Ni, Jian-Quan; Perrimon, Norbert

    2015-11-01

    To facilitate large-scale functional studies in Drosophila, the Drosophila Transgenic RNAi Project (TRiP) at Harvard Medical School (HMS) was established along with several goals: developing efficient vectors for RNAi that work in all tissues, generating a genome-scale collection of RNAi stocks with input from the community, distributing the lines as they are generated through existing stock centers, validating as many lines as possible using RT-qPCR and phenotypic analyses, and developing tools and web resources for identifying RNAi lines and retrieving existing information on their quality. With these goals in mind, here we describe in detail the various tools we developed and the status of the collection, which is currently composed of 11,491 lines and covering 71% of Drosophila genes. Data on the characterization of the lines either by RT-qPCR or phenotype is available on a dedicated website, the RNAi Stock Validation and Phenotypes Project (RSVP, http://www.flyrnai.org/RSVP.html), and stocks are available from three stock centers, the Bloomington Drosophila Stock Center (United States), National Institute of Genetics (Japan), and TsingHua Fly Center (China). Copyright © 2015 by the Genetics Society of America.

  20. The Transgenic RNAi Project at Harvard Medical School: Resources and Validation

    Science.gov (United States)

    Perkins, Lizabeth A.; Holderbaum, Laura; Tao, Rong; Hu, Yanhui; Sopko, Richelle; McCall, Kim; Yang-Zhou, Donghui; Flockhart, Ian; Binari, Richard; Shim, Hye-Seok; Miller, Audrey; Housden, Amy; Foos, Marianna; Randkelv, Sakara; Kelley, Colleen; Namgyal, Pema; Villalta, Christians; Liu, Lu-Ping; Jiang, Xia; Huan-Huan, Qiao; Wang, Xia; Fujiyama, Asao; Toyoda, Atsushi; Ayers, Kathleen; Blum, Allison; Czech, Benjamin; Neumuller, Ralph; Yan, Dong; Cavallaro, Amanda; Hibbard, Karen; Hall, Don; Cooley, Lynn; Hannon, Gregory J.; Lehmann, Ruth; Parks, Annette; Mohr, Stephanie E.; Ueda, Ryu; Kondo, Shu; Ni, Jian-Quan; Perrimon, Norbert

    2015-01-01

    To facilitate large-scale functional studies in Drosophila, the Drosophila Transgenic RNAi Project (TRiP) at Harvard Medical School (HMS) was established along with several goals: developing efficient vectors for RNAi that work in all tissues, generating a genome-scale collection of RNAi stocks with input from the community, distributing the lines as they are generated through existing stock centers, validating as many lines as possible using RT–qPCR and phenotypic analyses, and developing tools and web resources for identifying RNAi lines and retrieving existing information on their quality. With these goals in mind, here we describe in detail the various tools we developed and the status of the collection, which is currently composed of 11,491 lines and covering 71% of Drosophila genes. Data on the characterization of the lines either by RT–qPCR or phenotype is available on a dedicated website, the RNAi Stock Validation and Phenotypes Project (RSVP, http://www.flyrnai.org/RSVP.html), and stocks are available from three stock centers, the Bloomington Drosophila Stock Center (United States), National Institute of Genetics (Japan), and TsingHua Fly Center (China). PMID:26320097

  1. Improved protein quality in transgenic soybean expressing a de novo synthetic protein, MB-16.

    Science.gov (United States)

    Zhang, Yunfang; Schernthaner, Johann; Labbé, Natalie; Hefford, Mary A; Zhao, Jiping; Simmonds, Daina H

    2014-06-01

    To improve soybean [Glycine max (L.) Merrill] seed nutritional quality, a synthetic gene, MB-16 was introduced into the soybean genome to boost seed methionine content. MB-16, an 11 kDa de novo protein enriched in the essential amino acids (EAAs) methionine, threonine, lysine and leucine, was originally developed for expression in rumen bacteria. For efficient seed expression, constructs were designed using the soybean codon bias, with and without the KDEL ER retention sequence, and β-conglycinin or cruciferin seed specific protein storage promoters. Homozygous lines, with single locus integrations, were identified for several transgenic events. Transgene transmission and MB-16 protein expression were confirmed to the T5 and T7 generations, respectively. Quantitative RT-PCR analysis of developing seed showed that the transcript peaked in growing seed, 5-6 mm long, remained at this peak level to the full-sized green seed and then was significantly reduced in maturing yellow seed. Transformed events carrying constructs with the rumen bacteria codon preference showed the same transcription pattern as those with the soybean codon preference, but the transcript levels were lower at each developmental stage. MB-16 protein levels, as determined by immunoblots, were highest in full-sized green seed but the protein virtually disappeared in mature seed. However, amino acid analysis of mature seed, in the best transgenic line, showed a significant increase of 16.2 and 65.9 % in methionine and cysteine, respectively, as compared to the parent. This indicates that MB-16 elevated the sulfur amino acids, improved the EAA seed profile and confirms that a de novo synthetic gene can enhance the nutritional quality of soybean.

  2. Transgenic Mouse Lines Subdivide External Segment of the Globus Pallidus (GPe) Neurons and Reveal Distinct GPe Output Pathways

    Science.gov (United States)

    Mastro, Kevin J.; Bouchard, Rachel S.; Holt, Hiromi A. K.

    2014-01-01

    Cell-type diversity in the brain enables the assembly of complex neural circuits, whose organization and patterns of activity give rise to brain function. However, the identification of distinct neuronal populations within a given brain region is often complicated by a lack of objective criteria to distinguish one neuronal population from another. In the external segment of the globus pallidus (GPe), neuronal populations have been defined using molecular, anatomical, and electrophysiological criteria, but these classification schemes are often not generalizable across preparations and lack consistency even within the same preparation. Here, we present a novel use of existing transgenic mouse lines, Lim homeobox 6 (Lhx6)–Cre and parvalbumin (PV)–Cre, to define genetically distinct cell populations in the GPe that differ molecularly, anatomically, and electrophysiologically. Lhx6–GPe neurons, which do not express PV, are concentrated in the medial portion of the GPe. They have lower spontaneous firing rates, narrower dynamic ranges, and make stronger projections to the striatum and substantia nigra pars compacta compared with PV–GPe neurons. In contrast, PV–GPe neurons are more concentrated in the lateral portions of the GPe. They have narrower action potentials, deeper afterhyperpolarizations, and make stronger projections to the subthalamic nucleus and parafascicular nucleus of the thalamus. These electrophysiological and anatomical differences suggest that Lhx6–GPe and PV–GPe neurons participate in different circuits with the potential to contribute to different aspects of motor function and dysfunction in disease. PMID:24501350

  3. Production of transgenic pigs over-expressing the antiviral gene Mx1

    Directory of Open Access Journals (Sweden)

    Quanmei Yan

    2014-01-01

    Full Text Available The myxovirus resistance gene (Mx1 has a broad spectrum of antiviral activities. It is therefore an interesting candidate gene to improve disease resistance in farm animals. In this study, we report the use of somatic cell nuclear transfer (SCNT to produce transgenic pigs over-expressing the Mx1 gene. These transgenic pigs express approximately 15–25 times more Mx1 mRNA than non-transgenic pigs, and the protein level of Mx1 was also markedly enhanced. We challenged fibroblast cells isolated from the ear skin of transgenic and control pigs with influenza A virus and classical swine fever virus (CFSV. Indirect immunofluorescence assay (IFA revealed a profound decrease of influenza A proliferation in Mx1 transgenic cells. Growth kinetics showed an approximately 10-fold reduction of viral copies in the transgenic cells compared to non-transgenic controls. Additionally, we found that the Mx1 transgenic cells were more resistant to CSFV infection in comparison to non-transgenic cells. These results demonstrate that the Mx1 transgene can protect against viral infection in cells of transgenic pigs and indicate that the Mx1 transgene can be harnessed to develop disease-resistant pigs.

  4. Optimization of codon composition and regulatory elements for expression of human insulin like growth factor-1 in transgenic chloroplasts and evaluation of structural identity and function.

    Science.gov (United States)

    Daniell, Henry; Ruiz, Gricel; Denes, Bela; Sandberg, Laurence; Langridge, William

    2009-04-03

    Transgenic chloroplasts are potential bioreactors for recombinant protein production, especially for achievement of high levels of protein expression and proper folding. Production of therapeutic proteins in leaves provides transgene containment by elimination of reproductive structures. Therefore, in this study, human Insulin like Growth Factor-1 is expressed in transgenic chloroplasts for evaluation of structural identity and function. Expression of the synthetic Insulin like Growth Factor 1 gene (IGF-1s, 60% AT) was observed in transformed E. coli. However, no native IGF-1 gene (IGF-1n, 41% AT) product was detected in the western blots in E. coli. Site-specific integration of the transgenes into the tobacco chloroplast genome was confirmed after transformation using PCR. Southern blot analysis confirmed that the transgenic lines were homoplasmic. The transgenic plant lines had IGF-1s expression levels of 11.3% of total soluble protein (TSP). The IGF-1n plants contained 9.5% TSP as IGF-1n, suggesting that the chloroplast translation machinery is more flexible than E. coli in codon preference and usage. The expression of IGF-1 was increased up to 32% TSP under continuous illumination by the chloroplast light regulatory elements. IgG-Sepharose affinity column chromatographic separation of Z domain containing chloroplast derived IGF-1 protein, single and two dimensional electrophoresis methods and mass spectrometer analysis confirmed the identity of human IGF-1 in transgenic chloroplasts. Two spots analyzed from 2-D focusing/phoresis acrylamide gel showed the correct amino acid sequence of human IGF-1 and the S. aureus Z-tag. Cell proliferation assays in human HU-3 cells demonstrated the biological activity of chloroplast derived IGF-1 even in the presence of the S. aureus Z tag. This study demonstrates that the human Insulin like Growth Factor-1 expressed in transgenic chloroplasts is identical to the native protein and is fully functional. The ability to use plant

  5. Impaired c-Fos and polo-like kinase 2 induction in the limbic system of fear-conditioned α-synuclein transgenic mice.

    Directory of Open Access Journals (Sweden)

    Heinrich Schell

    Full Text Available α-Synuclein (αSYN is genetically and neuropathologically linked to a spectrum of neurodegenerative diseases including Parkinson's disease, dementia with Lewy bodies, and related disorders. Cognitive impairment is recapitulated in several αSYN transgenic mouse lines. However, the mechanisms of dysfunction in affected neurons are largely unknown. Here we measured neuronal activity induced gene products in the limbic system of αSYN transgenic mice upon fear conditioning (FC. Induction of the synaptic plasticity marker c-Fos was significantly reduced in the amygdala and hippocampus of (Thy1-h[A30P]αSYN transgenic mice in an age-dependent manner. Similarly, the neuronal activity inducible polo-like kinase 2 (Plk2 that can phosphorylate αSYN at the pathological site serine-129 was up-regulated in both brain regions upon FC. Plk2 inductions were also significantly impaired in aged (Thy1-h[A30P]αSYN transgenic mice, both in the amygdala and hippocampus. Plk2 inductions in the amygdala after FC were paralleled by a small but significant increase in the number of neuronal cell bodies immunopositive for serine-129 phosphorylated αSYN in young but not aged (Thy1-h[A30P]αSYN transgenic mice. In addition, we observed in the aged hippocampus a distinct type of apparently unmodified transgenic αSYN profiles resembling synaptic accumulations of αSYN. Thus, the cognitive decline observed in aged αSYN transgenic mice might be due to impairment of neurotransmission and synaptic plasticity in the limbic system by distinct αSYN species.

  6. Simultaneous Expression of PDH45 with EPSPS Gene Improves Salinity and Herbicide Tolerance in Transgenic Tobacco Plants.

    Science.gov (United States)

    Garg, Bharti; Gill, Sarvajeet S; Biswas, Dipul K; Sahoo, Ranjan K; Kunchge, Nandkumar S; Tuteja, Renu; Tuteja, Narendra

    2017-01-01

    To cope with the problem of salinity- and weed-induced crop losses, a multi-stress tolerant trait is need of the hour but a combinatorial view of such traits is not yet explored. The overexpression of PDH45 (pea DNA helicase 45) and EPSPS (5-enoylpruvyl shikimate-3-phosphate synthase) genes have been reported to impart salinity and herbicide tolerance. Further, the understanding of mechanism and pathways utilized by PDH45 and EPSPS for salinity and herbicide tolerance will help to improve the crops of economical importance. In the present study, we have performed a comparative analysis of salinity and herbicide tolerance to check the biochemical parameters and antioxidant status of tobacco transgenic plants. Collectively, the results showed that PDH45 overexpressing transgenic lines display efficient tolerance to salinity stress, while PDH45+EPSPS transgenics showed tolerance to both the salinity and herbicide as compared to the control [wild type (WT) and vector control (VC)] plants. The activities of the components of enzymatic antioxidant machinery were observed to be higher in the transgenic plants indicating the presence of an efficient antioxidant defense system which helps to cope with the stress-induced oxidative-damages. Photosynthetic parameters also showed significant increase in PDH45 and PDH45+EPSPS overexpressing transgenic plants in comparison to WT, VC and EPSPS transgenic plants under salinity stress. Furthermore, PDH45 and PDH45+EPSPS synergistically modulate the jasmonic acid and salicylic acid mediated signaling pathways for combating salinity stress. The findings of our study suggest that pyramiding of the PDH45 gene with EPSPS gene renders host plants tolerant to salinity and herbicide by enhancing the antioxidant machinery thus photosynthesis.

  7. Resistance to organophosphorus agent toxicity in transgenic mice expressing the G117H mutant of human butyrylcholinesterase

    International Nuclear Information System (INIS)

    Wang Yuxia; Ticu Boeck, Andreea; Duysen, Ellen G.; Van Keuren, Margaret; Saunders, Thomas L.; Lockridge, Oksana

    2004-01-01

    Organophosphorus toxicants (OP) include chemical nerve agents and pesticides. The goal of this work was to find out whether an animal could be made resistant to OP toxicity by genetic engineering. The human butyrylcholinesterase (BChE) mutant G117H was chosen for study because it has the unusual ability to hydrolyze OP as well as acetylcholine, and it is resistant to inhibition by OP. Human G117H BChE, under the control of the ROSA26 promoter, was expressed in all tissues of transgenic mice. A stable transgenic mouse line expressed 0.5 μg/ml of human G117H BChE in plasma as well as 2 μg/ml of wild-type mouse BChE. Intestine, kidneys, stomach, lungs, heart, spleen, liver, brain, and muscle expressed 0.6-0.15 μg/g of G117H BChE. Transgenic mice were normal in behavior and fertility. The LD50 dose of echothiophate for wild-type mice was 0.1 mg/kg sc. This dose caused severe cholinergic signs of toxicity and lethality in wild-type mice, but caused no deaths and only mild toxicity in transgenic animals. The mechanism of protection was investigated by measuring acetylcholinesterase (AChE) and BChE activity. It was found that AChE and endogenous BChE were inhibited to the same extent in echothiophate-treated wild type and transgenic mice. This led to the hypothesis that protection against echothiophate toxicity was not explained by hydrolysis of echothiophate. In conclusion, the transgenic G117H BChE mouse demonstrates the factors required to achieve protection from OP toxicity in a vertebrate animal

  8. Overexpression of GsZFP1 enhances salt and drought tolerance in transgenic alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Tang, Lili; Cai, Hua; Ji, Wei; Luo, Xiao; Wang, Zhenyu; Wu, Jing; Wang, Xuedong; Cui, Lin; Wang, Yang; Zhu, Yanming; Bai, Xi

    2013-10-01

    GsZFP1 encodes a Cys2/His2-type zinc-finger protein. In our previous study, when GsZFP1 was heterologously expressed in Arabidopsis, the transgenic Arabidopsis plants exhibited enhanced drought and cold tolerance. However, it is still unknown whether GsZFP1 is also involved in salt stress. GsZFP1 is from the wild legume Glycine soja. Therefore, the aims of this study were to further elucidate the functions of the GsZFP1 gene under salt and drought stress in the forage legume alfalfa and to investigate its biochemical and physiological functions under these stress conditions. Our data showed that overexpression of GsZFP1 in alfalfa resulted in enhanced salt tolerance. Under high salinity stress, greater relative membrane permeability and malondialdehyde (MDA) content were observed and more free proline and soluble sugars accumulated in transgenic alfalfa than in the wild-type (WT) plants; in addition, the transgenic lines accumulated less Na(+) and more K(+) in both the shoots and roots. Overexpression of GsZFP1 also enhanced the drought tolerance of alfalfa. The fold-inductions of stress-responsive marker gene expression, including MtCOR47, MtRAB18, MtP5CS, and MtRD2, were greater in transgenic alfalfa than those of WT under drought stress conditions. In conclusion, the transgenic alfalfa plants generated in this study could be used for farming in salt-affected as well as arid and semi-arid areas. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  9. How To Produce and Characterize Transgenic Plants.

    Science.gov (United States)

    Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

    2002-01-01

    Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

  10. No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities.

    Science.gov (United States)

    Lu, Z B; Tian, J C; Han, N S; Hu, C; Peng, Y F; Stanley, David; Ye, G Y

    2014-10-01

    A 2-yr field trial was conducted to assess the impacts of two new transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. All the arthropods were classified into five guilds, including herbivores, parasitoids, predators, detritivores, and others. The seasonal density and dominance distribution of each guild and community-level indices (species richness, Shannon-Wiener diversity index, Simpson diversity index, and evenness index) were compared among rice types. Principal response curves were used to investigate the differences of entire arthropod community of Bt rice plots relative to non-Bt rice plots. The results showed no significant difference was detected in the community-level indices and dominance distribution of guilds between Bt and non-Bt rice plots. The seasonal density of herbivores, detritivores, and others as well as density of the arthropod overall community were also not significantly affected by rice types in either year, although the density of predators and parasitoids in Bt rice plots was significantly lower than those in non-Bt rice plots. The lower abundances of Braconidae, Eulophidae, Cyrtorhinus lividipennis (Reuter) (Hemiptera: Miridae), and Theridiidae in Bt rice plots are likely attributed to the lower abundances of prey species or hosts. Principal response curves revealed that arthropod community in Bt was similar with that in non-Bt rice plots. In conclusion, our findings indicate that these two tested Bt rice lines had no marked negative effects on the arthropod community in the paddy fields.

  11. Application of a high-speed breeding technology to apple (Malus × domestica) based on transgenic early flowering plants and marker-assisted selection.

    Science.gov (United States)

    Flachowsky, Henryk; Le Roux, Pierre-Marie; Peil, Andreas; Patocchi, Andrea; Richter, Klaus; Hanke, Magda-Viola

    2011-10-01

    Breeding of apple (Malus × domestica) remains a slow process because of protracted generation cycles. Shortening the juvenile phase to achieve the introgression of traits from wild species into prebreeding material within a reasonable time frame is a great challenge. In this study, we evaluated early flowering transgenic apple lines overexpressing the BpMADS4 gene of silver birch with regard to tree morphology in glasshouse conditions. Based on the results obtained, line T1190 was selected for further analysis and application to fast breeding. The DNA sequences flanking the T-DNA were isolated and the T-DNA integration site was mapped on linkage group 4. The inheritance and correctness of the T-DNA integration were confirmed after meiosis. A crossbred breeding programme was initiated by crossing T1190 with the fire blight-resistant wild species Malus fusca. Transgenic early flowering F(1) seedlings were selected and backcrossed with 'Regia' and 98/6-10 in order to introgress the apple scab Rvi2, Rvi4 and powdery mildew Pl-1, Pl-2 resistance genes and the fire blight resistance quantitative trait locus FB-F7 present in 'Regia'. Three transgenic BC'1 seedlings pyramiding Rvi2, Rvi4 and FB-F7, as well as three other BC'1 seedlings combining Pl-1 and Pl-2, were identified. Thus, the first transgenic early flowering-based apple breeding programme combined with marker-assisted selection was established. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  12. Populational survey of arthropods on transgenic common bean expressing the rep gene from Bean golden mosaic virus.

    Science.gov (United States)

    Pinheiro, Patrícia V; Quintela, Eliane D; Junqueira, Ana Maria R; Aragão, Francisco J L; Faria, Josias C

    2014-01-01

    Genetically modified (GM) crops is considered the fastest adopted crop technology in the history of modern agriculture. However, possible undesirable and unintended effects must be considered during the research steps toward development of a commercial product. In this report we evaluated effects of a common bean virus resistant line on arthropod populations, considered as non-target organisms. This GM bean line (named M1/4) was modified for resistance against Bean golden mosaic virus (BGMV) by expressing a mutated REP protein, which is essential for virus replication. Biosafety studies were performed for a period of three years under field conditions. The abundance of some species was significantly higher in specific treatments in a particular year, but not consistently different in other years. A regular pattern was not observed in the distribution of insects between genetically modified and conventional treatments. Data analyses showed that minor differences observed can be attributed to random variation and were not consistent enough to conclude that the treatments were different. Therefore the present study indicates that the relative abundance of species are similar in transgenic and non-transgenic fields.

  13. Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

    Science.gov (United States)

    Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

    2018-05-01

    Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  14. Characterization and Ectopic Expression of CoWRI1, an AP2/EREBP Domain-Containing Transcription Factor from Coconut (Cocos nucifera L.) Endosperm, Changes the Seeds Oil Content in Transgenic Arabidopsis thaliana and Rice (Oryza sativa L.).

    Science.gov (United States)

    Sun, RuHao; Ye, Rongjian; Gao, Lingchao; Zhang, Lin; Wang, Rui; Mao, Ting; Zheng, Yusheng; Li, Dongdong; Lin, Yongjun

    2017-01-01

    Coconut ( Cocos nucifera L.) is a key tropical crop and a member of the monocotyledonous family Arecaceae ( Palmaceae ). Few genes and related metabolic processes involved in coconut endosperm development have been investigated. In this study, a new member of the WRI1 gene family was isolated from coconut endosperm and was named CoWRI1 . Its transcriptional activities and interactions with the acetyl-CoA carboxylase ( BCCP2 ) promoter of CoWRI1 were confirmed by the yeast two-hybrid and yeast one-hybrid approaches, respectively. Functional characterization was carried out through seed-specific expression in Arabidopsis and endosperm-specific expression in rice. In transgenic Arabidopsis , high over-expressions of CoWRI1 in seven independent T2 lines were detected by quantitative real-time PCR. The relative mRNA accumulation of genes encoding enzymes involved in either fatty acid biosynthesis or triacylglycerols assembly (BCCP2, KASI, MAT, ENR, FATA, and GPDH) were also assayed in mature seeds. Furthermore, lipid and fatty acids C16:0 and C18:0 significantly increased. In two homozygous T2 transgenic rice lines (G5 and G2), different CoWRI1 expression levels were detected, but no CoWRI1 transcripts were detected in the wild type. Analyses of the seed oil content, starch content, and total protein content indicated that the two T2 transgenic lines showed a significant increase ( P oil content. The transgenic lines also showed a significant increase in starch content, whereas total protein content decreased significantly. Further analysis of the fatty acid composition revealed that palmitic acid (C16:0) and linolenic acid (C18:3) increased significantly in the seeds of the transgenic rice lines, but oleic acid (C18:1) levels significantly declined.

  15. Road and Street Centerlines, Street-The data set is a line feature consisting of 13948 line segments representing streets. It was created to maintain the location of city and county based streets., Published in 1989, Davis County Government.

    Data.gov (United States)

    NSGIC Local Govt | GIS Inventory — Road and Street Centerlines dataset current as of 1989. Street-The data set is a line feature consisting of 13948 line segments representing streets. It was created...

  16. Potential of MuS1 Transgenic Tobacco for Phytoremediation of the Urban Soils Contaminated with Cadmium

    Science.gov (United States)

    Kim, K. H.; Kim, Y. N.; Kim, S. H.

    2010-05-01

    Urban soils are prone to contamination by trace elements such as Cd, Cu, Pb and Zn. Phytoremediation is one of the attractive remediation methods for soils contaminated with trace elements due to its non-destructive and environmentally-friendly characteristic. Scientists have tried to find hyper-accumulator plants in nature or to develop transgenic plant through genetic engineering. This study was carried out to identify a potential of MuS1 transgenic tobacco for phytoremediation of the urban soils contaminated with Cd. MuS1 is known as a multiple stress related gene with several lines. The previous study using RT-PCR showed that the expression of MuS1 gene in tobacco plant induced tolerance to Cd stress. For this study, MuS1 transgenic tobacco and wild-type tobacco (control) were cultivated in a hydroponic system treated with Cd (0, 50, 100 and 200μM Cd) for 3 weeks. At harvest, both tobacco and nutrient solution were collected and were analyzed for Cd. Effect of Cd treatment on morphological change of the tobacco leaves was also observed by variable-pressure scanning electron microscopy (VP-SEM). The tolerance of MuS1 transgenic tobacco to Cd stress was better than that of wild-type tobacco at all Cd levels. Especially, wild-type tobacco showed chlorosis and withering with 200μM Cd treatment, whereas MuS1 transgenic tobacco gradually recovered from Cd damage. Wild-type tobacco accumulated more Cd (4.65mg per plant) than MuS1 transgenic tobacco (2.37mg per plant) with 200μM Cd treatment. Cd translocation rate from root to leaves was 81.8 % for wild-type tobacco compared to 37.1 % for MuS1 transgenic tobacco. Result of VP-SEM showed that the number of trichome in the leaves for wild-type tobacco increased in comparison with that for untreated samples after 3 weeks, while that for MuS1 transgenic tobacco was not changed by Cd treatment. Results showed that the mechanism of the recovery of the MuS1 tobacco plant was not by high level of Cd uptake and accumulation

  17. Construction of a multicontrol sterility system for a maize male-sterile line and hybrid seed production based on the ZmMs7 gene encoding a PHD-finger transcription factor.

    Science.gov (United States)

    Zhang, Danfeng; Wu, Suowei; An, Xueli; Xie, Ke; Dong, Zhenying; Zhou, Yan; Xu, Liwen; Fang, Wen; Liu, Shensi; Liu, Shuangshuang; Zhu, Taotao; Li, Jinping; Rao, Liqun; Zhao, Jiuran; Wan, Xiangyuan

    2018-02-01

    Although hundreds of genetic male sterility (GMS) mutants have been identified in maize, few are commercially used due to a lack of effective methods to produce large quantities of pure male-sterile seeds. Here, we develop a multicontrol sterility (MCS) system based on the maize male sterility 7 (ms7) mutant and its wild-type Zea mays Male sterility 7 (ZmMs7) gene via a transgenic strategy, leading to the utilization of GMS in hybrid seed production. ZmMs7 is isolated by a map-based cloning approach and encodes a PHD-finger transcription factor orthologous to rice PTC1 and Arabidopsis MS1. The MCS transgenic maintainer lines are developed based on the ms7-6007 mutant transformed with MCS constructs containing the (i) ZmMs7 gene to restore fertility, (ii) α-amylase gene ZmAA and/or (iii) DNA adenine methylase gene Dam to devitalize transgenic pollen, (iv) red fluorescence protein gene DsRed2 or mCherry to mark transgenic seeds and (v) herbicide-resistant gene Bar for transgenic seed selection. Self-pollination of the MCS transgenic maintainer line produces transgenic red fluorescent seeds and nontransgenic normal colour seeds at a 1:1 ratio. Among them, all the fluorescent seeds are male fertile, but the seeds with a normal colour are male sterile. Cross-pollination of the transgenic plants to male-sterile plants propagates male-sterile seeds with high purity. Moreover, the transgene transmission rate through pollen of transgenic plants harbouring two pollen-disrupted genes is lower than that containing one pollen-disrupted gene. The MCS system has great potential to enhance the efficiency of maize male-sterile line propagation and commercial hybrid seed production. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision.

    Science.gov (United States)

    Woo, Hee-Jong; Qin, Yang; Park, Soo-Yun; Park, Soon Ki; Cho, Yong-Gu; Shin, Kong-Sik; Lim, Myung-Ho; Cho, Hyun-Suk

    2015-01-01

    Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM) crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP) gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice.

  19. Functional imaging of interleukin 1 beta expression in inflammatory process using bioluminescence imaging in transgenic mice

    Directory of Open Access Journals (Sweden)

    Liu Zhihui

    2008-08-01

    Full Text Available Abstract Background Interleukin 1 beta (IL-1β plays an important role in a number of chronic and acute inflammatory diseases. To understand the role of IL-1β in disease processes and develop an in vivo screening system for anti-inflammatory drugs, a transgenic mouse line was generated which incorporated the transgene firefly luciferase gene driven by a 4.5-kb fragment of the human IL-1β gene promoter. Luciferase gene expression was monitored in live mice under anesthesia using bioluminescence imaging in a number of inflammatory disease models. Results In a LPS-induced sepsis model, dramatic increase in luciferase activity was observed in the mice. This transgene induction was time dependent and correlated with an increase of endogenous IL-1β mRNA and pro-IL-1β protein levels in the mice. In a zymosan-induced arthritis model and an oxazolone-induced skin hypersensitivity reaction model, luciferase expression was locally induced in the zymosan injected knee joint and in the ear with oxazolone application, respectively. Dexamethasone suppressed the expression of luciferase gene both in the acute sepsis model and in the acute arthritis model. Conclusion Our data suggest that the transgenic mice model could be used to study transcriptional regulation of the IL-1β gene expression in the inflammatory process and evaluation the effect of anti-inflammatory drug in vivo.

  20. Accumulation of eicosapolyenoic acids enhances sensitivity to abscisic acid and mitigates the effects of drought in transgenic Arabidopsis thaliana.

    Science.gov (United States)

    Yuan, Xiaowei; Li, Yaxiao; Liu, Shiyang; Xia, Fei; Li, Xinzheng; Qi, Baoxiu

    2014-04-01

    IgASE1, a C₁₈ Δ(9)-specific polyunsaturated fatty acid elongase from the marine microalga Isochrysis galbana, is able to convert linoleic acid and α-linolenic acid to eicosadienoic acid and eicosatrienoic acid in Arabidopsis. Eicosadienoic acid and eicosatrienoic acid are precursors of arachidonic acid, eicosapentaenoic acid, and docosahexaenoic acid, which are synthesized via the Δ(8) desaturation biosynthetic pathways. This study shows that the IgASE1-expressing transgenic Arabidopsis exhibited altered morphology (decreased leaf area and biomass) and enhanced drought resistance compared to wild-type plants. The transgenic Arabidopsis were hypersensitive to abscisic acid (ABA) during seed germination, post-germination growth, and seedling development. They had elevated leaf ABA levels under well-watered and dehydrated conditions and their stomata were more sensitive to ABA. Exogenous application of eicosadienoic acid and eicosatrienoic acid can mimic ABA and drought responses in the wild type plants, similar to that found in the transgenic ones. The transcript levels of genes involved in the biosynthesis of ABA (NCED3, ABA1, AAO3) as well as other stress-related genes were upregulated in this transgenic line upon osmotic stress (300 mM mannitol). Taken together, these results indicate that these two eicosapolyenoic acids or their derived metabolites can mitigate the effects of drought in transgenic Arabidopsis, at least in part, through the action of ABA.

  1. The Dmp1-SOST Transgene Interacts With and Downregulates the Dmp1-Cre Transgene and the Rosa(Notch) Allele.

    Science.gov (United States)

    Zanotti, Stefano; Canalis, Ernesto

    2016-05-01

    Activation of Notch1 in osteocytes of Rosa(Notch) mice, where a loxP-flanked STOP cassette and the Nicd coding sequence were targeted to the reverse orientation splice acceptor (Rosa)26 locus, causes osteopetrosis associated with suppressed Sost expression and enhanced Wnt signaling. To determine whether Sost downregulation mediates the effects of Notch activation in osteocytes, Rosa(Notch) mice were crossed with transgenics expressing Cre recombinase or SOST under the control of the dentin matrix protein (Dmp)1 promoter. Dmp1-SOST transgenics displayed vertebral osteopenia and a modest femoral cancellous and cortical bone phenotype, whereas hemizygous Dmp1-Cre transgenics heterozygous for the Rosa(Notch) allele (Dmp1-Cre;Rosa(Notch)) exhibited osteopetrosis. The phenotype of Notch activation in osteocytes was prevented in Dmp1-Cre;Rosa(Notch) mice hemizygous for the Dmp1-SOST transgene. The effect was associated with downregulated Notch signaling and suppressed Dmp1 and Rosa26 expression. To test whether SOST regulates Notch expression in osteocytes, cortical bone cultures from Dmp1-Cre;Rosa(Notch) mice or from Rosa(Notch) control littermates were exposed to recombinant human SOST. The addition of SOST had only modest effects on Notch target gene mRNA levels and suppressed Dmp1, but not Cre or Rosa26, expression. These findings suggest that prevention of the Dmp1-Cre;Rosa(Notch) skeletal phenotype by Dmp1-SOST is not secondary to SOST expression but to interactions among the Dmp1-SOST and Dmp1-Cre transgenes and the Rosa26 locus. In conclusion, the Dmp1-SOST transgene suppresses the expression of the Dmp1-Cre transgene and of Rosa26. © 2015 Wiley Periodicals, Inc.

  2. Transgene teknikker erstatter problematisk avl

    DEFF Research Database (Denmark)

    Alstrup, Aage Kristian Olsen; Hansen, Axel Kornerup

    2016-01-01

    Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder.......Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder....

  3. An AANAT/ASMT transgenic animal model constructed with CRISPR/Cas9 system serving as the mammary gland bioreactor to produce melatonin-enriched milk in sheep.

    Science.gov (United States)

    Ma, Teng; Tao, Jingli; Yang, Minghui; He, Changjiu; Tian, Xiuzhi; Zhang, Xiaosheng; Zhang, Jinlong; Deng, Shoulong; Feng, Jianzhong; Zhang, Zhenzhen; Wang, Jing; Ji, Pengyun; Song, Yukun; He, Pingli; Han, Hongbing; Fu, Juncai; Lian, Zhengxing; Liu, Guoshi

    2017-08-01

    Melatonin as a potent antioxidant exhibits important nutritional and medicinal values. To produce melatonin-enriched milk will benefit the consumers. In this study, a sheep bioreactor which generates melatonin-enriched milk has been successfully developed by the technology that combined CRISPR/Cas9 system and microinjection. The AANAT and ASMT were cloned from pineal gland of Dorper sheep (Ovis aries). The in vitro studies found that AANAT and ASMT were successfully transferred to the mammary epithelial cell lines and significantly increased melatonin production in the culture medium compared to the nontransgenic cell lines. In addition, the Cas9 mRNA, sgRNA, and the linearized vectors pBC1-AANAT and pBC1-ASMT were co-injected into the cytoplasm of pronuclear embryos which were implanted into ewes by oviducts transferring. Thirty-four transgenic sheep were generated with the transgenic positive rate being roughly 35% which were identified by Southern blot and sequencing. Seven carried transgenic AANAT, two carried ASMT, and 25 carried both of AANAT and ASMT genes. RT-PCR and Western blot demonstrated that the lambs expressed these genes in their mammary epithelial cells and these animals produced melatonin-enriched milk. This is the first report to show a functional AANAT and ASMT transgenic animal model which produce significantly high levels of melatonin milk compared to their wild-type counterparts. The advanced technologies used in the study laid a foundation for generating large transgenic livestock, for example, the cows, which can produce high level of melatonin milk. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Generation of mRx-Cre Transgenic Mouse Line for Efficient Conditional Gene Deletion in Early Retinal Progenitors

    Czech Academy of Sciences Publication Activity Database

    Klímová, Lucie; Láchová, Jitka; Machoň, Ondřej; Sedláček, Radislav; Kozmik, Zbyněk

    2013-01-01

    Roč. 8, č. 5 (2013), e63029 E-ISSN 1932-6203 R&D Projects: GA ČR GAP305/11/2198; GA MŠk(CZ) LK11214; GA MŠk(CZ) LM2011032; GA ČR GAP305/10/2143; GA MŠk ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : eye development * lens * retina * transgenic mice Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  5. Utrophin up-regulation by an artificial transcription factor in transgenic mice.

    Directory of Open Access Journals (Sweden)

    Elisabetta Mattei

    2007-08-01

    Full Text Available Duchenne Muscular Dystrophy (DMD is a severe muscle degenerative disease, due to absence of dystrophin. There is currently no effective treatment for DMD. Our aim is to up-regulate the expression level of the dystrophin related gene utrophin in DMD, complementing in this way the lack of dystrophin functions. To this end we designed and engineered several synthetic zinc finger based transcription factors. In particular, we have previously shown that the artificial three zinc finger protein named Jazz, fused with the appropriate effector domain, is able to drive the transcription of a test gene from the utrophin promoter "A". Here we report on the characterization of Vp16-Jazz-transgenic mice that specifically over-express the utrophin gene at the muscular level. A Chromatin Immunoprecipitation assay (ChIP demonstrated the effective access/binding of the Jazz protein to active chromatin in mouse muscle and Vp16-Jazz was shown to be able to up-regulate endogenous utrophin gene expression by immunohistochemistry, western blot analyses and real-time PCR. To our knowledge, this is the first example of a transgenic mouse expressing an artificial gene coding for a zinc finger based transcription factor. The achievement of Vp16-Jazz transgenic mice validates the strategy of transcriptional targeting of endogenous genes and could represent an exclusive animal model for use in drug discovery and therapeutics.

  6. A Built-In Mechanism to Mitigate the Spread of Insect-Resistance and Herbicide-Tolerance Transgenes into Weedy Rice Populations

    Science.gov (United States)

    Liu, Chengyi; Li, Jingjing; Gao, Jianhua; Shen, Zhicheng; Lu, Bao-Rong; Lin, Chaoyang

    2012-01-01

    Background The major challenge of cultivating genetically modified (GM) rice (Oryza sativa) at the commercial scale is to prevent the spread of transgenes from GM cultivated rice to its coexisting weedy rice (O. sativa f. spontanea). The strategic development of GM rice with a built-in control mechanism can mitigate transgene spread in weedy rice populations. Methodology/Principal Findings An RNAi cassette suppressing the expression of the bentazon detoxifying enzyme CYP81A6 was constructed into the T-DNA which contained two tightly linked transgenes expressing the Bt insecticidal protein Cry1Ab and the glyphosate tolerant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), respectively. GM rice plants developed from this T-DNA were resistant to lepidopteran pests and tolerant to glyphosate, but sensitive to bentazon. The application of bentazon of 2000 mg/L at the rate of 40 mL/m2, which is approximately the recommended dose for the field application to control common rice weeds, killed all F2 plants containing the transgenes generated from the Crop-weed hybrids between a GM rice line (CGH-13) and two weedy rice strains (PI-63 and PI-1401). Conclusions/Significance Weedy rice plants containing transgenes from GM rice through gene flow can be selectively killed by the spray of bentazon when a non-GM rice variety is cultivated alternately in a few-year interval. The built-in control mechanism in combination of cropping management is likely to mitigate the spread of transgenes into weedy rice populations. PMID:22359609

  7. A built-in mechanism to mitigate the spread of insect-resistance and herbicide-tolerance transgenes into weedy rice populations.

    Directory of Open Access Journals (Sweden)

    Chengyi Liu

    Full Text Available BACKGROUND: The major challenge of cultivating genetically modified (GM rice (Oryza sativa at the commercial scale is to prevent the spread of transgenes from GM cultivated rice to its coexisting weedy rice (O. sativa f. spontanea. The strategic development of GM rice with a built-in control mechanism can mitigate transgene spread in weedy rice populations. METHODOLOGY/PRINCIPAL FINDINGS: An RNAi cassette suppressing the expression of the bentazon detoxifying enzyme CYP81A6 was constructed into the T-DNA which contained two tightly linked transgenes expressing the Bt insecticidal protein Cry1Ab and the glyphosate tolerant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS, respectively. GM rice plants developed from this T-DNA were resistant to lepidopteran pests and tolerant to glyphosate, but sensitive to bentazon. The application of bentazon of 2000 mg/L at the rate of 40 mL/m(2, which is approximately the recommended dose for the field application to control common rice weeds, killed all F(2 plants containing the transgenes generated from the Crop-weed hybrids between a GM rice line (CGH-13 and two weedy rice strains (PI-63 and PI-1401. CONCLUSIONS/SIGNIFICANCE: Weedy rice plants containing transgenes from GM rice through gene flow can be selectively killed by the spray of bentazon when a non-GM rice variety is cultivated alternately in a few-year interval. The built-in control mechanism in combination of cropping management is likely to mitigate the spread of transgenes into weedy rice populations.

  8. Equivalence analysis of quality traits in transgenic soybean over-expressing TaDREB3%转TaDREB3基因大豆的品质等同性分析

    Institute of Scientific and Technical Information of China (English)

    张彬彬; 李文滨

    2011-01-01

    Glydne max cv Dongnong 50 was transformed with a stress - tolerance gene TaDREBi. Three trans-genic lines with stable heredity were obtained and the seeds of the T4 generation were sown in field. The contents of protein, oil, fatty acid and isoflavone in seeds of the three transgenic lines and the non - transgenic control lines were determined and compared. The object was to study whether the introduction of foreign gene TaDREBi had changed the quality traits of soybean. Results showed that there were no significant differences in protein contents, oil contents, as well as fatty acid contents in soybean seeds between three transgenic lines and the control plants. Between the transgenic line 1 and the control, daidzein contents showed significant difference, but isoflavone contents showed no significant difference. It was suggested that introduction of TaDREBi into soybean did not cause much change in quality traits.%将抗逆基因TaDREB3转入大豆品种东农50,得到3个稳定遗传的株系,并将T4株系种子播于大田中.对3个转TaDREB3基因株系及非转基因对照株系的种子分别进行蛋白质、油份、脂肪酸、异黄酮等品质性状的等同性分析,研究转化外源基因TaDREB3后大豆原有品质性状是否有改变.结果表明:3个转基因株系和对照植株相比,蛋白质含量、油分含量和脂肪酸含量均差异不显著;转基因株系1的大豆黄素虽然和对照差异显著,但是异黄酮总含量和对照没有显著性差异.说明TaDREB3基因的导人并没有改变大豆的品质性状.

  9. Germ line transformation of the yellow fever mosquito, Aedes aegypti, mediated by transpositional insertion of a piggyBac vector.

    Science.gov (United States)

    Lobo, N F; Hua-Van, A; Li, X; Nolen, B M; Fraser, M J

    2002-04-01

    Mosquito-vectored diseases such as yellow fever and dengue fever continue to have a substantial impact on human populations world-wide. Novel strategies for control of these mosquito vectored diseases can arise through the development of reliable systems for genetic manipulation of the insect vector. A piggyBac vector marked with the Drosophila melanogaster cinnabar (cn) gene was used to transform the white-eyed khw strain of Aedes aegypti. Microinjection of preblastoderm embryos resulted in four families of cinnabar transformed insects. An overall transformation frequency of 4%, with a range of 0% to as high as 13% for individual experiments, was achieved when using a heat-shock induced transposase providing helper plasmid. Southern hybridizations indicated multiple insertion events in three of four transgenic lines, while the presence of duplicated target TTAA sites at either ends of individual insertions confirmed characteristic piggyBac transposition events in these three transgenic lines. The transgenic phenotype has remained stable for more than twenty generations. The transformations effected using the piggyBac element establish the potential of this element as a germ-line transformation vector for Aedine mosquitoes.

  10. High-efficiency Agrobacterium-mediated transformation of chickpea (Cicer arietinum L.) and regeneration of insect-resistant transgenic plants.

    Science.gov (United States)

    Mehrotra, Meenakshi; Sanyal, Indraneel; Amla, D V

    2011-09-01

    To develop an efficient genetic transformation system of chickpea (Cicer arietinum L.), callus derived from mature embryonic axes of variety P-362 was transformed with Agrobacterium tumefaciens strain LBA4404 harboring p35SGUS-INT plasmid containing the uidA gene encoding β-glucuronidase (GUS) and the nptII gene for kanamycin selection. Various factors affecting transformation efficiency were optimized; as Agrobacterium suspension at OD(600) 0.3 with 48 h of co-cultivation period at 20°C was found optimal for transforming 10-day-old MEA-derived callus. Inclusion of 200 μM acetosyringone, sonication for 4 s with vacuum infiltration for 6 min improved the number of GUS foci per responding explant from 1.0 to 38.6, as determined by histochemical GUS assay. For introducing the insect-resistant trait into chickpea, binary vector pRD400-cry1Ac was also transformed under optimized conditions and 18 T(0) transgenic plants were generated, representing 3.6% transformation frequency. T(0) transgenic plants reflected Mendelian inheritance pattern of transgene segregation in T(1) progeny. PCR, RT-PCR, and Southern hybridization analysis of T(0) and T(1) transgenic plants confirmed stable integration of transgenes into the chickpea genome. The expression level of Bt-Cry protein in T(0) and T(1) transgenic chickpea plants was achieved maximum up to 116 ng mg(-1) of soluble protein, which efficiently causes 100% mortality to second instar larvae of Helicoverpa armigera as analyzed by an insect mortality bioassay. Our results demonstrate an efficient and rapid transformation system of chickpea for producing non-chimeric transgenic plants with high frequency. These findings will certainly accelerate the development of chickpea plants with novel traits.

  11. Increased Expression of the Na,K-ATPase alpha4 Isoform Enhances Sperm Motility in Transgenic Mice1

    Science.gov (United States)

    Jimenez, Tamara; Sanchez, Gladis; McDermott, Jeffrey P.; Nguyen, Anh-Nguyet; Kumar, T. Rajendra; Blanco, Gustavo

    2010-01-01

    The Na,K-ATPase alpha4 (ATP1A4) isoform is specifically expressed in male germ cells and is highly prevalent in spermatozoa. Although selective inhibition of alpha4 activity with ouabain has been shown to affect sperm motility, a more direct analysis of the role of this isoform in sperm movement has not yet been demonstrated. To establish this, we engineered transgenic mice that express the rat alpha4 isoform fused to green fluorescent protein in male germ cells, under the control of the mouse protamine 1 promoter. We showed that the rat Atp1a4 transgene is expressed in mouse spermatozoa and that it is localized to the sperm flagellum. In agreement with increased expression of the alpha4 isoform, sperm from transgenic mice displayed higher alpha4-specific Na,K-ATPase activity and binding of fluorescently labeled ouabain than wild-type mice. In contrast, expression and activity of ATP1A1 (alpha1), the other Na,K-ATPase alpha isoform present in sperm, remained unchanged. Similar to wild-type mice, mice expressing the alpha4 transgene exhibited normal testis and sperm morphology and no differences in fertility. However, compared to wild-type mice, sperm from transgenic mice displayed plasma membrane hyperpolarization and higher total and progressive motility. Other parameters of motility also increased, including straight-line, curvilinear, and average path velocities and amplitude of lateral head displacement. In addition, sperm from the transgenic mice showed enhanced sperm hyperactive motility, but no changes in progesterone-induced acrosome reaction. Altogether, these results provide new genetic evidence for the role of the ATP1A4 isoform in sperm motility, under both noncapacitating and capacitating conditions. PMID:20826726

  12. Over-expression of a Rab family GTPase from phreatophyte Prosopis juliflora confers tolerance to salt stress on transgenic tobacco.

    Science.gov (United States)

    George, Suja; Parida, Ajay

    2011-03-01

    Plant growth and productivity are adversely affected by various abiotic and biotic stress factors. In our previous study, we used Prosopis juliflora, an abiotic stress tolerant tree species of Fabaceae, as a model plant system for isolating genes functioning in abiotic stress tolerance. Here we report the isolation and characterization of a Rab family GTPase from P. juliflora (Pj Rab7) and the ability of this gene to confer salt stress tolerance in transgenic tobacco. Northern analysis for Pj Rab7 in P. juliflora leaf tissue revealed up-regulation of this gene under salt stress under the concentrations and time points analyzed. Pj Rab7 transgenic tobacco lines survived better under conditions of 150 mM NaCl stress compared to control un-transformed plants. Pj Rab7 transgenic plants were found to accumulate more sodium than control plants during salt stress. The results of our studies could be used as a starting point for generation of crop plants tolerant to abiotic stress.

  13. in transgenic cucumber

    African Journals Online (AJOL)

    Jane

    2011-07-18

    Jul 18, 2011 ... College of Horticulture, South China Agriculture University, Guangzhou 510642, Guangdong ... The pattern of expression vector pBI-PacPAP. ..... Disease scale ... These transgenic T0 plants were self-pollinated and the.

  14. Cultured cells of the blood-brain barrier from apolipoprotein B-100 transgenic mice: effects of oxidized low-density lipoprotein treatment.

    Science.gov (United States)

    Lénárt, Nikolett; Walter, Fruzsina R; Bocsik, Alexandra; Sántha, Petra; Tóth, Melinda E; Harazin, András; Tóth, Andrea E; Vizler, Csaba; Török, Zsolt; Pilbat, Ana-Maria; Vígh, László; Puskás, László G; Sántha, Miklós; Deli, Mária A

    2015-07-17

    The apolipoprotein B-100 (ApoB-100) transgenic mouse line is a model of human atherosclerosis. Latest findings suggest the importance of ApoB-100 in the development of neurodegenerative diseases and microvascular/perivascular localization of ApoB-100 protein was demonstrated in the cerebral cortex of ApoB-100 transgenic mice. The aim of the study was to characterize cultured brain endothelial cells, pericytes and glial cells from wild-type and ApoB-100 transgenic mice and to study the effect of oxidized low-density lipoprotein (oxLDL) on these cells. Morphology of cells isolated from brains of wild type and ApoB-100 transgenic mice was characterized by immunohistochemistry and the intensity of immunolabeling was quantified by image analysis. Toxicity of oxLDL treatment was monitored by real-time impedance measurement and lactate dehydrogenase release. Reactive oxygen species and nitric oxide production, barrier permeability in triple co-culture blood-brain barrier model and membrane fluidity were also determined after low-density lipoprotein (LDL) or oxLDL treatment. The presence of ApoB-100 was confirmed in brain endothelial cells, while no morphological change was observed between wild type and transgenic cells. Oxidized but not native LDL exerted dose-dependent toxicity in all three cell types, induced barrier dysfunction and increased reactive oxygen species (ROS) production in both genotypes. A partial protection from oxLDL toxicity was seen in brain endothelial and glial cells from ApoB-100 transgenic mice. Increased membrane rigidity was measured in brain endothelial cells from ApoB-100 transgenic mice and in LDL or oxLDL treated wild type cells. The morphological and functional properties of cultured brain endothelial cells, pericytes and glial cells from ApoB-100 transgenic mice were characterized and compared to wild type cells for the first time. The membrane fluidity changes in ApoB-100 transgenic cells related to brain microvasculature indicate

  15. Myeloblastic leukemia cells conditionally blocked by myc-estrogen receptor chimeric transgenes for terminal differentiation coupled to growth arrest and apoptosis.

    Science.gov (United States)

    Selvakumaran, M; Liebermann, D; Hoffman-Liebermann, B

    1993-05-01

    Conditional mutants of the myeloblastic leukemic M1 cell line, expressing the chimeric mycer transgene, have been established. It is shown that M1 mycer cells, like M1, undergo terminal differentiation coupled to growth arrest and programmed cell death (apoptosis) after treatment with the physiologic differentiation inducer interleukin-6. However, when beta-estradiol is included in the culture medium, M1 mycer cells respond to differentiation inducers like M1 myc cell lines, where the differentiation program is blocked at an intermediate stage. By manipulating the function of the mycer transgene product, it is shown that there is a 10-hour window during myeloid differentiation, from 30 to 40 hours after the addition of the differentiation inducer, when the terminal differentiation program switches from being dependent on c-myc suppression to becoming c-myc suppression independent, where activation of c-myc has no apparent effect on mature macrophages. M1 mycer cell lines provide a powerful tool to increase our understanding of the role of c-myc in normal myelopoiesis and in leukemogenesis, also providing a strategy to clone c-myc target genes.

  16. The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

    Science.gov (United States)

    Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

    2015-10-01

    The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  17. Csf1r-mApple Transgene Expression and Ligand Binding In Vivo Reveal Dynamics of CSF1R Expression within the Mononuclear Phagocyte System.

    Science.gov (United States)

    Hawley, Catherine A; Rojo, Rocio; Raper, Anna; Sauter, Kristin A; Lisowski, Zofia M; Grabert, Kathleen; Bain, Calum C; Davis, Gemma M; Louwe, Pieter A; Ostrowski, Michael C; Hume, David A; Pridans, Clare; Jenkins, Stephen J

    2018-03-15

    CSF1 is the primary growth factor controlling macrophage numbers, but whether expression of the CSF1 receptor differs between discrete populations of mononuclear phagocytes remains unclear. We have generated a Csf1r -mApple transgenic fluorescent reporter mouse that, in combination with lineage tracing, Alexa Fluor 647-labeled CSF1-Fc and CSF1, and a modified Δ Csf1- enhanced cyan fluorescent protein (ECFP) transgene that lacks a 150 bp segment of the distal promoter, we have used to dissect the differentiation and CSF1 responsiveness of mononuclear phagocyte populations in situ. Consistent with previous Csf1r- driven reporter lines, Csf1r -mApple was expressed in blood monocytes and at higher levels in tissue macrophages, and was readily detectable in whole mounts or with multiphoton microscopy. In the liver and peritoneal cavity, uptake of labeled CSF1 largely reflected transgene expression, with greater receptor activity in mature macrophages than monocytes and tissue-specific expression in conventional dendritic cells. However, CSF1 uptake also differed between subsets of monocytes and discrete populations of tissue macrophages, which in macrophages correlated with their level of dependence on CSF1 receptor signaling for survival rather than degree of transgene expression. A double Δ Csf1r -ECFP- Csf1r -mApple transgenic mouse distinguished subpopulations of microglia in the brain, and permitted imaging of interstitial macrophages distinct from alveolar macrophages, and pulmonary monocytes and conventional dendritic cells. The Csf1r- mApple mice and fluorescently labeled CSF1 will be valuable resources for the study of macrophage and CSF1 biology, which are compatible with existing EGFP-based reporter lines. Copyright © 2018 The Authors.

  18. The ecological risks of transgenic plants.

    Science.gov (United States)

    Giovannetti, Manuela

    2003-01-01

    Biotechnologies have been utilized "ante litteram" for thousands of years to produce food and drink and genetic engineering techniques have been widely applied to produce many compounds for human use, from insulin to other medicines. The debate on genetically modified (GM) organisms broke out all over the world only when GM crops were released into the field. Plant ecologists, microbiologists and population geneticists carried out experiments aimed at evaluating the environmental impact of GM crops. The most significant findings concern: the spread of transgenes through GM pollen diffusion and its environmental impact after hybridisation with closely related wild species or subspecies; horizontal gene transfer from transgenic plants to soil microbes; the impact of insecticide proteins released into the soil by transformed plants on non-target microbial soil communities. Recent developments in genetic engineering produced a technology, dubbed "Terminator", which protects patented genes introduced in transgenic plants by killing the seeds in the second generation. This genetic construct, which interferes so heavily with fundamental life processes, is considered dangerous and should be ex-ante evaluated taking into account the data on "unexpected events", as here discussed, instead of relying on the "safe until proven otherwise" claim. Awareness that scientists, biotechnologists and genetic engineers cannot answer the fundamental question "how likely is that transgenes will be transferred from cultivated plants into the natural environment?" should foster long-term studies on the ecological risks and benefits of transgenic crops.

  19. Advancing environmental risk assessment for transgenic biofeedstock crops

    Directory of Open Access Journals (Sweden)

    Wolt Jeffrey D

    2009-11-01

    Full Text Available Abstract Transgenic modification of plants is a key enabling technology for developing sustainable biofeedstocks for biofuels production. Regulatory decisions and the wider acceptance and development of transgenic biofeedstock crops are considered from the context of science-based risk assessment. The risk assessment paradigm for transgenic biofeedstock crops is fundamentally no different from that of current generation transgenic crops, except that the focus of the assessment must consider the unique attributes of a given biofeedstock crop and its environmental release. For currently envisioned biofeedstock crops, particular emphasis in risk assessment will be given to characterization of altered metabolic profiles and their implications relative to non-target environmental effects and food safety; weediness and invasiveness when plants are modified for abiotic stress tolerance or are domesticated; and aggregate risk when plants are platforms for multi-product production. Robust risk assessments for transgenic biofeedstock crops are case-specific, initiated through problem formulation, and use tiered approaches for risk characterization.

  20. Aberrant phenotypes of transgenic mice expressing dimeric human erythropoietin

    Directory of Open Access Journals (Sweden)

    Yun Seong-Jo

    2012-01-01

    Full Text Available Abstract Background Dimeric human erythropoietin (dHuEPO peptides are reported to exhibit significantly higher biological activity than the monomeric form of recombinant EPO. The objective of this study was to produce transgenic (tg mice expressing dHuEPO and to investigate the characteristics of these mice. Methods A dHuEPO-expressing vector under the control of the goat beta-casein promoter, which produced a dimer of human EPO molecules linked by a 2-amino acid peptide linker (Asp-Ile, was constructed and injected into 1-cell fertilized embryos by microinjection. Mice were screened using genomic DNA samples obtained from tail biopsies. Blood samples were obtained by heart puncture using heparinized tubes, and hematologic parameters were assessed. Using the microarray analysis tool, we analyzed differences in gene expression in the spleens of tg and control mice. Results A high rate of spontaneous abortion or death of the offspring was observed in the recipients of dHuEPO embryos. We obtained 3 founder lines (#4, #11, and #47 of tg mice expressing the dHuEPO gene. However, only one founder line showed stable germline integration and transmission, subsequently establishing the only transgenic line (#11. We obtained 2 F1 mice and 3 F2 mice from line #11. The dHuEPO protein could not be obtained because of repeated spontaneous abortions in the tg mice. Tg mice exhibited symptoms such as short lifespan and abnormal blood composition. The red blood cell count, white blood cell count, and hematocrit levels in the tg mice were remarkably higher than those in the control mice. The spleens of the tg mice (F1 and F2 females were 11- and -21-fold larger than those of the control mice. Microarray analysis revealed 2,672 spleen-derived candidate genes; more genes were downregulated than upregulated (849/764. Reverse transcriptase-polymerase chain reaction (RT-PCR and quantitative real-time PCR (qRT-PCR were used for validating the results of the microarray

  1. Transgenic expression of the rice Xa21 pattern-recognition receptor in banana (Musa sp.) confers resistance to Xanthomonas campestris pv. musacearum.

    Science.gov (United States)

    Tripathi, Jaindra N; Lorenzen, Jim; Bahar, Ofir; Ronald, Pamela; Tripathi, Leena

    2014-08-01

    Banana Xanthomonas wilt (BXW), caused by the bacterium Xanthomonas campestris pv. musacearum (Xcm), is the most devastating disease of banana in east and central Africa. The spread of BXW threatens the livelihood of millions of African farmers who depend on banana for food security and income. There are no commercial chemicals, biocontrol agents or resistant cultivars available to control BXW. Here, we take advantage of the robust resistance conferred by the rice pattern-recognition receptor (PRR), XA21, to the rice pathogen Xanthomonas oryzae pv. oryzae (Xoo). We identified a set of genes required for activation of Xa21-mediated immunity (rax) that were conserved in both Xoo and Xcm. Based on the conservation, we hypothesized that intergeneric transfer of Xa21 would confer resistance to Xcm. We evaluated 25 transgenic lines of the banana cultivar 'Gonja manjaya' (AAB) using a rapid bioassay and 12 transgenic lines in the glasshouse for resistance against Xcm. About 50% of the transgenic lines showed complete resistance to Xcm in both assays. In contrast, all of the nontransgenic control plants showed severe symptoms that progressed to complete wilting. These results indicate that the constitutive expression of the rice Xa21 gene in banana results in enhanced resistance against Xcm. Furthermore, this work demonstrates the feasibility of PRR gene transfer between monocotyledonous species and provides a valuable new tool for controlling the BXW pandemic of banana, a staple food for 100 million people in east Africa. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  2. Overexpression of cotton RAV1 gene in Arabidopsis confers transgenic plants high salinity and drought sensitivity.

    Science.gov (United States)

    Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao

    2015-01-01

    RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.

  3. Preliminarily study on the maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on gastropods

    Science.gov (United States)

    Zhu, Tingbing; Zhang, Lihong; Zhang, Tanglin; Wang, Yaping; Hu, Wei; Olsen, Rolf Eric; Zhu, Zuoyan

    2017-10-01

    The present study preliminarily examined the differences in maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on four gastropods species (Bellamya aeruginosa, Radix auricularia, Parafossarulus sinensis and Alocinma longicornis) under laboratory conditions. In the maximum handling size trial, five fish from each age group (1-year-old and 2-year-old) and each genotype (transgenic and non-transgenic) of common carp were individually allowed to feed on B. aeruginosa with wide shell height range. The results showed that maximum handling size increased linearly with fish length, and there was no significant difference in maximum handling size between the two genotypes. In the size selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on three size groups of B. aeruginosa. The results show that the two genotypes of C. carpio favored the small-sized group over the large-sized group. In the species selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on thin-shelled B. aeruginosa and thick-shelled R. auricularia, and five pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on two gastropods species (P. sinensis and A. longicornis) with similar size and shell strength. The results showed that both genotypes preferred thin-shelled Radix auricularia rather than thick-shelled B. aeruginosa, but there were no significant difference in selectivity between the two genotypes when fed on P. sinensis and A. longicornis. The present study indicates that transgenic and non-transgenic C. carpio show similar selectivity of predation on the size- and species-limited gastropods. While this information may be useful for assessing the environmental risk of transgenic carp, it does not necessarily demonstrate that transgenic common carp might

  4. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  5. Differential gene expression in ADAM10 and mutant ADAM10 transgenic mice

    Directory of Open Access Journals (Sweden)

    Postina Rolf

    2009-02-01

    Full Text Available Abstract Background In a transgenic mouse model of Alzheimer disease (AD, cleavage of the amyloid precursor protein (APP by the α-secretase ADAM10 prevented amyloid plaque formation, and alleviated cognitive deficits. Furthermore, ADAM10 overexpression increased the cortical synaptogenesis. These results suggest that upregulation of ADAM10 in the brain has beneficial effects on AD pathology. Results To assess the influence of ADAM10 on the gene expression profile in the brain, we performed a microarray analysis using RNA isolated from brains of five months old mice overexpressing either the α-secretase ADAM10, or a dominant-negative mutant (dn of this enzyme. As compared to non-transgenic wild-type mice, in ADAM10 transgenic mice 355 genes, and in dnADAM10 mice 143 genes were found to be differentially expressed. A higher number of genes was differentially regulated in double-transgenic mouse strains additionally expressing the human APP[V717I] mutant. Overexpression of proteolytically active ADAM10 affected several physiological pathways, such as cell communication, nervous system development, neuron projection as well as synaptic transmission. Although ADAM10 has been implicated in Notch and β-catenin signaling, no significant changes in the respective target genes were observed in adult ADAM10 transgenic mice. Real-time RT-PCR confirmed a downregulation of genes coding for the inflammation-associated proteins S100a8 and S100a9 induced by moderate ADAM10 overexpression. Overexpression of the dominant-negative form dnADAM10 led to a significant increase in the expression of the fatty acid-binding protein Fabp7, which also has been found in higher amounts in brains of Down syndrome patients. Conclusion In general, there was only a moderate alteration of gene expression in ADAM10 overexpressing mice. Genes coding for pro-inflammatory or pro-apoptotic proteins were not over-represented among differentially regulated genes. Even a decrease of

  6. A Nestin-cre transgenic mouse is insufficient for recombination in early embryonic neural progenitors

    Directory of Open Access Journals (Sweden)

    Huixuan Liang

    2012-09-01

    Nestin-cre transgenic mice have been widely used to direct recombination to neural stem cells (NSCs and intermediate neural progenitor cells (NPCs. Here we report that a readily utilized, and the only commercially available, Nestin-cre line is insufficient for directing recombination in early embryonic NSCs and NPCs. Analysis of recombination efficiency in multiple cre-dependent reporters and a genetic mosaic line revealed consistent temporal and spatial patterns of recombination in NSCs and NPCs. For comparison we utilized a knock-in Emx1cre line and found robust recombination in NSCs and NPCs in ventricular and subventricular zones of the cerebral cortices as early as embryonic day 12.5. In addition we found that the rate of Nestin-cre driven recombination only reaches sufficiently high levels in NSCs and NPCs during late embryonic and early postnatal periods. These findings are important when commercially available cre lines are considered for directing recombination to embryonic NSCs and NPCs.

  7. TRANSGENIC STRATEGY FOR IDENTIFYING SYNAPTIC CONNECTIONS IN MICE BY FLUORESCENCE COMPLEMENTATION (GRASP

    Directory of Open Access Journals (Sweden)

    Masahito eYamagata

    2012-02-01

    Full Text Available In the "GFP reconstitution across synaptic partners" (GRASP method, non-fluorescent fragments of GFP are expressed in two different neurons; the fragments self-assemble at synapses between the two to form a fluorophore. GRASP has proven useful for light microscopic identification of synapses in two invertebrate species, Caenorhabditis elegans and Drosophila melanogaster, but has not yet been applied to vertebrates. Here, we describe GRASP constructs that function in mammalian cells and implement a transgenic strategy in which a Cre-dependent gene switch leads to expression of the two fragments in mutually exclusive neuronal subsets in mice. Using a transgenic line that expresses Cre selectively in rod photoreceptors, we demonstrate labeling of synapses in the outer plexiform layer of the retina. Labeling is specific, in that synapses made by rods remain labeled for at least 6 months whereas nearby synapses made by intercalated cone photoreceptors on many of the same interneurons remain unlabeled. We also generated antisera that label reconstituted GFP but neither fragment in order to amplify the GRASP signal and thereby increase the sensitivity of the method.

  8. Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots

    DEFF Research Database (Denmark)

    Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke

    2014-01-01

    induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots...

  9. Optimization of codon composition and regulatory elements for expression of human insulin like growth factor-1 in transgenic chloroplasts and evaluation of structural identity and function

    Directory of Open Access Journals (Sweden)

    Sandberg Laurence

    2009-04-01

    Full Text Available Abstract Background Transgenic chloroplasts are potential bioreactors for recombinant protein production, especially for achievement of high levels of protein expression and proper folding. Production of therapeutic proteins in leaves provides transgene containment by elimination of reproductive structures. Therefore, in this study, human Insulin like Growth Factor-1 is expressed in transgenic chloroplasts for evaluation of structural identity and function. Results Expression of the synthetic Insulin like Growth Factor 1 gene (IGF-1s, 60% AT was observed in transformed E. coli. However, no native IGF-1 gene (IGF-1n, 41% AT product was detected in the western blots in E. coli. Site-specific integration of the transgenes into the tobacco chloroplast genome was confirmed after transformation using PCR. Southern blot analysis confirmed that the transgenic lines were homoplasmic. The transgenic plant lines had IGF-1s expression levels of 11.3% of total soluble protein (TSP. The IGF-1n plants contained 9.5% TSP as IGF-1n, suggesting that the chloroplast translation machinery is more flexible than E. coli in codon preference and usage. The expression of IGF-1 was increased up to 32% TSP under continuous illumination by the chloroplast light regulatory elements. IgG-Sepharose affinity column chromatographic separation of Z domain containing chloroplast derived IGF-1 protein, single and two dimensional electrophoresis methods and mass spectrometer analysis confirmed the identity of human IGF-1 in transgenic chloroplasts. Two spots analyzed from 2-D focusing/phoresis acrylamide gel showed the correct amino acid sequence of human IGF-1 and the S. aureus Z-tag. Cell proliferation assays in human HU-3 cells demonstrated the biological activity of chloroplast derived IGF-1 even in the presence of the S. aureus Z tag. Conclusion This study demonstrates that the human Insulin like Growth Factor-1 expressed in transgenic chloroplasts is identical to the native

  10. Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision.

    Directory of Open Access Journals (Sweden)

    Hee-Jong Woo

    Full Text Available Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice.

  11. Enlightening the malaria parasite life cycle: bioluminescent Plasmodium in fundamental and applied research

    OpenAIRE

    Siciliano, Giulia; Alano, Pietro

    2015-01-01

    The unicellular protozoan parasites of the genus Plasmodium impose on human health worldwide the enormous burden of malaria. The possibility to genetically modify several species of malaria parasites represented a major advance in the possibility to elucidate their biology and is now turning laboratory lines of transgenic Plasmodium into precious weapons to fight malaria. Amongst the various genetically modified plasmodia, transgenic parasite lines expressing bioluminescent reporters have bee...

  12. Reproductive fitness of outcrossed hybrids between transgenic broccoli (brassica oleracea) carrying the ipt transgene and conventional varieties of kale, broccoli and cauliflower

    International Nuclear Information System (INIS)

    Ting, P.; Tu, Y.; Lin, C.; Chang, H.; Chen, L.; Litfu, A

    2014-01-01

    Pollens are potential carriers for genetically modified crops to transfer genetic materials horizontally to other plants. For phanerogams, pollen viability and cross-compatibility are critical factors for successful outcross hybridization. To evaluate this possibility, this project investigated pollen viability and pod setting rate by comparing broccoli (Brassica oleracea L. var. italica Planck) and broccoli transformed with the isopentenyl transferase (ipt) gene. Both served as pollen donors and four other varieties as pollen receptors to determine outcross rates. For pollen viability, F1 progeny was higher (p?0.05) for the cross of transgenic ipt broccoli with Li Syue significantly by FDA (fluorescein diacetate) assay. Higher successful hybrids were observed for transgenic ipt broccoli with Fu Yue, Li Syue and Green King. As pollen properties, number and grain diameter were significantly larger (p?0.05) in hybrid combinations of transgenic ipt broccoli with Li Syue and Green King significantly (p?0.05). The pod setting rates were higher while transgenic ipt broccoli served as donor plant. These results analyzing pollen properties between transgenic crops with possible outcross candidates would serve as one of those critical strategies for evaluating environmental biosafety issues for transgenic crops. (author)

  13. Stable expression and phenotypic impact of attacin E transgene in orchard grown apple trees over a 12 year period.

    Science.gov (United States)

    Borejsza-Wysocka, Ewa; Norelli, John L; Aldwinckle, Herb S; Malnoy, Mickael

    2010-06-03

    Transgenic trees currently are being produced by Agrobacterium-mediated transformation and biolistics. The future use of transformed trees on a commercial basis depends upon thorough evaluation of the potential environmental and public health risk of the modified plants, transgene stability over a prolonged period of time and the effect of the gene on tree and fruit characteristics. We studied the stability of expression and the effect on resistance to the fire blight disease of the lytic protein gene, attacin E, in the apple cultivar 'Galaxy' grown in the field for 12 years. Using Southern and western blot analysis, we compared transgene copy number and observed stability of expression of this gene in the leaves and fruit in several transformed lines during a 12 year period. No silenced transgenic plant was detected. Also the expression of this gene resulted in an increase in resistance to fire blight throughout 12 years of orchard trial and did not affect fruit shape, size, acidity, firmness, weight or sugar level, tree morphology, leaf shape or flower morphology or color compared to the control. Overall, these results suggest that transgene expression in perennial species, such as fruit trees, remains stable in time and space, over extended periods and in different organs. This report shows that it is possible to improve a desirable trait in apple, such as the resistance to a pathogen, through genetic engineering, without adverse alteration of fruit characteristics and tree shape.

  14. High level expression of Acidothermus cellulolyticus β-1, 4-endoglucanase in transgenic rice enhances the hydrolysis of its straw by cultured cow gastric fluid

    Directory of Open Access Journals (Sweden)

    Chou Hong

    2011-12-01

    Full Text Available Abstract Background Large-scale production of effective cellulose hydrolytic enzymes is the key to the bioconversion of agricultural residues to ethanol. The goal of this study was to develop a rice plant as a bioreactor for the large-scale production of cellulose hydrolytic enzymes via genetic transformation, and to simultaneously improve rice straw as an efficient biomass feedstock for conversion of cellulose to glucose. Results In this study, the cellulose hydrolytic enzyme β-1, 4-endoglucanase (E1 gene, from the thermophilic bacterium Acidothermus cellulolyticus, was overexpressed in rice through Agrobacterium-mediated transformation. The expression of the bacterial E1 gene in rice was driven by the constitutive Mac promoter, a hybrid promoter of Ti plasmid mannopine synthetase promoter and cauliflower mosaic virus 35S promoter enhancer, with the signal peptide of tobacco pathogenesis-related protein for targeting the E1 protein to the apoplastic compartment for storage. A total of 52 transgenic rice plants from six independent lines expressing the bacterial E1 enzyme were obtained that expressed the gene at high levels without severely impairing plant growth and development. However, some transgenic plants exhibited a shorter stature and flowered earlier than the wild type plants. The E1 specific activities in the leaves of the highest expressing transgenic rice lines were about 20-fold higher than those of various transgenic plants obtained in previous studies and the protein amounts accounted for up to 6.1% of the total leaf soluble protein. A zymogram and temperature-dependent activity analyses demonstrated the thermostability of the E1 enzyme and its substrate specificity against cellulose, and a simple heat treatment can be used to purify the protein. In addition, hydrolysis of transgenic rice straw with cultured cow gastric fluid for one hour at 39°C and another hour at 81°C yielded 43% more reducing sugars than wild type rice

  15. High level expression of Acidothermus cellulolyticus β-1, 4-endoglucanase in transgenic rice enhances the hydrolysis of its straw by cultured cow gastric fluid

    Energy Technology Data Exchange (ETDEWEB)

    Chou, Hong L.; Dai, Ziyu; Hsieh, Chia W.; Ku, Maurice S.

    2011-12-10

    Large-scale production of effective cellulose hydrolytic enzymes is the key to the bioconversion of agricultural residues to ethanol. The goal of this study was to develop a rice plant as a bioreactor for the large-scale production of cellulose hydrolytic enzymes via genetic transformation, and to simultaneously improve rice straw as an efficient biomass feedstock for conversion of cellulose to glucose. In this study, the cellulose hydrolytic enzyme {beta}-1, 4-endoglucanase (E1) from the thermophilic bacterium Acidothermus cellulolyticus was overexpressed in rice through Agrobacterium-mediated transformation. The expression of the bacterial gene in rice was driven by the constitutive Mac promoter, a hybrid promoter of Ti plasmid mannopine synthetase promoter and cauliflower mosaic virus 35S promoter enhancer with the signal peptide of tobacco pathogenesis-related protein for targeting the protein to the apoplastic compartment for storage. A total of 52 transgenic rice plants from six independent lines expressing the bacterial enzyme were obtained, which expressed the gene at high levels with a normal phenotype. The specific activities of E1 in the leaves of the highest expressing transgenic rice lines were about 20 fold higher than those of various transgenic plants obtained in previous studies and the protein amounts accounted for up to 6.1% of the total leaf soluble protein. Zymogram and temperature-dependent activity analyses demonstrated the thermostability of the enzyme and its substrate specificity against cellulose, and a simple heat treatment can be used to purify the protein. In addition, hydrolysis of transgenic rice straw with cultured cow gastric fluid yielded almost twice more reducing sugars than wild type straw. Taken together, these data suggest that transgenic rice can effectively serve as a bioreactor for large-scale production of active, thermostable cellulose hydrolytic enzymes. As a feedstock, direct expression of large amount of cellulases in

  16. A soluble form of Siglec-9 provides an antitumor benefit against mammary tumor cells expressing MUC1 in transgenic mice

    International Nuclear Information System (INIS)

    Tomioka, Yukiko; Morimatsu, Masami; Nishijima, Ken-ichi; Usui, Tatsufumi; Yamamoto, Sayo; Suyama, Haruka; Ozaki, Kinuyo; Ito, Toshihiro

    2014-01-01

    Highlights: • Tumor-associated antigen MUC1 binds to Siglec-9. • Soluble Siglec-9 reduced proliferation of MUC1-positive tumor in transgenic mice. • Soluble Siglec-9 and MUC1 on tumor cells were colocalized in transgenic mice. • MUC1 expression on tumor cells were reduced in soluble Siglec-9 transgenic mice. - Abstract: Tumor-associated MUC1 binds to Siglec-9, which is expected to mediate tumor cell growth and negative immunomodulation. We hypothesized that a soluble form of Siglec-9 (sSiglec-9) competitively inhibits a binding of MUC1 to its receptor molecules like human Siglec-9, leading to provide antitumor benefit against MUC1-expressing tumor, and generated transgenic mouse lines expressing sSiglec-9 (sSiglec-9 Tg). When mammary tumor cells expressing MUC1 were intraperitoneally transplanted into sSiglec-9 Tg, tumor proliferation was slower with the lower histological malignancy as compared with non-transgenic mice. The sSiglec-9 was detected in the ascites caused by the tumor in the sSiglec-9 Tg, and sSiglec-9 and MUC1 were often colocalized on surfaces of the tumor cells. PCNA immunohistochemistry also revealed the reduced proliferation of the tumor cells in sSiglec-9 Tg. In sSiglec-9 Tg with remarkable suppression of tumor proliferation, MUC1 expressions were tend to be reduced. In the ascites of sSiglec-9 Tg bearing the tumor, T cells were uniformly infiltrated, whereas aggregations of degenerative T cells were often observed in the non-transgenic mice. These results suggest that sSiglec-9 has an antitumor benefit against MUC1-expressing tumor in the transgenic mice, which may avoid the negative immunomodulation and/or suppress tumor-associated MUC1 downstream signal transduction, and subsequent tumor proliferation

  17. A soluble form of Siglec-9 provides an antitumor benefit against mammary tumor cells expressing MUC1 in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Tomioka, Yukiko, E-mail: ytomi@muses.tottori-u.ac.jp [Division of Disease Model Innovation, Institute for Genetic Medicine, Hokkaido University, Sapporo 060-0815 (Japan); Avian Zoonosis Research Center, Faculty of Agriculture, Tottori University, Tottori 680-8553 (Japan); Morimatsu, Masami, E-mail: mmorimat@vetmed.hokudai.ac.jp [Division of Disease Model Innovation, Institute for Genetic Medicine, Hokkaido University, Sapporo 060-0815 (Japan); Laboratory of Laboratory Animal Science and Medicine, Department of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-0818 (Japan); Nishijima, Ken-ichi, E-mail: nishijma@nubio.nagoya-u.ac.jp [Department of Biotechnology, Graduate School of Engineering, Nagoya University, Nagoya 464-8603 (Japan); Usui, Tatsufumi, E-mail: usutatsu@muses.tottori-u.ac.jp [Avian Zoonosis Research Center, Faculty of Agriculture, Tottori University, Tottori 680-8553 (Japan); Yamamoto, Sayo, E-mail: ysayo@anim.med.kyushu-u.ac.jp [Center of Biomedical Research, Research Center for Human Disease Modeling, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582 (Japan); Suyama, Haruka, E-mail: sharuka@anim.med.kyushu-u.ac.jp [Center of Biomedical Research, Research Center for Human Disease Modeling, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582 (Japan); Ozaki, Kinuyo, E-mail: k-ozaki@anim.med.kyushu-u.ac.jp [Center of Biomedical Research, Research Center for Human Disease Modeling, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582 (Japan); Ito, Toshihiro, E-mail: toshiito@muses.tottori-u.ac.jp [Avian Zoonosis Research Center, Faculty of Agriculture, Tottori University, Tottori 680-8553 (Japan); and others

    2014-07-18

    Highlights: • Tumor-associated antigen MUC1 binds to Siglec-9. • Soluble Siglec-9 reduced proliferation of MUC1-positive tumor in transgenic mice. • Soluble Siglec-9 and MUC1 on tumor cells were colocalized in transgenic mice. • MUC1 expression on tumor cells were reduced in soluble Siglec-9 transgenic mice. - Abstract: Tumor-associated MUC1 binds to Siglec-9, which is expected to mediate tumor cell growth and negative immunomodulation. We hypothesized that a soluble form of Siglec-9 (sSiglec-9) competitively inhibits a binding of MUC1 to its receptor molecules like human Siglec-9, leading to provide antitumor benefit against MUC1-expressing tumor, and generated transgenic mouse lines expressing sSiglec-9 (sSiglec-9 Tg). When mammary tumor cells expressing MUC1 were intraperitoneally transplanted into sSiglec-9 Tg, tumor proliferation was slower with the lower histological malignancy as compared with non-transgenic mice. The sSiglec-9 was detected in the ascites caused by the tumor in the sSiglec-9 Tg, and sSiglec-9 and MUC1 were often colocalized on surfaces of the tumor cells. PCNA immunohistochemistry also revealed the reduced proliferation of the tumor cells in sSiglec-9 Tg. In sSiglec-9 Tg with remarkable suppression of tumor proliferation, MUC1 expressions were tend to be reduced. In the ascites of sSiglec-9 Tg bearing the tumor, T cells were uniformly infiltrated, whereas aggregations of degenerative T cells were often observed in the non-transgenic mice. These results suggest that sSiglec-9 has an antitumor benefit against MUC1-expressing tumor in the transgenic mice, which may avoid the negative immunomodulation and/or suppress tumor-associated MUC1 downstream signal transduction, and subsequent tumor proliferation.

  18. Simultaneous detection of transgenic DNA by surface plasmon resonance imaging with potential application to gene doping detection.

    Science.gov (United States)

    Scarano, Simona; Ermini, Maria Laura; Spiriti, Maria Michela; Mascini, Marco; Bogani, Patrizia; Minunni, Maria

    2011-08-15

    Surface plasmon resonance imaging (SPRi) was used as the transduction principle for the development of optical-based sensing for transgenes detection in human cell lines. The objective was to develop a multianalyte, label-free, and real-time approach for DNA sequences that are identified as markers of transgenosis events. The strategy exploits SPRi sensing to detect the transgenic event by targeting selected marker sequences, which are present on shuttle vector backbone used to carry out the transfection of human embryonic kidney (HEK) cell lines. Here, we identified DNA sequences belonging to the Cytomegalovirus promoter and the Enhanced Green Fluorescent Protein gene. System development is discussed in terms of probe efficiency and influence of secondary structures on biorecognition reaction on sensor; moreover, optimization of PCR samples pretreatment was carried out to allow hybridization on biosensor, together with an approach to increase SPRi signals by in situ mass enhancement. Real-time PCR was also employed as reference technique for marker sequences detection on human HEK cells. We can foresee that the developed system may have potential applications in the field of antidoping research focused on the so-called gene doping.

  19. Bt rice harbouring cry genes controlled by a constitutive or wound-inducible promoter: protection and transgene expression under Mediterranean field conditions.

    Science.gov (United States)

    Breitler, Jean Christophe; Vassal, Jean Michel; del Mar Catala, Maria; Meynard, Donaldo; Marfà, Victoria; Melé, Enric; Royer, Monique; Murillo, Isabel; San Segundo, Blanca; Guiderdoni, Emmanuel; Messeguer, Joaquima

    2004-09-01

    Seven homozygous transgenic lines of two European commercial cultivars of rice (Ariete (A) and Senia (S)), harbouring the cry1B or cry1Aa Bacillus thuringiensis (Bt) delta-endotoxin genes, were field evaluated for protection from striped stem borer (SSB) (Chilo suppressalis) damage during the 2001 and 2002 summer crop seasons in the Delta de l'Ebre region, Spain. The plant codon-optimized toxin gene was placed under the control of the promoter of either the constitutive ubi1 gene or the wound-inducible mpi gene from maize. Stable, high-level, insecticidal protein accumulation was observed throughout root, leaf and seed tissues of field-grown plants harbouring the cry1B (lines A64.1, A33.1, A3.4 and S98.9) or cry1Aa (lines S05.1 and A19.14) genes under the control of the ubi1 promoter. Conversely, no toxin was detected in unwounded vegetative tissues of the A9.1 line harbouring the cry1B gene controlled by the mpi promoter, indicating that natural environmental stresses did not trigger the activity of the wound-inducible promoter. However, the toxin accumulated at 0.2% total soluble proteins in A9.1 sheath tissue exhibiting brown lesions resulting from SSB damage. The agronomical traits and performance of the transgenic lines were generally comparable with parental controls, except in the two lines accumulating Cry1Aa, which exhibited a high frequency of plants non-true to type. Natural infestation was assisted with manual infestations of L2/L3 SSB larvae in border control plants surrounding the experimental plots, which served as a reservoir for the second-cycle SSB population. The observation of damage (brown lesions and dead hearts) during the crop season and dissection of plants at harvest stage revealed a range of protection amongst the transgenic lines, which was highly consistent with the level of toxin accumulation and with previous experience in greenhouse assays. Lines A3.4 and S05.1 were found to exhibit stable and full protection against SSB attacks

  20. Pharmacodynamic study of Bay41-4109 in HBV transgenic mouse model

    Directory of Open Access Journals (Sweden)

    Xiu-mei LI

    2011-09-01

    Full Text Available Objective To study the pharmacodynamics of Bay41-4109,a novel anti-HBV compound,in HBV transgenic mouse model.Methods specific pathogen frce(SPF level TgM(HBV D1.3mice were divided into 3 groups: Bay41-4109 group [30mg/(kg·d],lamivudine group [30mg/(kg·d] and vehicle group(0.5% sodium carboxymethycellulose,with 32 in each.Antiviral effect of Bay41-4109 was tested in HBV transgenic mice including the analysis of HBcAg changes in liver tissue by immunohistochemistry,and changes in HBV DNA in liver and serum by quantitative real time PCR analysis.Serum transaminase(ALT and AST and body weight were assayed to evaluate the safety of the compound.Results Oral Bay41-4109 significantly reduced the number of HBV core antigen(HBcAg positive cell nucleus,average area of HBcAg positive cell nucleus and the rate of OD compared with vehicle group after 50 days treatment(P 0.05.However,Bay41-4109 could not significantly reduce HBV-specific DNA in HBV transgenic mice,both in liver and plasma.No significant impact was found on ALT,AST and body weigh of Bay41-4109-treated mice.Conclusions Bay41-4109 can more effectively reduce cytoplasmic HBcAg in liver sections than lamivudine.It is suggested that Bay41-4109,a different mode of action from lamivudine,represents a promising anti-HBV drug candidate with good antiviral effect and safety.