Transgenic cassava lines carrying heterologous alternative oxidase ...
African Journals Online (AJOL)
Afuape
2013-07-03
Jul 3, 2013 ... production of flowers, apomixis (Nassar et al., 2000; ... In order to increase the stress tolerance capacity of ... stress-related procedure due to the activities of auxin ... the evaluation of the transgenic lines for rate of OES .... Some transgenic lines carrying the 35S-AOX fragment amplified using 35S303F1 and.
Transgenic cassava lines carrying heterologous alternative oxidase ...
African Journals Online (AJOL)
Afuape
2013-07-03
Jul 3, 2013 ... Organized embryogenic callus development: In our experiment, somatic embryos were developed from leaf lobes collected from transgenic cassava lines carrying the AtAOX1a gene. Immature leaf lobes measuring about 1 to 6 mm obtained from about six weeks old in vitro derived plants were used.
Establishment and characterization of CAG/EGFP transgenic rabbit line.
Takahashi, Ri-ichi; Kuramochi, Takashi; Aoyagi, Kazuki; Hashimoto, Shu; Miyoshi, Ichiro; Kasai, Noriyuki; Hakamata, Yoji; Kobayashi, Eiji; Ueda, Masatsugu
2007-02-01
Cell marking is a very important procedure for identifying donor cells after cell and/or organ transplantation in vivo. Transgenic animals expressing marker proteins such as enhanced green fluorescent protein (EGFP) in their tissues are a powerful tool for research in fields of tissue engineering and regenerative medicine. The purpose of this study was to establish transgenic rabbit lines that ubiquitously express EGFP under the control of the cytomegalovirus immediate early enhancer/beta-actin promoter (CAG) to provide a fluorescent transgenic animal as a bioresource. We microinjected the EGFP expression vector into 945 rabbit eggs and 4 independent transgenic candidate pups were obtained. Two of them died before sexual maturation and one was infertile. One transgenic male candidate founder rabbit was obtained and could be bred by artificial insemination. The rabbit transmitted the transgene in a Mendelian manner. Using fluorescence in situ hybridization analysis, we detected the transgene at 7q11 on chromosome 7 as a large centromeric region in two F1 offspring (one female and one male). Eventually, one transgenic line was established. Ubiquitous EGFP fluorescence was confirmed in all examined organs. There were no gender-related differences in fluorescence. The established CAG/EGFP transgenic rabbit will be an important bioresource and a useful tool for various studies in tissue engineering and regenerative medicine.
Development of putative transgenic lines of cassava variety H-226 ...
African Journals Online (AJOL)
CMD) caused by the Indian cassava mosaic virus (ICMV) and Sri Lankan cassava mosaic virus (SLCMV). An attempt was done to develop transgenic cassava lines resistant to SLCMV through RNAi vector targeting a conserved 440 bp of 5' end ...
Adaptability and stability of transgenic soybean lines and cultivars in ...
African Journals Online (AJOL)
Subsequently, genotypic adaptability and stability were evaluated by the methods of Eberhart and Russel (1966), Lin and Binns modified by Carneiro, Annicchiarico and Centroid. All methods presented partial coherence on classifying the best genotypes and allowed the identification of the transgenic lines L1 and L4, and ...
Case Study: Polycystic Livers in a Transgenic Mouse Line
Energy Technology Data Exchange (ETDEWEB)
Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.; Diekwisch, Thomas G. H.; Ito, Yoshihiro; Fortman, Jeffrey D.
2014-04-01
Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycystic livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.
Meyer, P; Heidmann, I
1994-05-25
We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.
Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. Downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In the present study we sought to further...
Simplified methodology for large scale isolation of homozygous transgenic lines of lettuce
Directory of Open Access Journals (Sweden)
Flavia S. Darqui
2018-01-01
Conclusions: This protocol allows a simplified scaling-up of the production of multiple homozygous transgenic progeny lines in the early generations avoiding expensive and time-consuming molecular assays.
DEFF Research Database (Denmark)
Horvath, H.; Jensen, L.G.; Wong, O.T.
2001-01-01
in homozygous transgenic T-3 plants, and these remained constant over a 3-year period. In micro-malting experiments, the heat-stable enzyme reached levels of up to 1.4 mug.mg(-1) protein and survived kiln drying at levels of 70-100%. In the field trials of 1997 and 1998 the transgenic lines had a reduced 1000...... lines yielded approximately 6 t.ha(-1) and Golden Promise 7.7 t.ha(-1). Cross-breeding was carried out to transfer the transgene into a more suitable genetic background. Crosses of the semi-dwarf ari-e mutant Golden Promise gave rise to the four morphological phenotypes nutans, high erect, erect...... transformants were observed in some F-4 lines homozygous for the morphological phenotypes and for the transgene. In the case of a homozygous nutans line, the transgenic plants had a higher 1000-grain weight than those lacking the transgene. Like mutants providing useful output traits, transgenic plants...
Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines
Directory of Open Access Journals (Sweden)
Allah BAKHSH
2012-11-01
Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.
Line 63-1: A New Virus-resistant Transgenic Papaya
Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.
2005-01-01
The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment
Baer, G Ia; Emets, A I; Blium, Ia B
2014-01-01
The current data is dedicated to the study of bioballistic and Agrobacterium-mediated transformation of finger millet with the constructs carrying the mutant alpha-tubulin gene (TUAm 1), isolated from R-biotype goosegrass (Eleusine indica L.), for the decision of problem of dinitroaniline-resistance. It was found that 10 microM of trifluralin is optimal for the selection of transgene plants of finger millet. PCR analysis of transformed lines confirmed the transgene nature of plants. The analysis of seed of T1 oftransgene lines confirmed heterozygous character of inheritance of the resistance.
Generation of doubled haploid transgenic wheat lines by microspore transformation.
Directory of Open Access Journals (Sweden)
Rhoda A T Brew-Appiah
Full Text Available Microspores can be induced to develop homozygous doubled haploid plants in a single generation. In the present experiments androgenic microspores of wheat have been genetically transformed and developed into mature homozygous transgenic plants. Two different transformation techniques were investigated, one employing electroporation and the other co-cultivation with Agrobacterium tumefaciens. Different tissue culture and transfection conditions were tested on nine different wheat cultivars using four different constructs. A total of 19 fertile transformants in five genotypes from four market classes of common wheat were recovered by the two procedures. PCR followed by DNA sequencing of the products, Southern blot analyses and bio/histo-chemical and histological assays of the recombinant enzymes confirmed the presence of the transgenes in the T0 transformants and their stable inheritance in homozygous T1∶2 doubled haploid progenies. Several decisive factors determining the transformation and regeneration efficiency with the two procedures were determined: (i pretreatment of immature spikes with CuSO4 solution (500 mg/L at 4°C for 10 days; (ii electroporation of plasmid DNA in enlarged microspores by a single pulse of ∼375 V; (iii induction of microspores after transfection at 28°C in NPB-99 medium and regeneration at 26°C in MMS5 medium; (iv co-cultivation with Agrobacterium AGL-1 cells for transfer of plasmid T-DNA into microspores at day 0 for <24 hours; and (v elimination of AGL-1 cells after co-cultivation with timentin (200-400 mg/L.
Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene
DEFF Research Database (Denmark)
Efrat, S; Linde, S; Kofod, Hans
1988-01-01
Three pancreatic beta-cell lines have been established from insulinomas derived from transgenic mice carrying a hybrid insulin-promoted simian virus 40 tumor antigen gene. The beta tumor cell (beta TC) lines maintain the features of differentiated beta cells for about 50 passages in culture. The ...... both to immortalize a rare cell type and to provide a selection for the maintenance of its differentiated phenotype....
Gebarowski, Tomasz; Gebczak, Katarzyna; Wiatrak, Benita; Kulma, Anna; Pelc, Katarzyna; Czuj, Tadeusz; Szopa, Jan; Gasiorowski, Kazimierz
2017-03-01
Emulsions made of oils from transgenic flaxseeds significantly decreased in vitro proliferation of six tested human cancer cell lines in 48-h cultures, as assessed with the standard sulforhodamine assay. However, the emulsions also increased proliferation rate of normal human dermal fibroblasts and, to a lower extend, of keratinocytes. Both inhibition of in vitro proliferation of human cancer cell lines and stimulation of proliferation of normal dermal fibroblasts and keratinocytes were especially strong with the emulsion type B and with emulsion type M. Oils from seeds of transgenic flax type B and M should be considered as valuable adjunct to standard cytostatic therapy of human cancers and also could be applied to improve the treatment of skin lesions in wound healing.
RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam
International Nuclear Information System (INIS)
Wang Tiegu; Huang Qunce; Feng Weisen
2007-01-01
Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning
RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam
Wang, Tiegu; Huang, Qunce; Feng, Weisen
2007-10-01
Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.
RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam
Energy Technology Data Exchange (ETDEWEB)
Tiegu, Wang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Qunce, Huang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Weisen, Feng [Luoyang Institute of Agricultural Science, Luoyang 471022 (China)
2007-10-15
Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.
Directory of Open Access Journals (Sweden)
Luhua Zhang
Full Text Available Currently, the purity of hybrid seed is a crucial limiting factor when developing hybrid japonica rice (Oryza sativa L.. To chemically control hybrid seed purity, we transferred an improved atrazine chlorohydrolase gene (atzA from Pseudomonas ADP into hybrid japonica parental lines (two maintainers, one restorer, and Nipponbare, by using Agrobacterium-mediated transformation. We subsequently selected several transgenic lines from each genotype by using PCR, RT-PCR, and germination analysis. In the presence of the investigated atrazine concentrations, particularly 150 µM atrazine, almost all of the transgenic lines produced significantly larger seedlings, with similar or higher germination percentages, than did the respective controls. Although the seedlings of transgenic lines were taller and gained more root biomass compared to the respective control plants, their growth was nevertheless inhibited by atrazine treatment compared to that without treatment. When grown in soil containing 2 mg/kg or 5 mg/kg atrazine, the transgenic lines were taller, and had higher total chlorophyll contents than did the respective controls; moreover, three of the strongest transgenic lines completely recovered after 45 days of growth. After treatment with 2 mg/kg or 5 mg/kg of atrazine, the atrazine residue remaining in the soil was 2.9-7.0% or 0.8-8.7% respectively, for transgenic lines, and 44.0-59.2% or 28.1-30.8%, respectively, for control plants. Spraying plants at the vegetative growth stage with 0.15% atrazine effectively killed control plants, but not transgenic lines. Our results indicate that transgenic atzA rice plants show tolerance to atrazine, and may be used as parental lines in future hybrid seed production.
International Nuclear Information System (INIS)
Nöckel, Jessica; Engel, Natasja K van den; Winter, Hauke; Hatz, Rudolf A; Zimmermann, Wolfgang; Kammerer, Robert
2006-01-01
Gastric carcinoma is one of the most frequent cancers worldwide. Patients with gastric cancer at an advanced disease stage have a poor prognosis, due to the limited efficacy of available therapies. Therefore, the development of new therapies, like immunotherapy for the treatment of gastric cancer is of utmost importance. Since the usability of existing preclinical models for the evaluation of immunotherapies for gastric adenocarcinomas is limited, the goal of the present study was to establish murine in vivo models which allow the stepwise improvement of immunotherapies for gastric cancer. Since no murine gastric adenocarcinoma cell lines are available we established four cell lines (424GC, mGC3, mGC5, mGC8) from spontaneously developing tumors of CEA424/SV40 T antigen (CEA424/Tag) mice and three cell lines derived from double-transgenic offsprings of CEA424/Tag mice mated with human carcinoembryonic antigen (CEA)-transgenic (CEA424/Tag-CEA) mice (mGC2 CEA , mGC4 CEA , mGC11 CEA ). CEA424/Tag is a transgenic C57BL/6 mouse strain harboring the Tag under the control of a -424/-8 bp CEA gene promoter which leads to the development of invasive adenocarcinoma in the glandular stomach. Tumor cell lines established from CEA424/Tag-CEA mice express the well defined tumor antigen CEA under the control of its natural regulatory elements. The epithelial origin of the tumor cells was proven by morphological criteria including the presence of mucin within the cells and the expression of the cell adhesion molecules EpCAM and CEACAM1. All cell lines consistently express the transgenes CEA and/or Tag and MHC class I molecules leading to their susceptibility to lysis by Tag-specific CTL in vitro. Despite the presentation of CTL-epitopes derived from the transgene products the tumor cell lines were tumorigenic when grafted into C57BL/6, CEA424/Tag or CEA424/Tag-CEA-transgenic hosts and no significant differences in tumor take and tumor growth were observed in the different hosts
Czubacka, Anna; Sacco, Ermanno; Olszak-Przybyś, Hanna; Doroszewska, Teresa
2017-05-01
Genetic transformation of plants allows us to obtain improved genotypes enriched with the desired traits. However, if transgenic lines were to be used in breeding programs the stability of inserted transgenes is essential. In the present study, we followed the inheritance of transgenes in hybrids originated from crossing two transgenic tobacco lines resistant to Potato virus Y (PVY): MN 944 LMV with the transgene containing Lettuce mosaic virus coat protein gene (LMV CP) and AC Gayed ROKY2 with PVY replicase gene (ROKY2). Progeny populations generated by successive self-pollination were analyzed with respect to the transgene segregation ratio and resistance to Potato virus Y in tests carried out under greenhouse conditions. The presence of the virus in inoculated plants was detected by DAS-ELISA method. The results demonstrated the Mendelian fashion of inheritance of transgenes which were segregated independently and stably. As a result, we obtained T 4 generation of hybrid with both transgenes stacked and which was highly resistant to PVY.
GENETIC TRANSFORMATION AND ANALYSIS OF WHEAT TRANSGENIC CELL LINES BY IRAP-PCR
Directory of Open Access Journals (Sweden)
Bavol A. V.
2013-12-01
Full Text Available The transgenic wheat cell lines were obtained via biolistic transformation of the callus cultures initiated from the 3-day-old sterile seedling shoot apexes. The pAHC25 vector construction used for 14- and 28-day-old callus cultures transformation carried the selective phosphinothricin-N-acetyltransferase (bar gene and reporter ?-glucuronidase gene. The cell line selection was carried out on the media with phosphinothricin by means of graduated cell selection. The transgenic status of the obtained forms was proved by PCR-analysis. The presence of new relatively high molecular (more than 1 000 bp amplicons were found out for three transformed lines by means of IRAP PCRanalysis with the primers coding for long termainal repeats sequences of SIRE 1 retrotransposon. This fact may prove transposition of this mobile genetic element. The new DNA fragments were detected for three of the seven analyzed lines but for the control callus. It is possible to assume at induction of SIRE 1 transposition bis probably caused by the genomic stress of foreign DNA inserting or associated with the transformation process (mechanical wounding, cultivation on selective media.
DEFF Research Database (Denmark)
Jakobsen, Jannik E; Li, Juan; Moldt, Brian
2011-01-01
We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon-based do......We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon...
Directory of Open Access Journals (Sweden)
Sachin Kajla
Full Text Available Sinapine is a major anti-nutritive compound that accumulates in the seeds of Brassica species. When ingested, sinapine imparts gritty flavuor in meat and milk of animals and fishy odor to eggs of brown egg layers, thereby compromising the potential use of the valuable protein rich seed meal. Sinapine content in Brassica juncea germplasm ranges from 6.7 to 15.1 mg/g of dry seed weight (DSW which is significantly higher than the prescribed permissible level of 3.0 mg/g of DSW. Due to limited natural genetic variability, conventional plant breeding approach for reducing the sinapine content has largely been unsuccessful. Hence, transgenic approach for gene silencing was adopted by targeting two genes-SGT and SCT, encoding enzymes UDP- glucose: sinapate glucosyltransferase and sinapoylglucose: choline sinapoyltransferase, respectively, involved in the final two steps of sinapine biosynthetic pathway. These two genes were isolated from B. juncea and eight silencing constructs were developed using three different RNA silencing approaches viz. antisense RNA, RNAi and artificial microRNA. Transgenics in B. juncea were developed following Agrobacterium-mediated transformation. From a total of 1232 independent T0 transgenic events obtained using eight silencing constructs, 25 homozygous lines showing single gene inheritance were identified in the T2 generation. Reduction of seed sinapine content in these lines ranged from 15.8% to 67.2%; the line with maximum reduction had sinapine content of 3.79 mg/g of DSW. The study also revealed that RNAi method was more efficient than the other two methods used in this study.
Transgenic Xenopus laevis Line for In Vivo Labeling of Nephrons within the Kidney
Directory of Open Access Journals (Sweden)
Mark E. Corkins
2018-04-01
Full Text Available Xenopus laevis embryos are an established model for studying kidney development. The nephron structure and genetic pathways that regulate nephrogenesis are conserved between Xenopus and humans, allowing for the study of human disease-causing genes. Xenopus embryos are also amenable to large-scale screening, but studies of kidney disease-related genes have been impeded because assessment of kidney development has largely been limited to examining fixed embryos. To overcome this problem, we have generated a transgenic line that labels the kidney. We characterize this cdh17:eGFP line, showing green fluorescent protein (GFP expression in the pronephric and mesonephric kidneys and colocalization with known kidney markers. We also demonstrate the feasibility of live imaging of embryonic kidney development and the use of cdh17:eGFP as a kidney marker for secretion assays. Additionally, we develop a new methodology to isolate and identify kidney cells for primary culture. We also use morpholino knockdown of essential kidney development genes to establish that GFP expression enables observation of phenotypes, previously only described in fixed embryos. Taken together, this transgenic line will enable primary kidney cell culture and live imaging of pronephric and mesonephric kidney development. It will also provide a simple means for high-throughput screening of putative human kidney disease-causing genes.
Transgenic mice produced by retroviral transduction of male germ-line stem cells
Nagano, Makoto; Brinster, Clayton J.; Orwig, Kyle E.; Ryu, Buom-Yong; Avarbock, Mary R.; Brinster, Ralph L.
2001-01-01
Male germ-line stem cells are the only cell type in postnatal mammals that have the capability to self-renew and to contribute genes to the next generation. Genetic modification of these cells would provide an opportunity to study the biology of their complex self-renewal and differentiation processes, as well as enable the generation of transgenic animals in a wide range of species. Although retroviral vectors have been used as an efficient method to introduce genes into a variety of cell ty...
A human beta cell line with drug inducible excision of immortalizing transgenes
Benazra, Marion; Lecomte, Marie-José; Colace, Claire; Müller, Andreas; Machado, Cécile; Pechberty, Severine; Bricout-Neveu, Emilie; Grenier-Godard, Maud; Solimena, Michele; Scharfmann, Raphaël; Czernichow, Paul; Ravassard, Philippe
2015-01-01
Objectives Access to immortalized human pancreatic beta cell lines that are phenotypically close to genuine adult beta cells, represent a major tool to better understand human beta cell physiology and develop new therapeutics for Diabetes. Here we derived a new conditionally immortalized human beta cell line, EndoC-βH3 in which immortalizing transgene can be efficiently removed by simple addition of tamoxifen. Methods We used lentiviral mediated gene transfer to stably integrate a tamoxifen inducible form of CRE (CRE-ERT2) into the recently developed conditionally immortalized EndoC βH2 line. The resulting EndoC-βH3 line was characterized before and after tamoxifen treatment for cell proliferation, insulin content and insulin secretion. Results We showed that EndoC-βH3 expressing CRE-ERT2 can be massively amplified in culture. We established an optimized tamoxifen treatment to efficiently excise the immortalizing transgenes resulting in proliferation arrest. In addition, insulin expression raised by 12 fold and insulin content increased by 23 fold reaching 2 μg of insulin per million cells. Such massive increase was accompanied by enhanced insulin secretion upon glucose stimulation. We further observed that tamoxifen treated cells maintained a stable function for 5 weeks in culture. Conclusions EndoC βH3 cell line represents a powerful tool that allows, using a simple and efficient procedure, the massive production of functional non-proliferative human beta cells. Such cells are close to genuine human beta cells and maintain a stable phenotype for 5 weeks in culture. PMID:26909308
Valachova, Bernadeta; Brezovakova, Veronika; Bugos, Ondrej; Jadhav, Santosh; Smolek, Tomas; Novak, Petr; Zilka, Norbert
2018-08-01
Human tauopathies represent a heterogeneous group of neurodegenerative disorders characterized by distinct clinical features, typical histopathological structures, and defined ratio(s) of three-repeat and four-repeat tau isoforms within pathological aggregates. How the optional microtubule-binding repeat of tau influences this differentiation of pathologies is understudied. We have previously generated and characterized transgenic rodent models expressing human truncated tau aa151-391 with either three (SHR24) or four microtubule-binding repeats (SHR72). Here, we compare the behavioral and neuropathological hallmarks of these two transgenic lines using a battery of tests for sensorimotor, cognitive, and neurological functions over the age range of 3.5-15 months. Progression of sensorimotor and neurological deficits was similar in both transgenic lines; however, the lifespan of transgenic line SHR72 expressing truncated four-repeat tau was markedly shorter than SHR24. Moreover, the expression of three or four-repeat tau induced distinct neurofibrillary pathology in these lines. Transgenic lines displayed different distribution of tau pathology and different type of neurofibrillary tangles. Our results suggest that three- and four-repeat isoforms of tau may display different modes of action in the diseased brain. © 2018 Wiley Periodicals, Inc.
Lipsky, Alexander; Joshi, Janak Raj; Carmi, Nir; Yedidia, Iris
2016-11-20
The genus Ornithogalum includes several ornamental species that suffer substantial losses from bacterial soft rot caused by Pectobacteria. The absence of effective control measures for use against soft rot bacteria led to the initiation of a project in which a small antimicrobial peptide from an Asian horseshoe crab, tachyplesin (tpnI), was introduced into two commercial cultivars: O. dubium and O. thyrsoides. Disease severity and bacterial colonization were examined in transgenic lines expressing this peptide. Disease resistance was evaluated in six lines of each species by measuring bacterial proliferation in the plant tissue. Three transgenic lines of each species were subjected to further analysis in which the expression level of the transgene was evaluated using RT-PCR and qRT-PCR. The development of disease symptoms and bacterial colonization of the plant tissue were also examined using GFP-expressing strain of P. carotovorum subsp. brasiliense Pcb3. Confocal-microscopy imaging revealed significantly reduced quantities of bacterial cells in the transgenic plant lines that had been challenged with the bacterium. The results clearly demonstrate that tpnI expression reduces bacterial proliferation, colonization and disease symptom (reduced by 95-100%) in the transgenic plant tissues. The quantity of tpnI transcripts, as measured by qRT-PCR, was negatively correlated with the protection afforded to the plants, as measured by the reduced severity of disease symptoms in the tissue. Copyright © 2016 Elsevier B.V. All rights reserved.
Transgenic Chinese hamster V79 cell lines which exhibit variable levels of gpt mutagenesis
International Nuclear Information System (INIS)
Klein, C.B.; Rossman, T.G.
1990-01-01
The Escherichia coli gpt gene coding for xanthine-guanine phosphoribosyl transferase has been stably transfected into HPRT - Chinese hamster V79 cells. Several gpt - cell lines have been established, which retain the sequence(s) even after long-term culture without selection for gpt. While spontaneous mutagenesis to gpt - occurs rather frequently for most cell lines, it cannot be correlated with either the number of plasmid integration sites or deletion of the plasmid sequence(s). One transgenic cell line (g12), which continuously maintains a low spontaneous mutation frequency was used in comparative mutagenesis studies with wild-type V79 cells (gpt vs. hprt). Alkylating agents such as N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) and β-propiolactone (BPL) are shown to be equally toxic and mutagenic in both g12 and V79 cells. UV and X-rays are also equally toxic to both cell lines. The data presented here suggests that g12 cells may be useful to study mammalian mutagenesis by agents which yield limited response at the hprt locus
Chen, Hao; Zhang, Guoan; Zhang, Qifa; Lin, Yongjun
2008-02-01
Ten transgenic Bacillus thuringiensis Bt rice, Oryza sativa L., lines with different Bt genes (two Cry1Ac lines, three Cry2A lines, and five Cry9C lines) derived from the same variety Minghui 63 were evaluated in both the laboratory and the field. Bioassays were conducted by using the first instars of two main rice lepidopteran insect species: yellow stem borer, Scirpophaga incertulas (Walker) and Asiatic rice borer, Chilo suppressalis (Walker). All transgenic lines exhibited high toxicity to these two rice borers. Field evaluation results also showed that all transgenic lines were highly insect resistant with both natural infestation and manual infestation of the neonate larvae of S. incertulas compared with the nontransformed Minghui63. Bt protein concentrations in leaves of 10 transgenic rice lines were estimated by the sandwich enzyme-linked immunosorbent assay. The cry9C gene had the highest expression level, next was cry2A gene, and the cry1Ac gene expressed at the lowest level. The feeding behavior of 7-d-old Asiatic rice borer to three classes of Bt transgenic rice lines also was detected by using rice culm cuttings. The results showed that 7-d-old larvae of Asiatic rice borer have the capacity to distinguish Bt and non-Bt culm cuttings and preferentially fed on non-Bt cuttings. When only Bt culm cuttings with three classes of different Bt proteins (CrylAc, Cry2A, and Cry9C) were fed, significant distribution difference of 7-d-old Asiatic rice borer in culm cuttings of different Bt proteins also was found. In the current study, we evaluate different Bt genes in the same rice variety in both the laboratory and the field, and also tested feeding behavior of rice insect to these Bt rice. These data are valuable for the further development of two-toxin Bt rice and establishment of appropriate insect resistance management in the future.
DEFF Research Database (Denmark)
This book argues that it is time to rethink reception as a traditional paradigm for understanding the relation between the ancient Greco-Roman traditions and early Judaism and Christianity. The concept of reception implies taking something from one fixed box into another, often a chronological...... intend to develop a more multi-faceted view of such precesses and to go beyond the term reception....
Lactation Defect in a Widely Used MMTV-Cre Transgenic Line of Mice
Yuan, Taichang; Wang, Yongping; Pao, Lily; Anderson, Steve M.; Gu, Haihua
2011-01-01
Background MMTV-Cre mouse lines have played important roles in our understanding about the functions of numerous genes in mouse mammary epithelial cells during mammary gland development and tumorigenesis. However, numerous studies have not included MMTV-Cre mice as controls, and many investigators have not indicated which of the different MMTV-Cre founder lines were used in their studies. Here, we describe a lactation defect that severely limits the use of one of the most commonly used MMTV-Cre founder lines. Methodology/Principal Findings To explore the role of protein tyrosine phosphatase Shp1 in mammary gland development, mice bearing the floxed Shp1 gene were crossed with MMTV-Cre mice and mammary gland development was examined by histological and biochemical techniques, while lactation competency was assessed by monitoring pup growth. Surprisingly, both the Shp1fl/+;MMTV-Cre and MMTV-Cre female mice displayed a severe lactation defect when compared to the Shp1 fl/+ control mice. Histological and biochemical analyses reveal that female mice expressing the MMTV-Cre transgene, either alone or in combination with floxed genes, exhibit defects in lobuloalveolar expansion, presence of large cytoplasmic lipid droplets in luminal alveolar epithelial cells postpartum, and precocious induction of involution. Using a PCR-based genotyping method, the three different founder lines can be distinguished, and we determined that the MMTV-Cre line A, the most widely used MMTV-Cre founder line, exhibits a profound lactation defect that limits its use in studies on mammary gland development. Conclusions/Significance The identification of a lactation defect in the MMTV-Cre line A mice indicates that investigators must use MMTV-Cre alone mice as control in studies that utilize Cre recombinase to excise genes of interest from mammary epithelial cells. Our results also suggest that previous results obtained in studies using the MMTV-Cre line A line should be re-evaluated if the
Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao
2013-01-01
Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.
Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines
Directory of Open Access Journals (Sweden)
Joanne G. Bartlett
2014-01-01
Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.
Directory of Open Access Journals (Sweden)
Hung-Chieh Lee
Full Text Available Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50, huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+, cadmium (Cd2+ and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants.
Chu, Chien; Li, Hong-Ping; Tsai, Huai-Jen
2014-01-01
Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50), huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+), cadmium (Cd2+) and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants. PMID:24594581
Directory of Open Access Journals (Sweden)
Anna C. Chlebowski
Full Text Available Nitroreductase enzymes are responsible for the reduction of nitro functional groups to amino functional groups, and are found in a range of animal models, zebrafish (Danio rerio excluded. Transgenic zebrafish models have been developed for tissue-specific cell ablation, which use nitroreductase to ablate specific tissues or cell types following exposure to the non-toxic pro-drug metronidazole (MTZ. When metabolized by nitroreductase, MTZ produces a potent cytotoxin, which specifically ablates the tissue in which metabolism occurs. Uses, beyond tissue-specific cell ablation, are possible for the hepatocyte-specific Tg(l-fabp:CFP-NTRs891 zebrafish line, including investigations of the role of nitroreductase in the toxicity of nitrated compounds. The hepatic ablation characteristics of this transgenic line were explored, in order to expand its potential uses. Embryos were exposed at 48, 72, or 96 h post fertilization (hpf to a range of MTZ concentrations, and the ablation profiles were compared. Ablation occurred at a 10-fold lower concentration than previously reported. Embryos were exposed to a selection of other compounds, with and without MTZ, in order to investigate alternative uses for this transgenic line. Test compounds were selected based on: their ability to undergo nitroreduction, known importance of hepatic metabolism to toxicity, and known pharmaceutical hepatotoxins. Selected compounds included nitrated polycyclic aromatic hydrocarbons (nitro-PAHs, the PAHs retene and benzo[a]pyrene, and the pharmaceuticals acetaminophen and flutamide. The results suggest a range of potential roles of the liver in the toxicity of these compounds, and highlight the additional uses of this transgenic model in toxicity testing. Keywords: Zebrafish, Transgenic, Nitroreductase, Nitrated polycyclic aromatic hydrocarbon, Tissue ablation, Pharmaceuticals
Germline recombination in a novel Cre transgenic line, Prl3b1-Cre mouse.
Al-Soudy, Al-Sayed; Nakanishi, Tsuyoshi; Mizuno, Seiya; Hasegawa, Yoshikazu; Shawki, Hossam H; Katoh, Megumi C; Basha, Walaa A; Ibrahim, Abdelaziz E; El-Shemy, Hany A; Iseki, Hiroyoshi; Yoshiki, Atsushi; Hiromori, Youhei; Nagase, Hisamitsu; Takahashi, Satoru; Oishi, Hisashi; Sugiyama, Fumihiro
2016-07-01
Spermatogenesis is a complex and highly regulated process by which spermatogonial stem cells differentiate into spermatozoa. To better understand the molecular mechanisms of the process, the Cre/loxP system has been widely utilized for conditional gene knockout in mice. In this study, we generated a transgenic mouse line that expresses Cre recombinase under the control of the 2.5 kbp of the Prolactin family 3, subfamily b, member 1 (Prl3b1) gene promoter (Prl3b1-cre). Prl3b1 was initially reported to code for placental lactogen 2 (PL-2) protein in placenta along with increased expression toward the end of pregnancy. PL-2 was found to be expressed in germ cells in the testis, especially in spermatocytes. To analyze the specificity and efficiency of Cre recombinase activity in Prl3b1-cre mice, the mice were mated with reporter R26GRR mice, which express GFP ubiquitously before and tdsRed exclusively after Cre recombination. The systemic examination of Prl3b1-cre;R26GRR mice revealed that tdsRed-positive cells were detected only in the testis and epididymis. Fluorescence imaging of Prl3b1-cre;R26GRR testes suggested that Cre-mediated recombination took place in the germ cells with approximately 74% efficiency determined by in vitro fertilization. In conclusion, our results suggest that the Prl3b1-cre mice line provides a unique resource to understand testicular germ-cell development. genesis 54:389-397, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Saibi, Walid; Zouari, Nabil; Masmoudi, Khaled; Brini, Faiçal
2016-04-01
Dehydrins are claimed to stabilize macromolecules against freezing damage, dehydration, ionic or osmotic stresses, thermal stress and re-folding yield. However, their precise function remains unknown. In this context, we report the behavior of protease activities in dehydrin transgenic Arabidopsis lines against the wild type plant under salt stress (100mM NaCl). Indeed, proteases play key roles in plants, maintaining strict protein quality control and degrading specific sets of proteins in response to diverse environmental and developmental stimuli. We proved that durum wheat DHN-5 modulates the activity of some proteases, summarized on the promotion of the Cysteinyl protease and the decrease of the Aspartyl protease activity. This fact is also upgraded in salt stress conditions. We conclude that the dehydrin transgenic context encodes salinity tolerance in transgenic lines through the modulation of the interaction not only at transcriptional level but also at protein level and also with the impact of salt stress as an endogenous and exogenous effector on some biocatalysts like proteases. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Leah J Campbell
Full Text Available The ability to control transgene expression within specific tissues is an important tool for studying the molecular and cellular mechanisms of development, physiology, and disease. We developed a Tet-On system for spatial and temporal control of transgene expression in zebrafish rod photoreceptors. We generated two transgenic lines using the Xenopus rhodopsin promoter to drive the reverse tetracycline-controlled transcriptional transactivator (rtTA, one with self-reporting GFP activity and one with an epitope tagged rtTA. The self-reporting line includes a tetracycline response element (TRE-driven GFP and, in the presence of doxycycline, expresses GFP in larval and adult rods. A time-course of doxycycline treatment demonstrates that maximal induction of GFP expression, as determined by the number of GFP-positive rods, is reached within approximately 24 hours of drug treatment. The epitope-tagged transgenic line eliminates the need for the self-reporting GFP activity by expressing a FLAG-tagged rtTA protein. Both lines demonstrate strong induction of TRE-driven transgenes from plasmids microinjected into one-cell embryos. These results show that spatial and temporal control of transgene expression can be achieved in rod photoreceptors. Additionally, system components are constructed in Gateway compatible vectors for the rapid cloning of doxycycline-inducible transgenes and use in other areas of zebrafish research.
Generation of an ABCG2GFPn-puro transgenic line - A tool to study ABCG2 expression in mice
International Nuclear Information System (INIS)
Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen; Malas, Stavros
2009-01-01
The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.
Generation of an ABCG2{sup GFPn-puro} transgenic line - A tool to study ABCG2 expression in mice
Energy Technology Data Exchange (ETDEWEB)
Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Malas, Stavros, E-mail: smalas@cing.ac.cy [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Department of Biological Sciences, University of Cyprus, P.O. Box 20537, 1678 Nicosia (Cyprus)
2009-06-26
The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.
Characterisation of the p53 pathway in cell lines established from TH-MYCN transgenic mouse tumours.
Chen, Lindi; Esfandiari, Arman; Reaves, William; Vu, Annette; Hogarty, Michael D; Lunec, John; Tweddle, Deborah A
2018-03-01
Cell lines established from the TH-MYCN transgenic murine model of neuroblastoma are a valuable preclinical, immunocompetent, syngeneic model of neuroblastoma, for which knowledge of their p53 pathway status is important. In this study, the Trp53 status and functional response to Nutlin-3 and ionising radiation (IR) were determined in 6 adherent TH-MYCN transgenic cell lines using Sanger sequencing, western blot analysis and flow cytometry. Sensitivity to structurally diverse MDM2 inhibitors (Nutlin-3, MI-63, RG7388 and NDD0005) was determined using XTT proliferation assays. In total, 2/6 cell lines were Trp53 homozygous mutant (NHO2A and 844MYCN+/+) and 1/6 (282MYCN+/-) was Trp53 heterozygous mutant. For 1/6 cell lines (NHO2A), DNA from the corresponding primary tumour was found to be Trp53 wt. In all cases, the presence of a mutation was consistent with aberrant p53 signalling in response to Nutlin-3 and IR. In comparison to TP53 wt human neuroblastoma cells, Trp53 wt murine control and TH-MYCN cell lines were significantly less sensitive to growth inhibition mediated by MI-63 and RG7388. These murine Trp53 wt and mutant TH-MYCN cell lines are useful syngeneic, immunocompetent neuroblastoma models, the former to test p53-dependent therapies in combination with immunotherapies, such as anti-GD2, and the latter as models of chemoresistant relapsed neuroblastoma when aberrations in the p53 pathway are more common. The spontaneous development of Trp53 mutations in 3 cell lines from TH-MYCN mice may have arisen from MYCN oncogenic driven and/or ex vivo selection. The identified species-dependent selectivity of MI-63 and RG7388 should be considered when interpreting in vivo toxicity studies of MDM2 inhibitors.
T-DNA integration patterns in transgenic maize lines mediated by ...
African Journals Online (AJOL)
Jane
2011-10-03
Oct 3, 2011 ... locus can have profound effects on the level and stability of transgene ..... Thane N, Henke J, Wang T, Ruppert J, Shah N, Rotter K, Hodges J, ... Chia JM, Deragon JM, Estill JC, Fu Y, Jeddeloh JA, Han YJ, Lee H,. Li PH, Lisch ...
Borel, C; Audran, C; Frey, A; Marion-Poll, A; Tardieu, F; Simonneau, T
2001-03-01
A series of transgenic lines of Nicotiana plumbaginifolia with modified expression of zeaxanthin epoxidase gene (ZEP) provided contrasting ABA accumulation in roots and xylem sap. For mild water stress, concentration of ABA in the xylem sap ([ABA](xylem)) was clearly lower in plants underexpressing ZEP mRNA (complemented mutants and antisense transgenic lines) than in wild-type. In well-watered conditions, all lines presented similar [ABA](xylem) and similar ABA accumulation rates in detached roots. Plants could, therefore, be grown under normal light intensities and evaporative demand. Both ZEP mRNA abundance and ABA accumulation rate in roots increased with water deficit in all transgenic lines, except in complemented aba2-s1 mutants in which the ZEP gene was controlled by a constitutive promoter which does not respond to water deficit. These lines presented no change in root ABA content either with time or dehydration. The increase in ZEP mRNA abundance in roots with decreasing RWC was more pronounced in detached roots than in whole plants, suggesting a difference in mechanism. In all transgenic lines, a linear relationship was observed between predawn leaf water potential and [ABA](xylem), which could be reproduced in several experiments in the greenhouse and in the growth chamber. It is therefore possible to represent the effect of the transformation by a single parameter, thereby allowing the use of a quantitative approach to assist understanding of the behaviour of transgenic lines.
Directory of Open Access Journals (Sweden)
Alexander Raup
2016-09-01
Full Text Available Non-viral transfection protocols are typically optimized using standard cells and reporter proteins, potentially underestimating cellular or transgene effects. Here such effects were studied for two human (Jurkat, HEK-293 and two rodent (CHO-K1, L929 cell lines and three fluorescent reporter proteins. Expression of the enhanced green fluorescent protein (EGFP was studied under the control of the human elongation factor 1 alpha promoter and three viral promoters (SV40, SV40/enhancer, CMV, that of ZsYellow1 (yellow fluorescence and mCherry (red fluorescence for the CMV promoter. Results varied with the cell line, in particular for the Jurkat cells. Pair-wise co-transfection of the CMV controlled transgenes resulted in a significant fraction of monochromatic cells (EGFP for EGFP/YFP and EGFP/RFP co-transfections, YFP in case of YFP/RFP co-transfections. Only Jurkat cells were almost incapable of expressing YFP. Dilution of the plasmid DNA with a non-expressed plasmid showed cell line dependent effects on transfection efficiency and/or expression levels.
International Nuclear Information System (INIS)
Vanegas Araujo, Pablo Andres; Blanco Martinez, Jennifer Teresa; Chaparro Giraldo, Alejandro
2010-01-01
The potato plant is the fourth most important crop in the world. In Colombia around 2.8 million tons are produced annually economically supporting 90000 families. In the country, the major economic impact in the crop is caused by Tecia solanivora that originates loses up to 100% in the tuber production. The genetic plant breeding related to the introduction of Cry genes which codify insecticidal crystal proteins is an alternative for reducing the insect attack in commercial crops. In this work, the insertion, transcription and expression of Cry1Ac gen was characterized in different tissues and three development stages of two transgenic lines of Solanum tuberosum variety Diacol Capiro that were previously transformed by Agrobacterium tumefaciens method. The characterization was realized by PCR, RT-PCR and ELISA techniques. The gen insertion and transcription was confirmed using primers for Cry1Ac gen that amplified a specific band of 766 bp. The protein expression levels were higher than 45 µg/g and were not significantly different between the analyzed lines or the three development stages. Furthermore, taking into account some relevant phenotypic features, no significant differences were found between transgenic lines and controls. The results suggest that monitoring and biosecurity assays are necessary with this vegetal material because their high level expression inside all the tissues analyzed that could affect non-targeted insects.
Directory of Open Access Journals (Sweden)
Patrícia Valle Pinheiro
2009-09-01
Full Text Available The objective of the present work was to determine the inheritance and stability of transgenes of a transgenic bean line expressing the genes rep-trap-ren from Bean golden mosaic virus and the bar gene. Crosses were done between the transgenic line and four commercial bean cultivars, followed by four backcrosses to the commercial cultivars. Progenies from each cross were evaluated for the presence of the transgenes by brushing the leaves with glufosinate ammonium and by polymerase chain reaction using specific oligonucleotides. Advanced generations were rub-inoculated with an isolate of Bean common mosaic necrosis virus (BCMNV. The transgenes were inherited consistently in a Mendelian pattern in the four crosses studied. The analyzed lines recovered close to 80% of the characteristics of the recurrent parent, as determined by the random amplified DNA markers used, besides maintaining important traits such as resistance to BCMNV. The presence of the transgene did not cause any detectable undesirable effect in the evaluated progenies.O objetivo do presente trabalho foi determinar a herança e a estabilidade de transgenes de uma linhagem de feijoeiro-comum com expressão dos genes rep-trap-ren, do Bean golden mosaic virus, e do gene bar. Foram realizados cruzamentos entre a linhagem transgênica e quatro cultivares comerciais de feijão, seguidos de quatro retrocruzamentos. As progênies de cada cruzamento foram avaliadas quanto à presença dos transgenes, com aplicação do glifosinato de amônia nas folhas e por meio da reação da polimerase em cadeia com uso de oligonucleotídeos específicos. O vírus do mosaico comum necrótico do feijoeiro, Bean common mosaic necrosis virus (BCMNV, foi inoculado mecanicamente nas gerações avançadas. Os transgenes foram herdados em padrão mendeliano nos quatro cruzamentos estudados. As linhagens analisadas apresentaram cerca de 80% das características do parental recorrente, conforme determinado por an
Bruce X Longwood television reception survey
International Nuclear Information System (INIS)
Hatanaka, G.K.
1992-01-01
Property owners living close to a proposed 500-kV transmission line route in Ontario expressed concerns that the line would affect their television reception. To give a reasonable evaluation of the impact of the transmission line, tests were conducted before and after installation of the line in which the possibility of active or passive interference to reception was assessed. Measurements were made of signal strength and ambient noise, and television reception was also recorded on videotape. Possible transmission line effects due to radiated noise, signal reduction, and ghosts are analyzed. The analysis of signal and noise conditions, and the assessment of videotaped reception, provide reasonable evidence that the line has had negligible impact on the television reception along the line route. 13 refs., 18 figs., 12 tabs
Directory of Open Access Journals (Sweden)
Jingang Liang
Full Text Available Previous studies have shown that methionine from root exudates affects the rhizosphere bacterial population involved in soil nitrogen fixation. A transgenic line of Zigongdongdou soybean cultivar (ZD91 that expresses Arabidopsis cystathionine γ-synthase resulting in an increased methionine production was examined for its influence to the rhizosphere bacterial population. Using 16S rRNA gene-based pyrosequencing analysis of the V4 region and DNA extracted from bacterial consortia collected from the rhizosphere of soybean plants grown in an agricultural field at the pod-setting stage, we characterized the populational structure of the bacterial community involved. In total, 87,267 sequences (approximately 10,908 per sample were analyzed. We found that Acidobacteria, Proteobacteria, Bacteroidetes, Actinobacteria, Chloroflexi, Planctomycetes, Gemmatimonadetes, Firmicutes, and Verrucomicrobia constitute the dominant taxonomic groups in either the ZD91 transgenic line or parental cultivar ZD, and that there was no statistically significant difference in the rhizosphere bacterial community structure between the two cultivars.
Directory of Open Access Journals (Sweden)
Chi-Fang Chen
Full Text Available BACKGROUND: Zebrafish skin is composed of enveloping and basal layers which form a first-line defense system against pathogens. Zebrafish epidermis contains ionocytes and mucous cells that aid secretion of acid/ions or mucous through skin. Previous studies demonstrated that fish skin is extremely sensitive to external stimuli. However, little is known about the molecular mechanisms that modulate skin cell apoptosis in zebrafish. METHODOLOGY/PRINCIPAL FINDINGS: This study aimed to create a platform to conduct conditional skin ablation and determine if it is possible to attenuate apoptotic stimuli by overexpressing potential apoptosis modulating genes in the skin of live animals. A transgenic zebrafish line of Tg(krt4:NTR-hKikGR(cy17 (killer line, which can conditionally trigger apoptosis in superficial skin cells, was first established. When the killer line was incubated with the prodrug metrodinazole, the superficial skin displayed extensive apoptosis as judged by detection of massive TUNEL- and active caspase 3-positive signals. Great reductions in NTR-hKikGR(+ fluorescent signals accompanied epidermal cell apoptosis. This indicated that NTR-hKikGR(+ signal fluorescence can be utilized to evaluate apoptotic events in vivo. After removal of metrodinazole, the skin integrity progressively recovered and NTR-hKikGR(+ fluorescent signals gradually restored. In contrast, either crossing the killer line with testing lines or transiently injecting the killer line with testing vectors that expressed human constitutive active Akt1, mouse constitutive active Stat3, or HPV16 E6 element displayed apoptosis-resistant phenotypes to cytotoxic metrodinazole as judged by the loss of reduction in NTR-hKikGR(+ fluorescent signaling. CONCLUSION/SIGNIFICANCE: The killer/testing line binary system established in the current study demonstrates a nitroreductase/metrodinazole system that can be utilized to conditionally perform skin ablation in a real-time manner, and
A transgenic mouse line for molecular genetic analysis of excitatory glutamatergic neurons
DEFF Research Database (Denmark)
Borgius, Lotta; Restrepo, C. Ernesto; Leao, Richardson N.
2010-01-01
Excitatory glutamatergic neurons are part of most of the neuronal circuits in the mammalian nervous system. We have used BAC-technology to generate a BAC-Vglut2::Cre mouse line where Cre expression is driven by the vesicular glutamate transporter 2 (Vglut2) promotor. This BAC-Vglut2::Cre mouse line...... showed specific expression of Cre in Vglut2 positive cells in the spinal cord with no ectopic expression in GABAergic or glycinergic neurons. This mouse line also showed specific Cre expression in Vglut2 positive structures in the brain such as thalamus, hypothalamus, superior colliculi, inferior...... colliculi and deep cerebellar nuclei together with nuclei in the midbrain and hindbrain. Cre-mediated recombination was restricted to Cre expressing cells in the spinal cord and brain and occurred as early as E 12.5. Known Vglut2 positive neurons showed normal electrophysiological properties in the BAC...
Directory of Open Access Journals (Sweden)
Keiko Ikeda
Full Text Available The key role of the respiratory neural center is respiratory rhythm generation to maintain homeostasis through the control of arterial blood pCO2/pH and pO2 levels. The neuronal network responsible for respiratory rhythm generation in neonatal rat resides in the ventral side of the medulla and is composed of two groups; the parafacial respiratory group (pFRG and the pre-Bötzinger complex group (preBötC. The pFRG partially overlaps in the retrotrapezoid nucleus (RTN, which was originally identified in adult cats and rats. Part of the pre-inspiratory (Pre-I neurons in the RTN/pFRG serves as central chemoreceptor neurons and the CO2 sensitive Pre-I neurons express homeobox gene Phox2b. Phox2b encodes a transcription factor and is essential for the development of the sensory-motor visceral circuits. Mutations in human PHOX2B cause congenital hypoventilation syndrome, which is characterized by blunted ventilatory response to hypercapnia. Here we describe the generation of a novel transgenic (Tg rat harboring fluorescently labeled Pre-I neurons in the RTN/pFRG. In addition, the Tg rat showed fluorescent signals in autonomic enteric neurons and carotid bodies. Because the Tg rat expresses inducible Cre recombinase in PHOX2B-positive cells during development, it is a potentially powerful tool for dissecting the entire picture of the respiratory neural network during development and for identifying the CO2/O2 sensor molecules in the adult central and peripheral nervous systems.
Directory of Open Access Journals (Sweden)
Jacobs Jeanne ME
2011-10-01
Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.
Directory of Open Access Journals (Sweden)
Stefanie Schmitteckert
2017-12-01
Full Text Available The elucidation of molecular mechanisms that restrict the potential of pluripotent stem cells and promote cardiac lineage differentiation is of crucial relevance, since embryonic stem cells (ESCs hold great potential for cell based heart therapies. The homeodomain transcription factor Shox2 is essential for the development and proper function of the native cardiac pacemaker, the sinoatrial node. This prompted us to develop a cardiac differentiation model using ESC lines isolated from blastocysts of Shox2-deficient mice. The established cell model provides a fundamental basis for the investigation of molecular pathways under physiological and pathophysiological conditions for evaluating novel therapeutic approaches.
Directory of Open Access Journals (Sweden)
Thomas R Whitesell
Full Text Available Mural cells of the vascular system include vascular smooth muscle cells (SMCs and pericytes whose role is to stabilize and/or provide contractility to blood vessels. One of the earliest markers of mural cell development in vertebrates is α smooth muscle actin (acta2; αsma, which is expressed by pericytes and SMCs. In vivo models of vascular mural cell development in zebrafish are currently lacking, therefore we developed two transgenic zebrafish lines driving expression of GFP or mCherry in acta2-expressing cells. These transgenic fish were used to trace the live development of mural cells in embryonic and larval transgenic zebrafish. acta2:EGFP transgenic animals show expression that largely mirrors native acta2 expression, with early pan-muscle expression starting at 24 hpf in the heart muscle, followed by skeletal and visceral muscle. At 3.5 dpf, expression in the bulbus arteriosus and ventral aorta marks the first expression in vascular smooth muscle. Over the next 10 days of development, the number of acta2:EGFP positive cells and the number of types of blood vessels associated with mural cells increases. Interestingly, the mural cells are not motile and remain in the same position once they express the acta2:EGFP transgene. Taken together, our data suggests that zebrafish mural cells develop relatively late, and have little mobility once they associate with vessels.
Aproach study of freedom to operate for transgenic line rice in Colombia
Directory of Open Access Journals (Sweden)
Alejandro Chaparro Giraldo
2016-01-01
Full Text Available The development of a genetically modified variety (GM is a scientific and legal challenge, by genetic engineering techniques used and the intellectual property rights (IPR involved. Approximate analysis of freedom of operation for a GM line derived from a Colombian rice variety, express an optimized version of the cry1Ac gene; in order to pursue their commercial release in Colombia was made. To do this, a deconstruction of innovation, which potentially protectable elements DPI on which patent searches and patent applications were made in the national and international context, databases were determined public access was performed. 59 patents and patent applications were found in the international arena. The Superintendency of Industry and Trade of Colombia (SIC three applications for patents that may affect the freedom of operation for this innovation were found. It is concluded that the higher the possibility of developing a GM rice line expressing cry1Ac gene without affecting the interest of third parties , as long as it is done in the country to commercialize.
Mastro, Kevin J.; Bouchard, Rachel S.; Holt, Hiromi A. K.
2014-01-01
Cell-type diversity in the brain enables the assembly of complex neural circuits, whose organization and patterns of activity give rise to brain function. However, the identification of distinct neuronal populations within a given brain region is often complicated by a lack of objective criteria to distinguish one neuronal population from another. In the external segment of the globus pallidus (GPe), neuronal populations have been defined using molecular, anatomical, and electrophysiological criteria, but these classification schemes are often not generalizable across preparations and lack consistency even within the same preparation. Here, we present a novel use of existing transgenic mouse lines, Lim homeobox 6 (Lhx6)–Cre and parvalbumin (PV)–Cre, to define genetically distinct cell populations in the GPe that differ molecularly, anatomically, and electrophysiologically. Lhx6–GPe neurons, which do not express PV, are concentrated in the medial portion of the GPe. They have lower spontaneous firing rates, narrower dynamic ranges, and make stronger projections to the striatum and substantia nigra pars compacta compared with PV–GPe neurons. In contrast, PV–GPe neurons are more concentrated in the lateral portions of the GPe. They have narrower action potentials, deeper afterhyperpolarizations, and make stronger projections to the subthalamic nucleus and parafascicular nucleus of the thalamus. These electrophysiological and anatomical differences suggest that Lhx6–GPe and PV–GPe neurons participate in different circuits with the potential to contribute to different aspects of motor function and dysfunction in disease. PMID:24501350
Stobiecki, Maciej; Matysiak-Kata, Iwona; Frański, Rafał; Skała, Jacek; Szopa, Jan
2003-03-01
Transgenic potato plants overexpressing and repressing enzymes of flavonoids biosynthesis were created and analyzed. The selected plants clearly showed the expected changes in anthocyanins synthesis level. Overexpression of a DNA encoding dihydroflavonol 4-reductase (DFR) in sense orientation resulted in an increase in tuber anthocyanins, a 4-fold increase in petunidin and pelargonidin derivatives. A significant decrease in anthocyanin level was observed when the plant was transformed with a corresponding antisense construct. The transformation of potato plants was also accompanied by significant changes in steroid alkaloid glycosides (SAG) level in transgenic potato tuber. The changes in SAGs content was not dependent on flavonoid composition in transgenic potato. However, in an extreme situation where the highest (DFR11) or the lowest (DFRa3) anthocyanin level was detected the positive correlation with steroid alkaloid content was clearly visible. It is suggested that the changes in SAGs content resulted from chromatin stressed upon transformation. A liquid chromatography/mass spectrometry (LC/MS) system with electrospray ionization was applied for profiling qualitative and quantitative changes of steroid alkaloid glycosides in tubers of twelve lines of transgenic potato plants. Except alpha-chaconine and alpha-solanine, in the extracts from dried tuber skin alpha-solamargine and alpha-solasonine, triglycosides of solasonine, were identified in minor amounts, triglycosides of solanidine dehydrodimers were also recognized.
Vuong, H E; Pérez de Sevilla Müller, L; Hardi, C N; McMahon, D G; Brecha, N C
2015-10-29
Transgenic mouse lines are essential tools for understanding the connectivity, physiology and function of neuronal circuits, including those in the retina. This report compares transgene expression in the retina of a tyrosine hydroxylase (TH)-red fluorescent protein (RFP) mouse line with three catecholamine-related Cre recombinase mouse lines [TH-bacterial artificial chromosome (BAC)-, TH-, and dopamine transporter (DAT)-Cre] that were crossed with a ROSA26-tdTomato reporter line. Retinas were evaluated and immunostained with commonly used antibodies including those directed to TH, GABA and glycine to characterize the RFP or tdTomato fluorescent-labeled amacrine cells, and an antibody directed to RNA-binding protein with multiple splicing to identify ganglion cells. In TH-RFP retinas, types 1 and 2 dopamine (DA) amacrine cells were identified by their characteristic cellular morphology and type 1 DA cells by their expression of TH immunoreactivity. In the TH-BAC-, TH-, and DAT-tdTomato retinas, less than 1%, ∼ 6%, and 0%, respectively, of the fluorescent cells were the expected type 1 DA amacrine cells. Instead, in the TH-BAC-tdTomato retinas, fluorescently labeled AII amacrine cells were predominant, with some medium diameter ganglion cells. In TH-tdTomato retinas, fluorescence was in multiple neurochemical amacrine cell types, including four types of polyaxonal amacrine cells. In DAT-tdTomato retinas, fluorescence was in GABA immunoreactive amacrine cells, including two types of bistratified and two types of monostratified amacrine cells. Although each of the Cre lines was generated with the intent to specifically label DA cells, our findings show a cellular diversity in Cre expression in the adult retina and indicate the importance of careful characterization of transgene labeling patterns. These mouse lines with their distinctive cellular labeling patterns will be useful tools for future studies of retinal function and visual processing. Published by Elsevier
Li, Zhuo; Li, Li-Kun; Liu, Bin; Wang, Long; Parajulee, Megha N; Chen, Fa-Jun
2018-01-24
The widespread planting of insect-resistant crops has caused a dramatic shift in agricultural landscapes, thus raising concerns about the potential impacts on both target and non-target pests. In this study, we examined the potential effects of intra-specific seed mixture sowing with transgenic Bt rice (Bt) and its parental non-transgenic line (Nt) (100% Bt rice [Bt 100 ], 5% Nt+95% Bt [Nt 05 Bt 95 ], 10% Nt+90% Bt [Nt 10 Bt 90 ], 20% Nt+80% Bt [Nt 20 Bt 80 ], 40% Nt+60% Bt [Nt 40 Bt 60 ] and 100% Nt rice [Nt 100 ]) on target and non-target pests in a 2-year field trial in southern China. The occurrence of target pests, Sesamia inferens, Chilo suppressalis and Cnaphalocrocis medinalis, decreased with the increased ratio of Bt rice, and the mixture ratios with more than 90% Bt rice (Bt 100 and Nt 05 Bt 95 ) significantly increased the pest suppression efficiency, with the lowest occurrences of non-target planthoppers, Nilaparvata lugens and Sogatella furcifera in Nt 100 and Nt 05 Bt 95 . Furthermore, there were no significant differences in 1000-grain dry weight and grain dry weight per 100 plants between Bt 100 and Nt 05 Bt 95 . Seed mixture sowing of Bt rice with ≤10% (especially 5%) of its parent line was sufficient to overcome potential compliance issues that exist with the use of block or structured refuge to provide most effective control of both target and non-target pests without compromising the grain yield. It is also expected that the strategy of seed mixture sowing with transgenic Bt rice and the non-transgenic parental line would provide rice yield stability while decreasing the insecticide use frequency in rice production. © 2018 Institute of Zoology, Chinese Academy of Sciences.
Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei
2018-07-01
Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.
Czech Academy of Sciences Publication Activity Database
Mikuš, Tomáš; Poplštein, M.; Sedláková, J.; Landa, Vladimír; Jeníková, Gabriela; Trefil, P.; Lidický, J.; Malý, Petr
2004-01-01
Roč. 13, č. 5 (2004), s. 487-498 ISSN 0962-8819 R&D Projects: GA ČR GA304/03/0090 Institutional research plan: CEZ:AV0Z5052915 Keywords : erythropoietin, mammary gland, transgenic rabbit Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.107, year: 2004
Directory of Open Access Journals (Sweden)
Margarita Chumarina
2017-03-01
Full Text Available Mouse embryonic stem cell (mESC lines were derived by crossing heterozygous transgenic (tg mice expressing green fluorescent protein (GFP under the control of the rat tyrosine hydroxylase (TH promoter, with homozygous alpha-synuclein (aSYN mice expressing human mutant SNCAA53T under the control of the mouse Prion promoter (MoPrP, or wildtype (WT mice. The expression of GFP and human aSYN was validated by immunocytochemistry in midbrain neuron cultures upon differentiation of mESC lines using stromal cell-derived inducing activity. These mESC lines can help to study the impact of human aSYN expression in neurons and oligodendrocytes, and also trace GFP-expressing midbrain neurons.
DEFF Research Database (Denmark)
Ambjørn, Lone
2002-01-01
Sproglæringsteoretisk værktøj til udvikling af IT-støttede materialer og programmer inden for sproglig reception......Sproglæringsteoretisk værktøj til udvikling af IT-støttede materialer og programmer inden for sproglig reception...
Czech Academy of Sciences Publication Activity Database
Klímová, Lucie; Láchová, Jitka; Machoň, Ondřej; Sedláček, Radislav; Kozmik, Zbyněk
2013-01-01
Roč. 8, č. 5 (2013), e63029 E-ISSN 1932-6203 R&D Projects: GA ČR GAP305/11/2198; GA MŠk(CZ) LK11214; GA MŠk(CZ) LM2011032; GA ČR GAP305/10/2143; GA MŠk ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : eye development * lens * retina * transgenic mice Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013
Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I
2016-01-01
Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.
Pelosi, Barbara; Migliarini, Sara; Pacini, Giulia; Pratelli, Marta; Pasqualetti, Massimo
2014-01-01
Neurons producing serotonin (5-hydroxytryptamine, 5-HT) constitute one of the most widely distributed neuronal networks in the mammalian central nervous system (CNS) and exhibit a profuse innervation throughout the CNS already at early stages of development. Serotonergic neuron specification is controlled by a combination of secreted molecules and transcription factors such as Shh, Fgf4/8, Nkx2.2, Lmx1b and Pet1. In the mouse, Pet1 mRNA expression appears between 10 and 11 days post coitum (dpc) in serotonergic post-mitotic precursors and persists in serotonergic neurons up to adulthood, where it promotes the expression of genes defining the mature serotonergic phenotype such as tryptophan hydroxylase 2 (Tph2) and serotonin transporter (SERT). Hence, the generation of genetic tools based on Pet1 specific expression represents a valuable approach to study the development and function of the serotonergic system. Here, we report the generation of a Pet1210-Cre transgenic mouse line in which the Cre recombinase is expressed under the control of a 210 kb fragment from the Pet1 genetic locus to ensure a reliable and faithful control of somatic recombination in Pet1 cell lineage. Besides Cre-mediated recombination accurately occurred in the serotonergic system as expected and according to previous studies, Pet1210-Cre transgenic mouse line allowed us to identify novel, so far uncharacterized, Pet1 expression domains. Indeed, we showed that in the raphe Pet1 is expressed also in a non-serotonergic neuronal population intermingled with Tph2-expressing cells and mostly localized in the B8 and B9 nuclei. Moreover, we detected Cre-mediated recombination also in the developing pancreas and in the ureteric bud derivatives of the kidney, where it reflected a specific Pet1 expression. Thus, Pet1210-Cre transgenic mouse line faithfully drives Cre-mediated recombination in all Pet1 expression domains representing a valuable tool to genetically manipulate serotonergic and non
Chakraborty, Anirban; Mitra, Joy; Bhattacharyya, Jagannath; Pradhan, Subrata; Sikdar, Narattam; Das, Srirupa; Chakraborty, Saikat; Kumar, Sachin; Lakhanpaul, Suman; Sen, Soumitra K
2015-06-01
Over-expression of the unedited mitochondrial orfB gene product generates male sterility in fertile indica rice lines in a dose-dependent manner. Cytoplasmic male sterility (CMS) and nuclear-controlled fertility restoration are widespread developmental features in plant reproductive systems. In self-pollinated crop plants, these processes often provide useful tools to exploit hybrid vigour. The wild abortive CMS has been employed in the majority of the "three-line" hybrid rice production since 1970s. In the present study, we provide experimental evidence for a positive functional relationship between the 1.1-kb unedited orfB gene transcript, and its translated product in the mitochondria with male sterility. The generation of the 1.1-kb unedited orfB gene transcripts increased during flowering, resulting in low ATP synthase activity in sterile plants. Following insertion of the unedited orfB gene into the genome of male-fertile plants, the plants became male sterile in a dose-dependent manner with concomitant reduction of ATPase activity of F1F0-ATP synthase (complex V). Fertility of the transgenic lines and normal activity of ATP synthase were restored by down-regulation of the unedited orfB gene expression through RNAi-mediated silencing. The genetic elements deciphered in this study could further be tested for their use in hybrid rice development.
Diversity Networking Reception
2014-03-01
Join us at the APS Diversity Reception to relax, network with colleagues, and learn about programs and initiatives for women, underrepresented minorities, and LGBT physicists. You'll have a great time meeting friends in a supportive environment and making connections.
Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong
2016-01-01
Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.
Directory of Open Access Journals (Sweden)
Shanshan Dong
Full Text Available Pollen-mediated gene flow (PMGF is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.
Directory of Open Access Journals (Sweden)
Xiaoyan Zhang
Full Text Available Previously we have developed a transgenic zebrafish line (LiPan with liver-specific red fluorescent protein (DsRed expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine] caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics and chlorphenamine (pain killer did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry
Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan
2014-01-01
Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid
International Nuclear Information System (INIS)
Robab, U.E.; )
2014-01-01
The transgenic peanut plants expressing bar and rcg3 genes were subjected to assessment of any change in nutritional value of the crop at various locations. The protein and fat contents of transgenic lines were compared with the non-transgenic parent varieties. Protein content in the transgenic lines was higher as compared to that in non-transgenic counterparts and differences among locations for fat and protein content were significant. No differences among fatty acids were recorded for genes, events and locations. Irrespective of small differences, all the values were in range described for this crop and transgenic lines appeared to be substantially equivalent to non-transgenic parent varieties. (author)
Beyond the bolus: transgenic tools for investigating the neurophysiology of learning and memory.
Lykken, Christine; Kentros, Clifford G
2014-10-01
Understanding the neural mechanisms underlying learning and memory in the entorhinal-hippocampal circuit is a central challenge of systems neuroscience. For more than 40 years, electrophysiological recordings in awake, behaving animals have been used to relate the receptive fields of neurons in this circuit to learning and memory. However, the vast majority of such studies are purely observational, as electrical, surgical, and pharmacological circuit manipulations are both challenging and relatively coarse, being unable to distinguish between specific classes of neurons. Recent advances in molecular genetic tools can overcome many of these limitations, enabling unprecedented control over neural activity in behaving animals. Expression of pharmaco- or optogenetic transgenes in cell-type-specific "driver" lines provides unparalleled anatomical and cell-type specificity, especially when delivered by viral complementation. Pharmacogenetic transgenes are specially designed neurotransmitter receptors exclusively activated by otherwise inactive synthetic ligands and have kinetics similar to traditional pharmacology. Optogenetic transgenes use light to control the membrane potential, and thereby operate at the millisecond timescale. Thus, activation of pharmacogenetic transgenes in specific neuronal cell types while recording from other parts of the circuit allows investigation of the role of those neurons in the steady state, whereas optogenetic transgenes allow one to determine the immediate network response. © 2014 Lykken and Kentros; Published by Cold Spring Harbor Laboratory Press.
Predicting Volleyball Serve-Reception
Paulo, Ana; Zaal, Frank T J M; Fonseca, Sofia; Araujo, Duarte
2016-01-01
Serve and serve-reception performance have predicted success in volleyball. Given the impact of serve-reception on the game, we aimed at understanding what it is in the serve and receiver's actions that determines the selection of the type of pass used in serve-reception and its efficacy. Four
THE AUDIT OF RECEPTION PROCESS
Directory of Open Access Journals (Sweden)
Dorina MOCUŢA
2013-01-01
Full Text Available The object of study case is to analyze the quality of the logistics department, focusing on the audit process. Purpose of this paper is to present the advantages resulting from the systematic audit processes and methods of analysis and improvement of nonconformities found. The case study is realised at SC Miele Tehnica SRL Brasov, twelfth production line, and the fourth from outside Germany. The specific objectives are: clarifying the concept of audit quality, emphasizing requirements ISO 19011:2003 "Guidelines for auditing quality management systems and / or environment" on audits; cchieving quality audit and performance analysis; improved process performance reception materials; compliance with legislation and auditing standards applicable in EU and Romania.
Directory of Open Access Journals (Sweden)
Xiemin Qi
2016-07-01
Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.
Expression of bgt gene in transgenic birch (Betula platyphylla Suk ...
African Journals Online (AJOL)
Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch plants indicated that the ...
Expression of bgt gene in transgenic birch (Betula platyphylla Suk.)
African Journals Online (AJOL)
STORAGESEVER
2009-08-04
Aug 4, 2009 ... Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch.
Carraresi, Laura; Martinelli, Rosanna; Vannoni, Alessandro; Riccio, Massimo; Dembic, Maja; Tripodi, Sergio; Cintorino, Marcella; Santi, Spartaco; Bigliardi, Elisa; Carmellini, Mario; Rossini, Mara
2006-01-08
We have established two murine cell lines derived from Small Cell Lung Carcinomas (SCLCs) developed by HPV-E6/E7 transgenic mice. These cells named PPAP-9 and PPAP-10 were isolated from mice bearing tumors, 9 and 10 months old, respectively. The cells, 5 microm in diameter, express HPV oncoproteins and sustain tumor formation after subcutaneous injection in syngenic mice. A detailed analysis indicated the epithelial origin and the neuroendocrine differentiation of these cells. We showed by confocal immunofluorescence the expression of the epithelial marker cytokeratin 5, whose gene promoter was used to direct the expression of HPV E6/E. Cells express several neuroendocrine markers such as CGRP, MAP-2, Ash1, CgrA, Scg2. The neuroendocrine differentiation of these cells was further confirmed by electron microscopy demonstrating neuropeptides secreting granules in their cytoplasm. Furthermore, in agreement with the altered expression observed in the majority of human SCLC we showed in these cells the absence of both p53 and pRB and a dramatic reduction in the expression of Caveolin-1.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin
2005-04-01
Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants. Copyright 2005 Society of Chemical Industry.
No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities.
Lu, Z B; Tian, J C; Han, N S; Hu, C; Peng, Y F; Stanley, David; Ye, G Y
2014-10-01
A 2-yr field trial was conducted to assess the impacts of two new transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. All the arthropods were classified into five guilds, including herbivores, parasitoids, predators, detritivores, and others. The seasonal density and dominance distribution of each guild and community-level indices (species richness, Shannon-Wiener diversity index, Simpson diversity index, and evenness index) were compared among rice types. Principal response curves were used to investigate the differences of entire arthropod community of Bt rice plots relative to non-Bt rice plots. The results showed no significant difference was detected in the community-level indices and dominance distribution of guilds between Bt and non-Bt rice plots. The seasonal density of herbivores, detritivores, and others as well as density of the arthropod overall community were also not significantly affected by rice types in either year, although the density of predators and parasitoids in Bt rice plots was significantly lower than those in non-Bt rice plots. The lower abundances of Braconidae, Eulophidae, Cyrtorhinus lividipennis (Reuter) (Hemiptera: Miridae), and Theridiidae in Bt rice plots are likely attributed to the lower abundances of prey species or hosts. Principal response curves revealed that arthropod community in Bt was similar with that in non-Bt rice plots. In conclusion, our findings indicate that these two tested Bt rice lines had no marked negative effects on the arthropod community in the paddy fields.
Education and Technology Transfer Unit/ETT-EC
2004-01-01
Friday 15.10.2004 CERN 50th Anniversary articles will be sold in the Main Building, ground floor on Friday 15th October from 10h00 to 16h00. T-shirt, (S, M, L, XL) 20.- K-way (M, L, XL) 20.- Silk tie (2 models) 30.- Einstein tie 45.- Umbrella 20.- Caran d'Ache pen 5.- 50th Anniversary Pen 5.- Kit of Cartoon Album & Crayons 10.- All the articles are also available at the Reception Shop in Building 33 from Monday to Saturday between 08.30 and 17.00 hrs. Education and Technology Transfer Unit/ETT-EC
DEFF Research Database (Denmark)
Mathieu, David
Some might argue that reception analysis is a remnant of the past in an age where “people formerly known as the audience” (Rosen, 2006) are producing and circulating content on a diversity of interactive and participatory media platforms. Far from being the case, reception research must continue......, which appears increasingly complex, multi-formed and integrated to the audience. The original dimensions of Schrøder’s model need to be looked at with reference to both reception and circulation (Jenkins et al., 2013), and to the network that binds participatory media culture. It appears that with media...... 2.0, phenomena which traditionally fell under the labels of interpretation or reception are increasingly taking part in the media text itself. As audiences become textual matters, they contribute to set a new agenda for media research....
2009-01-01
At a reception on 28 January, the CERN management presented their best wishes for 2009 to politicians and representatives of the administrations in the local area, and diplomats representing CERN’s Member States, Observer States and other countries.
Accumulation of nickel in transgenic tobacco
Sidik, Nik Marzuki; Othman, Noor Farhan
2013-11-01
The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TFtransgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.
2013 North Dakota Transgenic Barley Research and FHB Nursery Report
Research continues to develop and test new transgenic plants using genes provided by collaborators. As lines are developed in Golden Promise, they are crossed to Conlon for field testing. Transgenic lines developed in Conlon are being crossed to resistant lines developed by the breeding programs. ...
Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C
1998-10-01
The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.
The Receptive Side of Teaching
Hruska, Barbara
2008-01-01
When observing teachers in action, one is likely to witness explaining, modeling, managing, guiding, and encouraging. These expressive behaviors constitute a directive force moving outward from teacher to students. Though less visible to an outside observer, teaching also requires receptive skills, the ability to take in information by being fully…
Communication from Goods Reception services
2007-01-01
Members of the personnel are invited to take note that only parcels corresponding to official orders or contracts will be handled at CERN. Individuals are not authorised to have private merchandise delivered to them at CERN and private deliveries will not be accepted by the Goods Reception services. Thank you for your understanding.
Measuring receptive collocational competence across proficiency ...
African Journals Online (AJOL)
The present study investigates (i) English as Foreign Language (EFL) learners' receptive collocational knowledge growth in relation to their linguistic proficiency level; (ii) how much receptive collocational knowledge is acquired as linguistic proficiency develops; and (iii) the extent to which receptive knowledge of ...
[Progress in transgenic fish techniques and application].
Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying
2011-05-01
Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.
Neuroanatomy and transgenic technologies
This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...
Directory of Open Access Journals (Sweden)
Minas Bakalchev
2015-10-01
Full Text Available The perception of elements in a system often creates their interdependence, interconditionality, and suppression. The lines from a basic geometrical element have become the model of a reductive world based on isolation according to certain criteria such as function, structure, and social organization. Their traces are experienced in the contemporary world as fragments or ruins of a system of domination of an assumed hierarchical unity. How can one release oneself from such dependence or determinism? How can the lines become less “systematic” and forms more autonomous, and less reductive? How is a form released from modernistic determinism on the new controversial ground? How can these elements or forms of representation become forms of action in the present complex world? In this paper, the meaning of lines through the ideas of Le Corbusier, Leonidov, Picasso, and Hitchcock is presented. Spatial research was made through a series of examples arising from the projects of the architectural studio “Residential Transformations”, which was a backbone for mapping the possibilities ranging from playfulness to exactness, as tactics of transformation in the different contexts of the contemporary world.
Transgenic plants with enhanced growth characteristics
Energy Technology Data Exchange (ETDEWEB)
Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.
2018-01-09
The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.
Transgenic plants with enhanced growth characteristics
Energy Technology Data Exchange (ETDEWEB)
Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.
2016-09-06
The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.
Note from the Goods Reception services
FI Department
2008-01-01
Members of the personnel are invited to take note that only parcels corresponding to official orders or contracts will be handled at CERN. Individuals are not authorised to have private merchandise delivered to them at CERN and private deliveries will not be accepted by the Goods Reception services. Goods Reception Services
Rehabilitering og 'motion på recept'
DEFF Research Database (Denmark)
Larsen, Niels Sandholm; Larsen, Kristian
2008-01-01
af disse forskningsarbejder er etablering af fænomenet 'motion på recept'. Konceptet om 'motion på recept' stammer oprindelig fra Sverige, hvor praktiserende læger i en periode har haft mulighed for at henvise visse typer af patienter til fysisk træning hos praktiserende fysioterapeuter. Ribe Amt...... 2007)....
[Production of human proteins in the blood of transgenic animals
Massoud, M.; Bischoff, Rainer; Dalemans, W.; Pointu, H.; Attal, J.; Schultz, H.; Clesse, D.; Stinnakre, M.G.; Pavirani, A.; Houdebine, L.M.
1990-01-01
The human alpha 1-antitrypsin gene has been microinjected into rabbit embryos. A line of transgenic rabbits has thus been established. Human alpha 1-antitrypsin was found in the blood of transgenic animals at the concentration of 1 mg/ml plasma. The human protein was active and separable from its
Central auditory neurons have composite receptive fields.
Kozlov, Andrei S; Gentner, Timothy Q
2016-02-02
High-level neurons processing complex, behaviorally relevant signals are sensitive to conjunctions of features. Characterizing the receptive fields of such neurons is difficult with standard statistical tools, however, and the principles governing their organization remain poorly understood. Here, we demonstrate multiple distinct receptive-field features in individual high-level auditory neurons in a songbird, European starling, in response to natural vocal signals (songs). We then show that receptive fields with similar characteristics can be reproduced by an unsupervised neural network trained to represent starling songs with a single learning rule that enforces sparseness and divisive normalization. We conclude that central auditory neurons have composite receptive fields that can arise through a combination of sparseness and normalization in neural circuits. Our results, along with descriptions of random, discontinuous receptive fields in the central olfactory neurons in mammals and insects, suggest general principles of neural computation across sensory systems and animal classes.
Hepatic steatosis in transgenic mice overexpressing human histone deacetylase 1
International Nuclear Information System (INIS)
Wang, Ai-Guo; Seo, Sang-Beom; Moon, Hyung-Bae; Shin, Hye-Jun; Kim, Dong Hoon; Kim, Jin-Man; Lee, Tae-Hoon; Kwon, Ho Jeong; Yu, Dae-Yeul; Lee, Dong-Seok
2005-01-01
It is generally thought that histone deacetylases (HDACs) play important roles in the transcriptional regulation of genes. However, little information is available concerning the specific functions of individual HDACs in disease states. In this study, two transgenic mice lines were established which harbored the human HDAC1 gene. Overexpressed HDAC1 was detected in the nuclei of transgenic liver cells, and HDAC1 enzymatic activity was significantly higher in the transgenic mice than in control littermates. The HDAC1 transgenic mice exhibited a high incidence of hepatic steatosis and nuclear pleomorphism. Molecular studies showed that HDAC1 may contribute to nuclear pleomorphism through the p53/p21 signaling pathway
Competitive performance of transgenic wheat resistant to powdery mildew.
Directory of Open Access Journals (Sweden)
Olena Kalinina
Full Text Available Genetically modified (GM plants offer an ideal model system to study the influence of single genes that confer constitutive resistance to pathogens on the ecological behaviour of plants. We used phytometers to study competitive interactions between GM lines of spring wheat Triticum aestivum carrying such genes and control lines. We hypothesized that competitive performance of GM lines would be reduced due to enhanced transgene expression under pathogen levels typically encountered in the field. The transgenes pm3b from wheat (resistance against powdery mildew Blumeria graminis or chitinase and glucanase genes from barley (resistance against fungi in general were introduced with the ubiquitin promoter from maize (pm3b and chitinase genes or the actin promoter from rice (glucanase gene. Phytometers of 15 transgenic and non-transgenic wheat lines were transplanted as seedlings into plots sown with the same 15 lines as competitive environments and subject to two soil nutrient levels. Pm3b lines had reduced mildew incidence compared with control lines. Chitinase and chitinase/glucanase lines showed the same high resistance to mildew as their control in low-nutrient treatment and slightly lower mildew rates than the control in high-nutrient environment. Pm3b lines were weaker competitors than control lines. This resulted in reduced yield and seed number. The Pm3b line with the highest transgene expression had 53.2% lower yield than the control whereas the Pm3b line which segregated in resistance and had higher mildew rates showed only minor costs under competition. The line expressing both chitinase and glucanase genes also showed reduced yield and seed number under competition compared with its control. Our results suggest that single transgenes conferring constitutive resistance to pathogens can have ecological costs and can weaken plant competitiveness even in the presence of the pathogen. The magnitude of these costs appears related to the degree
Receptive females mitigate costs of sexual conflict.
Harano, T
2015-02-01
Males typically gain fitness from multiple mating, whereas females often lose fitness from numerous mating, potentially leading to sexual conflict over mating. This conflict is expected to favour the evolution of female resistance to mating. However, females may incur male harassment if they refuse to copulate; thus, greater female resistance may increase costs imposed by males. Here, I show that the evolution of resistance to mating raises fitness disadvantages of interacting with males when mating is harmful in female adzuki bean beetles, Callosobruchus chinensis. Females that were artificially selected for higher and lower remating propensity evolved to accept and resist remating, respectively. Compared with females that evolved to accept remating, females that evolved to resist it suffered higher fitness costs from continuous exposure to males. The costs of a single mating measured by the effect on longevity did not differ among selection line females. This study indicates that receptive rather than resistant females mitigate the fitness loss resulting from sexual conflict, suggesting that even though mating is harmful, females can evolve to accept additional mating. © 2014 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2014 European Society For Evolutionary Biology.
Welfare assessment in transgenic pigs expressing green fluorescent protein (GFP)
DEFF Research Database (Denmark)
Huber, Reinhard C.; Remuge, Liliana; Carlisle, Ailsa
2012-01-01
Since large animal transgenesis has been successfully attempted for the first time about 25 years ago, the technology has been applied in various lines of transgenic pigs. Nevertheless one of the concerns with the technology—animal welfare—has not been approached through systematic assessment...... and statements regarding the welfare of transgenic pigs have been based on anecdotal observations during early stages of transgenic programs. The main aim of the present study was therefore to perform an extensive welfare assessment comparing heterozygous transgenic animals expressing GFP with wildtype animals...... months. The absence of significant differences between GFP and wildtype animals in the parameters observed suggests that the transgenic animals in question are unlikely to suffer from deleterious effects of transgene expression on their welfare and thus support existing anecdotal observations of pigs...
Directory of Open Access Journals (Sweden)
M. Theau.Clément
2015-09-01
Full Text Available Sexual receptivity of rabbit does at insemination greatly influences fertility and is generally induced by hormones or techniques known as “biostimulation”. Searching for more sustainable farming systems, an original alternative would be to utilise the genetic pathway to increase the does’receptivity. The purpose of the present study was to identify genetic and non-genetic factors that influence rabbit doe sexual receptivity, in the context of a divergent selection experiment over 1 generation. The experiment spanned 2 generations: the founder generation (G0 consisting of 140 rabbit does, and the G1 generation comprising 2 divergently selected lines (L and H lines with 70 does each and 2 successive batches from each generation. The selection rate of the G0 females to form the G1 lines was 24/140. The selection tests consisted of 16 to 18 successive receptivity tests at the rate of 3 tests per week. On the basis of 4716 tests from 275 females, the average receptivity was 56.6±48.2%. A batch effect and a test operator effect were revealed. The contribution of females to the total variance was 20.0%, whereas that of bucks was only 1.1%. Throughout the experiment, 18.2% of does expressed a low receptivity (< 34%, 50.7% a medium one and 33.1% a high one (>66%. Some does were frequently receptive, whereas others were rarely receptive. The repeatability of sexual receptivity was approximately 20%. The results confirmed the high variability of sexual receptivity of non-lactating rabbit does maintained without any biostimulation or hormonal treatment. A lack of selection response on receptivity was observed. Accordingly, the heritability of receptivity was estimated at 0.01±0.02 from an animal model and at 0.02±0.03 from a sire and dam model. The heritability of the average receptivity of a doe was calculated as 0.04. In agreement with the low estimated heritability, the heritability determined was no different from zero
Accurate measure of transgene copy number in crop plants using droplet digital PCR
Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...
Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice
DEFF Research Database (Denmark)
Fromont-Racine, M; Bucchini, D; Madsen, O
1990-01-01
Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....
A transgenic mouse model for trilateral retinoblastoma
O'Brien, J.M.; Marcus, D.M.; Bernards, R.A.; Carpenter, J.L.; Windle, J.J.; Mellon, P.; Albert, D.M.
1990-01-01
We present a murine model of trilateral retinoblastoma. Ocular retinoblastoma and central nervous system tumors are observed in a line of mice formed by the transgenic expression of SV40 T-antigen. An oncogenic protein known to bind to the retinoblastoma gene product (p105-Rb) is specifically
Invocation Receptivity in Female of Rabbit
Directory of Open Access Journals (Sweden)
Martin Fik
2017-05-01
Full Text Available The target of this work was verified effect of transport females in the car for advance state of receptivity in young females broiler rabbits. We used nulliparous females of broiler hybrid HYCOLE (age 4-5 months, weight 3.5-3.8 kg. Experiment was realizated twice. First in half of November (31 females, second in half of February (32 females. Females was layed individually in boxes. After they were transported by car 1 hour (50 km. Before and after experiment we detected state of receptivity in females with coloration of vulva. The state of receptivity was determited from 1 for 4 colour of vulva. ( 1 – anemic coloration of vulva, 2- pink, 3 – red, 4- violet. We detected positive state of transport, on the receptivity. In November before transport was average of receptivity 1.87, after transport 2.25. The state of receptivity will be improve in 12 females (38.71 %. Improve from 1 to 2 was detected in 4 females, from 2 to 3 in 8 females. Improved from 2 to 4 , or from 3 to 4 wasn´t noticed in this group. The state of receptivity wasn´t changed in 19 females (61.29 %. In the state of receptivity 1 stayed 2 females, in the state 2 stayed 15 females, in the state 3 stayed 2 females and in the state 4 wasn´t any female. In February after the end of experiment, state of receptivity was improved with transport in the car from 2.19 to 2.65. The state of receptivity was improved in 13 females (40.63 %. Improve from 1 to 2 we detected in 1 female, from 2 to 3 we detected in 8 females, from 2 to 4 we detected in 2 females, from 3 to 4 in 2 females. In 19 females (59.38% we don´t noticed change state of receptivity. In the state of receptivity 1 were 2 females, in 2 were 11 females, in 3 were 5 females, in 4 was 1 female.
Nocarova, Eva; Fischer, Lukas
2009-04-22
Phenotypic characterization of transgenic cell lines, frequently used in plant biology studies, is complicated because transgene expression in individual cells is often heterogeneous and unstable. To identify the sources and to reduce this heterogeneity, we transformed tobacco (Nicotiana tabacum L.) BY-2 cells with a gene encoding green fluorescent protein (GFP) using Agrobacterium tumefaciens, and then introduced a simple cloning procedure to generate cell lines derived from the individual transformed cells. Expression of the transgene was monitored by analysing GFP fluorescence in the cloned lines and also in lines obtained directly after transformation. The majority ( approximately 90%) of suspension culture lines derived from calli that were obtained directly from transformation consisted of cells with various levels of GFP fluorescence. In contrast, nearly 50% of lines generated by cloning cells from the primary heterogeneous suspensions consisted of cells with homogenous GFP fluorescence. The rest of the lines exhibited "permanent heterogeneity" that could not be resolved by cloning. The extent of fluorescence heterogeneity often varied, even among genetically identical clones derived from the primary transformed lines. In contrast, the offspring of subsequent cloning of the cloned lines was uniform, showing GFP fluorescence intensity and heterogeneity that corresponded to the original clone. The results demonstrate that, besides genetic heterogeneity detected in some lines, the primary lines often contained a mixture of epigenetically different cells that could be separated by cloning. This indicates that a single integration event frequently results in various heritable expression patterns, which are probably accidental and become stabilized in the offspring of the primary transformed cells early after the integration event. Because heterogeneity in transgene expression has proven to be a serious problem, it is highly advisable to use transgenes tagged with
International Nuclear Information System (INIS)
Ahmad, R.; Hussain, J.
2014-01-01
Abiotic stresses are the most important contributors towards low productivity of major food crops. Various attempts have been made to enhance abiotic stress tolerance of crop plants by classical breeding and genetic transformation. Genetic transformation with glycinebetaine (GB) synthesizing enzymes' gene(s) in naturally non accumulating plants has resulted in enhanced tolerance against variety of abiotic stresses. Present study was aimed to evaluate the performance of GB synthesizing transgenic potato plants against salt and cold stresses. Transgenic potato plants were challenged against salt and cold stresses at whole plant level. Transgenic lines were characterized to determine the transgene copy number. Different parameters like integrity, chlorophyll contents, tuber yield and vegetative biomass were studied to monitor the stress tolerance of transgenic potato plants. The results were compared with Non-transgenic (NT) plants and statistically analyzed to evaluate significant differences. Multi-copy insertion of expression cassette was found in both transgenic lines. Upon salt stress, transgenic plants maintained better growth as compared to NT plants. The tuber yield of transgenic plants was significantly greater than NT plants in salt stress. Transgenic plants showed improved membrane integrity against cold stress by depicting appreciably reduced ion leakage as compared to NT plants. Moreover, transgenic plants showed significantly less chlorophyll bleaching than NT plants upon cold stress. In addition, NT plants accumulated significantly less biomass, and yielded fewer tubers as compared to transgenic plants after cold stress treatment. The study will be a committed step for field evaluation of transgenic plants with the aim of commercialization. (author)
From Iser to Turner and beyond: reception theory meets cognitive criticism
Directory of Open Access Journals (Sweden)
Craig Hamilton
2012-01-01
Full Text Available In this essay, we review the work of Wolfgang Iser, the major proponent of reception theory, and Mark Turner, the major proponent of cognitive criticism. The two theoretical lines advocated by Iser and Turner focus on the cognitive processes involved with reading literary texts. Unfortunately, bibliographic blind spots in both lines lead to the assumption that there is little overlap between reception theory and cognitive criticism. We put this assumption to rest by comparing and contrasting works by Iser and Turner in detail, starting with Iser’s work in the mid-1970s and ending with Turner’s work in the late 1990s.
Morning Receptions in a Danish ECE Context
DEFF Research Database (Denmark)
Kornerup, Ida; Gravgaard, Mette Lykke
This paper focus on a special pedagogical context; morning receptions as a learning environment. The studies of mornings are part of a 3 year long research project in which different types of learning environments were investigated. Few studies have researched morning receptions in this perspecti...... even though pedagogues often emphasize that this particular pedagogical context have implications on the children’s wellbeing and learning possibilities throughout the day....
Tang, Wei; Newton, Ronald J; Weidner, Douglas A
2007-01-01
An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.
African Journals Online (AJOL)
Jane
2011-07-18
Jul 18, 2011 ... College of Horticulture, South China Agriculture University, Guangzhou 510642, Guangdong ... The pattern of expression vector pBI-PacPAP. ..... Disease scale ... These transgenic T0 plants were self-pollinated and the.
A computational theory of visual receptive fields.
Lindeberg, Tony
2013-12-01
A receptive field constitutes a region in the visual field where a visual cell or a visual operator responds to visual stimuli. This paper presents a theory for what types of receptive field profiles can be regarded as natural for an idealized vision system, given a set of structural requirements on the first stages of visual processing that reflect symmetry properties of the surrounding world. These symmetry properties include (i) covariance properties under scale changes, affine image deformations, and Galilean transformations of space-time as occur for real-world image data as well as specific requirements of (ii) temporal causality implying that the future cannot be accessed and (iii) a time-recursive updating mechanism of a limited temporal buffer of the past as is necessary for a genuine real-time system. Fundamental structural requirements are also imposed to ensure (iv) mutual consistency and a proper handling of internal representations at different spatial and temporal scales. It is shown how a set of families of idealized receptive field profiles can be derived by necessity regarding spatial, spatio-chromatic, and spatio-temporal receptive fields in terms of Gaussian kernels, Gaussian derivatives, or closely related operators. Such image filters have been successfully used as a basis for expressing a large number of visual operations in computer vision, regarding feature detection, feature classification, motion estimation, object recognition, spatio-temporal recognition, and shape estimation. Hence, the associated so-called scale-space theory constitutes a both theoretically well-founded and general framework for expressing visual operations. There are very close similarities between receptive field profiles predicted from this scale-space theory and receptive field profiles found by cell recordings in biological vision. Among the family of receptive field profiles derived by necessity from the assumptions, idealized models with very good qualitative
Transgene mus som sygdomsmodeller
DEFF Research Database (Denmark)
Schuster, Mikkel Bruhn; Porse, Bo Torben
2003-01-01
Transgenic animal models have proven to be useful tools in understanding both basic biology and the events associated with disease. Recent technical advances in the area of genomic manipulation in combination with the availability of the human and murine genomic sequences now allow the precise...... tailoring of the mouse genome. In this review we describe a few systems in which transgenic animal models have been employed for the purpose of studying the etiology of human diseases. Udgivelsesdato: 2003-Feb-17...
Directory of Open Access Journals (Sweden)
Mengling Wen
Full Text Available The Cre/loxP system is increasingly exploited for genetic manipulation of DNA in vitro and in vivo. It was previously reported that inactive ''split-Cre'' fragments could restore Cre activity in transgenic mice when overlapping co-expression was controlled by two different promoters. In this study, we analyzed recombination activities of split-Cre proteins, and found that no recombinase activity was detected in the in vitro recombination reaction in which only the N-terminal domain (NCre of split-Cre protein was expressed, whereas recombination activity was obtained when the C-terminal (CCre or both NCre and CCre fragments were supplied. We have also determined the recombination efficiency of split-Cre proteins which were co-expressed in hair roots of transgenic tobacco. No Cre recombination event was observed in hair roots of transgenic tobacco when the NCre or CCre genes were expressed alone. In contrast, an efficient recombination event was found in transgenic hairy roots co-expressing both inactive split-Cre genes. Moreover, the restored recombination efficiency of split-Cre proteins fused with the nuclear localization sequence (NLS was higher than that of intact Cre in transgenic lines. Thus, DNA recombination mediated by split-Cre proteins provides an alternative method for spatial and temporal regulation of gene expression in transgenic plants.
Huang, Jie Hong; Jiang, Rui; Kortstee, Anne; Dees, Dianka C.T.; Trindade, Luisa M.; Gruppen, Harry; Schols, Henk A.
2017-01-01
BACKGROUND: Genes encoding pectic enzymes were introduced into wild-type potato Karnico. Cell wall materials were extracted from Karnico and transgenic lines expressing β-galactosidase (β-Gal-14) or rhamnogalacturonan lyase (RGL-18). Pectic polysaccharides from the β-Gal-14 transgenic line exhibited
Recent advances in the development of new transgenic animal technology.
Miao, Xiangyang
2013-03-01
Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by genetic engineering technology so that these genes can be inherited and expressed by offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors in the production of transgenic animals. A variety of transgenic technologies are available. Each has its own advantages and disadvantages and needs further study because of unresolved technical and safety issues. Further studies will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. This article reviews the recently developed animal transgenic technologies, including the germ line stem cell-mediated method to improve efficiency, gene targeting to improve accuracy, RNA interference-mediated gene silencing technology, zinc-finger nuclease gene targeting technology and induced pluripotent stem cell technology. These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields.
Gene flow from transgenic common beans expressing the bar gene.
Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L
2010-01-01
Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium.
Design and Management of Field Trials of Transgenic Cereals
Bedő, Zoltán; Rakszegi, Mariann; Láng, László
The development of gene transformation systems has allowed the introgression of alien genes into plant genomes, thus providing a mechanism for broadening the genetic resources available to plant breeders. The design and the management of field trials vary according to the purpose for which transgenic cereals are developed. Breeders study the phenotypic and genotypic stability of transgenic plants, monitor the increase in homozygosity of transgenic genotypes under field conditions, and develop backcross generations to transfer the introduced genes into secondary transgenic cereal genotypes. For practical purposes, they may also multiply seed of the transgenic lines to produce sufficient amounts of grain for the detailed analysis of trait(s) of interest, to determine the field performance of transgenic lines, and to compare them with the non-transformed parental genotypes. Prior to variety registration, the Distinctness, Uniformity and Stability (DUS) tests and Value for Cultivation and Use (VCU) experiments are carried out in field trials. Field testing includes specific requirements for transgenic cereals to assess potential environmental risks. The capacity of the pollen to survive, establish and disseminate in the field test environment, the potential for gene transfer, the effects of products expressed by the introduced sequences and phenotypic and genotypic instability that might cause deleterious effects must all be specifically monitored, as required by EU Directives 2003/701/EC (1) on the release of genetically modified higher plants in the environment.
A dominant-negative mutation within AtMYB90 blocks flower pigment production in transgenic tobacco.
During de novo shoot induction in cultured transgenic tobacco callus a spontaneous mutation within the coding region of a AtMYB90 transgene produced a plant line in which the original transgene-induced over-pigmented phenotype (dark red/purple from anthocyanin overproduction in most tissues) was los...
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 2. Transgenics in Agriculture. D Rex Arunraj B Gajendra Babu. Classroom Volume 6 Issue 2 February 2001 pp 83-92. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/006/02/0083-0092 ...
The reception of relativity in the Netherlands
van Besouw, J.; van Dongen, J.A.E.F.
2013-01-01
This article reviews the early academic and public reception of Albert Einstein's theory of relativity in the Netherlands, particularly after Arthur Eddington's eclipse experiments of 1919. Initially, not much attention was given to relativity, as it did not seem an improvement over Hendrik A.
Language, gay pornography, and audience reception.
Leap, William L
2011-01-01
Erotic imagery is an important component of gay pornographic cinema, particularly, where work of audience reception is concerned. However, to assume the audience engagement with the films is limited solely to the erotic realm is to underestimate the workings of ideological power in the context and aftermath of reception. For example, the director of the film under discussion here (Men of Israel; Lucas, 2009b) intended to present an erotic celebration of the nation-state. Yet, most viewers ignore the particulars of context in their comments about audience reception, placing the "Israeli" narrative within a broader framework, using transnational rather than film-specific criteria to guide their "reading" of the Israeli-centered narrative. This article uses as its entry point the language that viewers employ when describing their reactions to Men of Israel on a gay video club's Web site; this article shows how the work of audience reception may draw attention to a film's erotic details while invoking social and political messages that completely reframe the film's erotic narrative.
The receptiveness toward remotely supported myofeedback treatment
Huis in 't Veld, M.H.A.; Voerman, Gerlienke; Hermens, Hermanus J.; Vollenbroek-Hutten, Miriam Marie Rosé
Remotely supported myofeedback treatment (RSMT) is considered to be a potentially valuable alternative to the conventional myofeedback treatment, as it might increase efficiency of care. This study was aimed at examining the receptiveness of potential end users (patients and professionals) with
Speech recognition employing biologically plausible receptive fields
DEFF Research Database (Denmark)
Fereczkowski, Michal; Bothe, Hans-Heinrich
2011-01-01
spectro-temporal receptive fields to auditory spectrogram input, motivated by the auditory pathway of humans, and ii) the adaptation or learning algorithms involved are biologically inspired. This is in contrast to state-of-the-art combinations of Mel-frequency cepstral coefficients and Hidden Markov...
Measuring receptive collocational competence across proficiency levels
Directory of Open Access Journals (Sweden)
Déogratias Nizonkiza
2015-12-01
Full Text Available The present study investigates, (i English as Foreign Language (EFL learners’ receptive collocational knowledge growth in relation to their linguistic proficiency level; (ii how much receptive collocational knowledge is acquired as proficiency develops; and (iii the extent to which receptive knowledge of collocations of EFL learners varies across word frequency bands. A proficiency measure and a collocation test were administered to English majors at the University of Burundi. Results of the study suggest that receptive collocational competence develops alongside EFL learners’ linguistic proficiency; which lends empirical support to Gyllstad (2007, 2009 and Author (2011 among others, who reported similar findings. Furthermore, EFL learners’ collocations growth seems to be quantifiable wherein both linguistic proficiency level and word frequency occupy a crucial role. While more gains in terms of collocations that EFL learners could potentially add as a result of change in proficiency are found at lower levels of proficiency; collocations of words from more frequent word bands seem to be mastered first, and more gains are found at more frequent word bands. These results confirm earlier findings on the non-linearity nature of vocabulary growth (cf. Meara 1996 and the fundamental role played by frequency in word knowledge for vocabulary in general (Nation 1983, 1990, Nation and Beglar 2007, which are extended here to collocations knowledge.
A Methodology for Conus APOE Reception Planning.
1982-09-01
mentioned, the reception process is a service-type system, which produces services to be rendered to the personnel and cargo flowing through it. The... Heizer , Ramon N. Chief, Supply Systems Branch, Dir- ectorate of Distribution, DCS/Logistics Operations, HQ AFLC, Wright-Patterson AFB OH. Personal inter
Ableism and the Reception of Improvised Soundsinging
Tonelli, Christopher
2016-01-01
Soundsinging is one name for the practice of making music using an idiosyncratic palette of vocal and non-vocal oral techniques. This paper is concerned with the reception of soundsinging and, more specifically, with listeners whose reactions to soundsinging involve attempts to contain the practice.
Chamber of Commerce reception for Dr. Lucas
1986-01-01
Dr. William R. Lucas, Marshall's fourth Center Director (1974-1986), delivers a speech in front of a picture of the lunar landscape with Earth looming in the background while attending a Huntsville Chamber of Commerce reception honoring his achievements as Director of Marshall Space Flight Center (MSFC).
The Critical Reception of Lewis Nordan
DEFF Research Database (Denmark)
Bjerre, Thomas Ærvold
2010-01-01
The essay covers the critical reception of Mississippi-writer Lewis Nordan from his debut in 1983 to the boost in scholarly attention in the new millennium. The essay covers newspaper reviews but pays particular attention to the many academic essays that have placed Nordan as a writer...
Inheritance and segregation of exogenous genes in transgenic cotton
Indian Academy of Sciences (India)
Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton. The transformed cotton varieties CCRI 30 and NewCott 33B expressing the Bt cryIA gene, and cotton line TFD expressing the tfdA gene were crossed with ...
Concetta Chiara Cannella; Gandolfa Cascio; Francesca Molonia; Serena Vitulo
2014-01-01
After the description of the main migration routes toward Italian territory, the article provides an overview of the laws and administrative policy instruments that characterize the system of reception and detention of migrants in Italy. This type of information can help psychosocial workers supporting migrants to better cope with various psychosocial issues, such as the landing in a foreign country. Following a report on the first reception intervention carried out in Palermo, Sicily, by Psi...
Current Writing: Text and Reception in Southern Africa: Advanced ...
African Journals Online (AJOL)
Current Writing: Text and Reception in Southern Africa: Advanced Search. Journal Home > Current Writing: Text and Reception in Southern Africa: Advanced Search. Log in or Register to get access to full text downloads.
Narendran, M; Deole, Satish G; Harkude, Satish; Shirale, Dattatray; Nanote, Asaram; Bihani, Pankaj; Parimi, Srinivas; Char, Bharat R; Zehr, Usha B
2013-08-01
Agrobacterium -mediated transformation system for okra using embryos was devised and the transgenic Bt plants showed resistance to the target pest, okra shoot, and fruit borer ( Earias vittella ). Okra is an important vegetable crop and progress in genetic improvement via genetic transformation has been impeded by its recalcitrant nature. In this paper, we describe a procedure using embryo explants for Agrobacterium-mediated transformation and tissue culture-based plant regeneration for efficient genetic transformation of okra. Twenty-one transgenic okra lines expressing the Bacillus thuringiensis gene cry1Ac were generated from five transformation experiments. Molecular analysis (PCR and Southern) confirmed the presence of the transgene and double-antibody sandwich ELISA analysis revealed Cry1Ac protein expression in the transgenic plants. All 21 transgenic plants were phenotypically normal and fertile. T1 generation plants from these lines were used in segregation analysis of the transgene. Ten transgenic lines were selected randomly for Southern hybridization and the results confirmed the presence of transgene integration into the genome. Normal Mendelian inheritance (3:1) of cry1Ac gene was observed in 12 lines out of the 21 T0 lines. We selected 11 transgenic lines segregating in a 3:1 ratio for the presence of one transgene for insect bioassays using larvae of fruit and shoot borer (Earias vittella). Fruit from seven transgenic lines caused 100 % larval mortality. We demonstrate an efficient transformation system for okra which will accelerate the development of transgenic okra with novel agronomically useful traits.
Weber, Ricardo Luís Mayer; Wiebke-Strohm, Beatriz; Bredemeier, Christian; Margis-Pinheiro, Márcia; de Brito, Giovani Greigh; Rechenmacher, Ciliana; Bertagnolli, Paulo Fernando; de Sá, Maria Eugênia Lisei; Campos, Magnólia de Araújo; de Amorim, Regina Maria Santos; Beneventi, Magda Aparecida; Margis, Rogério; Grossi-de-Sa, Maria Fátima; Bodanese-Zanettini, Maria Helena
2014-12-10
Drought is by far the most important environmental factor contributing to yield losses in crops, including soybeans [Glycine max (L.) Merr.]. To address this problem, a gene that encodes an osmotin-like protein isolated from Solanum nigrum var. americanum (SnOLP) driven by the UBQ3 promoter from Arabidopsis thaliana was transferred into the soybean genome by particle bombardment. Two independently transformed soybean lines expressing SnOLP were produced. Segregation analyses indicated single-locus insertions for both lines. qPCR analysis suggested a single insertion of SnOLP in the genomes of both transgenic lines, but one copy of the hpt gene was inserted in the first line and two in the second line. Transgenic plants exhibited no remarkable phenotypic alterations in the seven analyzed generations. When subjected to water deficit, transgenic plants performed better than the control ones. Leaf physiological measurements revealed that transgenic soybean plants maintained higher leaf water potential at predawn, higher net CO2 assimilation rate, higher stomatal conductance and higher transpiration rate than non-transgenic plants. Grain production and 100-grain weight were affected by water supply. Decrease in grain productivity and 100-grain weight were observed for both transgenic and non-transgenic plants under water deficit; however, it was more pronounced for non-transgenic plants. Moreover, transgenic lines showed significantly higher 100-grain weight than non-transgenic plants under water shortage. This is the first report showing that expression of SnOLP in transgenic soybeans improved physiological responses and yield components of plants when subjected to water deficit, highlighting the potential of this gene for biotechnological applications.
Prediction of turning stability using receptance coupling
Jasiewicz, Marcin; Powałka, Bartosz
2018-01-01
This paper presents an issue of machining stability prediction of dynamic "lathe - workpiece" system evaluated using receptance coupling method. Dynamic properties of the lathe components (the spindle and the tailstock) are assumed to be constant and can be determined experimentally based on the results of the impact test. Hence, the variable of the system "machine tool - holder - workpiece" is the machined part, which can be easily modelled analytically. The method of receptance coupling enables a synthesis of experimental (spindle, tailstock) and analytical (machined part) models, so impact testing of the entire system becomes unnecessary. The paper presents methodology of analytical and experimental models synthesis, evaluation of the stability lobes and experimental validation procedure involving both the determination of the dynamic properties of the system and cutting tests. In the summary the experimental verification results would be presented and discussed.
Online Movie Trailers - A Reception Analysis
Jensen, Frida Videbæk; Rozé, Caroline
2014-01-01
This project is a reception analysis of how a target group receive online movie trailers. It utilized a focus group as means of research with participants from the dormitories Kollibrien and Korallen. We concluded that the group we investigated were not interested in online movie trailers as anything else than a preview of a movie. They preferred to experience movie trailers in the cinema. Their opinion of specific movie trailers were also determined by whether or not they identified with the...
Eugen Bleuler 150: Bleuler's reception of Freud.
Dalzell, Thomas G
2007-12-01
On the 150th anniversary of Eugen Bleuler's birth, this article examines his reception of Sigmund Freud and his use of Freudian theory to understand the symptoms of schizophrenia. In addition, in contrast to earlier interpretations of Bleuler's relationship with Freud in terms of an eventual personal and theoretical incompatibility, the article demonstrates that, although Bleuler did distance himself from the psychoanalytic movement, he remained consistent in his views on Freud's theories.
Gravitational wave reception by a sphere
International Nuclear Information System (INIS)
Ashby, N.; Dreitlein, J.
1975-01-01
The reception of gravitational waves by an elastic self-gravitating spherical detector is studied in detail. The equations of motion of a detector driven by a gravitational wave are presented in the intuitively convenient coordinate system of Fermi. An exact analytic solution is given for the homogeneous isotropic sphere. Nonlinear effects of a massive self-gravitating system are computed for a body of mass equal to that of the earth, and are shown to be numerically important
Dehydrins Impart Protection against Oxidative Stress in Transgenic Tobacco Plants.
Halder, Tanmoy; Upadhyaya, Gouranga; Basak, Chandra; Das, Arup; Chakraborty, Chandrima; Ray, Sudipta
2018-01-01
Environmental stresses generate reactive oxygen species (ROS) which might be detrimental to the plants when produced in an uncontrolled way. However, the plants ameliorate such stresses by synthesizing antioxidants and enzymes responsible for the dismutation of ROS. Additionally, the dehydrins were also able to protect the inactivation of the enzyme lactate dehydrogenase against hydroxyl radicals (OH ⋅ ) generated during Fenton's reaction. SbDhn1 and SbDhn2 overexpressing transgenic tobacco plants were able to protect against oxidative damage. Transgenic tobacco lines showed better photosynthetic efficiency along with high chlorophyll content, soluble sugar and proline. However, the malonyl dialdehyde (MDA) content was significantly lower in transgenic lines. Experimental evidence demonstrates the protective effect of dehydrins on electron transport chain in isolated chloroplast upon methyl viologen (MV) treatment. The transgenic tobacco plants showed significantly lower superoxide radical generation () upon MV treatment. The accumulation of the H 2 O 2 was also lower in the transgenic plants. Furthermore, in the transgenic plants the expression of ROS scavenging enzymes was higher compared to non-transformed (NT) or vector transformed (VT) plants. Taken together these data, during oxidative stress dehydrins function by scavenging the () directly and also by rendering protection to the enzymes responsible for the dismutation of () thereby significantly reducing the amount of hydrogen peroxides formed. Increase in proline content along with other antioxidants might also play a significant role in stress amelioration. Dehydrins thus function co-operatively with other protective mechanisms under oxidative stress conditions rendering protection in stress environment.
From conciliar ecumenism to transformative receptive ecumenism
Directory of Open Access Journals (Sweden)
Mary-Anne Plaatjies van Huffel
2017-09-01
Full Text Available This article attends to ecumenicity as the second reformation. The ecumenical organisations and agencies hugely influenced the theological praxis and reflection of the church during the past century. The First World Council of Churches (WCC Assembly in Amsterdam, the Netherlands, has been described as the most significant event in church history since the Reformation during the past decade. We saw the emergence of two initiatives that are going to influence ecumenical theology and practice in future, namely the Receptive Ecumenism and Catholic Learning research project, based in Durham, United Kingdom, and the International Theological Colloquium for Transformative Ecumenism of the WCC. Both initiatives constitute a fresh approach in methodology to ecumenical theology and practice. Attention will be given in this article to conciliar ecumenism, receptive ecumenism, transformative ecumenism and its implications for the development of an African transformative receptive ecumenism. In doing so, we should take cognisance of what Küng says about a confessionalist ghetto mentality: ‘We must avoid a confessionalistic ghetto mentality. Instead we should espouse an ecumenical vision that takes into consideration the world religions as well as contemporary ideologies: as much tolerance as possible toward those things outside the Church, toward the religious in general, and the human in general, and the development of that which is specifically Christian belong together!’
Receptive fields selection for binary feature description.
Fan, Bin; Kong, Qingqun; Trzcinski, Tomasz; Wang, Zhiheng; Pan, Chunhong; Fua, Pascal
2014-06-01
Feature description for local image patch is widely used in computer vision. While the conventional way to design local descriptor is based on expert experience and knowledge, learning-based methods for designing local descriptor become more and more popular because of their good performance and data-driven property. This paper proposes a novel data-driven method for designing binary feature descriptor, which we call receptive fields descriptor (RFD). Technically, RFD is constructed by thresholding responses of a set of receptive fields, which are selected from a large number of candidates according to their distinctiveness and correlations in a greedy way. Using two different kinds of receptive fields (namely rectangular pooling area and Gaussian pooling area) for selection, we obtain two binary descriptors RFDR and RFDG .accordingly. Image matching experiments on the well-known patch data set and Oxford data set demonstrate that RFD significantly outperforms the state-of-the-art binary descriptors, and is comparable with the best float-valued descriptors at a fraction of processing time. Finally, experiments on object recognition tasks confirm that both RFDR and RFDG successfully bridge the performance gap between binary descriptors and their floating-point competitors.
Learning receptive fields using predictive feedback.
Jehee, Janneke F M; Rothkopf, Constantin; Beck, Jeffrey M; Ballard, Dana H
2006-01-01
Previously, it was suggested that feedback connections from higher- to lower-level areas carry predictions of lower-level neural activities, whereas feedforward connections carry the residual error between the predictions and the actual lower-level activities [Rao, R.P.N., Ballard, D.H., 1999. Nature Neuroscience 2, 79-87.]. A computational model implementing the hypothesis learned simple cell receptive fields when exposed to natural images. Here, we use predictive feedback to explain tuning properties in medial superior temporal area (MST). We implement the hypothesis using a new, biologically plausible, algorithm based on matching pursuit, which retains all the features of the previous implementation, including its ability to efficiently encode input. When presented with natural images, the model developed receptive field properties as found in primary visual cortex. In addition, when exposed to visual motion input resulting from movements through space, the model learned receptive field properties resembling those in MST. These results corroborate the idea that predictive feedback is a general principle used by the visual system to efficiently encode natural input.
Transgenic algae engineered for higher performance
Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J
2014-10-21
The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.
Transgenic Cavendish bananas with resistance to Fusarium wilt tropical race 4.
Dale, James; James, Anthony; Paul, Jean-Yves; Khanna, Harjeet; Smith, Mark; Peraza-Echeverria, Santy; Garcia-Bastidas, Fernando; Kema, Gert; Waterhouse, Peter; Mengersen, Kerrie; Harding, Robert
2017-11-14
Banana (Musa spp.) is a staple food for more than 400 million people. Over 40% of world production and virtually all the export trade is based on Cavendish banana. However, Cavendish banana is under threat from a virulent fungus, Fusarium oxysporum f. sp. cubense tropical race 4 (TR4) for which no acceptable resistant replacement has been identified. Here we report the identification of transgenic Cavendish with resistance to TR4. In our 3-year field trial, two lines of transgenic Cavendish, one transformed with RGA2, a gene isolated from a TR4-resistant diploid banana, and the other with a nematode-derived gene, Ced9, remain disease free. Transgene expression in the RGA2 lines is strongly correlated with resistance. Endogenous RGA2 homologs are also present in Cavendish but are expressed tenfold lower than that in our most resistant transgenic line. The expression of these homologs can potentially be elevated through gene editing, to provide non-transgenic resistance.
Overexpression of host plant urease in transgenic silkworms.
Jiang, Liang; Huang, Chunlin; Sun, Qiang; Guo, Huizhen; Peng, Zhengwen; Dang, Yinghui; Liu, Weiqiang; Xing, Dongxu; Xu, Guowen; Zhao, Ping; Xia, Qingyou
2015-06-01
Bombyx mori and mulberry constitute a model of insect-host plant interactions. Urease hydrolyzes urea to ammonia and is important for the nitrogen metabolism of silkworms because ammonia is assimilated into silk protein. Silkworms do not synthesize urease and acquire it from mulberry leaves. We synthesized the artificial DNA sequence ureas using the codon bias of B. mori to encode the signal peptide and mulberry urease protein. A transgenic vector that overexpresses ure-as under control of the silkworm midgut-specific P2 promoter was constructed. Transgenic silkworms were created via embryo microinjection. RT-PCR results showed that urease was expressed during the larval stage and qPCR revealed the expression only in the midgut of transgenic lines. Urea concentration in the midgut and hemolymph of transgenic silkworms was significantly lower than in a nontransgenic line when silkworms were fed an artificial diet. Analysis of the daily body weight and food conversion efficiency of the fourth and fifth instar larvae and economic characteristics indicated no differences between transgenic silkworms and the nontransgenic line. These results suggested that overexpression of host plant urease promoted nitrogen metabolism in silkworms.
Plant biotechnology: transgenic crops.
Shewry, Peter R; Jones, Huw D; Halford, Nigel G
2008-01-01
Transgenesis is an important adjunct to classical plant breeding, in that it allows the targeted manipulation of specific characters using genes from a range of sources. The current status of crop transformation is reviewed, including methods of gene transfer, the selection of transformed plants and control of transgene expression. The application of genetic modification technology to specific traits is then discussed, including input traits relating to crop production (herbicide tolerance and resistance to insects, pathogens and abiotic stresses) and output traits relating to the composition and quality of the harvested organs. The latter include improving the nutritional quality for consumers as well as the improvement of functional properties for food processing.
Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus.
Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide
2015-01-01
Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.
Steven L. Voelker; Barbara Lachenbruch; Frederick C. Meinzer; Peter Kitin; Steven H. Strauss
2011-01-01
We studied xylem anatomy and hydraulic architecture in 14 transgenic insertion events and a control line of hybrid poplar (Populus spp.) that varied in lignin content. Transgenic events had different levels of down-regulation of two genes encoding 4-coumarate:coenzyme A ligase (4CL). Two-year-old trees were characterized after...
[TSA improve transgenic porcine cloned embryo development and transgene expression].
Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua
2011-07-01
Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.
Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh
2012-10-01
Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.
Ge, Jia; Wang, Lijun; Yang, Chen; Ran, Lingyu; Wen, Mengling; Fu, Xianan; Fan, Di; Luo, Keming
2016-10-01
An approach for restoring recombination activity of complementation split-Cre was developed to excise the transgene in hybrid progeny of GM crops. Growing concerns about the biosafety of genetically modified (GM) crops has currently become a limited factor affecting the public acceptance. Several approaches have been developed to generate selectable-marker-gene-free GM crops. However, no strategy was reported to be broadly applicable to hybrid crops. Previous studies have demonstrated that complementation split-Cre recombinase restored recombination activity in transgenic plants. In this study, we found that split-Cre mediated by split-intein Synechocystis sp. DnaE had high recombination efficiency when Cre recombinase was split at Asp232/Asp233 (866 bp). Furthermore, we constructed two plant expression vectors, pCA-NCre-In and pCA-Ic-CCre, containing NCre866-In and Ic-CCre866 fragments, respectively. After transformation, parent lines of transgenic Arabidopsis with one single copy were generated and used for hybridization. The results of GUS staining demonstrated that the recombination activity of split-Cre could be reassembled in these hybrid progeny of transgenic plants through hybridization and the foreign genes flanked by two loxP sites were efficiently excised. Our strategy may provide an effective approach for generating the next generation of GM hybrid crops without biosafety concerns.
The reception of Austrian economics in Italy
Directory of Open Access Journals (Sweden)
Antonio Magliulo
2018-04-01
Full Text Available Nowadays the Austrian School enjoys high reputation in Italy: books by Mises, Hayek and other Austrian economists are constantly republished and reviewed with great interest, both inside and outside academic circles. The situation was very different decades ago, when just a few Italian economists devoted attention to the Austrian School. This work studies the reception of Austrian Economics in Italy, from the beginning to our days, so as to bring out, by way of comparison, relevant features of Italian economic culture. We will try to offer just an overview of the entire story, in an attempt to provide useful elements for a deeper analysis of further topics and periods.
Directory of Open Access Journals (Sweden)
Venny Eka Meidasari
2014-06-01
Full Text Available Literary theory sees reception theory from the reader response that emphasizes the reader’s reception of a literary text. It is generally called audience reception in the analysis of communications models. In literary studies, reception theory originated from the work of Hans-Robert Jauss in the late 1960s. Communication only means that the original message will be clearly sent in its equivalent context to the target receptor. Similarly, the main role of translators is to send the message across without any form of distortion or emphasis. It is delivering the genuine context of the message to the language that the active receptor understands. A single mistake in a context translation can result to offensive message that can eventually lead to misunderstandings between active receptors. This paper proposes on the role of translator as the mediator between a writer of the original text and the active target language receptors of translated version in the course of communication which definitely affects the process and result of translation practice. It also reveals the emphasis on the creation text of the translation theories originated from the strategic communication theories, which hopefully leads to a dream of the most equivalence between the text and the translated version.
Single molecule Raman spectroscopic assay to detect transgene from GM plants.
Kadam, Ulhas S; Chavhan, Rahul L; Schulz, Burkhard; Irudayaraj, Joseph
2017-09-01
Substantial concerns have been raised for the safety of transgenics on human health and environment. Many organizations, consumer groups, and environmental agencies advocate for stringent regulations to avoid transgene products' contamination in food cycle or in nature. Here we demonstrate a novel approach using surface enhanced Raman spectroscopy (SERS) to detect and quantify transgene from GM plants. We show a highly sensitive and accurate quantification of transgene DNA from multiple transgenic lines of Arabidopsis. The assay allows us to detect and quantify the transgenes as low as 0.10 pg without need for PCR-amplification. This technology is relatively cheap, quick, simple, and suitable for detection at low target concentration. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Munir, I.; Hussan, W.; Kazi, M.; Mian, A.
2016-01-01
Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)
Ting, Jonathan T; Feng, Guoping
2014-01-01
The development and application of diverse BAC transgenic rodent lines has enabled rapid progress for precise molecular targeting of genetically-defined cell types in the mammalian central nervous system. These transgenic tools have played a central role in the optogenetic revolution in neuroscience. Indeed, an overwhelming proportion of studies in this field have made use of BAC transgenic Cre driver lines to achieve targeted expression of optogenetic probes in the brain. In addition, several BAC transgenic mouse lines have been established for direct cell-type specific expression of Channelrhodopsin-2 (ChR2). While the benefits of these new tools largely outweigh any accompanying challenges, many available BAC transgenic lines may suffer from confounds due in part to increased gene dosage of one or more "extra" genes contained within the large BAC DNA sequences. Here we discuss this under-appreciated issue and propose strategies for developing the next generation of BAC transgenic lines that are devoid of extra genes. Furthermore, we provide evidence that these strategies are simple, reproducible, and do not disrupt the intended cell-type specific transgene expression patterns for several distinct BAC clones. These strategies may be widely implemented for improved BAC transgenesis across diverse disciplines.
Werner Sombart and his reception in Italy
Directory of Open Access Journals (Sweden)
Simona Pisanelli
2015-03-01
Full Text Available This article intends to focus on the difficulty encountered by Werner Sombart’s works in gaining a hearing in various Italian intellectual circuits. As is well known, Sombart belonged to the German Historical School of economics, sharing with other scholars of that school the same problems in getting his work known in Italy. Our aim is to explain the reason for this hostile reception. First of all, we will analyze the factors which generally hindered the spread of the German Historical School in Italy, recognizing in economists like Francesco Ferrara, Idealists like Benedetto Croce and Marxists like Antonio Labriola some of its strongest opponents. We will dwell on the cases of Gustav Schmoller and Max Weber, in order to give two representative examples of the slow and complicated Italian reception of methodological approaches and analytical perspectives which characterized the scientific experience of the German Historical School. Secondly, we will try to show why Sombart was even less appreciated than other German social scientists, giving the reasons that attracted severe criticism from economists, economic historians and sociologists towards his interdisciplinary approach in the analysis of modern capitalism. Finally, we will show the reasons of the contemporary rediscovery of Sombart and of his works.
International Nuclear Information System (INIS)
Obata, Y.; Matsudaira, Y.; Hasegawa, H.; Tamaki, H.; Takahashi, T.; Morita, A.; Kasai, K.
1993-01-01
As a result of abnormal development of the thymus of these mice, TCR αβ lineage of the T cell differentiation is disturbed and cells belonging to the TCR γδ CD4 - CD8 - double negative (DN) lineage become preponderant. The γδ DN cells migrate into peripheral lymphoid organs and constitute nearly 50% of peripheral T cells. Immune function of the transgenic mice is severely impaired, indicating that the γδ cells are incapable of participating in these reactions. Molecular and serological analyses of T-cell lymphomas reveal that they belong to the γδ lineage. Tg.Tla a -3-1 mice should be useful in defining the role of TL in normal and abnormal T cell differentiation as well as in the development of T-cell lymphomas, and further they should facilitate studies on the differentiation and function of γδ T cells. We isolated T3 b -TL gene from B6 mice and constructed a chimeric gene in which T3 b -TL is driven by the promoter of H-2K b . With the chimeric gene, two transgenic mouse strains, Tg. Con.3-1 and -2 have been derived in C3H background. Both strains express TL antigen in various tissues including skin. The skin graft of transgenic mice on C3H and (B6 X C3H)F 1 mice were rejected. In the mice which rejected the grafts, CD8 + TCRαβ cytotoxic T cells (CTL) against TL antigens were recognized. The recognition of TL by CTL did not require the antigen presentation by H-2 molecules. The results indicated that TL antigen in the skin becomes a transplantation antigen and behaves like a typical allogeneic MHC class I antigen. The facts that (B6 X C3H)F 1 mice rejected the skin expressing T3 b -TL antigen and induced CTL that killed TL + lymphomas of B6 origin revealed that TL antigen encoded by T3 b -TL is recognized as non-self in B6 mice. Experiments are now extended to analyze immune responses to TL antigen expressed on autochthonous T cell lymphomas. (J.P.N.)
Segregation and expression of transgenes in the progenies of Bt ...
African Journals Online (AJOL)
DR. NJ TONUKARI
2012-04-17
Apr 17, 2012 ... segregation was observed in BC1F1, BC1F2 and F2 populations derived .... randomly chosen at the tillering stage respectively and were ground .... Figure 2. Southern blot of Hind III-digested DNA from Bt transgenic rice line ...
Transgenic engineering of male-specific muscular hypertrophy
DEFF Research Database (Denmark)
Pirottin, D.; Grobet, L.; Adamantidis, A.
2005-01-01
Using a two-step procedure involving insertional gene targeting and recombinase-mediated cassette exchange in ES cells, we have produced two lines of transgenic mice expressing a dominant-negative latency-associated myostatin propeptide under control of the myosin light chain 1F promoter and 1/3 ...
Complex genomic rearrangement in CCS-LacZ transgenic mice.
Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I
2007-02-01
The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.
Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T
2014-12-01
Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.
Directory of Open Access Journals (Sweden)
Tina Schäfer
2012-01-01
Full Text Available This study investigated the impact of constitutively expressed Trichoderma atroviride genes encoding exochitinase nag70 or endochitinase ech42 in transgenic lines of the apple cultivar Pinova on the symbiosis with arbuscular mycorrhizal fungi (AMF. We compared the exo- and endochitinase activities of leaves and roots from non-transgenic Pinova and the transgenic lines T386 and T389. Local and systemic effects were examined using own-rooted trees and trees grafted onto rootstock M9. Scab susceptibility was also assessed in own-rooted and grafted trees. AMF root colonization was assessed microscopically in the roots of apple trees cultivated in pots with artificial substrate and inoculated with the AMF Glomus intraradices and Glomus mosseae. Own-rooted transgenic lines had significantly higher chitinase activities in their leaves and roots compared to non-transgenic Pinova. Both of the own-rooted transgenic lines showed significantly fewer symptoms of scab infection as well as significantly lower root colonization by AMF. Biomass production was significantly reduced in both own-rooted transgenic lines. Rootstock M9 influenced chitinase activities in the leaves of grafted scions. When grafted onto M9, the leaf chitinase activities of non-transgenic Pinova (M9/Pinova and transgenic lines (M9/T386 and M9/T389 were not as different as when grown on their own roots. M9/T386 and M9/T389 were only temporarily less infected by scab than M9/Pinova. M9/T386 and M9/T389 did not differ significantly from M9/Pinova in their root chitinase activities, AMF root colonization and biomass.
Haas, Michael J.; Dragan, Yvonne P.; Hikita, Hiroshi; Shimel, Randee; Takimoto, Koichi; Heath, Susan; Vaughan, Jennifer; Pitot, Henry C.
1999-01-01
Transgenic Sprague-Dawley rats expressing either human transforming growth factor-α (TGFα) or simian virus 40 large and small T antigen (TAg), each under the control of the phosphoenolpyruvate carboxykinase (PEPCK) promoter, were developed as an approach to the study of the promotion of hepatocarcinogenesis in the presence of a transgene regulatable by diet and/or hormones. Five lines of PEPCK-TGFα transgenic rats were established, each genetic line containing from one to several copies of the transgene per haploid genome. Two PEPCK-TAg transgenic founder rats were obtained, each with multiple copies of the transgene. Expression of the transgene was undetectable in the TGFα transgenic rats and could not be induced when the animals were placed on a high-protein, low-carbohydrate diet. The transgene was found to be highly methylated in all of these lines. No pathological alterations in the liver and intestine were observed at any time (up to 2 years) during the lives of these rats. One line of transgenic rats expressing the PEPCK-TAg transgene developed pancreatic islet cell hyperplasias and carcinomas, with few normal islets evident in the pancreas. This transgene is integrated as a hypomethylated tandem array of 10 to 12 copies on chromosome 8q11. Expression of large T antigen is highest in pancreatic neoplasms, but is also detectable in the normal brain, kidney, and liver. Mortality is most rapid in males, starting at 5 months of age and reaching 100% by 8 months. Morphologically, islet cell differentiation in the tumors ranges from poor to well differentiated, with regions of necrosis and fibrosis. Spontaneous metastasis of TAg-positive tumor cells to regional lymph nodes was observed. These studies indicate the importance of DNA methylation in the repression of specific transgenes in the rat. However, the expression of the PEPCK-TAg induces neoplastic transformation in islet cells, probably late in neuroendocrine cell differentiation. T antigen expression
Transgene x environment interactions in genetically modified wheat.
Zeller, Simon L; Kalinina, Olena; Brunner, Susanne; Keller, Beat; Schmid, Bernhard
2010-07-12
The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM) plants. We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology.
Transgene x environment interactions in genetically modified wheat.
Directory of Open Access Journals (Sweden)
Simon L Zeller
Full Text Available BACKGROUND: The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM plants. METHODS AND FINDINGS: We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. CONCLUSIONS: Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology.
Transgenics, agroindustry and food sovereignty
Directory of Open Access Journals (Sweden)
Xavier Alejandro León Vega
2014-10-01
Full Text Available Food sovereignty has been implemented constitutionally in Ecuador; however, many of the actions and policies are designed to benefit the dominant model of food production, based in agroindustry, intensive monocultures, agrochemicals and transgenics. This article reflects upon the role of family farming as a generator of food sovereignty, and secondly the threat to them by agroindustry agriculture based in transgenic. The role played by food aid in the introduction of transgenic in Latin America and other regions of the world is also analyzed.
Post-mortem re-cloning of a transgenic red fluorescent protein dog.
Hong, So Gun; Koo, Ok Jae; Oh, Hyun Ju; Park, Jung Eun; Kim, Minjung; Kim, Geon-A; Park, Eun Jung; Jang, Goo; Lee, Byeong-Chun
2011-12-01
Recently, the world's first transgenic dogs were produced by somatic cell nuclear transfer. However, cellular senescence is a major limiting factor for producing more advanced transgenic dogs. To overcome this obstacle, we rejuvenated transgenic cells using a re-cloning technique. Fibroblasts from post-mortem red fluorescent protein (RFP) dog were reconstructed with in vivo matured oocytes and transferred into 10 surrogate dogs. One puppy was produced and confirmed as a re-cloned dog. Although the puppy was lost during birth, we successfully established a rejuvenated fibroblast cell line from this animal. The cell line was found to stably express RFP and is ready for additional genetic modification.
Receptiveness to Flexible Employment at Hungarian SMEs
Directory of Open Access Journals (Sweden)
Ákos Essősy
2018-04-01
Full Text Available Nowadays, only companies that are adaptable and flexible in their structure and processes can survive. The basis for a motivated company aiming for peak performance is organisational innovation. Hungary is one of the less innovative countries in Europe. Only organisations that can integrate new solutions smoothly into their everyday operations will remain truly competitive. The Government of Hungary, in its Partnership Agreement with the European Union, set out the goals for improving and supporting the adaptability of enterprises, the promotion of flexible and family-friendly workplace practices and services, and the employment of women with young children. The aim of this study is to demonstrate, through a Hungarian example, the receptiveness of Hungarian small and medium-sized enterprises to flexible forms of employment. The effect of flexible employment on economic adaptability and competitiveness through workforce efficiency and retention is examined. Its aim is the raise the awareness of options to increase employment among Hungarian SME managers.
Yamori, Wataru; Kondo, Eri; Sugiura, Daisuke; Terashima, Ichiro; Suzuki, Yuji; Makino, Amane
2016-01-01
Although photosynthesis is the most important source for biomass and grain yield, a lack of correlation between photosynthesis and plant yield among different genotypes of various crop species has been frequently observed. Such observations contribute to the ongoing debate whether enhancing leaf photosynthesis can improve yield potential. Here, transgenic rice plants that contain variable amounts of the Rieske FeS protein in the cytochrome (cyt) b6 /f complex between 10 and 100% of wild-type levels have been used to investigate the effect of reductions of these proteins on photosynthesis, plant growth and yield. Reductions of the cyt b6 /f complex did not affect the electron transport rates through photosystem I but decreased electron transport rates through photosystem II, leading to concomitant decreases in CO2 assimilation rates. There was a strong control of plant growth and grain yield by the rate of leaf photosynthesis, leading to the conclusion that enhancing photosynthesis at the single-leaf level would be a useful target for improving crop productivity and yield both via conventional breeding and biotechnology. The data here also suggest that changing photosynthetic electron transport rates via manipulation of the cyt b6 /f complex could be a potential target for enhancing photosynthetic capacity in higher plants. © 2015 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Ryan C Smith
Full Text Available Genetically modified mosquitoes have been proposed as an alternative strategy to reduce the heavy burden of malaria. In recent years, several proof-of-principle experiments have been performed that validate the idea that mosquitoes can be genetically modified to become refractory to malaria parasite development.We have created two transgenic lines of Anophelesstephensi, a natural vector of Plasmodium falciparum, which constitutively secrete a catalytically inactive phospholipase A2 (mPLA2 into the midgut lumen to interfere with Plasmodium ookinete invasion. Our experiments show that both transgenic lines expressing mPLA2 significantly impair the development of rodent malaria parasites, but only one line impairs the development of human malaria parasites. In addition, when fed on malaria-infected blood, mosquitoes from both transgenic lines are more fecund than non-transgenic mosquitoes. Consistent with these observations, cage experiments with mixed populations of transgenic and non-transgenic mosquitoes show that the percentage of transgenic mosquitoes increases when maintained on Plasmodium-infected blood.Our results suggest that the expression of an anti-Plasmodium effector gene gives transgenic mosquitoes a fitness advantage when fed malaria-infected blood. These findings have important implications for future applications of transgenic mosquito technology in malaria control.
Koller, Teresa; Brunner, Susanne; Herren, Gerhard; Hurni, Severine; Keller, Beat
2018-04-01
The combined effects of enhanced total transgene expression level and allele-specificity combination in transgenic allele-pyramided Pm3 wheat lines result in improved powdery mildew field resistance without negative pleiotropic effects. Allelic Pm3 resistance genes of wheat confer race-specific resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) and encode nucleotide-binding domain, leucine-rich repeat (NLR) receptors. Transgenic wheat lines overexpressing alleles Pm3a, b, c, d, f, and g have previously been generated by transformation of cultivar Bobwhite and tested in field trials, revealing varying degrees of powdery mildew resistance conferred by the transgenes. Here, we tested four transgenic lines each carrying two pyramided Pm3 alleles, which were generated by crossbreeding of lines transformed with single Pm3 alleles. All four allele-pyramided lines showed strongly improved powdery mildew resistance in the field compared to their parental lines. The improved resistance results from the two effects of enhanced total transgene expression levels and allele-specificity combinations. In contrast to leaf segment tests on greenhouse-grown seedlings, no allelic suppression was observed in the field. Plant development and yield scores of the pyramided lines were similar to the mean scores of the corresponding parental lines, and thus, the allele pyramiding did not cause any negative effects. On the contrary, in pyramided line, Pm3b × Pm3f normal plant development was restored compared to the delayed development and reduced seed set of parental line Pm3f. Allele-specific RT qPCR revealed additive transgene expression levels of the two Pm3 alleles in the pyramided lines. A positive correlation between total transgene expression level and powdery mildew field resistance was observed. In summary, allele pyramiding of Pm3 transgenes proved to be successful in enhancing powdery mildew field resistance.
33 CFR 158.310 - Reception facilities: General.
2010-07-01
... order to pass the inspection under § 158.160, must— (1) Be a reception facility as defined under § 158... residue; (5) Be capable of receiving NLS residue from an oceangoing ship within 24 hours after notice by that ship of the need for reception facilities; and (6) Be capable of completing the transfer of NLS...
Developmental Stages in Receptive Grammar Acquisition: A Processability Theory Account
Buyl, Aafke; Housen, Alex
2015-01-01
This study takes a new look at the topic of developmental stages in the second language (L2) acquisition of morphosyntax by analysing receptive learner data, a language mode that has hitherto received very little attention within this strand of research (for a recent and rare study, see Spinner, 2013). Looking at both the receptive and productive…
The Comparative Reception of Darwinism: A Brief History
Glick, Thomas F.
2010-01-01
The subfield of Darwin studies devoted to comparative reception coalesced around 1971 with the planning of a conference on the subject, at the University of Texas at Austin held in April 1972. The original focus was western Europe, Russia and the United States. Subsequently a spate of studies on the Italian reception added to the Eurocentric…
Transgene teknikker erstatter problematisk avl
DEFF Research Database (Denmark)
Alstrup, Aage Kristian Olsen; Hansen, Axel Kornerup
2016-01-01
Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder.......Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder....
Abouseadaa, Heba H; Osman, Gamal H; Ramadan, Ahmed M; Hassanein, Sameh E; Abdelsattar, Mohamed T; Morsy, Yasser B; Alameldin, Hussien F; El-Ghareeb, Doaa K; Nour-Eldin, Hanan A; Salem, Reda; Gad, Adel A; Elkhodary, Soheir E; Shehata, Maher M; Mahfouz, Hala M; Eissa, Hala F; Bahieldin, Ahmed
2015-07-22
Wheat is considered the most important cereal crop all over the world. The wheat weevil Sitophilus granarius is a serious insect pests in much of the wheat growing area worldwide and is responsible for significant loss of yield. Avidin proteins has been proposed to function as plant defense agents against insect pests. A synthetic avidin gene was introduced into spring wheat (Triticum aestivum L.) cv. Giza 168 using a biolistic bombardment protocol. The presence and expression of the transgene in six selected T0 transgenic wheat lines were confirmed at the molecular level. Accumulation of avidin protein was detected in transgenic plants compared to non-transgenic plants. Avidin transgene was stably integrated, transcribed and translated as indicated by Southern blot, ELISA, and dot blot analyses, with a high level of expression in transgenic wheat seeds. However, no expression was detected in untransformed wheat seeds. Functional integrity of avidin was confirmed by insect bioassay. The results of bioassay using transgenic wheat plants challenged with wheat weevil revealed 100 % mortality of the insects reared on transgenic plants after 21 days. Transgenic wheat plants had improved resistance to Sitophilus granarius.
Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.
Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki
2010-04-01
Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did
Reijneveld, S.A.; de Boer, J.B.; Bean, T.; Korfker, D.G.
2005-01-01
We assessed the effects of a stringent reception policy on the mental health of unaccompanied adolescent asylum seekers by comparing the mental health of adolescents in a restricted campus reception setting and in a setting offering more autonomy (numbers [response rates]: 69 [93%] and 53 [69%],
Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K
2000-06-01
Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.
Identification of Secretory Odontoblasts Using DMP1-GFP Transgenic Mice
Balic, Anamaria; Mina, Mina
2011-01-01
Terminal differentiation of odontoblasts from dental papilla is a long process involving several intermediate steps and changes in the transcriptional profile and expression of proteins secreted by cells in the odontoblast lineage. Transgenic mouse lines in which GFP expression is under the control of tissue-and stage specific promoters have provided powerful experimental tools for identification and isolation of cells at specific stages of differentiation along a lineage. Our previous studies showed utilization of pOBCol3.6GFP and pOBCol2.3GFP animals for identification of odontoblasts at early and late stages of polarization respectively. In the present study we used the DMP1-GFP transgenic animal as an experimental model to examine its expression during the differentiation of odontoblasts from progenitor cells in vivo and in vitro. Our observations showed that DMP1-GFP transgene is first activated in secretory/functional odontoblasts engaged in secretion of predentin and then transiently expressed at high levels in newly differentiated odontoblasts. Expression of DMP1-GFP was down-regulated in highly differentiated odontoblasts. The temporal and spatial pattern of expression of DMP1-GFP transgene closely mimics the expression of endogenous DMP1. This transgenic animal will facilitate studies of gene expression and biological functions in secretory/functional odontoblasts. PMID:21172466
Heart-specific expression of laminopathic mutations in transgenic zebrafish.
Verma, Ajay D; Parnaik, Veena K
2017-07-01
Lamins are key determinants of nuclear organization and function in the metazoan nucleus. Mutations in human lamin A cause a spectrum of genetic diseases that affect cardiac muscle and skeletal muscle as well as other tissues. A few laminopathies have been modeled using the mouse. As zebrafish is a well established model for the study of cardiac development and disease, we have investigated the effects of heart-specific lamin A mutations in transgenic zebrafish. We have developed transgenic lines of zebrafish expressing conserved lamin A mutations that cause cardiac dysfunction in humans. Expression of zlamin A mutations Q291P and M368K in the heart was driven by the zebrafish cardiac troponin T2 promoter. Homozygous mutant embryos displayed nuclear abnormalities in cardiomyocyte nuclei. Expression analysis showed the upregulation of genes involved in heart regeneration in transgenic mutant embryos and a cell proliferation marker was increased in adult heart tissue. At the physiological level, there was deviation of up to 20% from normal heart rate in transgenic embryos expressing mutant lamins. Adult homozygous zebrafish were fertile and did not show signs of early mortality. Our results suggest that transgenic zebrafish models of heart-specific laminopathies show cardiac regeneration and moderate deviations in heart rate during embryonic development. © 2017 International Federation for Cell Biology.
A wheat calreticulin gene (TaCRT1) contributes to drought tolerance in transgenic arabidopsis
International Nuclear Information System (INIS)
Xiang, V.; Du, C.; Jia, H.; Song, M.; Wang, Y.; Ma, Z.
2018-01-01
The TaCRT1 gene is a member of calreticulin (CRT) family in wheat. In our previous study, we showed that transgenic tobacco lines over expressing wheat TaCRT1 showed enhanced tolerance to salt stress. This study aimed to determine whether TaCRT1 over expression would increase drought tolerance in transgenic Arabidopsis. Over expression of TaCRT1 in Arabidopsis plants enhances tolerance to drought stress. However, the transgenic line was found to retard the growth. Moreover, the transgenic line showed decreased water loss but higher sensitivity to exogenous abscisic acid (ABA) compared with the wild type (Col-0). Meanwhile, the transgenic line had the elevated endogenous ABA level. The semi-quantitative RT-PCR (sqRT-PCR) analysis showed that transcription levels of ABA-biosynthesizing gene (NCED3) and ABA-responsive gene (ABF3) were higher in the transgenic line than that in the Col-0 under normal condition. The above results implied that the TaCRT1 might be able to used as a potential target to improve the drought tolerance in crops. (author)
High blood pressure in transgenic mice carrying the rat angiotensinogen gene.
Kimura, S; Mullins, J J; Bunnemann, B; Metzger, R; Hilgenfeldt, U; Zimmermann, F; Jacob, H; Fuxe, K; Ganten, D; Kaling, M
1992-01-01
Transgenic mice were generated by injecting the entire rat angiotensinogen gene into the germline of NMRI mice. The resulting transgenic animals were characterized with respect to hemodynamics, parameters of the renin angiotension system, and expression of the transgene. The transgenic line TGM(rAOGEN)123 developed hypertension with a mean arterial blood pressure of 158 mmHg in males and 132 mmHg in females. In contrast, the transgenic line TGM(rAOGEN)92 was not hypertensive. Rat angiotensinogen was detectable only in plasma of animals of line 123. Total plasma angiotensinogen and plasma angiotensin II concentrations were about three times as high as those of negative control mice. In TGM(rAOGEN)123 the transgene was highly expressed in liver and brain. Transcripts were also detected in heart, kidney and testis. In TGM(rAOGEN)92 the brain was the main expressing organ. In situ hybridization revealed an mRNA distribution in the brain of TGM(rAOGEN)123 similar to the one in rat. In TGM(rAOGEN)92 the expression pattern in the brain was aberrant. These data indicate that overexpression of the angiotensinogen gene in liver and brain leads to the development of hypertension in transgenic mice. The TGM(rAOGEN)123 constitutes a high angiotensin II type of hypertension and may provide a new experimental animal model to study the kinetics and function of the renin angiotensin system. Images PMID:1547785
Receptivity to Tobacco Advertising and Susceptibility to Tobacco Products.
Pierce, John P; Sargent, James D; White, Martha M; Borek, Nicolette; Portnoy, David B; Green, Victoria R; Kaufman, Annette R; Stanton, Cassandra A; Bansal-Travers, Maansi; Strong, David R; Pearson, Jennifer L; Coleman, Blair N; Leas, Eric; Noble, Madison L; Trinidad, Dennis R; Moran, Meghan B; Carusi, Charles; Hyland, Andrew; Messer, Karen
2017-06-01
Non-cigarette tobacco marketing is less regulated and may promote cigarette smoking among adolescents. We quantified receptivity to advertising for multiple tobacco products and hypothesized associations with susceptibility to cigarette smoking. Wave 1 of the nationally representative PATH (Population Assessment of Tobacco and Health) study interviewed 10 751 adolescents who had never used tobacco. A stratified random selection of 5 advertisements for each of cigarettes, e-cigarettes, smokeless products, and cigars were shown from 959 recent tobacco advertisements. Aided recall was classified as low receptivity, and image-liking or favorite ad as higher receptivity. The main dependent variable was susceptibility to cigarette smoking. Among US youth, 41% of 12 to 13 year olds and half of older adolescents were receptive to at least 1 tobacco advertisement. Across each age group, receptivity to advertising was highest for e-cigarettes (28%-33%) followed by cigarettes (22%-25%), smokeless tobacco (15%-21%), and cigars (8%-13%). E-cigarette ads shown on television had the highest recall. Among cigarette-susceptible adolescents, receptivity to e-cigarette advertising (39.7%; 95% confidence interval [CI]: 37.9%-41.6%) was higher than for cigarette advertising (31.7%; 95% CI: 29.9%-33.6%). Receptivity to advertising for each tobacco product was associated with increased susceptibility to cigarette smoking, with no significant difference across products (similar odds for both cigarette and e-cigarette advertising; adjusted odds ratio = 1.22; 95% CI: 1.09-1.37). A large proportion of US adolescent never tobacco users are receptive to tobacco advertising, with television advertising for e-cigarettes having the highest recall. Receptivity to advertising for each non-cigarette tobacco product was associated with susceptibility to smoke cigarettes. Copyright © 2017 by the American Academy of Pediatrics.
Middle Byzantine Historiography: Tradition, Innovation, and Reception
Directory of Open Access Journals (Sweden)
Staffan Wahlgren
2015-10-01
Full Text Available This paper provides an overview of Greek historical writing of the Middle Byzantine period (approx. 800 until 1000 A.D., with a particular focus on the major chronicles, such as Theophanesthe Confessor (early 9th c., George the Monk (probably late 9th c., and Symeon the Logothete (second half of the 10th c.. On the one hand, it is discussed how the chroniclers engage with tradition and either accept it or reject it. Acceptance of tradition is illustrated by many cases where chroniclers keep very close to the narrative modes of their predecessors and in particular where they copy them extensively. Rejection of, or at least deviation from tradition is illustrated by many cases where new narrative techniques and modes of expression are apparent. Particular attention is paid to some aspects of narrative technique which seem to be innovative. In short, there seems to be an increased tendency towards greater logical (and hence, narrative coherence in the chronicles and an increased tendency towards concentration on a small number of settings, issues and persons (in particular, there is an increased concentration on the Capital of Constantinople and the Emperor’s person. Further, reception is discussed, and especially how Middle Byzantine historical texts were read and used in later writings, including the Slavic literatures. The need for further research in order to understand the transmission processes, especially in the form of the philological study of manuscripts, is stressed.
Bioinspired magnetic reception and multimodal sensing.
Taylor, Brian K
2017-08-01
Several animals use Earth's magnetic field in concert with other sensor modes to accomplish navigational tasks ranging from local homing to continental scale migration. However, despite extensive research, animal magnetic reception remains poorly understood. Similarly, the Earth's magnetic field offers a signal that engineered systems can leverage to navigate in environments where man-made positioning systems such as GPS are either unavailable or unreliable. This work uses a behavioral strategy inspired by the migratory behavior of sea turtles to locate a magnetic goal and respond to wind when it is present. Sensing is performed using a number of distributed sensors. Based on existing theoretical biology considerations, data processing is performed using combinations of circles and ellipses to exploit the distributed sensing paradigm. Agent-based simulation results indicate that this approach is capable of using two separate magnetic properties to locate a goal from a variety of initial conditions in both noiseless and noisy sensory environments. The system's ability to locate the goal appears robust to noise at the cost of overall path length.
Everyday Citizenship: Identity Claims and Their Reception
Directory of Open Access Journals (Sweden)
Nick Hopkins
2015-10-01
Full Text Available Citizenship involves being able to speak and be heard as a member of the community. This can be a formal right (e.g., a right to vote. It can also be something experienced in everyday life. However, the criteria for being judged a fellow member of the community are multiple and accorded different weights by different people. Thus, although one may self-define alongside one’s fellows, the degree to which these others reciprocate depends on the weight they give to various membership criteria. This suggests we approach everyday community membership in terms of an identity claims-making process in which first, an individual claims membership through invoking certain criteria of belonging, and second, others evaluate that claim. Pursuing this logic we report three experiments investigating the reception of such identity-claims. Study 1 showed that in Scotland a claim to membership of the national ingroup was accepted more if couched in terms of place of birth and ancestry rather than just in terms of one’s subjective identification. Studies 2 and 3 showed that this differential acceptance mattered for the claimant’s ability to be heard as a community member. We discuss the implications of these studies for the conceptualization of community membership and the realization of everyday citizenship rights.
Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System
Directory of Open Access Journals (Sweden)
Zhanqi Dong
2018-02-01
Full Text Available The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV immediate early-1 (ie-1 gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-/sgRNA(-, Cas9(+/sgRNA(-, Cas9(-/sgRNA(+, and Cas9(+/sgRNA(+. We demonstrated that the Cas9(+/sgRNA(+ transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+/sgRNA(+ transgenic lines shows that the median lethal dose (LD50 is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+/sgRNA(+ transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.
Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System.
Dong, Zhanqi; Dong, Feifan; Yu, Xinbo; Huang, Liang; Jiang, Yaming; Hu, Zhigang; Chen, Peng; Lu, Cheng; Pan, Minhui
2018-01-01
The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV) immediate early-1 ( ie-1 ) gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-)/sgRNA(-), Cas9(+)/sgRNA(-), Cas9(-)/sgRNA(+), and Cas9(+)/sgRNA(+). We demonstrated that the Cas9(+)/sgRNA(+) transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+)/sgRNA(+) transgenic lines shows that the median lethal dose (LD50) is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+)/sgRNA(+) transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.
Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R
1996-04-01
We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.
Ren, Yachao; Zhang, Jun; Wang, Guiying; Liu, Xiaojie; Li, Li; Wang, Jinmao; Yang, Minsheng
2018-01-01
To explore the stability of insect resistance during the development of transgenic insect-resistant trees, this study investigated how insect resistance changes as transgenic trees age. We selected 19 transgenic insect-resistant triploid Populus tomentosa lines as plant material. The presence of exogenous genes and Cry1Ac protein expression were verified using polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) analyses. The toxicity for Clostera anachoreta and Lymantria dispar was evaluated by feeding fresh leaves to first instar larvae after the trees were planted in the field for 2 years and after the sixth year. Results of PCR showed that the exogenous genes had a long-term presence in the poplar genome. ELISA analyses showed significant differences existed on the 6-year-old transgenic lines. The insect-feeding experiment demonstrated significant differences in the mortality rates of C. anachoreta and L. dispar among different transgenic lines. The average corrected mortality rates of C. anachoreta and L. dispar ranged from 5.6-98.7% to 35.4-7.2% respectively. The larval mortality rates differed significantly between the lines at different ages. Up to 52.6% of 1-year-old transgenic lines and 42.1% of 2-year-old transgenic lines caused C. anachoreta larval mortality rates to exceed 80%, whereas only 26.3% of the 6-year-old transgenic lines. The mortality rates of L. dispar exhibited the same trend: 89.5% of 1-year-old transgenic lines and 84.2% of 2-year-old transgenic lines caused L. dispar larval mortality rates to exceed 80%; this number decreased to 63.2% for the 6-year-old plants. The proportion of 6-year-old trees with over 80% larval mortality rates was clearly lower than that of the younger trees. The death distribution of C. anachoreta in different developmental stages also showed the larvae that fed on the leaves of 1-year-old trees were killed mostly during L 1 and L 2 stages, whereas the proportion of larvae that died in L 3
[Biofuels, food security and transgenic crops].
Acosta, Orlando; Chaparro-Giraldo, Alejandro
2009-01-01
Soaring global food prices are threatening to push more poor people back below the poverty line; this will probably become aggravated by the serious challenge that increasing population and climate changes are posing for food security. There is growing evidence that human activities involving fossil fuel consumption and land use are contributing to greenhouse gas emissions and consequently changing the climate worldwide. The finite nature of fossil fuel reserves is causing concern about energy security and there is a growing interest in the use of renewable energy sources such as biofuels. There is growing concern regarding the fact that biofuels are currently produced from food crops, thereby leading to an undesirable competition for their use as food and feed. Nevertheless, biofuels can be produced from other feedstocks such as lingo-cellulose from perennial grasses, forestry and vegetable waste. Biofuel energy content should not be exceeded by that of the fossil fuel invested in its production to ensure that it is energetically sustainable; however, biofuels must also be economically competitive and environmentally acceptable. Climate change and biofuels are challenging FAO efforts aimed at eradicating hunger worldwide by the next decade. Given that current crops used in biofuel production have not been domesticated for this purpose, transgenic technology can offer an enormous contribution towards improving biofuel crops' environmental and economic performance. The present paper critically presents some relevant relationships between biofuels, food security and transgenic plant technology.
Tackaberry, Eilleen S; Prior, Fiona; Bell, Margaret; Tocchi, Monika; Porter, Suzanne; Mehic, Jelica; Ganz, Peter R; Sardana, Ravinder; Altosaar, Illimar; Dudani, Anil
2003-06-01
The use of transgenic plants in the production of recombinant proteins for human therapy, including subunit vaccines, is being investigated to evaluate the efficacy and safety of these emerging biopharmaceutical products. We have previously shown that synthesis of recombinant glycoprotein B (gB) of human cytomegalovirus can be targeted to seeds of transgenic tobacco when directed by the rice glutelin 3 promoter, with gB retaining critical features of immunological reactivity (E.S. Tackaberry et al. 1999. Vaccine, 17: 3020-3029). Here, we report development of second generation transgenic plant lines (T1) homozygous for the transgene. Twenty progeny plants from two lines (A23T(1)-2 and A24T(1)-3) were grown underground in an environmentally contained mine shaft. Based on yields of gB in their seeds, the A23T(1)-2 line was then selected for scale-up in the same facility. Analyses of mature seeds by ELISA showedthat gB specific activity in A23T(1)-2 seeds was over 30-fold greater than the best T0 plants from the same transformation series, representing 1.07% total seed protein. These data demonstrate stable inheritance, an absence of transgene inactivation, and enhanced levels of gB expression in a homozygous second generation plant line. They also provide evidence for the suitability of using this environmentally secure facility to grow transgenic plants producing therapeutic biopharmaceuticals.
Nath, Manoj; Garg, Bharti; Sahoo, Ranjan Kumar; Tuteja, Narendra
2015-01-01
Salinity stress negatively affects the crop productivity worldwide, including that of rice. Coping with these losses is a major concern for all countries. The pea DNA helicase, PDH45 is a unique member of helicase family involved in the salinity stress tolerance. However, the exact mechanism of the PDH45 in salinity stress tolerance is yet to be established. Therefore, the present study was conducted to investigate the mechanism of PDH45-mediated salinity stress tolerance in transgenic tobacco and rice lines along with wild type (WT) plants using CoroNa Green dye based sodium localization in root and shoot sections. The results showed that under salinity stress root and shoot of PDH45 overexpressing transgenic tobacco and rice accumulated less sodium (Na(+)) as compared to their respective WT. The present study also reports salinity tolerant (FL478) and salinity susceptible (Pusa-44) varieties of rice accumulated lowest and highest Na(+) level, respectively. All the varieties and transgenic lines of rice accumulate differential Na(+) ions in root and shoot. However, roots accumulate high Na(+) as compared to the shoots in both tobacco and rice transgenic lines suggesting that the Na(+) transport in shoot is somehow inhibited. It is proposed that the PDH45 is probably involved in the deposition of apoplastic hydrophobic barriers and consequently inhibit Na(+) transport to shoot and therefore confers salinity stress tolerance to PDH45 overexpressing transgenic lines. This study concludes that tobacco (dicot) and rice (monocot) transgenic plants probably share common salinity tolerance mechanism mediated by PDH45 gene.
Ko, Moonkyung; Cho, Jung Hyun; Seo, Hyo-Hyoun; Lee, Hyun-Hwa; Kang, Ha-Young; Nguyen, Thai Son; Soh, Hyun Cheol; Kim, Young Soon; Kim, Jeong-Il
2016-08-01
Resistance against anthracnose fungi was enhanced in transgenic pepper plants that accumulated high levels of a carboxylesterase, PepEST in anthracnose-susceptible fruits, with a concurrent induction of antioxidant enzymes and SA-dependent PR proteins. A pepper esterase gene (PepEST) is highly expressed during the incompatible interaction between ripe fruits of pepper (Capsicum annuum L.) and a hemibiotrophic anthracnose fungus (Colletotrichum gloeosporioides). In this study, we found that exogenous application of recombinant PepEST protein on the surface of the unripe pepper fruits led to a potentiated state for disease resistance in the fruits, including generation of hydrogen peroxide and expression of pathogenesis-related (PR) genes that encode mostly small proteins with antimicrobial activity. To elucidate the role of PepEST in plant defense, we further developed transgenic pepper plants overexpressing PepEST under the control of CaMV 35S promoter. Molecular analysis confirmed the establishment of three independent transgenic lines carrying single copy of transgenes. The level of PepEST protein was estimated to be approximately 0.002 % of total soluble protein in transgenic fruits. In response to the anthracnose fungus, the transgenic fruits displayed higher expression of PR genes, PR3, PR5, PR10, and PepThi, than non-transgenic control fruits did. Moreover, immunolocalization results showed concurrent localization of ascorbate peroxidase (APX) and PR3 proteins, along with the PepEST protein, in the infected region of transgenic fruits. Disease rate analysis revealed significantly low occurrence of anthracnose disease in the transgenic fruits, approximately 30 % of that in non-transgenic fruits. Furthermore, the transgenic plants also exhibited resistance against C. acutatum and C. coccodes. Collectively, our results suggest that overexpression of PepEST in pepper confers enhanced resistance against the anthracnose fungi by activating the defense signaling
First-year university students' receptive and productive use of ...
African Journals Online (AJOL)
Kate H
Keywords: academic vocabulary, receptive knowledge, productive knowledge, collocations, vocabulary ...... The challenge of validation: Assessing the performance of a test of ..... This is a new drug used to tr…………… depression. 56.
The Early Literary Reception of Ernest Hemingway in Iran
Directory of Open Access Journals (Sweden)
Atefeh Ghasemnejad
2018-01-01
Full Text Available This essay investigates the dynamics that led to the literary reception of Ernest Hemingway before the Islamic Revolution in Iran. This article deploys reception studies as a branch of Comparative Literature with a focus upon conceptions of Siegbert Salomon Prawer and the practical method of George Asselineau to unearth the ideological, political, and historical milieu that embraced Hemingway’s literary fortune in Iran. This investigation, unprecedented in the study of Iranian literature, discusses how and why Hemingway was initially received in Iran. As such, the inception of literary fortune of Ernest Hemingway in Iran is examined by the contextual features, Persian literary taste, and the translator’s incentives that paved the way for this reception. This article also uncovers the reasons for the delay in the literary reception of Hemingway in Iran and discussed why some of Hemingway’s oeuvres enjoyed recognition while others were neglected by the Iranian readership.
Developing Reception Competence in Children with a Mild Intellectual Disability
Directory of Open Access Journals (Sweden)
Ana Koritnik
2015-06-01
Full Text Available The paper presents research paradigms which study factors that allow influencing the language development of children with mild intellectual disabilities to the greatest extent possible. Special attention is dedicated to the development of the reception competence with the use of reception didactics methods based on a relatively frequent use of less demanding non-language semiotic functions. The core of the paper presents results of an experimental case study (on a sample of five children with a mild intellectual disability over a one school year period, through which the reception competence in these children was developed with a systematic use of an adapted communication model of literary education as an experimental factor. The results have confirmed the initially set hypothesis about reception progress.
Colour Constancy Beyond the Classical Receptive Field.
Akbarinia, Arash; Parraga, C Alejandro
2017-09-18
The problem of removing illuminant variations to preserve the colours of objects (colour constancy) has already been solved by the human brain using mechanisms that rely largely on centre-surround computations of local contrast. In this paper we adopt some of these biological solutions described by long known physiological findings into a simple, fully automatic, functional model (termed Adaptive Surround Modulation or ASM). In ASM, the size of a visual neuron's receptive field (RF) as well as the relationship with its surround varies according to the local contrast within the stimulus, which in turn determines the nature of the centre-surround normalisation of cortical neurons higher up in the processing chain. We modelled colour constancy by means of two overlapping asymmetric Gaussian kernels whose sizes are adapted based on the contrast of the surround pixels, resembling the change of RF size. We simulated the contrast-dependent surround modulation by weighting the contribution of each Gaussian according to the centre-surround contrast. In the end, we obtained an estimation of the illuminant from the set of the most activated RFs' outputs. Our results on three single-illuminant and one multi-illuminant benchmark datasets show that ASM is highly competitive against the state-of-the-art and it even outperforms learning-based algorithms in one case. Moreover, the robustness of our model is more tangible if we consider that our results were obtained using the same parameters for all datasets, that is, mimicking how the human visual system operates. These results might provide an insight on how dynamical adaptation mechanisms contribute to make object's colours appear constant to us.
Receptivity to alcohol marketing predicts initiation of alcohol use.
Henriksen, Lisa; Feighery, Ellen C; Schleicher, Nina C; Fortmann, Stephen P
2008-01-01
This longitudinal study examined the influence of alcohol advertising and promotions on the initiation of alcohol use. A measure of receptivity to alcohol marketing was developed from research about tobacco marketing. Recall and recognition of alcohol brand names were also examined. Data were obtained from in-class surveys of sixth, seventh, and eighth graders at baseline and 12-month follow-up. Participants who were classified as never drinkers at baseline (n = 1,080) comprised the analysis sample. Logistic regression models examined the association of advertising receptivity at baseline with any alcohol use and current drinking at follow-up, adjusting for multiple risk factors, including peer alcohol use, school performance, risk taking, and demographics. At baseline, 29% of never drinkers either owned or wanted to use an alcohol branded promotional item (high receptivity), 12% students named the brand of their favorite alcohol ad (moderate receptivity), and 59% were not receptive to alcohol marketing. Approximately 29% of adolescents reported any alcohol use at follow-up; 13% reported drinking at least 1 or 2 days in the past month. Never drinkers who reported high receptivity to alcohol marketing at baseline were 77% more likely to initiate drinking by follow-up than those were not receptive. Smaller increases in the odds of alcohol use at follow-up were associated with better recall and recognition of alcohol brand names at baseline. Alcohol advertising and promotions are associated with the uptake of drinking. Prevention programs may reduce adolescents' receptivity to alcohol marketing by limiting their exposure to alcohol ads and promotions and by increasing their skepticism about the sponsors' marketing tactics.
Yazhisai, Uthaman; Rajagopalan, Prem Anand; Raja, Joseph A J; Chen, Tsung-Chi; Yeh, Shyi-Dong
2015-08-01
Tospoviruses cause severe damages to important crops worldwide. In this study, Nicotiana benthamiana transgenic lines carrying individual untranslatable constructs comprised of the conserved region of the L gene (denoted as L), the 5' half of NSs coding sequence (NSs) or the antisense fragment of whole N coding sequence (N) of Watermelon silver mottle virus (WSMoV), individually or in combination, were generated. A total of 15-17 transgenic N. benthamiana lines carrying individual transgenes were evaluated against WSMoV and the serologically unrelated Tomato spotted wilt virus (TSWV). Among lines carrying single or chimeric transgenes, the level of resistance ranged from susceptible to completely resistant against WSMoV. From the lines carrying individual transgenes and highly resistant to WSMoV (56-63% of lines assayed), 30% of the L lines (3/10 lines assayed) and 11% of NSs lines (1/9 lines assayed) were highly resistant against TSWV. The chimeric transgenes provided higher degrees of resistance against WSMoV (80-88%), and the NSs fragment showed an additive effect to enhance the resistance to TSWV. Particularly, the chimeric transgenes with the triple combination of fragments, namely L/NSs/N or HpL/NSs/N (a hairpin construct), provided a higher degree of resistance (both 50%, with 7/14 lines assayed) against TSWV. Our results indicate that the untranslatable NSs fragment is able to enhance the transgenic resistance conferred by the L conserved region. The better performance of L/NSs/N and HpL/NSs/N in transgenic N. benthamiana lines suggests their potential usefulness in generating high levels of enhanced transgenic resistance against serologically unrelated tospoviruses in agronomic crops.
ZyFISH: a simple, rapid and reliable zygosity assay for transgenic mice.
Directory of Open Access Journals (Sweden)
Donal McHugh
Full Text Available Microinjection of DNA constructs into fertilized mouse oocytes typically results in random transgene integration at a single genomic locus. The resulting transgenic founders can be used to establish hemizygous transgenic mouse lines. However, practical and experimental reasons often require that such lines be bred to homozygosity. Transgene zygosity can be determined by progeny testing assays which are expensive and time-consuming, by quantitative Southern blotting which is labor-intensive, or by quantitative PCR (qPCR which requires transgene-specific design. Here, we describe a zygosity assessment procedure based on fluorescent in situ hybridization (zyFISH. The zyFISH protocol entails the detection of transgenic loci by FISH and the concomitant assignment of homozygosity using a concise and unbiased scoring system. The method requires small volumes of blood, is scalable to at least 40 determinations per assay, and produces results entirely consistent with the progeny testing assay. This combination of reliability, simplicity and cost-effectiveness makes zyFISH a method of choice for transgenic mouse zygosity determinations.
Abid, Nabeela; Khatoon, Asia; Maqbool, Asma; Irfan, Muhammad; Bashir, Aftab; Asif, Irsa; Shahid, Muhammad; Saeed, Asma; Brinch-Pedersen, Henrik; Malik, Kauser A
2017-02-01
Phytate is a major constituent of wheat seeds and chelates metal ions, thus reducing their bioavailability and so the nutritional value of grains. Transgenic plants expressing heterologous phytase are expected to enhance degradation of phytic acid stored in seeds and are proposed to increase the in vitro bioavailability of mineral nutrients. Wheat transgenic plants expressing Aspergillus japonicus phytase gene (phyA) in wheat endosperm were developed till T 3 generation. The transgenic lines exhibited 18-99 % increase in phytase activity and 12-76 % reduction of phytic acid content in seeds. The minimum phytic acid content was observed in chapatti (Asian bread) as compared to flour and dough. The transcript profiling of phyA mRNA indicated twofold to ninefold higher expression as compared to non transgenic controls. There was no significant difference in grain nutrient composition of transgenic and non-transgenic seeds. In vitro bioavailability assay for iron and zinc in dough and chapatti of transgenic lines revealed a significant increase in iron and zinc contents. The development of nutritionally enhanced cereals is a step forward to combat nutrition deficiency for iron and zinc in malnourished human population, especially women and children.
Integrated parallel reception, excitation, and shimming (iPRES).
Han, Hui; Song, Allen W; Truong, Trong-Kha
2013-07-01
To develop a new concept for a hardware platform that enables integrated parallel reception, excitation, and shimming. This concept uses a single coil array rather than separate arrays for parallel excitation/reception and B0 shimming. It relies on a novel design that allows a radiofrequency current (for excitation/reception) and a direct current (for B0 shimming) to coexist independently in the same coil. Proof-of-concept B0 shimming experiments were performed with a two-coil array in a phantom, whereas B0 shimming simulations were performed with a 48-coil array in the human brain. Our experiments show that individually optimized direct currents applied in each coil can reduce the B0 root-mean-square error by 62-81% and minimize distortions in echo-planar images. The simulations show that dynamic shimming with the 48-coil integrated parallel reception, excitation, and shimming array can reduce the B0 root-mean-square error in the prefrontal and temporal regions by 66-79% as compared with static second-order spherical harmonic shimming and by 12-23% as compared with dynamic shimming with a 48-coil conventional shim array. Our results demonstrate the feasibility of the integrated parallel reception, excitation, and shimming concept to perform parallel excitation/reception and B0 shimming with a unified coil system as well as its promise for in vivo applications. Copyright © 2013 Wiley Periodicals, Inc.
Stigma development and receptivity in almond (Prunus dulcis).
Yi, Weiguang; Law, S Edward; McCoy, Dennis; Wetzstein, Hazel Y
2006-01-01
Fertilization is essential in almond production, and pollination can be limiting in production areas. This study investigated stigma receptivity under defined developmental stages to clarify the relationship between stigma morphology, pollen germination, tube growth and fruit set. Light and scanning electron microscopy were employed to examine stigma development at seven stages of flower development ranging from buds that were swollen to flowers in which petals were abscising. Flowers at different stages were hand pollinated and pollen germination and tube growth assessed. Artificial pollinations in the field were conducted to determine the effect of flower age on fruit set. Later stages of flower development exhibited greater stigma receptivity, i.e. higher percentages of pollen germination and more extensive tube growth occurred in older (those opened to the flat petal stage or exhibiting petal fall) than younger flowers. Enhanced stigma receptivity was associated with elongation of stigmatic papillae and increased amounts of stigmatic exudate that inundated papillae at later developmental stages. Field pollinations indicated that the stigma was still receptive and nut set was maintained in older flowers. Stigma receptivity in almond does not become optimal until flowers are past the fully open stage. The stigma is still receptive and fruit set is maintained in flowers even at the stage when petals are abscising. Strategies to enhance pollination and crop yield, including the timing and placement of honey bees, should consider the effectiveness of developmentally advanced flowers.
How To Produce and Characterize Transgenic Plants.
Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark
2002-01-01
Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)
Transgenic Pm3 multilines of wheat show increased powdery mildew resistance in the field.
Brunner, Susanne; Stirnweis, Daniel; Diaz Quijano, Carolina; Buesing, Gabriele; Herren, Gerhard; Parlange, Francis; Barret, Pierre; Tassy, Caroline; Sautter, Christof; Winzeler, Michael; Keller, Beat
2012-05-01
Resistance (R) genes protect plants very effectively from disease, but many of them are rapidly overcome when present in widely grown cultivars. To overcome this lack of durability, strategies that increase host resistance diversity have been proposed. Among them is the use of multilines composed of near-isogenic lines (NILs) containing different disease resistance genes. In contrast to classical R-gene introgression by recurrent backcrossing, a transgenic approach allows the development of lines with identical genetic background, differing only in a single R gene. We have used alleles of the resistance locus Pm3 in wheat, conferring race-specific resistance to wheat powdery mildew (Blumeria graminis f. sp. tritici), to develop transgenic wheat lines overexpressing Pm3a, Pm3c, Pm3d, Pm3f or Pm3g. In field experiments, all tested transgenic lines were significantly more resistant than their respective nontransformed sister lines. The resistance level of the transgenic Pm3 lines was determined mainly by the frequency of virulence to the particular Pm3 allele in the powdery mildew population, Pm3 expression levels and most likely also allele-specific properties. We created six two-way multilines by mixing seeds of the parental line Bobwhite and transgenic Pm3a, Pm3b and Pm3d lines. The Pm3 multilines were more resistant than their components when tested in the field. This demonstrates that the difference in a single R gene is sufficient to cause host-diversity effects and that multilines of transgenic Pm3 wheat lines represent a promising strategy for an effective and sustainable use of Pm3 alleles. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Ghimire, Bimal Kumar; Seong, Eun Soo; Lee, Chan Ok; Lee, Jae Geun; Yu, Chang Yeon; Kim, Seung Hyun; Chung, Ill Min
2015-09-01
The main goal of this study was to generate transgenic Perilla frutescens with enhanced antioxidant properties by overexpressing the γ-tocopherol methyltransferase (γ-tmt) gene. In this study, the antioxidant activity of methanolic crude extracts of transgenic and non-transgenic control plants was investigated using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging method. Free radical scavenging activity was evaluated using α-tocopherol and butylated hydroxyl toluene as standard antioxidants. In general, the ethyl acetate fraction of transgenic P. frutescens showed stronger DPPH radical scavenging activity than the ethyl acetate fraction from non-transgenic control plants (IC50 2.00 ± 0.10 and 5.53 ± 0.40 μg ∙ ml(-1), respectively). High-performance liquid chromatography analysis of phenolic acids in leaf extracts confirmed increased levels of 16 individual phenolic compounds in two transgenic lines (pf47-5 and pf47-8) compared with control plants. Changes in the phenolic compound profile and α-tocopherol content were correlated with the antioxidant properties of transgenic plants, indicating that the introduction of transgene γ-tmt influenced the metabolism of phenolic compounds and subsequently produced biochemical changes in the transformants. There were no significant differences in photosynthetic rate in the transgenic plants as compared to the non-transgenic control plants, suggesting that the alteration of phenolic compounds and tocopherol composition had little impact on photosynthesis.
Directory of Open Access Journals (Sweden)
Yu-Guo Yuan
2014-01-01
Full Text Available To improve nutrient content of goat milk, we describe the construction of a vector (pBLAC containing a hybrid goat β-lactoglobulin (BLG promoter/cytomegalovirus (CMV enhancer. We also describe the generation of transgenic goats expressing rhLA by somatic cell nuclear transfer (SCNT. Of 334 one-cell stage embryos derived from three transgenic cell lines and 99 embryos derived from non-transgenic (NT cells surgically transferred to the oviducts of 37 recipients, two recipients delivered two kids (2% from the non-transfected line and five recipients delivered six kids (1.8% from transgenic cell lines, three of which died within 2 days. Compared to the NT donor cells, transfection of donor cells does not negatively affect the development of nuclear transfer embryos into viable transgenic offspring. However, the clone efficiency in cell line number 1 was lower than that in numbers 2 and 3, and in the NT lines (0.9% versus 1.9% 2.4% and 2%; P<0.05. Two transgenic cloned goats expressed rhLA in the milk at 0.1–0.9 mg/mL. The mammary gland-specific expression vector pBLAC with hybrid BLG/CMV can drive the hLA gene to express in vitro and in vivo. These data establish the basis for use of a hybrid promoter/enhancer strategy to produce rhLA transgenic goats.
RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea.
Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L; Mukherjee, Sunil Kumar; Sahoo, Lingaraj
2017-01-01
Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea.
Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.
Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di
2015-07-01
The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.
Progress on researches of transgenic alfalfa
International Nuclear Information System (INIS)
Guo Huiqin; Wang Mi; Ren Weibo; Xu Zhu; Chen Libo
2010-01-01
In this paper, the progress on the researches of transgenic alfalfa in the past two decades had been reviewed in the aspects of regeneration system, transformation, improvement of the important traits and so on. Moreover, such problems as variation of transgene expression and safety of transgenic plant had also been discussed and propose had been given for the future research work. (authors)
Pons, Elsa; Peris, Josep E; Peña, Leandro
2012-07-15
The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the selectable marker genes that are most
Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I
2016-01-01
Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity.
Transgenic plants: from first successes to future applications.
Van Lijsebettens, Mieke; Angenon, Geert; De Block, Marc
2013-01-01
This dialogue was held between the Guest Editors of the Special Issue on "Plant Transgenesis" of the Int. J. Dev. Biol. and Marc De Block. He was one of the first scientists worldwide to obtain transgenic plants transformed with the chimeric selectable marker genes encoding neomycin phosphotransferase and bialaphos that confer resistance against the antibiotic kanamycin and the herbicide Basta®/glufosinate, respectively at the Department of Genetics of Ghent University and, later on, at the spin-off company, Plant Genetic Systems. Today, these two genes are still the most frequently utilized markers in transgene technology. Marc De Block chose to work on the improvement of crops in an industrial environment to help realize the production of superior seeds or products. He was part of the team that developed the male sterility/restorer system in canola (Brassica napus var. napus) that led to the first hybrid lines to be commercialized as successful products of transgene technology. In more than 30 years of research, he developed transformation procedures for numerous crops, designed histochemical, biochemical and physiological assays to monitor plant performance, and made original and innovative contributions to plant biology. Presently, he considers transgenic research part of the toolbox for plant improvement and essential for basic plant research.
Fritz, Jonathan; Elhilali, Mounya; David, Stephen; Shamma, Shihab
2007-01-01
Acoustic filter properties of A1 neurons can dynamically adapt to stimulus statistics, classical conditioning, instrumental learning and the changing auditory attentional focus. We have recently developed an experimental paradigm that allows us to view cortical receptive field plasticity on-line as the animal meets different behavioral challenges by attending to salient acoustic cues and changing its cortical filters to enhance performance. We propose that attention is the key trigger that in...
Directory of Open Access Journals (Sweden)
Zhao Roong
2001-12-01
Full Text Available Abstract Background Transgenic mice have been used extensively to analyze gene function. Unfortunately, traditional transgenic procedures have only limited use in analyzing alleles that cause lethality because lines of founder mice cannot be established. This is frustrating given that such alleles often reveal crucial aspects of gene function. For this reason techniques that facilitate the generation of embryos expressing such alleles would be of enormous benefit. Although the transient generation of transgenic embryos has allowed limited analysis of lethal alleles, it is expensive, time consuming and technically challenging. Moreover a fundamental limitation with this approach is that each embryo generated is unique and transgene expression is highly variable due to the integration of different transgene copy numbers at random genomic sites. Results Here we describe an alternative method that allows the generation of clonal mouse embryos harboring a single-copy transgene at a defined genomic location. This was facilitated through the production of Hprt negative embryonic stem cells that allow the derivation of embryos by tetraploid embryo complementation. We show that targeting transgenes to the hprt locus in these ES cells by homologous recombination can be efficiently selected by growth in HAT medium. Moreover, embryos derived solely from targeted ES cells containing a single copy LacZ transgene under the control of the α-myosin heavy chain promoter exhibited the expected cardiac specific expression pattern. Conclusion Our results demonstrate that tetraploid embryo complementation by F3 hprt negative ES cells facilitates the generation of transgenic mouse embryos containing a single copy gene at a defined genomic locus. This approach is simple, extremely efficient and bypasses any requirement to generate chimeric mice. Moreover embryos generated by this procedure are clonal in that they are all derived from a single ES cell lines. This
Biotechnology network promotes knowledge of transgenics
International Nuclear Information System (INIS)
Blanco Picado, Patricia; Valdez Melara, Marta
2015-01-01
Red de Ingenieria Genetica Aplicada al Mejoramiento de Cultivos Tropicales (Rigatrop) integrated by a group of scientists from the Universidad de Costa Rica (UCR), Universidad Nacional (UNA) and of the Instituto Tecnologico de Costa Rica (TEC) have organized two forums on the topic of transgenics. The first forum has shown successful experiences of development of transgenic crops in Latin America, as for example: the transgenic bean, project realized in Brazil and transgenic eggplant in Bangladesh. The second forum has been about transgenics and environment effected at the UCR, on the occasion of World Environment Day. Rigatrop members are working currently in two projects applying biotechnological tools to coffee [es
Transgenic Epigenetics: Using Transgenic Organisms to Examine Epigenetic Phenomena
Directory of Open Access Journals (Sweden)
Lori A. McEachern
2012-01-01
Full Text Available Non-model organisms are generally more difficult and/or time consuming to work with than model organisms. In addition, epigenetic analysis of model organisms is facilitated by well-established protocols, and commercially-available reagents and kits that may not be available for, or previously tested on, non-model organisms. Given the evolutionary conservation and widespread nature of many epigenetic mechanisms, a powerful method to analyze epigenetic phenomena from non-model organisms would be to use transgenic model organisms containing an epigenetic region of interest from the non-model. Interestingly, while transgenic Drosophila and mice have provided significant insight into the molecular mechanisms and evolutionary conservation of the epigenetic processes that target epigenetic control regions in other model organisms, this method has so far been under-exploited for non-model organism epigenetic analysis. This paper details several experiments that have examined the epigenetic processes of genomic imprinting and paramutation, by transferring an epigenetic control region from one model organism to another. These cross-species experiments demonstrate that valuable insight into both the molecular mechanisms and evolutionary conservation of epigenetic processes may be obtained via transgenic experiments, which can then be used to guide further investigations and experiments in the species of interest.
"Ornithorhynchus Paradoxus": The Reception of Arthur Schopenhauer between 1818 and 1848
Directory of Open Access Journals (Sweden)
Héctor del Estal Sánchez
2018-03-01
Full Text Available This essay intends to examine the reception of Arthur Schopenhauer’s philosophy in the period betweeen 1818 and 1848, thereby contributing to a demythologization of the luck of the philosopher’s thought on these three decades prior to the beginning of his fame. In order to achieve this, after showing a general picture of the personal myth that has characterised a great part of the historiographic tradition according to which his philosophy would have been ignored or silenced (1, we will present the four key lines of his reception, through the analysis of the news that his contemporaries gave of his philosophy in reviews, manuals of history of philosophy, or encyclopedias. Those four key lines are: a reading of Schopenhauer’s philosophy that stressed on its oriental features (2, an interpretation in an idealistic key which placed a lack of originality in Schopenhauer’s philosophy (3, an academic community that placed it against “the spirit of the times” due to the secondary place of Reason against the Will (4 and finally, the emergence of the first followers of Schopenhauer’s philosophy (5.
Directory of Open Access Journals (Sweden)
Xiuling Cao
Full Text Available Maize rough dwarf disease (MRDD, caused by several Fijiviruses in the family Reoviridae, is a global disease that is responsible for substantial yield losses in maize. Although some maize germplasm have low levels of polygenic resistance to MRDD, highly resistant cultivated varieties are not available for agronomic field production in China. In this work, we have generated transgenic maize lines that constitutively express rnc70, a mutant E. coli dsRNA-specific endoribonuclease gene. Transgenic lines were propagated and screened under field conditions for 12 generations. During three years of evaluations, two transgenic lines and their progeny were challenged with Rice black-streaked dwarf virus (RBSDV, the causal agent of MRDD in China, and these plants exhibited reduced levels of disease severity. In two normal years of MRDD abundance, both lines were more resistant than non-transgenic plants. Even in the most serious MRDD year, six out of seven progeny from one line were resistant, whereas non-transgenic plants were highly susceptible. Molecular approaches in the T12 generation revealed that the rnc70 transgene was integrated and expressed stably in transgenic lines. Under artificial conditions permitting heavy virus inoculation, the T12 progeny of two highly resistant lines had a reduced incidence of MRDD and accumulation of RBSDV in infected plants. In addition, we confirmed that the RNC70 protein could bind directly to RBSDV dsRNA in vitro. Overall, our data show that RNC70-mediated resistance in transgenic maize can provide efficient protection against dsRNA virus infection.
Herrero, S; Culbreath, A K; Csinos, A S; Pappu, H R; Rufty, R C; Daub, M E
2000-02-01
ABSTRACT Transformation of plants with the nucleocapsid (N) gene of Tomato spotted wilt tospovirus (TSWV) provides resistance to disease development; however, information is lacking on the response of plants to natural inoculum in the field. Three tobacco cultivars were transformed with the N gene of a dahlia isolate of TSWV (TSWV-D), and plants were evaluated over several generations in the greenhouse. The resistant phenotype was more frequently observed in 'Burley 21' than in 'KY-14' or 'K-326', but highly resistant 'Burley 21' transgenic lines were resistant to only 44% of the heterologous TSWV isolates tested. Advanced generation (R(3) and R(4)) transgenic resistant lines of 'Burley 21' and a 'K-326' F(1) hybrid containing the N genes of two TSWV isolates were evaluated in the field near Tifton, GA, where TSWV is endemic. Disease development was monitored by symptom expression and enzyme-linked immunosorbent assay (ELISA) analysis. Whereas incidence of TSWV infection in 'Burley 21' susceptible controls was 20% in 1996 and 62% in 1997, the mean incidence in transgenic lines was reduced to 4 and 31%, respectively. Three transgenic 'Burley 21' lines were identified that had significantly lower incidence of disease than susceptible controls over the two years of the study. In addition, the rate of disease increase at the onset of the 1997 epidemic was reduced for all the 'Burley 21' transgenic lines compared with the susceptible controls. The 'K-326' F(1) hybrid was as susceptible as the 'K-326' nontransformed control. ELISA analysis demonstrated that symptomless plants from the most resistant 'Burley 21' transgenic lines accumulated detectable nucleocapsid protein, whereas symptomless plants from more susceptible lines did not. We conclude that transgenic resistance to TSWV is effective in reducing incidence of the disease in the field, and that accumulation of transgene protein may be important in broad-spectrum resistance.
Ma, Hao; Song, Congfeng; Borth, Wayne; Sether, Diane; Melzer, Michael; Hu, John
2011-10-20
Tomato spotted wilt virus (TSWV) has a very wide host range, and is transmitted in a persistent manner by several species of thrips. These characteristics make this virus difficult to control. We show here that the over-expression of the mitochondrial alternative oxidase (AOX) in tomato and petunia is related to TSWV resistance. The open reading frame and full-length sequence of the tomato AOX gene LeAox1au were cloned and introduced into tomato 'Healani' and petunia 'Sheer Madness' using Agrobacterium-mediated transformation. Highly expressed AOX transgenic tomato and petunia plants were selfed and transgenic R1 seedlings from 10 tomato lines and 12 petunia lines were used for bioassay. For each assayed line, 22 to 32 tomato R1 progeny in three replications and 39 to 128 petunia progeny in 13 replications were challenged with TSWV. Enzyme-Linked Immunosorbent Assays showed that the TSWV levels in transgenic tomato line FKT4-1 was significantly lower than that of wild-type controls after challenge with TSWV. In addition, transgenic petunia line FKP10 showed significantly less lesion number and smaller lesion size than non-transgenic controls after inoculation by TSWV. In all assayed transgenic tomato lines, a higher percentage of transgenic progeny had lower TSWV levels than non-transgenic plants after challenge with TSWV, and the significantly increased resistant levels of tomato and petunia lines identified in this study indicate that altered expression levels of AOX in tomato and petunia can affect the levels of TSWV resistance.
Directory of Open Access Journals (Sweden)
Ma Hao
2011-10-01
Full Text Available Abstract Background Tomato spotted wilt virus (TSWV has a very wide host range, and is transmitted in a persistent manner by several species of thrips. These characteristics make this virus difficult to control. We show here that the over-expression of the mitochondrial alternative oxidase (AOX in tomato and petunia is related to TSWV resistance. Results The open reading frame and full-length sequence of the tomato AOX gene LeAox1au were cloned and introduced into tomato 'Healani' and petunia 'Sheer Madness' using Agrobacterium-mediated transformation. Highly expressed AOX transgenic tomato and petunia plants were selfed and transgenic R1 seedlings from 10 tomato lines and 12 petunia lines were used for bioassay. For each assayed line, 22 to 32 tomato R1 progeny in three replications and 39 to 128 petunia progeny in 13 replications were challenged with TSWV. Enzyme-Linked Immunosorbent Assays showed that the TSWV levels in transgenic tomato line FKT4-1 was significantly lower than that of wild-type controls after challenge with TSWV. In addition, transgenic petunia line FKP10 showed significantly less lesion number and smaller lesion size than non-transgenic controls after inoculation by TSWV. Conclusion In all assayed transgenic tomato lines, a higher percentage of transgenic progeny had lower TSWV levels than non-transgenic plants after challenge with TSWV, and the significantly increased resistant levels of tomato and petunia lines identified in this study indicate that altered expression levels of AOX in tomato and petunia can affect the levels of TSWV resistance.
Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.
Directory of Open Access Journals (Sweden)
Shih Ping Yao
2002-04-01
Full Text Available Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C, is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57 of transgenic pigs (F0 generation. Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species.
Transgenic Arabidopsis Gene Expression System
Ferl, Robert; Paul, Anna-Lisa
2009-01-01
The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.
DEFF Research Database (Denmark)
Gustafsson, E; Brakebusch, C; Hietanen, K
2001-01-01
Tissue-specific gene inactivation using the Cre-loxP system has become an important tool to unravel functions of genes when the conventional null mutation is lethal. We report here the generation of a transgenic mouse line expressing Cre recombinase in endothelial cells. In order to avoid...... the production and screening of multiple transgenic lines we used embryonic stem cell and embryoid body technology to identify recombinant embryonic stem cell clones with high, endothelial-specific Cre activity. One embryonic stem cell clone that showed high Cre activity in endothelial cells was used to generate...... germline chimeras. The in vivo efficiency and specificity of the transgenic Cre was analysed by intercrossing the tie-1-Cre line with the ROSA26R reporter mice. At initial stages of vascular formation (E8-9), LacZ staining was detected in almost all cells of the forming vasculature. Between E10 and birth...
Azab, Ehab; Hegazy, Ahmad K; El-Sharnouby, Mohamed E; Abd Elsalam, Hassan E
2016-01-01
The potential use of human P450-transgenic plants for phytoremediation of pesticide contaminated soils was tested in laboratory and greenhouse experiments. The transgenic P450 CYP1A2 gene Arabidopsis thaliana plants metabolize number of herbicides, insecticides and industrial chemicals. The P450 isozymes CYP1A2 expressed in A. thaliana were examined regarding the herbicide simazine (SIM). Transgenic A. thaliana plants expressing CYP1A2 gene showed significant resistance to SIM supplemented either in plant growth medium or sprayed on foliar parts. The results showed that SIM produces harmful effect on both rosette diameter and primary root length of the wild type (WT) plants. In transgenic A. thaliana lines, the rosette diameter and primary root length were not affected by SIM concentrations used in this experiment. The results indicate that CYP1A2 can be used as a selectable marker for plant transformation, allowing efficient selection of transgenic lines in growth medium and/or in soil-grown plants. The transgenic A. thaliana plants exhibited a healthy growth using doses of up to 250 μmol SIM treatments, while the non-transgenic A. thaliana plants were severely damaged with doses above 50 μmol SIM treatments. The transgenic A. thaliana plants can be used as phytoremediator of environmental SIM contaminants.
An examination of the concept of driving point receptance
Sheng, X.; He, Y.; Zhong, T.
2018-04-01
In the field of vibration, driving point receptance is a well-established and widely applied concept. However, as demonstrated in this paper, when a driving point receptance is calculated using the finite element (FE) method with solid elements, it does not converge as the FE mesh becomes finer, suggesting that there is a singularity. Hence, the concept of driving point receptance deserves a rigorous examination. In this paper, it is firstly shown that, for a point harmonic force applied on the surface of an elastic half-space, the Boussinesq formula can be applied to calculate the displacement amplitude of the surface if the response point is sufficiently close to the load. Secondly, by applying the Betti reciprocal theorem, it is shown that the displacement of an elastic body near a point harmonic force can be decomposed into two parts, with the first one being the displacement of an elastic half-space. This decomposition is useful, since it provides a solid basis for the introduction of a contact spring between a wheel and a rail in interaction. However, according to the Boussinesq formula, this decomposition also leads to the conclusion that a driving point receptance is infinite (singular), and would be undefinable. Nevertheless, driving point receptances have been calculated using different methods. Since the singularity identified in this paper was not appreciated, no account was given to the singularity in these calculations. Thus, the validity of these calculation methods must be examined. This constructs the third part of the paper. As the final development of the paper, the above decomposition is utilised to define and determine driving point receptances required for dealing with wheel/rail interactions.
Problems of generation and reception of gravitational waves
International Nuclear Information System (INIS)
Pisarev, A.F.
1975-01-01
The present day status of the problems of gravitation, wave radiation and reception is surveyed. The physical presentation and mathematical description of the processes of radiation, propagation and interaction of gravitation waves with matter and the electromagnetic field are given. The experiments on the search for gravitation waves of astophysical nature are analysed. The laboratory and cosmic sources of these waves and the methods of their reception are described. Special attention is drawn to the analysis of the proposals to perform a complete laboratory gravitation wave experiment
Problems of generation and reception of gravitational waves. [Review
Energy Technology Data Exchange (ETDEWEB)
Pisarev, A F [Joint Inst. for Nuclear Research, Dubna (USSR)
1975-01-01
The present day status of the problems of gravitation, wave radiation and reception is surveyed. The physical presentation and mathematical description of the processes of radiation, propagation and interaction of gravitation waves with matter and the electromagnetic field are given. The experiments on the search for gravitation waves of astophysical nature are analysed. The laboratory and cosmic sources of these waves and the methods of their reception are described. Special attention is drawn to the analysis of the proposals to perform a complete laboratory gravitation wave experiment.
Mora, A; Earle, E D
2001-04-01
Progeny from transgenic broccoli (cv. Green Comet) expressing a Trichoderma harzianum endochitinase gene were used to assess the interaction between endochitinase and the fungicide Bayleton in the control of Alternaria brassicicola. In vitro assays have shown synergistic effects of endochitinase and fungicides on fungal pathogens. Our study examined the in planta effects of endochitinase and Bayleton, individually and in combination. Two month old transgenic and non-transgenic plants were sprayed with ED50 levels of Bayleton and/or inoculated with an A. brassicicola spore suspension. Disease levels in non-sprayed transgenic plants were not statistically different from sprayed transgenic plants nor from sprayed non-transgenic controls. Thus endochitinase-transgenic plants alone provided a significant reduction of disease severity, comparable to the protection by fungicide on non-transgenic plants. Comparison of the expected additive and observed effects revealed no synergism between endochitinase and Bayleton (at ED50 level), and usually less than an additive effect. Some transgenic lines sprayed with fungicide at doses higher than ED50 showed resistance similar to the non-sprayed transgenic lines, again suggesting no synergistic effect. Lack of synergism may be due to incomplete digestion of the cell wall by endochitinase, so that the effect of Bayleton at the cell membrane is not enhanced.
DEFF Research Database (Denmark)
Chen, Yaling; Sun, Xiao-Feng; Zhou, Xin
2017-01-01
Starch phosphorylation occurs naturally during starch metabolism in the plant and is catalysed by glucan water dikinases (GWD1) and phosphoglucan water dikinase/glucan water dikinase 3 (PWD/GWD3). We generated six stable individual transgenic lines by over-expressing the potato GWD1 in rice....... Transgenic rice grain starch had 9-fold higher 6-phospho (6-P) monoesters and double amounts of 3-phospho (3-P) monoesters, respectively, compared to control grain. The shape and topography of the transgenic starch granules were moderately altered including surface pores and less well defined edges...... content was positively correlated with short chains of DP6-12. The starch pasting temperature, peak viscosity and the breakdown were lower but the setback was higher for transgenic rice flour. The 6-P content was negatively correlated with texture adhesiveness but positively correlated...
A transgenic approach to study argininosuccinate synthetase gene expression
2014-01-01
Background Argininosuccinate synthetase (ASS) participates in urea, nitric oxide and arginine production. Besides transcriptional regulation, a post-transcriptional regulation affecting nuclear precursor RNA stability has been reported. To study whether such post-transcriptional regulation underlines particular temporal and spatial ASS expression, and to investigate how human ASS gene behaves in a mouse background, a transgenic mouse system using a modified bacterial artificial chromosome carrying the human ASS gene tagged with EGFP was employed. Results Two lines of ASS-EGFP transgenic mice were generated: one with EGFP under transcriptional control similar to that of the endogenous ASS gene, another with EGFP under both transcriptional and post-transcriptional regulation as that of the endogenous ASS mRNA. EGFP expression in the liver, the organ for urea production, and in the intestine and kidney that are responsible for arginine biosynthesis, was examined. Organs taken from embryos E14.5 stage to young adult were examined under a fluorescence microscope either directly or after cryosectioning. The levels of EGFP and endogenous mouse Ass mRNAs were also quantified by S1 nuclease mapping. EGFP fluorescence and EGFP mRNA levels in both the liver and kidney were found to increase progressively from embryonic stage toward birth. In contrast, EGFP expression in the intestine was higher in neonates and started to decline at about 3 weeks after birth. Comparison between the EGFP profiles of the two transgenic lines indicated the developmental and tissue-specific regulation was mainly controlled at the transcriptional level. The ASS transgene was of human origin. EGFP expression in the liver followed essentially the mouse Ass pattern as evidenced by zonation distribution of fluorescence and the level of EGFP mRNA at birth. However, in the small intestine, Ass mRNA level declined sharply at 3 week of age, and yet substantial EGFP mRNA was still detectable at this stage
Bi, Rui-Ming; Jia, Hai-Yan; Feng, De-Shun; Wang, Hong-Gang
2006-05-01
The transgenic wheat of improved resistance to the storage pest was production. We have introduced the cowpea trypsin inhibitor gene (CpTI) into cultured embryonic callus cells of immature embryos of wheat elite line by Agrobacterium-mediated method. Independent plantlets were obtained from the kanamycin-resistant calli after screening. PCR and real time PCR analysis, PCR-Southern and Southern blot hybridization indicated that there were 3 transgenic plants viz. transformed- I, II and III (T- I, T-II and T-III). The transformation frequencies were obviously affected by Agrobacterium concentration, the infection duration and transformation treatment. The segregations of CpTI in the transgenic wheat progenies were not easily to be elucidated, and some transgenic wheat lines (T- I and T-III) showed Mendelian segregations. The determinations of insect resistance to the stored grain insect of wheat viz. the grain moth (Sitotroga cerealella Olivier) indicated that the 3 transgenic wheat progeny seeds moth-resistance was improved significantly. The seed moth-eaten ratio of T- I, T-II, T-III and nontransformed control was 19.8%, 21.9%, 32.9% and 58.3% respectively. 3 transgenic wheat T1 PCR-positive plants revealed that the 3 transgenic lines had excellent agronomic traits. They supplied good germplasm resource of insect-resistance for wheat genetic improvement.
Directory of Open Access Journals (Sweden)
Qiyan Jiang
2014-04-01
Full Text Available The transcription factor dehydration-responsive element binding protein (DREB is able to improve tolerance to abiotic stress in plants by regulating the expression of downstream genes involved in environmental stress resistance. The objectives of this study were to evaluate the salt tolerance of GmDREB1 transgenic wheat (Triticum aestivum L. and to evaluate its physiological and protein responses to salt stress. Compared with the wild type, the transgenic lines overexpressing GmDREB1 showed longer coleoptiles and radicles and a greater radicle number at the germination stage, as well as greater root length, fresh weight, and tiller number per plant at the seedling stage. The yield-related traits of transgenic lines were also improved compared with the wild type, indicating enhanced salt tolerance in transgenic lines overexpressing GmDREB1. Proteomics analysis revealed that osmotic- and oxidative-stress-related proteins were up-regulated in transgenic wheat leaves under salt stress conditions. Transgenic wheat had higher levels of proline and betaine and lower levels of malondialdehyde and relative electrolyte leakage than the wild type. These results suggest that GmDREB1 regulates the expression of osmotic- and oxidative-stress-related proteins that reduce the occurrence of cell injury caused by high salinity, thus improving the salt tolerance of transgenic wheat.
Overexpression of TiERF1 enhances resistance to sharp eyespot in transgenic wheat
Chen, Liang; Zhang, ZengYan; Liang, HongXia; Liu, HongXia; Du, LiPu; Xu, Huijun; Xin, Zhiyong
2008-01-01
Wheat sharp eyespot, primarily caused by a soil-borne fungus Rhizoctonia cerealis, has become one of the most serious diseases of wheat in China. In this study, an ethylene response factor (ERF) gene from a wheat relative Thinopyrum intermedium, TiERF1, was characterized further, transgenic wheat lines expressing TiERF1 were developed, and the resistance of the transgenic wheat lines against R. cerealis was investigated. Southern blotting analysis indicated that at least two copies of the TiE...
Single-Event Transgene Product Levels Predict Levels in Genetically Modified Breeding Stacks.
Gampala, Satyalinga Srinivas; Fast, Brandon J; Richey, Kimberly A; Gao, Zhifang; Hill, Ryan; Wulfkuhle, Bryant; Shan, Guomin; Bradfisch, Greg A; Herman, Rod A
2017-09-13
The concentration of transgene products (proteins and double-stranded RNA) in genetically modified (GM) crop tissues is measured to support food, feed, and environmental risk assessments. Measurement of transgene product concentrations in breeding stacks of previously assessed and approved GM events is required by many regulatory authorities to evaluate unexpected transgene interactions that might affect expression. Research was conducted to determine how well concentrations of transgene products in single GM events predict levels in breeding stacks composed of these events. The concentrations of transgene products were compared between GM maize, soybean, and cotton breeding stacks (MON-87427 × MON-89034 × DAS-Ø15Ø7-1 × MON-87411 × DAS-59122-7 × DAS-40278-9 corn, DAS-81419-2 × DAS-44406-6 soybean, and DAS-21023-5 × DAS-24236-5 × SYN-IR102-7 × MON-88913-8 × DAS-81910-7 cotton) and their component single events (MON-87427, MON-89034, DAS-Ø15Ø7-1, MON-87411, DAS-59122-7, and DAS-40278-9 corn, DAS-81419-2, and DAS-44406-6 soybean, and DAS-21023-5, DAS-24236-5, SYN-IR102-7, MON-88913-8, and DAS-81910-7 cotton). Comparisons were made within a crop and transgene product across plant tissue types and were also made across transgene products in each breeding stack for grain/seed. Scatter plots were generated comparing expression in the stacks to their component events, and the percent of variability accounted for by the line of identity (y = x) was calculated (coefficient of identity, I 2 ). Results support transgene concentrations in single events predicting similar concentrations in breeding stacks containing the single events. Therefore, food, feed, and environmental risk assessments based on concentrations of transgene products in single GM events are generally applicable to breeding stacks composed of these events.
Accurate measurement of transgene copy number in crop plants using droplet digital PCR.
Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger
2017-06-01
Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one- and two-copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.
Conti-Ramsden, Gina; Ullman, Michael T; Lum, Jarrad A G
2015-01-01
What memory systems underlie grammar in children, and do these differ between typically developing (TD) children and children with specific language impairment (SLI)? Whilst there is substantial evidence linking certain memory deficits to the language problems in children with SLI, few studies have investigated multiple memory systems simultaneously, examining not only possible memory deficits but also memory abilities that may play a compensatory role. This study examined the extent to which procedural, declarative, and working memory abilities predict receptive grammar in 45 primary school aged children with SLI (30 males, 15 females) and 46 TD children (30 males, 16 females), both on average 9;10 years of age. Regression analyses probed measures of all three memory systems simultaneously as potential predictors of receptive grammar. The model was significant, explaining 51.6% of the variance. There was a significant main effect of learning in procedural memory and a significant group × procedural learning interaction. Further investigation of the interaction revealed that procedural learning predicted grammar in TD but not in children with SLI. Indeed, procedural learning was the only predictor of grammar in TD. In contrast, only learning in declarative memory significantly predicted grammar in SLI. Thus, different memory systems are associated with receptive grammar abilities in children with SLI and their TD peers. This study is, to our knowledge, the first to demonstrate a significant group by memory system interaction in predicting grammar in children with SLI and their TD peers. In line with Ullman's Declarative/Procedural model of language and procedural deficit hypothesis of SLI, variability in understanding sentences of varying grammatical complexity appears to be associated with variability in procedural memory abilities in TD children, but with declarative memory, as an apparent compensatory mechanism, in children with SLI.
Intervention for Mixed Receptive-Expressive Language Impairment: A Review
Boyle, James; McCartney, Elspeth; O'Hare, Anne; Law, James
2010-01-01
Studies indicate that language impairment that cannot be accounted for by factors such as below-average non-verbal ability, hearing impairment, behaviour or emotional problems, or neurological impairments affects some 6% of school-age children. Language impairment with a receptive language component is more resistant to intervention than specific…
Adolescent Weight Status and Receptivity to Food TV Advertisements
Adachi-Mejia, Anna M.; Sutherland, Lisa A.; Longacre, Meghan R.; Beach, Michael L.; Titus-Ernstoff, Linda; Gibson, Jennifer J.; Dalton, Madeline A.
2011-01-01
Objective: This study examined the relationship between adolescent weight status and food advertisement receptivity. Design: Survey-based evaluation with data collected at baseline (initial and at 2 months), and at follow-up (11 months). Setting: New Hampshire and Vermont. Participants: Students (n = 2,281) aged 10-13 in 2002-2005. Main Outcome…
Contour detection based on nonclassical receptive field inhibition
Grigorescu, Cosmin; Petkov, Nicolai; Westenberg, Michel A.
We propose a biologically motivated computational step, called nonclassical receptive field (non-CRF) inhibition, more generally surround inhibition or suppression, to improve contour detection in machine vision. Non-CRF inhibition is exhibited by 80% of the orientation-selective neurons in the
Learning color receptive fields and color differential structure
ter Haar Romenij, B.M.
2016-01-01
In this paper we study the role of brain plasticity, and investigate the emergence and self-emergence of receptive fields from scalar and color natural images by principal component analysis of image patches. We describe the classical experiment on localized PCA on center-surround weighted patches
Psychological Models of Art Reception must be Empirically Grounded
DEFF Research Database (Denmark)
Nadal, Marcos; Vartanian, Oshin; Skov, Martin
2017-01-01
We commend Menninghaus et al. for tackling the role of negative emotions in art reception. However, their model suffers from shortcomings that reduce its applicability to empirical studies of the arts: poor use of evidence, lack of integration with other models, and limited derivation of testable...... hypotheses. We argue that theories about art experiences should be based on empirical evidence....
Qualitative Audience Research: Toward an Integrative Approach to Reception.
Jensen, Klaus Bruhn
1987-01-01
Analyzes research about the mass communication audience and describes a theoretical and methodological framework for further empirical studies. Discusses the (1) explanatory value of qualitative research; (2) social and cultural implications of the reception process, with special reference to television; and (3) applications and social relevance…
Receptive Learning Styles Of Introverts, Ambiverts And Extroverts In ...
African Journals Online (AJOL)
Learning to relate with people in their own style is important in helping to understand why they react the way they do. The purpose of this study therefore was to determine the differences in the receptive learning styles of introverts, ambiverts and extroverts in Senior High Schools (SHS) in the Sekondi-Takoradi Metropolis, ...
Radiation Emergency Preparedness Tools: Virtual Community Reception Center
Centers for Disease Control (CDC) Podcasts
This podcast is an overview of resources from the Clinician Outreach and Communication Activity (COCA) Call: Practical Tools for Radiation Emergency Preparedness. A specialist working with CDC's Radiation Studies Branch describes a web-based training tool known as a Virtual Community Reception Center (vCRC).
The Judaeo-Karaite Reception of the Hebrew Bible
DEFF Research Database (Denmark)
Sabih, Joshua
DESCRIPTION: The Karaites emerged as a school of thought within Middle Eastern Judaism in the 8th century. The Karaites were a “reading community” whose intellectual activity and daily lives were based around the divine scriptures. Over time Karaism became one of the two main competing schools of...... between the Rabbinate and the Karaite reception and interpretation of the Hebrew Bible....
Spectrotemporal dynamics of auditory cortical synaptic receptive field plasticity.
Froemke, Robert C; Martins, Ana Raquel O
2011-09-01
The nervous system must dynamically represent sensory information in order for animals to perceive and operate within a complex, changing environment. Receptive field plasticity in the auditory cortex allows cortical networks to organize around salient features of the sensory environment during postnatal development, and then subsequently refine these representations depending on behavioral context later in life. Here we review the major features of auditory cortical receptive field plasticity in young and adult animals, focusing on modifications to frequency tuning of synaptic inputs. Alteration in the patterns of acoustic input, including sensory deprivation and tonal exposure, leads to rapid adjustments of excitatory and inhibitory strengths that collectively determine the suprathreshold tuning curves of cortical neurons. Long-term cortical plasticity also requires co-activation of subcortical neuromodulatory control nuclei such as the cholinergic nucleus basalis, particularly in adults. Regardless of developmental stage, regulation of inhibition seems to be a general mechanism by which changes in sensory experience and neuromodulatory state can remodel cortical receptive fields. We discuss recent findings suggesting that the microdynamics of synaptic receptive field plasticity unfold as a multi-phase set of distinct phenomena, initiated by disrupting the balance between excitation and inhibition, and eventually leading to wide-scale changes to many synapses throughout the cortex. These changes are coordinated to enhance the representations of newly-significant stimuli, possibly for improved signal processing and language learning in humans. Copyright © 2011 Elsevier B.V. All rights reserved.
Advertising Receptivity and Youth Initiation of Smokeless Tobacco.
Timberlake, David S
2016-07-28
Cross-sectional data suggests that adolescents' receptivity to the advertising of smokeless tobacco is correlated with use of chewing tobacco or snuff. Lack of longitudinal data has precluded determination of whether advertising receptivity precedes or follows initiation of smokeless tobacco. The objective of this study was to test for the association between advertising receptivity and subsequent initiation of smokeless tobacco among adolescent males. Adolescent males from the 1993-1999 Teen Longitudinal California Tobacco Survey were selected at the baseline survey for never having used smokeless tobacco. Separate longitudinal analyses corresponded to two dependent variables, ever use of smokeless tobacco (1993-1996; N = 1,388) and use on 20 or more occasions (1993-1999; N = 1,014). Models were adjusted for demographic variables, risk factors for smokeless tobacco use, and exposure to users of smokeless tobacco. Advertising receptivity at baseline was predictive of ever use by late adolescence (RR(95% CI) = 2.0 (1.5, 2.8)) and regular use by young adulthood (RR(95% CI) = 3.7 (2.1, 6.7)) in models that were adjusted for covariates. Conclusions/ Importance: The findings challenge the tobacco industry's assertion that tobacco marketing does not impact youth initiation. This is particularly relevant to tobacco control in the United States because the 2009 Tobacco Control Act places fewer restrictions on smokeless tobacco products compared to cigarettes.
Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun
2011-01-01
In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...
Directory of Open Access Journals (Sweden)
Ren Chen
2010-01-01
Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.
Jung, Sunyo; Back, Kyoungwhan
2005-05-01
We analyzed the herbicidal and antioxidant defense responses of transgenic rice plants that overexpressed the Myxococcus xanthus protoporphyrinogen oxidase gene. Leaf squares of the wild-type incubated with oxyfluorfen were characterized by necrotic leaf lesions and increases in conductivity and malonyldialdehyde levels, whereas transgenic lines M4 and M7 did not show any change with up to 100 microM oxyfluorfen. The wild-type had decreased F(v)/F(m) and produced a high level of H(2)O(2) at 18 h after foliar application of oxyfluorfen, whereas transgenic lines M4 and M7 were unaffected. In response to oxyfluorfen, violaxanthin, beta-carotene, and chlorophylls (Chls) decreased in wild-type plants, whereas antheraxanthin and zeaxanthin increased. Only a slight decline in Chls was observed in transgenic lines at 48 h after oxyfluorfen treatment. Noticeable increases of cytosolic Cu/Zn-superoxide dismutase, peroxidase isozymes 1 and 2, and catalase were observed after at 48 h of oxyfluorfen treatment in the wild-type. Non-enzymatic antioxidants appeared to respond faster to oxyfluorfen-induced photodynamic stress than did enzymatic antioxidants. Protective responses for the detoxification of active oxygen species were induced to counteract photodynamic stress in oxyfluorfen-treated, wild-type plants. However, oxyfluorfen-treated, transgenic plants suffered less oxidative stress, confirming increased herbicidal resistance resulted from dual expression of M. xanthus Protox in chloroplasts and mitochondria.
Use of the viral 2A peptide for bicistronic expression in transgenic mice
Directory of Open Access Journals (Sweden)
Trichas Georgios
2008-09-01
Full Text Available Abstract Background Transgenic animals are widely used in biomedical research and biotechnology. Multicistronic constructs, in which several proteins are encoded by a single messenger RNA, are commonly used in genetically engineered animals. This is currently done by using an internal ribosomal entry site to separate the different coding regions. 2A peptides result in the co-translational 'cleavage' of proteins and are an attractive alternative to the internal ribosomal entry site. They are more reliable than the internal ribosomal entry site and lead to expression of multiple cistrons at equimolar levels. They work in a wide variety of eukaryotic cells, but to date have not been demonstrated to function in transgenic mice in an inheritable manner. Results To test 2A function in transgenic mice and uncover any possible toxicity of widespread expression of the 2A peptide, we made a bicistronic reporter construct containing the coding sequence for a membrane localised red fluorescent protein (Myr-TdTomato and a nuclear localised green fluorescent protein (H2B-GFP, separated by a 2A sequence. When this reporter is transfected into HeLa cells, the two fluorescent proteins correctly localise to mutually exclusive cellular compartments, demonstrating that the bicistronic construct is a reliable readout of 2A function. The two fluorescent proteins also correctly localise when the reporter is electroporated into chick neural tube cells. We made two independent transgenic mouse lines that express the bicistronic reporter ubiquitously. For both lines, transgenic mice are born in Mendelian frequencies and are found to be healthy and fertile. Myr-TdTomato and H2B-GFP segregate to mutually exclusive cellular compartments in all tissues examined from a broad range of developmental stages, ranging from embryo to adult. One transgenic line shows X-linked inheritance of the transgene and mosaic expression in females but uniform expression in males, indicating
Health Challenges in Refugee Reception: Dateline Europe 2016.
Blitz, Brad K; d'Angelo, Alessio; Kofman, Eleonore; Montagna, Nicola
2017-11-30
The arrival of more than one million migrants, many of them refugees, has proved a major test for the European Union. Although international relief and monitoring agencies have been critical of makeshift camps in Calais and Eidomeni where infectious disease and overcrowding present major health risks, few have examined the nature of the official reception system and its impact on health delivery. Drawing upon research findings from an Economic and Social Research Council (ESRC) funded project, this article considers the physical and mental health of asylum-seekers in transit and analyses how the closure of borders has engendered health risks for populations in recognised reception centres in Sicily and in Greece. Data gathered by means of a survey administered in Greece (300) and in Sicily (400), and complemented by in-depth interviews with migrants (45) and key informants (50) including representatives of government offices, humanitarian and relief agencies, NGOs and activist organisations, are presented to offer an analysis of the reception systems in the two frontline states. We note that medical provision varies significantly from one centre to another and that centre managers play a critical role in the transmission of vital information. A key finding is that, given such disparity, the criteria used by the UNHCR to grade health services reception do not address the substantive issue that prevent refugees from accessing health services, even when provided on site. Health provision is not as recorded in UNHCR reporting but rather there are critical gaps between provision, awareness, and access for refugees in reception systems in Sicily and in Greece. This article concludes that there is a great need for more information campaigns to direct refugees to essential services.
Health Challenges in Refugee Reception: Dateline Europe 2016
Directory of Open Access Journals (Sweden)
Brad K. Blitz
2017-11-01
Full Text Available The arrival of more than one million migrants, many of them refugees, has proved a major test for the European Union. Although international relief and monitoring agencies have been critical of makeshift camps in Calais and Eidomeni where infectious disease and overcrowding present major health risks, few have examined the nature of the official reception system and its impact on health delivery. Drawing upon research findings from an Economic and Social Research Council (ESRC funded project, this article considers the physical and mental health of asylum–seekers in transit and analyses how the closure of borders has engendered health risks for populations in recognised reception centres in Sicily and in Greece. Data gathered by means of a survey administered in Greece (300 and in Sicily (400, and complemented by in-depth interviews with migrants (45 and key informants (50 including representatives of government offices, humanitarian and relief agencies, NGOs and activist organisations, are presented to offer an analysis of the reception systems in the two frontline states. We note that medical provision varies significantly from one centre to another and that centre managers play a critical role in the transmission of vital information. A key finding is that, given such disparity, the criteria used by the UNHCR to grade health services reception do not address the substantive issue that prevent refugees from accessing health services, even when provided on site. Health provision is not as recorded in UNHCR reporting but rather there are critical gaps between provision, awareness, and access for refugees in reception systems in Sicily and in Greece. This article concludes that there is a great need for more information campaigns to direct refugees to essential services.
Health Challenges in Refugee Reception: Dateline Europe 2016
Blitz, Brad K.; d’Angelo, Alessio; Kofman, Eleonore; Montagna, Nicola
2017-01-01
The arrival of more than one million migrants, many of them refugees, has proved a major test for the European Union. Although international relief and monitoring agencies have been critical of makeshift camps in Calais and Eidomeni where infectious disease and overcrowding present major health risks, few have examined the nature of the official reception system and its impact on health delivery. Drawing upon research findings from an Economic and Social Research Council (ESRC) funded project, this article considers the physical and mental health of asylum–seekers in transit and analyses how the closure of borders has engendered health risks for populations in recognised reception centres in Sicily and in Greece. Data gathered by means of a survey administered in Greece (300) and in Sicily (400), and complemented by in-depth interviews with migrants (45) and key informants (50) including representatives of government offices, humanitarian and relief agencies, NGOs and activist organisations, are presented to offer an analysis of the reception systems in the two frontline states. We note that medical provision varies significantly from one centre to another and that centre managers play a critical role in the transmission of vital information. A key finding is that, given such disparity, the criteria used by the UNHCR to grade health services reception do not address the substantive issue that prevent refugees from accessing health services, even when provided on site. Health provision is not as recorded in UNHCR reporting but rather there are critical gaps between provision, awareness, and access for refugees in reception systems in Sicily and in Greece. This article concludes that there is a great need for more information campaigns to direct refugees to essential services. PMID:29189766
Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E
2013-11-01
Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.
Indirect effect of a transgenic wheat on aphids through enhanced powdery mildew resistance.
von Burg, Simone; Álvarez-Alfageme, Fernando; Romeis, Jörg
2012-01-01
In agricultural ecosystems, arthropod herbivores and fungal pathogens are likely to colonise the same plant and may therefore affect each other directly or indirectly. The fungus that causes powdery mildew (Blumeria graminis tritici) and cereal aphids are important pests of wheat but interactions between them have seldom been investigated. We studied the effects of powdery mildew of wheat on two cereal aphid species, Metopolophium dirhodum and Rhopalosiphum padi. We hypothesized that aphid number and size will be smaller on powdery mildew-infected plants than on non-infected plants. In a first experiment we used six commercially available wheat varieties whereas in the second experiment we used a genetically modified (GM) mildew-resistant wheat line and its non-transgenic sister line. Because the two lines differed only in the presence of the transgene and in powdery mildew resistance, experiment 2 avoided the confounding effect of variety. In both experiments, the number of M. dirhodum but not of R. padi was reduced by powdery mildew infection. Transgenic mildew-resistant lines therefore harboured bigger aphid populations than the non-transgenic lines. For both aphid species individual size was mostly influenced by aphid number. Our results indicate that plants that are protected from a particular pest (powdery mildew) became more favourable for another pest (aphids).
Indirect effect of a transgenic wheat on aphids through enhanced powdery mildew resistance.
Directory of Open Access Journals (Sweden)
Simone von Burg
Full Text Available In agricultural ecosystems, arthropod herbivores and fungal pathogens are likely to colonise the same plant and may therefore affect each other directly or indirectly. The fungus that causes powdery mildew (Blumeria graminis tritici and cereal aphids are important pests of wheat but interactions between them have seldom been investigated. We studied the effects of powdery mildew of wheat on two cereal aphid species, Metopolophium dirhodum and Rhopalosiphum padi. We hypothesized that aphid number and size will be smaller on powdery mildew-infected plants than on non-infected plants. In a first experiment we used six commercially available wheat varieties whereas in the second experiment we used a genetically modified (GM mildew-resistant wheat line and its non-transgenic sister line. Because the two lines differed only in the presence of the transgene and in powdery mildew resistance, experiment 2 avoided the confounding effect of variety. In both experiments, the number of M. dirhodum but not of R. padi was reduced by powdery mildew infection. Transgenic mildew-resistant lines therefore harboured bigger aphid populations than the non-transgenic lines. For both aphid species individual size was mostly influenced by aphid number. Our results indicate that plants that are protected from a particular pest (powdery mildew became more favourable for another pest (aphids.
Fritz, Jonathan; Elhilali, Mounya; Shamma, Shihab
2005-08-01
Listening is an active process in which attentive focus on salient acoustic features in auditory tasks can influence receptive field properties of cortical neurons. Recent studies showing rapid task-related changes in neuronal spectrotemporal receptive fields (STRFs) in primary auditory cortex of the behaving ferret are reviewed in the context of current research on cortical plasticity. Ferrets were trained on spectral tasks, including tone detection and two-tone discrimination, and on temporal tasks, including gap detection and click-rate discrimination. STRF changes could be measured on-line during task performance and occurred within minutes of task onset. During spectral tasks, there were specific spectral changes (enhanced response to tonal target frequency in tone detection and discrimination, suppressed response to tonal reference frequency in tone discrimination). However, only in the temporal tasks, the STRF was changed along the temporal dimension by sharpening temporal dynamics. In ferrets trained on multiple tasks, distinctive and task-specific STRF changes could be observed in the same cortical neurons in successive behavioral sessions. These results suggest that rapid task-related plasticity is an ongoing process that occurs at a network and single unit level as the animal switches between different tasks and dynamically adapts cortical STRFs in response to changing acoustic demands.
Recent progress on technologies and applications of transgenic ...
African Journals Online (AJOL)
USER
2010-06-14
Jun 14, 2010 ... this, the methods for producing transgenic poultry must become routine. ... and spermatogonial stem cells (SSCs) have been developed to generate transgenic chickens. ... any procedure aimed at generating transgenic birds.
The reception of Bollywood in Malaysia (1991-2012): a contextual study
Sreekumar, Rohini
2017-01-01
Bollywood films are increasingly drawing scholarly attention for their global appeal and reception. Transnational studies have examined the reception of Bollywood in Australia, Britain, Scotland, South Africa, Russia, the United States of America, Bangladesh and Nepal. However, academic work on the Southeast Asian reception of these films is scarcer. This research seeks to fill this gap by looking at the reception of Bollywood in Malaysia from 1991-2012. The thesis adopts a...
What is so ‘classical’ about Classical Reception? Theories, Methodologies and Future Prospects
Anastasia Bakogianni
2016-01-01
This paper delivered at the University of Rio on 3rd June 2015 seeks to explore different approaches to the most fundamental questions in classical reception studies. What is classical reception? And more particularly what is so ‘classical’ about classical reception? It discusses current trends in theory and methodology via an analysis of two cinematic receptions of the ancient story of Electra; one that proclaims its debt to a classical text while the other masks its classical connections.
What is so ‘classical’ about Classical Reception? Theories, Methodologies and Future Prospects
Directory of Open Access Journals (Sweden)
Anastasia Bakogianni
2016-06-01
Full Text Available This paper delivered at the University of Rio on 3rd June 2015 seeks to explore different approaches to the most fundamental questions in classical reception studies. What is classical reception? And more particularly what is so ‘classical’ about classical reception? It discusses current trends in theory and methodology via an analysis of two cinematic receptions of the ancient story of Electra; one that proclaims its debt to a classical text while the other masks its classical connections.
Directory of Open Access Journals (Sweden)
Aragão F.J.L.
1999-01-01
Full Text Available Bean (Phaseolus vulgaris, an important component in the diet of people in developing countries, has low levels of the essential amino acid, methionine. We have attempted to correct this deficiency by introducing a transgene coding for a methionine-rich storage albumin from the Brazil nut via biolistic methods. The transgene's coding sequence was driven by a doubled 35S CaMV promoter and AMV enhancer sequences. The transgene was stable and correctly expressed in homozygous R2 to R5 seeds. In two of the five transgenic lines the methionine content was significantly increased (14 and 23% over the values found in untransformed plants.
Nematode neuropeptides as transgenic nematicides.
Directory of Open Access Journals (Sweden)
Neil D Warnock
2017-02-01
Full Text Available Plant parasitic nematodes (PPNs seriously threaten global food security. Conventionally an integrated approach to PPN management has relied heavily on carbamate, organophosphate and fumigant nematicides which are now being withdrawn over environmental health and safety concerns. This progressive withdrawal has left a significant shortcoming in our ability to manage these economically important parasites, and highlights the need for novel and robust control methods. Nematodes can assimilate exogenous peptides through retrograde transport along the chemosensory amphid neurons. Peptides can accumulate within cells of the central nerve ring and can elicit physiological effects when released to interact with receptors on adjoining cells. We have profiled bioactive neuropeptides from the neuropeptide-like protein (NLP family of PPNs as novel nematicides, and have identified numerous discrete NLPs that negatively impact chemosensation, host invasion and stylet thrusting of the root knot nematode Meloidogyne incognita and the potato cyst nematode Globodera pallida. Transgenic secretion of these peptides from the rhizobacterium, Bacillus subtilis, and the terrestrial microalgae Chlamydomonas reinhardtii reduce tomato infection levels by up to 90% when compared with controls. These data pave the way for the exploitation of nematode neuropeptides as a novel class of plant protective nematicide, using novel non-food transgenic delivery systems which could be deployed on farmer-preferred cultivars.
Deaf Students' Receptive and Expressive American Sign Language Skills: Comparisons and Relations
Beal-Alvarez, Jennifer S.
2014-01-01
This article presents receptive and expressive American Sign Language skills of 85 students, 6 through 22 years of age at a residential school for the deaf using the American Sign Language Receptive Skills Test and the Ozcaliskan Motion Stimuli. Results are presented by ages and indicate that students' receptive skills increased with age and…
The Past in the Future: Problems and Potentials of Historical Reception Studies.
Jensen, Klaus Bruhn
1993-01-01
Gives examples of how qualitative methodologies have been employed to study media reception in the present. Identifies some forms of evidence that can creatively fill the gaps in knowledge about media reception in the past. Argues that the field must develop databases documenting media reception, which may broaden the scope of audience research in…
Modulation of horizontal cell receptive fields in the light adapted goldfish retina
Verweij, J.; Kamermans, M.; van den Aker, E. C.; Spekreijse, H.
1996-01-01
In the isolated goldfish retina, 700 nm background illumination increases the horizontal cell receptive field size, as measured with 565 nm slits of light, but decreases the receptive field size, when measured with 660 nm slits. These background-induced changes in receptive field size are absent
Transformation of pecan and regeneration of transgenic plants.
McGranahan, G H; Leslie, C A; Dandekar, A M; Uratsu, S L; Yates, I E
1993-09-01
A gene transfer system developed for walnut (Juglans regia L.) was successfully applied to pecan (Carya illinoensis [Wang] K. Koch). Repetitively embryogenic somatic embryos derived from open-pollinated seed of 'Elliott', 'Wichita', and 'Schley' were co-cultivated with Agrobacterium strain EHA 101/pCGN 7001, which contains marker genes for beta-glucuronidase activity and resistance to kanamycin. Several modifications of the standard walnut transformation techniques were tested, including a lower concentration of kanamycin and a modified induction medium, but these treatments had no measurable effect on efficiency of transformation. Nineteen of the 764 viable inoculated embryos produced transgenic subclones; 13 of these were from the line 'Elliott'6, 3 from 'Schley'5/3, and 3 from 'Wichita'9. Transgenic embryos of 'Wichita'9 germinated most readily and three subclones were successfully micropropagated. Three transgenic plants of one of these subclones were obtained by grafting the tissue cultured shoots to seedling pecan rootstock in the greenhouse. Gene insertion, initially detected by GUS activity, was confirmed by detection of integrated T-DNA sequences using Southern analysis.
[New advances in animal transgenic technology].
Sun, Zhen-Hong; Miao, Xiang-Yang; Zhu, Rui-Liang
2010-06-01
Animal transgenic technology is one of the fastest growing biotechnology in the 21st century. It is used to integrate foreign genes into the animal genome by genetic engineering technology so that foreign genes can be expressed and inherited to the offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors on preparation of transgenic animals. A variety of transgenic techniques are available, each of which has its own advantages and disadvantages and still needs further study because of unresolved technical and safety issues. With the in-depth research, the transgenic technology will have broad application prospects in the fields of exploration of gene function, animal genetic improvement, bioreactor, animal disease models, organ transplantation and so on. This article reviews the recently developed animal gene transfer techniques, including germline stem cell mediated method to improve the efficiency, gene targeting to improve the accuracy, RNA interference (RNAi)-mediated gene silencing technology, and the induced pluripotent stem cells (iPS) transgenic technology. The new transgenic techniques can provide a better platform for the study of trans-genic animals and promote the development of medical sciences, livestock production, and other fields.
Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas
2014-01-01
Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.
Rustagi, Anjana; Kumar, Deepak; Shekhar, Shashi; Yusuf, Mohd Aslam; Misra, Santosh; Sarin, Neera Bhalla
2014-06-01
Cationic antimicrobial peptides (CAPs) have shown potential against broad spectrum of phytopathogens. Synthetic versions with desirable properties have been modeled on these natural peptides. MsrA1 is a synthetic chimera of cecropin A and melittin CAPs with antimicrobial properties. We generated transgenic Brassica juncea plants expressing the msrA1 gene aimed at conferring fungal resistance. Five independent transgenic lines were evaluated for resistance to Alternaria brassicae and Sclerotinia sclerotiorum, two of the most devastating pathogens of B. juncea crops. In vitro assays showed inhibition by MsrA1 of Alternaria hyphae growth by 44-62 %. As assessed by the number and size of lesions and time taken for complete leaf necrosis, the Alternaria infection was delayed and restricted in the transgenic plants with the protection varying from 69 to 85 % in different transgenic lines. In case of S. sclerotiorum infection, the lesions were more severe and spread profusely in untransformed control compared with transgenic plants. The sclerotia formed in the stem of untransformed control plants were significantly more in number and larger in size than those present in the transgenic plants where disease protection of 56-71.5 % was obtained. We discuss the potential of engineering broad spectrum biotic stress tolerance by transgenic expression of CAPs in crop plants.
Directory of Open Access Journals (Sweden)
Hensel Goetz
2012-09-01
Full Text Available Abstract Background While the genetic transformation of the major cereal crops has become relatively routine, to date only a few reports were published on transgenic triticale, and robust data on T-DNA integration and segregation have not been available in this species. Results Here, we present a comprehensive analysis of stable transgenic winter triticale cv. Bogo carrying the selectable marker gene HYGROMYCIN PHOSPHOTRANSFERASE (HPT and a synthetic green fluorescent protein gene (gfp. Progeny of four independent transgenic plants were comprehensively investigated with regard to the number of integrated T-DNA copies, the number of plant genomic integration loci, the integrity and functionality of individual T-DNA copies, as well as the segregation of transgenes in T1 and T2 generations, which also enabled us to identify homozygous transgenic lines. The truncation of some integrated T-DNAs at their left end along with the occurrence of independent segregation of multiple T-DNAs unintendedly resulted in a single-copy segregant that is selectable marker-free and homozygous for the gfp gene. The heritable expression of gfp driven by the maize UBI-1 promoter was demonstrated by confocal laser scanning microscopy. Conclusions The used transformation method is a valuable tool for the genetic engineering of triticale. Here we show that comprehensive molecular analyses are required for the correct interpretation of phenotypic data collected from the transgenic plants.
Directory of Open Access Journals (Sweden)
Zhongqiu Teng
2016-08-01
Full Text Available Plant viruses, especially tobacco mosaic virus (TMV and cucumber mosaic virus (CMV are serious threats to Rehmannia glutinosa which is a “top grade” herb in China. In the present study, TMV- and CMV-resistant Rehmannia glutinosa Libosch. plants were constructed by transforming the protein (CP genes of TMV and CMV into Rehmannia glutinosa via a modified procedure of Agrobacterium tumefaciens-mediated transformation. Integration and expression of TMV CP and CMV CP transgenes in 2 lines, LBA-1 and LBA-2, were confirmed by PCR, Southern blot and RT-PCR. Both LBA-1 and LBA-2 were resistant to infection of homologous TMV and CMV strains. The quality of transgenic Rehmanniae Radix was evaluated based on fingerprint analysis and components quantitative analysis comparing with control root tubes. These results showed that chemical composition of transgenic Rehmanniae Radix were similar to non-transgenic ones, which demonstrated that the medical quality and biosafety of transgenic Rehmanniae Radix were equivalent to non-transgenic material when consumed as traditional Chinese medicinal (TCM.
Mohsin, Samreen; Maqbool, Asma; Ashraf, Mehwish; Malik, Kauser Abdulla
2017-08-01
A significant portion of organic phosphorus comprises of phytates which are not available to wheat for uptake. Hence for enabling wheat to utilize organic phosphorus in form of phytate, transgenic wheat expressing phytase from Aspergillus japonicus under barley root-specific promoter was developed. Transgenic events were initially screened via selection media containing BASTA, followed by PCR and BASTA leaf paint assay after hardening. Out of 138 successfully regenerated T o events, only 12 had complete constructs and thus further analyzed. Positive T1 transgenic plants, grown in sand, exhibited 0.08-1.77, 0.02-0.67 and 0.44-2.14 fold increase in phytase activity in root extracts, intact roots and external root solution, respectively, after 4 weeks of phosphorus stress. Based on these results, T2 generation of four best transgenic events was further analyzed which showed up to 1.32, 56.89, and 15.40 fold increase in phytase activity in root extracts, intact roots and external root solution, respectively, while in case of real-time PCR, maximum fold increase of 19.8 in gene expression was observed. Transgenic lines showed 0.01-1.18 fold increase in phosphorus efficiency along with higher phosphorus content when supplied phytate or inorganic phosphorus than control plants. Thus, this transgenic wheat may aid in reducing fertilizer utilization and enhancing wheat yield.
Directory of Open Access Journals (Sweden)
Patroba Odeny Ojola
2018-06-01
Full Text Available Cassava (Manihot esculenta Crantz is the most important staple food for more than 300 million people in Africa, and anthracnose disease caused by Colletotrichum gloeosporioides f. sp. manihotis is the most destructive fungal disease affecting cassava production in sub-Saharan Africa. The main objective of this study was to improve anthracnose resistance in cassava through genetic engineering. Transgenic cassava plants harbouring rice thaumatin-like protein (Ostlp gene, driven by the constitutive CaMV35S promoter, were generated using Agrobacterium-mediated transformation of friable embryogenic calli (FEC of cultivar TMS 60444. Molecular analysis confirmed the presence, integration, copy number of the transgene all the independent transgenic events. Semi-quantitative RT-PCR confirmed high expression levels of Ostlp in six transgenic lines tested. The antifungal activity of the transgene against Colletotrichum gloeosporioides pathogen was evaluated using the leaves and stem cuttings bioassay. The results demonstrated significantly delayed disease development and reduced size of necrotic lesions in leaves and stem cuttings of all transgenic lines compared to the leaves and stem cuttingss of non-transgenic control plants. Therefore, constitutive overexpression of rice thaumatin-like protein in transgenic cassava confers enhanced tolerance to the fungal pathogen C. gloeosporioides f. sp. manihotis. These results can therefore serve as an initial step towards genetic engineering of farmer-preffered cassava cultivars for resistance to anthracnose disease. Keywords: Colletotrichum gloeosporioides f. sp. manihotis, Thaumatin-like protein, Transgenic cassava
Flavell, D M; Wells, T; Wells, S E; Carmignac, D F; Thomas, G B; Robinson, I C
1996-01-01
Expression of human growth hormone (hGH) was targeted to growth hormone-releasing (GRF) neurons in the hypothalamus of transgenic rats. This induced dominant dwarfism by local feedback inhibition of GRF. One line, bearing a single copy of a GRF-hGH transgene, has been characterized in detail, and has been termed Tgr (for Transgenic growth-retarded). hGH was detected by immunocytochemistry in the brain, restricted to the median eminence of the hypothalamus. Low levels were also detected in the...
Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš
2017-08-01
Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.
Transgenic chickens expressing human urokinase-type plasminogen activator.
Lee, Sung Ho; Gupta, Mukesh Kumar; Ho, Young Tae; Kim, Teoan; Lee, Hoon Taek
2013-09-01
Urokinase-type plasminogen activator is a serine protease that is clinically used in humans for the treatment of thrombolytic disorders and vascular diseases such as acute ischemic stroke and acute peripheral arterial occlusion. This study explored the feasibility of using chickens as a bioreactor for producing human urokinase-type plasminogen activator (huPA). Recombinant huPA gene, under the control of a ubiquitous Rous sarcoma virus promoter, was injected into the subgerminal cavity of freshly laid chicken eggs at stage X using the replication-defective Moloney murine leukemia virus (MoMLV)-based retrovirus vectors encapsidated with VSV-G (vesicular stomatitis virus G) glycoprotein. A total of 38 chicks, out of 573 virus-injected eggs, hatched and contained the huPA gene in their various body parts. The mRNA transcript of the huPA gene was present in various organs, including blood and egg, and was germ-line transmitted to the next generation. The level of active huPA protein was 16-fold higher in the blood of the transgenic chicken than in the nontransgenic chicken (P huPA protein in eggs increased from 7.82 IU/egg in the G0 generation to 17.02 IU/egg in the G1 generation. However, huPA-expressing embryos had reduced survival and hatchability at d 18 and 21 of incubation, respectively, and the blood clotting time was significantly higher in transgenic chickens than their nontransgenic counterparts (P huPA transgenic chickens could be successfully produced by the retroviral vector system. Transgenic chickens, expressing the huPA under the control of a ubiquitous promoter, may not only be used as a bioreactor for pharming of the huPA drug but also be useful for studying huPA-induced bleeding and other disorders.
Bt-transgenic oilseed rape hybridization with its weedy relative, Brassica rapa.
Halfhill, Matthew D; Millwood, Reginald J; Raymer, Paul L; Stewart, C Neal
2002-10-01
The movement of transgenes from crops to weeds and the resulting consequences are concerns of modern agriculture. The possible generation of "superweeds" from the escape of fitness-enhancing transgenes into wild populations is a risk that is often discussed, but rarely studied. Oilseed rape, Brassica napus (L.), is a crop with sexually compatible weedy relatives, such as birdseed rape (Brassica rapa (L.)). Hybridization of this crop with weedy relatives is an extant risk and an excellent interspecific gene flow model system. In laboratory crosses, T3 lines of seven independent transformation events of Bacillus thuringiensis (Bt) oilseed rape were hybridized with two weedy accessions of B. rapa. Transgenic hybrids were generated from six of these oilseed rape lines, and the hybrids exhibited an intermediate morphology between the parental species. The Bt transgene was present in the hybrids, and the protein was synthesized at similar levels to the corresponding independent oilseed rape lines. Insect bioassays were performed and confirmed that the hybrid material was insecticidal. The hybrids were backcrossed with the weedy parent, and only half the oilseed rape lines were able to produce transgenic backcrosses. After two backcrosses, the ploidy level and morphology of the resultant plants were indistinguishable from B. rapa. Hybridization was monitored under field conditions (Tifton, GA, USA) with four independent lines of Bt oilseed rape with a crop to wild relative ratio of 1200:1. When B. rapa was used as the female parent, hybridization frequency varied among oilseed rape lines and ranged from 16.9% to 0.7%.
Qiyan Jiang; Zheng Hu; Hui Zhang; Youzhi Ma
2014-01-01
The transcription factor dehydration-responsive element binding protein (DREB) is able to improve tolerance to abiotic stress in plants by regulating the expression of downstream genes involved in environmental stress resistance. The objectives of this study were to evaluate the salt tolerance of GmDREB1 transgenic wheat (Triticum aestivum L.) and to evaluate its physiological and protein responses to salt stress. Compared with the wild type, the transgenic lines overexpressing GmDREB1 showed...
Han, Lanzhi; Liu, Peilei; Wu, Kongming; Peng, Yufa; Wang, Feng
2008-10-01
Genetically modified insect-resistant rice lines containing the cry1Ac gene from Bacillus thuringiensis (Bt) or the CpTI (cowpea trypsin inhibitor) gene developed for the management of lepidopterous pests are highly resistant to the major target pests, Chilo suppressalis (Walker), Cnaphalocrocis medinalis (Guenée), and Scirpophaga incertulas (Walker), in the main rice-growing areas of China. However, the effects of these transgenic lines on Sesamia inferens (Walker), an important lepidopterous rice pest, are currently unknown. Because different insect species have varying susceptibility to Bt insecticidal proteins that may affect population dynamics, research into the effects of these transgenic rice lines on the population dynamics of S. inferens was conducted in Fuzhou, southern China, in 2005 and 2006. The results of laboratory, field cage, and field plot experiments show that S. inferens has comparatively high susceptibility to the transgenic line during the early growing season, with significant differences observed in larval density and infestation levels between transgenic and control lines. Because of a decrease in Cry1Ac levels in the plant as it ages, the transgenic line provided only a low potential for population suppression late in the growing season. There is a correlation between the changing expression of Cry1Ac and the impact of transgenic rice on the population dynamics of S. inferens during the season. These results indicate that S. inferens may become a major pest in fields of prospective commercially released transgenic rice, and more attention should be paid to developing an effective alternative management strategy.
Nonredundant sparse feature extraction using autoencoders with receptive fields clustering.
Ayinde, Babajide O; Zurada, Jacek M
2017-09-01
This paper proposes new techniques for data representation in the context of deep learning using agglomerative clustering. Existing autoencoder-based data representation techniques tend to produce a number of encoding and decoding receptive fields of layered autoencoders that are duplicative, thereby leading to extraction of similar features, thus resulting in filtering redundancy. We propose a way to address this problem and show that such redundancy can be eliminated. This yields smaller networks and produces unique receptive fields that extract distinct features. It is also shown that autoencoders with nonnegativity constraints on weights are capable of extracting fewer redundant features than conventional sparse autoencoders. The concept is illustrated using conventional sparse autoencoder and nonnegativity-constrained autoencoders with MNIST digits recognition, NORB normalized-uniform object data and Yale face dataset. Copyright © 2017 Elsevier Ltd. All rights reserved.
Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange
Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.
2014-01-01
RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198
Endometrial Receptivity and its Predictive Value for IVF/ICSI-Outcome.
Heger, A; Sator, M; Pietrowski, D
2012-08-01
Endometrial receptivity plays a crucial role in the establishment of a healthy pregnancy in cycles of assisted reproduction. The endometrium as a key factor during reproduction can be assessed in multiple ways, most commonly through transvaginal grey-scale or 3-D ultrasound. It has been shown that controlled ovarian hyperstimulation has a great impact on the uterine lining, which leads to different study results for the predictive value of endometrial factors measured on different cycle days. There is no clear consensus on whether endometrial factors are appropriate to predict treatment outcome and if so, which one is suited best. The aim of this review is to summarize recent findings of studies about the influence of endometrial thickness, volume and pattern on IVF- and ICSI-treatment outcome and provide an overview of future developments in the field.
Fonseca, Cátia; Planchon, Sébastien; Serra, Tânia; Chander, Subhash; Saibo, Nelson J M; Renaut, Jenny; Oliveira, M Margarida; Batista, Rita
2015-01-01
Identification of differences between genetically modified plants and their original counterparts plays a central role in risk assessment strategy. Our main goal was to better understand the relevance of transgene presence, genetic, and epigenetic changes induced by transgene insertion, and in vitro culture in putative unintended differences between a transgenic and its comparator. Thus, we have used multiplex fluorescence 2DE coupled with MS to characterize the proteome of three different rice lines (Oryza sativa L. ssp. japonica cv. Nipponbare): a control conventional line (C), an Agrobacterium-transformed transgenic line (Ta) and a negative segregant (NSb). We observed that Ta and NSb appeared identical (with only one spot differentially abundant--fold difference ≥ 1.5), contrasting with the control (49 spots with fold difference ≥ 1.5, in both Ta and NSb vs. control). Given that in vitro culture was the only event in common between Ta and NSb, we hypothesize that in vitro culture stress was the most relevant condition contributing for the observed proteomic differences. MS protein identification support our hypothesis, indicating that Ta and NSb lines adjusted their metabolic pathways and altered the abundance of several stress related proteins in order to cope with in vitro culture. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster
Lin, Chun-Chieh; Potter, Christopher J.
2016-01-01
Gene conversions occur when genomic double-strand DNA breaks (DSBs) trigger unidirectional transfer of genetic material from a homologous template sequence. Exogenous or mutated sequence can be introduced through this homology-directed repair (HDR). We leveraged gene conversion to develop a method for genomic editing of existing transgenic insertions in Drosophila melanogaster. The clustered regularly-interspaced palindromic repeats (CRISPR)/Cas9 system is used in the homology assisted CRISPR knock-in (HACK) method to induce DSBs in a GAL4 transgene, which is repaired by a single-genomic transgenic construct containing GAL4 homologous sequences flanking a T2A-QF2 cassette. With two crosses, this technique converts existing GAL4 lines, including enhancer traps, into functional QF2 expressing lines. We used HACK to convert the most commonly-used GAL4 lines (labeling tissues such as neurons, fat, glia, muscle, and hemocytes) to QF2 lines. We also identified regions of the genome that exhibited differential efficiencies of HDR. The HACK technique is robust and readily adaptable for targeting and replacement of other genomic sequences, and could be a useful approach to repurpose existing transgenes as new genetic reagents become available. PMID:27334272
Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.
Directory of Open Access Journals (Sweden)
Liping Ke
Full Text Available Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel. In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L and bentazon (4.2 µmol. A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.
Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin
2013-10-01
Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.
Wang, Yu Cheng; Qu, Guan Zheng; Li, Hong Yan; Wu, Ying Jie; Wang, Chao; Liu, Gui Feng; Yang, Chuan Ping
2010-02-01
Superoxide dismutases (SODs) play important role in stress tolerance of plants. In this study, an MnSOD gene (TaMnSOD) from Tamarix androssowii, under the control of the CaMV35S promoter, was introduced into poplar (Populus davidiana x P. bolleana). The physiological parameters, including SOD activity, malondialdehyde (MDA) content, relative electrical conductivity (REC) and relative weight gain, of transgenic lines and wild type (WT) plants, were measured and compared. The results showed that SOD activity was enhanced in transgenic plants, and the MDA content and REC were significantly decreased compared to WT plants when exposed to NaCl stress. In addition, the relative weight gains of the transgenic plants were 8- to 23-fold of those observed for WT plants after NaCl stress for 30 days. The data showed that the SOD activities that increased in transgenic lines are 1.3-4-folds of that increased in the WT plant when exposed to NaCl stress. Our analysis showed that increases in SOD activities as low as 0.15-fold can also significantly enhance salt tolerance in transgenic plants, suggesting an important role of increased SOD activity in plant salt tolerance
Food in film : a study on audience reception
Civelek, Ece Simin
2012-01-01
Ankara : The Department of Communication and Design, İhsan Doğramacı Bilkent University, 2012. Thesis (Master's) -- Bilkent University, 2012. Includes bibliographical references leaves 140-149. This study intends to analyze audience reception of foodstuff and related practices in films. In the study foodstuff and related practices are taken into consideration as a powerful semiotic system and in that respect are evaluated as an important property of filmic narration. Study e...
Impaired receptivity and decidualization in DHEA-induced PCOS mice
Li, Shu-Yun; Song, Zhuo; Song, Min-Jie; Qin, Jia-Wen; Zhao, Meng-Long; Yang, Zeng-Ming
2016-01-01
Polycystic ovary syndrome (PCOS), a complex endocrine disorder, is a leading cause of female infertility. An obvious reason for infertility in PCOS women is anovulation. However, success rate with high quality embryos selected by assisted reproduction techniques in PCOS patients still remain low with a high rate of early clinical pregnancy loss, suggesting a problem in uterine receptivity. Using a dehydroepiandrosterone-induced mouse model of PCOS, some potential causes of decreased fertility...
Reception theory and the Christian reader: A preliminary perspective
Directory of Open Access Journals (Sweden)
A. L. Comhrink
1983-03-01
Full Text Available In recent years there has been a significant shift in emphasis from text- centred criticism in literature to reader-centred criticism. This new field of criticism, called Reception Theory or Reader Response Criticism, denies the immutable nature of the "text” and regards as its object of study the work of literature that is created through the co-constituent creative and interpretive acts o f both writer and reader.
Concern About Hunger May Increase Receptivity to GMOs.
Carter, B Elijah; Conn, Caitlin C; Wiles, Jason R
2016-07-01
Due to a phenomenon known as the 'backfire effect', intuition-based opinions can be inadvertently strengthened by evidence-based counterarguments. Students' views on genetically modified organisms (GMOs) may be subject to this effect. We explored the impact of an empathetically accessible topic, world hunger, on receptivity to GMO technology as an alternative to direct evidence-based approaches. Copyright © 2016 Elsevier Ltd. All rights reserved.
van Blokland, R; ten Lohuis, M; Meyer, P
1997-12-01
The chromatin structures of two epigenetic alleles of a transgene were investigated by measuring the local accessibility of transgene chromatin to endonucleases. The two epialleles represented the active, hypomethylated state of a transgene in line 17-I of Petunia hybrida, and a transcriptionally inactive, hypermethylated derivative of the same transgene in line 17-IV. In nuclear preparations the inactive epiallele was significantly less sensitive to DNasel digestion and nuclease S7 digestion than the transcriptionally active epiallele, whereas no significant differences in accessibility were observed between naked DNA samples of the two epialleles. Our data suggest that a condensed chromatin structure is specifically imposed on transcribed regions of the construct in line 17-IV. In contrast, in both epialleles the plasmid region of the transgene, which is not transcriptionally active in plants, retains the same accessibility to endonucleases as the chromosomal integration site. These data suggest that transcriptional inactivation is linked to the process of transcription, and imply that control of transgene expression via the use of inducible or tissue-specific promoters might prevent transgene silencing and conserve the active state of transgenes during sexual propagation.
Clinical investigations of receptive and expressive musical functions after stroke
Directory of Open Access Journals (Sweden)
Ken eRosslau
2015-06-01
Full Text Available There is a long tradition of investigating various disorders of musical abilities after stroke. These impairments, associated with acquired amusia, can be highly selective, affecting only music perception (i.e., receptive abilities/functions or expression (music production abilities, and some patients report that these may dramatically influence their emotional state. The aim of this study was to systematically test both the melodic and rhythmic domains of music perception and expression in left- and right-sided stroke patients compared to healthy subjects. Music perception was assessed using rhythmic and melodic discrimination tasks, while tests of expressive function involved the vocal or instrumental reproduction of rhythms and melodies. Our approach revealed deficits in receptive and expressive functions in stroke patients, mediated by musical expertise. Those patients who had experienced a short period of musical training in childhood and adolescence performed better in the receptive and expressive subtests compared to those without any previous musical training. While discrimination of specific musical patterns was unimpaired after a right-sided stroke, patients with a left-sided stroke had worse results for fine melodic and rhythmic analysis. In terms of expressive testing, the most consistent results were obtained from a test that required patients to reproduce sung melodies. This implies that the means of investigating production abilities can impact the identification of deficits.
K-pop Reception and Participatory Fan Culture in Austria
Directory of Open Access Journals (Sweden)
Sang-Yeon Sung
2013-12-01
Full Text Available K-pop’s popularity and its participatory fan culture have expanded beyond Asia and become significant in Europe in the past few years. After South Korean pop singer Psy’s “Gangnam Style” music video topped the Austrian chart in October 2012, the number and size of K-pop events in Austria sharply increased, with fans organizing various participatory events, including K-pop auditions, dance festivals, club meetings, quiz competitions, dance workshops, and smaller fan-culture gatherings. In the private sector, longtime fans have transitioned from participants to providers, and in the public sector, from observers to sponsors. Through in-depth interviews with event organizers, sponsors, and fans, this article offers an ethnographic study of the reception of K-pop in Europe that takes into consideration local interactions between fans and Korean sponsors, perspectives on the genre, patterns of social integration, and histories. As a case study, this research stresses the local situatedness of K-pop fan culture by arguing that local private and public sponsors and fans make the reception of K-pop different in each locality. By exploring local scenes of K-pop reception and fan culture, the article demonstrates the rapidly growing consumption of K-pop among Europeans and stresses multidirectional understandings of globalization.
Sibship size, sibling cognitive sensitivity, and children's receptive vocabulary.
Prime, Heather; Pauker, Sharon; Plamondon, André; Perlman, Michal; Jenkins, Jennifer
2014-02-01
The aim of the current study was to examine the relationship between sibship size and children's vocabulary as a function of quality of sibling interactions. It was hypothesized that coming from a larger sibship (ie, 3+ children) would be related to lower receptive vocabulary in children. However, we expected this association to be moderated by the level of cognitive sensitivity shown by children's next-in-age older siblings. Data on 385 children (mean age = 3.15 years) and their next-in-age older siblings (mean age = 5.57 years) were collected and included demographic questionnaires, direct testing of children's receptive vocabulary, and videos of mother-child and sibling interactions. Sibling dyads were taped engaging in a cooperative building task and tapes were coded for the amount of cognitive sensitivity the older sibling exhibited toward the younger sibling. Hierarchical regression analyses were conducted and showed an interaction between sibship size and sibling cognitive sensitivity in the prediction of children's receptive vocabulary; children exposed to large sibships whose next-in-age older sibling exhibited higher levels of cognitive sensitivity were less likely to show low vocabulary skills when compared with those children exposed to large sibships whose siblings showed lower levels of cognitive sensitivity. Children who show sensitivity to the cognitive needs of their younger siblings provide a rich environment for language development. The negative impact of large sibships on language development is moderated by the presence of an older sibling who shows high cognitive sensitivity.
Aesthetic-Receptive and Critical-Creative in Appreciative Reading
Directory of Open Access Journals (Sweden)
Titin Setiartin
2017-10-01
Full Text Available Reading is a process of aesthetically appreciative receptive to emphasize critical-creative reading activities. Metacognitively students understand, address any and explore the idea of the author in the text. Students responded, criticize, and evaluate the author's ideas in the text. At this stage, students can construct their post read text into other forms (new text. The aim of this strategy equips students to understand the meaning of the story, explore ideas, responding critically, and creatively pouring backstory idea. Reading strategies aesthetically-critical-creative receptive grabbed cognitive, effective, and psychomotor toward literacy critical reading and creative writing. Read appreciative included into the activities of reading comprehension. This activity involves the sensitivity and ability to process aesthetically-receptive reading and critical-creative. Readers imagination roam the author to obtain meaningful understanding and experience of reading. Some models of reading comprehension proposed experts covering the steps before reading, when reading, and after reading. At that stage to enable students after reading thinking abilities. Activities that can be done at this stage, for example, examine the back story, retell, make drawings, diagrams, or maps the concept of reading, as well as making a road map that describes the event. Other activities that can be done is to transform our student's text stories through reinforcement form illustrated stories into comic book form, for example (transliteration.
Adolescent weight status and receptivity to food TV advertisements.
Adachi-Mejia, Anna M; Sutherland, Lisa A; Longacre, Meghan R; Beach, Michael L; Titus-Ernstoff, Linda; Gibson, Jennifer J; Dalton, Madeline A
2011-01-01
This study examined the relationship between adolescent weight status and food advertisement receptivity. Survey-based evaluation with data collected at baseline (initial and at 2 months), and at follow-up (11 months). New Hampshire and Vermont. Students (n = 2,281) aged 10-13 in 2002-2005. Overweight. Generalized estimating equations to model the relationship between identifying a food advertisement as their favorite and being overweight. Overall, 35.9% of the adolescents were overweight. Less than one fifth named a food advertisement as their favorite (16.1%). Most of the food advertisements were for less-healthful food (89.6%). After controlling for school, age, sex, sociodemographics, physical activity, number of TV sessions watched, and having a TV in the bedroom, overweight adolescents were significantly less likely to be receptive to food advertisements (relative risk = 0.83, 95% confidence interval 0.70, 0.98) compared to non-overweight adolescents. This study provides preliminary evidence that normal-weight adolescents are receptive to unhealthful food advertisements. Longitudinal studies are needed to evaluate whether consistent exposure to advertisements for unhealthful food, particularly if they are promoted with healthful behaviors such as being physically active, influence adolescents' food choices, and ultimately their body mass index, over the long term. Copyright © 2011 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.
Clinical investigations of receptive and expressive musical functions after stroke.
Rosslau, Ken; Steinwede, Daniel; Schröder, C; Herholz, Sibylle C; Lappe, Claudia; Dobel, Christian; Altenmüller, Eckart
2015-01-01
There is a long tradition of investigating various disorders of musical abilities after stroke. These impairments, associated with acquired amusia, can be highly selective, affecting only music perception (i.e., receptive abilities/functions) or expression (music production abilities), and some patients report that these may dramatically influence their emotional state. The aim of this study was to systematically test both the melodic and rhythmic domains of music perception and expression in left- and right-sided stroke patients compared to healthy subjects. Music perception was assessed using rhythmic and melodic discrimination tasks, while tests of expressive function involved the vocal or instrumental reproduction of rhythms and melodies. Our approach revealed deficits in receptive and expressive functions in stroke patients, mediated by musical expertise. Those patients who had experienced a short period of musical training in childhood and adolescence performed better in the receptive and expressive subtests compared to those without any previous musical training. While discrimination of specific musical patterns was unimpaired after a left-sided stroke, patients with a right-sided stroke had worse results for fine melodic and rhythmic analysis. In terms of expressive testing, the most consistent results were obtained from a test that required patients to reproduce sung melodies. This implies that the means of investigating production abilities can impact the identification of deficits.
Depression. Does it affect the comprehension of receptive skills?
Rashtchi, Mojgan; Zokaee, Zahra; Ghaffarinejad, Ali R; Sadeghi, Mohammad M
2012-07-01
To compare the comprehension of depressed and non-depressed male and female Iranian learners of English as a Foreign Language (EFL) in receptive skills, and to investigate whether inefficiency in learning English could be due to depression. We selected 126 boys and 96 girls aged between 15 and 18 by simple random sampling from 2 high schools in Kerman, Iran to examine whether there was any significant relationship between depression and comprehension of receptive skills in males and females. We undertook this descriptive, correlational study between January and May 2011 in Kerman, Iran. After administration of the Beck Depression Inventory (BDI), we found that 93 students were non-depressed, 65 had minimal depression, 48 mild depression, and 16 suffered from severe depression. The correlation between participants` scores on listening and reading test with depression level indicated a significant relationship between depression and comprehension of both listening, and reading. Males had higher scores in both reading and listening. In listening, there was no significant difference among the levels of depression and males and females. Regarding the reading skill, there was no significant difference among levels of depression; however, the reading comprehension of males and females differed significantly. Learners who show a deficiency in receptive skills should be examined for the possibility of suffering from some degree of depression.
Huang, Jie-Hong; Kortstee, Anne; Dees, Dianka C T; Trindade, Luisa M; Schols, Henk A; Gruppen, Harry
2016-08-01
Uridine diphosphate (UDP)-glucose 4-epimerase (UGE) catalyzes the conversion of UDP-glucose to UDP-galactose. Cell wall materials from the cv. Kardal (wild-type, background) and two UGE transgenic lines (UGE 45-1 and UGE 51-16) were isolated and fractionated. The galactose (Gal) content (mg/100g tuber) from UGE 45-1 transgenic line was 38% higher than that of wild-type, and resulted in longer pectin side chains. The Gal content present in UGE 51-16 was 17% lower than that of wild-type, although most pectin populations maintained the same level of Gal. Both UGE transgenic lines showed unexpectedly a decrease in acetylation and an increase in methyl-esterification of pectin. Both UGE transgenic lines showed similar proportions of homogalacturonan and rhamnogalacturonan I within pectin backbone as the wild-type, except for the calcium-bound pectin fraction exhibiting relatively less rhamnogalacturonan I. Next to pectin modification, xyloglucan populations from both transgenic lines were altered resulting in different XSGG and XXGG proportion in comparison to wild-type. Copyright © 2016 Elsevier Ltd. All rights reserved.
Luna, Aderval S.; da Silva, Arnaldo P.; Pinho, Jéssica S. A.; Ferré, Joan; Boqué, Ricard
Near infrared (NIR) spectroscopy and multivariate classification were applied to discriminate soybean oil samples into non-transgenic and transgenic. Principal Component Analysis (PCA) was applied to extract relevant features from the spectral data and to remove the anomalous samples. The best results were obtained when with Support Vectors Machine-Discriminant Analysis (SVM-DA) and Partial Least Squares-Discriminant Analysis (PLS-DA) after mean centering plus multiplicative scatter correction. For SVM-DA the percentage of successful classification was 100% for the training group and 100% and 90% in validation group for non transgenic and transgenic soybean oil samples respectively. For PLS-DA the percentage of successful classification was 95% and 100% in training group for non transgenic and transgenic soybean oil samples respectively and 100% and 80% in validation group for non transgenic and transgenic respectively. The results demonstrate that NIR spectroscopy can provide a rapid, nondestructive and reliable method to distinguish non-transgenic and transgenic soybean oils.
A review of recommendations for sequencing receptive and expressive language instruction.
Petursdottir, Anna Ingeborg; Carr, James E
2011-01-01
We review recommendations for sequencing instruction in receptive and expressive language objectives in early and intensive behavioral intervention (EIBI) programs. Several books recommend completing receptive protocols before introducing corresponding expressive protocols. However, this recommendation has little empirical support, and some evidence exists that the reverse sequence may be more efficient. Alternative recommendations include teaching receptive and expressive skills simultaneously (M. L. Sundberg & Partington, 1998) and building learning histories that lead to acquisition of receptive and expressive skills without direct instruction (Greer & Ross, 2008). Empirical support for these recommendations also is limited. Future research should assess the relative efficiency of receptive-before-expressive, expressive-before-receptive, and simultaneous training with children who have diagnoses of autism spectrum disorders. In addition, further evaluation is needed of the potential benefits of multiple-exemplar training and other variables that may influence the efficiency of receptive and expressive instruction.
Park, Sung-Chul; Kim, Yun-Hee; Kim, Sun Ha; Jeong, Yu Jeong; Kim, Cha Young; Lee, Joon Seol; Bae, Ji-Yeong; Ahn, Mi-Jeong; Jeong, Jae Cheol; Lee, Haeng-Soon; Kwak, Sang-Soo
2015-04-01
The R2R3-type protein IbMYB1 is a key regulator of anthocyanin biosynthesis in the storage roots of sweet potato [Ipomoea batatas (L.) Lam]. Previously, we demonstrated that IbMYB1 expression stimulated anthocyanin pigmentation in tobacco leaves and Arabidopsis. Here, we generated dual-pigmented transgenic sweet potato plants that accumulated high levels of both anthocyanins and carotenoids in a single sweet potato storage root. An orange-fleshed cultivar with high carotenoid levels was transformed with the IbMYB1 gene under the control of either the storage root-specific sporamin 1 (SPO1) promoter or the oxidative stress-inducible peroxidase anionic 2 (SWPA2) promoter. The SPO1-MYB transgenic lines exhibited higher anthocyanin levels in storage roots than empty vector control (EV) or SWPA2-MYB plants, but carotenoid content was unchanged. SWPA2-MYB transgenic lines exhibited higher levels of both anthocyanin and carotenoids than EV plants. Analysis of hydrolyzed anthocyanin extracts indicated that cyanidin and peonidin predominated in both overexpression lines. Quantitative reverse transcription-polymerase chain reaction analysis demonstrated that IbMYB1 expression in both IbMYB1 transgenic lines strongly induced the upregulation of several genes in the anthocyanin biosynthetic pathway, whereas the expression of carotenoid biosynthetic pathway genes varied between transgenic lines. Increased anthocyanin levels in transgenic plants also promoted the elevation of proanthocyanidin and total phenolic levels in fresh storage roots. Consequently, all IbMYB1 transgenic plants displayed much higher antioxidant activities than EV plants. In field cultivations, storage root yields varied between the transgenic lines. Taken together, our results indicate that overexpression of IbMYB1 is a highly promising strategy for the generation of transgenic plants with enhanced antioxidant capacity. © 2014 Scandinavian Plant Physiology Society.
Directory of Open Access Journals (Sweden)
Chan Anthony WS
2008-02-01
Full Text Available Abstract Background Alzheimer's disease (AD is a devastating neurodegenerative disorder that affects a large and growing number of elderly individuals. In addition to idiopathic disease, AD is also associated with autosomal dominant inheritance, which causes a familial form of AD (FAD. Some instances of FAD have been linked to mutations in the β-amyloid protein precursor (APP. Although there are numerous mouse AD models available, few rat AD models, which have several advantages over mice, have been generated. Results Fischer 344 rats expressing human APP driven by the ubiquitin-C promoter were generated via lentiviral vector infection of Fischer 344 zygotes. We generated two separate APP-transgenic rat lines, APP21 and APP31. Serum levels of human amyloid-beta (Aβ40 were 298 pg/ml for hemizygous and 486 pg/ml for homozygous APP21 animals. Serum Aβ42 levels in APP21 homozygous rats were 135 pg/ml. Immunohistochemistry in brain showed that the human APP transgene was expressed in neurons, but not in glial cells. These findings were consistent with independent examination of enhanced green fluorescent protein (eGFP in the brains of eGFP-transgenic rats. APP21 and APP31 rats expressed 7.5- and 3-times more APP mRNA, respectively, than did wild-type rats. Northern blots showed that the human APP transgene, driven by the ubiquitin-C promoter, is expressed significantly more in brain, kidney and lung compared to heart and liver. A similar expression pattern was also seen for the endogenous rat APP. The unexpected similarity in the tissue-specific expression patterns of endogenous rat APP and transgenic human APP mRNAs suggests regulatory elements within the cDNA sequence of APP. Conclusion This manuscript describes the generation of APP-transgenic inbred Fischer 344 rats. These are the first human AD model rat lines generated by lentiviral infection. The APP21 rat line expresses high levels of human APP and could be a useful model for AD. Tissue
Qiu, Jian; Sun, Shuquan; Luo, Shiqiao; Zhang, Jichuan; Xiao, Xianzhou; Zhang, Liqun; Wang, Feng; Liu, Shizhong
2014-04-01
This study developed a new purple coloured Taraxacum brevicorniculatum plant through genetic transformation using the Arabidopsis AtPAP1 gene, which overproduced anthocyanins in its vegetative tissues. Rubber-producing Taraxacum plants synthesise high-quality natural rubber (NR) in their roots and so are a promising alternative global source of this raw material. A major factor in its commercialization is the need for multipurpose exploitation of the whole plant. To add value to the aerial tissues, red/purple plants of the rubber-producing Taraxacum brevicorniculatum species were developed through heterologous expression of the production of anthocyanin pigment 1 (AtPAP1) transcription factor from Arabidopsis thaliana. The vegetative tissue of the transgenic plants showed an average of a 48-fold increase in total anthocyanin content over control levels, but with the exception of pigmentation, the transgenic plants were phenotypically comparable to controls and displayed similar growth vigor. Southern blot analysis confirmed that the AtPAP1 gene had been integrated into the genome of the high anthocyanin Taraxacum plants. The AtPAP1 expression levels were estimated by quantitative real-time PCR and were highly correlated with the levels of total anthocyanins in five independent transgenic lines. High levels of three cyanidin glycosides found in the purple plants were characterized by high performance liquid chromatography-mass spectrum analysis. The presence of NR was verified by NMR and infrared spectroscopy, and confirmed that NR biosynthesis had not been affected in the transgenic Taraxacum lines. In addition, other major phenylpropanoid products such as chlorogenic acid and quercetin glycosides were also enhanced in the transgenic Taraxacum. The red/purple transgenic Taraxacum lines described in this study would increase the future application of the species as a rubber-producing crop due to its additional health benefits.
Expression of multiple proteins in transgenic plants
Vierstra, Richard D.; Walker, Joseph M.
2002-01-01
A method is disclosed for the production of multiple proteins in transgenic plants. A DNA construct for introduction into plants includes a provision to express a fusion protein of two proteins of interest joined by a linking domain including plant ubiquitin. When the fusion protein is produced in the cells of a transgenic plant transformed with the DNA construction, native enzymes present in plant cells cleave the fusion protein to release both proteins of interest into the cells of the transgenic plant. Since the proteins are produced from the same fusion protein, the initial quantities of the proteins in the cells of the plant are approximately equal.
Rapid method for identification of transgenic fish zygosity
Directory of Open Access Journals (Sweden)
. Alimuddin
2007-07-01
Full Text Available Identification of zygosity in transgenik fish is normally achieved by PCR analysis with genomic DNA template extracted from the tissue of progenies which are derived by mating the transgenic fish and wild-type counterpart. This method needs relatively large amounts of fish material and is time- and labor-intensive. New approaches addressing this problem could be of great help for fish biotechnologists. In this experiment, we applied a quantitative real-time PCR (qr-PCR method to analyze zygosity in a stable line of transgenic zebrafish (Danio rerio carrying masu salmon, Oncorhynchus masou D6-desaturase-like gene. The qr-PCR was performed using iQ SYBR Green Supermix in the iCycler iQ Real-time PCR Detection System (Bio-Rad Laboratories, USA. Data were analyzed using the comparative cycle threshold method. The results demonstrated a clear-cut identification of all transgenic fish (n=20 classified as a homozygous or heterozygous. Mating of those fish with wild-type had revealed transgene transmission to the offspring following expected Mendelian laws. Thus, we found that the qTR-PCR to be effective for a rapid and precise determination of zygosity in transgenic fish. This technique could be useful in the establishment of breeding programs for mass transgenic fish production and in experiments in which zygosity effect could have a functional impact. Keywords: quantitative real-time PCR; zygosity; transgenic fish; mass production ABSTRAK Identifikasi sigositas ikan transgenik biasanya dilakukan menggunakan analisa PCR dengan cetakan DNA genomik yang diekstraksi dari jaringan ikan hasil persilangan antara ikan transgenik dan ikan normal. Metode ini memerlukan ikan dalam jumlah yang banyak, dan juga waktu serta tenaga. Pendekatan baru untuk mengatasi masalah tersebut akan memberikan manfaat besar kepada peneliti bioteknologi perikanan. Pada penelitian ini, kami menggunakan metode PCR real-time kuantitatif (krt-PCR untuk
While transgenic plants can offer agricultural benefits, the escape of transgenes out of crop fields is a major environmental concern. Escape of transgenic herbicide resistance has occurred between transgenic Brassica napus (canola) and weedy species in numerous locations. In t...
GABAB Receptor Constituents Revealed by Tandem Affinity Purification from Transgenic Mice
DEFF Research Database (Denmark)
Bartoi, Tudor; Rigbolt, Kristoffer T G; Du, Dan
2010-01-01
lines that allow a straightforward biochemical isolation of GABA(B) receptors. The transgenic mice express GABA(B1) isoforms that contain sequences for a two-step affinity purification, in addition to their endogenous subunit repertoire. Comparative analyses of purified samples from the transgenic mice...... and wild-type control animals revealed two novel components of the GABA(B1) complex. One of the identified proteins, potassium channel tetramerization domain-containing protein 12, associates with heterodimeric GABA(B) receptors via the GABA(B2) subunit. In transfected hippocampal neurons, potassium...
Gwak, Yu Shin; Han, Jung Yeon; Adhikari, Prakash Babu; Ahn, Chang Ho; Choi, Yong Eui
2017-06-01
Production of compound K (a ginsenoside saponin) and its precursors in transgenic tobacco resulted in stunted growth and seed set failure, which may be caused by strong autotoxicity of heterologously produced phytochemicals against the tobacco itself. Panax ginseng roots contain various saponins (ginsenosides), which are major bioactive compounds. A monoglucosylated saponin, compound K (20-O-(β-D-glucopyranosyl)-20(S)-protopanaxadiol), has high medicinal and cosmetic values but is present in undetectable amounts in naturally grown ginseng roots. The production of compound K (CK) requires complicated deglycosylation of ginsenosides using physicochemical and/or enzymatic degradation. In this work, we report the production of CK in transgenic tobacco by co-overexpressing three genes (PgDDS, CYP716A47 and UGT71A28) isolated from P. ginseng. Introduction and expression of the transgenes in tobacco lines were confirmed by genomic PCR and RT-PCR. All the lines of transgenic tobacco produced CK including its precursors, protopanaxadiol and dammarenediol-II (DD). The concentrations of CK in the leaves ranged from 1.55 to 2.64 µg/g dry weight, depending on the transgenic line. Interestingly, production of CK in tobacco brought stunted plant growth and gave rise to seed set failure. This seed set failure was caused by both long-styled flowers and abnormal pollen development in transgenic tobacco. Both CK and DD treatments highly suppressed in vitro germination and tube growth in wild-type pollens. Based on these results, metabolic engineering for CK production in transgenic tobacco was successfully achieved, but the production of CK and its precursors in tobacco severely affects vegetative and reproductive growth due to the cytotoxicity of phytochemicals that are heterologously produced in transgenic tobacco.
Nestin Reporter Transgene Labels Multiple Central Nervous System Precursor Cells
Directory of Open Access Journals (Sweden)
Avery S. Walker
2010-01-01
Full Text Available Embryonic neuroepithelia and adult subventricular zone (SVZ stem and progenitor cells express nestin. We characterized a transgenic line that expresses enhanced green fluorescent protein (eGFP specified to neural tissue by the second intronic enhancer of the nestin promoter that had several novel features. During embryogenesis, the dorsal telencephalon contained many and the ventral telencephalon few eGFP+ cells. eGFP+ cells were found in postnatal and adult neurogenic regions. eGFP+ cells in the SVZ expressed multiple phenotype markers, glial fibrillary acidic protein, Dlx, and neuroblast-specific molecules suggesting the transgene is expressed through the lineage. eGFP+ cell numbers increased in the SVZ after cortical injury, suggesting this line will be useful in probing postinjury neurogenesis. In non-neurogenic regions, eGFP was strongly expressed in oligodendrocyte progenitors, but not in astrocytes, even when they were reactive. This eGFP+ mouse will facilitate studies of proliferative neuroepithelia and adult neurogenesis, as well as of parenchymal oligodendrocytes.
Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.
Directory of Open Access Journals (Sweden)
Vinciane Régnier
Full Text Available The cystathionine β-synthase (CBS gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA metabolism, a pathway important for several brain physiological processes.Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1 expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line.We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.
Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.
Régnier, Vinciane; Billard, Jean-Marie; Gupta, Sapna; Potier, Brigitte; Woerner, Stéphanie; Paly, Evelyne; Ledru, Aurélie; David, Sabrina; Luilier, Sabrina; Bizot, Jean-Charles; Vacano, Guido; Kraus, Jan P; Patterson, David; Kruger, Warren D; Delabar, Jean M; London, Jaqueline
2012-01-01
The cystathionine β-synthase (CBS) gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS) cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA) metabolism, a pathway important for several brain physiological processes. Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1) expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line. We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.
Directory of Open Access Journals (Sweden)
Xiaoliang Duan
2018-03-01
Full Text Available Wheat aphids are major pests during the seed filling stage of wheat. Plant lectins are toxic to sap-sucking pests such as wheat aphids. In this study, Pinellia pedatisecta agglutinin (ppa, a gene encoding mannose binding lectin, was cloned, and it shared 92.69% nucleotide similarity and 94% amino acid similarity with Pinellia ternata agglutinin (pta. The ppa gene, driven by the constitutive and phloem-specific ribulose bisphosphate carboxylase small subunit gene (rbcs promoter in pBAC-rbcs-ppa expression vector, was transferred into the wheat cultivar Baofeng104 (BF104 by particle bombardment transformation. Fifty-four T0 transgenic plants were generated. The inheritance and expression of the ppa gene were confirmed by PCR and RT-PCR analysis respectively, and seven homozygous transgenic lines were obtained. An aphid bioassay on detached leaf segments revealed that seven ppa transgenic wheat lines had lower aphid growth rates and higher inhibition rates than BF104. Furthermore, two-year aphid bioassays in isolated fields showed that aphid numbers per tiller of transgenic lines were significantly decreased, compared with wild type BF104. Therefore, ppa could be a strong biotechnological candidate to produce aphid-resistant wheat.
AN APPROACH TO TRANSGENIC CROP MONITORING
Remote sensing by aerial or satellite images may provide a method of identifying transgenic pesticidal crop distribution in the landscape. Genetically engineered crops containing bacterial gene(s) that express an insecticidal protein from Bacillus thuringiensis (Bt) are regulated...
Directory of Open Access Journals (Sweden)
Mohammad S. Khan
2017-07-01
Full Text Available Transgenic Brassica napus harboring the synthetic chitinase (NiC gene exhibits broad-spectrum antifungal resistance. As the rhizosphere microorganisms play an important role in element cycling and nutrient transformation, therefore, biosafety assessment of NiC containing transgenic plants on soil ecosystem is a regulatory requirement. The current study is designed to evaluate the impact of NiC gene on the rhizosphere enzyme activities and microbial community structure. The transgenic lines with the synthetic chitinase gene (NiC showed resistance to Alternaria brassicicola, a common disease causing fungal pathogen. The rhizosphere enzyme analysis showed no significant difference in the activities of fivesoil enzymes: alkalyine phosphomonoestarase, arylsulphatase, β-glucosidase, urease and sucrase between the transgenic and non-transgenic lines of B. napus varieties, Durr-e-NIFA (DN and Abasyne-95 (AB-95. However, varietal differences were observed based on the analysis of molecular variance. Some individual enzymes were significantly different in the transgenic lines from those of non-transgenic but the results were not reproducible in the second trail and thus were considered as environmental effect. Genotypic diversity of soil microbes through 16S–23S rRNA intergenic spacer region amplification was conducted to evaluate the potential impact of the transgene. No significant diversity (4% for bacteria and 12% for fungal between soil microbes of NiC B. napus and the non-transgenic lines was found. However, significant varietal differences were observed between DN and AB-95 with 79% for bacterial and 54% for fungal diversity. We conclude that the NiC B. napus lines may not affect the microbial enzyme activities and community structure of the rhizosphere soil. Varietal differences might be responsible for minor changes in the tested parameters.
Tamura, Ken-Ichi; Sanada, Yasuharu; Tase, Kazuhiro; Kawakami, Akira; Yoshida, Midori; Yamada, Toshihiko
2014-04-01
Fructans can act as cryoprotectants and contribute to freezing tolerance in plant species, such as in members of the grass subfamily Pooideae that includes Triticeae species and forage grasses. To elucidate the relationship of freezing tolerance, carbohydrate composition and degree of polymerization (DP) of fructans, we generated transgenic plants in the model grass species Brachypodium distachyon that expressed cDNAs for sucrose:fructan 6-fructosyltransferases (6-SFTs) with different enzymatic properties: one cDNA encoded PpFT1 from timothy grass (Phleum pratense), an enzyme that produces high-DP levans; a second cDNA encoded wft1 from wheat (Triticum aestivum), an enzyme that produces low-DP levans. Transgenic lines expressing PpFT1 and wft1 showed retarded growth; this effect was particularly notable in the PpFT1 transgenic lines. When grown at 22 °C, both types of transgenic line showed little or no accumulation of fructans. However, after a cold treatment, wft1 transgenic plants accumulated fructans with DP = 3-40, whereas PpFT1 transgenic plants accumulated fructans with higher DPs (20 to the separation limit). The different compositions of the accumulated fructans in the two types of transgenic line were correlated with the differences in the enzymatic properties of the overexpressed 6-SFTs. Transgenic lines expressing PpFT1 accumulated greater amounts of mono- and disaccharides than wild type and wft1 expressing lines. Examination of leaf blades showed that after cold acclimation, PpFT1 overexpression increased tolerance to freezing; by contrast, the freezing tolerance of the wft1 expressing lines was the same as that of wild type plants. These results provide new insights into the relationship of the composition of water-soluble carbohydrates and the DP of fructans to freezing tolerance in plants.
Manikandan, R; Balakrishnan, N; Sudhakar, D; Udayasuriyan, V
2016-06-01
Bacillus thuringiensis is a major source of insecticidal genes imparting insect resistance in transgenic plants. Level of expression of transgenes in transgenic plants is important to achieve desirable level of resistance against target insects. In order to achieve desirable level of expression, rice chloroplast transit peptide sequence was fused with synthetic cry2AX1 gene to target its protein in chloroplasts. Sixteen PCR positive lines of rice were generated by Agrobacterium mediated transformation using immature embryos. Southern blot hybridization analysis of T 0 transgenic plants confirmed the integration of cry2AX1 gene in two to five locations of rice genome and ELISA demonstrated its expression. Concentration of Cry2AX1 in transgenic rice events ranged 5.0-120 ng/g of fresh leaf tissue. Insect bioassay of T 0 transgenic rice plants against neonate larvae of rice leaffolder showed larval mortality ranging between 20 and 80 % in comparison to control plant. Stable inheritance and expression of cry2AX1 gene was demonstrated in T 1 progenies through Southern and ELISA. In T 1 progenies, the highest concentration of Cry2AX1 and mortality of rice leaffolder larvae were recorded as 150 ng/g of fresh leaf tissue and 80 %, respectively. The Cry2AX1 expression even at a very low concentration (120-150 ng/g) in transgenic rice plants was found effective against rice leaffolder larvae.
Directory of Open Access Journals (Sweden)
Linghua Qiu
Full Text Available Transgenes flanked by loxP sites have been widely used to generate transgenic mice where the transgene expression can be controlled spatially and temporally by Cre recombinase. Data from this approach has led to important conclusions in cancer, neurodevelopment and neurodegeneration. Using this approach to conditionally express micro RNAs (miRNAs in mice, we found that Cre-mediated recombination in neural progenitor cells caused microcephaly in five of our ten independent transgenic lines. This effect was not associated with the types or the quantity of miRNAs being expressed, nor was it associated with specific target knockdown. Rather, it was correlated with the presence of multiple tandem transgene copies and inverted (head-to-head or tail-to-tail transgene repeats. The presence of these inverted repeats caused a high level of cell death in the ventricular zone of the embryonic brain, where Cre was expressed. Therefore, results from this Cre-loxP approach to generate inducible transgenic alleles must be interpreted with caution and conclusions drawn in previous reports may need reexamination.
Jackson, Carla Wood; Schatschneider, Christopher; Leacox, Lindsey
2014-01-01
The authors of this study described developmental trajectories and predicted kindergarten performance of Spanish and English receptive vocabulary acquisition of young Latino/a English language learners (ELLs) from socioeconomically disadvantaged migrant families. In addition, the authors examined the extent to which gender and individual initial performance in Spanish predict receptive vocabulary performance and growth rate. The authors used hierarchical linear modeling of 64 children's receptive vocabulary performance to generate growth trajectories, predict performance at school entry, and examine potential predictors of rate of growth. The timing of testing varied across children. The ELLs (prekindergarten to 2nd grade) participated in 2-5 testing sessions, each 6-12 months apart. The ELLs' average predicted standard score on an English receptive vocabulary at kindergarten was nearly 2 SDs below the mean for monolingual peers. Significant growth in the ELLs' receptive vocabulary was observed between preschool and 2nd grade, indicating that the ELLs were slowly closing the receptive vocabulary gap, although their average score remained below the standard score mean for age-matched monolingual peers. The ELLs demonstrated a significant decrease in Spanish receptive vocabulary standard scores over time. Initial Spanish receptive vocabulary was a significant predictor of growth in English receptive vocabulary. High initial Spanish receptive vocabulary was associated with greater growth in English receptive vocabulary and decelerated growth in Spanish receptive vocabulary. Gender was not a significant predictor of growth in either English or Spanish receptive vocabulary. ELLs from low socioeconomic backgrounds may be expected to perform lower in English compared with their monolingual English peers in kindergarten. Performance in Spanish at school entry may be useful in identifying children who require more intensive instructional support for English vocabulary
Li, Zhao; Zhou, Miaoping; Zhang, Zengyan; Ren, Lijuan; Du, Lipu; Zhang, Boqiao; Xu, Huijun; Xin, Zhiyong
2011-03-01
Fusarium head blight (scab), primarily caused by Fusarium graminearum, is a devastating disease of wheat (Triticum aestivum L.) worldwide. Wheat sharp eyespot, mainly caused by Rhizoctonia cerealis, is one of the major diseases of wheat in China. The defensin RsAFP2, a small cyteine-rich antifungal protein from radish (Raphanus sativus), was shown to inhibit growth in vitro of agronomically important fungal pathogens, such as F. graminearum and R. cerealis. The RsAFP2 gene was transformed into Chinese wheat variety Yangmai 12 via biolistic bombardment to assess the effectiveness of the defensin in protecting wheat from the fungal pathogens in multiple locations and years. The genomic PCR and Southern blot analyses indicated that RsAFP2 was integrated into the genomes of the transgenic wheat lines and heritable. RT-PCR and Western blot proved that the RsAFP2 was expressed in these transgenic wheat lines. Disease tests showed that four RsAFP2 transgenic lines (RA1-RA4) displayed enhanced resistance to F. graminearum compared to the untransformed Yangmai 12 and the null-segregated plants. Assays on Q-RT-PCR and disease severity showed that the express level of RsAFP2 was associated with the enhanced resistance degree. Two of these transgenic lines (RA1 and RA2) also exhibited enhanced resistance to R. cerealis. These results indicated that the expression of RsAFP2 conferred increased resistance to F. graminearum and R. cerealis in transgenic wheat.
GmPGIP3 enhanced resistance to both take-all and common root rot diseases in transgenic wheat.
Wang, Aiyun; Wei, Xuening; Rong, Wei; Dang, Liang; Du, Li-Pu; Qi, Lin; Xu, Hui-Jun; Shao, Yanjun; Zhang, Zengyan
2015-05-01
Take-all (caused by the fungal pathogen Gaeumannomyces graminis var. tritici, Ggt) and common root rot (caused by Bipolaris sorokiniana) are devastating root diseases of wheat (Triticum aestivum L.). Development of resistant wheat cultivars has been a challenge since no resistant wheat accession is available. GmPGIP3, one member of polygalacturonase-inhibiting protein (PGIP) family in soybean (Glycine max), exhibited inhibition activity against fungal endopolygalacturonases (PGs) in vitro. In this study, the GmPGIP3 transgenic wheat plants were generated and used to assess the effectiveness of GmPGIP3 in protecting wheat from the infection of Ggt and B. sorokiniana. Four independent transgenic lines were identified by genomic PCR, Southern blot, and reverse transcription PCR (RT-PCR). The introduced GmPGIP3 was integrated into the genomes of these transgenic lines and could be expressed. The expressing GmPGIP3 protein in these transgenic wheat lines could inhibit the PGs produced by Ggt and B. sorokiniana. The disease response assessments postinoculation showed that the GmPGIP3-expressing transgenic wheat lines displayed significantly enhanced resistance to both take-all and common root rot diseases caused by the infection of Ggt and B. sorokiniana. These data suggested that GmPGIP3 is an attractive gene resource in improving resistance to both take-all and common root rot diseases in wheat.
Handling of human short-chain acyl-CoA dehydrogenase (SCAD) variant proteins in transgenic mice
DEFF Research Database (Denmark)
Kragh, Peter M; Pedersen, Christina B; Schmidt, Stine P
2007-01-01
Abstract To investigate the in vivo handling of human short-chain acyl-CoA dehydrogenase (SCAD) variant proteins, three transgenic mouse lines were produced by pronuclear injection of cDNA encoding the wild-type, hSCAD-wt, and two disease causing folding variants hSCAD-319C > T and hSCAD-625G > A....... The transgenic mice were mated with an SCAD-deficient mouse strain (BALB/cByJ) and, in the second generation, three mouse lines were obtained without endogenous SCAD expression but harboring hSCAD-wt, hSCAD-319C > T, and hSCAD-625G > A transgenes, respectively. All three lines had expression of the transgene...... developed for any of the lines transgenic for the hSCAD folding variants. The indicated remarkable efficiency of the mouse protein quality control system in the degradation of SCAD folding variants should be further substantiated and investigated, since it might indicate ways to prevent disease...
A Transgenic Tri-Modality Reporter Mouse
Yan, Xinrui; Ray, Pritha; Paulmurugan, Ramasamy; Tong, Ricky; Gong, Yongquan; Sathirachinda, Ataya; Wu, Joseph C.; Gambhir, Sanjiv S.
2013-01-01
Transgenic mouse with a stably integrated reporter gene(s) can be a valuable resource for obtaining uniformly labeled stem cells, tissues, and organs for various applications. We have generated a transgenic mouse model that ubiquitously expresses a tri-fusion reporter gene (fluc2-tdTomato-ttk) driven by a constitutive chicken β-actin promoter. This "Tri-Modality Reporter Mouse" system allows one to isolate most cells from this donor mouse and image them for bioluminescent (fluc2), fluorescent...
Ethics and Transgenic Crops: a Review
Robinson, Jonathan
1999-01-01
This article represents a review of some of the ethical dilemmas that have arisen as a result of the development and deployment of transgenic crop plants. The potential for transgenic crops to alleviate human hunger and the possible effects on human health are discussed. Risks and benefits to the environment resulting from genetic engineering of crops for resistance to biotic and abiotic stresses are considered, in addition to effects on biodiversity. The socio-economic impacts and distributi...
Transgenic Wheat, Barley and Oats: Future Prospects
Dunwell, Jim M.
Following the success of transgenic maize and rice, methods have now been developed for the efficient introduction of genes into wheat, barley and oats. This review summarizes the present position in relation to these three species, and also uses information from field trial databases and the patent literature to assess the future trends in the exploitation of transgenic material. This analysis includes agronomic traits and also discusses opportunities in expanding areas such as biofuels and biopharming.
Transgenic animals and their application in medicine
Bagle TR, Kunkulol RR, Baig MS, More SY
2013-01-01
Transgenic animals are animals that are genetically altered to have traits that mimic symptoms of specific human pathologies. They provide genetic models of various human diseases which are important in understanding disease and developing new targets. In early 1980 Gordon and co-workers described the first gene addition experiment using the microinjection technology and since then the impact of transgenic technology on basic research has been significant. Within 20 years of its inception, AT...
Cortico-Cortical Receptive Field Estimates in Human Visual Cortex
Directory of Open Access Journals (Sweden)
Koen V Haak
2012-05-01
Full Text Available Human visual cortex comprises many visual areas that contain a map of the visual field (Wandell et al 2007, Neuron 56, 366–383. These visual field maps can be identified readily in individual subjects with functional magnetic resonance imaging (fMRI during experimental sessions that last less than an hour (Wandell and Winawer 2011, Vis Res 718–737. Hence, visual field mapping with fMRI has been, and still is, a heavily used technique to examine the organisation of both normal and abnormal human visual cortex (Haak et al 2011, ACNR, 11(3, 20–21. However, visual field mapping cannot reveal every aspect of human visual cortex organisation. For example, the information processed within a visual field map arrives from somewhere and is sent to somewhere, and visual field mapping does not derive these input/output relationships. Here, we describe a new, model-based analysis for estimating the dependence between signals in distinct cortical regions using functional magnetic resonance imaging (fMRI data. Just as a stimulus-referred receptive field predicts the neural response as a function of the stimulus contrast, the neural-referred receptive field predicts the neural response as a function of responses elsewhere in the nervous system. When applied to two cortical regions, this function can be called the cortico-cortical receptive field (CCRF. We model the CCRF as a Gaussian-weighted region on the cortical surface and apply the model to data from both stimulus-driven and resting-state experimental conditions in visual cortex.
Membrane-Initiated Estradiol Signaling Regulating Sexual Receptivity
Micevych, Paul E.; Dewing, Phoebe
2011-01-01
Estradiol has profound actions on the structure and function of the nervous system. In addition to nuclear actions that directly modulate gene expression, the idea that estradiol can rapidly activate cell signaling by binding to membrane estrogen receptors (mERs) has emerged. Even the regulation of sexual receptivity, an action previously thought to be completely regulated by nuclear ERs, has been shown to have a membrane-initiated estradiol signaling (MIES) component. This highlighted the question of the nature of mERs. Several candidates have been proposed, ERα, ERβ, ER-X, GPR30 (G protein coupled estrogen receptor), and a receptor activated by a diphenylacrylamide compound, STX. Although each of these receptors has been shown to be active in specific assays, we present evidence for and against their participation in sexual receptivity by acting in the lordosis-regulating circuit. The initial MIES that activates the circuit is in the arcuate nucleus of the hypothalamus (ARH). Using both activation of μ-opioid receptors (MOR) in the medial preoptic nucleus and lordosis behavior, we document that both ERα and the STX-receptor participate in the required MIES. ERα and the STX-receptor activation of cell signaling are dependent on the transactivation of type 1 metabotropic glutamate receptors (mGluR1a) that augment progesterone synthesis in astrocytes and protein kinase C (PKC) in ARH neurons. While estradiol-induced sexual receptivity does not depend on neuroprogesterone, proceptive behaviors do. Moreover, the ERα and the STX-receptor activation of medial preoptic MORs and augmentation of lordosis were sensitive to mGluR1a blockade. These observations suggest a common mechanism through which mERs are coupled to intracellular signaling cascades, not just in regulating reproduction, but in actions throughout the neuraxis including the cortex, hippocampus, striatum, and dorsal root ganglias. PMID:22649369
Membrane–initiated estradiol signaling regulating sexual receptivity
Directory of Open Access Journals (Sweden)
Paul E Micevych
2011-09-01
Full Text Available Estradiol has profound actions on the structure and function of the nervous system. In addition to nuclear actions that directly modulate gene expression, the idea that estradiol can rapidly activate cell signaling by binding to membrane estrogen receptors (mERs has emerged. Even the regulation of sexual receptivity, an action previously thought to be completely regulated by nuclear ERs, has been shown to have a membrane-initiated estradiol signaling (MIES component. This highlighted the question of the nature of mERs. Several candidates have been proposed, ERα, ERβ, ER-X, GPR30 (G protein coupled estrogen receptor; GPER, and a receptor activated by a diphenylacrylamide compound, STX. Although each of these receptors has been shown to be active in specific assays, we present evidence for and against their participation in sexual receptivity by acting in the lordosis-regulating circuit. The initial MIES that activates the circuit is in the arcuate nucleus of the hypothalamus (ARH. Using both activation of μ-opioid receptors (MOR in the medial preoptic nucleus and lordosis behavior, we document that both ERα and the STX receptor participate in the required MIES. ERα and the STX receptor activation of cell signaling are dependent on the transactivation of type 1 metabotropic glutamate receptors (mGluR1a that augment progesterone synthesis in astrocytes and protein kinase C (PKC in ARH neurons. While estradiol-induced sexual receptivity does not depend on neuroprogesterone, proceptive behaviors do. Moreover, the ERα and the STX receptor activation of medial preoptic MORs and augmentation of lordosis were sensitive to mGluR1a blockade. These observations suggest a common mechanism through which mERs are coupled to intracellular signaling cascades, not just in regulating reproduction, but in actions throughout the neuraxis including the cortex, hippocampus, striatum and DRGs.
Transgenic mice display hair loss and regrowth overexpressing mutant Hr gene.
Zhu, Kuicheng; Xu, Cunshuan; Zhang, Jintao; Chen, Yingying; Liu, Mengduan
2017-10-30
Mutations in the hairless (Hr) gene in both mice and humans have been implicated in the development of congenital atrichia, but the role of Hr in skin and hair follicle (HF) biology remains unknown. Here, we established transgenic mice (TG) overexpressing mutant Hr to investigate its specific role in the development of HF. Three transgenic lines were successfully constructed, and two of them (TG3 and TG8) displayed a pattern of hair loss and regrowth with alternation in the expression of HR protein. The mutant Hr gene inhibited the expression of the endogenous gene in transgenic individuals, which led to the development of alopecia. Interestingly, the hair regrew with the increase in the endogenous expression levels resulting from decreased mutant Hr expression. The findings of our study indicate that the changes in the expression of Hr result in hair loss or regrowth.
RNAi-mediated resistance to SMV and BYMV in transgenic tobacco
Directory of Open Access Journals (Sweden)
Lo Thi Mai Thu
2016-09-01
Full Text Available Soybean mosaic virus (SMV and bean yellow mosaic virus (BYMV are two typical types of viruses that cause mosaic in soybean plants. Multiple viral infections at the same site can lead to 66% to 80% yield reduction. We have aimed to improve SMV and BYMV resistance in Vietnamese soybeans using gene transfer techniques under the mechanism of RNAi. In this study, we present newly generated transgenic tobacco plants carrying RNAi [CPi (SMV-BYMV] resistance to the two types of viruses; 73.08% of transgenic tobacco lines proved to be fully resistant to SMV and BYMV. In addition, the number of virus copies in transgenic tobacco plants was reduced on average by more than 51% compared to the control plants (wild type. This promising result shows the potential of transerring the CPi (SMV-BYMV structure in soybean to increase resistance of soybean to SMV and BYMV and advance the aims of antiviral soybean breeding in Vietnam.
DEFF Research Database (Denmark)
Chen, Yaling; Sun, Xiao; Zhou, Xin Mao
2017-01-01
Starch phosphorylation occurs naturally during starch metabolism in the plant and is catalysed by glucan water dikinases (GWD1) and phosphoglucan water dikinase/glucan water dikinase 3 (PWD/GWD3). We generated six stable individual transgenic lines by over-expressing the potato GWD1 in rice....... Transgenic rice grain starch had 9-fold higher 6-phospho (6-P) monoesters and double amounts of 3-phospho (3-P) monoesters, respectively, compared to control grain. The shape and topography of the transgenic starch granules were moderately altered including surface pores and less well defined edges....... The gelatinization temperatures of both rice flour and extracted starch were significantly lower than those of the control and hence negatively correlated with the starch phosphate content. The 6-P content was positively correlated with amylose content and relatively long amylopectin chains with DP25-36, and the 3-P...
Transgene flow: Facts, speculations and possible countermeasures
Ryffel, Gerhart U
2014-01-01
Convincing evidence has accumulated that unintended transgene escape occurs in oilseed rape, maize, cotton and creeping bentgrass. The escaped transgenes are found in variant cultivars, in wild type plants as well as in hybrids of sexually compatible species. The fact that in some cases stacked events are present that have not been planted commercially, implies unintended recombination of transgenic traits. As the consequences of this continuous transgene escape for the ecosystem cannot be reliably predicted, I propose to use more sophisticated approaches of gene technology in future. If possible GM plants should be constructed using either site-directed mutagenesis or cisgenic strategies to avoid the problem of transgene escape. In cases where a transgenic trait is needed, efficient containment should be the standard approach. Various strategies available or in development are discussed. Such a cautious approach in developing novel types of GM crops will enhance the sustainable potential of GM crops and thus increase the public trust in green gene technology. PMID:25523171
Overexpression of CsANR increased flavan-3-ols and decreased anthocyanins in transgenic tobacco.
Kumar, Vinay; Yadav, Sudesh Kumar
2013-06-01
Anthocyanins and flavan-3-ols are distributed widely in plants and synthesized by a common biosynthetic pathway. Anthocyanin reductase (ANR) represents branching-point enzyme of this pathway converting anthocyanidins to flavan-3-ols. Since tea contains highest amount of flavonoids, a cDNA encoding anthocyanin reductase from tea (CsANR) was overexpressed in transgenic tobacco to check the influence on anthocyanin and flavan-3-ols. The transgenic tobacco was confirmed by genomic PCR and expression of transgene was analyzed through semiquantitative PCR. Interestingly flowers of transgenic tobacco were light pink/white in color instead of dark pink in wild tobacco, documenting the decrease in anthocyanins content. Upon measurement, flower anthocyanin content was found to be lesser. While flavan-3-ols (epicatechin and epigallocatechin) contents were increased in leaf tissue of transgenic lines. The expressions of other endogenous flavonoid biosynthetic pathway genes in different floral parts (sepal, petal, stamen, and carpel) of CsANR overexpressing tobacco as well as wild tobacco were analyzed. The transcript levels of PAL and CHI genes were downregulated, while transcript levels of F3H, FLS, CHS, ANR1, and ANR2 genes were upregulated in all floral parts of CsANR transgenic plants compared to wild tobacco. The expressions of DFR and ANS genes were also spatially modulated in different floral parts due to overexpression of CsANR. Thus, CsANR overexpression increased flavan-3-ols and decreased anthocyanin content by modulating the expressions of various flavonoid biosynthetic pathway genes in flower of tobacco. These changes might be responsible for the observed pollen tube in the pollens of CsANR overexpressing transgenic tobacco when they were still in the anther before pollination.
Ananieva, Elitsa A; Van Horn, Cynthia G; Jones, Meghan R; Hutson, Susan M
2017-02-01
Unlike other amino acids, the branched-chain amino acids (BCAAs) largely bypass first-pass liver degradation due to a lack of hepatocyte expression of the mitochondrial branched-chain aminotransferase (BCATm). This sets up interorgan shuttling of BCAAs and liver-skeletal muscle cooperation in BCAA catabolism. To explore whether complete liver catabolism of BCAAs may impact BCAA shuttling in peripheral tissues, the BCATm gene was stably introduced into mouse liver. Two transgenic mouse lines with low and high hepatocyte expression of the BCATm transgene (LivTg-LE and LivTg-HE) were created and used to measure liver and plasma amino acid concentrations and determine whether the first two BCAA enzymatic steps in liver, skeletal muscle, heart and kidney were impacted. Expression of the hepatic BCATm transgene lowered the concentrations of hepatic BCAAs while enhancing the concentrations of some nonessential amino acids. Extrahepatic BCAA metabolic enzymes and plasma amino acids were largely unaffected, and no growth rate or body composition differences were observed in the transgenic animals as compared to wild-type mice. Feeding the transgenic animals a high-fat diet did not reverse the effect of the BCATm transgene on the hepatic BCAA catabolism, nor did the high-fat diet cause elevation in plasma BCAAs. However, the high-fat-diet-fed BCATm transgenic animals experienced attenuation in the mammalian target of rapamycin (mTOR) pathway in the liver and had impaired blood glucose tolerance. These results suggest that complete liver BCAA metabolism influences the regulation of glucose utilization during diet-induced obesity. Copyright © 2016 Elsevier Inc. All rights reserved.
Transgenic Expression of the Anti-parasitic Factor TEP1 in the Malaria Mosquito Anopheles gambiae.
Directory of Open Access Journals (Sweden)
Gloria Volohonsky
2017-01-01
Full Text Available Mosquitoes genetically engineered to be resistant to Plasmodium parasites represent a promising novel approach in the fight against malaria. The insect immune system itself is a source of anti-parasitic genes potentially exploitable for transgenic designs. The Anopheles gambiae thioester containing protein 1 (TEP1 is a potent anti-parasitic protein. TEP1 is secreted and circulates in the mosquito hemolymph, where its activated cleaved form binds and eliminates malaria parasites. Here we investigated whether TEP1 can be used to create malaria resistant mosquitoes. Using a GFP reporter transgene, we determined that the fat body is the main site of TEP1 expression. We generated transgenic mosquitoes that express TEP1r, a potent refractory allele of TEP1, in the fat body and examined the activity of the transgenic protein in wild-type or TEP1 mutant genetic backgrounds. Transgenic TEP1r rescued loss-of-function mutations, but did not increase parasite resistance in the presence of a wild-type susceptible allele. Consistent with previous reports, TEP1 protein expressed from the transgene in the fat body was taken up by hemocytes upon a challenge with injected bacteria. Furthermore, although maturation of transgenic TEP1 into the cleaved form was impaired in one of the TEP1 mutant lines, it was still sufficient to reduce parasite numbers and induce parasite melanization. We also report here the first use of Transcription Activator Like Effectors (TALEs in Anopheles gambiae to stimulate expression of endogenous TEP1. We found that artificial elevation of TEP1 expression remains moderate in vivo and that enhancement of endogenous TEP1 expression did not result in increased resistance to Plasmodium. Taken together, our results reveal the difficulty of artificially influencing TEP1-mediated Plasmodium resistance, and contribute to further our understanding of the molecular mechanisms underlying mosquito resistance to Plasmodium parasites.
Directory of Open Access Journals (Sweden)
Satoto Satoto
2016-10-01
Full Text Available Successful application of genetic transformation technique, especially in developing rice variety resistant to brown plant hopper and stem borer, will depend on transgene being expressed and the gene inherited in a stable and predictable manner. This study aimed to analyse transgene segregation pattern of the progenies and the crosses of transgenic rice cv. Rojolele harboring cry1Ab and gna genes. The third generation (T2 of fivetransgenic Rojolele events containing gna and/or cry1Ab were evaluated for two generations to identify the homozygous lines and to study their inheritance. The homozygous lines were selected based on the result of PCR technique. The segregation patterns of gna and cry1Ab were studied in eight F2 populations derived from Rojolele x transgenic Rojolele homozygous for cry1Ab and or gna and their reciprocal crosses. Data resulted from PCR of F2 population were analysed using a Chi Square test. The study obtained six homozygous lines for gna, namely A22- 1-32, A22-1-37, C72-1-9, F11-1-48, K21-1-39, K21-1-48, and two homozygous lines for cry1Ab, namely K21-1-39 and K21- 1-48. Both cry1Ab and gna transgenes had been inherited through selfing and crossing with their wild type as indicated from the F1 containing gna and cry1Ab as many as 48.4% and 47.4%, respectively. In six of the eight crosses, gna was inherited in a 3:1 ratio consistent with Mendelian inheritance of a single dominant locus, while in the remaining two crosses, gna was segregated in a 1:1 ratio. The presence of cry1Ab in F2 populations also showed a 3:1 segregation ratio in all crosses. In the F2 population derived from F1 plant containing cry1Ab and gna, both transgenes segregated in a 9:3:3:1 dihybrid segregation ratio. This study will add to the diversity of genetic sources for insect resistance and allow further use of these transgenic lines for pyramiding resistance to brown plant hopper and stem borer or separately in rice breeding programs whenever
Radiation Emergency Preparedness Tools: Virtual Community Reception Center
Centers for Disease Control (CDC) Podcasts
2011-02-28
This podcast is an overview of resources from the Clinician Outreach and Communication Activity (COCA) Call: Practical Tools for Radiation Emergency Preparedness. A specialist working with CDC's Radiation Studies Branch describes a web-based training tool known as a Virtual Community Reception Center (vCRC). Created: 2/28/2011 by National Center for Environmental Health (NCEH) Radiation Studies Branch and Emergency Risk Communication Branch (ERCB)/Joint Information Center (JIC); Office of Public Health Preparedness and Response (OPHPR). Date Released: 2/28/2011.
Isocyanates useful for forming synthetic antigens receptive to radiolabelling
International Nuclear Information System (INIS)
Eisenhardt, W.A. Jr.; Hedaya, E.; Theodoropulos, S.
1981-01-01
This patent claim on behalf of Union Carbide Corporation, relates to synthesizing isocyantes useful for forming synthetic antigens receptive to radio labelling. The claim is for an isocyanate having the structural formula (R) 3 SiO-R' -N=C=O, wherein each R is independently selected from alkyl, alicyclic, aryl, alkaryl and aralkyl groups, each having no more than 10 carbon atoms and being optionally substituted by one or more halogen atoms, and R' is selected from -C 6 H 4 -CH 2 -CH 2 - and -C 6 H 4 -CH 2 -CH-COOCH 3 . (U.K.)
Personal suicidality in reception and identification with suicidal film characters.
Till, Benedikt; Vitouch, Peter; Herberth, Arno; Sonneck, Gernot; Niederkrotenthaler, Thomas
2013-04-01
The authors investigated the impact of suicidality on identity work during film exposure. Adults with low suicidality (n = 150) watched either It's My Party or The Fire Within, censored versions of these films not depicting the suicide, or the control film that concluded with a non-suicidal death. Baseline suicidality was measured with questionnaires before the movie. Identity work and identification with the protagonist were measured after the movie. Suicidality was directly associated with identity work during film dramas depicting suicide methods. The reception of suicide-related media content seems to partially depend on personal suicidality. Potential implications for suicide prevention are discussed.
Life Is Strange : a mediated game reception analysis
Mänder, Leili
2017-01-01
In this essay a mediated video game reception of the game Life Is Strange is made, with the purpose of examining the players' meaning-making processes from a gender perspective. The materials of this essay consist of videos from six different YouTube channels where each player film themselves whilst playing through Life Is Strange as a way to review and share the gaming experience. The results show how the meaning-making processes are littered with gender discourses and affects. The affects o...
Chen, Ming; Sun, Liying; Wu, Hongya; Chen, Jiong; Ma, Youzhi; Zhang, Xiaoxiang; Du, Lipu; Cheng, Shunhe; Zhang, Boqiao; Ye, Xingguo; Pang, Junlan; Zhang, Xinmei; Li, Liancheng; Andika, Ida B; Chen, Jianping; Xu, Huijun
2014-05-01
Wheat yellow mosaic virus (WYMV) has spread rapidly and causes serious yield losses in the major wheat-growing areas in China. Because it is vectored by the fungus-like organism Polymyxa graminis that survives for long periods in soil, it is difficult to eliminate by conventional crop management or fungicides. There is also only limited resistance in commercial cultivars. In this research, fourteen independent transgenic events were obtained by co-transformation with the antisense NIb8 gene (the NIb replicase of WYMV) and a selectable gene bar. Four original transgenic lines (N12, N13, N14 and N15) and an offspring line (N12-1) showed high and durable resistance to WYMV in the field. Four resistant lines were shown to have segregated and only contain NIb8 (without bar) by PCR and herbicide resistance testing in the later generations. Line N12-1 showed broad-spectrum resistance to WYMV isolates from different sites in China. After growing in the infested soil, WYMV could not be detected by tissue printing and Western blot assays of transgenic wheat. The grain yield of transgenic wheat was about 10% greater than the wild-type susceptible control. Northern blot and small RNA deep sequencing analyses showed that there was no accumulation of small interfering RNAs targeting the NIb8 gene in transgenic wheat plants, suggesting that transgene RNA silencing, a common mechanism of virus-derived disease resistance, is not involved in the process of WYMV resistance. This durable and broad-spectrum resistance to WYMV in transgenic wheat will be useful for alleviating the damage caused by WYMV. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Cheng, Yu-Jie; Kim, Myoung-Duck; Deng, Xi-Ping; Kwak, Sang-Soo; Chen, Wei
2013-12-01
IbMYB1, a transcription factor (TF) for R2R3-type MYB TFs, is a key regulator of anthocyanin biosynthesis during storage of sweet potatoes. Anthocyanins provide important antioxidants of nutritional value to humans, and also protect plants from oxidative stress. This study aimed to increase transgenic potatoes' (Solanum tuberosum cv. LongShu No.3) tolerance to environmental stress and enhance their nutritional value. Transgenic potato plants expressing IbMYB1 genes under the control of an oxidative stress-inducible peroxidase (SWPA2) promoter (referred to as SM plants) were successfully generated through Agrobacterium-mediated transformation. Two representative transgenic SM5 and SM12 lines were evaluated for enhanced tolerance to salinity, UV-B rays, and drought conditions. Following treatment of 100 mM NaCl, seedlings of SM5 and SM12 lines showed less root damage and more shoot growth than control lines expressing only an empty vector. Transgenic potato plants in pots treated with 400 mM NaCl showed high amounts of secondary metabolites, including phenols, anthocyanins, and flavonoids, compared with control plants. After treatment of 400 mM NaCl, transgenic potato plants also showed high DDPH radical scavenging activity and high PS II photochemical efficiency compared with the control line. Furthermore, following treatment of NaCl, UV-B, and drought stress, the expression levels of IbMYB1 and several structural genes in the flavonoid biosynthesis such as CHS, DFR, and ANS in transgenic plants were found to be correlated with plant phenotype. The results suggest that enhanced IbMYB1 expression affects secondary metabolism, which leads to improved tolerance ability in transgenic potatoes.
Gibson, Todd A.; Oller, D. Kimbrough; Jarmulowicz, Linda; Ethington, Corinna A.
2012-01-01
Adults and children learning a second language show difficulty accessing expressive vocabulary that appears accessible receptively in their first language (L1). We call this discrepancy the receptive-expressive gap. Kindergarten Spanish (L1) - English (L2) sequential bilinguals were given standardized tests of receptive and expressive vocabulary in both Spanish and English. We found a small receptive-expressive gap in English but a large receptive-expressive gap in Spanish. We categorized chi...
RECEPTION OF SPOKEN ENGLISH. MISHEARINGS IN THE LANGUAGE OF BUSINESS AND LAW
Directory of Open Access Journals (Sweden)
HOREA Ioana-Claudia
2013-07-01
Full Text Available Spoken English may sometimes cause us to face a peculiar problem in respect of the reception and the decoding of auditive signals, which might lead to mishearings. Risen from erroneous perception, from a lack in understanding the communication and an involuntary mental replacement of a certain element or structure by a more familiar one, these mistakes are most frequently encountered in the case of listening to songs, where the melodic line can facilitate the development of confusion by its somewhat altered intonation, which produces the so called mondegreens. Still, instances can be met in all domains of verbal communication, as proven in several examples noticed during classes of English as a foreign language (EFL taught to non-philological subjects. Production and perceptions of language depend on a series of elements that influence the encoding and the decoding of the message. These filters belong to both psychological and semantic categories which can either interfere with the accuracy of emission and reception. Poor understanding of a notion or concept combined with a more familiar relation with a similarly sounding one will result in unconsciously picking the structure which is better known. This means ‘hearing’ something else than it had been said, something closer to the receiver’s preoccupations and baggage of knowledge than the original structure or word. Some mishearings become particularly relevant as they concern teaching English for Specific Purposes (ESP. Such are those encountered during classes of Business English or in English for Law. Though not very likely to occur too often, given an intuitively felt inaccuracy - as the terms are known by the users to need to be more specialised -, such examples are still not ignorable. Thus, we consider they deserve a higher degree of attention, as they might become quite relevant in the global context of an increasing work force migration and a spread of multinational companies.
Fast and robust estimation of spectro-temporal receptive fields using stochastic approximations.
Meyer, Arne F; Diepenbrock, Jan-Philipp; Ohl, Frank W; Anemüller, Jörn
2015-05-15
The receptive field (RF) represents the signal preferences of sensory neurons and is the primary analysis method for understanding sensory coding. While it is essential to estimate a neuron's RF, finding numerical solutions to increasingly complex RF models can become computationally intensive, in particular for high-dimensional stimuli or when many neurons are involved. Here we propose an optimization scheme based on stochastic approximations that facilitate this task. The basic idea is to derive solutions on a random subset rather than computing the full solution on the available data set. To test this, we applied different optimization schemes based on stochastic gradient descent (SGD) to both the generalized linear model (GLM) and a recently developed classification-based RF estimation approach. Using simulated and recorded responses, we demonstrate that RF parameter optimization based on state-of-the-art SGD algorithms produces robust estimates of the spectro-temporal receptive field (STRF). Results on recordings from the auditory midbrain demonstrate that stochastic approximations preserve both predictive power and tuning properties of STRFs. A correlation of 0.93 with the STRF derived from the full solution may be obtained in less than 10% of the full solution's estimation time. We also present an on-line algorithm that allows simultaneous monitoring of STRF properties of more than 30 neurons on a single computer. The proposed approach may not only prove helpful for large-scale recordings but also provides a more comprehensive characterization of neural tuning in experiments than standard tuning curves. Copyright © 2015 Elsevier B.V. All rights reserved.
Nrl-Cre transgenic mouse mediates loxP recombination in developing rod photoreceptors.
Brightman, Diana S; Razafsky, David; Potter, Chloe; Hodzic, Didier; Chen, Shiming
2016-03-01
The developing mouse retina is a tractable model for studying neurogenesis and differentiation. Although transgenic Cre mouse lines exist to mediate conditional genetic manipulations in developing mouse retinas, none of them act specifically in early developing rods. For conditional genetic manipulations of developing retinas, a Nrl-Cre mouse line in which the Nrl promoter drives expression of Cre in rod precursors was created. The results showed that Nrl-Cre expression was specific to the retina where it drives rod-specific recombination with a temporal pattern similar to endogenous Nrl expression during retinal development. This Nrl-Cre transgene does not negatively impact retinal structure and function. Taken together, the data suggested that the Nrl-Cre mouse line was a valuable tool to drive Cre-mediated recombination specifically in developing rods. © 2016 Wiley Periodicals, Inc.
Regulation of Expression of the prb-1b / ACC Deaminase gene by UV-B in Transgenic tomatoes
International Nuclear Information System (INIS)
Tamot, B.K.; Pauls, K.P.; Glick, R.
2003-01-01
Transgenic tomato plants with 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase gene from Enterobacter cloacae UWA4 under the control of a pathogenesis-related promoter (prb-1b) from tobacco were challenged by abiotic stresses to determine the expression patterns of the transgene. No ACC deaminase RNA or protein was detected bu RT-PCR and in western blots prepared from leaf proteins of transgenic plants after wounding or treatment with alpha-amino butyric acid, xylanase, ethephon, salicylic acid, jasmonic acid , ethylene, or ethylene plus jasmonic acid. However, expression of the ACC deaminase transgene was observed in leaves and roots of transformed tomato lines exposed to UV light. The UV response required a minimum of 48 h of exposure and was specific to UV-B light
DEFF Research Database (Denmark)
Ghiasi, Seyed Mojtaba; Salmanian, A H; Chinikar, S
2011-01-01
in their serum and feces, respectively. The mice in the fed/boosted group showed a significant rise in specific IgG antibodies after a single boost. Our results imply that oral immunization of animals with edible materials from transgenic plants is feasible, and further assessments are under way. In addition......While Crimean-Congo hemorrhagic fever (CCHF) has a high mortality rate in humans, the associated virus (CCHFV) does not induce clinical symptoms in animals, but animals play an important role in disease transmission to humans. Our aim in this study was to examine the immunogenicity of the CCHFV...... glycoprotein when expressed in the root and leaf of transgenic plants via hairy roots and stable transformation of tobacco plants, respectively. After confirmatory analyses of transgenic plant lines and quantification of the expressed glycoprotein, mice were either fed with the transgenic leaves or roots, fed...
Zhirnov, I V; Trifonova, E A; Romanova, A V; Filipenko, E A; Sapotsky, M V; Malinovsky, V I; Kochetov, A V; Shumny, V K
2016-11-01
Transgenic Nicotiana tabacum L. cv. SR1 plants, characterized by an increase in the level of dsRNA-specific hydrolytic activity after induction by wounding, were obtained. The Solanum lycopersicum anionic peroxidase gene promoter (new for plant genetic engineering) was for the first time used for the induced expression of the target Serratia marcescens RNase III gene. Upon infection with the tobacco mosaic virus (TMV), the transgenic plants of the obtained lines did not differ significantly from the control group in the level of TMV capsid protein accumulation. In general, no delay in the development of the infection symptoms was observed in transgenic plants as compared with the control group. The obtained transgenic plants represent a new model for the study of the biological role of endoribonucleases from the RNase III family, including in molecular mechanisms of resistance to pathogens.
Energy Technology Data Exchange (ETDEWEB)
Cheng, Xiaoxia [Key Laboratory of Aquatic Biodiversity and Conservation of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei (China); University of Chinese Academy of Sciences, Beijing (China); Chen, Xiaowen; Jin, Xia; He, Jiangyan [Key Laboratory of Aquatic Biodiversity and Conservation of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei (China); Yin, Zhan, E-mail: zyin@ihb.ac.cn [Key Laboratory of Aquatic Biodiversity and Conservation of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei (China); Ningbo Laboratory, State Key Laboratory of Freshwater Ecology and Biotechnology (China)
2014-07-01
The glycoprotein subunit α (gsuα) gene encodes the shared α subunit of the three pituitary heterodimeric glycoprotein hormones: follicle-stimulating hormone β (Fshβ), luteinizing hormone β (Lhβ) and thyroid stimulating hormone β (Tshβ). In our current study, we identified and characterized the promoter region of zebrafish gsuα and generated a stable gsuα:EGFP transgenic line, which recapitulated the endogenous gsuα expression in the early developing pituitary gland. A relatively conserved regulatory element set is presented in the promoter regions of zebrafish and three other known mammalian gsuα promoters. Our results also demonstrated that the expression patterns of the gsuα:EGFP transgene were all identical to those expression patterns of the endogenous gsuα expression in the pituitary tissue when our transgenic fish were treated with various endocrine chemicals, including forskolin (FSK), SP600125, trichostatin A (TSA), KClO{sub 4}, dexamethasone (Dex), β-estradiol and progesterone. Thus, this gsuα:EGFP transgenic fish reporter line provides another valuable tool for investigating the lineage development of gsuα-expressing gonadotrophins and the coordinated regulation of various glycoprotein hormone subunit genes. These reporter fish can serve as a novel platform to perform screenings of endocrine-disrupting chemicals (EDCs) in vivo as well. - Highlights: • Identification of the promoter of zebrafish glycoprotein subunit α (gsuα) gene • Generation of stable transmission gsuα:EGFP transgenic zebrafish reporter • Demonstration of the recapitulation of the gsuα:EGFP and endogenous gsuα expression • Suggestion of the gsuα:EGFP transgenic zebrafish as a novel platform for EDC study.
International Nuclear Information System (INIS)
Cheng, Xiaoxia; Chen, Xiaowen; Jin, Xia; He, Jiangyan; Yin, Zhan
2014-01-01
The glycoprotein subunit α (gsuα) gene encodes the shared α subunit of the three pituitary heterodimeric glycoprotein hormones: follicle-stimulating hormone β (Fshβ), luteinizing hormone β (Lhβ) and thyroid stimulating hormone β (Tshβ). In our current study, we identified and characterized the promoter region of zebrafish gsuα and generated a stable gsuα:EGFP transgenic line, which recapitulated the endogenous gsuα expression in the early developing pituitary gland. A relatively conserved regulatory element set is presented in the promoter regions of zebrafish and three other known mammalian gsuα promoters. Our results also demonstrated that the expression patterns of the gsuα:EGFP transgene were all identical to those expression patterns of the endogenous gsuα expression in the pituitary tissue when our transgenic fish were treated with various endocrine chemicals, including forskolin (FSK), SP600125, trichostatin A (TSA), KClO 4 , dexamethasone (Dex), β-estradiol and progesterone. Thus, this gsuα:EGFP transgenic fish reporter line provides another valuable tool for investigating the lineage development of gsuα-expressing gonadotrophins and the coordinated regulation of various glycoprotein hormone subunit genes. These reporter fish can serve as a novel platform to perform screenings of endocrine-disrupting chemicals (EDCs) in vivo as well. - Highlights: • Identification of the promoter of zebrafish glycoprotein subunit α (gsuα) gene • Generation of stable transmission gsuα:EGFP transgenic zebrafish reporter • Demonstration of the recapitulation of the gsuα:EGFP and endogenous gsuα expression • Suggestion of the gsuα:EGFP transgenic zebrafish as a novel platform for EDC study
Directory of Open Access Journals (Sweden)
Sara Anjomani Virmouni
Full Text Available Friedreich ataxia (FRDA is an autosomal recessive neurodegenerative disorder, caused by a GAA repeat expansion mutation within intron 1 of the FXN gene. We have previously established and performed preliminary characterisation of several human FXN yeast artificial chromosome (YAC transgenic FRDA mouse models containing GAA repeat expansions, Y47R (9 GAA repeats, YG8R (90 and 190 GAA repeats and YG22R (190 GAA repeats.We now report extended cellular, molecular and functional characterisation of these FXN YAC transgenic mouse models. FXN transgene copy number analysis of the FRDA mice demonstrated that the YG22R and Y47R lines each have a single copy of the FXN transgene while the YG8R line has two copies. Single integration sites of all transgenes were confirmed by fluorescence in situ hybridisation (FISH analysis of metaphase and interphase chromosomes. We identified significant functional deficits, together with a degree of glucose intolerance and insulin hypersensitivity, in YG8R and YG22R FRDA mice compared to Y47R and wild-type control mice. We also confirmed increased somatic GAA repeat instability in the cerebellum and brain of YG22R and YG8R mice, together with significantly reduced levels of FXN mRNA and protein in the brain and liver of YG8R and YG22R compared to Y47R.Together these studies provide a detailed characterisation of our GAA repeat expansion-based YAC transgenic FRDA mouse models that will help investigations of FRDA disease mechanisms and therapy.
Mi, Xiaoxiao; Liu, Xue; Yan, Haolu; Liang, Lina; Zhou, Xiangyan; Yang, Jiangwei; Si, Huaijun; Zhang, Ning
2017-01-01
Aphids, the largest group of sap-sucking pests, cause significant yield losses in agricultural crops worldwide every year. The massive use of pesticides to combat this pest causes severe damage to the environment, putting in risk the human health. In this study, transgenic potato plants expressing Galanthus nivalis agglutinin (GNA) gene were developed using CaMV 35S and ST-LS1 promoters generating six transgenic lines (35S1-35S3 and ST1-ST3 corresponding to the first and second promoter, respectively). Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the GNA gene was expressed in leaves, stems and roots of transgenic plants under the control of the CaMV 35S promoter, while it was only expressed in leaves and stems under the control of the ST-LS1 promoter. The levels of aphid mortality after 5 days of the inoculation in the assessed transgenic lines ranged from 20 to 53.3%. The range of the aphid population in transgenic plants 15 days after inoculation was between 17.0±1.43 (ST2) and 36.6±0.99 (35S3) aphids per plant, which corresponds to 24.9-53.5% of the aphid population in non-transformed plants. The results of our study suggest that GNA expressed in transgenic potato plants confers a potential tolerance to aphid attack, which appears to be an alternative against the use of pesticides in the future. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.
Cloning and functional characterization of MusaVND1 using transgenic banana plants.
Negi, Sanjana; Tak, Himanshu; Ganapathi, T R
2015-06-01
Vascular related NAC (NAM, ATAF and CUC) domain-containing genes regulate secondary wall deposition and differentiation of xylem vessel elements. MusaVND1 is an ortholog of Arabidopsis VND1 and contains the highly conserved NAC domain. The expression of MusaVND1 is highest in developing corm and during lignification conditions, the increase in expression of MusaVND1 coincides with the expression of PAL, COMT and C4H genes. MusaVND1 encodes a nuclear localized protein as MusaVND1-GFP fusion protein gets localized to nucleus. Transient overexpression of MusaVND1 converts banana embryogenic cells to xylem vessel elements, with a final differentiation frequency of 33.54% at the end of tenth day. Transgenic banana plants overexpressing MusaVND1 showed stunted growth and were characterized by PCR and Southern blot analysis. Transgenic banana plants showed transdifferentiation of various types of cells into xylem vessel elements and ectopic deposition of lignin in cells of various plant organs such as leaf and corm. Tracheary element formation was seen in the cortical region of transgenic corm as well as in epidermal cells of leaves. Biochemical analysis indicates significantly higher levels of lignin and cellulose content in transgenic banana lines than control plants. MusaVND1 overexpressing transgenic banana plants showed elevated expression levels of genes involved in lignin and cellulose biosynthesis pathway. Further expression of different MYB transcription factors positively regulating secondary wall deposition was also up regulated in MusaVND1 transgenic lines.
Sanders, Angela; Hemmelgarn, Harmony; Melrose, Heather L; Hein, Leanne; Fuller, Maria; Clarke, Lorne A
2013-08-01
Gaucher disease is an autosomal recessively inherited storage disorder caused by deficiency of the lysosomal hydrolase, acid β-glucosidase. The disease manifestations seen in Gaucher patients are highly heterogeneous as is the responsiveness to therapy. The elucidation of the precise factors responsible for this heterogeneity has been challenging as the development of clinically relevant animal models of Gaucher disease has been problematic. Although numerous murine models for Gaucher disease have been described each has limitations in their specific utility. We describe here, transgenic murine models of Gaucher disease that will be particularly useful for the study of pharmacological chaperones. We have produced stable transgenic mouse strains that individually express wild type, N370S and L444P containing human acid β-glucosidase and show that each of these transgenic lines rescues the lethal phenotype characteristic of acid β-glucosidase null mice. Both the N370S and L444P transgenic models show early and progressive elevations of tissue sphingolipids with L444P mice developing progressive splenic Gaucher cell infiltration. We demonstrate the potential utility of these new transgenic models for the study of Gaucher disease pathogenesis. In addition, since these mice produce only human enzyme, they are particularly relevant for the study of pharmacological chaperones that are specifically targeted to human acid β-glucosidase and the common mutations underlying Gaucher disease. Copyright © 2013 Elsevier Inc. All rights reserved.
Ignacimuthu, S; Ceasar, S Antony
2012-03-01
Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.
Directory of Open Access Journals (Sweden)
N. A. Matvieieva
2013-04-01
Full Text Available The aim of our work was to obtain Althaea officinalis L. «hairy» root culture with human interferon α2b gene (ifn-α2b, to measure fructans content and antiviral activity of extracts from the transgenic roots. Transformation of leaf and root explants was carried out by means of Agrobacterium rhizogenes-mediated transformation. Antiviral activity was measured by the reduction in cytopathic effect of vesicular stomatitis virus (Indiana strain in bovine kidney cells line MDBK. Transformation frequency was 100% for leaf and root explants. RT-PCR confirmed ifn- α2b gene transcription. The clones of transgenic roots differed in mass increasing from 0, 036 ± 0,008 up to 0,371 ± 0,019 g in 30 days cultivation and in fructan synthesis from 67,2± 4,47 up to 154,6 ± 6,62 mg/g roots dry weight. Extracts from «hairy»roots culture were characterized by high antiviral activity against vesicular stomatitis virus — up to 26 000 IU/ g of roots fresh weight. In some cases the genetic transformation shown to lead increasing the growth rate and increasing the level of fructan synthesis in transgenic A. officinalis roots. Extracts from cultivated in vitro marshmallow transgenic roots were characterized by high level of antiviral activity against vesicular stomatitis virus. Thus, there were obtained transgenic A. officinalis roots, characterized by high growth rate, significant accumulation of fructans and high antiviral activity.
9th Transgenic Technology Meeting (TT2010) in Berlin, Germany: a meeting report.
Saunders, Thomas L; Sobieszczuk, Peter
2010-12-01
The first Transgenic Technology (TT) Meeting was organized in 1999 by Johannes Wilbertz, Karolinska Institute, Stockholm, Sweden as a regional meeting. The TT Meetings continued in this way, constantly gathering additional practitioners of transgenic methodologies until the breakthrough in 2005 when the 6th TT Meeting in Barcelona, Spain, hosted by Lluis Montoliu (Centro Nacional de Biotecnologia, Madrid, Spain), generated the momentum to establish the International Society for Transgenic Technologies (ISTT). Since 2006, the ISTT has continued to promote the TT Meetings and provide its membership with a forum to discuss best practices and new methods in the field. The TT2010 Meeting was held at the Max Delbrück Center for Molecular Medicine (Berlin, Germany). Participation at the TT2010 Meeting exceeded the registration capacity and set a new attendance record. Session topics included methods for the generation of rat and mouse models of human disease, fundamental and advanced topics in rodent embryonic stem cells, and the newest transgenic technologies. Short presentations from selected abstracts were of especial interest. Roundtable discussions on transgenic facility establishment and cryoarchiving of mouse lines were favorably received. Students, technical staff, and professors participated in numerous discussions and came away with practical methods and new ideas for research.
Rapid Integration of Multi-copy Transgenes Using Optogenetic Mutagenesis in Caenorhabditis elegans
Directory of Open Access Journals (Sweden)
Kentaro Noma
2018-06-01
Full Text Available Stably transmitted transgenes are indispensable for labeling cellular components and manipulating cellular functions. In Caenorhabditis elegans, transgenes are generally generated as inheritable multi-copy extrachromosomal arrays, which can be stabilized in the genome through a mutagenesis-mediated integration process. Standard methods to integrate extrachromosomal arrays primarily use protocols involving ultraviolet light plus trimethylpsoralen or gamma- or X-ray irradiation, which are laborious and time-consuming. Here, we describe a one-step integration method, following germline-mutagenesis induced by mini Singlet Oxygen Generator (miniSOG. Upon blue light treatment, miniSOG tagged to histone (Histone-miniSOG generates reactive oxygen species (ROS and induces heritable mutations, including DNA double-stranded breaks. We demonstrate that we can bypass the need to first establish extrachromosomal transgenic lines by coupling microinjection of desired plasmids with blue light illumination on Histone-miniSOG worms to obtain integrants in the F3 progeny. We consistently obtained more than one integrant from 12 injected animals in two weeks. This optogenetic approach significantly reduces the amount of time and labor for transgene integration. Moreover, it enables to generate stably expressed transgenes that cause toxicity in animal growth.
Yang, Qingqing; Wu, Hongyu; Li, Qianfeng; Duan, Ruxu; Zhang, Changquan; Sun, Samuel Saiming; Liu, Qiaoquan
2017-05-31
Lysine is the first limiting essential amino acid in rice. We previously constructed a series of transgenic rice lines to enhance lysine biosynthesis (35S), down-regulate its catabolism (Ri), or simultaneously achieve both metabolic effects (35R). In this study, nine transgenic lines, three from each group, were selected for both field and animal feeding trials. The results showed that the transgene(s) caused no obvious effects on field performance and main agronomic traits. Mature seeds of transgenic line 35R-17 contained 48-60-fold more free lysine than in wild type and had slightly lower apparent amylose content and softer gel consistency. Moreover, a 35-day feeding experiment showed that the body weight gain, food efficiency, and protein efficiency ratio of rats fed the 35R-17 transgenic rice diet were improved when compared with those fed wild-type rice diet. These data will be useful for further evaluation and potential commercialization of 35R high-lysine transgenic rice.
Yurek, D M; Hasselrot, U; Cass, W A; Sesenoglu-Laird, O; Padegimas, L; Cooper, M J
2015-01-22
In previous studies that used compacted DNA nanoparticles (DNP) to transfect cells in the brain, we observed higher transgene expression in the denervated striatum when compared to transgene expression in the intact striatum. We also observed that long-term transgene expression occurred in astrocytes as well as neurons. Based on these findings, we hypothesized that the higher transgene expression observed in the denervated striatum may be a function of increased gliosis. Several aging studies have also reported an increase of gliosis as a function of normal aging. In this study we used DNPs that encoded for human glial cell line-derived neurotrophic factor (hGDNF) and either a non-specific human polyubiquitin C (UbC) or an astrocyte-specific human glial fibrillary acidic protein (GFAP) promoter. The DNPs were injected intracerebrally into the denervated or intact striatum of young, middle-aged or aged rats, and glial cell line-derived neurotrophic factor (GDNF) transgene expression was subsequently quantified in brain tissue samples. The results of our studies confirmed our earlier finding that transgene expression was higher in the denervated striatum when compared to intact striatum for DNPs incorporating either promoter. In addition, we observed significantly higher transgene expression in the denervated striatum of old rats when compared to young rats following injections of both types of DNPs. Stereological analysis of GFAP+ cells in the striatum confirmed an increase of GFAP+ cells in the denervated striatum when compared to the intact striatum and also an age-related increase; importantly, increases in GFAP+ cells closely matched the increases in GDNF transgene levels. Thus neurodegeneration and aging may lay a foundation that is actually beneficial for this particular type of gene therapy while other gene therapy techniques that target neurons are actually targeting cells that are decreasing as the disease progresses. Copyright © 2014 IBRO. Published by
Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K
2014-01-01
Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.
Directory of Open Access Journals (Sweden)
Nidhi Thakur
Full Text Available BACKGROUND: Expression of double strand RNA (dsRNA designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi, thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci upon oral feeding. The v-ATPase subunit A (v-ATPaseA coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. METHODOLOGY/PRINCIPAL FINDINGS: Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. CONCLUSIONS/SIGNIFICANCE: Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.
Receptivity of Hypersonic Boundary Layers over Straight and Flared Cones
Balakumar, Ponnampalam; Kegerise, Michael A.
2010-01-01
The effects of adverse pressure gradients on the receptivity and stability of hypersonic boundary layers were numerically investigated. Simulations were performed for boundary layer flows over a straight cone and two flared cones. The steady and the unsteady flow fields were obtained by solving the two-dimensional Navier-Stokes equations in axi-symmetric coordinates using the 5th order accurate weighted essentially non-oscillatory (WENO) scheme for space discretization and using third-order total-variation-diminishing (TVD) Runge-Kutta scheme for time integration. The mean boundary layer profiles were analyzed using local stability and non-local parabolized stability equations (PSE) methods. After the most amplified disturbances were identified, two-dimensional plane acoustic waves were introduced at the outer boundary of the computational domain and time accurate simulations were performed. The adverse pressure gradient was found to affect the boundary layer stability in two important ways. Firstly, the frequency of the most amplified second-mode disturbance was increased relative to the zero pressure gradient case. Secondly, the amplification of first- and second-mode disturbances was increased. Although an adverse pressure gradient enhances instability wave growth rates, small nose-tip bluntness was found to delay transition due to the low receptivity coefficient and the resulting weak initial amplitude of the instability waves. The computed and measured amplitude-frequency spectrums in all three cases agree very well in terms of frequency and the shape except for the amplitude.
The media's reception of the risk associated with radioactive disasters
International Nuclear Information System (INIS)
Vettenranta, S.
1996-01-01
There is an urgent need to develop methodologies to examine the response by the media to radioactive disasters. 'Reception study' is a new research approach in the field of mass communication, studying how the viewers construct meaning from TV news. This ongoing reception study explores how fifteen respondents, all involved in the Chernobyl disaster in 1986, recall and interpret TV news coverage nine years after the accident. The main aim is to discover how the news affects the recipients' interpretations of a disaster and what kind of thoughts, reactions and associations risk messages provoke in retrospect, in the present and in the beliefs about the future. The initial findings indicate that the Chernobyl news on TV was mainly based on technical rationality, while viewers construct meaning founded on symbolic, cultural rationality. The transmission of catastrophe news is not just a matter of responding to the information needs of the public. Denotative risk messages simultaneously convey connotative, symbolic resonance of risk on a metaphysical level. (author)
The public reception of the Research Assessment Exercise 1996.
Directory of Open Access Journals (Sweden)
Julian Warner
1998-01-01
Full Text Available This paper reviews the public reception of the Research Assessment Exercise 1996 (RAE from its announcement in December 1996 to the decline of discussion at end May 1997. A model for diffusion of the RAE is established which distinguishes extra-communal (or exoteric from intra-communal (or esoteric media. The different characteristics of each medium and the changing nature of the discussion over time are considered. Different themes are distinguished in the public reception of the RAE: the spatial distribution of research; the organisation of universities; disciplinary differences in understanding; a perceived conflict between research and teaching; the development of a culture of accountability; and analogies with the organisation of professional football. In conclusion, it is suggested that the RAE and its effects can be more fully considered from the perspective of scholarly communication and understandings of the development of knowledge than it has been by previous contributions in information science, which have concentrated on the possibility of more efficient implementation of existing processes. A fundamental responsibility for funding councils is also identified: to promote the overall health of university education and research, while establishing meaningful differentiations between units.
Receptivity to Kinetic Fluctuations: A Multiple Scales Approach
Edwards, Luke; Tumin, Anatoli
2017-11-01
The receptivity of high-speed compressible boundary layers to kinetic fluctuations (KF) is considered within the framework of fluctuating hydrodynamics. The formulation is based on the idea that KF-induced dissipative fluxes may lead to the generation of unstable modes in the boundary layer. Fedorov and Tumin solved the receptivity problem using an asymptotic matching approach which utilized a resonant inner solution in the vicinity of the generation point of the second Mack mode. Here we take a slightly more general approach based on a multiple scales WKB ansatz which requires fewer assumptions about the behavior of the stability spectrum. The approach is modeled after the one taken by Luchini to study low speed incompressible boundary layers over a swept wing. The new framework is used to study examples of high-enthalpy, flat plate boundary layers whose spectra exhibit nuanced behavior near the generation point, such as first mode instabilities and near-neutral evolution over moderate length scales. The configurations considered exhibit supersonic unstable second Mack modes despite the temperature ratio Tw /Te > 1 , contrary to prior expectations. Supported by AFOSR and ONR.
Implantation in assisted reproduction: a look at endometrial receptivity.
Fatemi, H M; Popovic-Todorovic, B
2013-11-01
Implantation failure in assisted reproduction is thought to be mainly due to impaired uterine receptivity. With normal uterine anatomy, changes in endocrine profile during ovarian stimulation and medical conditions of the mother (i.e. thrombophilia and abnormal immunological response) could result in a non-receptive endometrium. High oestradiol concentrations during ovarian stimulation lead to premature progesterone elevation, causing endometrial advancement and hampering implantation, which can be overcome by a freeze-all approach and embryo transfer in natural cycles or by milder stimulation protocols. Patients with recurrent implantation failure (RIF) should be tested for inherited and acquired thrombophilias. Each patient should be individually assessed and counselled regarding therapy with low-molecular-weight heparin (LMWH). Empirical treatment with LMWH, aspirin or corticosteroids is not effective for women with RIF who have negative thrombophilic tests. If thrombophilic tests are normal, patients should be tested for immunological causes. If human leukocyte antigen dissimilarity is proven, treatment with intravenous immunoglobulin might be beneficial. Preliminary observational studies using intralipid infusion in the presence of increased natural killer cytotoxic activity are interesting but the proposed rationale is controversial and randomized controlled trials are needed. Hysteroscopy and/or endometrial scratching in the cycle preceding ovarian stimulation should become standard for patients with RIF. Copyright © 2013 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
Teaching receptive naming of Chinese characters to children with autism by incorporating echolalia.
Leung, J P; Wu, K I
1997-01-01
The facilitative effect of incorporating echolalia on teaching receptive naming of Chinese characters to children with autism was assessed. In Experiment 1, echoing the requested character name prior to the receptive naming task facilitated matching a character to its name. In addition, task performance was consistently maintained only when echolalia preceded the receptive manual response. Positive results from generalization tests suggested that learned responses occurred across various nove...
Fritz, Jonathan B; Elhilali, Mounya; David, Stephen V; Shamma, Shihab A
2007-07-01
Acoustic filter properties of A1 neurons can dynamically adapt to stimulus statistics, classical conditioning, instrumental learning and the changing auditory attentional focus. We have recently developed an experimental paradigm that allows us to view cortical receptive field plasticity on-line as the animal meets different behavioral challenges by attending to salient acoustic cues and changing its cortical filters to enhance performance. We propose that attention is the key trigger that initiates a cascade of events leading to the dynamic receptive field changes that we observe. In our paradigm, ferrets were initially trained, using conditioned avoidance training techniques, to discriminate between background noise stimuli (temporally orthogonal ripple combinations) and foreground tonal target stimuli. They learned to generalize the task for a wide variety of distinct background and foreground target stimuli. We recorded cortical activity in the awake behaving animal and computed on-line spectrotemporal receptive fields (STRFs) of single neurons in A1. We observed clear, predictable task-related changes in STRF shape while the animal performed spectral tasks (including single tone and multi-tone detection, and two-tone discrimination) with different tonal targets. A different set of task-related changes occurred when the animal performed temporal tasks (including gap detection and click-rate discrimination). Distinctive cortical STRF changes may constitute a "task-specific signature". These spectral and temporal changes in cortical filters occur quite rapidly, within 2min of task onset, and fade just as quickly after task completion, or in some cases, persisted for hours. The same cell could multiplex by differentially changing its receptive field in different task conditions. On-line dynamic task-related changes, as well as persistent plastic changes, were observed at a single-unit, multi-unit and population level. Auditory attention is likely to be pivotal in
Gibson, Todd A; Oller, D Kimbrough; Jarmulowicz, Linda
2018-03-01
Receptive standardized vocabulary scores have been found to be much higher than expressive standardized vocabulary scores in children with Spanish as L1, learning L2 (English) in school (Gibson et al., 2012). Here we present evidence suggesting the receptive-expressive gap may be harder to evaluate than previously thought because widely-used standardized tests may not offer comparable normed scores. Furthermore monolingual Spanish-speaking children tested in Mexico and monolingual English-speaking children in the US showed other, yet different statistically significant discrepancies between receptive and expressive scores. Results suggest comparisons across widely used standardized tests in attempts to assess a receptive-expressive gap are precarious.
Hunt, Jonathan J; Dayan, Peter; Goodhill, Geoffrey J
2013-01-01
Receptive fields acquired through unsupervised learning of sparse representations of natural scenes have similar properties to primary visual cortex (V1) simple cell receptive fields. However, what drives in vivo development of receptive fields remains controversial. The strongest evidence for the importance of sensory experience in visual development comes from receptive field changes in animals reared with abnormal visual input. However, most sparse coding accounts have considered only normal visual input and the development of monocular receptive fields. Here, we applied three sparse coding models to binocular receptive field development across six abnormal rearing conditions. In every condition, the changes in receptive field properties previously observed experimentally were matched to a similar and highly faithful degree by all the models, suggesting that early sensory development can indeed be understood in terms of an impetus towards sparsity. As previously predicted in the literature, we found that asymmetries in inter-ocular correlation across orientations lead to orientation-specific binocular receptive fields. Finally we used our models to design a novel stimulus that, if present during rearing, is predicted by the sparsity principle to lead robustly to radically abnormal receptive fields.
Expressive and receptive language skills in preschool children from a socially disadvantaged area.
Ryan, Ashling; Gibbon, Fiona E; O'shea, Aoife
2016-02-01
Evidence suggests that children present with receptive language skills that are equivalent to or more advanced than expressive language skills. This profile holds true for typical and delayed language development. This study aimed to determine if such a profile existed for preschool children from an area of social deprivation and to investigate if particular language skills influence any differences found between expressive and receptive skills. Data from 187 CELF P2 UK assessments conducted on preschool children from two socially disadvantaged areas in a city in southern Ireland. A significant difference was found between Receptive Language Index (RLI) and Expressive Language Index (ELI) scores with Receptive scores found to be lower than Expressive scores. The majority (78.6%) of participants had a lower Receptive Language than Expressive score (RLI ELI), with very few (3.2%) having the same Receptive and Expressive scores (RLI = ELI). Scores for the Concepts and Following Directions (receptive) sub-test were significantly lower than for the other receptive sub tests, while scores for the Expressive Vocabulary sub-test were significantly higher than for the other expressive sub tests. The finding of more advanced expressive than receptive language skills in socially deprived preschool children is previously unreported and clinically relevant for speech-language pathologists in identifying the needs of this population.
International Nuclear Information System (INIS)
Fan Chunyang; Simmons, Steven O.; Law, Sheran H.W.; Jensen, Karl; Cowden, John; Hinton, David; Padilla, Stephanie; Ramabhadran, Ram
2011-01-01
Fish models such as zebrafish and medaka are increasingly used as alternatives to rodents in developmental and toxicological studies. These developmental and toxicological studies can be facilitated by the use of transgenic reporters that permit the real-time, noninvasive observation of the fish. Here we report the construction and characterization of transgenic medaka lines expressing green fluorescent protein (GFP) under the control of the zebrafish neurogenin 1 (ngn1) gene promoter. Neurogenin (ngn1) is a helix-loop-helix transcription factor expressed in proliferating neuronal progenitor cells early in neuronal differentiation and plays a crucial role in directing neurogenesis. GFP expression was detected from 24 h post-fertilization until hatching, in a spatial pattern consistent with the previously reported zebrafish ngn1 expression. Temporal expression of the transgene parallels the expression profile of the endogenous medaka ngn1 transcript. Further, we demonstrate that embryos from the transgenic line permit the non-destructive, real-time screening of ngn1 promoter-directed GFP expression in a 96-well format, enabling higher throughput studies of developmental neurotoxicants. This strain has been deposited with and maintained by the National BioResource Project and is available on request ( (http://www.shigen.nig.ac.jp/medaka/strainDetailAction.do?quickSearch=true and strainId=5660)).
Characterisation of the nociceptive phenotype of suppressible galanin overexpressing transgenic mice
Directory of Open Access Journals (Sweden)
Wynick David
2010-10-01
Full Text Available Abstract The neuropeptide galanin is widely expressed in both the central and peripheral nervous systems and is involved in many diverse biological functions. There is a substantial data set that demonstrates galanin is upregulated after injury in the DRG, spinal cord and in many brain regions where it plays a predominantly antinociceptive role in addition to being neuroprotective and pro-regenerative. To further characterise the role of galanin following nerve injury, a novel transgenic line was created using the binary transgenic tet-off system, to overexpress galanin in galaninergic tissue in a suppressible manner. The double transgenic mice express significantly more galanin in the DRG one week after sciatic nerve section (axotomy compared to WT mice and this overexpression is suppressible upon administration of doxycycline. Phenotypic analysis revealed markedly attenuated allodynia when galanin is overexpressed and an increase in allodynia following galanin suppression. This novel transgenic line demonstrates that whether galanin expression is increased at the time of nerve injury or only after allodynia is established, the neuropeptide is able to reduce neuropathic pain behaviour. These new findings imply that administration of a galanin agonist to patients with established allodynia would be an effective treatment for neuropathic pain.
Grill, Mischala A.; Bales, Mark A.; Fought, Amber N.; Rosburg, Kristopher C.; Munger, Stephanie J.; Antin, Parker B.
2003-01-01
Tightly regulated control of over-expression is often necessary to study one aspect or time point of gene function and, in transgenesis, may help to avoid lethal effects and complications caused by ubiquitous over-expression. We have utilized the benefits of an optimized tet-on system and a modified muscle creatine kinase (MCK) promoter to generate a skeletal muscle-specific, doxycycline (Dox) controlled over-expression system in transgenic mice. A DNA construct was generated in which the codon optimized reverse tetracycline transactivator (rtTA) was placed under control of a skeletal muscle-specific version of the mouse MCK promoter. Transgenic mice containing this construct expressed rtTA almost exclusively in skeletal muscles. These mice were crossed to a second transgenic line containing a bi-directional promoter centered on a tet responder element driving both a luciferase reporter gene and a tagged gene of interest; in this case the calpain inhibitor calpastatin. Compound hemizygous mice showed high level, Dox dependent muscle-specific luciferase activity often exceeding 10,000-fold over non-muscle tissues of the same mouse. Western and immunocytochemical analysis demonstrated similar Dox dependent muscle-specific induction of the tagged calpastatin protein. These findings demonstrate the effectiveness and flexibility of the tet-on system to provide a tightly regulated over-expression system in adult skeletal muscle. The MCKrtTA transgenic lines can be combined with other transgenic responder lines for skeletal muscle-specific over-expression of any target gene of interest.
Transgene-induced gene silencing is not affected by a change in ploidy level.
Directory of Open Access Journals (Sweden)
Daniela Pignatta
Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.
Changes in oxidative stress in transgenic RNAi ACO1 tomato fruit during ripening
Eglous, Najat Mohamed; Ali, Zainon Mohd; Hassan, Maizom; Zainal, Zamri
2013-11-01
Tomato (Solanum Lycopersicum L.) is the second most cultivated vegetable in the world and widely used as a system for studying the role of ethylene during fruit ripening. Our objective was to study the oxidative stress and antioxidative metabolism during ripening of non transgenic tomato and transgenic line-21 tomato which reduced ethylene. The line-21 of transgenic tomato plants (RNAi ACO1) had lower ethylene production and longer shelf-life more than 32 days as compared to the wild-type fruits which have very short shelf-life. In this study, tomato fruit were divided into five different stages (MG: mature green 5%, B: breaker 25%, T: turning 50%, O: orange75%, RR: red ripe100%). The activity of lipoxygenase (LOX) and lipid peroxidation (MDA) were measured to assess changes in oxidative stress. The LOX activity and MDA content decreased significantly obtaining 2.6-fold and 1.2-fold, respectively, as compared to the wild type fruit. However, superoxide dismutase (SOD) and catalase (CAT) activities were increased to 1.9 and 1.2 folds from the mature green to the fully ripe stage in transgenic tomatoes. Furthermore, the wild type tomato increases 1.3 in SOD and 1.6 in CAT activities. The overall results indicate that the wild type tomato fruit showed a faster rate of ripening, parallel to decline in the rate of enzymatic antioxidative systems as compared to the transgenic line-21 tomato fruit. In addition, the results show that the antioxidant capacity is improved during the ripening process and is accompanied by an increase in the oxidative stress.
Overexpression of a modiifed AM79 aroA gene in transgenic maize confers high tolerance to glyphosate
Institute of Scientific and Technical Information of China (English)
REN Zhen-jing; CAO Gao-yi; ZHANG Yu-wen; LIU Yan; LIU Yun-jun
2015-01-01
It has previously been shown that a bacterial 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene AM79 aroA can be a candidate gene to develop glyphosate-tolerant transgenic crops (Cao et al. 2012). In this study, AM79 aroA was redesigned using the plant biased codons and eliminating the motifs which would lead to the instability of mRNA, to create a synthetic gene that would be expressed highly in plant cel s. The redesigned and artiifcial y synthesized gene, named as mAM79, was cloned into plant expression vector pM3301UbiSpAM79, where mAM79 is fused with signal peptide sequence of pea rib-1,5-bisphospate carboxylase (rbcS) smal subunit and control ed by ubiquitin promoter. The plasmid was transformed into maize (Zea mays) immature embryos using Agrobacterium-mediated transformation method. Total 74 regenerated plants were obtained and PCR analysis showed that these transgenic plants had the integration of mAM79. Southern blot analysis was performed on the genomic DNA from four transgenic lines, and the result showed that one or two copies of mAM79 were integrated into maize genome. RT-PCR analysis result indicated that mAM79 was highly transcribed in transgenic maize plants. When sprayed with glyphosate, transgenic maize line AM85 and AM72 could tolerate 4-fold of commercial usage of glyphosate;however, al the non-transgenic maize plants were kil ed by glyphosate. The results in this study conifrmed that mAM79 could be used to develop glyphosate-tolerant maize, and the obtained transgenic maize lines could be used for the breeding of glyphosate-tolerant maize.
The ecological risks of transgenic plants.
Giovannetti, Manuela
2003-01-01
Biotechnologies have been utilized "ante litteram" for thousands of years to produce food and drink and genetic engineering techniques have been widely applied to produce many compounds for human use, from insulin to other medicines. The debate on genetically modified (GM) organisms broke out all over the world only when GM crops were released into the field. Plant ecologists, microbiologists and population geneticists carried out experiments aimed at evaluating the environmental impact of GM crops. The most significant findings concern: the spread of transgenes through GM pollen diffusion and its environmental impact after hybridisation with closely related wild species or subspecies; horizontal gene transfer from transgenic plants to soil microbes; the impact of insecticide proteins released into the soil by transformed plants on non-target microbial soil communities. Recent developments in genetic engineering produced a technology, dubbed "Terminator", which protects patented genes introduced in transgenic plants by killing the seeds in the second generation. This genetic construct, which interferes so heavily with fundamental life processes, is considered dangerous and should be ex-ante evaluated taking into account the data on "unexpected events", as here discussed, instead of relying on the "safe until proven otherwise" claim. Awareness that scientists, biotechnologists and genetic engineers cannot answer the fundamental question "how likely is that transgenes will be transferred from cultivated plants into the natural environment?" should foster long-term studies on the ecological risks and benefits of transgenic crops.
Byeon, Yeong; Lee, Hyoung Yool; Lee, Kyungjin; Back, Kyoungwhan
2014-09-01
Ectopic overexpression of melatonin biosynthetic genes of animal origin has been used to generate melatonin-rich transgenic plants to examine the functional roles of melatonin in plants. However, the subcellular localization of these proteins expressed in the transgenic plants remains unknown. We studied the localization of sheep (Ovis aries) serotonin N-acetyltransferase (OaSNAT) and a translational fusion of a rice SNAT transit peptide to OaSNAT (TS:OaSNAT) in plants. Laser confocal microscopy analysis revealed that both OaSNAT and TS:OaSNAT proteins were localized to the cytoplasm even with the addition of the transit sequence to OaSNAT. Transgenic rice plants overexpressing the TS:OaSNAT fusion transgene exhibited high SNAT enzyme activity relative to untransformed wild-type plants, but lower activity than transgenic rice plants expressing the wild-type OaSNAT gene. Melatonin levels in both types of transgenic rice plant corresponded well with SNAT enzyme activity levels. The TS:OaSNAT transgenic lines exhibited increased seminal root growth relative to wild-type plants, but less than in the OaSNAT transgenic lines, confirming that melatonin promotes root growth. Seed-specific OaSNAT expression under the control of a rice prolamin promoter did not confer high levels of melatonin production in transgenic rice seeds compared with seeds from transgenic plants expressing OaSNAT under the control of the constitutive maize ubiquitin promoter. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Deng, Lei; Pan, Yu; Chen, Xuqing; Chen, Guoping; Hu, Zongli
2013-07-01
Homozygous state-associated co-suppression is not a very common phenomenon. In our experiments, two transgenic plants 3A29 and 1195A were constructed by being transformed with the constructs pBIN-353A and pBIN119A containing nptII gene as a marker respectively. The homozygous progeny from these two independent transgenic lines 3A29 and 1195A, displayed kanamycin-sensitivity and produced a short main root without any lateral roots as untransformed control (wild-type) seedlings when germinated on kanamycin media. For the seedlings derived from putative hemizygous plants, the percentage of the seedlings showing normal growth on kanamycin media was about 50% and lower than the expected percentage (75%). Southern analysis of the genomic DNA confirmed that the homozygous and hemizygous plants derived from the same lines contained the same multiple nptII transgenes, which were located on the same site of chromosome. Northern analysis suggested that the marker nptII gene was expressed in the primary and the hemizygous transformants, but it was silenced in the homozygous transgenic plants. Further Northern analysis indicated that antisense and sense small nptII-derived RNAs were present in the transgenic plants and the blotting signal of nptII-derived small RNA was much higher in the homozygous transgenic plants than that of hemizygous transgenic plants. Additionally, read-through transcripts from the TRAMP gene to the nptII gene were detected. These results suggest that the read-through transcripts may be involved in homozygous state-associated silencing of the nptII transgene in transgenic tomato plants and a certain threshold level of the nptII-derived small RNAs is required for the homozygous state-associated co-suppression of the nptII transgene. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Weidong Gao
Full Text Available Late embryogenesis abundant (LEA genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA was transformed into Xiaohei poplar (Populussimonii × P. nigra via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR and ribonucleic acid (RNA gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11 showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.
Gao, Weidong; Bai, Shuang; Li, Qingmei; Gao, Caiqiu; Liu, Guifeng; Li, Guangde; Tan, Feili
2013-01-01
Late embryogenesis abundant (LEA) genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA) was transformed into Xiaohei poplar (Populussimonii × P. nigra) via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR) and ribonucleic acid (RNA) gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA) content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11) showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.
Expression Analysis of CB2-GFP BAC Transgenic Mice.
Schmöle, Anne-Caroline; Lundt, Ramona; Gennequin, Benjamin; Schrage, Hanna; Beins, Eva; Krämer, Alexandra; Zimmer, Till; Limmer, Andreas; Zimmer, Andreas; Otte, David-Marian
2015-01-01
The endocannabinoid system (ECS) is a retrograde messenger system, consisting of lipid signaling molecules that bind to at least two G-protein-coupled receptors, Cannabinoid receptor 1 and 2 (CB1 and 2). As CB2 is primarily expressed on immune cells such as B cells, T cells, macrophages, dendritic cells, and microglia, it is of great interest how CB2 contributes to immune cell development and function in health and disease. Here, understanding the mechanisms of CB2 involvement in immune-cell function as well as the trafficking and regulation of CB2 expressing cells are crucial issues. Up to now, CB2 antibodies produce unclear results, especially those targeting the murine protein. Therefore, we have generated BAC transgenic GFP reporter mice (CB2-GFPTg) to trace CB2 expression in vitro and in situ. Those mice express GFP under the CB2 promoter and display GFP expression paralleling CB2 expression on the transcript level in spleen, thymus and brain tissue. Furthermore, by using fluorescence techniques we show that the major sources for GFP-CB2 expression are B cells in spleen and blood and microglia in the brain. This novel CB2-GFP transgenic reporter mouse line represents a powerful resource to study CB2 expression in different cell types. Furthermore, it could be used for analyzing CB2-mediated mobilization and trafficking of immune cells as well as studying the fate of recruited immune cells in models of acute and chronic inflammation.
Expression Analysis of CB2-GFP BAC Transgenic Mice.
Directory of Open Access Journals (Sweden)
Anne-Caroline Schmöle
Full Text Available The endocannabinoid system (ECS is a retrograde messenger system, consisting of lipid signaling molecules that bind to at least two G-protein-coupled receptors, Cannabinoid receptor 1 and 2 (CB1 and 2. As CB2 is primarily expressed on immune cells such as B cells, T cells, macrophages, dendritic cells, and microglia, it is of great interest how CB2 contributes to immune cell development and function in health and disease. Here, understanding the mechanisms of CB2 involvement in immune-cell function as well as the trafficking and regulation of CB2 expressing cells are crucial issues. Up to now, CB2 antibodies produce unclear results, especially those targeting the murine protein. Therefore, we have generated BAC transgenic GFP reporter mice (CB2-GFPTg to trace CB2 expression in vitro and in situ. Those mice express GFP under the CB2 promoter and display GFP expression paralleling CB2 expression on the transcript level in spleen, thymus and brain tissue. Furthermore, by using fluorescence techniques we show that the major sources for GFP-CB2 expression are B cells in spleen and blood and microglia in the brain. This novel CB2-GFP transgenic reporter mouse line represents a powerful resource to study CB2 expression in different cell types. Furthermore, it could be used for analyzing CB2-mediated mobilization and trafficking of immune cells as well as studying the fate of recruited immune cells in models of acute and chronic inflammation.
Rong, Wei; Qi, Lin; Wang, Jingfen; Du, Lipu; Xu, Huijun; Wang, Aiyun; Zhang, Zengyan
2013-08-01
Take-all, caused by soil-borne fungus Gaeumannomyces graminis var. tritici (Ggt), is a devastating root disease of wheat (Triticum aestivum) worldwide. Breeding resistant wheat cultivars is the most promising and reliable approach to protect wheat from take-all. Currently, no resistant wheat germplasm is available to breed cultivars using traditional methods. In this study, gene transformation was carried out using Snakin-1 (SN1) gene isolated from potato (Solanum tuberosum) because the peptide shows broad-spectrum antimicrobial activity in vitro. Purified SN1 peptide also inhibits in vitro the growth of Ggt mycelia. By bombardment-mediated method, the gene SN1 was transformed into Chinese wheat cultivar Yangmai 18 to generate SN1 transgenic wheat lines, which were used to assess the effectiveness of the SN1 peptide in protecting wheat from Ggt. Genomic PCR and Southern blot analyses indicated that the alien gene SN1 was integrated into the genomes of five transgenic wheat lines and heritable from T₀ to T₄ progeny. Reverse transcription-PCR and Western blot analyses showed that the introduced SN1 gene was transcribed and highly expressed in the five transgenic wheat lines. Following challenging with Ggt, disease test results showed that compared to segregants lacking the transgene and untransformed wheat plants, these five transgenic wheat lines expressing SN1 displayed significantly enhanced resistance to take-all. These results suggest that SN1 may be a potentially transgenic tool for improving the take-all resistance of wheat.
Zhu, Xiuliang; Li, Zhao; Xu, Huijun; Zhou, Miaoping; Du, Lipu; Zhang, Zengyan
2012-08-01
The fungus Cochliobolus sativus is the main pathogen of common root rot, a serious soil-borne disease of wheat (Triticum aestivum L.). The fungus Fusarium graminearum is the primary pathogen of Fusarium head blight, a devastating disease of wheat worldwide. In this study, the wheat lipid transfer protein gene, TaLTP5, was cloned and evaluated for its ability to suppress disease development in transgenic wheat. TaLTP5 expression was induced after C. sativus infection. The TaLTP5 expression vector, pA25-TaLTP5, was constructed and bombarded into Chinese wheat variety Yangmai 18. Six TaLTP5 transgenic wheat lines were established and characterized. PCR and Southern blot analyses indicated that the introduced TaLTP5 gene was integrated into the genomes of six transgenic wheat lines by distinct patterns, and heritable. RT-PCR and real-time quantitative RT-PCR revealed that the TaLTP5 gene was over-expressed in the transgenic wheat lines compared to segregants lacking the transgene and wild-type wheat plants. Following challenge with C. sativus or F. graminearum, all six transgenic lines overexpressing TaLTP5 exhibited significantly enhanced resistance to both common root rot and Fusarium head blight compared to the untransformed wheat Yangmai 18.
Directory of Open Access Journals (Sweden)
Zhu Chenguang
2015-01-01
Full Text Available The overexpression of the algal glutamine synthetase (GS gene DvGS1 in Arabidopsis thaliana resulted in higher plant biomass and better growth phenotype. The purpose of this study was to recognize the biological mechanism for the growth improvement of DvGS1-transgenic Arabidopsis. A series of molecular and biochemical investigations related to nitrogen and carbon metabolism in the DvGS1-transgenic line was conducted. Analysis of nitrogen use efficiency (NUE-related gene transcription and enzymatic activity revealed that the transcriptional level and enzymatic activity of the genes encoding GS, glutamate synthase, glutamate dehydrogenase, alanine aminotransferase and aspartate aminotransferase, were significantly upregulated, especially from leaf tissues of the DvGS1-transgenic line under two nitrate conditions. The DvGS1-transgenic line showed increased total nitrogen content and decreased carbon: nitrogen ratio compared to wild-type plants. Significant reduced concentrations of free nitrate, ammonium, sucrose, glucose and starch, together with higher concentrations of total amino acids, individual amino acids (glutamate, aspartate, asparagine, methionine, soluble proteins and fructose in leaf tissues confirmed that the DvGS1-transgenic line demonstrated a higher efficiency of nitrogen assimilation, which subsequently affected carbon metabolism. These improved metabolisms of nitrogen and carbon conferred the DvGS1-transgenic Arabidopsis higher NUE, more biomass and better growth phenotype compared with the wild-type plants.
Toxins for Transgenic Resistance to Hemipteran Pests
Chougule, Nanasaheb P.; Bonning, Bryony C.
2012-01-01
The sap sucking insects (Hemiptera), which include aphids, whiteflies, plant bugs and stink bugs, have emerged as major agricultural pests. The Hemiptera cause direct damage by feeding on crops, and in some cases indirect damage by transmission of plant viruses. Current management relies almost exclusively on application of classical chemical insecticides. While the development of transgenic crops expressing toxins derived from the bacterium Bacillus thuringiensis (Bt) has provided effective plant protection against some insect pests, Bt toxins exhibit little toxicity against sap sucking insects. Indeed, the pest status of some Hemiptera on Bt-transgenic plants has increased in the absence of pesticide application. The increased pest status of numerous hemipteran species, combined with increased prevalence of resistance to chemical insecticides, provides impetus for the development of biologically based, alternative management strategies. Here, we provide an overview of approaches toward transgenic resistance to hemipteran pests. PMID:22822455
Development of marker-free transgenic lettuce resistant to Mirafiori lettuce big-vein virus.
Kawazu, Yoichi; Fujiyama, Ryoi; Imanishi, Shunsuke; Fukuoka, Hiroyuki; Yamaguchi, Hirotaka; Matsumoto, Satoru
2016-10-01
Lettuce big-vein disease caused by Mirafiori lettuce big-vein virus (MLBVV) is found in major lettuce production areas worldwide, but highly resistant cultivars have not yet been developed. To produce MLBVV-resistant marker-free transgenic lettuce that would have a transgene with a promoter and terminator of lettuce origin, we constructed a two T-DNA binary vector, in which the first T-DNA contained the selectable marker gene neomycin phosphotransferase II, and the second T-DNA contained the lettuce ubiquitin gene promoter and terminator and inverted repeats of the coat protein (CP) gene of MLBVV. This vector was introduced into lettuce cultivars 'Watson' and 'Fuyuhikari' by Agrobacterium tumefaciens-mediated transformation. Regenerated plants (T0 generation) that were CP gene-positive by PCR analysis were self-pollinated, and 312 T1 lines were analyzed for resistance to MLBVV. Virus-negative plants were checked for the CP gene and the marker gene, and nine lines were obtained which were marker-free and resistant to MLBVV. Southern blot analysis showed that three of the nine lines had two copies of the CP gene, whereas six lines had a single copy and were used for further analysis. Small interfering RNAs, which are indicative of RNA silencing, were detected in all six lines. MLBVV infection was inhibited in all six lines in resistance tests performed in a growth chamber and a greenhouse, resulting in a high degree of resistance to lettuce big-vein disease. Transgenic lettuce lines produced in this study could be used as resistant cultivars or parental lines for breeding.
The Galker test of speech reception in noise
DEFF Research Database (Denmark)
Lauritsen, Maj-Britt Glenn; Söderström, Margareta; Kreiner, Svend
2016-01-01
PURPOSE: We tested "the Galker test", a speech reception in noise test developed for primary care for Danish preschool children, to explore if the children's ability to hear and understand speech was associated with gender, age, middle ear status, and the level of background noise. METHODS......: The Galker test is a 35-item audio-visual, computerized word discrimination test in background noise. Included were 370 normally developed children attending day care center. The children were examined with the Galker test, tympanometry, audiometry, and the Reynell test of verbal comprehension. Parents...... and daycare teachers completed questionnaires on the children's ability to hear and understand speech. As most of the variables were not assessed using interval scales, non-parametric statistics (Goodman-Kruskal's gamma) were used for analyzing associations with the Galker test score. For comparisons...
Peripheral auditory processing and speech reception in impaired hearing
DEFF Research Database (Denmark)
Strelcyk, Olaf
One of the most common complaints of people with impaired hearing concerns their difficulty with understanding speech. Particularly in the presence of background noise, hearing-impaired people often encounter great difficulties with speech communication. In most cases, the problem persists even...... if reduced audibility has been compensated for by hearing aids. It has been hypothesized that part of the difficulty arises from changes in the perception of sounds that are well above hearing threshold, such as reduced frequency selectivity and deficits in the processing of temporal fine structure (TFS......) at the output of the inner-ear (cochlear) filters. The purpose of this work was to investigate these aspects in detail. One chapter studies relations between frequency selectivity, TFS processing, and speech reception in listeners with normal and impaired hearing, using behavioral listening experiments. While...
Genetic influences on receptive joint attention in chimpanzees (Pan troglodytes)
DEFF Research Database (Denmark)
Hopkins, William D; Keebaugh, Alaine C; Reamer, Lisa A
2014-01-01
Despite their genetic similarity to humans, our understanding of the role of genes on cognitive traits in chimpanzees remains virtually unexplored. Here, we examined the relationship between genetic variation in the arginine vasopressin V1a receptor gene (AVPR1A) and social cognition in chimpanzees...... cognition task was significantly heritable. Furthermore, males with one DupB(+) allele performed significantly better and were more responsive to socio-communicative cues than males homozygous for the DupB- deletion. Performance on a non-social cognition task was not associated with the AVPR1A genotype....... The collective findings show that AVPR1A polymorphisms are associated with individual differences in performance on a receptive joint attention task in chimpanzees....
Pheromone reception in moths: from molecules to behaviors.
Zhang, Jin; Walker, William B; Wang, Guirong
2015-01-01
Male moths detect and find their mates using species-specific sex pheromones emitted by conspecific females. Olfaction plays a vital role in this behavior. Since the first discovery of an insect sex pheromone from the silkmoth Bombyx mori, great efforts have been spent on understanding the sensing of the pheromones in vivo. Much progress has been made in elucidating the molecular mechanisms that mediate chemoreception in insects in the past few decades. In this review, we focus on pheromone reception and detection in moths, from the molecular to the behavioral level. We trace the information pathway from the capture of pheromone by male antennae, binding and transportation to olfactory receptor neurons, receptor activation, signal transduction, molecule inactivation, through brain processing and behavioral response. We highlight the impact of recent studies and also provide our insights into pheromone processing. © 2015 Elsevier Inc. All rights reserved.
Transgenic cultures: from the economic viewpoint
Directory of Open Access Journals (Sweden)
Mauricio Mosquera
2001-01-01
Full Text Available The introduction of transgenic seeds for agricultural purposes poses modification to their production, due to the potential for reaching desired characteristics such as greater yield, this being fundamental in an economic environment characterised by open market conditions. However, acceptance of products resulting from genetic engineering is far from becoming a simple process; discussion relating to the predominance of private sector interests, the monopoly of knowledge and the safety of such seeds/food is currently in the spotlight. This article presents the main points of debate regarding adoption of transgenic cultures, contributing to discussion about this topic for Colombia.
Generation of BAC transgenic epithelial organoids.
Directory of Open Access Journals (Sweden)
Gerald Schwank
Full Text Available Under previously developed culture conditions, mouse and human intestinal epithelia can be cultured and expanded over long periods. These so-called organoids recapitulate the three-dimensional architecture of the gut epithelium, and consist of all major intestinal cell types. One key advantage of these ex vivo cultures is their accessibility to live imaging. So far the establishment of transgenic fluorescent reporter organoids has required the generation of transgenic mice, a laborious and time-consuming process, which cannot be extended to human cultures. Here we present a transfection protocol that enables the generation of recombinant mouse and human reporter organoids using BAC (bacterial artificial chromosome technology.
Stable Skin-specific Overexpression of Human CTLA4-Ig in Transgenic Mice through Seven Generations
Institute of Scientific and Technical Information of China (English)
Yong WANG; Yong NI; Hong WEI; Feng-Chao WANG; Liang-Peng GE; Xiang GAO
2006-01-01
Skin graft rejection is a typical cellular immune response, mainly mediated by T cells. Cytotoxic T lymphocyte associated antigen 4-immunoglobin (CTLA4-Ig) extends graft survival by blocking the T cell co-stimulation pathway and inhibiting T cell activation. To investigate the efficacy of CTLA4-Ig in prolonging skin graft survival, human CTLA4-Ig (hCTLA4-Ig) was engineered to overexpress in mouse skin by transgenesis using the K14 promoter. Reverse transcription-polymerase chain reaction (RT-PCR) and Western blot assay indicated that the expression of CTLA4-Ig remained skin-specific and relatively constant compared to the internal control protein, AKT, through seven generations. The presence and concentration of the hCTLA4-Ig protein in transgenic mouse sera was determined by enzyme-linked immunosorbent assay (ELISA), and the results indicated that the serum CTLA4-Ig concentration also remained constant through generations. Survival of transgenic mouse skins grafted onto rat wounds was remarkably prolonged compared to that of wild-type skins from the same mouse strain, and remained comparable among all seven generations. This suggested that the bioactive hCTLA4-Ig protein was stably expressed in transgenical mice through at least seven generations, which was consistent with the stable skin-specific CTLA4-Ig expression.The results demonstrated that the transgenic expression of hCTLA4-Ig in skin driven by the K14 promoter remained constant through generations, and a transgenic line can be established to provide transgenic skin with extended survival reproducibly.
Comparative proteomics of milk fat globule membrane proteins from transgenic cloned cattle.
Directory of Open Access Journals (Sweden)
Shunchao Sui
Full Text Available The use of transgenic livestock is providing new methods for obtaining pharmaceutically useful proteins. However, the protein expression profiles of the transgenic animals, including expression of milk fat globule membrane (MFGM proteins, have not been well characterized. In this study, we compared the MFGM protein expression profile of the colostrum and mature milk from three lines of transgenic cloned (TC cattle, i.e., expressing recombinant human α-lactalbumin (TC-LA, lactoferrin (TC-LF or lysozyme (TC-LZ in the mammary gland, with those from cloned non-transgenic (C and conventionally bred normal animals (N. We identified 1, 225 proteins in milk MFGM, 166 of which were specifically expressed only in the TC-LA group, 265 only in the TC-LF group, and 184 only in the TC-LZ group. There were 43 proteins expressed only in the transgenic cloned animals, but the concentrations of these proteins were below the detection limit of silver staining. Functional analysis also showed that the 43 proteins had no obvious influence on the bovine mammary gland. Quantitative comparison revealed that MFGM proteins were up- or down-regulated more than twofold in the TC and C groups compared to N group: 126 in colostrum and 77 in mature milk of the TC-LA group; 157 in colostrum and 222 in mature milk of the TC-LF group; 49 in colostrum and 98 in mature milk of the TC-LZ group; 98 in colostrum and 132 in mature milk in the C group. These up- and down-regulated proteins in the transgenic animals were not associated with a particular biological function or pathway, which appears that expression of certain exogenous proteins has no general deleterious effects on the cattle mammary gland.
Generation and characterization of a transgenic pig carrying a DsRed-monomer reporter gene.
Directory of Open Access Journals (Sweden)
Chih-Jen Chou
Full Text Available Pigs are an optimal animal for conducting biomedical research because of their anatomical and physiological resemblance to humans. In contrast to the abundant resources available in the study of mice, few fluorescent protein-harboring porcine models are available for preclinical studies. In this paper, we report the successful generation and characterization of a transgenic DsRed-Monomer porcine model.The transgene comprised a CMV enhancer/chicken-beta actin promoter and DsRed monomeric cDNA. Transgenic pigs were produced by using pronuclear microinjection. PCR and Southern blot analyses were applied for identification of the transgene. Histology, blood examinations and computed tomography were performed to study the health conditions. The pig amniotic fluid progenitor/stem cells were also isolated to examine the existence of red fluorescence and differentiation ability.Transgenic pigs were successfully generated and transmitted to offspring at a germ-line transmission rate of 43.59% (17/39. Ubiquitous expression of red fluorescence was detected in the brain, eye, tongue, heart, lung, liver, pancreas, spleen, stomach, small intestine, large intestine, kidney, testis, and muscle; this was confirmed by histology and western blot analyses. In addition, we confirmed the differentiation potential of amniotic fluid progenitor stem cells isolated from the transgenic pig.This red fluorescent pig can serve as a host for other fluorescent-labeled cells in order to study cell-microenvironment interactions, and can provide optimal red-fluorescent-labeled cells and tissues for research in developmental biology, regenerative medicine, and xenotransplantation.
Quantitative analysis of lentiviral transgene expression in mice over seven generations.
Wang, Yong; Song, Yong-tao; Liu, Qin; Liu, Cang'e; Wang, Lu-lu; Liu, Yu; Zhou, Xiao-yang; Wu, Jun; Wei, Hong
2010-10-01
together, these data suggested that transgenic lines with long term stable expression and no position effect can be established by lentiviral transgenesis.
47 CFR 73.825 - Protection to reception of TV channel 6.
2010-10-01
... 47 Telecommunication 4 2010-10-01 2010-10-01 false Protection to reception of TV channel 6. 73.825... RADIO BROADCAST SERVICES Low Power FM Broadcast Stations (LPFM) § 73.825 Protection to reception of TV... separation distances in the following table are met with respect to all full power TV Channel 6 stations. FM...
Directory of Open Access Journals (Sweden)
Simona Chirică
2017-12-01
Full Text Available The new Regulation regarding the reception of construction works and corresponding installations, approved by Government's Decision no. 347/2017 (“Regulation 2017” has general applicability for all construction works for which there is an obligation to obtain a building permit. Regulation 2017 brings significant changes and clarifications expected by the real estate sector regarding: (i the composition of the commissions involved in the reception procedure, (ii the role of the site supervisor who thus gains significant participation in the reception procedure, and (iii the participation of the public authorities' representatives at the reception, having the veto right on the decision of the reception commission upon the completion of the construction works. Another element of novelty brought by Regulation 2017 is the possibility to do the reception upon the completion of the construction works, respectively the final reception for parts / objectives / sectors of or from the building, if they are distinct/ independent from a physical and functional point of view. Thus, the new regulation facilitates the procedure of authorizing investment objectives and the costs of the process. The partial reception is another innovation brought by the Regulation 2017 in support of the investor, who can thus take over a part of the construction, at a certain stage, and obtain its registration with the Land Book.
The Social Nature of Argumentative Practices: The Philosophy of Argument and Audience Reception
Paula Olmos
2018-01-01
Abstract: This article reviews Christopher W. Tindale’s The Philosophy of Argument and Audience Reception (Cambridge, 2015). Résumé: Cet article est une critique de The Philosophy of Argument and Audience Reception (Cambridge, 2015) de Christopher W. Tindale.
Technological Development and Its Impact on Student Reception of a Campus Radio
Mohamed, Shafizan; Wok, Saodah; Lahabou, Mahaman
2018-01-01
In 2011, a study was conducted to look at students' reception of IIUM.FM, a newly launched online campus radio. Using the Technological Acceptance Model (TAM), the study found that factors such as perceived ease of use, perceived usefulness, and attitude highly influenced audience reception of the online radio. In 2016, a corresponding study,…
Effective Strategies for Turning Receptive Vocabulary into Productive Vocabulary in EFL Context
Faraj, Avan Kamal Aziz
2015-01-01
Vocabulary acquisition has been a main concern of EFL English teachers and learners. There have been tons of research to examine the student's level of receptive vocabulary and productive vocabulary, but no research has conducted on how turning receptive vocabulary into productive vocabulary. This study has reported the impact of the teaching…
Teaching Receptive Naming of Chinese Characters to Children with Autism by Incorporating Echolalia.
Leung, Jin-Pang; Wu, Kit-I
1997-01-01
The facilitative effect of incorporating echolalia on teaching receptive naming of Chinese characters to four Hong Kong children (ages 8-10) with autism was assessed. Results from two experiments indicated echolalia was the active component contributing to the successful acquisition and maintenance of receptive naming of Chinese characters.…
Mchitarjan, Irina
2015-01-01
This article reports a historical case study of extensive educational transfer: the reception, adaptation, and use of German progressive education and German school reform ideas and practices in Russia at the beginning of the twentieth century. The reception of German educational ideas greatly enriched the theory and practice of the Russian school…
Unaccompanied adolescents seeking asylum: Poorer mental health under a restrictive reception
Reijneveld, S.A.; Boer, J.B.de; Bean, T.; Korfker, D.G.
2005-01-01
We assessed the effects of a stringent reception policy on the mental health of unaccompanied adolescent asylum seekers by comparing the mental health of adolescents in a restricted campus reception setting and in a setting offering more autonomy (numbers [response rates]: 69 [93%] and 53 [69%],
The Effects of Receptive and Productive Learning of Word Pairs on Vocabulary Knowledge
Webb, Stuart
2009-01-01
English as a foreign language students in Japan learned target words in word pairs receptively and productively. Five aspects of vocabulary knowledge--orthography, association, syntax, grammatical functions, and meaning and form--were each measured by receptive and productive tests. The study uses an innovative methodology in that each target word…
An Examination of College Students' Receptiveness to Alcohol-Related Information and Advice
Leahy, Matthew M.; Jouriles, Ernest N.; Walters, Scott T.
2013-01-01
This project examined the reliability and validity of a newly developed measure of college students' receptiveness to alcohol related information and advice. Participants were 116 college students who reported having consumed alcohol at some point in their lifetime. Participants completed a measure of receptiveness to alcohol-related…
Genome-Wide Association Study of Receptive Language Ability of 12-Year-Olds
Harlaar, Nicole; Meaburn, Emma L.; Hayiou-Thomas, Marianna E.; Davis, Oliver S. P.; Docherty, Sophia; Hanscombe, Ken B.; Haworth, Claire M. A.; Price, Thomas S.; Trzaskowski, Maciej; Dale, Philip S.; Plomin, Robert
2014-01-01
Purpose: Researchers have previously shown that individual differences in measures of receptive language ability at age 12 are highly heritable. In the current study, the authors attempted to identify some of the genes responsible for the heritability of receptive language ability using a "genome-wide association" approach. Method: The…
The effectiveness of correcting codes in reception in the whole in additive normal white noise
Shtarkov, Y. M.
1974-01-01
Some possible criteria for estimating the effectiveness of correcting codes are presented, and the energy effectiveness of correcting codes is studied for symbol-by-symbol reception. Expressions for the energetic effectiveness of binary correcting codes for reception in the whole are produced. Asymptotic energetic effectiveness and finite signal/noise ratio cases are considered.
International Nuclear Information System (INIS)
Dickie, Peter; Roberts, Amanda; Uwiera, Richard; Witmer, Jennifer; Sharma, Kirti; Kopp, Jeffrey B.
2004-01-01
Clinical and morphologic features of human immunodeficiency virus (HIV)-associated nephropathy (HIVAN), such as proteinuria, sclerosing glomerulopathy, tubular degeneration, and interstitial disease, have been modeled in mice bearing an HIV proviral transgene rendered noninfectious through a deletion in gag/pol. Exploring the genetic basis of HIVAN, HIV transgenic mice bearing mutations in either or both of the accessory genes nef and vpr were created. Proteinuria and focal glomerulosclerosis (FGS) only developed in mice with an intact vpr gene. Transgenic mice bearing a simplified proviral DNA (encoding only Tat and Vpr) developed renal disease characterized by FGS in which Vpr protein was localized to glomerular and tubular epithelia by immunohistochemistry. The dual transgenic progeny of HIV[Tat/Vpr] mice bred to HIV[ΔVpr] proviral transgenic mice displayed a more severe nephropathy with no apparent increase in Vpr expression, implying that multiple viral genes contribute to HIVAN. However, the unique contribution of macrophage-specific Vpr expression in the development of glomerular disease was underscored by the induction of FGS in multiple murine lines bearing a c-fms/vpr transgene
Boddupally, Dayakar; Tamirisa, Srinath; Gundra, Sivakrishna Rao; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao
2018-05-31
To evolve rice varieties resistant to different groups of insect pests a fusion gene, comprising DI and DII domains of Bt Cry1Ac and carbohydrate binding domain of garlic lectin (ASAL), was constructed. Transgenic rice lines were generated and evaluated to assess the efficacy of Cry1Ac::ASAL fusion protein against three major pests, viz., yellow stem borer (YSB), leaf folder (LF) and brown planthopper (BPH). Molecular analyses of transgenic plants revealed stable integration and expression of the fusion gene. In planta insect bioassays on transgenics disclosed enhanced levels of resistance compared to the control plants. High insect mortality of YSB, LF and BPH was observed on transgenics compared to that of control plants. Furthermore, honeydew assays revealed significant decreases in the feeding ability of BPH on transgenic plants as compared to the controls. Ligand blot analysis, using BPH insects fed on cry1Ac::asal transgenic rice plants, revealed a modified receptor protein-binding pattern owing to its ability to bind to additional receptors in insects. The overall results authenticate that Cry1Ac::ASAL protein is endowed with remarkable entomotoxic effects against major lepidopteran and hemipteran insects. As such, the fusion gene appears promising and can be introduced into various other crops to control multiple insect pests.
Directory of Open Access Journals (Sweden)
Wiebke Garrels
Full Text Available Genetic engineering can expand the utility of pigs for modeling human diseases, and for developing advanced therapeutic approaches. However, the inefficient production of transgenic pigs represents a technological bottleneck. Here, we assessed the hyperactive Sleeping Beauty (SB100X transposon system for enzyme-catalyzed transgene integration into the embryonic porcine genome. The components of the transposon vector system were microinjected as circular plasmids into the cytoplasm of porcine zygotes, resulting in high frequencies of transgenic fetuses and piglets. The transgenic animals showed normal development and persistent reporter gene expression for >12 months. Molecular hallmarks of transposition were confirmed by analysis of 25 genomic insertion sites. We demonstrate germ-line transmission, segregation of individual transposons, and continued, copy number-dependent transgene expression in F1-offspring. In addition, we demonstrate target-selected gene insertion into transposon-tagged genomic loci by Cre-loxP-based cassette exchange in somatic cells followed by nuclear transfer. Transposase-catalyzed transgenesis in a large mammalian species expands the arsenal of transgenic technologies for use in domestic animals and will facilitate the development of large animal models for human diseases.
Directory of Open Access Journals (Sweden)
Rosalind A Leggatt
Full Text Available Growth hormone (GH transgenic fish have accelerated growth and could improve production efficiency in aquaculture. However, concern exists regarding potential environmental risks of GH transgenic fish should they escape rearing facilities. While environmental effects have been examined in some GH transgenic models, there is a lack of information on whether effects differ among different constructs or strains of transgenic fish. We compared growth and survival of wild-type coho salmon (Oncorhynchus kisutch fry, a fast-growing GH transgenic strain containing a metallothionein promoter (TMT, and three lines/strains containing a reportedly weaker histone-3 promoter (TH3 in hatchery conditions and semi-natural stream tanks with varying levels of natural food and predators. Rank order of genotype size and survival differed with varying environmental conditions, both within and among experiments. Despite accelerated growth in hatchery conditions, TMT fry gained little or no growth enhancement in stream conditions, had enhanced survival when food was limiting, and inconsistent survival under other conditions. Rank growth was inconsistent in TH3 strains, with one strain having highest, and two strains having the lowest growth in stream conditions, although all TH3 strains had consistently poor survival. These studies demonstrate the importance of determining risk estimates for each unique transgenic model independent of other models.
Niklaus, Michael; Gruissem, Wilhelm; Vanderschuren, Hervé
2011-01-01
Cassava is one of the most important crops in the tropics. Its industrial use for starch and biofuel production is also increasing its importance for agricultural production in tropical countries. In the last decade cassava biotechnology has emerged as a valuable alternative to the breeding constraints of this highly heterozygous crop for improved trait development of cassava germplasm. Cassava transformation remains difficult and time-consuming because of limitations in selecting transgenic tissues and regeneration of transgenic plantlets. We have recently reported an efficient and robust cassava transformation protocol using the hygromycin phosphotransferase II (hptII) gene as selection marker and the aminoglycoside hygromycin at optimal concentrations to maximize the regeneration of transgenic plantlets. In the present work, we expanded the transformation protocol to the use of the neomycin phosphotransferase II (nptII) gene as selection marker. Several aminoglycosides compatible with the use of nptII were tested and optimal concentrations for cassava transformation were determined. Given its efficiency equivalent to hptII as selection marker with the described protocol, the use of nptII opens new possibilities to engineer transgenic cassava lines with multiple T-DNA insertions and to produce transgenic cassava with a resistance marker gene that is already deregulated in several commercial transgenic crops.
Lectin cDNA and transgenic plants derived therefrom
Raikhel, Natasha V.
2000-10-03
Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.
Chromosomal localisation of the CD4cre transgene in B6·Cg-Tg(Cd4-cre)1Cwi mice.
Westendorf, Kerstin; Durek, Pawel; Ayew, Samia; Mashreghi, Mir-Farzin; Radbruch, Andreas
2016-09-01
The B6·Cg-Tg(Cd4-cre)1Cwi line expresses CRE recombinase under the control of the promoter and regulatory elements of the Cd4 gene. Here we show that CRE recombinase expression reduces the number and frequencies of CD4 positive subsets in a dose-dependent manner and localize the integration site of the transgenic construct to position 60335693-60341285 (qD) of chromosome 3. The insert contains at least 15 complete sequential copies of the transgenic construct. Based on this information we describe a novel PCR assay for genetic typing of transgenic mice. Copyright © 2016 Elsevier B.V. All rights reserved.
Mammary gland tumor formation in transgenic mice overexpressing stromelysin-1
Energy Technology Data Exchange (ETDEWEB)
Sympson, Carolyn J; Bissell, Mina J; Werb, Zena
1995-06-01
An intact basement membrane (BM) is essential for the proper function, differentiation and morphology of many epithelial cells. The disruption or loss of this BM occurs during normal development as well as in the disease state. To examine the importance of BM during mammary gland development in vivo, we generated transgenic mice that inappropriately express autoactivating isoforms of the matrix metalloproteinase stromelysin-1. The mammary glands from these mice are both functionally and morphologically altered throughout development. We have now documented a dramatic incidence of breast tumors in several independent lines of these mice. These data suggest that overexpression of stromelysin-1 and disruption of the BM may be a key step in the multi-step process of breast cancer.
Degradation of β-Aryl Ether Bonds in Transgenic Plants
DEFF Research Database (Denmark)
Mnich, Ewelina
Lignin is one of the main building blocks of the plant cell wall. It tethers the cell wall by cross-linking with polysaccharides conferring mechanical strength to plants, aiding water transport and providing a mechanical barrier against pathogens. It is generated by the polymerization....... Compared to other plants grass cell walls contain elevated amount of ferulates which play a crucial role in cross-linking of polysaccharides and lignin. In addition ferulates are believed to be nucleation cites for the lignification. The bacterium Sphingomonas paucimobilis SYK6 has developed an enzyme...... of the cell wall. The aim of the study was to alter lignin structure by expression in plants of the enzymes from S. paucimobilis involved in ether bond degradation (LigDFG). Arabidopsis thaliana and Brachypodium distachyon transgenic lines were generated and characterized with respect to lignin structure...
Gregson, Kim D; Erath, Stephen A; Pettit, Gregory S; Tu, Kelly M
2016-12-01
Associations linking parenting emotional climate and quality of parental social coaching with young adolescents' receptivity to parental social coaching were examined (N = 80). Parenting emotional climate was assessed with adolescent-reported parental warmth and hostility. Quality of parental social coaching (i.e., prosocial advice, benign framing) was assessed via parent-report and behavioral observations during a parent-adolescent discussion about negative peer evaluation. An adolescent receptivity latent variable score was derived from observations of adolescents' behavior during the discussion, change in adolescents' peer response plan following the discussion, and adolescent-reported tendency to seek social advice from the parent. Parenting climate moderated associations between coaching and receptivity: Higher quality coaching was associated with greater receptivity in the context of a more positive climate. Analyses suggested a stronger association between coaching and receptivity among younger compared to older adolescents. © 2015 The Authors. Journal of Research on Adolescence © 2015 Society for Research on Adolescence.
Fuentes, Alejandro; Carlos, Natacha; Ruiz, Yoslaine; Callard, Danay; Sánchez, Yadira; Ochagavía, María Elena; Seguin, Jonathan; Malpica-López, Nachelli; Hohn, Thomas; Lecca, Maria Rita; Pérez, Rosabel; Doreste, Vivian; Rehrauer, Hubert; Farinelli, Laurent; Pujol, Merardo; Pooggin, Mikhail M
2016-03-01
RNA interference (RNAi) is a widely used approach to generate virus-resistant transgenic crops. However, issues of agricultural importance like the long-term durability of RNAi-mediated resistance under field conditions and the potential side effects provoked in the plant by the stable RNAi expression remain poorly investigated. Here, we performed field trials and molecular characterization studies of two homozygous transgenic tomato lines, with different selection markers, expressing an intron-hairpin RNA cognate to the Tomato yellow leaf curl virus (TYLCV) C1 gene. The tested F6 and F4 progenies of the respective kanamycin- and basta-resistant plants exhibited unchanged field resistance to TYLCV and stably expressed the transgene-derived short interfering RNA (siRNAs) to represent 6 to 8% of the total plant small RNAs. This value outnumbered the average percentage of viral siRNAs in the nontransformed plants exposed to TYLCV-infested whiteflies. As a result of the RNAi transgene expression, a common set of up- and downregulated genes was revealed in the transcriptome profile of the plants selected from either of the two transgenic events. A previously unidentified geminivirus causing no symptoms of viral disease was detected in some of the transgenic plants. The novel virus acquired V1 and V2 genes from TYLCV and C1, C2, C3, and C4 genes from a distantly related geminivirus and, thereby, it could evade the repressive sequence-specific action of transgene-derived siRNAs. Our findings shed light on the mechanisms of siRNA-directed antiviral silencing in transgenic plants and highlight the applicability limitations of this technology as it may alter the transcriptional pattern of nontarget genes.
Forsberg, C W; Meidinger, R G; Ajakaiye, A; Murray, D; Fan, M Z; Mandell, I B; Phillips, J P
2014-10-01
A transgenic line of Yorkshire (YK) pigs named the Cassie (CA) line was produced with a low copy number phytase transgene inserted in the genome. The transgenic line efficiently digests P, Ca, and other major minerals of plant dietary origin. The objectives of this study were to 1) compare carcass and tissue nutrient composition and meat quality traits for third generation hemizygous CA line market BW finisher pigs (n = 24) with age-matched conventional YK finisher pigs (n = 24) and 2) examine effects of outbreeding with high-index conventional YK boars on modifying carcass leanness from the third to sixth generations in CA line finisher boars (n = 73) and gilts (n = 103). Cassie boars (n = 12) and CA gilts (n = 12) were fed diets without supplemental P and comparable numbers of age-matched YK boars and gilts fed diets containing supplement P were raised throughout the finisher phase. The pigs were slaughtered and then fabricated into commercial pork primals before meat composition and quality evaluation. Proximate and major micronutrient composition was determined on tissues including fat, kidney, lean, liver, and skin. The main difference observed was greater (P = 0.033) crude fat content in CA boar carcasses and increased (P phytase action rather than to insertion of the transgene. However, from a meat composition perspective, transgenic expression of phytase in the CA line of YK pigs had little overall effect on meat composition. Outbreeding of high-index CA gilts with high-index commercial YK boars linearly reduced (P = 0.002) back fat thickness with a corresponding linear increase (P = 0.001) in lean yield in finisher CA gilts, although no change in these parameters was observed in CA finisher boars. The increase in lean yield in CA gilts by selective breeding without affecting the level of salivary phytase activity documents the value of conventional genetic selection in conjunction with genetic modification.
Cohen, Robert M.; Rezai-Zadeh, Kavon; Weitz, Tara M.; Rentsendorj, Altan; Gate, David; Spivak, Inna; Bholat, Yasmin; Vasilevko, Vitaly; Glabe, Charles G.; Breunig, Joshua J.; Rakic, Pasko; Davtyan, Hayk; Agadjanyan, Michael G.; Kepe, Vladimir; Barrio, Jorge
2013-01-01
Alzheimer’s disease (AD) is hallmarked by amyloid plaques, neurofibrillary tangles, and widespread cortical neuronal loss (Selkoe, 2001). The ‘amyloid cascade hypothesis’ posits that cerebral amyloid sets neurotoxic events into motion that precipitate Alzheimer dementia (Hardy and Allsop, 1991). Yet, faithful recapitulation of all AD features in widely used transgenic (Tg) mice engineered to overproduce Aβ peptides has been elusive. We have developed a Tg rat model (line TgF344-AD) expressing...
Transgenic Overexpression of the Proprotein Convertase Furin Enhances Skin Tumor Growth
Directory of Open Access Journals (Sweden)
Jian Fu
2012-04-01
Full Text Available Furin, one of the members of the family of proprotein convertases (PCs, ubiquitously expressed as a type I membrane-bound proteinase, activates several proteins that contribute to tumor progression. In vitro studies using cancer cell lines and clinical specimens demonstrated that furin processes important substrates such as insulin-like growth factor 1 receptor (IGF-1R and transforming growth factor β, leading to increased tumor growth and progression. Despite the numerous studies associating furin with tumor development, its effects in preclinical models has not been comprehensively studied. In this study, we sought to determine the protumorigenic role of furin in vivo after a two-stage chemical carcinogenesis protocol in transgenic mice in which furin expression was targeted to the epidermal basal layer. We found that processing of the PC substrate IGF-1R and the proliferation rate of mouse epidermis was enhanced in transgenic mice when compared with their WT counterparts. Histopathologic diagnoses of the tumors demonstrated that furin transgenic mice (line F47 developed twice as many squamous carcinomas as the control, WT mice (P < .002. Similarly, tumors cells from transgenic mice were able to process PC substrates more efficiently than tumor cells from WT mice. Furthermore, furin expression resulted in a higher SCC volume in transgenic mice as well as an increase in the percentage of high-grade SCC, including poorly differentiated and spindle cell carcinomas. In conclusion, expression of furin in the basal layer of the epidermis increased tumor development and enhanced tumor growth, supporting the consideration of furin as a potential target for cancer treatment.
IDENTIFICATION OF ESCAPED TRANSGENIC CREEPING BENTGRASS IN OREGON
When transgenic plants are cultivated near wild species that are sexually compatible with the crop, gene flow between the crop and wild plants is possible. A resultant concern is that transgene flow and transgene introgression within wild populations could have unintended ecologi...
Altenbach, Susan B; Tanaka, Charlene K; Seabourn, Bradford W
2014-12-24
The end-use quality of wheat flour varies as a result of the growth conditions of the plant. Among the wheat gluten proteins, the omega-5 gliadins have been identified as a major source of environmental variability, increasing in proportion in grain from plants that receive fertilizer or are subjected to high temperatures during grain development. The omega-5 gliadins also have been associated with the food allergy wheat-dependent exercise-induced anaphylaxis (WDEIA). Recently, transgenic lines with reduced levels of omega-5 gliadins were developed using RNA interference (RNAi). These lines make it possible to determine whether changes in the levels of omega-5 gliadins in response to environmental conditions and agronomic inputs may be responsible for changes in flour end-use quality. Two transgenic wheat lines and a non-transgenic control were grown under a controlled temperature regimen with or without post-anthesis fertilizer and the protein composition of the resulting flour was analyzed by quantitative two-dimensional gel electrophoresis (2-DE). In one transgenic line, all 2-DE spots identified as omega-5 gliadins were substantially reduced without effects on other proteins. In the other transgenic line, the omega-5 gliadins were absent and there was a partial reduction in the levels of the omega-1,2 gliadins and the omega-1,2 chain-terminating gliadins as well as small changes in several other proteins. With the exception of the omega gliadins, the non-transgenic control and the transgenic plants showed similar responses to the fertilizer treatment. Protein contents of flour were determined by the fertilizer regimen and were similar in control and transgenic samples produced under each regimen while both mixing time and mixing tolerance were improved in flour from transgenic lines when plants received post-anthesis fertilizer. The data indicate that omega-5 gliadins have a negative effect on flour quality and suggest that changes in quality with the growth
Directory of Open Access Journals (Sweden)
Su Chen
2014-09-01
Full Text Available In our previous research, the Tamarix androssowii LEA gene (Tamarix androssowii late embryogenesis abundant protein Mrna, GenBank ID: DQ663481 was transferred into Populus simonii × Populus nigra. Among the eleven transgenic lines, one exhibited a dwarf phenotype compared to the wild type and other transgenic lines, named dwf1. To uncover the mechanisms underlying this phenotype, digital gene expression libraries were produced from dwf1, wild-type, and other normal transgenic lines, XL-5 and XL-6. Gene expression profile analysis indicated that dwf1 had a unique gene expression pattern in comparison to the other two transgenic lines. Finally, a total of 1246 dwf1-unique differentially expressed genes were identified. These genes were further subjected to gene ontology and pathway analysis. Results indicated that photosynthesis and carbohydrate metabolism related genes were significantly affected. In addition, many transcription factors genes were also differentially expressed in dwf1. These various differentially expressed genes may be critical for dwarf mutant formation; thus, the findings presented here might provide insight for our understanding of the mechanisms of tree growth and development.
Genome-Wide Analysis of a TaLEA-Introduced Transgenic Populus simonii × Populus nigra Dwarf Mutant
Directory of Open Access Journals (Sweden)
Jing Jiang
2012-03-01
Full Text Available A dwarf mutant (dwf1 was obtained among 15 transgenic lines, when TaLEA (Tamarix androssowii late embryogenesis abundant gene was introduced into Populus simonii × Populus nigra by Agrobacterium tumefaciens-mediated transformation. Under the same growth conditions, dwf1 height was significantly reduced compared with the wild type and the other transgenic lines. Because only one transgenic line (dwf1 displayed the dwarf phenotype, we considered that T-DNA insertion sites may play a role in the mutant formation. The mechanisms underlying this effect were investigated using TAIL-PCR (thermal asymmetric interlaced PCR and microarrays methods. According to the TAIL-PCR results, two flanking sequences located on chromosome IV and VIII respectively, were cloned. The results indicated the integration of two independent T-DNA copies. We searched for the potential genes near to the T-DNA insertions. The nearest gene was a putative poplar AP2 transcription factor (GI: 224073210. Expression analysis showed that AP2 was up-regulated in dwf1 compared with the wild type and the other transgenic lines. According to the microarrays results, a total of 537 genes involved in hydrolase, kinase and transcription factor activities, as well as protein and nucleotide binding, showed significant alterations in gene expression. These genes were expressed in more than 60 metabolic pathways, including starch, sucrose, galactose and glycerolipid metabolism and phenylpropanoids and flavonoid biosyntheses. Our transcriptome and T-DNA insertion sites analyses might provide some useful insights into the dwarf mutant formation.
Moravcikova, J.; Matusikova, I.; Libantova, J.; Bauer, M.; Mlynarova, L.
2004-01-01
The genes encoding for a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase were co-introduced into Slovak potato (Solanum tuberosum L.) breeding line 116/86 using Agrobacterium tumefaciens. For both transgenes the number of integrated copies and level of RNA expression
Directory of Open Access Journals (Sweden)
Ling Li
Full Text Available The effects of endocrine disrupting chemicals (EDCs on reproduction are well known, whereas their developmental effects are much less characterized. However, exposure to endocrine disruptors during organogenesis may lead to deleterious and permanent problems later in life. Zebrafish (Danio rerio transgenic lines expressing the green fluorescent protein (GFP in specific organs and tissues are powerful tools to uncover developmental defects elicited by EDCs. Here, we used seven transgenic lines to visualize in vivo whether a series of EDCs and other pharmaceutical compounds can alter organogenesis in zebrafish. We used transgenic lines expressing GFP in pancreas, liver, blood vessels, inner ear, nervous system, pharyngeal tooth and pectoral fins. This screen revealed that four of the tested chemicals have detectable effects on different organs, which shows that the range of effects elicited by EDCs is wider than anticipated. The endocrine disruptor tetrabromobisphenol-A (TBBPA, as well as the three drugs diclofenac, trichostatin A (TSA and valproic acid (VPA induced abnormalities in the embryonic vascular system of zebrafish. Moreover, TSA and VPA induced specific alterations during the development of pancreas, an observation that was confirmed by in situ hybridization with specific markers. Developmental delays were also induced by TSA and VPA in the liver and in pharyngeal teeth, resulting in smaller organ size. Our results show that EDCs can induce a large range of developmental alterations during embryogenesis of zebrafish and establish GFP transgenic lines as powerful tools to screen for EDCs effects in vivo.
Chen, Lei; Auh, Chung-Kyoon; Dowling, Paul; Bell, Jeremey; Chen, Fang; Hopkins, Andrew; Dixon, Richard A; Wang, Zeng-Yu
2003-11-01
Lignification of cell walls during plant development has been identified as the major factor limiting forage digestibility and concomitantly animal productivity. cDNA sequences encoding a key lignin biosynthetic enzyme, cinnamyl alcohol dehydrogenase (CAD), were cloned from the widely grown monocotyledonous forage species tall fescue (Festuca arundinacea Schreb.). Recombinant tall fescue CAD expressed in E. coli exhibited the highest V(max)/K(m) values when coniferaldehyde and sinapaldehyde were used as substrates. Transgenic tall fescue plants carrying either sense or antisense CAD gene constructs were obtained by microprojectile bombardment of single genotype-derived embryogenic suspension cells. Severely reduced levels of mRNA transcripts and significantly reduced CAD enzymatic activities were found in two transgenic plants carrying sense and antisense CAD transgenes, respectively. These CAD down-regulated transgenic lines had significantly decreased lignin content and altered ratios of syringyl (S) to guaiacyl (G), G to p-hydroxyphenyl (H) and S to H units. No significant changes in cellulose, hemicellulose, neutral sugar composition, p-coumaric acid and ferulic acid levels were observed in the transgenic plants. Increases of in vitro dry matter digestibility of 7.2-9.5% were achieved in the CAD down-regulated lines, thus providing a novel germplasm to be used for the development of grass cultivars with improved forage quality.
First-Generation Transgenic Plants and Statistics
Nap, Jan-Peter; Keizer, Paul; Jansen, Ritsert
1993-01-01
The statistical analyses of populations of first-generation transgenic plants are commonly based on mean and variance and generally require a test of normality. Since in many cases the assumptions of normality are not met, analyses can result in erroneous conclusions. Transformation of data to
Generation of antiviral transgenic chicken using spermatogonial ...
African Journals Online (AJOL)
This study was conducted in order to generate anti-viral transgenic chickens through transfected spermatogonial stem cell with fusion gene EGFP-MMx. After injecting fusion gene EGFP-MMx into testes, tissues frozen section, polymerase chain reaction (PCR) and dot blot of testes was performed at 30, 40, 50, 60, 70 and 80 ...
Transgenic strategies for improving rice disease resistance
African Journals Online (AJOL)
STORAGESEVER
2009-05-04
May 4, 2009 ... practice. However, the useful life-span of many resistant cultivars is only a few years, due to the breakdown of the .... Thus, suppression of insect feeding by transgenic .... different types of defense-responsive genes were found.
Assessing the value of transgenic crops.
Lacey, Hugh
2002-10-01
In the current controversy about the value of transgenic crops, matters open to empirical inquiry are centrally at issue. One such matter is a key premise in a common argument (that I summarize) that transgenic crops should be considered to have universal value. The premise is that there are no alternative forms of agriculture available to enable the production of sufficient food to feed the world. The proponents of agroecology challenge it, claiming that agroecology provides an alternative, and they deny the claim that it is well founded on empirical evidence. It is, therefore, a matter of both social and scientific importance that this premise and the criticisms of it be investigated rigorously and empirically, so that the benefits and disadvantages of transgenic-intensive agriculture and agroecology can be compared in a reliable way. Conducting adequate investigation about the potential contribution of agroecology requires that the cultural conditions of its practice (and, thus, of the practices and movements of small-scale farmers in the "third world") be strengthened--and this puts the interests of investigation into tension with the socio-economic interests driving the development of transgenics. General issues about relationship between ethical argument and empirical (scientific) investigation are raised throughout the article.
Cancer immunotherapy : insights from transgenic animal models
McLaughlin, PMJ; Kroesen, BJ; Harmsen, MC; de Leij, LFMH
2001-01-01
A wide range of strategies in cancer immunotherapy has been developed in the last decade, some of which are currently being used in clinical settings. The development of these immunotherapeutical strategies has been facilitated by the generation of relevant transgenic animal models. Since the
Metal resistance sequences and transgenic plants
Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.
1999-10-12
The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.
Transgenic plants with increased calcium stores
Wyatt, Sarah (Inventor); Tsou, Pei-Lan (Inventor); Robertson, Dominique (Inventor); Boss, Wendy (Inventor)
2004-01-01
The present invention provides transgenic plants over-expressing a transgene encoding a calcium-binding protein or peptide (CaBP). Preferably, the CaBP is a calcium storage protein and over-expression thereof does not have undue adverse effects on calcium homeostasis or biochemical pathways that are regulated by calcium. In preferred embodiments, the CaBP is calreticulin (CRT) or calsequestrin. In more preferred embodiments, the CaBP is the C-domain of CRT, a fragment of the C-domain, or multimers of the foregoing. In other preferred embodiments, the CaBP is localized to the endoplasmic reticulum by operatively associating the transgene encoding the CaBP with an endoplasmic reticulum localization peptide. Alternatively, the CaBP is targeted to any other sub-cellular compartment that permits the calcium to be stored in a form that is biologically available to the plant. Also provided are methods of producing plants with desirable phenotypic traits by transformation of the plant with a transgene encoding a CaBP. Such phenotypic traits include increased calcium storage, enhanced resistance to calcium-limiting conditions, enhanced growth and viability, increased disease and stress resistance, enhanced flower and fruit production, reduced senescence, and a decreased need for fertilizer production. Further provided are plants with enhanced nutritional value as human food or animal feed.
Directory of Open Access Journals (Sweden)
Ana Isabel Garcia Diaz
2016-04-01
Full Text Available The Wistar Kyoto (WKY rat and the spontaneously hypertensive (SHR rat inbred strains are well-established models for human crescentic glomerulonephritis (CRGN and metabolic syndrome, respectively. Novel transgenic (Tg strains add research opportunities and increase scientific value to well-established rat models. We have created two novel Tg strains using Sleeping Beauty transposon germline transgenesis, ubiquitously expressing green fluorescent protein (GFP under the rat elongation factor 1 alpha (EF1a promoter on the WKY and SHR genetic backgrounds. The Sleeping Beauty system functioned with high transgenesis efficiency; 75% of new rats born after embryo microinjections were transgene positive. By ligation-mediated PCR, we located the genome integration sites, confirming no exonic disruption and defining a single or low copy number of the transgenes in the new WKY-GFP and SHR-GFP Tg lines. We report GFP-bright expression in embryos, tissues and organs in both lines and show preliminary in vitro and in vivo imaging data that demonstrate the utility of the new GFP-expressing lines for adoptive transfer, transplantation and fate mapping studies of CRGN, metabolic syndrome and other traits for which these strains have been extensively studied over the past four decades.
Transgenic tools to characterize neuronal properties of discrete populations of zebrafish neurons.
Satou, Chie; Kimura, Yukiko; Hirata, Hiromi; Suster, Maximiliano L; Kawakami, Koichi; Higashijima, Shin-ichi
2013-09-01
The developing nervous system consists of a variety of cell types. Transgenic animals expressing reporter genes in specific classes of neuronal cells are powerful tools for the study of neuronal network formation. We generated a wide variety of transgenic zebrafish that expressed reporter genes in specific classes of neurons or neuronal progenitors. These include lines in which neurons of specific neurotransmitter phenotypes expressed fluorescent proteins or Gal4, and lines in which specific subsets of the dorsal progenitor domain in the spinal cord expressed fluorescent proteins. Using these, we examined domain organization in the developing dorsal spinal cord, and found that there are six progenitor domains in zebrafish, which is similar to the domain organization in mice. We also systematically characterized neurotransmitter properties of the neurons that are produced from each domain. Given that reporter gene expressions occurs in a wide area of the nervous system in the lines generated, these transgenic fish should serve as powerful tools for the investigation of not only the neurons in the dorsal spinal cord but also neuronal structures and functions in many other regions of the nervous system.
Canons and Heroes: The Reception of the Complete Works Translation Project in Finland, 2002-13
Directory of Open Access Journals (Sweden)
Keinänen Nely
2017-12-01
Full Text Available This essay examines the reception of the ten-year Complete Works translation project undertaken by the Finnish publishing company Werner Söderström Oy (WSOY in 2004-13. Focusing on reviews published in the first and last years of the project, the essay details ongoing processes of Shakespeare (re-canonization in Finland, as each new generation explains to itself what Shakespeare means to them, and why it continues to read, translate and perform Shakespeare. These processes are visible in comments from the series editors and translators extolling the importance of Shakespeare’s work and the necessity of creating new, modern translations so Finns can read Shakespeare in their mother tongue; in discussions of the literary qualities of a good Shakespeare translation, e.g. whether it is advisable to use iambic pentameter in Finnish, a trochaic language; and in the creation of publisher and translator “heroes,” who at significant cost to themselves, whether in money in terms of the publisher, or time and effort in terms of the translators, labour to provide the public with their Shakespeare in modern Finnish. While on the whole reviewers celebrated the new translations, there was some resistance to changes in familiar lines from older translations, such as Macbeth’s “tomorrow” speech, suggesting that there are nevertheless some limits on modernizing “classic” translations.
Cortical depth dependent population receptive field attraction by spatial attention in human V1.
Klein, Barrie P; Fracasso, Alessio; van Dijk, Jelle A; Paffen, Chris L E; Te Pas, Susan F; Dumoulin, Serge O
2018-04-27
Visual spatial attention concentrates neural resources at the attended location. Recently, we demonstrated that voluntary spatial attention attracts population receptive fields (pRFs) toward its location throughout the visual hierarchy. Theoretically, both a feed forward or feedback mechanism could underlie pRF attraction in a given cortical area. Here, we use sub-millimeter ultra-high field functional MRI to measure pRF attraction across cortical depth and assess the contribution of feed forward and feedback signals to pRF attraction. In line with previous findings, we find consistent attraction of pRFs with voluntary spatial attention in V1. When assessed as a function of cortical depth, we find pRF attraction in every cortical portion (deep, center and superficial), although the attraction is strongest in deep cortical portions (near the gray-white matter boundary). Following the organization of feed forward and feedback processing across V1, we speculate that a mixture of feed forward and feedback processing underlies pRF attraction in V1. Specifically, we propose that feedback processing contributes to the pRF attraction in deep cortical portions. Copyright © 2018. Published by Elsevier Inc.
Ulbrich, Susanne E; Groebner, Anna E; Bauersachs, Stefan
2013-01-01
The development of a fertilized oocyte into a differentiated multi-cellular organism is a major challenge with regard to the orchestration of the expression of the mammalian genome. Highly complex networks of genes are temporally and spatially regulated during cellular differentiation to generate specific cell types. Embryonic development is critically influenced by external impacts in the female reproductive tract. A most critical phase of pregnancy in mammals is the pre- and peri-implantation period, during which the uterine environment plays a crucial role in supporting the development of the conceptus. The analytical description of the transcriptome, proteome and metabolome of the embryo-maternal interface is a prerequisite for the understanding of the complex regulatory processes taking place during this time. This review lines out potentials and limitations of different approaches to unravel the determinants of endometrial receptivity in cattle, the pig and the horse. Suitable in vivo and in vitro models, which have been used to elucidate factors participating in the embryo-maternal dialog are discussed. Taken together, transcriptome analyses and specified selective candidate gene driven approaches contribute to the understanding of endometrial function. The endometrium as sensor and driver of fertility may indicate the qualitative and quantitative nature of signaling molecules sent by the early embryo and in turn, accordingly impact on embryonic development. Copyright © 2012 Elsevier Inc. All rights reserved.
Shao, Feng; Li, Kemeng; Lin, Weisi; Jiang, Gangyi; Yu, Mei; Dai, Qionghai
2015-10-01
Quality assessment of 3D images encounters more challenges than its 2D counterparts. Directly applying 2D image quality metrics is not the solution. In this paper, we propose a new full-reference quality assessment for stereoscopic images by learning binocular receptive field properties to be more in line with human visual perception. To be more specific, in the training phase, we learn a multiscale dictionary from the training database, so that the latent structure of images can be represented as a set of basis vectors. In the quality estimation phase, we compute sparse feature similarity index based on the estimated sparse coefficient vectors by considering their phase difference and amplitude difference, and compute global luminance similarity index by considering luminance changes. The final quality score is obtained by incorporating binocular combination based on sparse energy and sparse complexity. Experimental results on five public 3D image quality assessment databases demonstrate that in comparison with the most related existing methods, the devised algorithm achieves high consistency with subjective assessment.
Yubo Wang; Tatinati, Sivanagaraja; Liyu Huang; Kim Jeong Hong; Shafiq, Ghufran; Veluvolu, Kalyana C; Khong, Andy W H
2017-07-01
Extracranial robotic radiotherapy employs external markers and a correlation model to trace the tumor motion caused by the respiration. The real-time tracking of tumor motion however requires a prediction model to compensate the latencies induced by the software (image data acquisition and processing) and hardware (mechanical and kinematic) limitations of the treatment system. A new prediction algorithm based on local receptive fields extreme learning machines (pLRF-ELM) is proposed for respiratory motion prediction. All the existing respiratory motion prediction methods model the non-stationary respiratory motion traces directly to predict the future values. Unlike these existing methods, the pLRF-ELM performs prediction by modeling the higher-level features obtained by mapping the raw respiratory motion into the random feature space of ELM instead of directly modeling the raw respiratory motion. The developed method is evaluated using the dataset acquired from 31 patients for two horizons in-line with the latencies of treatment systems like CyberKnife. Results showed that pLRF-ELM is superior to that of existing prediction methods. Results further highlight that the abstracted higher-level features are suitable to approximate the nonlinear and non-stationary characteristics of respiratory motion for accurate prediction.
International Nuclear Information System (INIS)
Vidoto, Edson Luiz Gea
1995-01-01
The aim of the present work was to optimize the signal to noise ratio in our NMR imaging system (TORM 005) by improving transducer's reception quality through better designed coils, balanced tuning circuit for this coils and power decoupling circuits and by reducing interference from the electromagnetic environment. For this purpose, we had to modify the internal electromagnetic shielding and incorporate line filters in the more critical signals paths. Also, new types of coils were developed, improving the signal to noise ratio, and allowing us to make clinical exams with superior quality for several anatomies. Balanced circuits for tuning and matching of the coil were studied and built, allowing a reduction of the coil losses because patient's load. This produced a more reliable coil tuning after positioning each new patient. Circuits to avoid the receiver input overload and decoupling circuits for the isolation of receiver coils from excitation coil were designed and incorporated to the TORM 005. All these alterations of our imaging system (TORM 005) contributed to a significant improvement in the signal to noise ratio, reliability and reproducibility of the system. This permitted to operate the system routinely for clinical applications, research and development in the area of ultra low magnetic field tomography. (author)
Transgenic Mosquitoes - Fact or Fiction?
Wilke, André B B; Beier, John C; Benelli, Giovanni
2018-06-01
Technologies for controlling mosquito vectors based on genetic manipulation and the release of genetically modified mosquitoes (GMMs) are gaining ground. However, concrete epidemiological evidence of their effectiveness, sustainability, and impact on the environment and nontarget species is lacking; no reliable ecological evidence on the potential interactions among GMMs, target populations, and other mosquito species populations exists; and no GMM technology has yet been approved by the WHO Vector Control Advisory Group. Our opinion is that, although GMMs may be considered a promising control tool, more studies are needed to assess their true effectiveness, risks, and benefits. Overall, several lines of evidence must be provided before GMM-based control strategies can be used under the integrated vector management framework. Copyright © 2018 Elsevier Ltd. All rights reserved.
Ströh, Sebastian; Puller, Christian; Swirski, Sebastian; Hölzel, Maj-Britt; van der Linde, Lea I S; Segelken, Jasmin; Schultz, Konrad; Block, Christoph; Monyer, Hannah; Willecke, Klaus; Weiler, Reto; Greschner, Martin; Janssen-Bienhold, Ulrike; Dedek, Karin
2018-02-21
In the mammalian retina, horizontal cells receive glutamatergic inputs from many rod and cone photoreceptors and return feedback signals to them, thereby changing photoreceptor glutamate release in a light-dependent manner. Horizontal cells also provide feedforward signals to bipolar cells. It is unclear, however, how horizontal cell signals also affect the temporal, spatial, and contrast tuning in retinal output neurons, the ganglion cells. To study this, we generated a genetically modified mouse line in which we eliminated the light dependency of feedback by deleting glutamate receptors from mouse horizontal cells. This genetic modification allowed us to investigate the impact of horizontal cells on ganglion cell signaling independent of the actual mode of feedback in the outer retina and without pharmacological manipulation of signal transmission. In control and genetically modified mice (both sexes), we recorded the light responses of transient OFF-α retinal ganglion cells in the intact retina. Excitatory postsynaptic currents (EPSCs) were reduced and the cells were tuned to lower temporal frequencies and higher contrasts, presumably because photoreceptor output was attenuated. Moreover, receptive fields of recorded cells showed a significantly altered surround structure. Our data thus suggest that horizontal cells are responsible for adjusting the dynamic range of retinal ganglion cells and, together with amacrine cells, contribute to the center/surround organization of ganglion cell receptive fields in the mouse. SIGNIFICANCE STATEMENT Horizontal cells represent a major neuronal class in the mammalian retina and provide lateral feedback and feedforward signals to photoreceptors and bipolar cells, respectively. The mode of signal transmission remains controversial and, moreover, the contribution of horizontal cells to visual processing is still elusive. To address the question of how horizontal cells affect retinal output signals, we recorded the light
Diversity of arthropod community in transgenic poplar-cotton ecosystems.
Zhang, D J; Lu, Z Y; Liu, J X; Li, C L; Yang, M S
2015-12-02
Poplar-cotton agro-ecosystems are the main agricultural planting modes of plain cotton fields in China. Here, we performed a systematic survey of the diversity and population of arthropod communities in four different combination of poplar-cotton eco-systems, including I) non-transgenic poplar and non-transgenic cotton fields; II) non-transgenic poplar and transgenic cotton fields [Bacillus thuringiensis (Bt) cotton]; III) Bt transgenic poplar (high insect resistant strain Pb29) and non-transgenic cotton; and IV) transgenic poplar and transgenic cotton fields, over a period of 3 years. Based on the statistical methods used to investigate community ecology, the effects of transgenic ecosystems on the whole structure of the arthropod community, on the structure of arthropods in the nutritive layer, and on the similarity of arthropod communities were evaluated. The main results were as follows: the transgenic poplar-cotton ecosystem has a stronger inhibitory effect on insect pests and has no impact on the structure of the arthropod community, and therefore, maintains the diversity of the arthropod community. The character index of the community indicated that the structure of the arthropod community of the transgenic poplar-cotton ecosystem was better than that of the poplar-cotton ecosystem, and that system IV had the best structure. As for the abundance of nutritional classes, the transgenic poplar-cotton ecosystem was also better than that of the non-transgenic poplar-cotton ecosystem. The cluster analysis and similarity of arthropod communities between the four different transgenic poplar-cotton ecosystems illustrated that the structure of the arthropod community excelled in the small sample of the transgenic poplar-cotton ecosystems.
Zhou, Dinggang; Wang, Chunfeng; Li, Zhu; Chen, Yun; Gao, Shiwu; Guo, Jinlong; Lu, Wenying; Su, Yachun; Xu, Liping; Que, Youxiong
2016-01-01
Genetic engineering offers an attractive alternative in sugarcane breeding for increasing cane and sugar yields as well as disease and insect resistance. Bar transgenic sugarcane employing the herbicide tolerance is a useful agronomical trait in weed control. In this study, a loop-mediated isothermal amplification (LAMP) assay for rapid detection of the bar gene in transgenic sugarcane has been developed and evaluated. A set of six primers was designed for LAMP-based amplification of the bar gene. The LAMP reaction conditions were optimized as follows: 5.25 mM of Mg(2+), 6:1 ratio of inner vs. outer primer, and 6.0 U of Bst DNA polymerase in a reaction volume of 25.0 μL. The detection limit of the recombinant plasmid 1Ac0229 was as low as 10 copies in the developed LAMP, which was 10-fold higher sensitive than that of conventional PCR. In 100 putative transgenic lines, the bar gene was detected in 100/100 cases (100%) by LAMP and 97/100 cases (97%) by conventional PCR, respectively. In conclusion, the developed LAMP assay is visual, rapid, sensitive, reliable, and cost-effective for detection of the bar specific transgenic sugarcane.
ChR2 transgenic animals in peripheral sensory system: Sensing light as various sensations.
Ji, Zhi-Gang; Wang, Hongxia
2016-04-01
Since the introduction of Channelrhodopsin-2 (ChR2) to neuroscience, optogenetics technology was developed, making it possible to activate specific neurons or circuits with spatial and temporal precision. Various ChR2 transgenic animal models have been generated and are playing important roles in revealing the mechanisms of neural activities, mapping neural circuits, controlling the behaviors of animals as well as exploring new strategy for treating the neurological diseases in both central and peripheral nervous system. An animal including humans senses environments through Aristotle's five senses (sight, hearing, smell, taste and touch). Usually, each sense is associated with a kind of sensory organ (eyes, ears, nose, tongue and skin). Is it possible that one could hear light, smell light, taste light and touch light? When ChR2 is targeted to different peripheral sensory neurons by viral vectors or generating ChR2 transgenic animals, the animals can sense the light as various sensations such as hearing, touch, pain, smell and taste. In this review, we focus on ChR2 transgenic animals in the peripheral nervous system. Firstly the working principle of ChR2 as an optogenetic actuator is simply described. Then the current transgenic animal lines where ChR2 was expressed in peripheral sensory neurons are presented and the findings obtained by these animal models are reviewed. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Pradeep Kumar Papolu
2016-07-01
Full Text Available Root-knot nematodes (RKN cause substantial yield decline in eggplant and sustainable management options to minimize crop damage due to nematodes are still limited. A number of genetic engineering strategies have been developed to disrupt the successful plant-nematode interactions. Among them, delivery of proteinase inhibitors from the plant to perturb nematode development and reproduction is arguably the most effective strategy. In the present study, transgenic eggplant expressing a modified rice cystatin (OC-IΔD86 gene under the control of the root-specific promoter, TUB-1, was generated to evaluate the genetically modified nematode resistance. Five putative transformants were selected through PCR and genomic Southern blot analysis. Expression of the cystatin transgene was confirmed in all the events using western blotting, ELISA and qPCR assay. Upon challenge inoculation, all the transgenic events exhibited a detrimental effect on RKN development and reproduction. The best transgenic line (a single copy event showed 78.3% inhibition in reproductive success of RKN. Our results suggest that cystatins can play an important role for improving nematode resistance in eggplant and their deployment in gene pyramiding strategies with other proteinase inhibitors could ultimately enhance crop yield.
Directory of Open Access Journals (Sweden)
Liu Zhihui
2008-08-01
Full Text Available Abstract Background Interleukin 1 beta (IL-1β plays an important role in a number of chronic and acute inflammatory diseases. To understand the role of IL-1β in disease processes and develop an in vivo screening system for anti-inflammatory drugs, a transgenic mouse line was generated which incorporated the transgene firefly luciferase gene driven by a 4.5-kb fragment of the human IL-1β gene promoter. Luciferase gene expression was monitored in live mice under anesthesia using bioluminescence imaging in a number of inflammatory disease models. Results In a LPS-induced sepsis model, dramatic increase in luciferase activity was observed in the mice. This transgene induction was time dependent and correlated with an increase of endogenous IL-1β mRNA and pro-IL-1β protein levels in the mice. In a zymosan-induced arthritis model and an oxazolone-induced skin hypersensitivity reaction model, luciferase expression was locally induced in the zymosan injected knee joint and in the ear with oxazolone application, respectively. Dexamethasone suppressed the expression of luciferase gene both in the acute sepsis model and in the acute arthritis model. Conclusion Our data suggest that the transgenic mice model could be used to study transcriptional regulation of the IL-1β gene expression in the inflammatory process and evaluation the effect of anti-inflammatory drug in vivo.
Arabidopsis EF-Tu receptor enhances bacterial disease resistance in transgenic wheat.
Schoonbeek, Henk-Jan; Wang, Hsi-Hua; Stefanato, Francesca L; Craze, Melanie; Bowden, Sarah; Wallington, Emma; Zipfel, Cyril; Ridout, Christopher J
2015-04-01
Perception of pathogen (or microbe)-associated molecular patterns (PAMPs/MAMPs) by pattern recognition receptors (PRRs) is a key component of plant innate immunity. The Arabidopsis PRR EF-Tu receptor (EFR) recognizes the bacterial PAMP elongation factor Tu (EF-Tu) and its derived peptide elf18. Previous work revealed that transgenic expression of AtEFR in Solanaceae confers elf18 responsiveness and broad-spectrum bacterial disease resistance. In this study, we developed a set of bioassays to study the activation of PAMP-triggered immunity (PTI) in wheat. We generated transgenic wheat (Triticum aestivum) plants expressing AtEFR driven by the constitutive rice actin promoter and tested their response to elf18. We show that transgenic expression of AtEFR in wheat confers recognition of elf18, as measured by the induction of immune marker genes and callose deposition. When challenged with the cereal bacterial pathogen Pseudomonas syringae pv. oryzae, transgenic EFR wheat lines had reduced lesion size and bacterial multiplication. These results demonstrate that AtEFR can be transferred successfully from dicot to monocot species, further revealing that immune signalling pathways are conserved across these distant phyla. As novel PRRs are identified, their transfer between plant families represents a useful strategy for enhancing resistance to pathogens in crops. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Dinggang eZhou
2016-03-01
Full Text Available Genetic engineering offers an attractive alternative in sugarcane breeding for increasing cane and sugar yields as well as disease and insect resistance. Bar transgenic sugarcane employing the herbicide tolerance is a useful agronomical trait in weed control. In this study, a loop-mediated isothermal amplification (LAMP assay for rapid detection of the bar gene in transgenic sugarcane has been developed and evaluated. A set of six primers was designed for LAMP-based amplification of the bar gene. The LAMP reaction conditions were optimized as follows: 5.25 mM of Mg2+, 6:1 ratio of inner vs outer primer, and 6.0 U of Bst DNA polymerase in a reaction volume of 25.0 μL. The detection limit of the recombinant plasmid 1Ac0229 was as low as 10 copies in the developed LAMP, which was ten-fold higher sensitive than that of conventional PCR. In 100 putative transgenic lines, the bar gene was detected in 100/100 cases (100% by LAMP and 97/100 cases (97% by conventional PCR, respectively. In conclusion, the developed LAMP assay is visual, rapid, sensitive, reliable and cost-effective for detection of the bar specific transgenic sugarcane.
An extensive phenotypic characterization of the hTNFα transgenic mice
Directory of Open Access Journals (Sweden)
Tugusheva Marina
2007-12-01
Full Text Available Abstract Background Tumor necrosis factor alpha (TNFα is implicated in a wide variety of pathological and physiological processes, including chronic inflammatory conditions, coronary artery disease, diabetes, obesity, and cachexia. Transgenic mice expressing human TNFα (hTNFα have previously been described as a model for progressive rheumatoid arthritis. In this report, we describe extensive characterization of an hTNFα transgenic mouse line. Results In addition to arthritis, these hTNFα transgenic mice demonstrated major alterations in body composition, metabolic rate, leptin levels, response to a high-fat diet, bone mineral density and content, impaired fertility and male sexual function. Many phenotypes displayed an earlier onset and a higher degree of severity in males, pointing towards a significant degree of sexual dimorphism in response to deregulated expression of TNFα. Conclusion These results highlight the potential usefulness of this transgenic model as a resource for studying the progressive effects of constitutively expressed low levels of circulating TNFα, a condition mimicking that observed in a number of human pathological conditions.
AβPP/PS1 Transgenic Mice Show Sex Differences in the Cerebellum Associated with Aging.
Ordoñez-Gutierrez, Lara; Fernandez-Perez, Ivan; Herrera, Jose Luis; Anton, Marta; Benito-Cuesta, Irene; Wandosell, Francisco
2016-09-06
Cerebellar pathology has been related to presenilin 1 mutations in certain pedigrees of familial Alzheimer's disease. However, cerebellum tissue has not been intensively analyzed in transgenic models of mutant presenilins. Furthermore, the effect of the sex of the mice was not systematically analyzed, despite the fact that important gender differences in the evolution of the disease in the human population have been described. We analyzed whether the progression of amyloidosis in a double transgenic mouse, AβPP/PS1, is susceptible to aging and differentially affects males and females. The accumulation of amyloid in the cerebellum differentially affects males and females of the AβPP/PS1 transgenic line, which was found to be ten-fold higher in 15-month-old females. Amyloid-β accumulation was more evident in the molecular layer of the cerebellum, but glia reaction was only observed in the granular layer of the older mice. The sex divergence was also observed in other neuronal, survival, and autophagic markers. The cerebellum plays an important role in the evolution of the pathology in this transgenic mouse model. Sex differences could be crucial for a complete understanding of this disease. We propose that the human population could be studied in this way. Sex-specific treatment strategies in human populations could show a differential response to the therapeutic approach.
Genomic localization of the Z/EG transgene in the mouse genome.
Colombo, Sophie; Kumasaka, Mayuko; Lobe, Corrinne; Larue, Lionel
2010-02-01
The Z/EG transgenic mouse line, produced by Novak et al., displays tissue-specific EGFP expression after Cre-mediated recombination. The autofluorescence of EGFP allows the visualization of cells of interest displaying Cre recombination. The initial construct was designed such that cells without Cre recombination express the beta-galactosidase marker, facilitating counterselection. We used inverse PCR to identify the site of integration of the Z/EG transgene, to improve the efficiency of homozygous Z/EG mouse production. Recombined cells produced large amounts of EGFP protein, resulting in higher levels of fluorescence and therefore greater contrast with nonrecombined cells. We mapped the transgene to the G1 region of chromosome 5. This random insertion was found to have occurred 230-bp upstream from the start codon of the Rasa4 gene. The insertion of the Z/EG transgene in the C57BL/6 genetic background had no effect on Rasa4 expression. Homozygous Z/EG mice therefore had no obvious phenotype. (c) 2009 Wiley-Liss, Inc.
Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.
Rao, Suryadevara S; Hildebrand, David
2009-10-01
The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.
Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan
2009-09-23
Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.
Sunitha, Mellacheruvu; Srinath, Tamirisa; Reddy, Vudem Dashavantha; Rao, Khareedu Venkateswara
2017-06-01
Transgenic rice expressing pigeonpea Cc CDR conferred high-level tolerance to different abiotic stresses. The multiple stress tolerance observed in CcCDR -transgenic lines is attributed to the modulation of ABA-dependent and-independent signalling-pathway genes. Stable transgenic plants expressing Cajanus cajan cold and drought regulatory protein encoding gene (CcCDR), under the control of CaMV35S and rd29A promoters, have been generated in indica rice. Different transgenic lines of CcCDR, when subjected to drought, salt, and cold stresses, exhibited higher seed germination, seedling survival rates, shoot length, root length, and enhanced plant biomass when compared with the untransformed control plants. Furthermore, transgenic plants disclosed higher leaf chlorophyll content, proline, reducing sugars, SOD, and catalase activities, besides lower levels of MDA. Localization studies revealed that the CcCDR-GFP fusion protein was mainly present in the nucleus of transformed cells of rice. The CcCDR transgenics were found hypersensitive to abscisic acid (ABA) and showed reduced seed germination rates as compared to that of control plants. When the transgenic plants were exposed to drought and salt stresses at vegetative and reproductive stages, they revealed larger panicles and higher number of filled grains compared to the untransformed control plants. Under similar stress conditions, the expression levels of P5CS, bZIP, DREB, OsLEA3, and CIPK genes, involved in ABA-dependent and-independent signal transduction pathways, were found higher in the transgenic plants than the control plants. The overall results amply demonstrate that the transgenic rice expressing CcCDR bestows high-level tolerance to drought, salt, and cold stress conditions. Accordingly, the CcCDR might be deployed as a promising candidate gene for improving the multiple stress tolerance of diverse crop plants.
Gibson, Todd A.; Oller, D. Kimbrough; Jarmulowicz, Linda; Ethington, Corinna A.
2012-01-01
Adults and children learning a second language show difficulty accessing expressive vocabulary that appears accessible receptively in their first language (L1). We call this discrepancy the receptive-expressive gap. Kindergarten Spanish (L1)-English (L2) sequential bilinguals were given standardized tests of receptive and expressive vocabulary in…
Aberrant phenotypes of transgenic mice expressing dimeric human erythropoietin
Directory of Open Access Journals (Sweden)
Yun Seong-Jo
2012-01-01
Full Text Available Abstract Background Dimeric human erythropoietin (dHuEPO peptides are reported to exhibit significantly higher biological activity than the monomeric form of recombinant EPO. The objective of this study was to produce transgenic (tg mice expressing dHuEPO and to investigate the characteristics of these mice. Methods A dHuEPO-expressing vector under the control of the goat beta-casein promoter, which produced a dimer of human EPO molecules linked by a 2-amino acid peptide linker (Asp-Ile, was constructed and injected into 1-cell fertilized embryos by microinjection. Mice were screened using genomic DNA samples obtained from tail biopsies. Blood samples were obtained by heart puncture using heparinized tubes, and hematologic parameters were assessed. Using the microarray analysis tool, we analyzed differences in gene expression in the spleens of tg and control mice. Results A high rate of spontaneous abortion or death of the offspring was observed in the recipients of dHuEPO embryos. We obtained 3 founder lines (#4, #11, and #47 of tg mice expressing the dHuEPO gene. However, only one founder line showed stable germline integration and transmission, subsequently establishing the only transgenic line (#11. We obtained 2 F1 mice and 3 F2 mice from line #11. The dHuEPO protein could not be obtained because of repeated spontaneous abortions in the tg mice. Tg mice exhibited symptoms such as short lifespan and abnormal blood composition. The red blood cell count, white blood cell count, and hematocrit levels in the tg mice were remarkably higher than those in the control mice. The spleens of the tg mice (F1 and F2 females were 11- and -21-fold larger than those of the control mice. Microarray analysis revealed 2,672 spleen-derived candidate genes; more genes were downregulated than upregulated (849/764. Reverse transcriptase-polymerase chain reaction (RT-PCR and quantitative real-time PCR (qRT-PCR were used for validating the results of the microarray
Reception receiving new materials on a basis monotechtical alloys by methods of thermal processing
International Nuclear Information System (INIS)
Aubakirova, R.K.; Zhumakanova, V.R.; Kudasova, D.K.
2005-01-01
also on an arrangement of a line liquidus on the concrete diagram of a status, i.e. generally mode of heat treatment essentially influences display of fast diffusion grooves. Thus, the received data allow speaking that, varying modes of meltdowns heat treatment of the specified systems, the reception of alloys with new morphology structures is possible, and, means, and the properties, i.e. give an opportunity of management of process of reception materials with new, given set of properties. There is an opportunity to manage the process of receiving materials with new given set of properties
Efficiency of an automated reception and turnaround time management system for the phlebotomy room.
Yun, Soon Gyu; Shin, Jeong Won; Park, Eun Su; Bang, Hae In; Kang, Jung Gu
2016-01-01
Recent advances in laboratory information systems have largely been focused on automation. However, the phlebotomy services have not been completely automated. To address this issue, we introduced an automated reception and turnaround time (TAT) management system, for the first time in Korea, whereby the patient's information is transmitted directly to the actual phlebotomy site and the TAT for each phlebotomy step can be monitored at a glance. The GNT5 system (Energium Co., Ltd., Korea) was installed in June 2013. The automated reception and TAT management system has been in operation since February 2014. Integration of the automated reception machine with the GNT5 allowed for direct transmission of laboratory order information to the GNT5 without involving any manual reception step. We used the mean TAT from reception to actual phlebotomy as the parameter for evaluating the efficiency of our system. Mean TAT decreased from 5:45 min to 2:42 min after operationalization of the system. The mean number of patients in queue decreased from 2.9 to 1.0. Further, the number of cases taking more than five minutes from reception to phlebotomy, defined as the defect rate, decreased from 20.1% to 9.7%. The use of automated reception and TAT management system was associated with a decrease of overall TAT and an improved workflow at the phlebotomy room.
McDaniel, Jena; Yoder, Paul; Woynaroski, Tiffany; Watson, Linda R
2018-05-15
Correlates of receptive-expressive vocabulary size discrepancies may provide insights into why language development in children with autism spectrum disorder (ASD) deviates from typical language development and ultimately improve intervention outcomes. We indexed receptive-expressive vocabulary size discrepancies of 65 initially preverbal children with ASD (20-48 months) to a comparison sample from the MacArthur-Bates Communicative Development Inventories Wordbank (Frank, Braginsky, Yurovsky, & Marchman, 2017) to quantify typicality. We then tested whether attention toward a speaker and oral motor performance predict typicality of the discrepancy 8 months later. Attention toward a speaker correlated positively with receptive-expressive vocabulary size discrepancy typicality. Imitative and nonimitative oral motor performance were not significant predictors of vocabulary size discrepancy typicality. Secondary analyses indicated that midpoint receptive vocabulary size mediated the association between initial attention toward a speaker and end point receptive-expressive vocabulary size discrepancy typicality. Findings support the hypothesis that variation in attention toward a speaker might partially explain receptive-expressive vocabulary size discrepancy magnitude in children with ASD. Results are consistent with an input-processing deficit explanation of language impairment in this clinical population. Future studies should test whether attention toward a speaker is malleable and causally related to receptive-expressive discrepancies in children with ASD.
Liu, Peng; Reichl, John H.; Rao, Eshaan R.; McNellis, Brittany M.; Huang, Eric S.; Hemmy, Laura S.; Forster, Colleen L.; Kuskowski, Michael A.; Borchelt, David R.; Vassar, Robert; Ashe, Karen H.; Zahs, Kathleen R.
2016-01-01
There exist several dozen lines of transgenic mice that express human amyloid-β precursor protein (AβPP) with Alzheimer’s disease (AD)-linked mutations. AβPP transgenic mouse lines differ in the types and amounts of Aβ that they generate and in their spatiotemporal patterns of expression of Aβ assemblies, providing a toolkit to study Aβ amyloidosis and the influence of Aβ aggregation on brain function. More complete quantitative descriptions of the types of Aβ assemblies present in transgenic mice and in humans during disease progression should add to our understanding of how Aβ toxicity in mice relates to the pathogenesis of AD. Here, we provide a direct quantitative comparison of amyloid plaque burdens and plaque sizes in four lines of AβPP transgenic mice. We measured the fraction of cortex and hippocampus occupied by dense-core plaques, visualized by staining with Thioflavin S, in mice from young adulthood through advanced age. We found that the plaque burdens among the transgenic lines varied by an order of magnitude: at 15 months of age, the oldest age studied, the median cortical plaque burden in 5XFAD mice was already ~4.5 times that of 21-month Tg2576 mice and ~15 times that of 21–24-month rTg9191 mice. Plaque-size distributions changed across the lifespan in a line- and region-dependent manner. We also compared the dense-core plaque burdens in the mice to those measured in a set of pathologically-confirmed AD cases from the Nun Study. Cortical plaque burdens in Tg2576, APPSwePS1ΔE9, and 5XFAD mice eventually far exceeded those measured in the human cohort. PMID:28059792
Liu, Peng; Reichl, John H; Rao, Eshaan R; McNellis, Brittany M; Huang, Eric S; Hemmy, Laura S; Forster, Colleen L; Kuskowski, Michael A; Borchelt, David R; Vassar, Robert; Ashe, Karen H; Zahs, Kathleen R
2017-01-01
There exist several dozen lines of transgenic mice that express human amyloid-β protein precursor (AβPP) with Alzheimer's disease (AD)-linked mutations. AβPP transgenic mouse lines differ in the types and amounts of Aβ that they generate and in their spatiotemporal patterns of expression of Aβ assemblies, providing a toolkit to study Aβ amyloidosis and the influence of Aβ aggregation on brain function. More complete quantitative descriptions of the types of Aβ assemblies present in transgenic mice and in humans during disease progression should add to our understanding of how Aβ toxicity in mice relates to the pathogenesis of AD. Here, we provide a direct quantitative comparison of amyloid plaque burdens and plaque sizes in four lines of AβPP transgenic mice. We measured the fraction of cortex and hippocampus occupied by dense-core plaques, visualized by staining with Thioflavin S, in mice from young adulthood through advanced age. We found that the plaque burdens among the transgenic lines varied by an order of magnitude: at 15 months of age, the oldest age studied, the median cortical plaque burden in 5XFAD mice was already ∼4.5 times that of 21-month-old Tg2576 mice and ∼15 times that of 21-24-month-old rTg9191 mice. Plaque-size distributions changed across the lifespan in a line- and region-dependent manner. We also compared the dense-core plaque burdens in the mice to those measured in a set of pathologically-confirmed AD cases from the Nun Study. Cortical plaque burdens in Tg2576, APPSwePS1ΔE9, and 5XFAD mice eventually far exceeded those measured in the human cohort.
Receptivity of Hypersonic Boundary Layers to Distributed Roughness and Acoustic Disturbances
Balakumar, P.
2013-01-01
Boundary-layer receptivity and stability of Mach 6 flows over smooth and rough seven-degree half-angle sharp-tipped cones are numerically investigated. The receptivity of the boundary layer to slow acoustic disturbances, fast acoustic disturbances, and vortical disturbances is considered. The effects of three-dimensional isolated roughness on the receptivity and stability are also simulated. The results for the smooth cone show that the instability waves are generated in the leading edge region and that the boundary layer is much more receptive to slow acoustic waves than to the fast acoustic waves. Vortical disturbances also generate unstable second modes, however the receptivity coefficients are smaller than that of the slow acoustic wave. Distributed roughness elements located near the nose region decreased the receptivity of the second mode generated by the slow acoustic wave by a small amount. Roughness elements distributed across the continuous spectrum increased the receptivity of the second mode generated by the slow and fast acoustic waves and the vorticity wave. The largest increase occurred for the vorticity wave. Roughness elements distributed across the synchronization point did not change the receptivity of the second modes generated by the acoustic waves. The receptivity of the second mode generated by the vorticity wave increased in this case, but the increase is lower than that occurred with the roughness elements located across the continuous spectrum. The simulations with an isolated roughness element showed that the second mode waves generated by the acoustic disturbances are not influenced by the small roughness element. Due to the interaction, a three-dimensional wave is generated. However, the amplitude is orders of magnitude smaller than the two-dimensional wave.
Isogenic transgenic homozygous fish induced by artificial parthenogenesis.
Nam, Y K; Cho, Y S; Kim, D S
2000-12-01
As a model system for vertebrate transgenesis, fish have many attractive advantages, especially with respect to the characteristics of eggs, allowing us to produce isogenic, transgenic, homozygous vertebrates by combining with chromosome-set manipulation. Here, we describe the large-scale production of isogenic transgenic homozygous animals using our experimental organism, the mud loach Misgurnus mizolepis, by the simple process of artificial parthenogenesis in a single generation. These isogenic fish have retained transgenic homozygous status in a stable manner during the subsequent 5 years, and exhibited increased levels of transgene expression. Furthermore, their isogenic nature was confirmed by cloned transgenic homozygous offspring produced via another step of parthenogenic reproduction of the isogenic homozygous transgenic fish. These results demonstrate that a combination of transgenesis and artificial parthenogenesis will make the rapid utilization of genetically pure homozygous transgenic system in vertebrate transgenesis possible.
Reception pattern influence on magnetoacoustic tomography with magnetic induction
International Nuclear Information System (INIS)
Sun Xiao-Dong; Wang Xin; Zhou Yu-Qi; Ma Qing-Yu; Zhang Dong
2015-01-01
Based on the acoustic radiation theory of a dipole source, the influence of the transducer reception pattern is studied for magnetoacoustic tomography with magnetic induction (MAT-MI). Numerical studies are conducted to simulate acoustic pressures, waveforms, and reconstructed images with unidirectional, omnidirectional, and strong directional transducers. With the analyses of equivalent and projection sources, the influences of the model dimension and the layer effect are qualitatively analyzed to evaluate the performance of MAT-MI. Three-dimensional simulation studies show that the strong directional transducer with a large radius can reduce the influences of equivalent sources, projection sources, and the layer effect effectively, resulting in enhanced pressure and improved image contrast, which is beneficial for boundary pressure extraction in conductivity reconstruction. The reconstructed conductivity contrast images present the conductivity boundaries as stripes with different contrasts and polarities, representing the values and directions of the conductivity changes of the scanned layer. The favorable results provide solid evidence for transducer selection and suggest potential practical applications of MAT-MI in biomedical imaging. (paper)
a Review of Reception Studies in Iranian Universities
Directory of Open Access Journals (Sweden)
Abbas V. Kazemi
2015-06-01
Full Text Available In this article, we studied student dissertations in cultural studies departments and articles of two important journals (Iranian Journal of Cultural Research and Quarterly Journal of Iranian Association for Cultural Studies & Communication. Our main questions are how the condition of reception possibility is assumed in Iranian cultural studies? How we can classify our audiences? In particular, how and who is the audience in Iran? This analysis shows that most of the Iranian cultural studies oriented to urban middle class of Tehran, instead of lower middle class or labor class. The result demonstrates that, most of scholars consider audience as an active subject that resists against text massages. Hence, they overlook the role of ideology and power in construction of subject and audience. As if, a type of optimistic cultural studies was adapted in an authoritarian political context. This approach on resistance is called resistance ideology by the authors; a situation in which we believe resistance is a sort of relieving and appeasing drug for critical cultural scholars.
Impaired receptivity and decidualization in DHEA-induced PCOS mice.
Li, Shu-Yun; Song, Zhuo; Song, Min-Jie; Qin, Jia-Wen; Zhao, Meng-Long; Yang, Zeng-Ming
2016-12-07
Polycystic ovary syndrome (PCOS), a complex endocrine disorder, is a leading cause of female infertility. An obvious reason for infertility in PCOS women is anovulation. However, success rate with high quality embryos selected by assisted reproduction techniques in PCOS patients still remain low with a high rate of early clinical pregnancy loss, suggesting a problem in uterine receptivity. Using a dehydroepiandrosterone-induced mouse model of PCOS, some potential causes of decreased fertility in PCOS patients were explored. In our study, ovulation problem also causes sterility in PCOS mice. After blastocysts from normal mice are transferred into uterine lumen of pseudopregnant PCOS mice, the rate of embryo implantation was reduced. In PCOS mouse uteri, the implantation-related genes are also dysregulated. Additionally, artificial decidualization is severely impaired in PCOS mice. The serum estrogen level is significantly higher in PCOS mice than vehicle control. The high level of estrogen and potentially impaired LIF-STAT3 pathway may lead to embryo implantation failure in PCOS mice. Although there are many studies about effects of PCOS on endometrium, both embryo transfer and artificial decidualization are applied to exclude the effects from ovulation and embryos in our study.
Generation and reception of spread-spectrum signals
Moser, R.
1983-05-01
The term 'spread-spectrum' implies a technique whereby digitized information is added to a pseudo-random number sequence and the resultant bit stream changes some parameter of the carrier frequency in discrete increments. The discrete modulation of the carrier frequency is usually realized either as a multiple level phase shift keyed or frequency shift keyed signal. The resultant PSK-modulated frequency spectrum is referred to as direct sequence spread-spectrum, whereas the FSK-modulated carrier frequency is referred to as a frequency hopped spread spectrum. These can be considered the major subsets of the more general term 'spread-spectrum'. In discussing signal reception, it is pointed out that active correlation methods are used for channel synchronization when the psuedo random sequences are long or when the processing gain is large, whereas the passive methods may be used for either short pseudo-random noise generation codes or to assist in attaining initial synchronization in long sequence spread-spectrum systems.
Fortissimus robore: Martin Krpan as a case of biblical reception
Directory of Open Access Journals (Sweden)
David Movrin
2009-12-01
Full Text Available Martin Krpan z Vrha, written by Fran Levstik as a conscious experiment in prose-writing, has been interpreted variously during the last century and a half. The duel between a Slovenian peasant and a giant who comes to terrorise Vienna was in turn read by scholars as a political satire, the realisation of a literary and linguistic programme, a literary parody etc. Its motif was mostly interpreted with reference to Slavic folklore characters (Pegam and Lambergar, Prince Marko,peter Klepec etc.. The analysis according to the model devised by Vladimir Propp, however, shows striking similarities with Biblical story of David and Goliath (1 Sm 17. The reception of this motif is marked by significant political overtones, already present in antiquity and then interest ingly developed in places as diverse as sixteenth-century Florence, Prague, and the Netherlands. As attested by the sources, Levstik used this motif several limes; to a certain extent he even identi fied with its hero.
Disinhibition outside receptive fields in the visual cortex.
Walker, Gary A; Ohzawa, Izumi; Freeman, Ralph D
2002-07-01
By definition, the region outside the classical receptive field (CRF) of a neuron in the visual cortex does not directly activate the cell. However, the response of a neuron can be influenced by stimulation of the surrounding area. In previous work, we showed that this influence is mainly suppressive and that it is generally limited to a local region outside the CRF. In the experiments reported here, we investigate the mechanisms of the suppressive effect. Our approach is to find the position of a grating patch that is most effective in suppressing the response of a cell. We then use a masking stimulus at different contrasts over the grating patch in an attempt to disinhibit the response. We find that suppressive effects may be partially or completely reversed by use of the masking stimulus. This disinhibition suggests that effects from outside the CRF may be local. Although they do not necessarily underlie the perceptual analysis of a figure-ground visual scene, they may provide a substrate for this process.
The Foucault-Habermas Debate: the Reflexive and Receptive Aspects of Critique
DEFF Research Database (Denmark)
Hansen, Ejvind
2005-01-01
In this paper I discuss the relationship between two different approaches to critical theory – the reflective and the receptive approaches. I show how it can be fruitful to discuss the relationship between Habermas and Foucault through this distinction. My point is that whereas Habermas focusses...... on critique as a reflexive activity, Foucault mainly focusses on the receptive conditions for critique to be possible. I argue further that Foucault focusses on the receptive aspects of critique, the quest for universality is not as pressing as it is in Habermas’ approach, because problematizing critique can...
Chen, Yang; Tian, Jun-Ce; Shen, Zhi-Chen; Peng, Yu-Fa; Hu, Cui; Guo, Yu-Yuan; Ye, Gong-Yin
2010-08-01
Six transgenic rice, Oryza sativa L., lines (G6H1, G6H2, G6H3, G6H4, G6H5, and G6H6) expressing a fused Cry1Ab/Vip3H protein, were evaluated for resistance against the Asiatic rice borer, Chilo suppressalis (Walker) (Lepidoptera: Crambidae), and the stem borer Sesamia inferens (Walker) (Lepidoptera: Noctuidae) in the laboratory and field. The bioassay results indicated that the mortality of Asiatic rice borer and S. inferens neonate larvae on six transgenic lines from seedling to filling stage was up to 100% at 168 h after infestation. The cumulative feeding area by Asiatic rice borer neonate larvae on all transgenic lines was significantly reduced compared with the untransformed parental 'Xiushui 110' rice. A 2-yr field evaluation showed that damage during the vegetative stage (deadheart) or during the reproductive stage (whitehead) caused by Asiatic rice borer and S. inferens for transgenic lines was much lower than the control. For three lines (G6H1, G6H2, and G6H6), no damage was found during the entire growing period. Estimation of fused Cry1Ab/Vip3H protein concentrations using PathoScreen kit for Bt-Cry1Ab/1Ac protein indicated that the expression levels of Cry1Ab protein both in main stems (within the average range of 0.006-0.073% of total soluble protein) and their flag leaves (within the average range of 0.001-0.038% of total soluble protein) were significantly different among six transgenic lines at different developmental stages. Both laboratory and field researches suggested that the transgenic rice lines have considerable potential for protecting rice from attack by both stem borers.
Directory of Open Access Journals (Sweden)
Jędrzej Pawlicki
2012-01-01
Full Text Available This article describes Yasmina Khadra’s autobiographical work composed of two books: "L’écrivain" and "L’imposture des mots" and its reception in France. The main purpose of this study was to establish the literary genre of these books, which implies determining whether Khandra’s work represents an autobiography or an autofiction with reference to P. Lejeune’s and V. Colonna’s theoretical studies. The dividing line between two genres in Khandra’s works refl ects his inner split between being either a solder or a writer. The presentation will also help to understand the controversy resulting from Khandra’s participation in Algerian civil war. Moreover the analysis is related to modern Algerian history.