WorldWideScience

Sample records for transgenic bt cotton

  1. Biosafety assessment of transgenic Bt cotton on model animals

    Directory of Open Access Journals (Sweden)

    Sadia Bano

    2016-05-01

    Full Text Available Abstract Background: To know the effects of transgenic crops on soil microorganisms, animals and other expected hazards due to the introduction of GM crops into the environment is critical both scientifically and environmentally. The work was conducted to study the effect of insecticidal Bt protein on Rats and Earthworms. Methods: For this purpose, animals like rat and soil organisms like Earthworm were selected. Rats were selected on the basis of its 95% homology on genomic, cellular and enzymatic level with human while earthworm were preferred on the basis of their direct contact with soil to evaluate the impact of Bt (Cry1AC crop field soil on earthworm, secreted by root exudates of Bt cotton. Several physical, molecular, biochemical and histological analyses were performed on both Rats/Earthworms fed on standard diet (control group as well containing Bt protein (experimental group. Results: Molecular analyses such as immune Dot blot, SDS-PAGE, ELISA and PCR, confirmed the absence of Cry1Ac protein in blood and urine samples of rats, which were fed with Bt protein in their diet. Furthermore, histological studies showed that there was no difference in cellular architecture in liver, heart, kidney and intestine of Bt and non-Bt diet fed rats. To see the effect of Bt on earthworm two different groups were studied, one with transgenic plant field soil supplemented with grinded leaves of cotton and second group with non-Bt field soil. Conclusions: No lethal effects of transgenic Bt protein on the survival of earthworm and rats were observed. Bradford assay, Dipstick assay ELISA demonstrated the absence of Cry1Ac protein in the mid-gut epithelial tissue of earthworm. The results of present study will be helpful in successful deployment and commercial release of genetically modified crop in Pakistan.

  2. Effects of Elevated Carbon Dioxide on the Growth and Foliar Chemistry of Transgenic Bt Cotton

    Institute of Scientific and Technical Information of China (English)

    Gang Wu; Fa-Jun Chen; Feng Ge; Yu-Cheng Sun

    2007-01-01

    A field study was carried out to quantify plant growth and the foliar chemistry of transgenic Bacillus thuringiensis (Bt)cotton (cv. GK-12) exposed to ambient CO2 and elevated (double-ambient) CO2 for different lengths of time (1, 2 and 3 months) in 2004 and 2005. The results indicated that CO2 levels significantly affected plant height, leaf area per plant and leaf chemistry of transgenic Bt cotton. Significantly, higher plant height and leaf area per plant were observed after cotton plants that were grown in elevated CO2 were compared with plants grown in ambient CO2 for 1, 2 and 3 months in the investigation. Simultaneously, significant interaction between CO2 level x investigating year was observed in leaf area per plant. Moreover, foliar total amino acids were increased by 14%, 13%, 11% and 12%, 14%, 10% in transgenic Bt cotton after exposed to elevated CO2 for 1, 2 or 3 months compared with ambient CO2 in 2004 and 2005, respectively. Condensed tannin occurrence increased by 17%, 11%, 9% in 2004 and 12%, 11%, 9% in 2005 in transgenic Bt cotton after being exposed to elevated CO2 for 1, 2 or 3 months compared with ambient CO2 for the same time. However, Bt toxin decreased by 3.0%,2.9%, 3.1% and 2.4%, 2.5%, 2.9% in transgenic Bt cotton after exposed to elevated CO2 for 1, 2 or 3months compared with ambient CO2 for same time in 2004 and 2005, respectively. Furthermore, there was prominent interaction on the foliar total amino acids between the CO2 level and the time of cotton plant being exposed to elevated CO2. It is presumed that elevated CO2 can alter the plant growth and hence ultimately the phenotype allocation to foliar chemistical components of transgenic Bt cotton, which may in turn, affect the plant-herbivore interactions.

  3. Competitive release and outbreaks of non-target pests associated with transgenic Bt cotton.

    Science.gov (United States)

    Zeilinger, Adam R; Olson, Dawn M; Andow, David A

    2016-06-01

    The adoption of transgenic Bt cotton has, in some cases, led to environmental and economic benefits through reduced insecticide use. However, the distribution of these benefits and associated risks among cotton growers and cotton-growing regions has been uneven due in part to outbreaks of non-target or secondary pests, thereby requiring the continued use of synthetic insecticides. In the southeastern USA, Bt cotton adoption has resulted in increased abundance of and damage from stink bug pests, Euschistus servus and Nezara viridula (Heteroptera: Pentatomidae). While the impact of increased stink bug abundance has been well-documented, the causes have remained unclear. We hypothesize that release from competition with Bt-susceptible target pests may drive stink bug outbreaks in Bt cotton. We first examined the evidence for competitive release of stink bugs through meta-analysis of previous studies. We then experimentally tested if herbivory by Bt-susceptible Helicoverpa zea increases stink bug leaving rates and deters oviposition on non-Bt cotton. Consistent with previous studies, we found differences in leaving rates only for E servus, but we found that both species strongly avoided ovipositing on H. zea-damaged plants. Considering all available evidence, competitive release of stink bug populations in Bt cotton likely contributes to outbreaks, though the relative importance of competitive release remains an open question. Ecological risk assessments of Bt crops and other transgenic insecticidal crops would benefit from greater understanding of the ecological mechanisms underlying non-target pest outbreaks and greater attention to indirect ecological effects more broadly.

  4. [Effects of transgenic Bt + CpTI cotton on rhizosphere bacteria and ammonia oxidizing bacteria population].

    Science.gov (United States)

    Dong, Lianhua; Meng, Ying; Wang, Jing

    2014-03-04

    The effect of transgenic cotton on the rhizosphere bacteria can be important to the risk assessment for the genetically modified crops. We studied the rhizosphere microbial community with cultivating genetically modified cotton. The effects of transgenic Bt + CpTI Cotton (SGK321) and its receptor cotton (SY321) on rhizosphere total bacteria and ammonia oxidizing bacteria population size were studied by using droplet digital PCR. We collected rhizosphere soil before cotton planting and along with the cotton growth stage (squaring stage, flowering stage, belling stage and boll opening stage). There was no significant change on the total bacterial population between the transgenic cotton and the receptor cotton along with the growth stage. However, the abundance of ammonia oxidizing bacteria (AOB) in both type of cottons showed significant difference between different growth stages, and the variation tendency was different. In squaring stage, the numbers of AOB in rhizosphere of SY321 and SGK321 increased 4 and 2 times, respectively. In flowering stage, AOB number in rhizosphere of SY321 significantly decreased to be 5.96 x 10(5) copies/g dry soil, however, that of SGK321 increased to be 1.25 x 10(6) copies/g dry soil. In belling stage, AOB number of SY321 greatly increased to be 1.49 x 10(6) copies/g dry soil, but no significant change was observed for AOB number of SGK321. In boll opening stage, both AOB number of SY321 and SGK321 clearly decreased and they were significantly different from each other. Compared to the non-genetically modified cotton, the change in abundance of ammonia oxidizing bacteria was slightly smooth in the transgenic cotton. Not only the cotton growth stage but also the cotton type caused this difference. The transgenic cotton can slow down the speed of ammonia transformation through impacting the number of AOB, which is advantageous for plant growth.

  5. Effects of Soil Salinity on the Expression of Bt Toxin (Cry1Ac and the Control Efficiency of Helicoverpa armigera in Field-Grown Transgenic Bt Cotton.

    Directory of Open Access Journals (Sweden)

    Jun-Yu Luo

    Full Text Available An increasing area of transgenic Bacillus thuringiensis (Bt cotton is being planted in saline-alkaline soil in China. The Bt protein level in transgenic cotton plants and its control efficiency can be affected by abiotic stress, including high temperature, water deficiency and other factors. However, how soil salinity affects the expression of Bt protein, thus influencing the control efficiency of Bt cotton against the cotton bollworm (CBW Helicoverpa armigera (Hübner in the field, is poorly understood. Our objective in the present study was to investigate the effects of soil salinity on the expression of Bt toxin (Cry1Ac and the control efficiency of Helicoverpa armigera in field-grown transgenic Bt cotton using three natural saline levels (1.15 dS m-1 [low soil-salinity], 6.00 dS m-1 [medium soil-salinity] and 11.46 dS m-1 [high soil-salinity]. We found that the Bt protein content in the transgenic Bt cotton leaves and the insecticidal activity of Bt cotton against CBW decreased with the increasing soil salinity in laboratory experiments during the growing season. The Bt protein content of Bt cotton leaves in the laboratory were negatively correlated with the salinity level. The CBW populations were highest on the Bt cotton grown in medium-salinity soil instead of the high-salinity soil in field conditions. A possible mechanism may be that the relatively high-salinity soil changed the plant nutritional quality or other plant defensive traits. The results from this study may help to identify more appropriate practices to control CBW in Bt cotton fields with different soil salinity levels.

  6. The effects of Fe2O3 nanoparticles on physiology and insecticide activity in non-transgenic and Bt-transgenic cotton

    Directory of Open Access Journals (Sweden)

    Nhan eLe Van

    2016-01-01

    Full Text Available As the demands for nanotechnology and nanoparticle (NP applications in agriculture increase, the ecological risk has drawn more attention because of the unpredictable results of interactions between NPs and transgenic crops. In this study, we investigated the effects of various concentrations of Fe2O3 NPs on Bt-transgenic cotton in comparison with conventional cotton for 10 days. Each treatment was conducted in triplicate, and each experiment was repeated three times. Results demonstrated that Fe2O3 nanoparticles (NPs inhibited the plant height and root length of Bt-transgenic cotton and promoted root hairs and biomass of non-transgenic cotton. Nutrients such as Na and K in Bt-transgenic cotton roots increased, while Zn contents decreased with Fe2O3 NPs. Most hormones in the roots of Bt-transgenic cotton increased at low Fe2O3 NP exposure (100 mg·L−1 but decreased at high concentrations of Fe2O3 NPs (1000 mg·L−1. Fe2O3 NPs increased the Bt-toxin in leaves and roots of Bt-transgenic cotton. Fe2O3 NPs were absorbed into roots, then transported to the shoots of both Bt-transgenic and non-transgenic cottons. The bioaccumulation of Fe2O3 NPs in plants might be a potential risk for agricultural crops and affect the environment and human health.

  7. Soil microflora and enzyme activities in rhizosphere of Transgenic Bt cotton hybrid under different intercropping systems and plant protection schedules

    Science.gov (United States)

    Biradar, D. P.; Alagawadi, A. R.; Basavanneppa, M. A.; Udikeri, S. S.

    2012-04-01

    Field experiments were conducted over three rainy seasons of 2005-06 to 2007-08 on a Vertisol at Dharwad, Karnataka, India to study the effect of intercropping and plant protection schedules on productivity, soil microflora and enzyme activities in the rhizosphere of transgenic Bt cotton hybrid. The experiment consisted of four intercropping systems namely, Bt cotton + okra, Bt cotton + chilli, Bt cotton + onion + chilli and Bt cotton + redgram with four plant protection schedules (zero protection, protection for Bt cotton, protection for intercrop and protection for both crops). Observations on microbial populations and enzyme activities were recorded at 45, 90, 135 and 185 (at harvest) days after sowing (DAS). Averaged over years, Bt cotton + okra intercropping had significantly higher total productivity than Bt cotton + chilli and Bt cotton + redgram intercropping system and was similar to Bt cotton + chilli + onion intercropping system. With respect to plant protection schedules for bollworms, protection for both cotton and intercrops recorded significantly higher yield than the rest of the treatments. Population of total bacteria, fungi, actinomycetes, P-solubilizers, free-living N2 fixers as well as urease, phosphatase and dehydrogenase enzyme activities increased up to 135 days of crop growth followed by a decline. Among the intercropping systems, Bt cotton + chilli recorded significantly higher population of microorganisms and enzyme activities than other cropping systems. While Bt cotton with okra as intercrop recorded the least population of total bacteria and free-living N2 fixers as well as urease activity. Intercropping with redgram resulted in the least population of actinomycetes, fungi and P-solubilizers, whereas Bt cotton with chilli and onion recorded least activities of dehydrogenase and phosphatase. Among the plant protection schedules, zero protection recorded maximum population of microorganisms and enzyme activities. This was followed by the

  8. Identification of top-down forces regulating cotton aphid population growth in transgenic Bt cotton in central China.

    Directory of Open Access Journals (Sweden)

    Peng Han

    Full Text Available The cotton aphid Aphis gossypii Glover is the main aphid pest in cotton fields in the Yangtze River Valley Cotton-planting Zone (YRZ in central China. Various natural enemies may attack the cotton aphid in Bt cotton fields but no studies have identified potential specific top-down forces that could help manage this pest in the YRZ in China. In order to identify possibilities for managing the cotton aphid, we monitored cotton aphid population dynamics and identified the effect of natural enemies on cotton aphid population growth using various exclusion cages in transgenic Cry1Ac (Bt+CpTI (Cowpea trypsin inhibitor cotton field in 2011. The aphid population growth in the open field (control was significantly lower than those protected or restricted from exposure to natural enemies in the various exclusion cage types tested. The ladybird predator Propylaea japonica Thunberg represented 65% of Coccinellidae predators, and other predators consisted mainly of syrphids (2.1% and spiders (1.5%. The aphid parasitoids Aphidiines represented 76.7% of the total count of the natural enemy guild (mainly Lysiphlebia japonica Ashmead and Binodoxys indicus Subba Rao & Sharma. Our results showed that P. japonica can effectively delay the establishment and subsequent population growth of aphids during the cotton growing season. Aphidiines could also reduce aphid density although their impact may be shadowed by the presence of coccinellids in the open field (likely both owing to resource competition and intraguild predation. The implications of these results are discussed in a framework of the compatibility of transgenic crops and top-down forces exerted by natural enemy guild.

  9. The recovery of Bt toxin content after temperature stress termination in transgenic cotton

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Y.; Wen, Y.; Zhang, X.; Wang, Y.; Chen, D.

    2013-06-01

    The insecticidal efficacy of Bt cotton under different environments has generated controversy in recent years. The objective of this study was to investigate possible reasons of the conflicting results caused by temperature stress. Two different types of Bt transgenic cotton cultivars (a Bt cultivar, Sikang1, and an hybrid Bt cultivar, Sikang3) were selected. The plants of the two Bt cultivars were exposed to high temperature (37 degree centigrade), low temperature (18 degree centigrade), and the control (27 degree centigrade) for short (24 h) and long (48 h) periods of stress at peak boll stage, and then moved to the glasshouse where the control plants were maintained. The results showed that the leaf insecticidal toxin content fully recovered within 24 h to the level of control after the end of short duration high-temperature treatment, and recovered mostly within 48 h of the termination of 24 h low-temperature stress. Under long duration high temperature treatment the Bt toxin content required longer recovery periods (48 and 72 h for Sikang3 and Sikang1, respectively) to reach the control level. The Bt protein content only recovered partially at 96 h after the end of the long-duration low-temperature stress, and the concentrations of the Cry1Ac protein were 74% and 77% of the corresponding control for Sikang1 and Sikang3, respectively. The different recovery and increase slowly of the leaf nitrogen metabolic rates after ceasing the heat and cold stress may be possible reason for the above difference. In summary, the duration and type of temperature (cold or heat) stress may cause different Bt insecticidal protein recovery rate due to different recovery rate of enzymes. (Author) 31 refs.

  10. Effects of Soil Water Deficit on Insecticidal Protein Expression in Boll Shells of Transgenic Bt Cotton and the Mechanism

    Directory of Open Access Journals (Sweden)

    Xiang Zhang

    2017-12-01

    Full Text Available This study was conducted to investigate the effects of soil water deficit on insecticidal protein expression in boll shells of cotton transgenic for a Bt gene. In 2014, Bt cotton cultivars Sikang 1 (a conventional cultivar and Sikang 3 (a hybrid cultivar were planted in pots and five soil water content treatments were imposed at peak boll stage: 15% (G1, 35% (G2, 40% (G3, 60% (G4, and 75% field capacity (CK, respectively. Four treatments (G2, G3, G4, and CK were repeated in 2015 in the field. Results showed that the insecticidal protein content of boll shells decreased with increasing water deficit. Compared with CK, boll shell insecticidal protein content decreased significantly when soil water content was below 60% of maximum water holding capacity for Sikang 1 and Sikang 3. However, increased Bt gene expression was observed when boll shell insecticidal protein content was significantly reduced. Activity assays of key enzymes in nitrogen metabolism showed that boll shell protease and peptidase increased but nitrogen reductase and glutamic-pyruvic transaminase (GPT decreased. Insecticidal protein content exhibited significant positive correlation with nitrogen reductase and GPT activities; and significant negative correlation with protease and peptidase activities. These findings suggest that the decrease of insecticidal protein content associated with increasing water deficit was a net result of decreased synthesis and increased decomposition.

  11. The halo effect: suppression of pink bollworm on non-Bt cotton by Bt cotton in China.

    Directory of Open Access Journals (Sweden)

    Peng Wan

    Full Text Available In some previously reported cases, transgenic crops producing insecticidal proteins from Bacillus thuringiensis (Bt have suppressed insect pests not only in fields planted with such crops, but also regionally on host plants that do not produce Bt toxins. Here we used 16 years of field data to determine if Bt cotton caused this "halo effect" against pink bollworm (Pectinophora gossypiella in six provinces of the Yangtze River Valley of China. In this region, the percentage of cotton hectares planted with Bt cotton increased from 9% in 2000 to 94% in 2009 and 2010. We found that Bt cotton significantly decreased the population density of pink bollworm on non-Bt cotton, with net decreases of 91% for eggs and 95% for larvae on non-Bt cotton after 11 years of Bt cotton use. Insecticide sprays targeting pink bollworm and cotton bollworm (Helicoverpa armigera decreased by 69%. Previously reported evidence of the early stages of evolution of pink bollworm resistance to Bt cotton in China has raised concerns that if unchecked, such resistance could eventually diminish or eliminate the benefits of Bt cotton. The results reported here suggest that it might be possible to find a percentage of Bt cotton lower than the current level that causes sufficient regional pest suppression and reduces the risk of resistance.

  12. Performance and cross-crop resistance of Cry1F-maize selected Spodoptera frugiperda on transgenic Bt cotton: implications for resistance management.

    Science.gov (United States)

    Yang, Fei; Kerns, David L; Brown, Sebe; Kurtz, Ryan; Dennehy, Tim; Braxton, Bo; Head, Graham; Huang, Fangneng

    2016-06-15

    Transgenic crops producing Bacillus thuringiensis (Bt) proteins have become a primary tool in pest management. Due to the intensive use of Bt crops, resistance of the fall armyworm, Spodoptera frugiperda, to Cry1F maize has occurred in Puerto Rico, Brazil, and some areas of the southeastern U.S. The sustainability of Bt crops faces a great challenge because the Cry1F-maize resistant S. frugiperda may also infest other Bt crops in multiple cropping ecosystems. Here we examined the survival and plant injury of a S. frugiperda population selected with Cry1F maize on three single-gene and five pyramided Bt cotton products. Larvae of Cry1F-susceptible (SS), -heterozygous (RS), and -resistant (RR) genotypes of S. frugiperda were all susceptible to the pyramided cotton containing Cry1Ac/Cry2Ab, Cry1Ac/Cry1F/Vip3A, Cry1Ab/Cry2Ae, or Cry1Ab/Cry2Ae/Vip3A, and the single-gene Cry2Ae cotton. Pyramided cotton containing Cry1Ac/Cry1F was effective against SS and RS, but not for RR. These findings show that the Cry1F-maize selected S. frugiperda can cause cross-crop resistance to other Bt crops expressing similar insecticidal proteins. Resistance management and pest management programs that utilize diversify mortality factors must be implemented to ensure the sustainability of Bt crops. This is especially important in areas where resistance to single-gene Bt crops is already widespread.

  13. Leaf tissue assay for lepidopteran pests of Bt cotton

    Science.gov (United States)

    Laboratory measurements of susceptibility to Bt toxins can be a poor indicator of the ability of an insect to survive on transgenic crops. We investigated the potential of using cotton leaf tissue for evaluating heliothine susceptibilities to two dual-gene Bt cottons. A preliminary study was conduct...

  14. Assessment of Bollgard II cotton pollen mediated transgenes flow to ...

    African Journals Online (AJOL)

    Assessment of Bollgard II cotton pollen mediated transgenes flow to conventional cotton in the farming conditions of Burkina ... This has led to experiment on Bt cotton from 2003 to 2007. ... EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

  15. Inheritance and segregation of exogenous genes in transgenic cotton

    Indian Academy of Sciences (India)

    Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton. The transformed cotton varieties CCRI 30 and NewCott 33B expressing the Bt cryIA gene, and cotton line TFD expressing the tfdA gene were crossed with ...

  16. Fitness of Bt-resistant cabbage loopers on Bt cotton plants.

    Science.gov (United States)

    Tetreau, Guillaume; Wang, Ran; Wang, Ping

    2017-10-01

    Development of resistance to the insecticidal toxins from Bacillus thuringiensis (Bt) in insects is the major threat to the continued success of transgenic Bt crops in agriculture. The fitness of Bt-resistant insects on Bt and non-Bt plants is a key parameter that determines the development of Bt resistance in insect populations. In this study, a comprehensive analysis of the fitness of Bt-resistant Trichoplusia ni strains on Bt cotton leaves was conducted. The Bt-resistant T. ni strains carried two genetically independent mechanisms of resistance to Bt toxins Cry1Ac and Cry2Ab. The effects of the two resistance mechanisms, individually and in combination, on the fitness of the T. ni strains on conventional non-Bt cotton and on transgenic Bt cotton leaves expressing a single-toxin Cry1Ac (Bollgard I) or two Bt toxins Cry1Ac and Cry2Ab (Bollgard II) were examined. The presence of Bt toxins in plants reduced the fitness of resistant insects, indicated by decreased net reproductive rate (R 0 ) and intrinsic rate of increase (r). The reduction in fitness in resistant T. ni on Bollgard II leaves was greater than that on Bollgard I leaves. A 12.4-day asynchrony of adult emergence between the susceptible T. ni grown on non-Bt cotton leaves and the dual-toxin-resistant T. ni on Bollgard II leaves was observed. Therefore, multitoxin Bt plants not only reduce the probability for T. ni to develop resistance but also strongly reduce the fitness of resistant insects feeding on the plants. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  17. Early warning of cotton bollworm resistance associated with intensive planting of Bt cotton in China.

    Directory of Open Access Journals (Sweden)

    Haonan Zhang

    Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to promote survival of susceptible pests. To delay pest resistance to transgenic cotton producing Bt toxin Cry1Ac, farmers in the United States and Australia planted refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. Here we report data from a 2010 survey showing field-evolved resistance to Cry1Ac of the major target pest, cotton bollworm (Helicoverpa armigera, in northern China. Laboratory bioassay results show that susceptibility to Cry1Ac was significantly lower in 13 field populations from northern China, where Bt cotton has been planted intensively, than in two populations from sites in northwestern China where exposure to Bt cotton has been limited. Susceptibility to Bt toxin Cry2Ab did not differ between northern and northwestern China, demonstrating that resistance to Cry1Ac did not cause cross-resistance to Cry2Ab, and implying that resistance to Cry1Ac in northern China is a specific adaptation caused by exposure to this toxin in Bt cotton. Despite the resistance detected in laboratory bioassays, control failures of Bt cotton have not been reported in China. This early warning may spur proactive countermeasures, including a switch to transgenic cotton producing two or more toxins distinct from Cry1A toxins.

  18. The natural refuge policy for Bt cotton (Gossypium L. in Pakistan – a situation analysis

    Directory of Open Access Journals (Sweden)

    Muhammad Sajjad Ali

    2013-07-01

    Full Text Available Bt cotton (event Cry1Ac was formally commercialized in Pakistan in 2010. However, there has been an increasing trend of planting unauthorized Bt cotton germplasm in farmers' fields since 2003 with a high rate of adoption in the core cotton areas especially in the province Punjab. The transgenic cotton technology has provided the growers with substantial economic benefits and has reduced their dependence on pesticides for pest control, especially against Helicoverpa armigera (Hubner. However, keeping in view the capacity of this insect to develop resistance against novel chemical formulations, it is easily speculated that Bt toxin, too, is no exception. Refuge crop policy for mono transgenic crop events has helped in delaying the rate of resistance evolution in the target pests. Thus, in Pakistan, where planting of structured refuge crops along Bt cotton fields is not mandatory, the effectiveness and durability of Bt cotton technology may decrease due to a number of factors which are discussed in this review.

  19. Diversity of arthropod community in transgenic poplar-cotton ecosystems.

    Science.gov (United States)

    Zhang, D J; Lu, Z Y; Liu, J X; Li, C L; Yang, M S

    2015-12-02

    Poplar-cotton agro-ecosystems are the main agricultural planting modes of plain cotton fields in China. Here, we performed a systematic survey of the diversity and population of arthropod communities in four different combination of poplar-cotton eco-systems, including I) non-transgenic poplar and non-transgenic cotton fields; II) non-transgenic poplar and transgenic cotton fields [Bacillus thuringiensis (Bt) cotton]; III) Bt transgenic poplar (high insect resistant strain Pb29) and non-transgenic cotton; and IV) transgenic poplar and transgenic cotton fields, over a period of 3 years. Based on the statistical methods used to investigate community ecology, the effects of transgenic ecosystems on the whole structure of the arthropod community, on the structure of arthropods in the nutritive layer, and on the similarity of arthropod communities were evaluated. The main results were as follows: the transgenic poplar-cotton ecosystem has a stronger inhibitory effect on insect pests and has no impact on the structure of the arthropod community, and therefore, maintains the diversity of the arthropod community. The character index of the community indicated that the structure of the arthropod community of the transgenic poplar-cotton ecosystem was better than that of the poplar-cotton ecosystem, and that system IV had the best structure. As for the abundance of nutritional classes, the transgenic poplar-cotton ecosystem was also better than that of the non-transgenic poplar-cotton ecosystem. The cluster analysis and similarity of arthropod communities between the four different transgenic poplar-cotton ecosystems illustrated that the structure of the arthropod community excelled in the small sample of the transgenic poplar-cotton ecosystems.

  20. A point mutation (L1015F) of the voltage-sensitive sodium channel gene associated with lambda-cyhalothrin resistance in Apolygus lucorum (Meyer-Dür) population from the transgenic Bt cotton field of China.

    Science.gov (United States)

    Zhen, Congai; Gao, Xiwu

    2016-02-01

    In China, the green mirid bug, Apolygus lucorum (Meyer-Dür), has caused severe economic damage to many kinds of crops, especially the cotton and jujubes. Pyrethroid insecticides have been widely used for controlling this pest in the transgenic Bt cotton field. Five populations of A. lucorum collected from cotton crops at different locations in China were evaluated for lambda-cyhalothrin resistance. The results showed that only the population collected from Shandong Province exhibited 30-fold of resistance to lambda-cyhalothrin. Neither PBO nor DEF had obvious synergism when compared the synergistic ratio between SS and RR strain which was originated from the Shandong population. Besides, there were no statistically significant differences (p>0.05) in the carboxylesterase, glutathione S-transferase, or 7-ethoxycoumarin O-deethylase activities between the Shandong population and the laboratory susceptible strain (SS). The full-length sodium channel gene named AlVSSC encoding 2028 amino acids was obtained by RT-PCR and rapid amplification of cDNA ends (RACE). One single point mutation L1015F in the AlVSSC was detected only in the Shandong population. Our results revealed that the L1015F mutation associated with pyrethroid resistance was identified in A. lucorum populations in China. These results will be useful for the rational chemical control of A. lucorum in the transgenic Bt cotton field. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Insect pests management of bt cotton through the manipulation of different eco-friendly techniques

    International Nuclear Information System (INIS)

    Ahmad, N.; Khan, M.H.; Tofique, M.

    2011-01-01

    This study was designed to manage insect pests of Bt cotton through the manipulation of different eco-friendly techniques. A perusal of data, based on the overall performance of different treatments reflected that lowest population of jassids (0.29) was observed in bio-control treated Bt cotton followed by bio-control treated conventional cotton (0.41). Mean per leaf population of thrips was found lowest in insecticide treated Bt cotton (0.97) which was statically at par with bi-control treated conventional cotton (0.95), biocontrol treated Bt cotton (1.09) and colour traps treated Bt cotton (1.50). In case of white flies, bio-control treated Bt cotton and bio-control treated conventional cotton again proved effective in maintaining the population at lower levels per leaf (0.33 and 0.35 respectively). No bollworms infestation was recorded in transgenic cotton whereas higher attack of the same was observed in the untreated conventional cotton block. The best results were achieved with the application of bio-control agents in combination with Bt cotton resulting in least infestation by insect pests and maximum seed yield of 3657 kg/ha. The population of Chrysoperla carnea was significantly higher in Bt and conventional cotton treated with bio-control agents as compared to the other treatments. The parasitism percentage of Trichogramma chilonis was observed significantly higher in bio-control treated conventional cotton. The studies manifested that combination of bio-control technology with Bt cotton effectively preserves the local beneficial insect fauna indicating its potential to be used as integrated management system against different insect pests of cotton. (author)

  2. Food safety knowledge on the Bt mutant protein Cry8Ka5 employed in the development of coleopteran-resistant transgenic cotton plants.

    Science.gov (United States)

    Farias, Davi F; Peijnenburg, Ad A C M; Grossi-de-Sá, Maria F; Carvalho, Ana F U

    2015-01-01

    Insecticidal Cry proteins from Bacillus thuringiensis (Bt) have been exploited in the development of genetically modified (GM) crops for pest control. However, several pests are still difficult to control such as the coleopteran boll weevil Anthonomus grandis. By applying in vitro molecular evolution to the cry8Ka1 gene sequence, variants were generated with improved activity against A. grandis. Among them, Cry8Ka5 mutant protein showed coleoptericidal activity 3-fold higher (LC50 2.83 μg/mL) than that of the original protein (Cry8Ka1). Cry8Ka5 has been used in breeding programs in order to obtain coleopteran-resistant cotton plants. Nevertheless, there is some concern in relation to the food safety of transgenic crops, especially to the heterologously expressed proteins. In this context, our research group has performed risk assessment studies on Cry8Ka5, using the tests recommended by Codex as well as tests that we proposed as alternative and/or complementary approaches. Our results on the risk analysis of Cry8Ka5 taken together with those of other Cry proteins, point out that there is a high degree of certainty on their food safety. It is reasonable to emphasize that most safety studies on Cry proteins have essentially used the Codex approach. However, other methodologies would potentially provide additional information such as studies on the effects of Cry proteins and derived peptides on the indigenous gastrointestinal microbiota and on intestinal epithelial cells of humans. Additionally, emerging technologies such as toxicogenomics potentially will offer sensitive alternatives for some current approaches or methods.

  3. Effect of Iranian Bt cotton on life table of Bemisia tabaci (Hemiptera: Alyrodidae and Cry 1Ab detection in the whitefly honeydew

    Directory of Open Access Journals (Sweden)

    Solmaz Azimi

    2016-09-01

    Full Text Available Transgenic cotton expressing the Cry 1Ab protein of Bacillus thuringiensis developing against Helocoverpa armigera may be affect on secondary pest such as Bemisia tabaci. In this study effects of Bt cotton on demographic parameters of B. tabaci were assessed and the data analyzed using the age specific, two-sex life table parameters. Results showed that getting to the adulthood stage, was faster on non-Bt cotton in comparison with Bt cotton. Also the fecundity was higher on non-Bt cotton than that on Bt cotton. Some of the population parameters (r, R0 and T of B. tabaci were affected by the Bt cotton significantly. The intrinsic rate of increase (r on Bt and non-Bt cotton was 0.07 day-1 and 0.1 day-1 , respectively. The net reproductive rate (R0 was 20.68 and 15.04 offspring/individual on Bt and non-Bt cotton, respectively. Mean generation time (T in non-Bt cotton was 27.22 and 34.62 days in Bt cotton. The results indicated that the life history of B. tabaci in the laboratory condition was influenced by host plant quality and Bt cotton was not a suitable host for B. tabaci. The western immunoblot method showed that the Cry protein detection in honeydew was positive which indicated that the Cry protein was ingested. Results revealed that the transgenic cotton could adversely affect the secondary pest and the natural enemies which feed on such pests as a host or their honeydew as a food source should be considered.

  4. Pollen- and seed-mediated transgene flow in commercial cotton seed production fields.

    Directory of Open Access Journals (Sweden)

    Shannon Heuberger

    Full Text Available BACKGROUND: Characterizing the spatial patterns of gene flow from transgenic crops is challenging, making it difficult to design containment strategies for markets that regulate the adventitious presence of transgenes. Insecticidal Bacillus thuringiensis (Bt cotton is planted on millions of hectares annually and is a potential source of transgene flow. METHODOLOGY/PRINCIPAL FINDINGS: Here we monitored 15 non-Bt cotton (Gossypium hirsutum, L. seed production fields (some transgenic for herbicide resistance, some not for gene flow of the Bt cotton cry1Ac transgene. We investigated seed-mediated gene flow, which yields adventitious Bt cotton plants, and pollen-mediated gene flow, which generates outcrossed seeds. A spatially-explicit statistical analysis was used to quantify the effects of nearby Bt and non-Bt cotton fields at various spatial scales, along with the effects of pollinator abundance and adventitious Bt plants in fields, on pollen-mediated gene flow. Adventitious Bt cotton plants, resulting from seed bags and planting error, comprised over 15% of plants sampled from the edges of three seed production fields. In contrast, pollen-mediated gene flow affected less than 1% of the seed sampled from field edges. Variation in outcrossing was better explained by the area of Bt cotton fields within 750 m of the seed production fields than by the area of Bt cotton within larger or smaller spatial scales. Variation in outcrossing was also positively associated with the abundance of honey bees. CONCLUSIONS/SIGNIFICANCE: A comparison of statistical methods showed that our spatially-explicit analysis was more powerful for understanding the effects of surrounding fields than customary models based on distance. Given the low rates of pollen-mediated gene flow observed in this study, we conclude that careful planting and screening of seeds could be more important than field spacing for limiting gene flow.

  5. Impact of efficient refuge policies for Bt cotton in India on world cotton trade

    OpenAIRE

    Singla, Rohit; Johnson, Phillip N.; Misra, Sukant K.

    2010-01-01

    India is a major cotton producing country in the world along with the U.S. and China. A change in the supply of and demand for cotton in the Indian market has the potential to have an impact on world cotton trade. This study evaluates the implications of efficient Bt cotton refuge policies in India on world and U.S. cotton markets. It can be hypothesized that increased refuge requirements for Bt cotton varieties in India could decrease the world supply of cotton because of the lower yield pot...

  6. What are farmers really planting? Measuring the presence and effectiveness of Bt cotton in Pakistan.

    Directory of Open Access Journals (Sweden)

    David J Spielman

    Full Text Available Genetically modified, insect-resistant Bacillus thuringiensis (Bt cotton is cultivated extensively in Pakistan. Past studies, however, have raised concerns about the prevalence of Bt cotton varieties possessing weak or nonperforming insect-resistance traits conferred by the cry gene. We examine this issue using data drawn from a representative sample of cotton-growing households that were surveyed in six agroclimatic zones spanning 28 districts in Pakistan in 2013, as well as measurements of Cry protein levels in cotton tissue samples collected from the sampled households' main fields. The resultant dataset combines information from 593 sampled households with corresponding plant tissue diagnostics from 70 days after sowing, as well as information from 589 sampled households with corresponding diagnostics from 120 days after sowing. Our analysis indicates that 11 percent of farmers believed they were cultivating Bt cotton when, in fact, the Cry toxin was not present in the tested tissue at 70 days after sowing (i.e., a Type I error. The analysis further indicates that 5 percent of farmers believed they were cultivating non-Bt cotton when, in fact, the Cry toxin was present in the tested tissue (i.e., a Type II error. In addition, 17 percent of all sampled farmers were uncertain whether or not they were cultivating Bt cotton. Overall, 33 percent of farmers either did not know or were mistaken in their beliefs about the presence of the cry gene in the cotton they cultivated. Results also indicate that toxic protein levels in the plant tissue samples occurred below threshold levels for lethality in a significant percentage of cases, although these measurements may also be affected by factors related to tissue sample collection, handling, storage, and testing procedures. Nonetheless, results strongly suggest wide variability both in farmers' beliefs and in gene expression. Such variability has implications for policy and regulation in Pakistan

  7. Food safety knowledge on the Bt mutant protein Cry8Ka5 employed in the development of coleopteran-resistant transgenic cotton plants

    NARCIS (Netherlands)

    Felipe Farias, Davi; Peijnenburg, A.A.C.M.; Grossi-de-Sá, Maria F.; Carvalho, A.F.U.

    2015-01-01

    Insecticidal Cry proteins from Bacillus thuringiensis (Bt) have been exploited in the development of genetically modified (GM) crops for pest control. However, several pests are still difficult to control such as the coleopteran boll weevil Anthonomus grandis. By applying in vitro molecular

  8. Indian Bt cotton varieties do not affect the performance of cotton aphids.

    Directory of Open Access Journals (Sweden)

    Nora C Lawo

    Full Text Available Cotton varieties expressing Cry proteins derived from the soil bacterium Bacillus thuringiensis (Bt are grown worldwide for the management of pest Lepidoptera. To prevent non-target pest outbreaks and to retain the biological control function provided by predators and parasitoids, the potential risk that Bt crops may pose to non-target arthropods is addressed prior to their commercialization. Aphids play an important role in agricultural systems since they serve as prey or host to a number of predators and parasitoids and their honeydew is an important energy source for several arthropods. To explore possible indirect effects of Bt crops we here examined the impact of Bt cotton on aphids and their honeydew. In climate chambers we assessed the performance of cotton aphids, Aphis gossypii Glover (Hemiptera: Aphididae when grown on three Indian Bt (Cry1Ac cotton varieties (MECH 12, MECH 162, MECH 184 and their non-transformed near isolines. Furthermore, we examined whether aphids pick up the Bt protein and analyzed the sugar composition of aphid honeydew to evaluate its suitability for honeydew-feeders. Plant transformation did not have any influence on aphid performance. However, some variation was observed among the three cotton varieties which might partly be explained by the variation in trichome density. None of the aphid samples contained Bt protein. As a consequence, natural enemies that feed on aphids are not exposed to the Cry protein. A significant difference in the sugar composition of aphid honeydew was detected among cotton varieties as well as between transformed and non-transformed plants. However, it is questionable if this variation is of ecological relevance, especially as honeydew is not the only sugar source parasitoids feed on in cotton fields. Our study allows the conclusion that Bt cotton poses a negligible risk for aphid antagonists and that aphids should remain under natural control in Bt cotton fields.

  9. Incipient resistance of Helicoverpa punctigera to the Cry2Ab Bt toxin in Bollgard II cotton.

    Directory of Open Access Journals (Sweden)

    Sharon Downes

    Full Text Available Combinations of dissimilar insecticidal proteins ("pyramids" within transgenic plants are predicted to delay the evolution of pest resistance for significantly longer than crops expressing a single transgene. Field-evolved resistance to Bacillus thuringiensis (Bt transgenic crops has been reported for first generation, single-toxin varieties and the Cry1 class of proteins. Our five year data set shows a significant exponential increase in the frequency of alleles conferring Cry2Ab resistance in Australian field populations of Helicoverpa punctigera since the adoption of a second generation, two-toxin Bt cotton expressing this insecticidal protein. Furthermore, the frequency of cry2Ab resistance alleles in populations from cropping areas is 8-fold higher than that found for populations from non-cropping regions. This report of field evolved resistance to a protein in a dual-toxin Bt-crop has precisely fulfilled the intended function of monitoring for resistance; namely, to provide an early warning of increases in frequencies that may lead to potential failures of the transgenic technology. Furthermore, it demonstrates that pyramids are not 'bullet proof' and that rapid evolution to Bt toxins in the Cry2 class is possible.

  10. Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.

    Science.gov (United States)

    Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

    2017-08-01

    Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T 0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2 -ΔΔCt analyses revealed that T 0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T 0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g -1 fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T 0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T 1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g -1 fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  11. Suppressing Resistance to Bt Cotton with Sterile Insect Releases

    Energy Technology Data Exchange (ETDEWEB)

    Tabashnik, B E [Department of Entomology, University of Arizona, Tucson, AZ (United States); Sisterson, M S [USDA-ARS, San Joaquin Valley Agricultural Sciences Center, Parlier, CA (United States); Ellsworth, P C [Department of Entomology, University of Arizona, Maricopa Agricultural Center, Maricopa, AZ (United States)

    2011-01-15

    Genetically engineered crops that produce insecticidal toxins from Bacillus thuringiensis (Bt) are grown widely for pest control. However, insect adaptation can reduce the toxins' efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to provide susceptible insects to mate with resistant insects. Variable farmer compliance is one of the limitations of this approach. Here we report the benefits of an alternative strategy where sterile insects are released to mate with resistant insects and refuges are scarce or absent. Computer simulations show that this approach works in principle against pests with recessive or dominant inheritance of resistance. During a largescale, four-year field deployment of this strategy in Arizona, resistance of pink bollworm (Pectinophora gossypiella) to Bt cotton did not increase. A multitactic eradication program that included the release of sterile moths reduced pink bollworm abundance by >99%, while eliminating insecticide sprays against this key invasive pest. (author)

  12. Impacts of transgenic poplar-cotton agro-ecosystems upon target pests and non-target insects under field conditions.

    Science.gov (United States)

    Zhang, D J; Liu, J X; Lu, Z Y; Li, C L; Comada, E; Yang, M S

    2015-07-27

    Poplar-cotton agro-ecosystems are the main agricultural planting modes of cotton fields in China. With increasing acres devoted to transgenic insect-resistant poplar and transgenic insect-resistant cotton, studies examining the effects of transgenic plants on target and non-target insects become increasingly important. We systematically surveyed populations of both target pests and non-target insects for 4 different combinations of poplar-cotton eco-systems over 3 years. Transgenic Bt cotton strongly resisted the target insects Fall webworm moth [Hyphantria cunea (Drury)], Sylepta derogata Fabrieius, and American bollworm (Heliothis armigera), but no clear impact on non-target insect cotton aphids (Aphis gossypii). Importantly, intercrops containing transgenic Pb29 poplar significantly increased the inhibitory effects of Bt cotton on Fall webworm moth in ecosystem IV. Highly resistant Pb29 poplar reduced populations of the target pests Grnsonoma minutara Hubner and non-target insect poplar leaf aphid (Chaitophorus po-pulialbae), while Fall webworm moth populations were unaffected. We determined the effects of Bt toxin from transgenic poplar and cotton on target and non-target pests in different ecosystems of cotton-poplar intercrops and identified the synergistic effects of such combinations toward both target and non-target insects.

  13. Field evaluation of Bt cotton crop impact on nontarget pests: cotton aphid and boll weevil.

    Science.gov (United States)

    Sujii, E R; Togni, P H B; de A Ribeiro, P; de A Bernardes, T; Milane, P V G N; Paula, D P; Pires, C S S; Fontes, E M G

    2013-02-01

    Bt cotton plants expressing Cry1Ac protein have high specificity for the control of lepidopteran larvae. However, studies conducted in several countries have shown these plants have a differential impact on nontarget herbivores. The aim of this study was to compare the colonization rates and population abundance of the cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae) and the boll weevil, Anthonomus grandis Boheman (Coleoptera: Curculionidae), in plots of Bt (Nuopal) and non-Bt cotton (Delta Opal) in an experimental field in Brasilia, DF, Brazil. No difference was observed in the preference and colonization by winged aphids to plants from the two treatments. There was no significant difference in abundance of wingless aphids or in the production of winged aphids between treatments. Apparently, the parameters that control factors such as fecundity, survival, and dispersal were similar on both Bt and non-Bt plants. Monitoring of plants for coccinellids, a specialist predator of aphids, and ants that act on the dispersal of aphids among plants showed no significant difference between Bt and non-Bt plants, supporting the inference above. Regarding the effect on boll weevil, there was also no significant difference between treatments in the total number of fruiting structures attacked in each plot, the percentage of fruiting structures attacked per plant or on the number of weevils emerging from fruits with boll weevil damage from egg-laying, when damaged fruit samples were held in the laboratory. Based on these results, we conclude that there is no impact of Bt cotton crop expressing Cry1Ac on the nontarget herbivores tested under field conditions.

  14. Segregation and expression of transgenes in the progenies of Bt ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-04-17

    Apr 17, 2012 ... segregation was observed in BC1F1, BC1F2 and F2 populations derived .... randomly chosen at the tillering stage respectively and were ground .... Figure 2. Southern blot of Hind III-digested DNA from Bt transgenic rice line ...

  15. Cross-resistance to purified Bt proteins, Bt corn and Bt cotton in a Cry2Ab2-corn resistant strain of Spodoptera frugiperda.

    Science.gov (United States)

    Yang, Fei; Kerns, David L; Head, Graham P; Price, Paula; Huang, Fangneng

    2017-12-01

    Gene-pyramiding by combining two or more dissimilar Bacillus thuringiensis (Bt) proteins into a crop has been used to delay insect resistance. The durability of gene-pyramiding can be reduced by cross-resistance. Fall armyworm, Spodoptera frugiperda, is a major target pest of the Cry2Ab2 protein used in pyramided Bt corn and cotton. Here, we provide the first experimental evaluation of cross-resistance in S. frugiperda selected with Cry2Ab2 corn to multiple Bt sources including purified Bt proteins, Bt corn and Bt cotton. Concentration - response bioassays showed that resistance ratios for Cry2Ab2-resistant (RR) relative to Cry2Ab2-susceptible (SS) S. frugiperda were -1.4 for Cry1F, 1.2 for Cry1A.105, >26.7 for Cry2Ab2, >10.0 for Cry2Ae and -1.1 for Vip3A. Larvae of Cry2Ab2-heterozygous (RS), SS and RR S. frugiperda were all susceptible to Bt corn and Bt cotton containing Cry1 (Cry1F or Cry1A.105) and/or Vip3A proteins. Pyramided Bt cotton containing Cry1Ac + Cry2Ab2 or Cry1Ab + Cry2Ae were also effective against SS and RS, but not RR. These findings suggest that Cry2Ab2-corn-selected S. frugiperda is not cross-resistant to Cry1F, Cry1A.105 or Vip3A protein, or corn and cotton plants containing these Bt proteins, but it can cause strong cross-resistance to Cry2Ae and Bt crops expressing similar Bt proteins. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  16. A case to study population dynamics of bemisia tabaci and thrips tabaci on bt and non-bt cotton genotypes

    International Nuclear Information System (INIS)

    Akram, M.; Hussain, M.; Ahmed, S.; Hafeez, F.; Farooq, M.; Arshad, M.

    2013-01-01

    Studies were conducted to investigate the performance of eight bt and five non-bt cotton genotypes against whitefly and thrips and impact of abiotic factors on the population fluctuation of these sucking pests, at cotton research station, multan, during 2010 and 2011. The results exhibited that bt genotypes found more susceptible host for the whitefly and thirps than non-bt genotypes, during the course of years of study. Among bt genotypes, maximum and minimum temperature showed significant and positive effect on whitefly population whereas relative humidity exerted negative effect during 2010. During 2011, the effect of all the factors was non significant. On cumulative basis, there was positive correlation between population of whitefly and minimum temperature. But in case of non-bt, it has negative with maximum temperature whereas relative humidity had a positive effect on whitefly population. similar trend was observed for thrips population on bt varieties during both years but on non-bt varieties only minimum temperature exerted strong positive impact on thrips population. Hierarchical regression models for whitefly and thrips revealed that minimum temperature was the most important factor (Bt and non-Bt varieties). Maximum temperature was the major contributing factor for whitefly fluctuation on bt varieties during 2010. (author)

  17. Tri-trophic interactions between Bt cotton, the herbivore Aphis gossypii Glover (Homoptera: Aphididae), and the predator Chrysopa pallens (Rambur) (Neuroptera: Chrysopidae).

    Science.gov (United States)

    Guo, Jian-Ying; Wan, Fang-Hao; Dong, Liang; Lövei, Gábor L; Han, Zhao-Jun

    2008-02-01

    Tri-trophic impacts of transgenic Bacillus thuringiensis (Bt) cotton GK12 and NuCOTN 99B were studied using a predator, the great lacewing Chrysopa pallens (Rambur), and its prey, the cotton aphid Aphis gossypii Glover, in laboratory feeding experiments. The parental nontransgenic cotton cultivar of GK12 was used as control. The predator was fed with uniform (aphids from a single cultivar) or mixed prey (aphids from the three cotton cultivars provided on alternate days). Mortality and development of the immature stages, pupal body mass, adult sex ratio, fecundity, and egg viability of C. pallens were measured. When fed GK12-originated aphid prey, pupal body mass of C. pallens was significantly higher than that of the control, more females emerged, and these females laid significantly more eggs. Other parameters were not impacted. Females emerging from larvae maintained on NuCOTN 99B-originated prey laid fewer eggs than those maintained on GK12. Other measurements did not differ significantly between the two Bt cotton cultivars. Compared with the control, mixed feeding significantly prolonged pupal development time and increased pupal body mass and percentage of females but did not affect other parameters. These results indicate that C. pallens is sensitive to aphid prey from different cotton cultivars. Transgenic Bt cotton GK12-originated aphid prey has no adverse impact on survival, development, and fecundity of C. pallens. Between the two Bt cotton cultivars, NuCOTN 99B-originated aphid prey provided to C. pallens in the larval stage may lower female fecundity. Mixed feeding of C. pallens with the two Bt cotton-originated prey and non-Bt prey may have some adverse impacts on pupal development.

  18. China's Cotton Policy and the Impact of China's WTO Accession and Bt Cotton Adoption on the Chinese and U.S. Cotton Sectors

    OpenAIRE

    Cheng Fang; Bruce A. Babcock

    2003-01-01

    In this paper we provide an analysis of China's cotton policy and develop a framework to quantify the impact of both China's World Trade Organization (WTO) accession and Bt (Bacillus thuringiensis) cotton adoption on Chinese and U.S. cotton sectors. We use a Chinese cotton sector model consisting of supply, demand, price linkages, and textiles output equations. A two-stage framework model provides gross cropping area and total area for cotton and major subsitute crops from nine cotton-produci...

  19. An Empirical Assessment of Transgene Flow from a Bt Transgenic Poplar Plantation.

    Directory of Open Access Journals (Sweden)

    Jianjun Hu

    Full Text Available To assess the possible impact of transgenic poplar plantations on the ecosystem, we analyzed the frequency and distance of gene flow from a mature male transgenic Populus nigra plantation carrying the Bacillus thuringiensis toxin gene (Bt poplar and the survival of Bt poplar seeds. The resultant Bt poplar seeds occurred at a frequency of ~0.15% at 0 m to ~0.02% at 500 m from the Bt poplar plantation. The germination of Bt poplar seeds diminished within three weeks in the field (germination rate from 68% to 0% compared to 48% after three weeks of storage at 4°C. The survival rate of seedlings in the field was 0% without any treatment but increased to 1.7% under the addition of four treatments (cleaning and trimming, watering, weeding, and covering with plastic film to maintain moisture after being seeded in the field for eight weeks. The results of this study indicate that gene flow originating from the Bt poplar plantation occurred at an extremely low level through pollen or seeds under natural conditions. This study provides first-hand field data on the extent of transgene flow in poplar plantations and offers guidance for the risk assessment of transgenic poplar plantations.

  20. Valuing financial, health and environmental benefits of Bt cotton in Pakistan

    OpenAIRE

    Kouser, Shahzad; Qaim, Matin

    2012-01-01

    Data from a farm survey and choice experiment are used to value the benefits of Bt cotton in Pakistan. Unlike previous research on the economic impacts of Bt, which mostly concentrated on financial benefits in terms of gross margins, we also quantify and monetize positive externalities associated with technology adoption. Due to lower chemical pesticide use on Bt cotton plots, there are significant health advantages in terms of reduced incidence of acute pesticide poisoning, and environmental...

  1. Effect of pyramiding Bt and CpTI genes on resistance of cotton to Helicoverpa armigera (Lepidoptera: Noctuidae) under laboratory and field conditions

    NARCIS (Netherlands)

    Cui, J.J.; Luo, J.Y.; Werf, van der W.; Ma, Y.; Xia, J.Y.

    2011-01-01

    Transgenic cotton (Gossypium hirsutum L.) varieties, adapted to China, have been bred that express two genes for resistance to insects. the Cry1Ac gene from Bacillus thuringiensis (Berliner) (Bt), and a trypsin inhibitor gene from cowpea (CpTI). Effectiveness of the double gene modification in

  2. PRICING OF BT COTTON SEEDS IN INDIA: THE DEBATE BEHIND

    Directory of Open Access Journals (Sweden)

    Anchal ARORA

    2014-11-01

    Full Text Available In 2006 the state government of Andhra Pradesh reduced the Bt cotton seed prices from Indian Rs1600 to Rs750 in order to make the technology affordable and accessible to small and marginal farmers in the state and also to prevent the monopolistic market structure in the seed market. The drastic reduction in seed prices, on the other hand could affect the profitability of seed providing companies and curb their incentives to innovate in future. Recent literature has also examined the impact of price controls on diffusion of technology, revenue and profitability of seed providers. It suggests that price controls have positively impacted the diffusion of technology in India, and were also successful in increasing the revenue of seed providers in the short run. However, the impact of price controls on profitability would depend on cost conditions. In the light of the above discussion, this article attempts to discuss the debate behind price controls and draws certain policy implications pertaining to pricing of Bt seeds, which has an international policy relevance.

  3. Spatial Distribution of Eggs of Alabama argillacea Hübner and Heliothis virescens Fabricius (Lepidoptera: Noctuidae on Bt and non-BtCotton

    Directory of Open Access Journals (Sweden)

    TATIANA R. RODRIGUES

    2015-12-01

    Full Text Available ABSTRACT Among the options to control Alabama argillacea (Hübner, 1818 and Heliothis virescens (Fabricius, 1781 on cotton, insecticide spraying and biological control have been extensively used. The GM'Bt' cotton has been introduced as an extremely viable alternative, but it is yet not known how transgenic plants affect populations of organisms that are interrelated in an agroecosystem. For this reason, it is important to know how the spatial arrangement of pests and beneficial insect are affected, which may call for changes in the methods used for sampling these species. This study was conducted with the goal to investigate the pattern of spatial distribution of eggs of A. argillacea and H. virescens in DeltaOpalTM (non-Bt and DP90BTMBt cotton cultivars. Data were collected during the agricultural year 2006/2007 in two areas of 5,000 m2, located in in the district of Nova América, Caarapó municipality. In each sampling area, comprising 100 plots of 50 m2, 15 evaluations were performed on two plants per plot. The sampling consisted in counting the eggs. The aggregation index (variance/mean ratio, Morisita index and exponent k of the negative binomial distribution and chi-square fit of the observed and expected values to the theoretical frequency distribution (Poisson, Binomial and Negative Binomial Positive, showed that in both cultivars, the eggs of these species are distributed according to the aggregate distribution model, fitting the pattern of negative binomial distribution.

  4. Non-recessive Bt toxin resistance conferred by an intracellular cadherin mutation in field-selected populations of cotton bollworm.

    Directory of Open Access Journals (Sweden)

    Haonan Zhang

    Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins have been planted widely to control insect pests, yet evolution of resistance by the pests can reduce the benefits of this approach. Recessive mutations in the extracellular domain of toxin-binding cadherin proteins that confer resistance to Bt toxin Cry1Ac by disrupting toxin binding have been reported previously in three major lepidopteran pests, including the cotton bollworm, Helicoverpa armigera. Here we report a novel allele from cotton bollworm with a deletion in the intracellular domain of cadherin that is genetically linked with non-recessive resistance to Cry1Ac. We discovered this allele in each of three field-selected populations we screened from northern China where Bt cotton producing Cry1Ac has been grown intensively. We expressed four types of cadherin alleles in heterologous cell cultures: susceptible, resistant with the intracellular domain mutation, and two complementary chimeric alleles with and without the mutation. Cells transfected with each of the four cadherin alleles bound Cry1Ac and were killed by Cry1Ac. However, relative to cells transfected with either the susceptible allele or the chimeric allele lacking the intracellular domain mutation, cells transfected with the resistant allele or the chimeric allele containing the intracellular domain mutation were less susceptible to Cry1Ac. These results suggest that the intracellular domain of cadherin is involved in post-binding events that affect toxicity of Cry1Ac. This evidence is consistent with the vital role of the intracellular region of cadherin proposed by the cell signaling model of the mode of action of Bt toxins. Considered together with previously reported data, the results suggest that both pore formation and cell signaling pathways contribute to the efficacy of Bt toxins.

  5. Mechanism and DNA-based detection of field-evolved resistance to transgenic Bt corn in fall armyworm (Spodoptera frugiperda)

    Science.gov (United States)

    Evolution of resistance threatens sustainability of transgenic crops producing insecticidal proteins from the bacterium Bacillus thuringiensis (Bt). The fall armyworm is a devastating pest controlled by transgenic Bt corn producing the Cry1Fa insecticidal protein. However, fall armyworm populations ...

  6. Effects of Bt-transgenic rice cultivation on planktonic communities in paddy fields and adjacent ditches

    International Nuclear Information System (INIS)

    Liu, Yongbo; Liu, Fang; Wang, Chao; Quan, Zhanjun; Li, Junsheng

    2016-01-01

    The non-target effects of transgenic plants are issues of concern; however, their impacts in cultivated agricultural fields and adjacent natural aquatic ecosystems are poorly understood. We conducted field experiments during two growing seasons to determine the effects of cultivating Bacillus thuringiensis (Bt)-transgenic rice on the phytoplankton and zooplankton communities in a paddy field and an adjacent ditch. Bt toxin was detected in soil but not in water. Water quality was not significantly different between non-Bt and Bt rice fields, but varied among up-, mid- and downstream locations in the ditch. Cultivation of Bt-transgenic rice had no effects on zooplankton communities. Phytoplankton abundance and biodiversity were not significantly different between transgenic and non-transgenic rice fields in 2013; however, phytoplankton were more abundant in the transgenic rice field than in the non-transgenic rice field in 2014. Water quality and rice type explained 65.9% and 12.8% of this difference in 2014, respectively. Phytoplankton and zooplankton were more abundant in mid- and downstream, than upstream, locations in the ditch, an effect that we attribute to water quality differences. Thus, the release of Bt toxins into field water during the cultivation of transgenic crops had no direct negative effects on plankton community composition, but indirect effects that alter environmental conditions should be taken into account during the processes of management planning and policymaking. - Highlights: • We detect fusion Cry1Ab/1Ac proteins from Bt rice entering into aquatic ecosystems. • Bt-transgenic rice cultivation have no significant effect on zooplankton community. • Bt-transgenic rice cultivation have indirect effect on phytoplankton community. • Water quality explains the difference of plankton communities in adjacent ditches.

  7. Effects of Bt-transgenic rice cultivation on planktonic communities in paddy fields and adjacent ditches

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yongbo, E-mail: liuyb@craes.org.cn [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Liu, Fang [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Wang, Chao [Pearl River Fisheries Research Institute, Chinese Academy of Fishery Science, Guangzhou 510380 (China); Quan, Zhanjun [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Li, Junsheng, E-mail: lijsh@creas.org.cn [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China)

    2016-09-15

    The non-target effects of transgenic plants are issues of concern; however, their impacts in cultivated agricultural fields and adjacent natural aquatic ecosystems are poorly understood. We conducted field experiments during two growing seasons to determine the effects of cultivating Bacillus thuringiensis (Bt)-transgenic rice on the phytoplankton and zooplankton communities in a paddy field and an adjacent ditch. Bt toxin was detected in soil but not in water. Water quality was not significantly different between non-Bt and Bt rice fields, but varied among up-, mid- and downstream locations in the ditch. Cultivation of Bt-transgenic rice had no effects on zooplankton communities. Phytoplankton abundance and biodiversity were not significantly different between transgenic and non-transgenic rice fields in 2013; however, phytoplankton were more abundant in the transgenic rice field than in the non-transgenic rice field in 2014. Water quality and rice type explained 65.9% and 12.8% of this difference in 2014, respectively. Phytoplankton and zooplankton were more abundant in mid- and downstream, than upstream, locations in the ditch, an effect that we attribute to water quality differences. Thus, the release of Bt toxins into field water during the cultivation of transgenic crops had no direct negative effects on plankton community composition, but indirect effects that alter environmental conditions should be taken into account during the processes of management planning and policymaking. - Highlights: • We detect fusion Cry1Ab/1Ac proteins from Bt rice entering into aquatic ecosystems. • Bt-transgenic rice cultivation have no significant effect on zooplankton community. • Bt-transgenic rice cultivation have indirect effect on phytoplankton community. • Water quality explains the difference of plankton communities in adjacent ditches.

  8. Effects of temperature on the feeding behavior of Alabama argillacea (Hübner (Lepidoptera: Noctuidae on Bt and non-Bt cotton plants

    Directory of Open Access Journals (Sweden)

    FRANCISCO S. RAMALHO

    2017-12-01

    Full Text Available ABSTRACT The host acceptance behavior and environmental factors as temperature affect the feeding behavior of Lepidoptera pests. Thus, they must be considered in studies about the risk potential of resistance evolution. The current study sets the differences in the feeding behavior of neonate Alabama argillacea (Hübner (Lepidoptera: Noctuidae larvae exposed to Bt and non-Bt cotton plants, under different temperatures and time gap after hatching. Two cotton cultivars were used: the Bt (DP 404 BG - bollgard and the non-transformed isoline, DP 4049. We found that the feeding behavior of neonate A. argillacea is significantly different between Bt and non-Bt cotton. Based on the number of larvae with vegetal tissue in their gut found on the plant and in the organza as well as on the amount of vegetal tissue ingested by the larvae. A. argillacea shows feeding preference for non-Bt cotton plants, in comparison to that on the Bt. However, factors such as temperature and exposure time may affect detection capacity and plant abandonment by the larvae and it results in lower ingestion of vegetal tissue. Such results are relevant to handle the resistance of Bt cotton cultivars to A. argillacea and they also enable determining how the cotton seeds mix will be a feasible handling option to hold back resistance evolution in A. argillacea populations on Bt cotton, when it is compared to other refuge strategies. The results can also be useful to determine which refuge distribution of plants is more effective for handling Bt cotton resistance to A. argillacea.

  9. Effective dominance of resistance of Spodoptera frugiperda to Bt maize and cotton varieties: implications for resistance management

    Science.gov (United States)

    Horikoshi, Renato J.; Bernardi, Daniel; Bernardi, Oderlei; Malaquias, José B.; Okuma, Daniela M.; Miraldo, Leonardo L.; Amaral, Fernando S. De A. E.; Omoto, Celso

    2016-10-01

    The resistance of fall armyworm (FAW), Spodoptera frugiperda, has been characterized to some Cry and Vip3A proteins of Bacillus thuringiensis (Bt) expressed in transgenic maize in Brazil. Here we evaluated the effective dominance of resistance based on the survival of neonates from selected Bt-resistant, heterozygous, and susceptible (Sus) strains of FAW on different Bt maize and cotton varieties. High survival of strains resistant to the Cry1F (HX-R), Cry1A.105/Cry2Ab (VT-R) and Cry1A.105/Cry2Ab/Cry1F (PW-R) proteins was detected on Herculex, YieldGard VT PRO and PowerCore maize. Our Vip3A-resistant strain (Vip-R) exhibited high survival on Herculex, Agrisure Viptera and Agrisure Viptera 3 maize. However, the heterozygous from HX-R × Sus, VT-R × Sus, PW-R × Sus and Vip-R × Sus had complete mortality on YieldGard VT PRO, PowerCore, Agrisure Viptera, and Agrisure Viptera 3, whereas the HX-R × Sus and Vip-R × Sus strains survived on Herculex maize. On Bt cotton, the HX-R, VT-R and PW-R strains exhibited high survival on Bollgard II. All resistant strains survived on WideStrike, but only PW-R and Vip-R × Sus survived on TwinLink. Our study provides useful data to aid in the understanding of the effectiveness of the refuge strategy for Insect Resistance Management of Bt plants.

  10. Assessment of Bollgard II cotton pollen mediated transgenes flow to ...

    African Journals Online (AJOL)

    INERA05

    2013-08-14

    Aug 14, 2013 ... insects such as honey bees, bumble bees and butterflies. Genetic materials ... cotton fields separated from the transgenes source by wide open space. In Boni ..... Breeding: new strategies in plant improvement. International ...

  11. Fitness cost of resistance to Bt cotton linked with increased gossypol content in pink bollworm larvae.

    Directory of Open Access Journals (Sweden)

    Jennifer L Williams

    Full Text Available Fitness costs of resistance to Bacillus thuringiensis (Bt crops occur in the absence of Bt toxins, when individuals with resistance alleles are less fit than individuals without resistance alleles. As costs of Bt resistance are common, refuges of non-Bt host plants can delay resistance not only by providing susceptible individuals to mate with resistant individuals, but also by selecting against resistance. Because costs typically vary across host plants, refuges with host plants that magnify costs or make them less recessive could enhance resistance management. Limited understanding of the physiological mechanisms causing fitness costs, however, hampers attempts to increase costs. In several major cotton pests including pink bollworm (Pectinophora gossypiella, resistance to Cry1Ac cotton is associated with mutations altering cadherin proteins that bind this toxin in susceptible larvae. Here we report that the concentration of gossypol, a cotton defensive chemical, was higher in pink bollworm larvae with cadherin resistance alleles than in larvae lacking such alleles. Adding gossypol to the larval diet decreased larval weight and survival, and increased the fitness cost affecting larval growth, but not survival. Across cadherin genotypes, the cost affecting larval growth increased as the gossypol concentration of larvae increased. These results suggest that increased accumulation of plant defensive chemicals may contribute to fitness costs associated with resistance to Bt toxins.

  12. Bt cotton and employment effects for female agricultural laborers in Pakistan.

    Science.gov (United States)

    Kouser, Shahzad; Abedullah; Qaim, Matin

    2017-01-25

    The literature about economic and social impacts of Bt cotton adoption on farm households in developing countries is growing. Yet, there is still uncertainty about wider implications of this technology for rural development, including effects for landless rural laborers. Bt-related yield advantages may lead to intensified production and higher demand for labor. Building on farm survey data collected in Pakistan and using double-hurdle regression models, we analyze employment effects of Bt cotton adoption. Model estimates show that Bt adoption has increased the demand for hired labor by 55%. Manual harvesting, which is common in Pakistan, is a labor-intensive activity primarily carried out by female laborers. Accordingly, gender disaggregation shows that the employment-generating effects are particularly strong for women, who often belong to the most disadvantaged groups of rural societies. These results suggest that Bt technology can contribute to additional employment income for the poor and to more equitable rural development. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Bacillus thuringiensis (Bt) transgenic crop: an environment friendly insect-pest management strategy.

    Science.gov (United States)

    Kumar, Suresh; Chandra, Amaresh; Pandey, K C

    2008-09-01

    Introduction of DDT (dichloro-diphenyl-trichloroethane) and following move towards indiscriminate use of synthetic chemical insecticides led to the contamination of water and food sources, poisoning of non-target beneficial insects and development of insect-pests resistant to the chemical insecticides. Increased public concems about the adverse environmental effects of indiscriminate use of chemical insecticides prompted search of altemative methods for insect-pest control. One of the promising alternatives has been the use of biological control agents. There is well-documented history of safe application of Bt (B. thuringiensis, a gram positive soil bacterium) as effective biopesticides and a number of reports of expression of delta-endotoxin gene(s) in crop plants are available. Only a few insecticidal sprays are required on Bt transgenic crops, which not only save cost and time, but also reduce health risks. Insects exhibit remarkable ability to develop resistance to different insecticidal compounds, which raises concern about the unsystematic use of Bt transgenic technology also. Though resistance to Bt products among insect species under field conditions has been rare, laboratory studies show that insects are capable of developing high levels of resistance to one ormore Cry proteins. Now it is generally agreed that 'high-dose/refuge strategy' is the most promising and practical approach to prolong the effectiveness of Bt toxins. Although manybiosafety concerns, ethical and moral issues exist, area under Bt transgenic crops is rapidly increasing and they are cultivated on more than 32 million hectares world over Even after reservation of European Union (EU) for acceptance of geneticaly modified (GM) crops, 6 out of 25 countries have already adopted Bt crops and many otherindustrial countries will adopt Bt transgenic crops in near future. While the modem biotechnology has been recognized to have a great potential for the promotion of human well-being, adoption

  14. Modeling evolution of resistance of sugarcane borer (Lepidoptera: Crambidae) to transgenic Bt corn.

    Science.gov (United States)

    Kang, J; Huang, F; Onstad, D W

    2014-08-01

    Diatraea saccharalis (F.) (Lepidoptera: Crambidae) is a target pest of transgenic corn expressing Bacillus thuringiensis (Bt) protein, and the first evidence of resistance by D. saccharalis to Cry1Ab corn was detected in a field population in northeast Louisiana in 2004. We used a model of population dynamics and genetics of D. saccharalis to 1) study the effect of interfield dispersal, the first date that larvae enter diapause for overwintering, toxin mortality, the proportion of non-Bt corn in the corn patch, and the area of a crop patch on Bt resistance evolution; and 2) to identify gaps in empirical knowledge for managing D. saccharalis resistance to Bt corn. Increasing, the proportion of corn refuge did not always improve the durability of Bt corn if the landscape also contained sugarcane, sorghum, or rice. In the landscape, which consisted of 90% corn area, 5% sorghum area, and 5% rice area, the durability of single-protein Bt corn was 40 yr when the proportion of corn refuge was 0.2 but 16 yr when the proportion of corn refuge was 0.5. The Bt resistance evolution was sensitive to a change (from Julian date 260 to 272) in the first date larvae enter diapause for overwintering and moth movement. In the landscapes with Bt corn, non-Bt corn, sugarcane, sorghum, and rice, the evolution of Bt resistance accelerated when larvae entered diapause for overwintering early. Intermediate rates of moth movement delayed evolution of resistance more than either extremely low or high rates. This study suggested that heterogeneity in the agrolandscapes may complicate the strategy for managing Bt resistance in D. saccharalis, and designing a Bt resistance management strategy for D. saccharalis is challenging because of a lack of empirical data about overwintering and moth movement.

  15. Transgenic cotton coexpressing Vip3A and Cry1Ac has a broad insecticidal spectrum against lepidopteran pests.

    Science.gov (United States)

    Chen, Wen-Bo; Lu, Guo-Qing; Cheng, Hong-Mei; Liu, Chen-Xi; Xiao, Yu-Tao; Xu, Chao; Shen, Zhi-Cheng; Wu, Kong-Ming

    2017-10-01

    Although farmers in China have grown transgenic Bt-Cry1Ac cotton to resist the major pest Helicoverpa armigera since 1997 with great success, many secondary lepidopteran pests that are tolerant to Cry1Ac are now reported to cause considerable economic damage. Vip3AcAa, a chimeric protein with the N-terminal part of Vip3Ac and the C-terminal part of Vip3Aa, has a broad insecticidal spectrum against lepidopteran pests and has no cross resistance to Cry1Ac. In the present study, we tested insecticidal activities of Vip3AcAa against Spodoptera litura, Spodoptera exigua, and Agrotis ipsilon, which are relatively tolerant to Cry1Ac proteins. The bioassay results showed that insecticidal activities of Vip3AcAa against these three pests are superior to Cry1Ac, and after an activation pretreatment, Vip3AcAa retained insecticidal activity against S. litura, S. exigua and A. ipsilon that was similar to the unprocessed protein. The putative receptor for this chimeric protein in the brush border membrane vesicle (BBMV) in the three pests was also identified using biotinylated Vip3AcAa toxin. To broaden Bt cotton activity against a wider spectrum of pests, we introduced the vip3AcAa and cry1Ac genes into cotton. Larval mortality rates for S. litura, A. ipsilon and S. exigua that had fed on this new cotton increased significantly compared with larvae fed on non-Bt cotton and Bt-Cry1Ac cotton in a laboratory experiment. These results suggested that the Vip3AcAa protein is an excellent option for a "pyramid" strategy for integrated pest management in China. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Transgenic Bacillus thuringiensis (Bt rice is safer to aquatic ecosystems than its non-transgenic counterpart.

    Directory of Open Access Journals (Sweden)

    Guangsheng Li

    Full Text Available Rice lines genetically modified with the crystal toxin genes from Bacillus thuringiensis (Bt have experienced rapid development, with biosafety certificates for two Bt rice lines issued in 2009. There has still been no commercial release of these lines yet due to public concerns about human health and environmental risks. Some studies confirmed that Bt rice was as safe as conventional rice to non-target organisms when pesticides were not applied, however, pesticides are still required in Bt rice to control non-lepidopteran pests. In this study, we assessed the environmental effects of two Bt rice lines expressing either the cry1Ab/1Ac or cry2A genes, respectively, by using zooplanktons as indicator species under normal field management practices using pesticides when required. In the whole rice growing season, non-Bt rice was sprayed 5 times while Bt rice was sprayed 2 times, which ensured both rice achieved a normal yield. Field investigations showed that rice type (Bt and non-Bt significantly influenced zooplankton abundance and diversity, which were up to 95% and 80% lower in non-Bt rice fields than Bt rice fields. Laboratory rearing showed that water from non-Bt rice fields was significantly less suitable for the survival and reproduction of Daphnia magna and Paramecium caudatum in comparison with water from Bt rice fields. Higher pesticide residues were detected in the water from non-Bt than Bt rice fields, accounting for the bad performance of zooplankton in non-Bt field water. Our results demonstrate that Bt rice is safer to aquatic ecosystems than non-Bt rice, and its commercialization will be beneficial for biodiversity restoration in rice-based ecosystems.

  17. Elevated atmospheric ozone increases concentration of insecticidal Bacillus thuringiensis (Bt) Cry1Ac protein in Bt Brassica napus and reduces feeding of a Bt target herbivore on the non-transgenic parent

    International Nuclear Information System (INIS)

    Himanen, Sari J.; Nerg, Anne-Marja; Nissinen, Anne; Stewart, C. Neal; Poppy, Guy M.; Holopainen, Jarmo K.

    2009-01-01

    Sustained cultivation of Bacillus thuringiensis (Bt) transgenic crops requires stable transgene expression under variable abiotic conditions. We studied the interactions of Bt toxin production and chronic ozone exposure in Bt cry1Ac-transgenic oilseed rape and found that the insect resistance trait is robust under ozone elevations. Bt Cry1Ac concentrations were higher in the leaves of Bt oilseed rape grown under elevated ozone compared to control treatment, measured either per leaf fresh weight or per total soluble protein of leaves. The mean relative growth rate of a Bt target herbivore, Plutella xylostella L. larvae was negative on Bt plants in all ozone treatments. On the non-transgenic plants, larval feeding damage was reduced under elevated ozone. Our results indicate the need for monitoring fluctuations in Bt toxin concentrations to reveal the potential of ozone exposure for altering dosing of Bt proteins to target and non-target herbivores in field environments experiencing increasing ozone pollution. - Elevated atmospheric ozone can induce fluctuations in insecticidal protein concentrations in transgenic plants

  18. Elevated atmospheric ozone increases concentration of insecticidal Bacillus thuringiensis (Bt) Cry1Ac protein in Bt Brassica napus and reduces feeding of a Bt target herbivore on the non-transgenic parent

    Energy Technology Data Exchange (ETDEWEB)

    Himanen, Sari J. [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland)], E-mail: sari.himanen@uku.fi; Nerg, Anne-Marja [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland); Nissinen, Anne [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland); MTT Agrifood Research Finland, Plant Protection, FIN-31600 Jokioinen (Finland); Stewart, C. Neal [University of Tennessee, Department of Plant Sciences, Knoxville, TN 37996-4561 (United States); Poppy, Guy M. [University of Southampton, School of Biological Sciences, Southampton SO16 7PX (United Kingdom); Holopainen, Jarmo K. [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland)

    2009-01-15

    Sustained cultivation of Bacillus thuringiensis (Bt) transgenic crops requires stable transgene expression under variable abiotic conditions. We studied the interactions of Bt toxin production and chronic ozone exposure in Bt cry1Ac-transgenic oilseed rape and found that the insect resistance trait is robust under ozone elevations. Bt Cry1Ac concentrations were higher in the leaves of Bt oilseed rape grown under elevated ozone compared to control treatment, measured either per leaf fresh weight or per total soluble protein of leaves. The mean relative growth rate of a Bt target herbivore, Plutella xylostella L. larvae was negative on Bt plants in all ozone treatments. On the non-transgenic plants, larval feeding damage was reduced under elevated ozone. Our results indicate the need for monitoring fluctuations in Bt toxin concentrations to reveal the potential of ozone exposure for altering dosing of Bt proteins to target and non-target herbivores in field environments experiencing increasing ozone pollution. - Elevated atmospheric ozone can induce fluctuations in insecticidal protein concentrations in transgenic plants.

  19. Adsorption, desorption and biodegradation in soil of CrylAb toxin protein from Bt transgenic rice

    International Nuclear Information System (INIS)

    Wang Haiyan; Ye Qingfu

    2004-01-01

    The equilibrium adsorption and binding of CrylAb toxin from Bt transgenic rice, to 7 different soils and the biodegradation of the bound toxin were studied. The adsorption rate of Bt in soils improved with decreasing of the added Bt purified protein concentration. Adsorption rate (125 and 780 nm/ml) in powdery-muddy paddy soil, Fluvio-marine yellow loamy and Coastal saline soil were 24.85% and 40.81%, 9.1% and 31.67%, 12.47% and 30.75%, respectively. Desorption rate in the soils dropped with content of soil-absorbed protein decreased. Its adsorption ratio in powdery-muddy paddy soil was 12.95% and 5.88%, respectively. The relationship between adsorption amount and concentration of Bt purified protein in different soils was notably positive correlation (P 0 e -λt ); Half life of Bt protein in soils was among 15.2-97.6 d; Degradation of pruified Bt protein was rapid at the initial incubation time (30 d), but slow at 150d incubation; The degradation of purified Bt protein in Intertidal sandy soil was the slowest with half-life of 97.6d. The protein in the soil amended with 1.25 μg/g could be still detectable after incubation of 345d; the degradation of purified Bt protein in Coastal saline soil and Aquic light saline sandy soil were faster. Their half-lives were 19.6 d and 15.2 d, respecitvely. The residue time of Bt purified protein in the soils was all more than 150 d. (authors)

  20. No evidence for change in oviposition behaviour of Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) after widespread adoption of transgenic insecticidal cotton.

    Science.gov (United States)

    Zalucki, M P; Cunningham, J P; Downes, S; Ward, P; Lange, C; Meissle, M; Schellhorn, N A; Zalucki, J M

    2012-08-01

    Cotton growing landscapes in Australia have been dominated by dual-toxin transgenic Bt varieties since 2004. The cotton crop has thus effectively become a sink for the main target pest, Helicoverpa armigera. Theory predicts that there should be strong selection on female moths to avoid laying on such plants. We assessed oviposition, collected from two cotton-growing regions, by female moths when given a choice of tobacco, cotton and cabbage. Earlier work in the 1980s and 1990s on populations from the same geographic locations indicated these hosts were on average ranked as high, mid and low preference plants, respectively, and that host rankings had a heritable component. In the present study, we found no change in the relative ranking of hosts by females, with most eggs being laid on tobacco, then cotton and least on cabbage. As in earlier work, some females laid most eggs on cotton and aspects of oviposition behaviour had a heritable component. Certainly, cotton is not avoided as a host, and the implications of these finding for managing resistance to Bt cotton are discussed.

  1. Impacto do algodoeiro Bt na dinâmica populacional do pulgão-do-algodoeiro em casa de vegetação Impact of Bt cotton on the population dynamics of the cotton aphid in greenhouse

    Directory of Open Access Journals (Sweden)

    Edison Ryoiti Sujii

    2008-10-01

    Full Text Available O objetivo deste trabalho foi desenvolver um protocolo experimental para avaliar o impacto do algodoeiro Bt na bionomia e na escolha de plantas para colonização pelo pulgão-do-algodoeiro (Aphis gossypii. A bionomia do pulgão foi avaliada em casa de vegetação com insetos criados em gaiolas individuais com plantas de algodão Bt, da variedade DP 404 BG (Bollgard, ou sua isolinha não transformada DP 4049. Gaiolas contendo vasos com plantas de algodoeiro Bt e não-Bt foram usadas como arena de escolha, para a avaliação de preferência de adultos alados. O período pré-reprodutivo e reprodutivo, a longevidade, a curva de sobrevivência, a produção de prole total e diária por fêmea e a curva acumulada de produção de prole da população não apresentaram diferenças significativas. Não foi observada diferença na escolha de plantas para colonização por indivíduos alados, o que indica taxas equivalentes de colonização nas populações iniciais. O algodoeiro Bt não afeta a dinâmica populacional de A. gossypii e não aumenta seu potencial de risco como praga.The objective of this work was to develop an experimental protocol to assess the impact of Bt cotton on bionomics and on plant choice for Aphis gossypii colonization. The bionomics of the cotton aphid was assessed in greenhouse with insects reared in individual cages containing Bt cotton plants of the variety DP 404 BG (Bollgard or its nontransformed isoline DP 4049. Cages with Bt cotton and non-Bt cotton were used as choosing arena for evaluation of winged adults preference. There was no significant difference for pre-reproduction period (immature phase, reproduction period, longevity, survivorship curve total and daily production of offspring by female, and curve of accumulated production of offspring by the population. There was no preference of colonization for any plant by winged adults, which indicates equivalent rates of colonization of the initial populations. Bt

  2. Adoption of Bt Cotton: Threats and Challenges Adopción de Algodón Bt: Desafíos y Amenazas

    Directory of Open Access Journals (Sweden)

    Muhammad Faisal Bilal

    2012-09-01

    Full Text Available Adopting new technology always involves advantages and risks; Bt cotton (Gossypium hirsutum L. is a new technology well known in developed countries for its many advantages, such as reduced pesticide application, better insect pest control, and higher lint yield. However, its success in developing countries is still a question mark. Global adoption of Bt cotton has risen dramatically from 0.76 million ha when introduced in 1996 to 7.85 million ha in the 2005 cotton-growing season where 54% of the cotton crops in the USA, 76% in China, and 80% in Australia were grown with single or multiple Bt genes. Bollworms are serious cotton pests causing 30-40% yield reduction in Pakistan and 20-66% potential crop losses in India. The major advances shown in this review include: (1 Evolution of Bt cotton may prove to be a green revolution to enhance cotton yield; (2 adoption of Bt cotton by farmers is increasing due to its beneficial environmental effects by reducing pesticide application: however, a high seed price has compelled farmers to use illegal non-approved Bt causing huge damage to crops because of low tolerance to insect pests; and (3 some factors responsible for changes in the efficiency of the Bt gene and Bt cotton yield include internal phenology (genetics, atmospheric changes (CO2 concentration, nutrition, insect pests, boll distribution pattern, disease and nematodes, removal of fruiting branch and/or floral bud, introduction of Bt gene, and terpenoids and tannin production in the plant body.La adopción de nueva tecnología siempre involucra ventajas y riesgos; algodón Bt (Gossypium hirsutum L. es una nueva tecnología bien conocida en países desarrollados por muchas ventajas como reducida aplicación de pesticidas, mejor control de insectos plaga, y mayor producción de fibra, pero su éxito en países en desarrollo aún conlleva dudas. La adopción global de algodón Bt ha aumentado dramáticamente de 0,76 millones de hectáreas en su

  3. Changes in Actinomycetes community structure under the influence of Bt transgenic brinjal crop in a tropical agroecosystem.

    Science.gov (United States)

    Singh, Amit Kishore; Singh, Major; Dubey, Suresh Kumar

    2013-05-29

    The global area under brinjal cultivation is expected to be 1.85 million hectare with total fruit production about 32 million metric tons (MTs). Brinjal cultivars are susceptible to a variety of stresses that significantly limit productivity. The most important biotic stress is caused by the Brinjal fruit and shoot Borer (FSB) forcing farmers to deploy high doses of insecticides; a matter of serious health concern. Therefore, to control the adverse effect of insecticides on the environment including the soil, transgenic technology has emerged as the effective alternative. However, the reports, regarding the nature of interaction of transgenic crops with the native microbial community are inconsistent. The effect of a Bt transgenic brinjal expressing the bio-insecticidal protein (Cry1Ac) on the rhizospheric community of actinomycetes has been assessed and compared with its non-transgenic counterpart. Significant variation in the organic carbon observed between the crops (non-Bt and Bt brinjal) may be due to changes in root exudates quality and composition mediated by genetic attributes of Bt transgenic brinjal. Real time quantitative PCR indicated significant differences in the actinomycetes- specific 16S rRNA gene copy numbers between the non-Bt (5.62-27.86) × 1011 g-1 dws and Bt brinjal planted soil (5.62-24.04) × 1011 g-1 dws. Phylogenetic analysis indicated 14 and 11, actinomycetes related groups in soil with non-Bt and Bt brinjal crop, respectively. Micrococaceaea and Nocardiodaceae were the dominant groups in pre-vegetation, branching, flowering, maturation and post-harvest stage. However, Promicromonosporaceae, Streptosporangiaceae, Mycobacteriaceae, Geodermatophilaceae, Frankiaceae, Kineosporaceae, Actisymmetaceae and Streptomycetaceae were exclusively detected in a few stages in non-Bt brinjal rhizosphere soil while Nakamurellaceae, Corynebactericeae, Thermomonosporaceae and Pseudonocardiaceae in Bt brinjal counterpart. Field trails envisage

  4. Bt-transgenic oilseed rape hybridization with its weedy relative, Brassica rapa.

    Science.gov (United States)

    Halfhill, Matthew D; Millwood, Reginald J; Raymer, Paul L; Stewart, C Neal

    2002-10-01

    The movement of transgenes from crops to weeds and the resulting consequences are concerns of modern agriculture. The possible generation of "superweeds" from the escape of fitness-enhancing transgenes into wild populations is a risk that is often discussed, but rarely studied. Oilseed rape, Brassica napus (L.), is a crop with sexually compatible weedy relatives, such as birdseed rape (Brassica rapa (L.)). Hybridization of this crop with weedy relatives is an extant risk and an excellent interspecific gene flow model system. In laboratory crosses, T3 lines of seven independent transformation events of Bacillus thuringiensis (Bt) oilseed rape were hybridized with two weedy accessions of B. rapa. Transgenic hybrids were generated from six of these oilseed rape lines, and the hybrids exhibited an intermediate morphology between the parental species. The Bt transgene was present in the hybrids, and the protein was synthesized at similar levels to the corresponding independent oilseed rape lines. Insect bioassays were performed and confirmed that the hybrid material was insecticidal. The hybrids were backcrossed with the weedy parent, and only half the oilseed rape lines were able to produce transgenic backcrosses. After two backcrosses, the ploidy level and morphology of the resultant plants were indistinguishable from B. rapa. Hybridization was monitored under field conditions (Tifton, GA, USA) with four independent lines of Bt oilseed rape with a crop to wild relative ratio of 1200:1. When B. rapa was used as the female parent, hybridization frequency varied among oilseed rape lines and ranged from 16.9% to 0.7%.

  5. Distribuição espacial de Aphis gossypii (Glover (Hemiptera, Aphididae e Bemisia tabaci (Gennadius biótipo B (Hemiptera, Aleyrodidae em algodoeiro Bt e não-Bt Spatial distribution of Aphis gossypii (Glover (Hemiptera, Aphididae and Bemisia tabaci (Gennadius biotype B (Hemiptera, Aleyrodidae on Bt and non-Bt cotton

    Directory of Open Access Journals (Sweden)

    Tatiana Rojas Rodrigues

    2010-03-01

    improving the sampling techniques and revealing differences in the behavior of non-target species between both cultivars. So, this experiment aimed to investigate the spatial distribution pattern of those species on the conventional non-Bt cotton crop, compared to the Bt cultivar. The samplings took place in two areas of 5.000 m² each, where it was done 14 evaluations counting adults of white-flies and colonies of aphids. The aggregation indexes (variance/mean rate, index of Morisita and Exponent k of the Negative Binomial Distribution were calculated and accomplished the fitness tests of the individuals' numeric classes found and expected to the theoretical distributions of frequency (Poisson, Negative Binomial and Positive Binomial. Those analyses showed that in both cultivars, the spatial distribution of B. tabaci fitted to negative binomial distribution throughout the study period, indicating that the transgenic cultivar did not influence the pattern of aggregate distribution of this insect. With respect to the analysis for A. gossypii, the aggregation indexes showed aggregated distribution in both cultivars, but the distributions of frequency pointed to the occurrence of aggregate distribution only on conventional cotton, since there was no adjustment to the data on Bt crop. This indicates that Bt cotton has altered the aphids normal pattern of dispersion in the crop.

  6. Effects of seed mixture sowing with transgenic Bt rice and its parental line on the population dynamics of target stemborers and leafrollers, and non-target planthoppers.

    Science.gov (United States)

    Li, Zhuo; Li, Li-Kun; Liu, Bin; Wang, Long; Parajulee, Megha N; Chen, Fa-Jun

    2018-01-24

    The widespread planting of insect-resistant crops has caused a dramatic shift in agricultural landscapes, thus raising concerns about the potential impacts on both target and non-target pests. In this study, we examined the potential effects of intra-specific seed mixture sowing with transgenic Bt rice (Bt) and its parental non-transgenic line (Nt) (100% Bt rice [Bt 100 ], 5% Nt+95% Bt [Nt 05 Bt 95 ], 10% Nt+90% Bt [Nt 10 Bt 90 ], 20% Nt+80% Bt [Nt 20 Bt 80 ], 40% Nt+60% Bt [Nt 40 Bt 60 ] and 100% Nt rice [Nt 100 ]) on target and non-target pests in a 2-year field trial in southern China. The occurrence of target pests, Sesamia inferens, Chilo suppressalis and Cnaphalocrocis medinalis, decreased with the increased ratio of Bt rice, and the mixture ratios with more than 90% Bt rice (Bt 100 and Nt 05 Bt 95 ) significantly increased the pest suppression efficiency, with the lowest occurrences of non-target planthoppers, Nilaparvata lugens and Sogatella furcifera in Nt 100 and Nt 05 Bt 95 . Furthermore, there were no significant differences in 1000-grain dry weight and grain dry weight per 100 plants between Bt 100 and Nt 05 Bt 95 . Seed mixture sowing of Bt rice with ≤10% (especially 5%) of its parent line was sufficient to overcome potential compliance issues that exist with the use of block or structured refuge to provide most effective control of both target and non-target pests without compromising the grain yield. It is also expected that the strategy of seed mixture sowing with transgenic Bt rice and the non-transgenic parental line would provide rice yield stability while decreasing the insecticide use frequency in rice production. © 2018 Institute of Zoology, Chinese Academy of Sciences.

  7. Difference in leaf water use efficiency/photosynthetic nitrogen use efficiency of Bt-cotton and its conventional peer.

    Science.gov (United States)

    Guo, Ruqing; Sun, Shucun; Liu, Biao

    2016-09-15

    This study is to test the effects of Bt gene introduction on the foliar water/nitrogen use efficiency in cotton. We measured leaf stomatal conductance, photosynthetic rate, and transpiration rate under light saturation condition at different stages of a conventional cultivar (zhongmian no. 16) and its counterpart Bt cultivar (zhongmian no. 30) that were cultured on three levels of fertilization, based on which leaf instantaneous water use efficiency was derived. Leaf nitrogen concentration was measured to calculate leaf photosynthetic nitrogen use efficiency, and leaf δ(13)C was used to characterize long term water use efficiency. Bt cultivar was found to have lower stomatal conductance, net photosynthetic rates and transpiration rates, but higher instantaneous and long time water use efficiency. In addition, foliar nitrogen concentration was found to be higher but net photosynthetic rate was lower in the mature leaves of Bt cultivar, which led to lower photosynthetic nitrogen use efficiency. This might result from the significant decrease of photosynthetic rate due to the decrease of stomatal conductance. In conclusion, our findings show that the introduction of Bt gene should significantly increase foliar water use efficiency but decrease leaf nitrogen use efficiency in cotton under no selective pressure.

  8. Cry1Ab protein from Bt transgenic rice does not residue in rhizosphere soil

    International Nuclear Information System (INIS)

    Wang Haiyan; Ye Qingfu; Wang Wei; Wu Licheng; Wu Weixiang

    2006-01-01

    Expression of Cry1Ab protein in Bt transgenic rice (KMD) and its residue in the rhizosphere soil during the whole growth in field, as well as degradation of the protein from KMD straw in five soils under laboratory incubation were studied. The residue of Cry1Ab protein in KMD rhizosphere soil was undetectable (below the limit of 0.5 ng/g air-dried soil). The Cry1Ab protein contents in the shoot and root of KMD were 3.23-8.22 and 0.68-0.89 μg/g (fresh weight), respectively. The half-lives of the Cry1Ab protein in the soils amended with KMD straw (4%, w/w) ranged from 11.5 to 34.3 d. The residence time of the protein varied significantly in a Fluvio-marine yellow loamy soil amended with KMD straw at the rate of 3, 4 and 7%, with half-lives of 9.9, 13.8 and 18 d, respectively. In addition, an extraction method for Cry1Ab protein in soil was developed, with extraction efficiencies of 46.4-82.3%. - Cry1Ab protein was not detected in the rhizosphere soil of field-grown Bt transgenic rice

  9. Developmental immunotoxicity is not associated with the consumption of transgenic Bt rice TT51 in rats.

    Science.gov (United States)

    Hu, Jing; Liang, Chunlai; Zhang, Xiaopeng; Zhang, Qiannan; Cui, Wenming; Yu, Zhou

    2018-04-01

    TT51 is a transgenic strain of Bt rice generated by fusing a synthetic CryAb/Ac gene into MingHui rice. In this study, rats from F0, F1, and F2 generations were fed a diet with 60% TT51 rice, MingHui rice, or nominal-origin rice. The study focused on developmental immunotoxicity in F1 and F2 offspring after long-term consumption of TT51. A wide range of immunological parameters was monitored in this two-generation study on reproductive toxicity. The experiments were performed on F1 and F2 offspring at postnatal days 21 and 42. No adverse clinical effects were observed in any of the experimental groups. In addition, histopathology observations and immunotoxicity tests, including hematological indicators, spleen lymphocyte subsets, natural killer cell activity, lymphoproliferative response, and plaque-forming cell assay, revealed no significant difference between the groups. These results indicated that developmental immunotoxicity was not associated with a diet of transgenic Bt rice TT51, compared to the parental MingHui rice. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Distribution and Potential Impact of Feral Cotton on the ...

    African Journals Online (AJOL)

    Transgenic Bt cotton with insecticidal properties presents a potential solution to the bollworm infestation in Tanzania. However, concerns associated with transgenic crops viz.; transgene flow to wild and feral relatives, increased potential for resistance evolution, need to be addressed prior to adoption of any transgenic crop.

  11. Field trials to evaluate effects of continuously planted transgenic insect-resistant cottons on soil invertebrates.

    Science.gov (United States)

    Li, Xiaogang; Liu, Biao; Wang, Xingxiang; Han, Zhengmin; Cui, Jinjie; Luo, Junyu

    2012-03-01

    Impacts on soil invertebrates are an important aspect of environmental risk assessment and post-release monitoring of transgenic insect-resistant plants. The purpose of this study was to research and survey the effects of transgenic insect-resistant cottons that had been planted over 10 years on the abundance and community structure of soil invertebrates under field conditions. During 3 consecutive years (2006-2008), eight common taxa (orders) of soil invertebrates belonging to the phylum Arthropoda were investigated in two different transgenic cotton fields and one non-transgenic cotton field (control). Each year, soil samples were taken at four different growth stages of cotton (seedling, budding, boll forming and boll opening). Animals were extracted from the samples using the improved Tullgren method, counted and determined to the order level. The diversity of the soil fauna communities in the different fields was compared using the Simpson's, Shannon's diversity indices and evenness index. The results showed a significant sampling time variation in the abundance of soil invertebrates monitored in the different fields. However, no difference in soil invertebrate abundance was found between the transgenic cotton fields and the control field. Both sampling time and cotton treatment had a significant effect on the Simpson's, Shannon's diversity indices and evenness index. They were higher in the transgenic fields than the control field at the growth stages of cotton. Long-term cultivation of transgenic insect-resistant cottons had no significant effect on the abundance of soil invertebrates. Collembola, Acarina and Araneae could act as the indicators of soil invertebrate in this region to monitor the environmental impacts of transgenic plants in the future. This journal is © The Royal Society of Chemistry 2012

  12. Performance of some transgenic cotton cultivars against insect pest complex, virus incidence and yield

    International Nuclear Information System (INIS)

    Babar, T.K.; Karar, H.; Hasnain, M.; Saleem, M.; Ali, A.

    2013-01-01

    Five cultivars of cotton i.e., IR4-NIBGE, IR5-NIBGE Bt-121, Sitara-10M and Sitara-11M were screened for resistance against insect pest complex and Cotton Leaf Curl Virus (CLCuV) incidence in the research area of Cotton Research Station, Multan. The result depicted that the most resistant variety against jassids was IR4-NIBGE and Sitara-11M whereas IR4-NIBGE showed the maximum resistance against whitefly infestation. The least susceptible variety to the infestation of thrips was Sitara-10M. The most susceptible variety to the prevalence of Red Cotton Bug (RCB) was IR4-NIBGE. The genotype Bt-121 showed the attack of spotted bollworm. The high population of Dusky Cotton Bug (DCB) was observed on Bt-121 throughout the season. The incidence of virus percentage increased with the passage of time; however, the variety IR5-NIBGE exhibited maximum level of tolerance. Variety Bt-121 gave the maximum yield i.e., 1852 kg per acre followed by IR5-NIBGE, Sitara-11M, Sitara-10M 1584, 1503, 1466 kg per acre respectively. Our results suggest that IR4-NIBGE and Sitara -11M are comparatively tolerant to jassids and whitefly which are the yield losing pest. So IR4-NIBGE and Sitara -11M varieties can be included in IPM programme for the management of these voracious pests. (author)

  13. Transgenic Cotton Plants Expressing the HaHR3 Gene Conferred Enhanced Resistance to Helicoverpa armigera and Improved Cotton Yield.

    Science.gov (United States)

    Han, Qiang; Wang, Zhenzhen; He, Yunxin; Xiong, Yehui; Lv, Shun; Li, Shupeng; Zhang, Zhigang; Qiu, Dewen; Zeng, Hongmei

    2017-08-30

    RNA interference (RNAi) has been developed as an efficient technology. RNAi insect-resistant transgenic plants expressing double-stranded RNA (dsRNA) that is ingested into insects to silence target genes can affect the viability of these pests or even lead to their death. HaHR3 , a molt-regulating transcription factor gene, was previously selected as a target expressed in bacteria and tobacco plants to control Helicoverpa armigera by RNAi technology. In this work, we selected the dsRNA- HaHR3 fragment to silence HaHR3 in cotton bollworm for plant mediated-RNAi research. A total of 19 transgenic cotton lines expressing HaHR3 were successfully cultivated, and seven generated lines were used to perform feeding bioassays. Transgenic cotton plants expressing ds HaHR3 were shown to induce high larval mortality and deformities of pupation and adult eclosion when used to feed the newly hatched larvae, and 3rd and 5th instar larvae of H. armigera . Moreover, HaHR3 transgenic cotton also demonstrated an improved cotton yield when compared with controls.

  14. Increased frequency of pink bollworm resistance to Bt toxin Cry1Ac in China.

    Directory of Open Access Journals (Sweden)

    Peng Wan

    Full Text Available Transgenic crops producing insecticidal proteins from Bacillus thuringiensis (Bt kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The main approach for delaying pest adaptation to Bt crops uses non-Bt host plants as "refuges" to increase survival of susceptible pests. To delay evolution of pest resistance to transgenic cotton producing Bt toxin Cry1Ac, the United States and some other countries have required refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. The "natural" refuge strategy focuses on cotton bollworm (Helicoverpa armigera, the primary target of Bt cotton in China that attacks many crops, but it does not apply to another major pest, pink bollworm (Pectinophora gossypiella, which feeds almost entirely on cotton in China. Here we report data showing field-evolved resistance to Cry1Ac by pink bollworm in the Yangtze River Valley of China. Laboratory bioassay data from 51 field-derived strains show that the susceptibility to Cry1Ac was significantly lower during 2008 to 2010 than 2005 to 2007. The percentage of field populations yielding one or more survivors at a diagnostic concentration of Cry1Ac increased from 0% in 2005-2007 to 56% in 2008-2010. However, the median survival at the diagnostic concentration was only 1.6% from 2008 to 2010 and failure of Bt cotton to control pink bollworm has not been reported in China. The early detection of resistance reported here may promote proactive countermeasures, such as a switch to transgenic cotton producing toxins distinct from Cry1A toxins, increased planting of non-Bt cotton, and integration of other management tactics together with Bt cotton.

  15. Cadmium-induced functional and ultrastructural alterations in roots of two transgenic cotton cultivars

    Energy Technology Data Exchange (ETDEWEB)

    Daud, M.K.; Sun, Yuqiang; Dawood, M. [Department of Agronomy, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310029 (China); Hayat, Y. [Institute of Bioinformatics, Zhejiang University, Hangzhou 310029 (China); Variath, M.T.; Wu Yuxiang [Department of Agronomy, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310029 (China); Raziuddin [Department of Agronomy, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310029 (China); Plant Breeding and Genetics Department, NWFP Agricultural University Peshawar, Peshawar (Pakistan); Mishkat, Ullah [Zoological Sciences Division, Pakistan Museum of Natural History, Garden Avenue, Shakarparian, Islamabad 44000 (Pakistan); Salahuddin [District Agriculture Extension Offices, Bannu Road, Dera Ismail Khan (NWFP) (Pakistan); Najeeb, Ullah [Department of Agronomy, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310029 (China); Zhu, Shuijin [Department of Agronomy, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310029 (China)], E-mail: shjzhu@zju.edu.cn

    2009-01-15

    The toxic effect of cadmium (Cd) at increasing concentrations was studied with special attention being given to the root morphological and ultrastructural changes in two transgenic cotton cultivars viz. BR001 and GK30 and their wild relative viz. Coker 312. In comparison to their respective controls, low concentration (10 and 100 {mu}M) of Cd greatly stimulated seed germination, while it was inhibited by highest concentration of Cd (1000 {mu}M) in case of two transgenic cultivars. However, in Coker 312 the seed germination percentage progressively decreased over the control at all Cd levels. Various physiological and morphological parameters of the root and whole plant in both transgenic cotton cultivars and their relative wild cotton genotype respond differently towards the Cd toxicity. Bioavailability of Cd was concentration-dependent where seedling root captured more Cd as compared to shoot. BR001 accumulated more Cd followed by GK30, while Coker 312 was less Cd accumulator. The ultrastructural modifications in the root tip cells of both the transgenic cotton cultivars and their wild relative were also dose-dependent. With the increase in Cd levels, the fine structures of their root cells also invariably changed. Increase in plasmolysis of the plasma membrane, greater number of nucleoli and vacuoles and enlarged vacuoles could be observed in both transgenic cotton cultivars. In comparison to them, Coker 312 showed relatively well developed ultrastructures of the root tips except enlarged vacuoles and greater number of mitochondria. Moreover, the accumulation of Cd in the form of electron dense granules and crystals both in vacuoles and attached to cell walls were visible in both transgenic cotton cultivars and their wild relative. These results suggest that both transgenic cotton cultivars and their wild relative cotton genotype responded positively towards Cd stress at seedling stage, the internal Cd-detoxification might be through apoplastic and symplastic

  16. Cadmium-induced functional and ultrastructural alterations in roots of two transgenic cotton cultivars

    International Nuclear Information System (INIS)

    Daud, M.K.; Sun, Yuqiang; Dawood, M.; Hayat, Y.; Variath, M.T.; Wu Yuxiang; Raziuddin; Mishkat, Ullah; Salahuddin; Najeeb, Ullah; Zhu, Shuijin

    2009-01-01

    The toxic effect of cadmium (Cd) at increasing concentrations was studied with special attention being given to the root morphological and ultrastructural changes in two transgenic cotton cultivars viz. BR001 and GK30 and their wild relative viz. Coker 312. In comparison to their respective controls, low concentration (10 and 100 μM) of Cd greatly stimulated seed germination, while it was inhibited by highest concentration of Cd (1000 μM) in case of two transgenic cultivars. However, in Coker 312 the seed germination percentage progressively decreased over the control at all Cd levels. Various physiological and morphological parameters of the root and whole plant in both transgenic cotton cultivars and their relative wild cotton genotype respond differently towards the Cd toxicity. Bioavailability of Cd was concentration-dependent where seedling root captured more Cd as compared to shoot. BR001 accumulated more Cd followed by GK30, while Coker 312 was less Cd accumulator. The ultrastructural modifications in the root tip cells of both the transgenic cotton cultivars and their wild relative were also dose-dependent. With the increase in Cd levels, the fine structures of their root cells also invariably changed. Increase in plasmolysis of the plasma membrane, greater number of nucleoli and vacuoles and enlarged vacuoles could be observed in both transgenic cotton cultivars. In comparison to them, Coker 312 showed relatively well developed ultrastructures of the root tips except enlarged vacuoles and greater number of mitochondria. Moreover, the accumulation of Cd in the form of electron dense granules and crystals both in vacuoles and attached to cell walls were visible in both transgenic cotton cultivars and their wild relative. These results suggest that both transgenic cotton cultivars and their wild relative cotton genotype responded positively towards Cd stress at seedling stage, the internal Cd-detoxification might be through apoplastic and symplastic binding

  17. Both point mutations and low expression levels of the nicotinic acetylcholine receptor β1 subunit are associated with imidacloprid resistance in an Aphis gossypii (Glover) population from a Bt cotton field in China.

    Science.gov (United States)

    Chen, Xuewei; Li, Fen; Chen, Anqi; Ma, Kangsheng; Liang, Pingzhuo; Liu, Ying; Song, Dunlun; Gao, Xiwu

    2017-09-01

    Aphis gossypii Glover is a destructive pest of numerous crops throughout the world. Although the expansion of Bt cotton cultivation has helped to control some insect pests, the damage from cotton aphids has not been mitigated. The evolution of aphid resistance to imidacloprid has made its chemical control more difficult since its introduction in 1991. Field populations of A. gossypii that were collected from different transgenic (Bt) cotton planting areas of China in 2014 developed different levels of resistance to imidacloprid. The IMI_R strain has developed high resistance to imidacloprid with the resistance ratio >1200-fold. Compared with the susceptible IMI_S strain, the IMI_R strain also developed a high level cross resistance to sulfoxaflor and acetamiprid. The limited synergism with either PBO or DEF suggests that resistance may be due to the site mutation of molecular target rather than to enhanced detoxification. Three target-site mutations within the nicotinic acetylcholine receptor (nAChR) β1 subunit were detected in the IMI_R strain. The R81T mutation has been reported to be responsible for imidacloprid resistance in A. gossypii and M. persicae. Both V62I and K264E were first detected in A. gossypii. These point mutations are also present in field populations, suggesting that they play a role in the resistance to imidacloprid. Furthermore, the expression level of transcripts encoding β1 subunit was decreased significantly in the IMI_R strain compared with the IMI_S strain, suggesting that both point mutations and the down-regulation of nAChR β1 subunit expression may be involved in the resistance mechanism for imidacloprid in A. gossypii. These results should be useful for the management of imidacloprid-resistant cotton aphids in Bt cotton fields in China. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Effects of 90-Day Feeding of Transgenic Maize BT799 on the Reproductive System in Male Wistar Rats

    Directory of Open Access Journals (Sweden)

    Qian-ying Guo

    2015-12-01

    Full Text Available BT799 is a genetically modified (GM maize plant that expresses the Cry1Ac gene from Bacillus thuringiensis (Bt. The Cry1Ac gene was introduced into maize line Zhen58 to encode the Bt crystal protein and thus produce insect-resistant maize BT799. Expression of Bt protein in planta confers resistance to Lepidopteran pests and corn rootworms. The present study was designed to investigate any potential effects of BT799 on the reproductive system of male rats and evaluate the nutritional value of diets containing BT799 maize grain in a 90-day subchronic rodent feeding study. Male Wistar rats were fed with diets containing BT799 maize flours or made from its near isogenic control (Zhen58 at a concentration of 84.7%, nutritionally equal to the standard AIN-93G diet. Another blank control group of male rats were treated with commercial AIN-93G diet. No significant differences in body weight, hematology and serum chemistry results were observed between rats fed with the diets containing transgenic BT799, Zhen58 and the control in this 13-week feeding study. Results of serum hormone levels, sperm parameters and relative organ/body weights indicated no treatment-related side effects on the reproductive system of male rats. In addition, no diet-related changes were found in necropsy and histopathology examinations. Based on results of the current study, we did not find any differences in the parameters tested in our study of the reproductive system of male rats between BT799 and Zhen58 or the control.

  19. Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.

    Directory of Open Access Journals (Sweden)

    Liping Ke

    Full Text Available Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel. In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L and bentazon (4.2 µmol. A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.

  20. Inheritance and segregation of exogenous genes in transgenic cotton

    Indian Academy of Sciences (India)

    1Key Laboratory of Cotton Genetic Improvement of the Ministry of Agriculture, Cotton Research Institute, Chinese. Academy of Agricultural Sciences, Anyang Henan 455 112, People's Republic of China. 2Institute ..... Athens, Greece. Xie D. X. ...

  1. Survival and Development of Spodoptera frugiperda and Chrysodeixis includens (Lepidoptera: Noctuidae) on Bt Cotton and Implications for Resistance Management Strategies in Brazil.

    Science.gov (United States)

    Sorgatto, Rodrigo J; Bernardi, Oderlei; Omoto, Celso

    2015-02-01

    In Brazil, Spodoptera frugiperda (J. E. Smith) and Chrysodeixis includens (Walker) are important cotton pests and target of control of Bollgard II (Cry1Ac/Cry2Ab2) and WideStrike (Cry1Ac/Cry1F) cotton technologies. To subsidize an insect resistance management program, we conducted laboratory studies to evaluate the toxicity of these Bt cotton plants throughout larval development of S. frugiperda and C. includens. In bioassays with leaf disc, the efficacy of both Bt cotton plants against neonates was >80% for S. frugiperda and 100% for C. includens. However, S. frugiperda larvae that survived on Bt cotton had >76% of growth inhibition and stunting. In bioassays with S. frugiperda and C. includens larvae fed on non-Bt near-isoline during different time period (from 3 to 18 d) and then transferred to Bollgard II or WideStrike leaves showed that larval susceptibility decreased as larval age increased. For Bollgard II cotton, in all S. frugiperda instars, there were larvae that reached the pupal and adult stages. In contrast, on WideStrike cotton, a few larvae in fifth and sixth instar completed the biological cycle. For C. includens, some larvae in sixth instar originated adults in both Bt cotton plants. In conclusion, Bollgard II and WideStrike cotton technologies showed high efficacy against neonates of S. frugiperda and C. includens. However, the mortality of these species decreases as larval age increase, allowing insect survival in a possible seed mixture environment and favoring the resistance evolution. © The Author 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. A comprehensive assessment of the effects of Bt cotton on Coleomegilla maculata demonstrates no detrimental effects by Cry1Ac and Cry2Ab.

    Directory of Open Access Journals (Sweden)

    Yunhe Li

    Full Text Available The ladybird beetle, Coleomegilla maculata (DeGeer, is a common and abundant predator in many cropping systems. Its larvae and adults are predaceous, feeding on aphids, thrips, lepidopteran larvae and plant tissues, such as pollen. Therefore, this species is exposed to insecticidal proteins expressed in insect-resistant, genetically engineered cotton expressing Cry proteins derived from Bacillus thuringiensis (Bt. A tritrophic bioassay was conduced to evaluate the potential impact of Cry2Ab- and Cry1Ac-expressing cotton on fitness parameters of C. maculata using Bt-susceptible and -resistant larvae of Trichoplusia ni as prey. Coleomegilla maculata survival, development time, adult weight and fecundity were not different when they were fed with resistant T. ni larvae reared on either Bt or control cotton. To ensure that C. maculata were not sensitive to the tested Cry toxins independent from the plant background and to add certainty to the hazard assessment, C. maculata larvae were fed artificial diet incorporated with Cry2Ab, Cry1Ac or both at >10 times higher concentrations than in cotton tissue. Artificial diet containing E-64 was included as a positive control. No differences were detected in any life-table parameters between Cry protein-containing diet treatments and the control diet. In contrast, larvae of C. maculata fed the E-64 could not develop to the pupal stage and the 7-d larval weight was significantly negatively affected. In both feeding assays, the stability and bioactivity of Cry proteins in the food sources were confirmed by ELISA and sensitive-insect bioassays. Our results show that C. maculata is not affected by Bt cotton and is not sensitive to Cry2Ab and Cry1Ac at concentrations exceeding the levels in Bt cotton, thus demonstrating that Bt cotton will pose a negligible risk to C. maculata. More importantly, this study demonstrates a comprehensive system for assessing the risk of genetically modified plants on non

  3. Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines

    Directory of Open Access Journals (Sweden)

    Allah BAKHSH

    2012-11-01

    Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.

  4. Transgenic Cotton Plants Expressing Double-stranded RNAs Target HMG-CoA Reductase (HMGR) Gene Inhibits the Growth, Development and Survival of Cotton Bollworms.

    Science.gov (United States)

    Tian, Geng; Cheng, Linlin; Qi, Xuewei; Ge, Zonghe; Niu, Changying; Zhang, Xianlong; Jin, Shuangxia

    2015-01-01

    RNA interference (RNAi) has been developed as a powerful technique in the research of functional genomics as well as plant pest control. In this report, double-stranded RNAs (dsRNA) targeting 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene, which catalyze a rate-limiting enzymatic reaction in the mevalonate pathway of juvenile hormone (JH) synthesis in cotton bollworm, was expressed in cotton plants via Agrobacterium tumefaciens-mediated transformation. PCR and Sothern analysis revealed the integration of HMGR gene into cotton genome. RT-PCR and qRT-PCR confirmed the high transcription level of dsHMGR in transgenic cotton lines. The HMGR expression both in transcription and translation level was significantly downregulated in cotton bollworms (helicoverpa armigera) larvae after feeding on the leaves of HMGR transgenic plants. The transcription level of HMGR gene in larvae reared on transgenic cotton leaves was as much as 80.68% lower than that of wild type. In addition, the relative expression level of vitellogenin (Vg, crucial source of nourishment for offspring embryo development) gene was also reduced by 76.86% when the insect larvae were fed with transgenic leaves. The result of insect bioassays showed that the transgenic plant harboring dsHMGR not only inhibited net weight gain but also delayed the growth of cotton bollworm larvae. Taken together, transgenic cotton plant expressing dsRNAs successfully downregulated HMGR gene and impaired the development and survival of target insect, which provided more option for plant pest control.

  5. Distribution and Metabolism of Bt-Cry1Ac Toxin in Tissues and Organs of the Cotton Bollworm, Helicoverpa armigera

    Directory of Open Access Journals (Sweden)

    Zhuoya Zhao

    2016-07-01

    Full Text Available Crystal (Cry proteins derived from Bacillus thuringiensis (Bt have been widely used in transgenic crops due to their toxicity against insect pests. However, the distribution and metabolism of these toxins in insect tissues and organs have remained obscure because the target insects do not ingest much toxin. In this study, several Cry1Ac-resistant strains of Helicoverpa armigera, fed artificial diets containing high doses of Cry1Ac toxin, were used to investigate the distribution and metabolism of Cry1Ac in their bodies. Cry1Ac was only detected in larvae, not in pupae or adults. Also, Cry1Ac passed through the midgut into other tissues, such as the hemolymph and fat body, but did not reach the larval integument. Metabolic tests revealed that Cry1Ac degraded most rapidly in the fat body, followed by the hemolymph, peritrophic membrane and its contents. The toxin was metabolized slowly in the midgut, but was degraded in all locations within 48 h. These findings will improve understanding of the functional mechanism of Bt toxins in target insects and the biotransfer and the bioaccumulation of Bt toxins in arthropod food webs in the Bt crop ecosystem.

  6. Resistance to dual-gene Bt maize in Spodoptera frugiperda: selection, inheritance, and cross-resistance to other transgenic events.

    Science.gov (United States)

    Santos-Amaya, Oscar F; Rodrigues, João V C; Souza, Thadeu C; Tavares, Clébson S; Campos, Silverio O; Guedes, Raul N C; Pereira, Eliseu J G

    2015-12-17

    Transgenic crop "pyramids" producing two or more Bacillus thuringiensis (Bt) toxins active against the same pest are used to delay evolution of resistance in insect pest populations. Laboratory and greenhouse experiments were performed with fall armyworm, Spodoptera frugiperda, to characterize resistance to Bt maize producing Cry1A.105 and Cry2Ab and test some assumptions of the "pyramid" resistance management strategy. Selection of a field-derived strain of S. frugiperda already resistant to Cry1F maize with Cry1A.105 + Cry2Ab maize for ten generations produced resistance that allowed the larvae to colonize and complete the life cycle on these Bt maize plants. Greenhouse experiments revealed that the resistance was completely recessive (Dx = 0), incomplete, autosomal, and without maternal effects or cross-resistance to the Vip3Aa20 toxin produced in other Bt maize events. This profile of resistance supports some of the assumptions of the pyramid strategy for resistance management. However, laboratory experiments with purified Bt toxin and plant leaf tissue showed that resistance to Cry1A.105 + Cry2Ab2 maize further increased resistance to Cry1Fa, which indicates that populations of fall armyworm have high potential for developing resistance to some currently available pyramided maize used against this pest, especially where resistance to Cry1Fa was reported in the field.

  7. Exploring the Resilience of Bt Cotton's ‘Pro-Poor Success Story’

    NARCIS (Netherlands)

    Glover, D.

    2010-01-01

    Expectations play a powerful role in driving technological change. Expectations are often encapsulated in narratives of technological promise that emphasize potential benefits and downplay potential negative impacts. Genetically modified (GM, transgenic) crops have been framed by expectations that

  8. Cry-Bt identifier: a biological database for PCR detection of Cry genes present in transgenic plants.

    Science.gov (United States)

    Singh, Vinay Kumar; Ambwani, Sonu; Marla, Soma; Kumar, Anil

    2009-10-23

    We describe the development of a user friendly tool that would assist in the retrieval of information relating to Cry genes in transgenic crops. The tool also helps in detection of transformed Cry genes from Bacillus thuringiensis present in transgenic plants by providing suitable designed primers for PCR identification of these genes. The tool designed based on relational database model enables easy retrieval of information from the database with simple user queries. The tool also enables users to access related information about Cry genes present in various databases by interacting with different sources (nucleotide sequences, protein sequence, sequence comparison tools, published literature, conserved domains, evolutionary and structural data). http://insilicogenomics.in/Cry-btIdentifier/welcome.html.

  9. The value of trust in biotech crop development: a case study of Bt cotton in Burkina Faso

    Directory of Open Access Journals (Sweden)

    Ezezika Obidimma C

    2012-11-01

    Full Text Available Abstract Background Agricultural biotechnology public-private partnerships (PPPs have been recognized as having great potential in improving agricultural productivity and increasing food production in sub-Saharan Africa. However, there is much public skepticism about the use of GM (genetically modified crops and suspicion about private sector involvement in agbiotech projects. This case study sought to understand the role of trust in the Bacillus thuringiensis (Bt cotton in Burkina Faso project by exploring practices and challenges associated with trust-building, and determining what makes these practices effective from the perspective of multiple stakeholders. Methods We conducted semi-structured, face-to-face interviews to obtain stakeholders’ understanding of trust in general as well as in the context of agbiotech PPPs. Relevant documents and articles were analyzed to generate descriptions of how trust was operationalized in this evolving agbiotech PPP. Data was analyzed based on emergent themes to create a comprehensive narrative on how trust is understood and built among the partners and with the community. Results We derived four key lessons from our findings. First, strong collaboration between research, industry and farmers greatly contributes to both the success of, and fostering of trust in, the partnership. Second, this case study also revealed the important, though often unrecognized, role of researchers as players in the communication strategy of the project. Third, effective and comprehensive communication takes into account issues such as illiteracy and diversity. Fourth, follow-up at the field level and the need for a multifaceted communications strategy is important for helping push the project forward. Conclusions Burkina Faso’s well-established and effective cotton selling system laid the foundation for the implementation of the Bt cotton project – particularly, the strong dialogue and the receptivity to collaboration

  10. Biological activity of Bt proteins expressed in different structures of transgenic corn against Spodoptera frugiperda

    Directory of Open Access Journals (Sweden)

    Daniel Bernardi

    2016-06-01

    Full Text Available ABSTRACT: Spodoptera frugiperda (J. E. Smith is the main target pest of Bt corn technologies, such as YieldGard VT PRO(tm (Cry1A.105/Cry2Ab2 and PowerCore(tm (Cry1A.105/Cry2Ab2/Cry1F. In this study, it was evaluated the biological activity of Bt proteins expressed in different plant structures of YieldGard VT PRO(tm and PowerCore(tm corn against S. frugiperda . Complete mortality of S. frugiperda neonates was observed on leaf-disc of both Bt corn technologies. However, the mortality in silks and grains was lower than 50 and 6%, respectively. In addition, more than 49% of the surviving larvae in silks and grains completed the biological cycle. However, all life table parameters were negatively affected in insects that developed in silks and grains of both Bt corn events. In summary, the low biological activity of Bt proteins expressed on silks and grains of YieldGard VT PRO(tm and PowerCore(tm corn can contribute to the resistance evolution in S. frugiperda populations.

  11. Transgenic cotton plants expressing Cry1Ia12 toxin confer resistance to fall armyworm (Spodoptera frugiperda and cotton boll weevil (Anthonomus grandis

    Directory of Open Access Journals (Sweden)

    Raquel Sampaio Oliveira

    2016-02-01

    Full Text Available Gossypium hirsutum (commercial cooton is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized with PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold. Also, a significant reduction of Anthonomus grandis emerging adults (up to 60% was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda and the Coleopteran (A. grandis insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

  12. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis).

    Science.gov (United States)

    de Oliveira, Raquel S; Oliveira-Neto, Osmundo B; Moura, Hudson F N; de Macedo, Leonardo L P; Arraes, Fabrício B M; Lucena, Wagner A; Lourenço-Tessutti, Isabela T; de Deus Barbosa, Aulus A; da Silva, Maria C M; Grossi-de-Sa, Maria F

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

  13. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis)

    Science.gov (United States)

    de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081

  14. Gone with transgenic cotton cropping in the USA. A perception of the presentations and interactions at the Beltwide Cotton Conferences, New Orleans (Louisiana, USA, 4-7/01/2010

    Directory of Open Access Journals (Sweden)

    Fok, M.

    2011-01-01

    Full Text Available The 2010 Beltwide Cotton Conferences provided a new vision of the consequences of about 15 years of widespread and uncoordinated cropping of transgenic cotton in the United States. Insect-resistant and/or herbicide-tolerant cotton varieties modified parasite complexes, namely those of insects and weeds damaging cotton crops. The Conferences have revealed that the adaptation solutions so far proposed make illusory the expectations at the launch of transgenic cotton, in terms of effective pest control, cost reduction, and antagonism between chemical and biotech methods. The USA case points out that the technical and economic sustainability of transgenic varieties must lie in a systemic and coordinated approach.

  15. Overexpression of cotton RAV1 gene in Arabidopsis confers transgenic plants high salinity and drought sensitivity.

    Science.gov (United States)

    Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao

    2015-01-01

    RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.

  16. Efficacy evaluation of selected herbicides on weed control and productivity evaluation of Bt cotton in Punjab.

    Science.gov (United States)

    Singh, Kulvir; Rathore, Pankaj

    2015-07-01

    Field experiments were conducted during Kharif 2012 and 2013 to evaluate the efficacy of different herbicides for weed management in cotton. Highest seed cotton yield (3537.3 kg ha(-1)) was recorded in weed free plots followed by pendimethalin @1.0 kg a.i ha(-1) as Pre.em.+quizalofopethyl @50 g a.i ha(-1) post-em at 2-4 weed leaf stage + one hoeing (3318.9 kg ha") owing to improved number of bolls per plant and boll weight. Statistically least yield was recorded underweedy check (1435.4 kg ha(-1)). Application of pyrithiobac sodium could not express any visible toxic effect on crop indicating its selectivity for cotton, although none of the tested new chemicals i.e., pyrithiobac sodium@ 62.5g a.i ha(-1) and quizalofopethyl @50g a.i ha(-1) when applied alone could not outperform the existing recommended chemicals for weed management. Yield losses to the extent of 6.2-59.4% were recorded due to weed competition. Weed control efficiency (WCE) was highest under weed free check (86.8%) followed by pendimethalin @1.0 kg a.i ha(-1) as Pre. em.+quizalofopethyl @50g a.i ha(-1), at 2-4 weed leaf stage + one hoeing (73.7%), whereas minimum values were for weedy check (24.7%). Though net returns (r94660 ha(-1)) were highest for weed free check but higher B:C ratio (2:11) was observed for pendimethalin @1.0 kg a.i ha(-1) as Pre em.+quizalofopethyl @50 g a.i ha(-1) post-em at 2-4 weed leaf stage+one hoeing. Therefore, for reasons such as labor shortage besides their timely availability, using these herbicides in combination with cultural practices could be the practical solution foreconomically efficient and effective weed management.

  17. Harmonized biosafety regulations are key to trust building in regional agbiotech partnerships: the case of the Bt cotton project in East Africa

    Directory of Open Access Journals (Sweden)

    Ezezika Obidimma C

    2012-11-01

    Full Text Available Abstract Background The Bacillus thuringiensis (Bt cotton public-private partnership (PPP project in East Africa was designed to gather baseline data on the effect of Bt cotton on biodiversity and the possibility of gene flow to wild cotton varieties. The results of the project are intended to be useful for Kenya, Uganda, and Tanzania when applying for biosafety approvals. Using the backdrop of the different biosafety regulations in the three countries, we investigate the role of trust in the Bt cotton partnership in East Africa. Methods Data were collected by reviewing relevant project documents and peer-reviewed articles on Bt cotton in Tanzania, Kenya and Uganda; conducting face-to-face interviews with key informants of the project; and conducting direct observations of the project. Data were analyzed based on recurring and emergent themes to create a comprehensive narrative on how trust is understood and built among the partners and with the community. Results We identified three factors that posed challenges to building trust in the Bt cotton project in East Africa: different regulatory regimes among the three countries; structural and management differences among the three partner institutions; and poor public awareness of GM crops and negative perceptions of the private sector. The structural and management differences were said to be addressed through joint planning, harmonization of research protocols, and management practices, while poor public awareness of GM crops and negative perceptions of the private sector were said to be addressed through open communication, sharing of resources, direct stakeholder engagement and awareness creation. The regulatory differences remained outside the scope of the project. Conclusions To improve the effectiveness of agbiotech PPPs, there is first a need for a regulatory regime that is acceptable to both the public and private sector partners. Second, early and continuous joint planning; sharing of

  18. No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities.

    Science.gov (United States)

    Lu, Z B; Tian, J C; Han, N S; Hu, C; Peng, Y F; Stanley, David; Ye, G Y

    2014-10-01

    A 2-yr field trial was conducted to assess the impacts of two new transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. All the arthropods were classified into five guilds, including herbivores, parasitoids, predators, detritivores, and others. The seasonal density and dominance distribution of each guild and community-level indices (species richness, Shannon-Wiener diversity index, Simpson diversity index, and evenness index) were compared among rice types. Principal response curves were used to investigate the differences of entire arthropod community of Bt rice plots relative to non-Bt rice plots. The results showed no significant difference was detected in the community-level indices and dominance distribution of guilds between Bt and non-Bt rice plots. The seasonal density of herbivores, detritivores, and others as well as density of the arthropod overall community were also not significantly affected by rice types in either year, although the density of predators and parasitoids in Bt rice plots was significantly lower than those in non-Bt rice plots. The lower abundances of Braconidae, Eulophidae, Cyrtorhinus lividipennis (Reuter) (Hemiptera: Miridae), and Theridiidae in Bt rice plots are likely attributed to the lower abundances of prey species or hosts. Principal response curves revealed that arthropod community in Bt was similar with that in non-Bt rice plots. In conclusion, our findings indicate that these two tested Bt rice lines had no marked negative effects on the arthropod community in the paddy fields.

  19. Exploring the resilience of Bt cotton's "pro-poor success story".

    Science.gov (United States)

    Glover, Dominic

    2010-01-01

    Expectations play a powerful role in driving technological change. Expectations are often encapsulated in narratives of technological promise that emphasize potential benefits and downplay potential negative impacts. Genetically modified (GM, transgenic) crops have been framed by expectations that they would be an intrinsically "pro-poor" innovation that would contribute powerfully to international agricultural development. However, expectations typically have to be scaled back in the light of experience. Published reviews of the socio-economic impacts of GM crops among poor, small-scale farmers in the developing world indicate that these effects have been very mixed and contingent on the agronomic, socio-economic and institutional settings where the technology has been applied. These conclusions should modulate expectations about the pro-poor potential of GM crop technology and focus attention on the conditions under which it might deliver substantial and sustainable benefits for poor farmers. However, the idea of GM crop technology as an intrinsically pro-poor developmental success story has been sustained in academic, public and policy arenas. This narrative depends upon an analysis that disembeds the technology from the technical, social and institutional contexts in which it is applied. Agricultural development policy should be based on a more rigorous and dispassionate analysis, rather than optimistic expectations alone.

  20. Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

    Science.gov (United States)

    Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2013-01-01

    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

  1. Mutagenicity of the potent rat hepatocarcinogen 6BT to the liver of transgenic (lacI) rats: consideration of a reduced mutation assay protocol.

    Science.gov (United States)

    Lefevre, P A; Tinwell, H; Ashby, J

    1997-01-01

    6-(p-dimethylaminophenylazo)benzothiazole (6BT) is an unusually potent rat hepatocarcinogen, producing large malignant liver tumours after only 2-3 months of dietary administration in a riboflavin-deficient diet. This azocarcinogen has been evaluated in a Big Blue F344 transgenic rat (lacI) gene mutation assay. In a reproduction of the early stages of the carcinogenesis bioassay of this agent, rats were maintained on a riboflavin-deficient diet and were given 10 consecutive daily doses of 6BT (10 mg/kg) by oral gavage. The animals were killed and the livers examined 11 days after the final dose. The livers of 6BT-treated rats showed evidence of hepatocellular hypertrophy in centrolobular areas, with some indication of an increased incidence of mitotic figures. An approximately 10-fold increase in the mutation frequency of DNA isolated from an aliquot of the combined liver homogenates of 6BT-treated rats was observed over that obtained from an equivalent aliquot from control animals. Examination of DNA samples isolated from the livers of individual animals confirmed that 6BT was mutagenic in Big Blue rat livers. These data extend the sensitivity of this transgenic assay to include azo hepatocarcinogens. The determination of mutation frequencies using pooled tissue samples represented a major resource-saving adaptation of the assay protocol in the present study; the general advantages and disadvantages of this practice are discussed.

  2. Field response of aboveground non-target arthropod community to transgenic Bt-Cry1Ab rice plant residues in postharvest seasons.

    Science.gov (United States)

    Bai, Yao-Yu; Yan, Rui-Hong; Ye, Gong-Yin; Huang, Fangneng; Wangila, David S; Wang, Jin-Jun; Cheng, Jia-An

    2012-10-01

    Risk assessments of ecological effects of transgenic rice expressing lepidoptera-Cry proteins from Bacillus thuringiensis (Bt) on non-target arthropods have primarily focused on rice plants during cropping season, whereas few studies have investigated the effects in postharvest periods. Harvested rice fallow fields provide a critical over-wintering habitat for arthropods in the Chinese rice ecosystems, particularly in the southern region of the country. During 2006-08, two independent field trials were conducted in Chongqing, China to investigate the effects of transgenic Cry1Ab rice residues on non-target arthropod communities. In each trial, pitfall traps were used to sample arthropods in field plots planted with one non-Bt variety and two Bt rice lines expressing the Cry1Ab protein. Aboveground arthropods in the trial plots during the postharvest season were abundant, while community densities varied significantly between the two trials. A total of 52,386 individual insects and spiders, representing 93 families, was captured in the two trials. Predominant arthropods sampled were detritivores, which accounted for 91.9% of the total captures. Other arthropods sampled included predators (4.2%), herbivores (3.2%), and parasitoids (0.7%). In general, there were no significant differences among non-Bt and Bt rice plots in all arthropod community-specific parameters for both trials, suggesting no adverse impact of the Bt rice plant residues on the aboveground non-target arthropod communities during the postharvest season. The results of this study provide additional evidence that Bt rice is safe to non-target arthropod communities in the Chinese rice ecosystems.

  3. Does transgenic Cry1Ac + CpTI cotton pollen affect hypopharyngeal gland development and midgut proteolytic enzyme activity in the honey bee Apis mellifera L. (Hymenoptera, Apidae)?

    Science.gov (United States)

    Han, Peng; Niu, Chang-Ying; Biondi, Antonio; Desneux, Nicolas

    2012-11-01

    The transgenic Cry1Ac (Bt toxin) + CpTI (Cowpea Trypsin Inhibitor) cotton cultivar CCRI41 is increasingly used in China and potential side effects on the honey bee Apis mellifera L. have been documented recently. Two studies have assessed potential lethal and sublethal effects in young bees fed with CCRI41 cotton pollen but no effect was observed on learning capacities, although lower feeding activity in exposed honey bees was noted (antifeedant effect). The present study aimed at providing further insights into potential side effects of CCRI41 cotton on honey bees. Emerging honey bees were exposed to different pollen diets using no-choice feeding protocols (chronic exposure) in controlled laboratory conditions and we aimed at documenting potential mechanisms underneath the CCRI41 antifeedant effect previously reported. Activity of midgut proteolytic enzyme of young adult honey bees fed on CCRI41 cotton pollen were not significantly affected, i.e. previously observed antifeedant effect was not linked to disturbed activity of the proteolytic enzymes in bees' midgut. Hypopharyngeal gland development was assessed by quantifying total extractable proteins from the glands. Results suggested that CCRI41 cotton pollen carries no risk to hypopharyngeal gland development of young adult honey bees. In the two bioassays, honey bees exposed to 1 % soybean trypsin inhibitor were used as positive controls for both midgut proteolytic enzymes and hypopharyngeal gland proteins quantification, and bees exposed to 48 ppb (part per billion) (i.e. 48 ng g(-1)) imidacloprid were used as controls for exposure to a sublethal concentration of toxic product. The results show that the previously reported antifeedant effect of CCRI41 cotton pollen on honey bees is not linked to effects on their midgut proteolytic enzymes or on the development of their hypopharyngeal glands. The results of the study are discussed in the framework of risk assessment of transgenic crops on honey bees.

  4. Effects of feeding Bt maize to sows during gestation and lactation on maternal and offspring immunity and fate of transgenic material.

    Directory of Open Access Journals (Sweden)

    Stefan G Buzoianu

    Full Text Available BACKGROUND: We aimed to determine the effect of feeding transgenic maize to sows during gestation and lactation on maternal and offspring immunity and to assess the fate of transgenic material. METHODOLOGY/PRINCIPAL FINDINGS: On the day of insemination, sows were assigned to one of two treatments (n = 12/treatment; 1 non-Bt control maize diet or 2 Bt-MON810 maize diet, which were fed for ~143 days throughout gestation and lactation. Immune function was assessed by leukocyte phenotyping, haematology and Cry1Ab-specific antibody presence in blood on days 0, 28 and 110 of gestation and at the end of lactation. Peripheral-blood mononuclear cell cytokine production was investigated on days 28 and 110 of gestation. Haematological analysis was performed on offspring at birth (n = 12/treatment. Presence of the cry1Ab transgene was assessed in sows' blood and faeces on day 110 of gestation and in blood and tissues of offspring at birth. Cry1Ab protein presence was assessed in sows' blood during gestation and lactation and in tissues of offspring at birth. Blood monocyte count and percentage were higher (P<0.05, while granulocyte percentage was lower (P<0.05 in Bt maize-fed sows on day 110 of gestation. Leukocyte count and granulocyte count and percentage were lower (P<0.05, while lymphocyte percentage was higher (P<0.05 in offspring of Bt maize-fed sows. Bt maize-fed sows had a lower percentage of monocytes on day 28 of lactation and of CD4(+CD8(+ lymphocytes on day 110 of gestation, day 28 of lactation and overall (P<0.05. Cytokine production was similar between treatments. Transgenic material or Cry1Ab-specific antibodies were not detected in sows or offspring. CONCLUSIONS/SIGNIFICANCE: Treatment differences observed following feeding of Bt maize to sows did not indicate inflammation or allergy and are unlikely to be of major importance. These results provide additional data for Bt maize safety assessment.

  5. Effects of 90-day feeding of transgenic Bt rice TT51 on the reproductive system in male rats.

    Science.gov (United States)

    Wang, Er Hui; Yu, Zhou; Hu, Jing; Xu, Hai Bin

    2013-12-01

    Rice is a staple food crop; however, the threat of pests leads to a serious decline in its output and quality. The CryAb/CryAc gene, encodes a synthetic fusion Bacillus thuringiensis (Bt) crystal protein, was introduced into rice MingHui63 to produce insect-resistant rice TT51. This study was undertaken to investigate potential unintended effects of TT51 on the reproductive system in male rats. Male rats were treated with diets containing 60% of either TT51 or MingHui63 by weight, nutritionally balanced to an AIN93G diet, for 90days. An additional negative control group of rats were fed with a rice-based AIN93G diet. Body weights, food intake, hematology, serum chemistry, serum hormone levels, sperm parameters and relative organ/body weights were measured, and gross as well as microscopic pathology were examined. No diet-related significant differences in the values of response variables were observed between rats that were fed with diet containing transgenic TT51, MingHui63 and the control in this 90-day feeding study. In addition, necropsy and histopathology examination indicated no treatment-related changes. The results from the present study indicated that TT51 does not appear to exert any effect on the reproductive system in male rats compared with MingHui63 or the control. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Current situation of pests targeted by Bt crops in Latin America.

    Science.gov (United States)

    Blanco, C A; Chiaravalle, W; Dalla-Rizza, M; Farias, J R; García-Degano, M F; Gastaminza, G; Mota-Sánchez, D; Murúa, M G; Omoto, C; Pieralisi, B K; Rodríguez, J; Rodríguez-Maciel, J C; Terán-Santofimio, H; Terán-Vargas, A P; Valencia, S J; Willink, E

    2016-06-01

    Transgenic crops producing Bacillus thuringiensis- (Bt) insecticidal proteins (Bt crops) have provided useful pest management tools to growers for the past 20 years. Planting Bt crops has reduced the use of synthetic insecticides on cotton, maize and soybean fields in 11 countries throughout Latin America. One of the threats that could jeopardize the sustainability of Bt crops is the development of resistance by targeted pests. Governments of many countries require vigilance in measuring changes in Bt-susceptibility in order to proactively implement corrective measures before Bt-resistance is widespread, thus prolonging the usefulness of Bt crops. A pragmatic approach to obtain information on the effectiveness of Bt-crops is directly asking growers, crop consultants and academics about Bt-resistance problems in agricultural fields, first-hand information that not necessarily relies on susceptibility screens performed in laboratories. This type of information is presented in this report. Problematic pests of cotton and soybeans in five Latin American countries currently are effectively controlled by Bt crops. Growers that plant conventional (non-Bt) cotton or soybeans have to spray synthetic insecticides against multiple pests that otherwise are controlled by these Bt crops. A similar situation has been observed in six Latin American countries where Bt maize is planted. No synthetic insecticide applications are used to control corn pests because they are controlled by Bt maize, with the exception of Spodoptera frugiperda. While this insect in some countries is still effectively controlled by Bt maize, in others resistance has evolved and necessitates supplemental insecticide applications and/or the use of Bt maize cultivars that express multiple Bt proteins. Partial control of S. frugiperda in certain countries is due to its natural tolerance to the Bt bacterium. Of the 31 pests targeted and controlled by Bt crops in Latin America, only S. frugiperda has shown

  7. Bt crop effects on functional guilds of non-target arthropods: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    L LaReesa Wolfenbarger

    Full Text Available BACKGROUND: Uncertainty persists over the environmental effects of genetically-engineered crops that produce the insecticidal Cry proteins of Bacillus thuringiensis (Bt. We performed meta-analyses on a modified public database to synthesize current knowledge about the effects of Bt cotton, maize and potato on the abundance and interactions of arthropod non-target functional guilds. METHODOLOGY/PRINCIPAL FINDINGS: We compared the abundance of predators, parasitoids, omnivores, detritivores and herbivores under scenarios in which neither, only the non-Bt crops, or both Bt and non-Bt crops received insecticide treatments. Predators were less abundant in Bt cotton compared to unsprayed non-Bt controls. As expected, fewer specialist parasitoids of the target pest occurred in Bt maize fields compared to unsprayed non-Bt controls, but no significant reduction was detected for other parasitoids. Numbers of predators and herbivores were higher in Bt crops compared to sprayed non-Bt controls, and type of insecticide influenced the magnitude of the difference. Omnivores and detritivores were more abundant in insecticide-treated controls and for the latter guild this was associated with reductions of their predators in sprayed non-Bt maize. No differences in abundance were found when both Bt and non-Bt crops were sprayed. Predator-to-prey ratios were unchanged by either Bt crops or the use of insecticides; ratios were higher in Bt maize relative to the sprayed non-Bt control. CONCLUSIONS/SIGNIFICANCE: Overall, we find no uniform effects of Bt cotton, maize and potato on the functional guilds of non-target arthropods. Use of and type of insecticides influenced the magnitude and direction of effects; insecticde effects were much larger than those of Bt crops. These meta-analyses underscore the importance of using controls not only to isolate the effects of a Bt crop per se but also to reflect the replacement of existing agricultural practices. Results will

  8. Imidacloprid affects the functional response of predator Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) to strains of Spodoptera frugiperda (J.E. Smith) on Bt cotton.

    Science.gov (United States)

    Malaquias, J B; Ramalho, F S; Omoto, C; Godoy, W A C; Silveira, R F

    2014-03-01

    Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) is one of the most common asopine species in the neotropical region and its occurrence was reported in several countries of South and Central America, as an important biological control agent for many crops. This study was carried out to identify the imidacloprid impacts on the functional response of predator P. nigrispinus fed on Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) strain resistant to lambda-cyhalothrin, on Bt cotton expressing Cry1Ac (Bollgard(®)). Spodoptera frugiperda larvae were used in the following conditions: resistant (1) and susceptible (2) strains to lambda-cyhalothrin fed on Bollgard(®) cotton leaves (DP 404 BG); and resistant (3) and susceptible (4) strains to lambda-cyhalothrin fed on non-genetically modified cotton leaves (cultivar DP4049). The predatory behavior of P. nigrispinus was affected by imidacloprid and the type II asymptotic curve was the one that best described the functional response data. Handling time (T h ) of predator females did not differ among treatments in the presence of imidacloprid. The attack rate did decrease, however, due to an increase in the density of larvae offered. Regardless of the treatment (S. frugiperda strain or cotton cultivar), the predation of P. nigrispinus females on S. frugiperda larvae was significantly lower when exposed to imidacloprid, especially at a density of 16 larvae/predator. The predation behavior of P. nigrispinus on S. frugiperda larvae is affected by the insecticide imidacloprid showing that its applications should be used in cotton crop with caution.

  9. Fate of Transgenic DNA from Orally Administered Bt MON810 Maize and Effects on Immune Response and Growth in Pigs

    Science.gov (United States)

    Walsh, Maria C.; Buzoianu, Stefan G.; Gardiner, Gillian E.; Rea, Mary C.; Gelencsér, Eva; Jánosi, Anna; Epstein, Michelle M.; Ross, R. Paul; Lawlor, Peadar G.

    2011-01-01

    We assessed the effect of short-term feeding of genetically modified (GM: Bt MON810) maize on immune responses and growth in weanling pigs and determined the fate of the transgenic DNA and protein in-vivo. Pigs were fed a diet containing 38.9% GM or non-GM isogenic parent line maize for 31 days. We observed that IL-12 and IFNγ production from mitogenic stimulated peripheral blood mononuclear cells decreased (PGM maize exposure. While Cry1Ab-specific IgG and IgA were not detected in the plasma of GM maize-fed pigs, the detection of the cry1Ab gene and protein was limited to the gastrointestinal digesta and was not found in the kidneys, liver, spleen, muscle, heart or blood. Feeding GM maize to weanling pigs had no effect on growth performance or body weight. IL-6 and IL-4 production from isolated splenocytes were increased (PGM maize while the proportion of CD4+ T cells in the spleen decreased. In the ileum, the proportion of B cells and macrophages decreased while the proportion of CD4+ T cells increased in GM maize-fed pigs. IL-8 and IL-4 production from isolated intraepithelial and lamina propria lymphocytes were also increased (PGM maize. In conclusion, there was no evidence of cry1Ab gene or protein translocation to the organs and blood of weaning pigs. The growth of pigs was not affected by feeding GM maize. Alterations in immune responses were detected; however, their biologic relevance is questionable. PMID:22132091

  10. Evaluating potassium-use-efficiency of five cotton genotypes of pakistan

    International Nuclear Information System (INIS)

    Hassan, Z.U.; Kubar, K.A.

    2014-01-01

    Potassium (K) deficiency in Pakistani soils has been recently reported as the major limiting factor affecting sustainable cotton production. The present study was conducted to envisage how K nutrition affect the growth, biomass production, yield and K-use-efficiency of five cotton genotypes, NIBGE-3701, NIBGE-1524 (Bt-transgenic), Sadori, Sindh-1 and SAU-2 (non-Bt conventional), commonly grown in Pakistan. All five genotypes were raised at deficient and adequate K levels, i.e. 0 and 60 kg K/sub 2/O ha-1, respectively. The experiment was performed in plastic pots following a completely randomized factorial design with three repeats. Adequate K nutrition significantly increased various plant growth traits and yield of all cotton genotypes under study, viz. number of sympodia (21%), number of leaves (34%), leaf dry biomass (30%), shoot dry biomass (31%), number of bolls (50%) and yield of seed cotton (92%). Substantial variations were observed among cotton genotypes for their K-use-efficiency and K-response-efficiency. Sadori and SAU-2 were screened as most K-use-efficient cotton genotypes, while Sindh-1 and SAU-2 were ranked as the most K-responsive cotton genotypes. Interestingly, Sadori did not respond to K nutrition. Moreover, Bt cotton genotypes accumulated more K as compared to non-Bt genotypes. The cotton genotype SAU-2 was identified as efficient-response genotype for better adaptation for both low- and high-K-input sustainable cotton agriculture systems. (author)

  11. Survival and development of a stored-product pest, Sitophilus zeamais (Coleoptera: Curculionidae), and its natural enemy, the parasitoid Lariophagus distinguendus (Hymenoptera. Pteromalidae), on transgenic Bt maize

    DEFF Research Database (Denmark)

    Hansen, Lise S.; Lövei, Gabor L; Székács, András

    2013-01-01

    Background The effect of transgenic maize (Zea mays L.) containing a lepidopteran-specific Bt toxin on a stored-product pest, Sitophilus zeamais Motschulsky, and its parasitoid, Lariophagus distinguendus Förster, was examined in the laboratory to test the impact of transgenic maize on stored...

  12. Transgenic plants over-expressing insect-specific microRNA acquire insecticidal activity against Helicoverpa armigera: an alternative to Bt-toxin technology.

    Science.gov (United States)

    Agrawal, Aditi; Rajamani, Vijayalakshmi; Reddy, Vanga Siva; Mukherjee, Sunil Kumar; Bhatnagar, Raj K

    2015-10-01

    The success of Bt transgenics in controlling predation of crops has been tempered by sporadic emergence of resistance in targeted insect larvae. Such emerging threats have prompted the search for novel insecticidal molecules that are specific and could be expressed through plants. We have resorted to small RNA-based technology for an investigative search and focused our attention to an insect-specific miRNA that interferes with the insect molting process resulting in the death of the larvae. In this study, we report the designing of a vector that produces artificial microRNA (amiR), namely amiR-24, which targets the chitinase gene of Helicoverpa armigera. This vector was used as transgene in tobacco. Northern blot and real-time analysis revealed the high level expression of amiR-24 in transgenic tobacco plants. Larvae feeding on the transgenic plants ceased to molt further and eventually died. Our results demonstrate that transgenic tobacco plants can express amiR-24 insectice specific to H. armigera.

  13. [Double-ambient CO2 concentration affects the growth, development and sucking behavior of non-target brown plant hopper Nilaparvata lugens fed on transgenic Bt rice.

    Science.gov (United States)

    Lu, Yong Qing; Dai, Yang; Yu, Xiu Ying; Yu, Fu-Lan; Jiang, Shou Lin; Zhou, Zong Yuan; Chen, Fa Jun

    2018-02-01

    In recent years, the two issues of climate change including elevated CO 2 etc., and resistance of transgenic Bt crops against non-target insect pests have received widespread attention. Elevated CO 2 can affect the herbivorous insects. To date, there is no consensus about the effect of elevated CO 2 on the suck-feeding insect pests (non-target insect pests of transgenic Bt crops). Its effects on the suck-feeding behavior have rarely been reported. In this study, CO 2 levels were set up in artificial climate chamber to examined the effects of ambient (400 μL·L -1 ) and double-ambient (800 μL·L -1 ) CO 2 levels on the suck-feeding behavior, growth, development, and reproduction of the non-target insect pest of transgenic Bt rice, brown planthopper, Nilaparvata lugens. The results showed that CO 2 level significantly affected the egg and nymph duration, longevity and body mass of adults, and feeding behavior of the 4th and 5th instar nymphs, while had no effect on the fecundity of N. lugens. The duration of eggs and nymphs, and the longevity of female adults were significantly shortened by 4.0%, 4.2% and 6.6% respectively, the proportion of the macropterous adults was significantly increased by 11.6%, and the body mass of newly hatched female adults was significantly decreased by 2.2% by elevated CO 2 . In addition, elevated CO 2 significantly enhanced the stylet puncturing efficiency of the 4th and 5th instar nymphs of N. lugens. The duration ofphloem ingestion of the N4b waveform was significantly prolonged by 60.0% and 50.1%, and the frequency significantly was increased by 230.0% and 155.9% for the 4th and 5th instar nymphs of N. lugens by elevated CO 2 , respectively. It was concluded that double-ambient CO 2 could promote the growth and development of N. lugens through enhancing its suck-feeding, shorten the generation life-span and increase the macropertous adults' proportion of N. lugens. Thus, it could result in the occurrence of non-target rice

  14. Synthetic Polymer Affinity Ligand for Bacillus thuringiensis ( Bt) Cry1Ab/Ac Protein: The Use of Biomimicry Based on the Bt Protein-Insect Receptor Binding Mechanism.

    Science.gov (United States)

    Liu, Mingming; Huang, Rong; Weisman, Adam; Yu, Xiaoyang; Lee, Shih-Hui; Chen, Yalu; Huang, Chao; Hu, Senhua; Chen, Xiuhua; Tan, Wenfeng; Liu, Fan; Chen, Hao; Shea, Kenneth J

    2018-05-24

    We report a novel strategy for creating abiotic Bacillus thuringiensis ( Bt) protein affinity ligands by biomimicry of the recognition process that takes place between Bt Cry1Ab/Ac proteins and insect receptor cadherin-like Bt-R 1 proteins. Guided by this strategy, a library of synthetic polymer nanoparticles (NPs) was prepared and screened for binding to three epitopes 280 FRGSAQGIEGS 290 , 368 RRPFNIGINNQQ 379 and 436 FRSGFSNSSVSIIR 449 located in loop α8, loop 2 and loop 3 of domain II of Bt Cry1Ab/Ac proteins. A negatively charged and hydrophilic nanoparticle (NP12) was found to have high affinity to one of the epitopes, 368 RRPFNIGINNQQ 379 . This same NP also had specific binding ability to both Bt Cry1Ab and Bt Cry1Ac, proteins that share the same epitope, but very low affinity to Bt Cry2A, Bt Cry1C and Bt Cry1F closely related proteins that lack epitope homology. To locate possible NP- Bt Cry1Ab/Ac interaction sites, NP12 was used as a competitive inhibitor to block the binding of 865 NITIHITDTNNK 876 , a specific recognition site in insect receptor Bt-R 1 , to 368 RRPFNIGINNQQ 379 . The inhibition by NP12 reached as high as 84%, indicating that NP12 binds to Bt Cry1Ab/Ac proteins mainly via 368 RRPFNIGINNQQ 379 . This epitope region was then utilized as a "target" or "bait" for the separation and concentration of Bt Cry1Ac protein from the extract of transgenic Bt cotton leaves by NP12. This strategy, based on the antigen-receptor recognition mechanism, can be extended to other biotoxins and pathogen proteins when designing biomimic alternatives to natural protein affinity ligands.

  15. Energy budgeting and carbon footprint of transgenic cotton-wheat production system through peanut intercropping and FYM addition.

    Science.gov (United States)

    Singh, Raman Jeet; Ahlawat, I P S

    2015-05-01

    Two of the most pressing sustainability issues are the depletion of fossil energy resources and the emission of atmospheric green house gases like carbon dioxide to the atmosphere. The aim of this study was to assess energy budgeting and carbon footprint in transgenic cotton-wheat cropping system through peanut intercropping with using 25-50% substitution of recommended dose of nitrogen (RDN) of cotton through farmyard manure (FYM) along with 100% RDN through urea and control (0 N). To quantify the residual effects of previous crops and their fertility levels, a succeeding crop of wheat was grown with varying rates of nitrogen, viz. 0, 50, 100, and 150 kg ha(-1). Cotton + peanut-wheat cropping system recorded 21% higher system productivity which ultimately helped to maintain higher net energy return (22%), energy use efficiency (12%), human energy profitability (3%), energy productivity (7%), carbon outputs (20%), carbon efficiency (17%), and 11% lower carbon footprint over sole cotton-wheat cropping system. Peanut addition in cotton-wheat system increased the share of renewable energy inputs from 18 to 21%. With substitution of 25% RDN of cotton through FYM, share of renewable energy resources increased in the range of 21% which resulted into higher system productivity (4%), net energy return (5%), energy ratio (6%), human energy profitability (74%), energy productivity (6%), energy profitability (5%), and 5% lower carbon footprint over no substitution. The highest carbon footprint (0.201) was recorded under control followed by 50 % substitution of RDN through FYM (0.189). With each successive increase in N dose up to 150 kg N ha(-1) to wheat, energy productivity significantly reduced and share of renewable energy inputs decreased from 25 to 13%. Application of 100 kg N ha(-1) to wheat maintained the highest grain yield (3.71 t ha(-1)), net energy return (105,516 MJ ha(-1)), and human energy profitability (223.4) over other N doses applied to wheat

  16. Cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Rathore, Keerti S; Campbell, LeAnne M; Sherwood, Shanna; Nunes, Eugenia

    2015-01-01

    Cotton continues to be a crop of great economic importance in many developing and some developed countries. Cotton plants expressing the Bt gene to deter some of the major pests have been enthusiastically and widely accepted by the farmers in three of the major producing countries, i.e., China, India, and the USA. Considering the constraints related to its production and the wide variety of products derived from the cotton plant, it offers several target traits that can be improved through genetic engineering. Thus, there is a great need to accelerate the application of biotechnological tools for cotton improvement. This requires a simple, yet robust gene delivery/transformant recovery system. Recently, a protocol, involving large-scale, mechanical isolation of embryonic axes from germinating cottonseeds followed by direct transformation of the meristematic cells has been developed by an industrial laboratory. However, complexity of the mechanical device and the patent restrictions are likely to keep this method out of reach of most academic laboratories. In this chapter, we describe the method developed in our laboratory that has undergone further refinements and involves Agrobacterium-mediated transformation of cotton cells, selection of stable transgenic callus lines, and recovery of plants via somatic embryogenesis.

  17. Recent long-distance transgene flow into wild populations conforms to historical patterns of gene flow in cotton (Gossypium hirsutum) at its centre of origin.

    Science.gov (United States)

    Wegier, A; Piñeyro-Nelson, A; Alarcón, J; Gálvez-Mariscal, A; Alvarez-Buylla, E R; Piñero, D

    2011-10-01

    Over 95% of the currently cultivated cotton was domesticated from Gossypium hirsutum, which originated and diversified in Mexico. Demographic and genetic studies of this species at its centre of origin and diversification are lacking, although they are critical for cotton conservation and breeding. We investigated the actual and potential distribution of wild cotton populations, as well as the contribution of historical and recent gene flow in shaping cotton genetic diversity and structure. We evaluated historical gene flow using chloroplast microsatellites and recent gene flow through the assessment of transgene presence in wild cotton populations, exploiting the fact that genetically modified cotton has been planted in the North of Mexico since 1996. Assessment of geographic structure through Bayesian spatial analysis, BAPS and Genetic Algorithm for Rule-set Production (GARP), suggests that G. hirsutum seems to conform to a metapopulation scheme, with eight distinct metapopulations. Despite evidence for long-distance gene flow, genetic variation among the metapopulations of G. hirsutum is high (He = 0.894 ± 0.01). We identified 46 different haplotypes, 78% of which are unique to a particular metapopulation, in contrast to a single haplotype detected in cotton cultivars. Recent gene flow was also detected (m = 66/270 = 0.24), with four out of eight metapopulations having transgenes. We discuss the implications of the data presented here with respect to the conservation and future breeding of cotton populations and genetic diversity at its centre of crop origin. © 2011 Blackwell Publishing Ltd.

  18. Overexpression of a cotton (Gossypium hirsutum) WRKY gene, GhWRKY34, in Arabidopsis enhances salt-tolerance of the transgenic plants.

    Science.gov (United States)

    Zhou, Li; Wang, Na-Na; Gong, Si-Ying; Lu, Rui; Li, Yang; Li, Xue-Bao

    2015-11-01

    Soil salinity is one of the most serious threats in world agriculture, and often influences cotton growth and development, resulting in a significant loss in cotton crop yield. WRKY transcription factors are involved in plant response to high salinity stress, but little is known about the role of WRKY transcription factors in cotton so far. In this study, a member (GhWRKY34) of cotton WRKY family was functionally characterized. This protein containing a WRKY domain and a zinc-finger motif belongs to group III of cotton WRKY family. Subcellular localization assay indicated that GhWRKY34 is localized to the cell nucleus. Overexpression of GhWRKY34 in Arabidopsis enhanced the transgenic plant tolerance to salt stress. Several parameters (such as seed germination, green cotyledons, root length and chlorophyll content) in the GhWRKY34 transgenic lines were significantly higher than those in wild type under NaCl treatment. On the contrary, the GhWRKY34 transgenic plants exhibited a substantially lower ratio of Na(+)/K(+) in leaves and roots dealing with salt stress, compared with wild type. Growth status of the GhWRKY34 transgenic plants was much better than that of wild type under salt stress. Expressions of the stress-related genes were remarkably up-regulated in the transgenic plants under salt stress, compared with those in wild type. Based on the data presented in this study, we hypothesize that GhWRKY34 as a positive transcription regulator may function in plant response to high salinity stress through maintaining the Na(+)/K(+) homeostasis as well as activating the salt stress-related genes in cells. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  19. Spatial distribution of adult Anthonomus grandis Boheman (Coleoptera: Curculionidae and buds with feeding punctures on conventional and Bt cottonDistribuição espacial de adultos e botões com orifício de alimentação de Anthonomus grandis Boheman (Coleoptera: Curculionidae em algodoeiro convencional e Bt

    Directory of Open Access Journals (Sweden)

    Paulo Rogerio Beltramin da Fonseca

    2013-06-01

    Full Text Available O conhecimento dos arranjos de dispersão para adultos e botões com orifício de alimentação de Anthonomus grandis em cultivares de algodoeiro é necessário para aperfeiçoar o monitoramento e controle da praga. Esta pesquisa teve por objetivo realizar análises probabilísticas dos padrões de distribuição espacial dos adultos e botões com orifícios de alimentação de A. grandis em duas cultivares de algodão Bt e não Bt. O estudo foi conduzido a campo em duas áreas experimentais, cada uma composta por 100 parcelas de sete linhas de sete metros de comprimento. Em 16 amostragens avaliaram-se cinco plantas por parcela através da contagem dos adultos e dos botões com orifício de alimentaçãoentre janeiro e maio de 2010. Foram calculados os índices de dispersão (razão variância/média, índice de Morisita e Expoente k da Distribuição Binomial Negativa e as distribuições teóricas de freqüência (Poisson, Binomial Negativa e Binomial Positiva. Não houve diferença estatística entre as cultivares avaliadas. A distribuição espacial dos adultos de A. grandis, nas cultivares Bt e não Bt, ajustou-se nos arranjos probabilísticos de distribuição binomial negativa (agregado e distribuição binomial positiva (uniforme, conforme os dias após a emergência do algodoeiro. As análises de dispersão para os botões com orifícios de alimentação nas culturas Bt e convencional mostraram os modelos espaciais de Poisson (aleatório, distribuição binomial negativa (agregado e distribuição binomial positiva (uniforme, em seqüência, durante o ciclo da cultura.Dispersion patterns of Anthonomus grandis adults and damaged squares with their feeding punctures are important to enhance pest monitoring and control on cotton. In this research we performed probabilistic analyses of the distribution patterns of adults and squares with feeding punctures of A. grandis on two cotton genotypes, Bt and non-Bt near isogenic lines. We conducted

  20. A R2R3-MYB transcription factor that is specifically expressed in cotton (Gossypium hirsutum) fibers affects secondary cell wall biosynthesis and deposition in transgenic Arabidopsis.

    Science.gov (United States)

    Sun, Xiang; Gong, Si-Ying; Nie, Xiao-Ying; Li, Yang; Li, Wen; Huang, Geng-Qing; Li, Xue-Bao

    2015-07-01

    Secondary cell wall (SCW) is an important industrial raw material for pulping, papermaking, construction, lumbering, textiles and potentially for biofuel production. The process of SCW thickening of cotton fibers lays down the cellulose that will constitute the bulk (up to 96%) of the fiber at maturity. In this study, a gene encoding a MYB-domain protein was identified in cotton (Gossypium hirsutum) and designated as GhMYBL1. Quantitative real-time polymerase chain reaction (RT-PCR) analysis revealed that GhMYBL1 was specifically expressed in cotton fibers at the stage of secondary wall deposition. Further analysis indicated that this protein is a R2R3-MYB transcription factor, and is targeted to the cell nucleus. Overexpression of GhMYBL1 in Arabidopsis affected the formation of SCW in the stem xylem of the transgenic plants. The enhanced SCW thickening also occurred in the interfascicular fibers, xylary fibers and vessels of the GhMYBL1-overexpression transgenic plants. The expression of secondary wall-associated genes, such as CesA4, CesA7, CesA8, PAL1, F5H and 4CL1, were upregulated, and consequently, cellulose and lignin biosynthesis were enhanced in the GhMYBL1 transgenic plants. These data suggested that GhMYBL1 may participate in modulating the process of secondary wall biosynthesis and deposition of cotton fibers. © 2014 Scandinavian Plant Physiology Society.

  1. ptxD gene in combination with phosphite serves as a highly effective selection system to generate transgenic cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Pandeya, Devendra; Campbell, LeAnne M; Nunes, Eugenia; Lopez-Arredondo, Damar L; Janga, Madhusudhana R; Herrera-Estrella, Luis; Rathore, Keerti S

    2017-12-01

    This report demonstrates the usefulness of ptxD/phosphite as a selection system that not only provides a highly efficient and simple means to generate transgenic cotton plants, but also helps address many of the concerns related to the use of antibiotic and herbicide resistance genes in the production of transgenic crops. Two of the most popular dominant selectable marker systems for plant transformation are based on either antibiotic or herbicide resistance genes. Due to concerns regarding their safety and in order to stack multiple traits in a single plant, there is a need for alternative selectable marker genes. The ptxD gene, derived from Pseudomonas stutzeri WM88, that confers to cells the ability to convert phosphite (Phi) into orthophosphate (Pi) offers an alternative selectable marker gene as demonstrated for tobacco and maize. Here, we show that the ptxD gene in combination with a protocol based on selection medium containing Phi, as the sole source of phosphorus (P), can serve as an effective and efficient system to select for transformed cells and generate transgenic cotton plants. Fluorescence microscopy examination of the cultures under selection and molecular analyses on the regenerated plants demonstrate the efficacy of the system in recovering cotton transformants following Agrobacterium-mediated transformation. Under the ptxD/Phi selection, an average of 3.43 transgenic events per 100 infected explants were recovered as opposed to only 0.41% recovery when bar/phosphinothricin (PPT) selection was used. The event recovery rates for nptII/kanamycin and hpt/hygromycin systems were 2.88 and 2.47%, respectively. Molecular analysis on regenerated events showed a selection efficiency of ~ 97% under the ptxD/Phi system. Thus, ptxD/Phi has proven to be a very efficient, positive selection system for the generation of transgenic cotton plants with equal or higher transformation efficiencies compared to the commonly used, negative selection systems.

  2. Bt rice harbouring cry genes controlled by a constitutive or wound-inducible promoter: protection and transgene expression under Mediterranean field conditions.

    Science.gov (United States)

    Breitler, Jean Christophe; Vassal, Jean Michel; del Mar Catala, Maria; Meynard, Donaldo; Marfà, Victoria; Melé, Enric; Royer, Monique; Murillo, Isabel; San Segundo, Blanca; Guiderdoni, Emmanuel; Messeguer, Joaquima

    2004-09-01

    Seven homozygous transgenic lines of two European commercial cultivars of rice (Ariete (A) and Senia (S)), harbouring the cry1B or cry1Aa Bacillus thuringiensis (Bt) delta-endotoxin genes, were field evaluated for protection from striped stem borer (SSB) (Chilo suppressalis) damage during the 2001 and 2002 summer crop seasons in the Delta de l'Ebre region, Spain. The plant codon-optimized toxin gene was placed under the control of the promoter of either the constitutive ubi1 gene or the wound-inducible mpi gene from maize. Stable, high-level, insecticidal protein accumulation was observed throughout root, leaf and seed tissues of field-grown plants harbouring the cry1B (lines A64.1, A33.1, A3.4 and S98.9) or cry1Aa (lines S05.1 and A19.14) genes under the control of the ubi1 promoter. Conversely, no toxin was detected in unwounded vegetative tissues of the A9.1 line harbouring the cry1B gene controlled by the mpi promoter, indicating that natural environmental stresses did not trigger the activity of the wound-inducible promoter. However, the toxin accumulated at 0.2% total soluble proteins in A9.1 sheath tissue exhibiting brown lesions resulting from SSB damage. The agronomical traits and performance of the transgenic lines were generally comparable with parental controls, except in the two lines accumulating Cry1Aa, which exhibited a high frequency of plants non-true to type. Natural infestation was assisted with manual infestations of L2/L3 SSB larvae in border control plants surrounding the experimental plots, which served as a reservoir for the second-cycle SSB population. The observation of damage (brown lesions and dead hearts) during the crop season and dissection of plants at harvest stage revealed a range of protection amongst the transgenic lines, which was highly consistent with the level of toxin accumulation and with previous experience in greenhouse assays. Lines A3.4 and S05.1 were found to exhibit stable and full protection against SSB attacks

  3. A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis.

    Science.gov (United States)

    Lu, Pu; Magwanga, Richard Odongo; Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang

    2018-04-12

    Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 ( TOM1 ), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum , 9 in Gossypium arboreum , and 11 in Gossypium raimondii . The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H₂O₂. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton

  4. A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis

    Directory of Open Access Journals (Sweden)

    Pu Lu

    2018-04-01

    Full Text Available Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 (TOM1, a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum, 9 in Gossypium arboreum, and 11 in Gossypium raimondii. The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H2O2. The low malondialdehyde (MDA level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress

  5. PERIODS OF WEED INTERFERENCE ON TRANSGENIC COTTON ‘IMACD 6001LL’

    Directory of Open Access Journals (Sweden)

    MARCOS PAULO DA SILVA

    2016-01-01

    Full Text Available The objective of this study was to determine the periods of weed interference and its impact on productivity of cotton 'IMACD 6001LL'. The experiment was conducted in Jaboticabal, São Paulo, the second crop in 2011 and consisted of two treatment groups: the first culture remained free of competing weeds since of emergence up different periods of its development: (0-15 , 0-25, 0-35, 0-45, 0-55, 0-65, 0-75 and 0-183 days - harvest. In the second treatment group was held to the contrary: the crop was in harmony with the weeds since of emergence up to the same stages of development described above. The treatments were arranged in a randomized block design in four replications. During these periods was evaluated dry matter accumulation by weeds. The cotton yield data were subjected to regression analysis and resulting in a CPWC of 35 DAE, the CPWR was 133 DAE and .The weed community was composed mainly of Raphanus raphanistrum, Amaranthus spp., Cyperus rotundus, Alternanthera tenella and Eleusine indica. Living with this community throughout the cycle resulted in reduction almost 85% in cotton yield.

  6. The economic impact and the distribution of benefits and risk from the adoption of insect resistant (Bt) cotton in West Africa:

    OpenAIRE

    Falck-Zepeda, Jose; Horna, Daniela; Smale, Melinda

    2007-01-01

    "Cotton is the largest source of export receipts of several West African countries. Statistics however show a decreasing tendency in cotton yields and an increasing tendency in pesticide use. Under this circumstances there appear to be potential payoffs from the use of biotechnology products in the farming systems of the region. In this study we estimate different scenarios for the potential deployment of insect resistant cotton in selected countries in West Africa (WA). We use an economic su...

  7. Evaluation of two cotton varieties CRSP1 and CRSP2 for genetic transformation efficiency, expression of transgenes Cry1Ac + Cry2A, GT gene and insect mortality

    Directory of Open Access Journals (Sweden)

    Arfan Ali

    2016-03-01

    Full Text Available Expression of the transgene with a desirable character in crop plant is the ultimate goal of transgenic research. Transformation of two Bt genes namely Cry1Ac and Cry2A cloned as separate cassette under 35S promoter in pKHG4 plant expression vector was done by using shoot apex cut method of Agrobacterium. Molecular confirmation of putative transgenic cotton plants for Cry1Ac, Cry2A and GT gene was done through PCR and ELISA. Transformation efficiency of CRSP-1 and CRSP-2 was calculated to be 1.2 and 0.8% for Cry1Ac while 0.9 and 0.6% for Cry2A and 1.5 and 0.7% for GTG respectively. CRSP-1 was found to adopt natural environment (acclimatized earlier than CRSP-2 when exposed to sunlight for one month. Expression of Cry1Ac, Cry2A and GTG was found to be 1.2, 1 and 1.3 ng/μl respectively for CRSP-1 as compared to CRSP-2 where expression was recorded to be 0.9, 0.5 and 0.9 ng/μl respectively. FISH analysis of the transgenic CRSP-1 and CRSP-2 demonstrated the presence of one and two copy numbers respectively. Similarly, the response of CRSP-1 against Glyphosate @1900 ml/acre was far better with almost negligible necrotic spot and efficient growth after spray as compared to CRSP-2 where some plants were found to have necrosis and negative control where the complete decay of plant was observed after seven days of spray assay. Similarly, almost 100% mortality of 2nd instar larvae of Heliothis armigera was recorded after three days in CRSP-1 as compared CRSP-2 where insect mortality was found to be less than 90%. Quantitatively speaking non transgenic plants were found with 23–90% leaf damage by insect, while CRSP-1 was with less than 5% and CRSP-2 with 17%. Taken together CRSP1 was found to have better insect control and weedicide resistance along with its natural ability of genetic modification and can be employed by the valuable farmers for better insect control and simultaneously for better production.

  8. Functional Characterization of Cotton GaMYB62L, a Novel R2R3 TF in Transgenic Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Hamama Islam Butt

    Full Text Available Drought stress can trigger the production of ABA in plants, in response to adverse conditions, which induces the transcript of stress-related marker genes. The R2R3 MYB TFs are implicated in regulation of various plants developmental, metabolic and multiple environmental stress responses. Here, a R2R3-MYB cloned gene, GaMYB62L, was transformed in Arabidopsis and was functionally characterized. The GaMYB62L protein contains two SANT domains with a conserved R2R3 imperfect repeats. The GaMYB62L cDNA is 1,017 bp with a CDS of 879, encodes a 292-residue polypeptide with MW of 38.78 kD and a pI value of 8.91. Overexpressed GaMYB62L transgenic Arabidopsis have increased proline and chlorophyll content, superior seed germination rate under salt and osmotic stress, less water loss rate with reduced stomatal apertures, high drought avoidance as compared to WT on water deprivation and also significant plant survival rates at low temperature. In addition, overexpressed GaMYB62L lines were more sensitive to ABA mediated germination and root elongation assay. Moreover, ABA induced GaMYB62L overexpression, enhanced the expression of ABA stress related marker genes like RD22, COR15A, ADH1, and RD29A. Together, overexpression of GaMYB62L suggested having developed better drought, salt and cold tolerance in transgenic Arabidopsis and thus presented it as a prospective candidate gene to achieve better abiotic stress tolerance in cotton crop.

  9. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  10. Amplicon based RNA interference targeting V2 gene of cotton leaf curl Kokhran virus-Burewala strain can provide resistance in transgenic cotton plants

    Science.gov (United States)

    An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...

  11. Transgenic Bt Corn, Soil Insecticide, and Insecticidal Seed Treatment Effects on Corn Rootworm (Coleoptera: Chrysomelidae) Beetle Emergence, Larval Feeding Injury, and Corn Yield in North Dakota.

    Science.gov (United States)

    Calles-Torrez, Veronica; Knodel, Janet J; Boetel, Mark A; Doetkott, Curt D; Podliska, Kellie K; Ransom, Joel K; Beauzay, Patrick; French, B Wade; Fuller, Billy W

    2018-02-09

    Northern, Diabrotica barberi Smith & Lawrence (Coleoptera: Chrysomelidae), and western, Diabrotica virgifera virgifera LeConte (Coleoptera: Chrysomelidae), corn rootworms are economic pests of corn, Zea mays L. in North America. We measured the impacts of corn hybrids incorporated with Cry3Bb1, Cry34/35Ab1, and pyramided (Cry3Bb1 + Cry34/35Ab1) Bacillus thuringiensis Berliner (Bt) proteins, tefluthrin soil insecticide, and clothianidin insecticidal seed treatment on beetle emergence, larval feeding injury, and corn yield at five locations from 2013 to 2015 in eastern North Dakota. In most cases, emergence was significantly lower in Bt-protected corn than in non-Bt corn hybrids. Exceptions included Wyndmere, ND (2013), where D. barberi emergence from Cry34/35Ab1 plots was not different from that in the non-Bt hybrid, and Arthur, ND (2013), where D. v. virgifera emergence from Cry3Bb1 plots did not differ from that in the non-Bt hybrid. Bt hybrids generally produced increased grain yield compared with non-Bt corn where rootworm densities were high, and larval root-feeding injury was consistently lower in Bt-protected plots than in non-Bt corn. The lowest overall feeding injury and emergence levels occurred in plots planted with the Cry3Bb1 + Cry34/35Ab1 hybrid. Time to 50% cumulative emergence of both species was 5-7 d later in Bt-protected than in non-Bt hybrids. Tefluthrin and clothianidin were mostly inconsequential in relation to beetle emergence and larval root injury. Our findings could suggest that some North Dakota populations could be in early stages of increased tolerance to some Bt toxins; however, Bt corn hybrids currently provide effective protection against rootworm injury in eastern North Dakota. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Reproduction of root knot nematode (Meloidogyne incognita) on Bt ...

    African Journals Online (AJOL)

    SARAH

    2013-09-30

    Sep 30, 2013 ... ELISA detected Bt protein in soil and roots of Bt cotton but not in HART 89M ... as the use of organic amendments and nematicides with other .... isogenic counterpart to test the effect of the Bt gene ..... Bendezu and Starr (2003) identified two types of RKN ... soil texture, temperature, moisture, aeration and.

  13. Cadmium-induced ultramorphological and physiological changes in leaves of two transgenic cotton cultivars and their wild relative

    International Nuclear Information System (INIS)

    Daud, M.K.; Variath, M.T.; Ali, Shafaqat; Najeeb, U.; Jamil, Muhammad; Hayat, Y.; Dawood, M.; Khan, Muhammad Imran; Zaffar, M.; Cheema, Sardar Alam; Tong, X.H.; Zhu Shuijin

    2009-01-01

    The present study describes cadmium-induced alterations in the leaves as well as at the whole plant level in two transgenic cotton cultivars (BR001 and GK30) and their wild relative (Coker 312) using both ultramorphological and physiological indices. With elevated levels of Cd (i.e. 10, 100, 1000 μM), the mean lengths of root, stem and leaf and leaf width as well as their fresh and dry biomasses linearly decreased over their respective controls. Moreover, root, stem and leaf water absorption capacities progressively stimulated, which were high in leaves followed by roots and stems. BR001 accumulated more cadmium followed by GK30 and Coker 312. Root and shoot cadmium uptakes were significantly and directly correlated with each other as well as with leaf, stem and root water absorption capacities. The ultrastructural modifications in leaf mesophyll cells were triggered with increase in Cd stress regime. They were more obvious in BR001 followed by GK30 and Coker 312. Changes in morphology of chloroplast, increase in number and size of starch grains as well as increase in number of plastoglobuli were the noticed qualitative effects of Cd on photosynthetic organ. Cd in the form of electron dense granules could be seen inside the vacuoles and attached to the cell walls in all these cultivars. From the present experiment, it can be well established that both apoplastic and symplastic bindings are involved in Cd detoxification in these cultivars. Absence of tonoplast invagination reveals that Cd toxic levels did not cause water stress in any cultivars. Additionally, these cultivars possess differential capabilities towards Cd accumulation and its sequestration.

  14. High Expression of Cry1Ac Protein in Cotton (Gossypium hirsutum by Combining Independent Transgenic Events that Target the Protein to Cytoplasm and Plastids.

    Directory of Open Access Journals (Sweden)

    Amarjeet Kumar Singh

    Full Text Available Transgenic cotton was developed using two constructs containing a truncated and codon-modified cry1Ac gene (1,848 bp, which was originally characterized from Bacillus thuringiensis subspecies kurstaki strain HD73 that encodes a toxin highly effective against many lepidopteran pests. In Construct I, the cry1Ac gene was cloned under FMVde, a strong constitutively expressing promoter, to express the encoded protein in the cytoplasm. In Construct II, the encoded protein was directed to the plastids using a transit peptide taken from the cotton rbcSIb gene. Genetic transformation experiments with Construct I resulted in a single copy insertion event in which the Cry1Ac protein expression level was 2-2.5 times greater than in the Bacillus thuringiensis cotton event Mon 531, which is currently used in varieties and hybrids grown extensively in India and elsewhere. Another high expression event was selected from transgenics developed with Construct II. The Cry protein expression resulting from this event was observed only in the green plant parts. No transgenic protein expression was observed in the non-green parts, including roots, seeds and non-green floral tissues. Thus, leucoplasts may lack the mechanism to allow entry of a protein tagged with the transit peptide from a protein that is only synthesized in tissues containing mature plastids. Combining the two events through sexual crossing led to near additive levels of the toxin at 4-5 times the level currently used in the field. The two high expression events and their combination will allow for effective resistance management against lepidopteran insect pests, particularly Helicoverpa armigera, using a high dosage strategy.

  15. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line using 18S and ITS rDNA Sequences over Four Seasons

    Directory of Open Access Journals (Sweden)

    Xiemin Qi

    2016-07-01

    Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.

  16. Impacts of elevated CO2 on exogenous Bacillus thuringiensis toxins and transgene expression in transgenic rice under different levels of nitrogen

    OpenAIRE

    Jiang, Shoulin; Lu, Yongqing; Dai, Yang; Qian, Lei; Muhammad, Adnan Bodlah; Li, Teng; Wan, Guijun; Parajulee, Megha N.; Chen, Fajun

    2017-01-01

    Recent studies have highlighted great challenges of transgene silencing for transgenic plants facing climate change. In order to understand the impacts of elevated CO2 on exogenous Bacillus thuringiensis (Bt) toxins and transgene expression in transgenic rice under different levels of N-fertilizer supply, we investigated the biomass, exogenous Bt toxins, Bt-transgene expression and methylation status in Bt rice exposed to two levels of CO2 concentrations and nitrogen (N) supply (1/8, 1/4, 1/2...

  17. GhWRKY25, a group I WRKY gene from cotton, confers differential tolerance to abiotic and biotic stresses in transgenic Nicotiana benthamiana.

    Science.gov (United States)

    Liu, Xiufang; Song, Yunzhi; Xing, Fangyu; Wang, Ning; Wen, Fujiang; Zhu, Changxiang

    2016-09-01

    WRKY transcription factors are involved in various processes, ranging from plant growth to abiotic and biotic stress responses. Group I WRKY members have been rarely reported compared with group II or III members, particularly in cotton (Gossypium hirsutum). In this study, a group I WRKY gene, namely, GhWRKY25, was cloned from cotton and characterized. Expression analysis revealed that GhWRKY25 can be induced or deduced by the treatments of abiotic stresses and multiple defense-related signaling molecules. Overexpression of GhWRKY25 in Nicotiana benthamiana reduced plant tolerance to drought stress but enhanced tolerance to salt stress. Moreover, more MDA and ROS accumulated in transgenic plants after drought treatment with lower activities of SOD, POD, and CAT. Our study further demonstrated that GhWRKY25 overexpression in plants enhanced sensitivity to the fungal pathogen Botrytis cinerea by reducing the expression of SA or ET signaling related genes and inducing the expression of genes involved in the JA signaling pathway. These results indicated that GhWRKY25 plays negative or positive roles in response to abiotic stresses, and the reduced pathogen resistance may be related to the crosstalk of the SA and JA/ET signaling pathways.

  18. Brazilian Free-tailed Bats (Tadarida brasiliensis) as Insect Pest Regulators in Transgenic and Conventional Cotton Crops

    Science.gov (United States)

    During the past 12,000 years agricultural systems have transitioned from natural habitats to conventional agricultural regions, and recently to large areas of genetically- engineered (GE) croplands. This GE revolution occurred for cotton in a span of slightly more than a decade w...

  19. A diverse family of serine proteinase genes expressed in cotton boll weevil (Anthonomus grandis): implications for the design of pest-resistant transgenic cotton plants.

    Science.gov (United States)

    Oliveira-Neto, Osmundo B; Batista, João A N; Rigden, Daniel J; Fragoso, Rodrigo R; Silva, Rodrigo O; Gomes, Eliane A; Franco, Octávio L; Dias, Simoni C; Cordeiro, Célia M T; Monnerat, Rose G; Grossi-De-Sá, Maria F

    2004-09-01

    Fourteen different cDNA fragments encoding serine proteinases were isolated by reverse transcription-PCR from cotton boll weevil (Anthonomus grandis) larvae. A large diversity between the sequences was observed, with a mean pairwise identity of 22% in the amino acid sequence. The cDNAs encompassed 11 trypsin-like sequences classifiable into three families and three chymotrypsin-like sequences belonging to a single family. Using a combination of 5' and 3' RACE, the full-length sequence was obtained for five of the cDNAs, named Agser2, Agser5, Agser6, Agser10 and Agser21. The encoded proteins included amino acid sequence motifs of serine proteinase active sites, conserved cysteine residues, and both zymogen activation and signal peptides. Southern blotting analysis suggested that one or two copies of these serine proteinase genes exist in the A. grandis genome. Northern blotting analysis of Agser2 and Agser5 showed that for both genes, expression is induced upon feeding and is concentrated in the gut of larvae and adult insects. Reverse northern analysis of the 14 cDNA fragments showed that only two trypsin-like and two chymotrypsin-like were expressed at detectable levels. Under the effect of the serine proteinase inhibitors soybean Kunitz trypsin inhibitor and black-eyed pea trypsin/chymotrypsin inhibitor, expression of one of the trypsin-like sequences was upregulated while expression of the two chymotrypsin-like sequences was downregulated. Copyright 2004 Elsevier Ltd.

  20. Herbicide-resistant cotton (Gossypium hirsutum) plants: an alternative way of manual weed removal.

    Science.gov (United States)

    Latif, Ayesha; Rao, Abdul Qayyum; Khan, Muhammad Azmat Ullah; Shahid, Naila; Bajwa, Kamran Shehzad; Ashraf, Muhammad Aleem; Abbas, Malik Adil; Azam, Muhammad; Shahid, Ahmad Ali; Nasir, Idrees Ahmad; Husnain, Tayyab

    2015-09-17

    Cotton yield has been badly affected by different insects and weed competition. In Past Application of multiple chemicals is required to manage insects and weed control was achieved by different conventional means, such as hand weeding, crop rotation and polyculture, because no synthetic chemicals were available. The control methods shifted towards high input and target-oriented methods after the discovery of synthetic herbicide in the 1930s. To utilise the transgenic approach, cotton plants expressing the codon-optimised CEMB GTGene were produced in the present study. Local cotton variety CEMB-02 containing Cry1Ac and Cry2A in single cassette was transformed by synthetic codon-optimised 5-enolpyruvylshikimate-3-phosphate synthase gene cloned into pCAMBIA 1301 vector under 35S promoter with Agrobacterium tumifaciens. Putative transgenic plants were screened in MS medium containing 120 µmol/L glyphosate. Integration and expression of the gene were evaluated by PCR from genomic DNA and ELISA from protein. A 1.4-kb PCR product for Glyphosate and 167-bp product for Cry2A were obtained by amplification through gene specific primers. Expression level of Glyphosate and Bt proteins in two transgenic lines were recorded to be 0.362, 0.325 µg/g leaf and 0.390, 0.300 µg/g leaf respectively. FISH analysis of transgenic lines demonstrates the presence of one and two copy no. of Cp4 EPSPS transgene respectively. Efficacy of the transgene Cp4 EPSPS was further evaluated by Glyphosate spray (41 %) assay at 1900 ml/acre and insect bioassay which shows 100 %mortality of insect feeding on transgenic lines as compared to control. The present study shows that the transgenic lines produced in this study were resistant not only to insects but also equally good against 1900 ml/acre field spray concentration of glyphosate.

  1. The Cotton WRKY Gene GhWRKY41 Positively Regulates Salt and Drought Stress Tolerance in Transgenic Nicotiana benthamiana.

    Directory of Open Access Journals (Sweden)

    Xiaoqian Chu

    Full Text Available WRKY transcription factors constitute a very large family of proteins in plants and participate in modulating plant biological processes, such as growth, development and stress responses. However, the exact roles of WRKY proteins are unclear, particularly in non-model plants. In this study, Gossypium hirsutum WRKY41 (GhWRKY41 was isolated and transformed into Nicotiana benthamiana. Our results showed that overexpression of GhWRKY41 enhanced the drought and salt stress tolerance of transgenic Nicotiana benthamiana. The transgenic plants exhibited lower malondialdehyde content and higher antioxidant enzyme activity, and the expression of antioxidant genes was upregulated in transgenic plants exposed to osmotic stress. A β-glucuronidase (GUS staining assay showed that GhWRKY41 was highly expressed in the stomata when plants were exposed to osmotic stress, and plants overexpressing GhWRKY41 exhibited enhanced stomatal closure when they were exposed to osmotic stress. Taken together, our findings demonstrate that GhWRKY41 may enhance plant tolerance to stress by functioning as a positive regulator of stoma closure and by regulating reactive oxygen species (ROS scavenging and the expression of antioxidant genes.

  2. Genetic Markers for Western Corn Rootworm Resistance to Bt Toxin

    OpenAIRE

    Flagel, Lex E.; Swarup, Shilpa; Chen, Mao; Bauer, Christopher; Wanjugi, Humphrey; Carroll, Matthew; Hill, Patrick; Tuscan, Meghan; Bansal, Raman; Flannagan, Ronald; Clark, Thomas L.; Michel, Andrew P.; Head, Graham P.; Goldman, Barry S.

    2015-01-01

    Western corn rootworm (WCR) is a major maize (Zea mays L.) pest leading to annual economic losses of more than 1 billion dollars in the United States. Transgenic maize expressing insecticidal toxins derived from the bacterium Bacillus thuringiensis (Bt) are widely used for the management of WCR. However, cultivation of Bt-expressing maize places intense selection pressure on pest populations to evolve resistance. Instances of resistance to Bt toxins have been reported in WCR. Developing genet...

  3. Fitness costs associated with field-evolved resistance to Bt maize in Spodoptera frugiperda (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Jakka, S R K; Knight, V R; Jurat-Fuentes, J L

    2014-02-01

    Increasing adoption of transgenic crops expressing cry toxin genes from Bacillus thuringiensis (Bt crops) represents an augmented risk for development of insect resistance. While fitness costs can greatly influence the rate of resistance evolution, most available data related to Bt resistance have been obtained from laboratory-selected insect strains. In this article, we test the existence of fitness costs associated with high levels of field-evolved resistance to Bt maize event TC1507 in a strain of Spodoptera frugiperda (JE Smith) originated from maize fields in Puerto Rico. Fitness costs in resistant S. frugiperda were evaluated by comparing biological performance to susceptible insects when reared on meridic diet, maize or soybean leaf tissue, or cotton reproductive tissues. Parameters monitored included larval survival, larval and pupal weights, developmental time (larval and pupal), adult longevity, reproductive traits (fecundity and fertility), and sex ratio. We found that all monitored parameters were influenced to a similar extent by the host, independently of susceptibility to Bt maize. The only parameter that significantly differed between strains for all hosts was a longer larval developmental period in resistant S. frugiperda, which resulted in emergence asynchrony between susceptible and resistant adults. To test the relevance of fitness costs in resistant S. frugiperda, we performed a selection experiment to monitor the stability of resistance in a heterogeneous strain through 12 generations of rearing on meridic diet. Our data demonstrate lack of fitness costs relevant to stability of field-evolved resistance to Bt maize and help explain reported stability of field-evolved resistance in Puerto Rican populations of S. frugiperda.

  4. A toxin-binding alkaline phosphatase fragment synergizes Bt toxin Cry1Ac against susceptible and resistant Helicoverpa armigera.

    Directory of Open Access Journals (Sweden)

    Wenbo Chen

    Full Text Available Evolution of resistance by insects threatens the continued success of pest control using insecticidal crystal (Cry proteins from the bacterium Bacillus thuringiensis (Bt in sprays and transgenic plants. In this study, laboratory selection with Cry1Ac yielded five strains of cotton bollworm, Helicoverpa armigera, with resistance ratios at the median lethal concentration (LC50 of activated Cry1Ac ranging from 22 to 1700. Reduced activity and reduced transcription of an alkaline phosphatase protein that binds Cry1Ac was associated with resistance to Cry1Ac in the four most resistant strains. A Cry1Ac-binding fragment of alkaline phosphatase from H. armigera (HaALP1f was not toxic by itself, but it increased mortality caused by Cry1Ac in a susceptible strain and in all five resistant strains. Although synergism of Bt toxins against susceptible insects by toxin-binding fragments of cadherin and aminopeptidase N has been reported previously, the results here provide the first evidence of synergism of a Bt toxin by a toxin-binding fragment of alkaline phosphatase. The results here also provide the first evidence of synergism of a Bt toxin by any toxin-binding peptide against resistant insects.

  5. A comparison of spider communities in Bt and non-Bt rice fields.

    Science.gov (United States)

    Lee, Sue Yeon; Kim, Seung Tae; Jung, Jong Kook; Lee, Joon-Ho

    2014-06-01

    To assess the potential adverse effects of a Bt rice line (Japonica rice cultivar, Nakdong) expressing a synthetic cry1Ac1 gene, C7-1-9-1-B, which was highly active against all larval stages of Cnaphalocrocis medinalis (Guenée) (Lepidoptera: Crambidae), we investigated the community structure of spiders in Bt and non-Bt rice fields during the rice-growing season in 2007 and 2008 in Chungcheongnam-do, Korea. Spiders were surveyed with a sweep net and suction device. Suction sampling captured more spiders, measured in terms of species level and abundance, than sweeping. Araneidae and Thomisidae were captured more by sweeping, and certain species were captured only by sweeping. These findings show that both suction and sweep sampling methods should be used because these methods are most likely complementary. In total, 29 species in 23 genera and nine families were identified from the 4,937 spiders collected, and both Bt and non-Bt rice fields showed a typical Korean spider assemblage. The temporal patterns of spider species richness and spider abundance were very similar between Bt and non-Bt rice, although significant differences in species richness were observed on a few occasions. Overall, spider community structure, including diversity, the dominant species, and abundance did not differ between Bt and non-Bt rice. The results of the study indicated that the transgenic Cry1Ac rice lines tested in this study had no adverse effects on the spider community structure of the rice fields.

  6. Does Bt rice pose risks to non-target arthropods? Results of a meta-analysis in China

    Science.gov (United States)

    Transgenic Bt rice expressing the protoxin proteins derived from Bacillus thuringiensis Berliner (Bt) have been developed since 1989. Their ecological risks toward non-target organisms have been investigated. However, these studies were conducted individually, yielding inconsistent conclusions and u...

  7. Quantification of toxins in a Cry1Ac + CpTI cotton cultivar and its potential effects on the honey bee Apis mellifera L.

    Science.gov (United States)

    Han, Peng; Niu, Chang-Ying; Lei, Chao-Liang; Cui, Jin-Jie; Desneux, Nicolas

    2010-11-01

    Transgenic Cry1Ac + CpTI cotton (CCRI41) is increasingly planted throughout China. However, negative effects of this cultivar on the honey bee Apis mellifera L., the most important pollinator for cultivated ecosystem, remained poorly investigated. The objective of our study was to evaluate the potential side effects of transgenic Cry1Ac + CpTI pollen from cotton on young adult honey bees A. mellifera L. Two points emphasized the significance of our study: (1) A higher expression level of insecticidal protein Cry1Ac in pollen tissues was detected (when compared with previous reports). In particular, Cry1Ac protein was detected at 300 ± 4.52 ng g(-1) [part per billion (ppb)] in pollen collected in July, (2) Effects on chronic mortality and feeding behaviour in honey bees were evaluated using a no-choice dietary feeding protocol with treated pollen, which guarantee the highest exposure level to bees potentially occurring in natural conditions (worst case scenario). Tests were also conducted using imidacloprid-treated pollen at a concentration of 48 ppb as positive control for sublethal effect on feeding behaviour. Our results suggested that Cry1Ac + CpTI pollen carried no lethal risk for honey bees. However, during a 7-day oral exposure to the various treatments (transgenic, imidacloprid-treated and control), honey bee feeding behaviour was disturbed and bees consumed significantly less CCRI41 cotton pollen than in the control group in which bees were exposed to conventional cotton pollen. It may indicate an antifeedant effect of CCRI41 pollen on honey bees and thus bees may be at risk because of large areas are planted with transgenic Bt cotton in China. This is the first report suggesting a potential sublethal effect of CCRI41 cotton pollen on honey bees. The implications of the results are discussed in terms of risk assessment for bees as well as for directions of future work involving risk assessment of CCRI41 cotton.

  8. Binding and Oligomerization of Modified and Native Bt Toxins in Resistant and Susceptible Pink Bollworm.

    Directory of Open Access Journals (Sweden)

    Josue Ocelotl

    Full Text Available Insecticidal proteins from Bacillus thuringiensis (Bt are used extensively in sprays and transgenic crops for pest control, but their efficacy is reduced when pests evolve resistance. Better understanding of the mode of action of Bt toxins and the mechanisms of insect resistance is needed to enhance the durability of these important alternatives to conventional insecticides. Mode of action models agree that binding of Bt toxins to midgut proteins such as cadherin is essential for toxicity, but some details remain unresolved, such as the role of toxin oligomers. In this study, we evaluated how Bt toxin Cry1Ac and its genetically engineered counterpart Cry1AcMod interact with brush border membrane vesicles (BBMV from resistant and susceptible larvae of Pectinophora gossypiella (pink bollworm, a global pest of cotton. Compared with Cry1Ac, Cry1AcMod lacks 56 amino acids at the amino-terminus including helix α-1; previous work showed that Cry1AcMod formed oligomers in vitro without cadherin and killed P. gossypiella larvae harboring cadherin mutations linked with >1000-fold resistance to Cry1Ac. Here we found that resistance to Cry1Ac was associated with reduced oligomer formation and insertion. In contrast, Cry1AcMod formed oligomers in BBMV from resistant larvae. These results confirm the role of cadherin in oligomerization of Cry1Ac in susceptible larvae and imply that forming oligomers without cadherin promotes toxicity of Cry1AcMod against resistant P. gossypiella larvae that have cadherin mutations.

  9. TRANSGENIC PLANTS EXPRESSING BACILLUS THURINGIENSIS DELTA-ENDOTOXINS

    Institute of Scientific and Technical Information of China (English)

    Hua-rong,Li; BrendaOppert; KunYanZhu; RandallA.Higgins; Fang-nengHuang; LawrentL.Buschman

    2003-01-01

    Commercial varieties of transgenic Bacillus thuringiensis (Bt) plants have been developed in many countries to control target pests. Initially, the expression of native Bt genes in plants was low due to mRNA instability, improper splicing, and post-translation modifications. Subsequently, modifications of the native Bt genes greatly enhanced expression levels. This is a review of the developments that made modem high-expression transgenic Bt plants possible, with an emphasis on the reasons for the low-level expression of native Bt genes in plant systems, and the techniques that have been used to improve plant expression of Bt toxin genes.

  10. Food safety assessment of Cry8Ka5 mutant protein using Cry1Ac as a control Bt protein.

    Science.gov (United States)

    Farias, Davi Felipe; Viana, Martônio Ponte; Oliveira, Gustavo Ramos; Santos, Vanessa Olinto; Pinto, Clidia Eduarda Moreira; Viana, Daniel Araújo; Vasconcelos, Ilka Maria; Grossi-de-Sa, Maria Fátima; Carvalho, Ana Fontenele Urano

    2015-07-01

    Cry8Ka5 is a mutant protein from Bacillus thuringiensis (Bt) that has been proposed for developing transgenic plants due to promising activity against coleopterans, like Anthonomus grandis (the major pest of Brazilian cotton culture). Thus, an early food safety assessment of Cry8Ka5 protein could provide valuable information to support its use as a harmless biotechnological tool. This study aimed to evaluate the food safety of Cry8Ka5 protein following the two-tiered approach, based on weights of evidence, proposed by ILSI. Cry1Ac protein was used as a control Bt protein. The history of safe use revealed no convincing hazard reports for Bt pesticides and three-domain Cry proteins. The bioinformatics analysis with the primary amino acids sequence of Cry8Ka5 showed no similarity to any known toxic, antinutritional or allergenic proteins. The mode of action of Cry proteins is well understood and their fine specificity is restricted to insects. Cry8Ka5 and Cry1Ac proteins were rapidly degraded in simulated gastric fluid, but were resistant to simulated intestinal fluid and heat treatment. The LD50 for Cry8Ka5 and Cry1Ac was >5000 mg/kg body weight when administered by gavage in mice. Thus, no expected relevant risks are associated with the consumption of Cry8Ka5 protein. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Field evidence for the exposure of ground beetles to Cry1Ab from transgenic corn.

    Science.gov (United States)

    Zwahlen, Claudia; Andow, David A

    2005-01-01

    Non-target organisms associated with the soil might be adversely affected by exposure to the CrylAb protein from Bacillus thuringiensis (Bt) in transgenic corn (Zea mays L.). To check for such exposure, we used ELISA to test for Cry1Ab in ground beetles collected live from fields with Bt corn residues and Bt corn (Bt/Bt), Bt corn residues and non-Bt crops (Bt/non-Bt), or non-Bt corn residues and non-Bt crops (non-Bt/non-Bt). In fields with Bt corn residues (Bt/Bt and Bt/non-Bt), Cry1Ab was present in all seven species of ground beetles examined (Agonum placidum, Bembidion rupicola, Clivina impressefrons, Cyclotrachelus iowensis, Harpalus pensylvanicus, Poecilus chalcites, and Poecilus lucublandus). For the two most abundant species, P. chalcites and P. lucublandus, the proportion of beetles with Cry1Ab was significantly higher in Bt/Bt fields (0.50-1.0) and Bt/non-Bt fields (0.41-0.50) than in non-Bt/non-Bt fields (0.0). This is the first field evidence that some ground beetle species are exposed to Cry1Ab. The implications of exposure on the performance of these non-target organisms are unclear.

  12. Field-Evolved Resistance in Corn Earworm to Cry Proteins Expressed by Transgenic Sweet Corn

    Science.gov (United States)

    Dively, Galen P.; Finkenbinder, Chad

    2016-01-01

    Background Transgenic corn engineered with genes expressing insecticidal toxins from the bacterium Bacillus thuringiensis (Berliner) (Bt) are now a major tool in insect pest management. With its widespread use, insect resistance is a major threat to the sustainability of the Bt transgenic technology. For all Bt corn expressing Cry toxins, the high dose requirement for resistance management is not achieved for corn earworm, Helicoverpa zea (Boddie), which is more tolerant to the Bt toxins. Methodology/Major Findings We present field monitoring data using Cry1Ab (1996–2016) and Cry1A.105+Cry2Ab2 (2010–2016) expressing sweet corn hybrids as in-field screens to measure changes in field efficacy and Cry toxin susceptibility to H. zea. Larvae successfully damaged an increasing proportion of ears, consumed more kernel area, and reached later developmental stages (4th - 6th instars) in both types of Bt hybrids (Cry1Ab—event Bt11, and Cry1A.105+Cry2Ab2—event MON89034) since their commercial introduction. Yearly patterns of H. zea population abundance were unrelated to reductions in control efficacy. There was no evidence of field efficacy or tissue toxicity differences among different Cry1Ab hybrids that could contribute to the decline in control efficacy. Supportive data from laboratory bioassays demonstrate significant differences in weight gain and fitness characteristics between the Maryland H. zea strain and a susceptible strain. In bioassays with Cry1Ab expressing green leaf tissue, Maryland H. zea strain gained more weight than the susceptible strain at all concentrations tested. Fitness of the Maryland H. zea strain was significantly lower than that of the susceptible strain as indicated by lower hatch rate, longer time to adult eclosion, lower pupal weight, and reduced survival to adulthood. Conclusions/Significance After ruling out possible contributing factors, the rapid change in field efficacy in recent years and decreased susceptibility of H. zea to Bt

  13. IT-BT convergence technology

    International Nuclear Information System (INIS)

    2012-12-01

    This book explains IT-BT convergence technology as the future technology, which includes a prolog, easy IT-BT convergence technology that has infinite potentials for new value, policy of IT-BT convergence technology showing the potential of smart Korea, IT-BT convergence opening happy future, for the new future of IT powerful nation Korea with IT-BT convergence technology and an epilogue. This book reveals the conception, policy, performance and future of IT-BT convergence technology.

  14. Cotton transformation via pollen tube pathway.

    Science.gov (United States)

    Wang, Min; Zhang, Baohong; Wang, Qinglian

    2013-01-01

    Although many gene transfer methods have been employed for successfully obtaining transgenic cotton, the major constraint in cotton improvement is the limitation of genotype because the majority of transgenic methods require plant regeneration from a single transformed cell which is limited by cotton tissue culture. Comparing with other plant species, it is difficult to induce plant regeneration from cotton; currently, only a limited number of cotton cultivars can be cultured for obtaining regenerated plants. Thus, development of a simple and genotype-independent genetic transformation method is particularly important for cotton community. In this chapter, we present a simple, cost-efficient, and genotype-independent cotton transformation method-pollen tube pathway-mediated transformation. This method uses pollen tube pathway to deliver transgene into cotton embryo sacs and then insert foreign genes into cotton genome. There are three major steps for pollen tube pathway-mediated genetic transformation, which include injection of -foreign genes into pollen tube, integration of foreign genes into plant genome, and selection of transgenic plants.

  15. Transgenic plants expressing the AaIT/GNA fusion protein show increased resistance and toxicity to both chewing and sucking pests.

    Science.gov (United States)

    Liu, Shu-Min; Li, Jie; Zhu, Jin-Qi; Wang, Xiao-Wei; Wang, Cheng-Shu; Liu, Shu-Sheng; Chen, Xue-Xin; Li, Sheng

    2016-04-01

    The adoption of pest-resistant transgenic plants to reduce yield losses and decrease pesticide use has been successful. To achieve the goal of controlling both chewing and sucking pests in a given transgenic plant, we generated transgenic tobacco, Arabidopsis, and rice plants expressing the fusion protein, AaIT/GNA, in which an insecticidal scorpion venom neurotoxin (Androctonus australis toxin, AaIT) is fused to snowdrop lectin (Galanthus nivalis agglutinin, GNA). Compared with transgenic tobacco and Arabidopsis plants expressing AaIT or GNA, transgenic plants expressing AaIT/GNA exhibited increased resistance and toxicity to one chewing pest, the cotton bollworm, Helicoverpa armigera. Transgenic tobacco and rice plants expressing AaIT/GNA showed increased resistance and toxicity to two sucking pests, the whitefly, Bemisia tabaci, and the rice brown planthopper, Nilaparvata lugens, respectively. Moreover, in the field, transgenic rice plants expressing AaIT/GNA exhibited a significant improvement in grain yield when infested with N. lugens. This study shows that expressing the AaIT/GNA fusion protein in transgenic plants can be a useful approach for controlling pests, particularly sucking pests which are not susceptible to the toxin in Bt crops. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  16. The Development of a Remote Sensor System and Decision Support Systems Architecture to Monitor Resistance Development in Transgenic Crops

    Science.gov (United States)

    Cacas, Joseph; Glaser, John; Copenhaver, Kenneth; May, George; Stephens, Karen

    2008-01-01

    The United States Environmental Protection Agency (EPA) has declared that "significant benefits accrue to growers, the public, and the environment" from the use of transgenic pesticidal crops due to reductions in pesticide usage for crop pest management. Large increases in the global use of transgenic pesticidal crops has reduced the amounts of broad spectrum pesticides used to manage pest populations, improved yield and reduced the environmental impact of crop management. A significant threat to the continued use of this technology is the evolution of resistance in insect pest populations to the insecticidal Bt toxins expressed by the plants. Management of transgenic pesticidal crops with an emphasis on conservation of Bt toxicity in field populations of insect pests is important to the future of sustainable agriculture. A vital component of this transgenic pesticidal crop management is establishing the proof of concept basic understanding, situational awareness, and monitoring and decision support system tools for more than 133650 square kilometers (33 million acres) of bio-engineered corn and cotton for development of insect resistance . Early and recent joint NASA, US EPA and ITD remote imagery flights and ground based field experiments have provided very promising research results that will potentially address future requirements for crop management capabilities.

  17. Dominant inheritance of field-evolved resistance to Bt corn in Busseolafusca.

    Directory of Open Access Journals (Sweden)

    Pascal Campagne

    Full Text Available Transgenic crops expressing Bacillus thuringiensis (Bt toxins have been adopted worldwide, notably in developing countries. In spite of their success in controlling target pests while allowing a substantial reduction of insecticide use, the sustainable control of these pest populations is threatened by the evolution of resistance. The implementation of the "high dose/refuge" strategy for managing insect resistance in transgenic crops aims at delaying the evolution of resistance to Bt crops in pest populations by promoting survival of susceptible insects. However, a crucial condition for the "high dose/refuge" strategy to be efficient is that the inheritance of resistance should be functionally recessive. Busseolafusca developed high levels of resistance to the Bt toxin Cry 1Ab expressed in Bt corn in South Africa. To test whether the inheritance of B. fusca resistance to the Bt toxin could be considered recessive we performed controlled crosses with this pest and evaluated its survival on Bt and non-Bt corn. Results show that resistance of B. fusca to Bt corn is dominant, which refutes the hypothesis of recessive inheritance. Survival on Bt corn was not lower than on non-Bt corn for both resistant larvae and the F1 progeny from resistant × susceptible parents. Hence, resistance management strategies of B. fusca to Bt corn must address non-recessive resistance.

  18. Impacts of elevated CO2 on exogenous Bacillus thuringiensis toxins and transgene expression in transgenic rice under different levels of nitrogen.

    Science.gov (United States)

    Jiang, Shoulin; Lu, Yongqing; Dai, Yang; Qian, Lei; Muhammad, Adnan Bodlah; Li, Teng; Wan, Guijun; Parajulee, Megha N; Chen, Fajun

    2017-11-07

    Recent studies have highlighted great challenges of transgene silencing for transgenic plants facing climate change. In order to understand the impacts of elevated CO 2 on exogenous Bacillus thuringiensis (Bt) toxins and transgene expression in transgenic rice under different levels of N-fertilizer supply, we investigated the biomass, exogenous Bt toxins, Bt-transgene expression and methylation status in Bt rice exposed to two levels of CO 2 concentrations and nitrogen (N) supply (1/8, 1/4, 1/2, 1 and 2 N). It is elucidated that the increased levels of global atmospheric CO 2 concentration will trigger up-regulation of Bt toxin expression in transgenic rice, especially with appropriate increase of N fertilizer supply, while, to some extent, the exogenous Bt-transgene expression is reduced at sub-N levels (1/4 and 1/2N), even though the total protein of plant tissues is reduced and the plant growth is restricted. The unpredictable and stochastic occurrence of transgene silencing and epigenetic alternations remains unresolved for most transgenic plants. It is expected that N fertilization supply may promote the expression of transgenic Bt toxin in transgenic Bt rice, particularly under elevated CO 2 .

  19. AN APPROACH TO TRANSGENIC CROP MONITORING

    Science.gov (United States)

    Remote sensing by aerial or satellite images may provide a method of identifying transgenic pesticidal crop distribution in the landscape. Genetically engineered crops containing bacterial gene(s) that express an insecticidal protein from Bacillus thuringiensis (Bt) are regulated...

  20. Market forces and technological substitutes cause fluctuations in the value of bat pest-control services for cotton.

    Directory of Open Access Journals (Sweden)

    Laura López-Hoffman

    Full Text Available Critics of the market-based, ecosystem services approach to biodiversity conservation worry that volatile market conditions and technological substitutes will diminish the value of ecosystem services and obviate the "economic benefits" arguments for conservation. To explore the effects of market forces and substitutes on service values, we assessed how the value of the pest-control services provided by Mexican free-tailed bats (Tadarida brasiliensis mexicana to cotton production in the southwestern U.S. has changed over time. We calculated service values each year from 1990 through 2008 by estimating the value of avoided crop damage and the reduced social and private costs of insecticide use in the presence of bats. Over this period, the ecosystem service value declined by 79% ($19.09 million U.S. dollars due to the introduction and widespread adoption of Bt (Bacillus thuringiensis cotton transgenically modified to express its own pesticide, falling global cotton prices and the reduction in the number of hectares in the U.S. planted with cotton. Our results demonstrate that fluctuations in market conditions can cause temporal variation in ecosystem service values even when ecosystem function--in this case bat population numbers--is held constant. Evidence is accumulating, however, of the evolution of pest resistance to Bt cotton, suggesting that the value of bat pest-control services may increase again. This gives rise to an economic option value argument for conserving Mexican free-tailed bat populations. We anticipate that these results will spur discussion about the role of ecosystem services in biodiversity conservation in general, and bat conservation in particular.

  1. Market forces and technological substitutes cause fluctuations in the value of bat pest-control services for cotton

    Science.gov (United States)

    López-Hoffman, Laura; Wiederholt, Ruscena; Sansone, Chris; Bagstad, Kenneth J.; Cryan, Paul M.; Diffendorfer, James E.; Goldstein, Joshua; LaSharr, Kelsie; Loomis, John; McCracken, Gary; Medellin, Rodrigo A.; Russell, Amy; Semmens, Darius J.

    2014-01-01

    Critics of the market-based, ecosystem services approach to biodiversity conservation worry that volatile market conditions and technological substitutes will diminish the value of ecosystem services and obviate the “economic benefits” arguments for conservation. To explore the effects of market forces and substitutes on service values, we assessed how the value of the pest-control services provided by Mexican free-tailed bats (Tadarida brasiliensis mexicana) to cotton production in the southwestern U.S. has changed over time. We calculated service values each year from 1990 through 2008 by estimating the value of avoided crop damage and the reduced social and private costs of insecticide use in the presence of bats. Over this period, the ecosystem service value declined by 79% ($19.09 million U.S. dollars) due to the introduction and widespread adoption of Bt (Bacillus thuringiensis) cotton transgenically modified to express its own pesticide, falling global cotton prices and the reduction in the number of hectares in the U.S. planted with cotton. Our results demonstrate that fluctuations in market conditions can cause temporal variation in ecosystem service values even when ecosystem function – in this case bat population numbers – is held constant. Evidence is accumulating, however, of the evolution of pest resistance to Bt cotton, suggesting that the value of bat pest-control services may increase again. This gives rise to an economic option value argument for conserving Mexican free-tailed bat populations. We anticipate that these results will spur discussion about the role of ecosystem services in biodiversity conservation in general, and bat conservation in particular.

  2. Testing public Bt maize events for control of stem borers in the first ...

    African Journals Online (AJOL)

    Transgenic maize (Zea mays L), developed using modified genes from the bacterium Bacillus thuringiensis (Bt), controls stem borers without observable negative effects to humans, livestock or the environment, and is now sown on 134 million hectares globally. Bt maize could contribute to increasing maize production in ...

  3. Genetic transformation of cry1EC gene into cotton ( Gossypium ...

    African Journals Online (AJOL)

    Cotton is the chief fibre crop of global importance. It plays a significant role in the national economy. Cotton crop is vulnerable to a number of insect species, especially to the larvae of lepidopteron pests. 60% insecticides sprayed on cotton are meant to control the damage caused by bollworm complex. Transgenic ...

  4. Evaluation of bioassays for testing Bt sweetpotato events against ...

    African Journals Online (AJOL)

    Sweetpotato weevil (Cylas puncticollis) Boheman is a serious pest throughout Sub-Saharan Africa region and is a big threat to sweetpotato cultivation. Ten transgenic sweetpotato events expressing Cry7Aa1, Cry3Ca1, and ET33-34 proteins from Bacillus thuringiensis (Bt) were evaluated for resistance against C.

  5. Engineering cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using viral truncated AC1 DNA sequences.

    Science.gov (United States)

    Hashmi, Jamil A; Zafar, Yusuf; Arshad, Muhammad; Mansoor, Shahid; Asad, Shaheen

    2011-04-01

    Several important biological processes are performed by distinct functional domains found on replication-associated protein (Rep) encoded by AC1 of geminiviruses. Two truncated forms of replicase (tAC1) gene, capable of expressing only the N-terminal 669 bp (5'AC1) and C-terminal 783 bp (3'AC1) nucleotides cloned under transcriptional control of the CaMV35S were introduced into cotton (Gossypium hirsutum L.) using LBA4404 strain of Agrobacterium tumefaciens to make use of an interference strategy for impairing cotton leaf curl virus (CLCuV) infection in transgenic cotton. Compared with nontransformed control, we observed that transgenic cotton plants overexpressing either N-terminal (5'AC1) or C-terminal (3'AC1) sequences confer resistance to CLCuV by inhibiting replication of viral genomic and β satellite DNA components. Molecular analysis by Northern blot hybridization revealed high transgene expression in early and late growth stages associated with inhibition of CLCuV replication. Of the eight T(1) transgenic lines tested, six had delayed and minor symptoms as compared to nontransformed control lines which developed disease symptoms after 2-3 weeks of whitefly-mediated viral delivery. Virus biological assay and growth of T(2) plants proved that transgenic cotton plants overexpressing 5'- and 3'AC1 displayed high resistance level up to 72, 81%, respectively, as compared to non-transformed control plants following inoculation with viruliferous whiteflies giving significantly high cotton seed yield. Progeny analysis of these plants by polymerase chain reaction (PCR), Southern blotting and virus biological assay showed stable transgene, integration, inheritance and cotton leaf curl disease (CLCuD) resistance in two of the eight transgenic lines having single or two transgene insertions. Transgenic cotton expressing partial AC1 gene of CLCuV can be used as virus resistance source in cotton breeding programs aiming to improve virus resistance in cotton crop.

  6. IMPACT OF BT ( BACILLUS THURINGIENSIS ) CROPS ON BAT ACTIVITY IN SOUTH TEXAS AGROECOSYSTEMS

    Science.gov (United States)

    The widespread adoption of transgenic insecticidal crops raises concerns that nontarget species may be harmed and food webs disrupted. The goal of this research is to determine how transgenic Bt (Bacillus thuringiensis) crops impact the activity of Brazilian freetailed bats (Tada...

  7. Decrease in catalase activity of Folsomia candida fed a Bt rice diet

    Energy Technology Data Exchange (ETDEWEB)

    Yuan Yiyang, E-mail: yuanyy@ioz.ac.cn [State Key Laboratory of Integrated Management of Pest and Rodents, Institute of Zoology, Chinese Academy of Sciences, 1 Beichen West Road, Chaoyang District, Beijing 100101 (China); Graduate School, Chinese Academy of Sciences, Beijing 100039 (China); Ke Xin, E-mail: xinke@sibs.ac.cn [Shanghai Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 300 Fenglin Road, Shanghai 200032 (China); Chen Fajun, E-mail: fajunchen@njau.edu.cn [College of Plant Protection, Department of Entomology, Nanjing Agricultural University, Nanjing 210095 (China); Krogh, Paul Henning, E-mail: phk@dmu.dk [Department of Bioscience, University of Aarhus, P.O. Box 314, Vejlsoevej 25, DK-8600 Silkeborg (Denmark); Ge Feng, E-mail: gef@ioz.ac.cn [State Key Laboratory of Integrated Management of Pest and Rodents, Institute of Zoology, Chinese Academy of Sciences, 1 Beichen West Road, Chaoyang District, Beijing 100101 (China)

    2011-12-15

    Here we report the effects of three Bt-rice varieties and their non-Bt conventional isolines on biological traits including survival, reproduction, and the activities of three antioxidant enzymes superoxide dismutase, catalase and peroxidase, in the Collembolan, Folsomia candida. The reproduction was significantly lower when fed Kemingdao and Huahui1 than those feeding on their non-GM near-isogenic varieties Xiushui and Minghui63 respectively, this can be explained by the differences of plant compositions depended on variety of rice. The catalase activity of F. candida was significantly lower when fed the Bt-rice variety Kemingdao compared to the near-isogenic non-Bt-rice variety Xiushui. This suggests that some Bt-rice varieties may impose environmental stress to collembolans. We emphasize that changes in activity of antioxidant enzymes of non-target organisms are important in understanding the ecological consequences for organisms inhabiting transgenic Bt-rice plantations. - Highlights: > We examine the effects of Bt-rice on Folsomia candida with laboratory test. > The reproduction of F. candida was decreased by two Bt-rice varieties. > Decreased reproduction caused by the differences of varieties or C/N ratio of rice. > The catalase activity was decreased by Bt-rice Kemingdao. > Some Bt-rice may impose environmental stress on NTOs. - The catalase of the collembolan (Folsomia candida) was decreased when fed Bt-rice, Kemingdao.

  8. Decrease in catalase activity of Folsomia candida fed a Bt rice diet

    International Nuclear Information System (INIS)

    Yuan Yiyang; Ke Xin; Chen Fajun; Krogh, Paul Henning; Ge Feng

    2011-01-01

    Here we report the effects of three Bt-rice varieties and their non-Bt conventional isolines on biological traits including survival, reproduction, and the activities of three antioxidant enzymes superoxide dismutase, catalase and peroxidase, in the Collembolan, Folsomia candida. The reproduction was significantly lower when fed Kemingdao and Huahui1 than those feeding on their non-GM near-isogenic varieties Xiushui and Minghui63 respectively, this can be explained by the differences of plant compositions depended on variety of rice. The catalase activity of F. candida was significantly lower when fed the Bt-rice variety Kemingdao compared to the near-isogenic non-Bt-rice variety Xiushui. This suggests that some Bt-rice varieties may impose environmental stress to collembolans. We emphasize that changes in activity of antioxidant enzymes of non-target organisms are important in understanding the ecological consequences for organisms inhabiting transgenic Bt-rice plantations. - Highlights: → We examine the effects of Bt-rice on Folsomia candida with laboratory test. → The reproduction of F. candida was decreased by two Bt-rice varieties. → Decreased reproduction caused by the differences of varieties or C/N ratio of rice. → The catalase activity was decreased by Bt-rice Kemingdao. → Some Bt-rice may impose environmental stress on NTOs. - The catalase of the collembolan (Folsomia candida) was decreased when fed Bt-rice, Kemingdao.

  9. Seletividade de amonio-glufosinate isolado e em mistura com pyrithiobac-sodium em algodoeiro transgênico LL® Selectivity of ammonium-glufosinate applied alone or in mixture with pyrithiobac sodium in transgenic LL® cotton

    Directory of Open Access Journals (Sweden)

    G.B.P. Braz

    2012-12-01

    Full Text Available Com a recente introdução no Brasil de variedades transgênicas de algodoeiro que apresentam resistência ao amonio-glufosinate (LL®, há escassez de informações tanto a respeito da seletividade de reaplicações desse herbicida, quanto no que se refere a misturas com outros herbicidas. Objetivou-se no presente trabalho avaliar a seletividade de aplicações sequenciais de amonio-glufosinate isolado e em associação com pyrithiobac-sodium em algodão transgênico LL®. Dessa forma, foi instalado um experimento em delineamento de blocos casualizados em arranjo fatorial (3x3+1, empregando-se oito repetições. O primeiro fator correspondeu à aplicação dos tratamentos amonio-glufosinate (500 g ha-1 e amonio-glufosinate + pyrithiobac-sodium (500 + 42 g ha-1 e 500 + 56 g ha-1. O segundo fator foi o número de aplicações sequenciais em pós-emergência do algodoeiro (uma, duas ou três. O tratamento adicional foi composto por testemunha sem aplicação de herbicida. A associação do pyrithiobac-sodium ao amonio-glufosinate causou maiores níveis de fitointoxicação inicial, embora não tenham havido mais sintomas duas semanas após as aplicações. A qualidade de fibra do algodoeiro não foi influenciada por nenhum dos tratamentos herbicidas. O amonio-glufosinate isolado foi seletivo para o algodão LL® em até três aplicações em pós-emergência. O algodoeiro apresentou ainda tolerância a uma aplicação da mistura de amonio-glufosinate + pyrithiobac-sodium, e não se observou qualquer efeito negativo sobre a produtividade de algodão em caroço.Due to the recent introduction of transgenic cotton varities with resistance to ammonium-glufosinate (LL® in Brazil, there is a lack of information related both to the selectivity of sequential reapplications of ammonium-glufosinate and to tank mixture with other herbicides. This work aimed to evaluate the selectivity of sequential applications of ammonium-glufosinate isolated or in

  10. Chloroplast localization of Cry1Ac and Cry2A protein- an alternative way of insect control in cotton

    Directory of Open Access Journals (Sweden)

    Adnan Muzaffar

    2015-01-01

    Full Text Available BACKGROUND: Insects have developed resistance against Bt-transgenic plants. A multi-barrier defense system to weaken their resistance development is now necessary. One such approach is to use fusion protein genes to increase resistance in plants by introducing more Bt genes in combination. The locating the target protein at the point of insect attack will be more effective. It will not mean that the non-green parts of the plants are free of toxic proteins, but it will inflict more damage on the insects because they are at maximum activity in the green parts of plants. RESULTS: Successful cloning was achieved by the amplification of Cry2A, Cry1Ac, and a transit peptide. The appropriate polymerase chain reaction amplification and digested products confirmed that Cry1Ac and Cry2A were successfully cloned in the correct orientation. The appearance of a blue color in sections of infiltrated leaves after 72 hours confirmed the successful expression of the construct in the plant expression system. The overall transformation efficiency was calculated to be 0.7%. The amplification of Cry1Ac-Cry2A and Tp2 showed the successful integration of target genes into the genome of cotton plants. A maximum of 0.673 μg/g tissue of Cry1Ac and 0.568 μg/g tissue of Cry2A was observed in transgenic plants. We obtained 100% mortality in the target insect after 72 hours of feeding the 2nd instar larvae with transgenic plants. The appearance of a yellow color in transgenic cross sections, while absent in the control, through phase contrast microscopy indicated chloroplast localization of the target protein. CONCLUSION: Locating the target protein at the point of insect attack increases insect mortality when compared with that of other transgenic plants. The results of this study will also be of great value from a biosafety point of view.

  11. GhZFP1, a novel CCCH-type zinc finger protein from cotton, enhances salt stress tolerance and fungal disease resistance in transgenic tobacco by interacting with GZIRD21A and GZIPR5.

    Science.gov (United States)

    Guo, Ying-Hui; Yu, Yue-Ping; Wang, Dong; Wu, Chang-Ai; Yang, Guo-Dong; Huang, Jin-Guang; Zheng, Cheng-Chao

    2009-01-01

    * Zinc finger proteins are a superfamily involved in many aspects of plant growth and development. However, CCCH-type zinc finger proteins involved in plant stress tolerance are poorly understood. * A cDNA clone designated Gossypium hirsutum zinc finger protein 1 (GhZFP1), which encodes a novel CCCH-type zinc finger protein, was isolated from a salt-induced cotton (G. hirsutum) cDNA library using differential hybridization screening and further studied in transgenic tobacco Nicotiana tabacum cv. NC89. Using yeast two-hybrid screening (Y2H), proteins GZIRD21A (GhZFP1 interacting and responsive to dehydration protein 21A) and GZIPR5 (GhZFP1 interacting and pathogenesis-related protein 5), which interacted with GhZFP1, were isolated. * GhZFP1 contains two typical zinc finger motifs (Cx8Cx5Cx3H and Cx5Cx4Cx3H), a putative nuclear export sequence (NES) and a potential nuclear localization signal (NLS). Transient expression analysis using a GhZFP1::GFP fusion gene in onion epidermal cells indicated a nuclear localization for GhZFP1. RNA blot analysis showed that the GhZFP1 transcript was induced by salt (NaCl), drought and salicylic acid (SA). The regions in GhZFP1 that interact with GZIRD21A and GZIPR5 were identified using truncation mutations. * Overexpression of GhZFP1 in transgenic tobacco enhanced tolerance to salt stress and resistance to Rhizoctonia solani. Therefore, it appears that GhZFP1 might be involved as an important regulator in plant responses to abiotic and biotic stresses.

  12. Integrating immunomarking with ecological and behavioural approaches to assess predation of Helicoverpa spp. larvae by wolf spiders in cotton

    Science.gov (United States)

    Wolf spiders (Araneae: Lycosidae) are abundant soil-dwelling predators found in cotton fields and can contribute important pest management services. These spiders can kill and consume larvae of the cotton bollworm Helicoverpa spp. (Lepidoptera: Noctuidae) that survive foraging on Bt cotton and desce...

  13. Effects of Bt-maize material on the life cycle of the land snail Cantareus aspersus

    DEFF Research Database (Denmark)

    Kramarz, Paulina; de Vaufleury, Annette; Gimbert, Frédéric

    2009-01-01

    ). For snails not previously exposed to Bt material, hatchability of eggs was similar in the soils tested. The outcome of the experiments indicates that, in growing snails, long-term exposure is needed to reveal an effect of Bt-maize. The hazard analysis of Bt-maize which we performed, based on a worst......Insect resistant Bt-maize (MON 810) expresses active Cry1Ab endotoxin derived from Bacillus thuringiensis (Bt). Snails constitute non-target soil species potentially exposed to Bt-toxin through consumption of plant material and soil in fields where transgenic plants have been grown. We studied...... the effect of the Cry1Ab toxin on survival, growth and egg hatchability of the snail Cantareus aspersus. From the age of 4 to 88 weeks, snails were fed either powdered Bt-maize or non-Bt-maize and exposed to soil samples collected after harvesting either the Bt-maize or non-Bt-maize. We applied four...

  14. Potential factors impacting season-long expression of Cry1Ac in 13 commercial varieties of Bollgard® cotton

    Directory of Open Access Journals (Sweden)

    John J. Adamczyk, Jr.

    2001-11-01

    Full Text Available Thirteen commercial varieties of transgenic Cry1Ac Bacillus thuringiensis Berliner (Bt cotton were examined across two sites in 2000 for potential factors that impact endotoxin expression. In all cases, two varieties (NuCOTN 33B and DP 458B/RR, Delta and Pineland Co., Scott, MS expressed more Cry1Ac than the other 11 varieties in various plant structures. These two varieties share the same parental background (DP 5415. Furthermore, when the next generation of plants were tested in the greenhouse, the same varietal patterns were exhibited. These data strongly suggest that factors such as parental background had a stronger impact on the expression of Cry1Ac than the environment.

  15. Toxins for Transgenic Resistance to Hemipteran Pests

    Science.gov (United States)

    Chougule, Nanasaheb P.; Bonning, Bryony C.

    2012-01-01

    The sap sucking insects (Hemiptera), which include aphids, whiteflies, plant bugs and stink bugs, have emerged as major agricultural pests. The Hemiptera cause direct damage by feeding on crops, and in some cases indirect damage by transmission of plant viruses. Current management relies almost exclusively on application of classical chemical insecticides. While the development of transgenic crops expressing toxins derived from the bacterium Bacillus thuringiensis (Bt) has provided effective plant protection against some insect pests, Bt toxins exhibit little toxicity against sap sucking insects. Indeed, the pest status of some Hemiptera on Bt-transgenic plants has increased in the absence of pesticide application. The increased pest status of numerous hemipteran species, combined with increased prevalence of resistance to chemical insecticides, provides impetus for the development of biologically based, alternative management strategies. Here, we provide an overview of approaches toward transgenic resistance to hemipteran pests. PMID:22822455

  16. LOBI test BT-15/BT-16 pre-test calculation

    International Nuclear Information System (INIS)

    Holmes, B.J.

    1991-03-01

    LOBI is a higher pressure, electrically heated integral system facility simulating a KWU 1300 MW PWR scaled 1:712 by volume, although full scale has been maintained in the vertical direction. In order to complete the test programme before the facility is closed in 1991 a number of tests have been performed in tandem, where the test procedures were compatible. BT-15/BT-16 is one such composite test. In their original form both tests BT-15 and BT-16 simulated a loss of main feedwater transient with delayed auxiliary feedwater injection, with the pumps running in BT-15 and tripped in BT-16. The aim of each test was to investigate the loss of primary/secondary heat transfer as the steam generator secondary sides boiled down, and the subsequent recovery of heat transfer as the auxiliary feedwater was tripped on. Due to a re-scheduling of the test programme there was insufficient time to perform sensitivity studies and so only one, base case, calculation is presented. (author)

  17. Carbon contributions from roots in cotton based rotations

    Science.gov (United States)

    Tan, D. K. Y.; Hulugalle, N. R.

    2012-04-01

    Most research on the decline in soil organic carbon (SOC) stocks in Australian cotton farming systems has focussed on the inputs from above-ground crop residues, with contribution from roots being less studied. This paper aims to outline the contribution of cotton roots and roots of other crops to soil carbon stocks in furrow-irrigated Vertisols in several cotton (Gossypium hirsutum L.)-based rotations. Data was collected from cotton-based rotation systems: cotton monoculture, cotton-vetch (Vicia benghalensis) Roth.), cotton-wheat (Triticum aestivum L.), cotton-wheat-vetch, cotton-corn, corn-corn, cotton-sorghum (Sorghum bicolor L.) and from BollgardTM II (Bt) and non-Bt cotton. Land management systems were permanent beds, with or without standing stubble, and conventional tillage. Root growth in the surface 0.10 m was measured with the core-break method, and that in the 0.10 to 1.0 m depth with a minirhizotron and I-CAP image capture system. These measurements were used to derive root C added to soil through intra-seasonal root death (Clost), C in roots remaining at the end of season (Croot), and total root C added to soil (Ctotal = Croot + Clost). Ctotal in non-Bt cotton (Sicot 80RRF, 0.9 t C/ha/year) was higher than in Bt cotton (Sicot 80RRF, 0.6 t C/ha/year). Overall, Ctotal from cotton roots ranges between 0.5 to 5 t C/ha/year, with Clost contributing 25-70%. Ctotal was greater with vetch than with wheat and was in the order of vetch in cotton-wheat-vetch (5.1 t C/ha/year) > vetch in cotton-vetch (1.9 t C/ha/year) > wheat in cotton-wheat (1.6 t C/ha/year) = wheat in cotton-wheat-vetch (1.7 t C/ha/year). Intra-seasonal root mortality accounted for 12% of total root carbon in vetch and 36% in wheat. Average corn Ctotal with monoculture was 9.3 t/ha and with cotton-corn 5.0 t/ha. Ctotal averaged between both treatments was, thus, of the order of 7.7 t C/ha/year and average Clost 0.04 t/ha/yr. Sorghum roots contributed less carbon with conventional tillage (8.2 t

  18. Stable integration and expression of a cry1Ia gene conferring resistance to fall armyworm and boll weevil in cotton plants.

    Science.gov (United States)

    Silva, Carliane Rc; Monnerat, Rose; Lima, Liziane M; Martins, Érica S; Melo Filho, Péricles A; Pinheiro, Morganna Pn; Santos, Roseane C

    2016-08-01

    Boll weevil is a serious pest of cotton crop. Effective control involves applications of chemical insecticides, increasing the cost of production and environmental pollution. The current genetically modified Bt crops have allowed great benefits to farmers but show activity limited to lepidopteran pests. This work reports on procedures adopted for integration and expression of a cry transgene conferring resistance to boll weevil and fall armyworm by using molecular tools. Four Brazilian cotton cultivars were microinjected with a minimal linear cassette generating 1248 putative lines. Complete gene integration was found in only one line (T0-34) containing one copy of cry1Ia detected by Southern blot. Protein was expressed in high concentration at 45 days after emergence (dae), decreasing by approximately 50% at 90 dae. Toxicity of the cry protein was demonstrated in feeding bioassays revealing 56.7% mortality to boll weevil fed buds and 88.1% mortality to fall armyworm fed leaves. A binding of cry1Ia antibody was found in the midgut of boll weevils fed on T0-34 buds in an immunodetection assay. The gene introduced into plants confers resistance to boll weevil and fall armyworm. Transmission of the transgene occurred normally to T1 progeny. All plants showed phenotypically normal growth, with fertile flowers and abundant seeds. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  19. Bt Jute Expressing Fused δ-Endotoxin Cry1Ab/Ac for Resistance to Lepidopteran Pests

    Directory of Open Access Journals (Sweden)

    Shuvobrata Majumder

    2018-01-01

    Full Text Available Jute (Corchorus sp. is naturally occurring, biodegradable, lignocellulosic-long, silky, golden shiny fiber producing plant that has great demands globally. Paper and textile industries are interested in jute because of the easy availability, non-toxicity and high yield of cellulosic biomass produced per acre in cultivation. Jute is the major and most industrially used bast fiber-producing crop in the world and it needs protection from insect pest infestation that decreases its yield and quality. Single locus integration of the synthetically fused cry1Ab/Ac gene of Bacillus thuringiensis (Bt in Corchorus capsularis (JRC 321 by Agrobacterium tumefaciens-mediated shoot tip transformation provided 5 potent Bt jute lines BT1, BT2, BT4, BT7 and BT8. These lines consistently expressed the Cry1Ab/Ac endotoxin ranging from 0.16 to 0.35 ng/mg of leaf, in the following generations (analyzed upto T4. The effect of Cry1Ab/Ac endotoxin was studied against 3 major Lepidopteran pests of jute- semilooper (Anomis sabulifera Guenee, hairy caterpillar (Spilarctia obliqua Walker and indigo caterpillar (Spodoptera exigua Hubner by detached leaf and whole plant insect bioassay on greenhouse-grown transgenic plants. Results confirm that larvae feeding on transgenic plants had lower food consumption, body size, body weight and dry weight of excreta compared to non-transgenic controls. Insect mortality range among transgenic feeders was 66–100% for semilooper and hairy caterpillar and 87.50% for indigo caterpillar. Apart from insect resistance, the transgenic plants were at par with control plants in terms of agronomic parameters and fiber quality. Hence, these Bt jutes in the field would survive Lepidopteran pest infestation, minimize harmful pesticide usage and yield good quality fiber.

  20. Increased mortality is predicted of Inachis io larvae caused by Bt-maize pollen in European farmland

    DEFF Research Database (Denmark)

    Holst, Niels; Lang, Andreas; Lövei, Gabor L

    2013-01-01

    A potential environmental risk of the field cultivation of insect-resistant (Bt-toxin expressing) transgenic maize (Zea mays) is the consumption of Bt-containing pollen by herbivorous larvae of butterflies (Lepidoptera). Maize is wind-pollinated, and at flowering time large amounts of pollen can...

  1. Impact of Bollgard ® genetically modified cotton on the biodiversity ...

    African Journals Online (AJOL)

    Using cotton cultivars that express a gene of the Bacillus thuringiensis (Bt) bacterium producing a protein (Cry1Ac) with an insecticide effect on the Lepidoptera pests has made it possible to reduce the number of insecticide applications during the crop cycle. Thus, the objective was to determine, in the field during the ...

  2. Responses by earthworms to reduced tillage in herbicide tolerant maize and Bt maize cropping systems

    DEFF Research Database (Denmark)

    Krogh, P. H.; Griffiths, B.; Demsar, D.

    2007-01-01

    -toxin producing transgenic maize line MON810 was studied for 1 year. At a Danish study site, Foulum (Jutland), one year of Bt corn was followed by 2 years of herbicide tolerant corn. At the French study site the most prominent effects observed were due to the tillage method where RT significantly reduced...

  3. Plant Fitness Assessment for Wild Relatives of Insect Resistant Bt-Crops

    Directory of Open Access Journals (Sweden)

    D. K. Letourneau

    2012-01-01

    Full Text Available When field tests of transgenic plants are precluded by practical containment concerns, manipulative experiments can detect potential consequences of crop-wild gene flow. Using topical sprays of bacterial Bacillus thuringiensis larvicide (Bt and larval additions, we measured fitness effects of reduced herbivory on Brassica rapa (wild mustard and Raphanus sativus (wild radish. These species represent different life histories among the potential recipients of Bt transgenes from Bt cole crops in the US and Asia, for which rare spontaneous crosses are expected under high exposure. Protected wild radish and wild mustard seedlings had approximately half the herbivore damage of exposed plants and 55% lower seedling mortality, resulting in 27% greater reproductive success, 14-day longer life-spans, and 118% more seeds, on average. Seed addition experiments in microcosms and in situ indicated that wild radish was more likely to spread than wild mustard in coastal grasslands.

  4. Climate change, transgenic corn adoption and field-evolved resistance in corn earworm.

    Science.gov (United States)

    Venugopal, P Dilip; Dively, Galen P

    2017-06-01

    Increased temperature anomaly during the twenty-first century coincides with the proliferation of transgenic crops containing the bacterium Bacillus thuringiensis (Berliner) (Bt) to express insecticidal Cry proteins. Increasing temperatures profoundly affect insect life histories and agricultural pest management. However, the implications of climate change on Bt crop-pest interactions and insect resistance to Bt crops remains unexamined. We analysed the relationship of temperature anomaly and Bt adoption with field-evolved resistance to Cry1Ab Bt sweet corn in a major pest, Helicoverpa zea (Boddie). Increased Bt adoption during 1996-2016 suppressed H. zea populations, but increased temperature anomaly buffers population reduction. Temperature anomaly and its interaction with elevated selection pressure from high Bt acreage probably accelerated the Bt-resistance development. Helicoverpa zea damage to corn ears, kernel area consumed, mean instars and proportion of late instars in Bt varieties increased with Bt adoption and temperature anomaly, through additive or interactive effects. Risk of Bt-resistant H. zea spreading is high given extensive Bt adoption, and the expected increase in overwintering and migration. Our study highlights the challenges posed by climate change for Bt biotechnology-based agricultural pest management, and the need to incorporate evolutionary processes affected by climate change into Bt-resistance management programmes.

  5. Cotton contamination

    CSIR Research Space (South Africa)

    Van der Sluijs, MHJ

    2018-05-01

    Full Text Available This review focusses on physical forms of contaminant including the presence, prevention and/or removal of foreign bodies, stickiness and seed-coat fragments rather than the type and quantity of chemical residues that might be present in cotton...

  6. Regional pest suppression associated with widespread Bt maize adoption benefits vegetable growers.

    Science.gov (United States)

    Dively, Galen P; Venugopal, P Dilip; Bean, Dick; Whalen, Joanne; Holmstrom, Kristian; Kuhar, Thomas P; Doughty, Hélène B; Patton, Terry; Cissel, William; Hutchison, William D

    2018-03-27

    Transgenic crops containing the bacterium Bacillus thuringiensis (Bt) genes reduce pests and insecticide usage, promote biocontrol services, and economically benefit growers. Area-wide Bt adoption suppresses pests regionally, with declines expanding beyond the planted Bt crops into other non-Bt crop fields. However, the offsite benefits to growers of other crops from such regional suppression remain uncertain. With data spanning 1976-2016, we demonstrate that vegetable growers benefit via decreased crop damage and insecticide applications in relation to pest suppression in the Mid-Atlantic United States. We provide evidence for the regional suppression of Ostrinia nubilalis (Hübner), European corn borer, and Helicoverpa zea (Boddie), corn earworm, populations in association with widespread Bt maize adoption (1996-2016) and decreased economic levels for injury in vegetable crops [peppers ( Capsicum annuum L.), green beans ( Phaseolus vulgaris L.), and sweet corn ( Zea mays L., convar. saccharata )] compared with the pre-Bt period (1976-1995). Moth populations of both species significantly declined in association with widespread Bt maize (field corn) adoption, even as increased temperatures buffered the population reduction. We show marked decreases in the number of recommended insecticidal applications, insecticides applied, and O. nubilalis damage in vegetable crops in association with widespread Bt maize adoption. These offsite benefits to vegetable growers in the agricultural landscape have not been previously documented, and the positive impacts identified here expand on the reported ecological effects of Bt adoption. Our results also underscore the need to account for offsite economic benefits of pest suppression, in addition to the direct economic benefits of Bt crops.

  7. The cultivation of Bt corn producing Cry1Ac toxins does not adversely affect non-target arthropods.

    Directory of Open Access Journals (Sweden)

    Yanyan Guo

    Full Text Available Transgenic corn producing Cry1Ac toxins from Bacillus thuringiensis (Bt provides effective control of Asian corn borer, Ostrinia furnacalis (Guenée, and thus reduces insecticide applications. However, whether Bt corn exerts undesirable effects on non-target arthropods (NTAs is still controversial. We conducted a 2-yr study in Shangzhuang Agricultural Experiment Station to assess the potential impact of Bt corn on field population density, biodiversity, community composition and structure of NTAs. On each sampling date, the total abundance, Shannon's diversity index, Pielou's evenness index and Simpson's diversity index were not significantly affected by Bt corn as compared to non-Bt corn. The "sampling dates" had a significant effect on these indices, but no clear tendencies related to "Bt corn" or "sampling dates X corn variety" interaction were recorded. Principal response curve analysis of variance indicated that Bt corn did not alter the distribution of NTAs communities. Bray-Curtis dissimilarity and distance analysis showed that Cry1Ac toxin exposure did not increase community dissimilarities between Bt and non-Bt corn plots and that the evolution of non-target arthropod community was similar on the two corn varieties. The cultivation of Bt corn failed to show any detrimental evidence on the density of non-target herbivores, predators and parasitoids. The composition of herbivores, predators and parasitoids was identical in Bt and non-Bt corn plots. Taken together, results from the present work support that Bt corn producing Cry1Ac toxins does not adversely affect NTAs.

  8. WHAT IS THE VALUE OF BT CORN?

    OpenAIRE

    Hurley, Terrance M.; Mitchell, Paul D.; Rice, Marlin E.

    2001-01-01

    A common perception is that the value of Bt corn arises from two components-Bt corn increases expected profit and reduces profit variability. This perception encourages farmers and the policy makers to add a risk benefit to estimates of the value of Bt corn to account for the variability reduction. However, a conceptual model generates a useful decomposition of the value of Bt corn and a condition determining the impact of Bt corn on profit variability. An empirical model finds that Bt corn i...

  9. SUSTAINABILITY OF INSECT RESISTANCE MANAGEMENT STRATEGIES FOR TRANSGENIC BT CORN

    Science.gov (United States)

    Increasing interest in the responsible management of technology in the industrial and agricultural sectors of the economy has been met through the development of broadly applicable tools to assess the "sustainability" of new technologies. An arena ripe for application of such ana...

  10. ANALYSIS OF INSECT RESISTANCE MANAGEMENT OPTIONS FOR TRANSGENIC BT CORN,

    Science.gov (United States)

    Increasing interest in the responsible management of technology in the industrial and agricultural sectors of the economy has been met through the development of broadly applicable tools to assess the "sustainability" of new technologies. An arena ripe for application of such ana...

  11. Transgenic Bacillus thuringiensis (Bt) chickpea: India's most wanted ...

    African Journals Online (AJOL)

    Sumita

    2013-09-25

    Sep 25, 2013 ... most wanted genetically modified (GM) pulse crop. Sumita Acharjee and Bidyut ... (predominantly, Helicoverpa armigera) and diseases, lack of supply of quality seeds, ... emerging from winter diapause. The trap crops are.

  12. Genetic markers for western corn rootworm resistance to Bt toxin.

    Science.gov (United States)

    Flagel, Lex E; Swarup, Shilpa; Chen, Mao; Bauer, Christopher; Wanjugi, Humphrey; Carroll, Matthew; Hill, Patrick; Tuscan, Meghan; Bansal, Raman; Flannagan, Ronald; Clark, Thomas L; Michel, Andrew P; Head, Graham P; Goldman, Barry S

    2015-01-07

    Western corn rootworm (WCR) is a major maize (Zea mays L.) pest leading to annual economic losses of more than 1 billion dollars in the United States. Transgenic maize expressing insecticidal toxins derived from the bacterium Bacillus thuringiensis (Bt) are widely used for the management of WCR. However, cultivation of Bt-expressing maize places intense selection pressure on pest populations to evolve resistance. Instances of resistance to Bt toxins have been reported in WCR. Developing genetic markers for resistance will help in characterizing the extent of existing issues, predicting where future field failures may occur, improving insect resistance management strategies, and in designing and sustainably implementing forthcoming WCR control products. Here, we discover and validate genetic markers in WCR that are associated with resistance to the Cry3Bb1 Bt toxin. A field-derived WCR population known to be resistant to the Cry3Bb1 Bt toxin was used to generate a genetic map and to identify a genomic region associated with Cry3Bb1 resistance. Our results indicate that resistance is inherited in a nearly recessive manner and associated with a single autosomal linkage group. Markers tightly linked with resistance were validated using WCR populations collected from Cry3Bb1 maize fields showing significant WCR damage from across the US Corn Belt. Two markers were found to be correlated with both diet (R2 = 0.14) and plant (R2 = 0.23) bioassays for resistance. These results will assist in assessing resistance risk for different WCR populations, and can be used to improve insect resistance management strategies. Copyright © 2015 Flagel et al.

  13. FUM gene expression profile and fumonisin production by Fusarium verticillioides inoculated in Bt and non-Bt maize

    Directory of Open Access Journals (Sweden)

    Liliana Oliveira Rocha

    2016-01-01

    Full Text Available This study aimed to determine the levels of fumonisins produced by F. verticillioides and FUM gene expression on Bt (Bacillus thuringiensis and non-Bt maize, post harvest, during different periods of incubation. Transgenic hybrids 30F35 YG, 2B710 Hx and their isogenic (30F35 and 2B710 were collected from the field and a subset of 30 samples selected for the experiments. Maize samples were sterilized by gamma radiation at a dose of 20 kGy. Samples were then inoculated with Fusarium verticillioides and analysed under controlled conditions of temperature and relative humidity for fumonisin B1 and B2 (FB¬1 and FB2 production and FUM1, FUM3, FUM6, FUM7, FUM8, FUM13, FUM14, FUM15 and FUM19 expression. 2B710 Hx and 30F35 YG kernel samples were virtually intact when compared to the non-Bt hybrids that came from the field. Statistical analysis showed that FB¬1 production was significantly lower in 30F35 YG and 2B710 Hx than in the 30F35 and 2B710 hybrids (P 0.05. The kernel injuries observed in the non-Bt samples have possibly facilitated F. verticillioides penetration and promoted FB1 production under controlled conditions. FUM genes were expressed by F. verticillioides in all of the samples. However, there was indication of lower expression of a few FUM genes in the Bt hybrids; and a weak association between FB1 production and the relative expression of some of the FUM genes were observed in the 30F35 YG hybrid.

  14. Strong oviposition preference for Bt over non-Bt maize in Spodoptera frugiperda and its implications for the evolution of resistance

    Science.gov (United States)

    2014-01-01

    Background Transgenic crops expressing Bt toxins have substantial benefits for growers in terms of reduced synthetic insecticide inputs, area-wide pest management and yield. This valuable technology depends upon delaying the evolution of resistance. The ‘high dose/refuge strategy’, in which a refuge of non-Bt plants is planted in close proximity to the Bt crop, is the foundation of most existing resistance management. Most theoretical analyses of the high dose/refuge strategy assume random oviposition across refugia and Bt crops. Results In this study we examined oviposition and survival of Spodoptera frugiperda across conventional and Bt maize and explored the impact of oviposition behavior on the evolution of resistance in simulation models. Over six growing seasons oviposition rates per plant were higher in Bt crops than in refugia. The Cry1F Bt maize variety retained largely undamaged leaves, and oviposition preference was correlated with the level of feeding damage in the refuge. In simulation models, damage-avoiding oviposition accelerated the evolution of resistance and either led to requirements for larger refugia or undermined resistance management altogether. Since larval densities affected oviposition preferences, pest population dynamics affected resistance evolution: larger refugia were weakly beneficial for resistance management if they increased pest population sizes and the concomitant degree of leaf damage. Conclusions Damaged host plants have reduced attractiveness to many insect pests, and crops expressing Bt toxins are generally less damaged than conventional counterparts. Resistance management strategies should take account of this behavior, as it has the potential to undermine the effectiveness of existing practice, especially in the tropics where many pests are polyvoltinous. Efforts to bring down total pest population sizes and/or increase the attractiveness of damaged conventional plants will have substantial benefits for slowing the

  15. Effect of transgenic Bacillus thuringiensis rice lines on mortality and feeding behavior of rice stem borers (Lepidoptera: Crambidae).

    Science.gov (United States)

    Chen, Hao; Zhang, Guoan; Zhang, Qifa; Lin, Yongjun

    2008-02-01

    Ten transgenic Bacillus thuringiensis Bt rice, Oryza sativa L., lines with different Bt genes (two Cry1Ac lines, three Cry2A lines, and five Cry9C lines) derived from the same variety Minghui 63 were evaluated in both the laboratory and the field. Bioassays were conducted by using the first instars of two main rice lepidopteran insect species: yellow stem borer, Scirpophaga incertulas (Walker) and Asiatic rice borer, Chilo suppressalis (Walker). All transgenic lines exhibited high toxicity to these two rice borers. Field evaluation results also showed that all transgenic lines were highly insect resistant with both natural infestation and manual infestation of the neonate larvae of S. incertulas compared with the nontransformed Minghui63. Bt protein concentrations in leaves of 10 transgenic rice lines were estimated by the sandwich enzyme-linked immunosorbent assay. The cry9C gene had the highest expression level, next was cry2A gene, and the cry1Ac gene expressed at the lowest level. The feeding behavior of 7-d-old Asiatic rice borer to three classes of Bt transgenic rice lines also was detected by using rice culm cuttings. The results showed that 7-d-old larvae of Asiatic rice borer have the capacity to distinguish Bt and non-Bt culm cuttings and preferentially fed on non-Bt cuttings. When only Bt culm cuttings with three classes of different Bt proteins (CrylAc, Cry2A, and Cry9C) were fed, significant distribution difference of 7-d-old Asiatic rice borer in culm cuttings of different Bt proteins also was found. In the current study, we evaluate different Bt genes in the same rice variety in both the laboratory and the field, and also tested feeding behavior of rice insect to these Bt rice. These data are valuable for the further development of two-toxin Bt rice and establishment of appropriate insect resistance management in the future.

  16. Study on kinetic degradation in soil and horizontal transfer of bt gene by 35S isotopic tracing method

    International Nuclear Information System (INIS)

    Wang Haiyan; Zhang Yanfei; Ye Qingfu

    2012-01-01

    In this study, 35 S isotopic tracing method was applied to investigate kinetic degradation of bt gene from Bt transgenic rice TT51 in two different soil and possibility of its horizontal transfer into soil bacteria as well. Results showed that, during 30 d of aerobic incubation, it was indicated that 35 S-Bt gene was not horizontally transferred into soil microorganisms. The aerobic soil degradation dynamics significantly followed a first-order dissipation pattern for bt gene. After 30 d of incubation, the amount of bt gene reached 9.32% of applied radioactivity for the fluvio-marine yellow loamy soil and 9.92% for the fluvio-aquatic soil, respectively. The half-lives in two soils were 3.53 d for the former soil and 5. 77 d for the latter soil, which means that bt gene was more easily degradable in the weak acidic soil. The use of 35 S labeling proved to be valuable; it served the purpose of validating the rigorousness of experimental protocols, and provided insights into the soil environmental safety assessment for Bt transgenic rice. (authors)

  17. The food and environmental safety of Bt crops.

    Science.gov (United States)

    Koch, Michael S; Ward, Jason M; Levine, Steven L; Baum, James A; Vicini, John L; Hammond, Bruce G

    2015-01-01

    Bacillus thuringiensis (Bt) microbial pesticides have a 50-year history of safety in agriculture. Cry proteins are among the active insecticidal ingredients in these pesticides, and genes coding for Cry proteins have been introduced into agricultural crops using modern biotechnology. The Cry gene sequences are often modified to enable effective expression in planta and several Cry proteins have been modified to increase biological activity against the target pest(s). Additionally, the domains of different but structurally conserved Cry proteins can be combined to produce chimeric proteins with enhanced insecticidal properties. Environmental studies are performed and include invertebrates, mammals, and avian species. Mammalian studies used to support the food and feed safety assessment are also used to support the wild mammal assessment. In addition to the NTO assessment, the environmental assessment includes a comparative assessment between the Bt crop and the appropriate conventional control that is genetically similar but lacks the introduced trait to address unintended effects. Specific phenotypic, agronomic, and ecological characteristics are measured in the Bt crop and the conventional control to evaluate whether the introduction of the insect resistance has resulted in any changes that might cause ecological harm in terms of altered weed characteristics, susceptibility to pests, or adverse environmental impact. Additionally, environmental interaction data are collected in field experiments for Bt crop to evaluate potential adverse effects. Further to the agronomic and phenotypic evaluation, potential movement of transgenes from a genetically modified crop plants into wild relatives is assessed for a new pest resistance gene in a new crop. This review summarizes the evidence for safety of crops containing Cry proteins for humans, livestock, and other non-target organisms.

  18. The Food and Environmental Safety of Bt Crops

    Directory of Open Access Journals (Sweden)

    Michael Stephen Koch

    2015-04-01

    Full Text Available Bt (Bacillus thuringiensis microbial pesticides have a 50-year history of safe use in agriculture. Cry proteins are among the active insecticidal ingredients in these pesticides, and genes coding for Cry proteins have been introduced into agricultural crops using modern biotechnology. The Cry gene sequences are often modified to enable effective expression in planta and several Cry proteins have been modified to increase biological activity against the target pest(s. Additionally, the domains of different but structurally conserved Cry proteins can be combined to produce chimeric proteins with enhanced insecticidal properties. Environmental studies are performed and include invertebrates, mammals and avian species. Mammalian studies used to support the food and feed safety assessment are also used to support the wild mammal assessment. In addition to the NTO assessment, the environmental assessment includes a comparative assessment between the Bt crop and the appropriate conventional control that is genetically similar but lacks the introduced trait to address unintended effects. Specific phenotypic, agronomic, and ecological characteristics are measured in the Bt crop and the conventional control to evaluate whether the introduction of the insect resistance has resulted in any changes that might cause ecological harm in terms of altered weed characteristics, susceptibility to pests, or adverse environmental impact. Additionally, environmental interaction data are collected in field experiments for Bt crop to evaluate potential adverse effects. Further to the agronomic and phenotypic evaluation, potential movement of transgenes from a genetically modified crop plants into wild relatives is assessed for a new pest resistance gene in a new crop. This review summarizes the evidence for safety of crops containing Cry proteins for humans, livestock, and other non-target organisms.

  19. The food and environmental safety of Bt crops

    Science.gov (United States)

    Koch, Michael S.; Ward, Jason M.; Levine, Steven L.; Baum, James A.; Vicini, John L.; Hammond, Bruce G.

    2015-01-01

    Bacillus thuringiensis (Bt) microbial pesticides have a 50-year history of safety in agriculture. Cry proteins are among the active insecticidal ingredients in these pesticides, and genes coding for Cry proteins have been introduced into agricultural crops using modern biotechnology. The Cry gene sequences are often modified to enable effective expression in planta and several Cry proteins have been modified to increase biological activity against the target pest(s). Additionally, the domains of different but structurally conserved Cry proteins can be combined to produce chimeric proteins with enhanced insecticidal properties. Environmental studies are performed and include invertebrates, mammals, and avian species. Mammalian studies used to support the food and feed safety assessment are also used to support the wild mammal assessment. In addition to the NTO assessment, the environmental assessment includes a comparative assessment between the Bt crop and the appropriate conventional control that is genetically similar but lacks the introduced trait to address unintended effects. Specific phenotypic, agronomic, and ecological characteristics are measured in the Bt crop and the conventional control to evaluate whether the introduction of the insect resistance has resulted in any changes that might cause ecological harm in terms of altered weed characteristics, susceptibility to pests, or adverse environmental impact. Additionally, environmental interaction data are collected in field experiments for Bt crop to evaluate potential adverse effects. Further to the agronomic and phenotypic evaluation, potential movement of transgenes from a genetically modified crop plants into wild relatives is assessed for a new pest resistance gene in a new crop. This review summarizes the evidence for safety of crops containing Cry proteins for humans, livestock, and other non-target organisms. PMID:25972882

  20. Life-History Traits of Spodoptera frugiperda Populations Exposed to Low-Dose Bt Maize.

    Science.gov (United States)

    Sousa, Fernanda F; Mendes, Simone M; Santos-Amaya, Oscar F; Araújo, Octávio G; Oliveira, Eugenio E; Pereira, Eliseu J G

    2016-01-01

    Exposure to Bacillus thuringiensis (Bt) toxins in low- and moderate-dose transgenic crops may induce sublethal effects and increase the rate of Bt resistance evolution, potentially compromising control efficacy against target pests. We tested this hypothesis using the fall armyworm Spodoptera frugiperda, a major polyphagous lepidopteran pest relatively tolerant to Bt notorious for evolving field-relevant resistance to single-gene Bt maize. Late-instar larvae were collected from Bt Cry1Ab and non-Bt maize fields in five locations in Brazil, and their offspring was compared for survival, development, and population growth in rearing environment without and with Cry1Ab throughout larval development. Larval survival on Cry1Ab maize leaves varied from 20 to 80% among the populations. Larvae reared on Cry1Ab maize had seven-day delay in development time in relation to control larvae, and such delay was shorter in offspring of armyworms from Cry1Ab maize. Population growth rates were 50-70% lower for insects continuously exposed to Cry1Ab maize relative to controls, showing the population-level effect of Cry1Ab, which varied among the populations and prior exposure to Cry1Ab maize in the field. In three out of five populations, armyworms derived from Bt maize reared on Cry1Ab maize showed higher larval weight, faster larval development and better reproductive performance than the armyworms derived from non-Bt maize, and one of these populations showed better performance on both Cry1Ab and control diets, indicating no fitness cost of the resistance trait. Altogether, these results indicate that offspring of armyworms that developed on field-grown, single-gene Bt Cry1Ab maize had reduced performance on Cry1Ab maize foliage in two populations studied, but in other three populations, these offspring had better overall performance on the Bt maize foliage than that of the armyworms from non-Bt maize fields, possibly because of Cry1Ab resistance alleles in these populations

  1. Development, survival and fitness performance of Helicoverpa zea (Lepidoptera: Noctuidae) in MON810 Bt field corn.

    Science.gov (United States)

    Horner, T A; Dively, G P; Herbert, D A

    2003-06-01

    Helicoverpa zea (Boddie) development, survival, and feeding injury in MON810 transgenic ears of field corn (Zea mays L.) expressing Bacillus thuringiensis variety kurstaki (Bt) Cry1Ab endotoxins were compared with non-Bt ears at four geographic locations over two growing seasons. Expression of Cry1Ab endotoxin resulted in overall reductions in the percentage of damaged ears by 33% and in the amount of kernels consumed by 60%. Bt-induced effects varied significantly among locations, partly because of the overall level and timing of H. zea infestations, condition of silk tissue at the time of egg hatch, and the possible effects of plant stress. Larvae feeding on Bt ears produced scattered, discontinuous patches of partially consumed kernels, which were arranged more linearly than the compact feeding patterns in non-Bt ears. The feeding patterns suggest that larvae in Bt ears are moving about sampling kernels more frequently than larvae in non-Bt ears. Because not all kernels express the same level of endotoxin, the spatial heterogeneity of toxin distribution within Bt ears may provide an opportunity for development of behavioral responses in H. zea to avoid toxin. MON810 corn suppressed the establishment and development of H. zea to late instars by at least 75%. This level of control is considered a moderate dose, which may increase the risk of resistance development in areas where MON810 corn is widely adopted and H. zea overwinters successfully. Sublethal effects of MON810 corn resulted in prolonged larval and prepupal development, smaller pupae, and reduced fecundity of H. zea. The moderate dose effects and the spatial heterogeneity of toxin distribution among kernels could increase the additive genetic variance for both physiological and behavioral resistance in H. zea populations. Implications of localized population suppression are discussed.

  2. The phosphatidylinositol synthase gene (GhPIS) contributes to longer, stronger, and finer fibers in cotton.

    Science.gov (United States)

    Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan

    2018-05-11

    Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.

  3. Saussurea involucrata SiDhn2 gene confers tolerance to drought stress in upland cotton

    International Nuclear Information System (INIS)

    Liu, B.; Zhu, J.; Mu, J.; Zhu, J.; Liang, Z.; Zhang, L.

    2017-01-01

    Severe water shortage has long been acknowledged as one major limiting factor for global cotton production, and cultivation of cotton varieties with strong drought resistance is of important economic and social significances. In this study, the Xinjiang upland cotton variety Xinluzao 42 was transformed with the SiDhn2 gene by optimized agrobacterium transformation system. The integration of SiDhn2 gene into cotton genome was confirmed by PCR and Southern blot hybridization, and the drought resistance of transgenic and corresponding receptor cotton plants and their physiological indexes under drought stress were detailedly analyzed. Multiple physiological and biochemical indexes including soluble sugar content, free proline content, chlorophyll content, relative water content, net photosynthetic rate, transpiration rate, intercellular CO/sub 2/ concentration in transgenic cotton expressing SiDhn2 gene under drought stress were significantly higher than those of receptor cotton. More importantly, the transgenic cotton plants exhibited remarkably decreased boll abscission rate and highly increased seed yield, indicating the significant role of SiDhn2 gene in cotton drought resistance and its great application potential in agricultural production. (author)

  4. Heterosis and correlation in interspecific and intraspecific hybrids of cotton.

    Science.gov (United States)

    Munir, S; Hussain, S B; Manzoor, H; Quereshi, M K; Zubair, M; Nouman, W; Shehzad, A N; Rasul, S; Manzoor, S A

    2016-06-24

    Interspecific and intraspecific hybrids show varying degrees of heterosis for yield and yield components. Yield-component traits have complex genetic relationships with each other. To determine the relationship of yield-component traits and fiber traits with seed cotton yield, six lines (Bt. CIM-599, CIM-573, MNH-786, CIM-554, BH-167, and GIZA-7) and three test lines (MNH-886, V4, and CIM-557) were crossed in a line x tester mating design. Heterosis was observed for seed cotton yield, fiber traits, and for other yield-component traits. Heterosis in interspecific hybrids for seed cotton yield was more prominent than in intraspecific hybrids. The interspecific hybrid Giza-7 x MNH-886 had the highest heterosis (114.77), while among intraspecific hybrids, CIM-554 x CIM-557 had the highest heterosis (61.29) for seed cotton yield. A major trait contributing to seed cotton yield was bolls/plant followed by boll weight. Correlation studies revealed that bolls/plant, boll weight, lint weight/boll, lint index, seed index, lint/seed, staple length, and staple strength were significantly and positively associated with seed cotton yield. Selection based on boll weight, boll number, lint weight/boll, and lint index will be helpful for improving cotton seed yield.

  5. Evaluation of the Impact of Genetically Modified Cotton After 20 Years of Cultivation in Mexico

    Directory of Open Access Journals (Sweden)

    Martha G. Rocha-Munive

    2018-06-01

    Full Text Available For more than 20 years cotton has been the most widely sown genetically modified (GM crop in Mexico. Its cultivation has fulfilled all requirements and has gone through the different regulatory stages. During the last 20 years, both research-institutions and biotech-companies have generated scientific and technical information regarding GM cotton cultivation in Mexico. In this work, we collected data in order to analyze the environmental and agronomic effects of the use of GM cotton in Mexico. In 1996, the introduction of Bt cotton made it possible to reactivate this crop, which in previous years was greatly reduced due to pest problems, production costs and environmental concerns. Bt cotton is a widely accepted tool for cotton producers and has proven to be efficient for the control of lepidopteran pests. The economic benefits of its use are variable, and depend on factors such as the international cotton-prices and other costs associated with its inputs. So far, the management strategies used to prevent development of insect resistance to GM cotton has been successful, and there are no reports of insect resistance development to Bt cotton in Mexico. In addition, no effects have been observed on non-target organisms. For herbicide tolerant cotton, the prevention of herbicide resistance has also been successful since unlike other countries, the onset of resistance weeds is still slow, apparently due to cultural practices and rotation of different herbicides. Environmental benefits have been achieved with a reduction in chemical insecticide applications and the subsequent decrease in primary pest populations, so that the inclusion of other technologies—e.g., use of non-Bt cotton- can be explored. Nevertheless, control measures need to be implemented during transport of the bolls and fiber to prevent dispersal of volunteer plants and subsequent gene flow to wild relatives distributed outside the GM cotton growing areas. It is still necessary to

  6. A new artificial diet for western corn rootworm larvae is compatible with and detects resistance to all current Bt toxins

    Science.gov (United States)

    Insect resistance to transgenic crops expressing one or more genes from Bacillus thuringiensis Berliner (Bt) is a growing concern for farmers, regulatory agencies, the seed industry, and researchers alike. Western corn rootworm (Diabrotica virgifera virgifera LeConte) is a pest of corn (Zea mays L.)...

  7. Characterization of NCAM expression and function in BT4C and BT4Cn glioma cells

    DEFF Research Database (Denmark)

    Andersson, A M; Moran, N; Gaardsvoll, H

    1991-01-01

    The neural cell adhesion molecule, NCAM, plays an important role in cell-cell adhesion. Therefore, we have studied NCAM expression in the glioma cell lines BT4C and BT4Cn. We demonstrate that the 2 cell lines differ in their metastatic ability; while BT4C cells have a very low capacity for produc...

  8. Approaches for improving present laboratory and field methodology for evaluation efficacy of transgenic technologies

    Science.gov (United States)

    Assessing the efficacy of transgenic plants under new environmental and management regimes is of prime importance to the companies which produce new or improved existing transgenic products, breeders which create different varieties stacked with Bt endotoxins, and growers who use them for production...

  9. Effect of Bt maize on the plant-aphid-parasitoid tritrophic relationships

    Czech Academy of Sciences Publication Activity Database

    Lumbierres, B.; Starý, Petr; Pons, X.

    2011-01-01

    Roč. 56, č. 2 (2011), s. 133-143 ISSN 1386-6141 Grant - others:Ministry of Education and Science(ES) AGL2002-0204; Ministry of Education and Science(ES) AP2002-(4104) Institutional research plan: CEZ:AV0Z50070508 Keywords : transgenic Bt maize * Aphididae * Rhopalosiphum padi Subject RIV: EH - Ecology, Behaviour Impact factor: 1.927, year: 2011

  10. Does Bt Corn Really Produce Tougher Residues

    Science.gov (United States)

    Bt corn hybrids produce insecticidal proteins that are derived from a bacterium, Bacillus thuringiensis. There have been concerns that Bt corn hybrids produce residues that are relatively resistant to decomposition. We conducted four experiments that examined the decomposition of corn residues und...

  11. Effect of irradiation on physiological and biochemical properties of Bt rice seedlings

    International Nuclear Information System (INIS)

    Wang Zhonghua; Chen Xiaojian; Bao Xusheng; Chen Yuling; Gu Qinqin

    2011-01-01

    The seeds of two varieties of Bt rice were treated by 60 Co γ-rays at the doses of 50, 100, 150, 250 and 350 Gy, respectively, their original parent was used as control material. The seedlings cultured from above seeds were used to detect the root activity, seedling growth, chlorophyll content,activities of phenylalanine ammonialyase (PAL), polyphenol oxidase (PPO), catalase(CAT), superoxide dismutase (SOD) and amylase to investigate the effect of irradiation treatment on the physiological and biochemical properties of Bt rice. The results showed that root activity, chlorophyll content, activities of PAL, PPO, CAT, SOD of Bt rice seedlings and amylase of germinating seeds were lower than those of the control group after irradiation treatment of < 250 Gy, but the differences were not significant, which was similar to those of original parent. Meanwhile, it was found that with dose increasing, the seedling height was increased, suggesting that irradiation treatment could stimulate the seedling growth. Therefore, Bt transgene can not change the irradiation sensitivity of rice and the conventional method of rice can be used in Bt rice irradiation mutation breeding. (authors)

  12. Cry1F resistance in fall armyworm Spodoptera frugiperda: single gene versus pyramided Bt maize.

    Science.gov (United States)

    Huang, Fangneng; Qureshi, Jawwad A; Meagher, Robert L; Reisig, Dominic D; Head, Graham P; Andow, David A; Ni, Xinzi; Kerns, David; Buntin, G David; Niu, Ying; Yang, Fei; Dangal, Vikash

    2014-01-01

    Evolution of insect resistance to transgenic crops containing Bacillus thuringiensis (Bt) genes is a serious threat to the sustainability of this technology. However, field resistance related to the reduced efficacy of Bt maize has not been documented in any lepidopteran pest in the mainland U.S. after 18 years of intensive Bt maize planting. Here we report compelling evidence of field resistance in the fall armyworm, Spodoptera frugiperda (J.E. Smith), to Cry1F maize (TC 3507) in the southeastern region of the U.S. An F2 screen showed a surprisingly high (0.293) Cry1F resistance allele frequency in a population collected in 2011 from non-Bt maize in south Florida. Field populations from non-Bt maize in 2012-2013 exhibited 18.8-fold to >85.4-fold resistance to purified Cry1F protein and those collected from unexpectedly damaged Bt maize plants at several locations in Florida and North Carolina had >85.4-fold resistance. In addition, reduced efficacy and control failure of Cry1F maize against natural populations of S. frugiperda were documented in field trials using Cry1F-based and pyramided Bt maize products in south Florida. The Cry1F-resistant S. frugiperda also showed a low level of cross-resistance to Cry1A.105 and related maize products, but not to Cry2Ab2 or Vip3A. The occurrence of Cry1F resistance in the U.S. mainland populations of S. frugiperda likely represents migration of insects from Puerto Rico, indicating the great challenges faced in achieving effective resistance management for long-distance migratory pests like S. frugiperda.

  13. Dictionary of Cotton

    Science.gov (United States)

    The Dictionary of Cotton has over 2,000 terms and definitions that were compiled by 33 researchers. It reflects the ongoing commitment of the International Cotton Advisory Committee, through its Technical Information Section, to the spread of knowledge about cotton to all those who have an interest ...

  14. Impact of transgenic sweet corn silks to two noctuid pests

    Science.gov (United States)

    Eight Bacillus thuringiensis (Bt) transgenic sweet corn hybrids were evaluated (with two controls) for their efficacy against two ear-feeding insects; the corn earworm [Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae)], and the fall armyworm (Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuid...

  15. The interaction of two-spotted spider mites, Tetranychus urticae Koch, with Cry protein production and predation by Amblyseius andersoni (Chant) in Cry1Ac/Cry2Ab cotton and Cry1F maize.

    Science.gov (United States)

    Crops producing insecticidal crystal (Cry) proteins from the bacterium, Bacillus thuringiensis (Bt), are an important tool for managing lepidopteran pests on cotton and maize. However, the effects of these Bt crops on non-target organisms, especially natural enemies that provide biological control s...

  16. Field Performance of Bt Eggplants (Solanum melongena L. in the Philippines: Cry1Ac Expression and Control of the Eggplant Fruit and Shoot Borer (Leucinodes orbonalis Guenee.

    Directory of Open Access Journals (Sweden)

    Desiree M Hautea

    Full Text Available Plants expressing Cry proteins from the bacterium, Bacillus thuringiensis (Bt, have become a major tactic for controlling insect pests in maize and cotton globally. However, there are few Bt vegetable crops. Eggplant (Solanum melongena is a popular vegetable grown throughout Asia that is heavily treated with insecticides to control the eggplant fruit and shoot borer, Leucinodes orbonalis (EFSB. Herein we provide the first publicly available data on field performance in Asia of eggplant engineered to produce the Cry1Ac protein. Replicated field trials with five Bt eggplant open-pollinated (OP lines from transformation event EE-1 and their non-Bt comparators were conducted over three cropping seasons in the Philippines from 2010-2012. Field trials documented levels of Cry1Ac protein expressed in plants and evaluated their efficacy against the primary target pest, EFSB. Cry1Ac concentrations ranged from 0.75-24.7 ppm dry weight with the highest in the terminal leaves (or shoots and the lowest in the roots. Cry1Ac levels significantly increased from the vegetative to the reproductive stage. Bt eggplant lines demonstrated excellent control of EFSB. Pairwise analysis of means detected highly significant differences between Bt eggplant lines and their non-Bt comparators for all field efficacy parameters tested. Bt eggplant lines demonstrated high levels of control of EFSB shoot damage (98.6-100% and fruit damage (98.1-99.7% and reduced EFSB larval infestation (95.8-99.3% under the most severe pest pressure during trial 2. Moths that emerged from larvae collected from Bt plants in the field and reared in their Bt eggplant hosts did not produce viable eggs or offspring. These results demonstrate that Bt eggplant lines containing Cry1Ac event EE-1 provide outstanding control of EFSB and can dramatically reduce the need for conventional insecticides.

  17. Comparison of fumonisin contamination using HPLC and ELISA methods in bt and near-isogenic maize hybrids infested with European corn borer or western bean cutworm.

    Science.gov (United States)

    Bowers, Erin; Hellmich, Richard; Munkvold, Gary

    2014-07-09

    Field trials were conducted from 2007 to 2010 to compare grain fumonisin levels among non-Bt maize hybrids and Bt hybrids with transgenic protection against manual infestations of European corn borer (ECB) and Western bean cutworm (WBC). HPLC and ELISA were used to measure fumonisin levels. Results of the methods were highly correlated, but ELISA estimates were higher. Bt hybrids experienced less insect injury, Fusarium ear rot, and fumonisin contamination compared to non-Bt hybrids. WBC infestation increased fumonisin content compared to natural infestation in non-Bt and hybrids expressing Cry1Ab protein in five of eight possible comparisons; in Cry1F hybrids, WBC did not impact fumonisins. These results indicate that WBC is capable of increasing fumonisin levels in maize. Under WBC infestation, Cry1F mitigated this risk more consistently than Cry1Ab or non-Bt hybrids. Transgenically expressed Bt proteins active against multiple lepidopteran pests can provide broad, consistent reductions in the risk of fumonisin contamination.

  18. Testing pollen of single and stacked insect-resistant Bt-maize on in vitro reared honey bee larvae.

    Science.gov (United States)

    Hendriksma, Harmen P; Härtel, Stephan; Steffan-Dewenter, Ingolf

    2011-01-01

    The ecologically and economic important honey bee (Apis mellifera) is a key non-target arthropod species in environmental risk assessment (ERA) of genetically modified (GM) crops. Honey bee larvae are directly exposed to transgenic products by the consumption of GM pollen. But most ERA studies only consider responses of adult bees, although Bt-proteins primarily affect the larval phases of target organisms. We adopted an in vitro larvae rearing system, to assess lethal and sublethal effects of Bt-pollen consumption in a standardized eco-toxicological bioassay. The effects of pollen from two Bt-maize cultivars, one expressing a single and the other a total of three Bt-proteins, on the survival and prepupae weight of honey bee larvae were analyzed. The control treatments included pollen from three non-transgenic maize varieties and of Heliconia rostrata. Three days old larvae were fed the realistic exposure dose of 2 mg pollen within the semi-artificial diet. The larvae were monitored over 120 h, until the prepupal stage, where larvae terminate feeding and growing. Neither single nor stacked Bt-maize pollen showed an adverse effect on larval survival and the prepupal weight. In contrast, feeding of H. rostrata pollen caused significant toxic effects. The results of this study indicate that pollen of the tested Bt-varieties does not harm the development of in vitro reared A. mellifera larvae. To sustain the ecosystem service of pollination, Bt-impact on A. mellifera should always be a crucial part of regulatory biosafety assessments. We suggest that our approach of feeding GM pollen on in vitro reared honey bee larvae is well suited of becoming a standard bioassay in regulatory risk assessments schemes of GM crops.

  19. Testing pollen of single and stacked insect-resistant Bt-maize on in vitro reared honey bee larvae.

    Directory of Open Access Journals (Sweden)

    Harmen P Hendriksma

    Full Text Available The ecologically and economic important honey bee (Apis mellifera is a key non-target arthropod species in environmental risk assessment (ERA of genetically modified (GM crops. Honey bee larvae are directly exposed to transgenic products by the consumption of GM pollen. But most ERA studies only consider responses of adult bees, although Bt-proteins primarily affect the larval phases of target organisms. We adopted an in vitro larvae rearing system, to assess lethal and sublethal effects of Bt-pollen consumption in a standardized eco-toxicological bioassay. The effects of pollen from two Bt-maize cultivars, one expressing a single and the other a total of three Bt-proteins, on the survival and prepupae weight of honey bee larvae were analyzed. The control treatments included pollen from three non-transgenic maize varieties and of Heliconia rostrata. Three days old larvae were fed the realistic exposure dose of 2 mg pollen within the semi-artificial diet. The larvae were monitored over 120 h, until the prepupal stage, where larvae terminate feeding and growing. Neither single nor stacked Bt-maize pollen showed an adverse effect on larval survival and the prepupal weight. In contrast, feeding of H. rostrata pollen caused significant toxic effects. The results of this study indicate that pollen of the tested Bt-varieties does not harm the development of in vitro reared A. mellifera larvae. To sustain the ecosystem service of pollination, Bt-impact on A. mellifera should always be a crucial part of regulatory biosafety assessments. We suggest that our approach of feeding GM pollen on in vitro reared honey bee larvae is well suited of becoming a standard bioassay in regulatory risk assessments schemes of GM crops.

  20. Testing Pollen of Single and Stacked Insect-Resistant Bt-Maize on In vitro Reared Honey Bee Larvae

    Science.gov (United States)

    Hendriksma, Harmen P.; Härtel, Stephan; Steffan-Dewenter, Ingolf

    2011-01-01

    The ecologically and economic important honey bee (Apis mellifera) is a key non-target arthropod species in environmental risk assessment (ERA) of genetically modified (GM) crops. Honey bee larvae are directly exposed to transgenic products by the consumption of GM pollen. But most ERA studies only consider responses of adult bees, although Bt-proteins primarily affect the larval phases of target organisms. We adopted an in vitro larvae rearing system, to assess lethal and sublethal effects of Bt-pollen consumption in a standardized eco-toxicological bioassay. The effects of pollen from two Bt-maize cultivars, one expressing a single and the other a total of three Bt-proteins, on the survival and prepupae weight of honey bee larvae were analyzed. The control treatments included pollen from three non-transgenic maize varieties and of Heliconia rostrata. Three days old larvae were fed the realistic exposure dose of 2 mg pollen within the semi-artificial diet. The larvae were monitored over 120 h, until the prepupal stage, where larvae terminate feeding and growing. Neither single nor stacked Bt-maize pollen showed an adverse effect on larval survival and the prepupal weight. In contrast, feeding of H. rostrata pollen caused significant toxic effects. The results of this study indicate that pollen of the tested Bt-varieties does not harm the development of in vitro reared A. mellifera larvae. To sustain the ecosystem service of pollination, Bt-impact on A. mellifera should always be a crucial part of regulatory biosafety assessments. We suggest that our approach of feeding GM pollen on in vitro reared honey bee larvae is well suited of becoming a standard bioassay in regulatory risk assessments schemes of GM crops. PMID:22194811

  1. Bt crops producing Cry1Ac, Cry2Ab and Cry1F do not harm the green lacewing, Chrysoperla rufilabris.

    Directory of Open Access Journals (Sweden)

    Jun-Ce Tian

    Full Text Available The biological control function provided by natural enemies is regarded as a protection goal that should not be harmed by the application of any new pest management tool. Plants producing Cry proteins from the bacterium, Bacillus thuringiensis (Bt, have become a major tactic for controlling pest Lepidoptera on cotton and maize and risk assessment studies are needed to ensure they do not harm important natural enemies. However, using Cry protein susceptible hosts as prey often compromises such studies. To avoid this problem we utilized pest Lepidoptera, cabbage looper (Trichoplusia ni and fall armyworm (Spodoptera frugiperda, that were resistant to Cry1Ac produced in Bt broccoli (T. ni, Cry1Ac/Cry2Ab produced in Bt cotton (T. ni, and Cry1F produced in Bt maize (S. frugiperda. Larvae of these species were fed Bt plants or non-Bt plants and then exposed to predaceous larvae of the green lacewing Chrysoperla rufilabris. Fitness parameters (larval survival, development time, fecundity and egg hatch of C. rufilabris were assessed over two generations. There were no differences in any of the fitness parameters regardless if C. rufilabris consumed prey (T. ni or S. frugiperda that had consumed Bt or non-Bt plants. Additional studies confirmed that the prey contained bioactive Cry proteins when they were consumed by the predator. These studies confirm that Cry1Ac, Cry2Ab and Cry1F do not pose a hazard to the important predator C. rufilabris. This study also demonstrates the power of using resistant hosts when assessing the risk of genetically modified plants on non-target organisms.

  2. Screening of cotton (gossypium hirsutum l.) genotypes for heat tolerance

    International Nuclear Information System (INIS)

    Abro, S.; Khan, M.A.; Sial, M.A.

    2015-01-01

    Cotton yield is highly affected due to biotic (diseases and pests) and abiotic (heat, dought and salinity) Stresses. Among them, high temperature is the main environmental constraint which adversely reduces cotton yield and quality. High temperature above 36 degree C affects plant growth and development especially during reproductive phase. Present studies were carried out to assess the tolerance of fifty-eight newly evolved cotton genotypes to heat stresses, based on agronomic and physiological characteristics. The genotypes were screened in field conditions under two temperature regimes. The studies were conducted at experimental farm of Nuclear Institute of Agriculture, Tando Jam, Pakistan. The results showed that March sown crop experienced high temperature (i.e. > 44 degree C in May and June), which significantly affected crop growth and productivity. The genotypes were identified as heat-tolerant on the basis of relative cell injury percentage (RCI %), heat susceptibility index (HSI) values, boll retention and seed cotton yield (kg/ha). RCI level in cotton genotypes ranged from 39.0 to 86.0%. Out of 58, seventeen genotypes (viz.NIA-80, NIA-81, NIA-83, NIA-84, NIA-M-30, NIA-M31, NIA-HM-48, NIA-HM-327, NIA-H-32, NIA-HM-2-1, NIA-Bt1, NIA-Bt2, NIA-Perkh, CRIS-342, CRIS-134, NIAB-111 and check variety Sadori indicated high level of heat tolerance at both (heat-stressed and non-stressed) temperature regimes; as shown the lowest relative injury level and relatively heat resistant index (HSI<1) values. Such genotypes could be used as heattolerant genotypes under heat-stressed environments. (author)

  3. Transgene flow: Facts, speculations and possible countermeasures

    Science.gov (United States)

    Ryffel, Gerhart U

    2014-01-01

    Convincing evidence has accumulated that unintended transgene escape occurs in oilseed rape, maize, cotton and creeping bentgrass. The escaped transgenes are found in variant cultivars, in wild type plants as well as in hybrids of sexually compatible species. The fact that in some cases stacked events are present that have not been planted commercially, implies unintended recombination of transgenic traits. As the consequences of this continuous transgene escape for the ecosystem cannot be reliably predicted, I propose to use more sophisticated approaches of gene technology in future. If possible GM plants should be constructed using either site-directed mutagenesis or cisgenic strategies to avoid the problem of transgene escape. In cases where a transgenic trait is needed, efficient containment should be the standard approach. Various strategies available or in development are discussed. Such a cautious approach in developing novel types of GM crops will enhance the sustainable potential of GM crops and thus increase the public trust in green gene technology. PMID:25523171

  4. Superoleophobic cotton textiles

    NARCIS (Netherlands)

    Leng, B.; Shao, Z.; With, de G.; Ming, W.

    2009-01-01

    Common cotton textiles are hydrophilic and oleophilic in nature. Superhydrophobic cotton textiles have the potential to be used as self-cleaning fabrics, but they typically are not super oil-repellent. Poor oil repellency may easily compromise the self-cleaning property of these fabrics. Here, we

  5. Cotton trends in India

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Cotton trends in India. A crop of significant economic importance, valued at over Rs. 15000 Crs. Provides income to 60 million people. Crucial raw material for Rs 83000 Crores textile industry out of which Rs 45754 crores is exports. Approx. 20 Million acres of cotton provides ...

  6. The "Cotton Problem"

    OpenAIRE

    Baffes, John

    2005-01-01

    Cotton is an important cash crop in many developing economies, supporting the livelihoods of millions of poor households. In some countries it contributes as much as 40 percent of merchandise exports and more than 5 percent of gross domestic product (GDP). The global cotton market, however, has been subject to numerous policy interventions, to the detriment of nonsubsidized producers. This ...

  7. Climate change and genetically modified insecticidal plants. Plant-herbivore interactions and secondary chemistry of Bt Cry1Ac-toxin producing oilseed rape (Brassica napus L.) under elevated CO{sub 2} or O{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Himanen, S.

    2008-07-01

    Transgenic insect-resistant plants producing Bacillus thuringiensis (Bt) crystalline endotoxins are the first commercial applications of genetically modified crops and their use has steadily expanded over the last ten years. Together with the expanding agricultural use of transgenic crops, climate change is predicted to be among the major factors affecting agriculture in the coming years. Plants, herbivores and insects of higher trophic levels are all predicted to be affected by the current atmospheric climate change. However, only very few studies to date have addressed the sustained use and herbivore interactions of Bt-producing plants under the influence of these abiotic factors. The main objective of this study was to comparatively assess the performance of a Bt Cry1Ac toxin-producing oilseed rape line and its non-transgenic parent line in terms of vegetative growth and allocation to secondary defence compounds (glucosinolates and volatile terpenoids), and the performance of Bt-target and nontarget insect herbivores as well as tritrophic interaction functioning on these lines. For this, several growth chamber experiments with vegetative stage non-Bt and Bt plants facing exposures to doubled atmospheric CO{sub 2} level alone or together with increased temperature and different regimes of elevated O{sub 3} were conducted. The main hypothesis of this work was that Bt-transgenic plants have reduced performance or allocation to secondary compounds due to the cost of producing Bt toxin under changed abiotic environments. The Bt-transgenic oilseed rape line exhibited slightly delayed vegetative growth and had increased nitrogen and reduced carbon content compared to the non-transgenic parent line, but the physiological responses (i.e. biomass gain and photosynthesis) of the plant lines to CO{sub 2} and O{sub 3} enhancements were equal. Two aphid species, non-susceptible to Bt Cry1Ac, showed equal performance and reproduction on both plant lines under elevated CO{sub 2

  8. Consumption of Bt Maize Pollen Containing Cry1Ie Does Not Negatively Affect Propylea japonica (Thunberg (Coleoptera: Coccinellidae

    Directory of Open Access Journals (Sweden)

    Yonghui Li

    2017-03-01

    Full Text Available Propylea japonica (Thunberg (Coleoptera: Coccinellidae are prevalent predators and pollen feeders in East Asian maize fields. They are therefore indirectly (via prey and directly (via pollen exposed to Cry proteins within Bt-transgenic maize fields. The effects of Cry1Ie-producing transgenic maize pollen on the fitness of P. japonica was assessed using two dietary-exposure experiments in the laboratory. In the first experiment, survival, larval developmental time, adult fresh weight, and fecundity did not differ between ladybirds consuming Bt or non-Bt maize pollen. In the second experiment, none of the tested lethal and sublethal parameters of P. japonica were negatively affected when fed a rapeseed pollen-based diet containing Cry1Ie protein at 200 μg/g dry weight of diet. In contrast, the larval developmental time, adult fresh weight, and fecundity of P. japonica were significantly adversely affected when fed diet containing the positive control compound E-64. In both experiments, the bioactivity of the Cry1Ie protein in the food sources was confirmed by bioassays with a Cry1Ie-sensitive lepidopteran species. These results indicated that P. japonica are not affected by the consumption of Cry1Ie-expressing maize pollen and are not sensitive to the Cry1Ie protein, suggesting that the growing of Bt maize expressing Cry1Ie protein will pose a negligible risk to P. japonica.

  9. Dictionary of cotton: Picking & ginning

    Science.gov (United States)

    Cotton is an essential commodity for textiles and has long been an important item of trade in the world’s economy. Cotton is currently grown in over 100 countries by an estimated 100 producers. The basic unit of the cotton trade is the cotton bale which consists of approximately 500 pounds of raw c...

  10. Gibberellin overproduction promotes sucrose synthase expression and secondary cell wall deposition in cotton fibers.

    Directory of Open Access Journals (Sweden)

    Wen-Qin Bai

    Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.

  11. [Research of the Bt crop biomass dynamics upon the invasion of Bt-resistant pests. A mathematical model].

    Science.gov (United States)

    Rusakov, A V; Medvinskiĭ, A B; Li, B -L; Gonik, M M

    2009-01-01

    The results of simulations of some consequences of the invasion of Bt-resistant pests into an agricultural ecosystem containing a Bt crop are presented. It is shown that the invasion of Bt-resistant pests leads to changes in the plant biomass dynamics, a decrease in the Bt crop production, and the deterioration of the predictability of the Bt crop production. We show that the parameter values at which the badly predictable Bt crop production takes place, occupy a minor area in the model parameter space. The size of the area depends on the insect reproduction period and the duration of the growing season.

  12. The change and relationship of several endogenesis hormone in different organs of cotton plant

    International Nuclear Information System (INIS)

    Dong Zhiqiang; Zhang Baoming; Liu Fang; Song Guoqi

    2005-01-01

    The changes of endogenesis hormone in young leaves (02)/functional leaves (04)/old leaves (08)/root tissue and root sap in different developing stages of Bt transgenic cotton GK-12 were investigated in 2002 at CAAS. The results showed that: 1) iPA + iP contents in young leaves/functional leaves/old leaves and root tissue changed with the changes of ZR + Z contents in different developing stages, but the changes trends were in other way round. The function of iPA + iP and ZR + Z were corresponding and complementary. Both the changes trends of iPA + iP and ZR + Z were single apex curves. 2) GA 3 and GA 4 , the two members of gibberellic acid, were also measured in this study. The change trends of GA 3 and GA 4 in young leaves/functional leaves/old leaves and root tissue were same. GA 3 was mainly regulating the construction and function of leaves and roots, GA 4 was mainly regulating consenescence of leaves. 3) The change trends of IAA and ABA in young leaves/functional leaves/old leaves and root tissue were different in different developing stage. The content of IAA and ABA in young leaves/functional leaves increased, and the content of IAA and ABA in old leaves and root tissue decreased with the development. ABA start-up senescence process of leaf and root, and then content of ABA declined. 4) The change trends of iPA + iP/ZR + Z/GA 3 /GA 4 /IAA and ABA content in root sap were single apex curve. (authors)

  13. Sublethal effects of Cry 1F Bt corn and clothianidin on black cutworm (Lepidoptera: Noctuidae) larval development.

    Science.gov (United States)

    Kullik, Sigrun A; Sears, Mark K; Schaafsma, Arthur W

    2011-04-01

    Black cutworm, Agrotis ipsilon (Hufnagel) (Lepidoptera: Noctuidae), is an occasional pest of maize (corn), Zea mays L., that may cause severe stand losses and injury to corn seedlings. The efficacy of the neonicotinoid seed treatment clothianidin at two commercially available rates and their interaction with a transgenic corn hybrid (Bt corn), trait expressing the Bacillus thuringiensis variety aizawai insecticidal toxin Cry 1Fa2, against black cutworm larvae was investigated. Clothianidin at a rate of 25 mg kernel(-1) on Bt corn increased larval mortality and reduced larval weight gains additively. In contrast, weights of larvae fed non-Bt corn seedlings treated with clothianidin at a rate of 25 mg kernel(-1) increased significantly, suggesting either compensatory overconsumption, hormesis, or hormoligosis. Both Bt corn alone and clothianidin at a rate of 125 mg kernel(-1) applied to non-Bt corn seedlings caused increased mortality and reduced larval weight gains. In two field trials, plots planted with Bt corn hybrids consistently had the highest plant populations and yields, regardless of whether they were treated with clothianidin at the lower commercial rate of 25 mg kernel(-1) The use of Bt corn alone or in combination with the low rate of clothianidin (25 mg kernel(-1)) seems suitable as a means of suppressing black cutworm in no-tillage cornfields, although rescue treatments may still be necessary under severe infestations. Clothianidin alone at the low rate of 25 mg kernel(-1) is not recommended for black cutworm control until further studies of its effects on larval physiology and field performance have been completed.

  14. Evaluation of stem borer resistance management strategies for Bt ...

    African Journals Online (AJOL)

    GREGORY

    2011-06-01

    Jun 1, 2011 ... cultivars were identified as cost-effective, flexible, easily adoptable and ... Key words: Refugia, cost-benefit analysis, Bt-maize, insect pest resistance management. ..... Refugia are part of stewardship plan for the Bt maize.

  15. Degradation and detection of transgenic Bacillus thuringiensis DNA and proteins in flour of three genetically modified rice events submitted to a set of thermal processes.

    Science.gov (United States)

    Wang, Xiaofu; Chen, Xiaoyun; Xu, Junfeng; Dai, Chen; Shen, Wenbiao

    2015-10-01

    This study aimed to investigate the degradation of three transgenic Bacillus thuringiensis (Bt) genes (Cry1Ab, Cry1Ac, and Cry1Ab/Ac) and the corresponding encoded Bt proteins in KMD1, KF6, and TT51-1 rice powder, respectively, following autoclaving, cooking, baking, or microwaving. Exogenous Bt genes were more stable than the endogenous sucrose phosphate synthase (SPS) gene, and short DNA fragments were detected more frequently than long DNA fragments in both the Bt and SPS genes. Autoclaving, cooking (boiling in water, 30 min), and baking (200 °C, 30 min) induced the most severe Bt protein degradation effects, and Cry1Ab protein was more stable than Cry1Ac and Cry1Ab/Ac protein, which was further confirmed by baking samples at 180 °C for different periods of time. Microwaving induced mild degradation of the Bt and SPS genes, and Bt proteins, whereas baking (180 °C, 15 min), cooking and autoclaving led to further degradation, and baking (200 °C, 30 min) induced the most severe degradation. The findings of the study indicated that degradation of the Bt genes and proteins somewhat correlated with the treatment intensity. Polymerase chain reaction, enzyme-linked immunosorbent assay, and lateral flow tests were used to detect the corresponding transgenic components. Strategies for detecting transgenic ingredients in highly processed foods are discussed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Review of the cotton market in Pakistan and its future prospects

    Directory of Open Access Journals (Sweden)

    Malik Tassawar Hussain

    2016-11-01

    Full Text Available Pakistan is the world’s 4th largest producer of cotton. Cultivation along the Indus River extends across nearly 3 million hectares and serves as the backbone of the economy. Despite this importance, information on the cotton sector in Pakistan, in particular with regard to cotton oils, is scanty and not available from a single source. This review seeks to remedy that gap. Though cultivated mainly for fiber, its kernel seed oil is also used as an edible vegetable oil and accounts for a large share of the local oil industry; per capita consumption of edible oils is nearly 14 kg, which is much higher than consumption in countries at similar levels of economic development. Pakistan fulfills 17.7% of its demand for edible oils through cottonseed oil. Total demand for this purpose in 2029–30 is estimated at 5.36 million tons of which local production will be 1.98 million tons. Genetically modified (Bt cotton was introduced in Pakistan in 2010 to control three deleterious lepidopterous insects; it now accounts for more than 85% of the cotton cultivated. There is good scope for organic cotton production in Pakistan, especially in non-traditional cotton growing areas where there is less insect pressure. High temperature and water scarcity associated with climate change are a major concern, since current cultivation takes place in areas that already experience extremely high temperatures.

  17. Life history attributes of Indian meal moth (Lepidoptera: Pyralidae) and Angoumois grain moth (Lepidoptera: Gelechiidae) reared on transgenic corn kernels.

    Science.gov (United States)

    Sedlacek, J D; Komaravalli, S R; Hanley, A M; Price, B D; Davis, P M

    2001-04-01

    The Indian meal moth, Plodia interpunctella (Hübner), and Angoumois grain moth, Sitotroga cerealella (Olivier), are two globally distributed stored-grain pests. Laboratory experiments were conducted to examine the impact that corn (Zea mays L.) kernels (i.e., grain) of some Bacillus thuringiensis Berliner (Bt) corn hybrids containing CrylAb Bt delta-endotoxin have on life history attributes of Indian meal moth and Angoumois grain moth. Stored grain is at risk to damage from Indian meal moth and Angoumois grain moth; therefore, Bt corn may provide a means of protecting this commodity from damage. Thus, the objective of this research was to quantify the effects of transgenic corn seed containing CrylAb delta-endotoxin on Indian meal moth and Angoumois grain moth survival, fecundity, and duration of development. Experiments with Bt grain, non-Bt isolines, and non-Bt grain were conducted in environmental chambers at 27 +/- 1 degrees C and > or = 60% RH in continuous dark. Fifty eggs were placed in ventilated pint jars containing 170 g of cracked or whole corn for the Indian meal moth and Angoumois grain moth, respectively. Emergence and fecundity were observed for 5 wk. Emergence and fecundity of Indian meal moth and emergence of Angoumois grain moth were significantly lower for individuals reared on P33V08 and N6800Bt, MON 810 and Bt-11 transformed hybrids, respectively, than on their non-Bt transformed isolines. Longer developmental times were observed for Indian meal moth reared on P33V08 and N6800Bt than their non-Bt-transformed isolines. These results indicate that MON 810 and Bt-11 CrylAb delta-endotoxin-containing kernels reduce laboratory populations of Indian meal moth and Angoumois grain moth. Thus, storing Bt-transformed grain is a management tactic that warrants bin scale testing and may effectively reduce Indian meal moth and Angoumois grain moth populations in grain without application of synthetic chemicals or pesticides.

  18. A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data.

    Science.gov (United States)

    Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young

    2017-08-15

    Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

  19. [Transformation and expression of specific insecticide gene Bt cry3A in resident endogenetic bacteria isolated from Apriona germari (Hope) larvae intestines].

    Science.gov (United States)

    Zhongkang, Wang; Wei, He; Guoxiong, Peng; Yuxian, Xia; Qiang, Li; Youping, Yin

    2008-09-01

    Transforming the specific insecticidal gene Bt cry3A into the dominant resident endogenetic bacteria in intestines of Apriona germari (Hope) larvae to construct transgenic bacteria that can colonize and express the insecticidal gene Bt cry3A perfectly in intestines of Apriona germari (Hope) larvae. We isolated and identified the dominant resident endogenetic bacteria by traditional methods and molecular method based of 16S rDNA analysis. Two Escherichia coli--Bacillus thuringiensis shuttle plasmid pHT305a and pHT7911 which contained specific insecticidal gene Bt cry3A were transformed into two resident endogenetic bacteria Brevibacillus brevis Ag12 and Bacillus thuringiensis Ag13 isolated from A. germari larvae intestines respectively by electro-transformation. Eighteen species of bacteria have isolated and identified from Apriona germari larvae intestines and two of them (Brevibacillus brevis Ag12 and Bacillus thuringiensis Ag13) were selected as starting bacteria to recieve the Bt cry3A. The 4 transgenic engineering strains Ag12-7911, Ag12-305a, Ag13-7911 and Ag13-305a were obtained successfully and validated by testing the plasmid stability in recombinants, transformants vegetal properties, crystal poisonous protein observation, expressional protein SDS-PAGE. The Bt cry3A gene had been transformed into Brevibacillus brevis and Bacillus thuringiensis. Both bioassay and examination of the engineering strains in intestines after feeding them to larvae showed that all these transformant strains (Brevibacillus brevis Ag12-305a, Bacillus thurigiensis Ag13-305a, Brevibacillus brevis Ag12-7911 and Bacillus thurigiensis Ag13-7911) could colonize and express 65 kDa protoxin in intestines of A. germari larvae and had insecticidal activity. We obtained four transgenic bacteria that can colonize and express the target insecticide gene Bt cry3A in A. germari larvae. They may be developed as a new insecticide.

  20. Practice Tests for the TOEFL iBT

    CERN Document Server

    Stirling, Bruce

    2012-01-01

    Practice Tests for the TOEFL iBT contains four TOEFL tests, with answer keys. Perfect for self-study and classrooms. Each TOEFL iBT Practice Test...* reflects the design of the official TOEFL internet-based test* tests academic English-language proficiency expected of university students in the United States, Canada, Australia, New Zealand, Ireland, Scotland and England* provides extra practice before you take the official TOEFL iBT* will help you identify those areas of academic English you need to improve for a higher TOEFL iBT score* will give you an unofficial, TOEFL iBT range score within

  1. BT's adoption of customer centric design.

    Science.gov (United States)

    Chamberlain, Mark; Esquivel, Jacqueline; Miller, Fiona; Patmore, Jeff

    2015-01-01

    Between 2005 and 2010 BT underwent a major transformation from a company with a special section devoted to 'older and disabled consumers' to a company with an inclusive design strategy. The mainstreaming of these issues responded to a demand for better, more user-friendly communications products and growing awareness of the importance of previously marginalised consumer groups. It also took place alongside the development and publication of BS7000-6, a guide to inclusive design management. Based on several product design case studies, this paper reflects on how and why this transformation was seen as necessary for future success, and how the transformation was achieved. The evolution of BT's approach has continued since, but this paper looks back in time, and documents the transformation up to 2010 and reflects the state of the company in 2010 rather than at the time of publication. Copyright © 2014 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  2. [SSR analysis on stress effect of transgenic hybrid poplar 741 on Clostera anachoreta (Fabricius) (Lepidoptera: Notodontidae)].

    Science.gov (United States)

    Liu, Jun Xia; Song, Xiao Ying; Jiang, Wen Hu; Zhou, Guo Na; Gao, Bao Jia

    2016-12-01

    The genetic differentiation of the experimental population of Clostera anachoreta fed on different resistant transgenic 741 poplar leaves was analyzed by SSR molecular marker technique to investigate stress effect of transgenic poplar Bt gene as food on target insect. The experimental population of C. anachoreta fed on transgenic 741 poplar high resistant strains 'Pb29', medium resis-tant strains 'Pb17' and non-transgenic poplar (CK), and the screened ten pairs of SSR primers were used. The results showed that 76 alleles were observed in ten pairs of primers. The average allele was 7.6, the average effective number of alleles was 2.2, the average observed heterozygosity was 0.5167, the average expected heterozygosity was 0.5167, and the average percentage of polymorphic loci was 96.7%. The genetic diversity level of C. anachoreta experimental population fed on transgenic poplar 741 was significantly higher than that fed on non-transgenic populations, and C. anachoreta fed on high resistance had the lowest genetic similarity with CK samples, which showed an increasing trend of the genetic diversity of the experimental population fed on transgenic Bt poplar. It was thus clear that transgenic hybrid poplar 741 had stress effects on genetic differentiation of C. anachoreta experimental population by SSR.

  3. Fusarium verticillioides and fumonisin contamination in Bt and non-Bt maize cultivated in Brazil.

    Science.gov (United States)

    Barroso, Vinícius M; Rocha, Liliana O; Reis, Tatiana A; Reis, Gabriela M; Duarte, Aildson P; Michelotto, Marcos D; Correa, Benedito

    2017-05-01

    Fusarium verticillioides is one of the main pathogens of maize, causing ear and stalk rots. This fungus is also able to produce high levels of fumonisins, which have been linked to various illnesses in humans and animals. Previous studies have shown that maize hybrids genetically modified with the cry genes from the bacterium Bacillus thuringiensis (Bt) presented lower incidence of F. verticillioides and fumonisin levels, presumably through the reduction of insects, which could act as vectors of fungi. The aim of this study was to assess the incidence of F. verticillioides and the concentration of fumonisins in Bt and isogenic non-Bt hybrids (2B710Hx, 30F35YG, 2B710, and 30F35, respectively). The samples of 2B710Hx and 30F35YG presented lower F. verticillioides frequency than 2B710 and 30F35 samples. However, there was no statistical difference between fumonisin contamination when Bt and non-Bt samples were compared (P > 0.05). The results suggest that other environmental parameters could possibly trigger fumonisin production during plant development in the field; consequently, other management strategies should be applied to aid controlling fumonisin contamination in maize.

  4. Response of AtNPR1-expressing cotton plants to Fusarium oxysporum f. sp. vasinfectum isolates

    Science.gov (United States)

    In our earlier investigation, we had demonstrated that transgenic cotton plants expressing AtNPR1 showed significant tolerance to Fusarium oxysporum f. sp. vasinfectum, isolate 11 (Fov11) and several other pathogens. The current study was designed to further characterize the nature of the protectio...

  5. Neuroanatomy and transgenic technologies

    Science.gov (United States)

    This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

  6. Ingestion of Bt rice pollen does not reduce the survival or hypopharyngeal gland development of Apis mellifera adults.

    Science.gov (United States)

    Wang, Yuanyuan; Dai, Pingli; Chen, Xiuping; Romeis, Jörg; Shi, Jianrong; Peng, Yufa; Li, Yunhe

    2017-05-01

    Because of its ecological and economic importance, the honey bee Apis mellifera is commonly used to assess the environmental risk of insect-resistant, genetically modified plants. In the present study, feeding-exposure experiments were used to determine whether pollen from transgenic rice harms A. mellifera worker bees. In 1 experiment, the survival and mean acinus diameter of hypopharyngeal glands of adult bees were similar when bees were fed on pollen from Bt rice lines or from a non-Bt rice line, but bee survival was significantly reduced when they received pollen that was mixed with potassium arsenate as a positive control. In a second experiment, bee survival and hypopharyngeal gland development were not reduced when adult bees were fed on non-Bt pollen and a sucrose solution supplemented with Cry2A at 400 µg/g, Cry1C at 50 µg/g, or bovine serum albumin (BSA) at 400 µg/g, but bee survival and hypopharyngeal gland development were reduced when the diet was supplemented with soybean trypsin inhibitor as a positive control. In both experiments, the uptake of Cry proteins by adult bees was confirmed. Overall, the results indicate that the planting of Bt rice lines expressing Cry2A or Cry1C protein poses a negligible risk to A. mellifera worker bees. Environ Toxicol Chem 2017;36:1243-1248. © 2016 SETAC. © 2016 SETAC.

  7. TOEFL strategies a complete guide to the iBT

    CERN Document Server

    Stirling, Bruce

    2016-01-01

    TOEFL students all ask: How can I get a high TOEFL iBT score? Answer: Learn argument scoring strategies. Why? Because the TOEFL iBT recycles opinion-based and fact-based arguments for testing purposes from start to finish. In other words, the TOEFL iBT is all arguments. That's right, all arguments. If you want a high score, you need essential argument scoring strategies. That is what TOEFL STRATEGIES A COMPLETE GUIDE gives you, and more!

  8. cotton fabric 51

    African Journals Online (AJOL)

    DR. AMINU

    1Department of Chemistry, Federal College of Education, Kano – Nigeria. 2Department of ... its versatility were examined taken into consideration, the molecular structure. ... hemicelluloses, pectin, coloring matter and ash ... temperature for a fixed period of time. These processes rendered the cotton 99% cellulose in nature.

  9. Cotton, Prof. Frank Albert

    Indian Academy of Sciences (India)

    ... Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Fellowship. Fellow Profile. Elected: 1985 Honorary. Cotton, Prof. Frank Albert. Date of birth: 9 April 1930. Date of death: 20 February 2007. Last known address: Department of Chemistry, Texas A & M University, College Station, TX 77843, U.S.A..

  10. Cotton regeneration in vitro

    Science.gov (United States)

    H. F. Sakhanokho and K. Rajasekaran Over the years, plant breeders have improved cotton via conventional breeding methods, but these methods are time-consuming. To complement classical breeding and, at times, reduce the time necessary for new cultivar development, breeders have turned to in vitro ...

  11. The crosstalk between Target of Rapamycin (TOR) and Jasmonic Acid (JA) signaling existing in Arabidopsis and cotton.

    Science.gov (United States)

    Song, Yun; Zhao, Ge; Zhang, Xueyan; Li, Linxuan; Xiong, Fangjie; Zhuo, Fengping; Zhang, Chaojun; Yang, Zuoren; Datla, Raju; Ren, Maozhi; Li, Fuguang

    2017-04-04

    Target of rapamycin (TOR) acts as an important regulator of cell growth, development and stress responses in most examined diploid eukaryotes. However, little is known about TOR in tetraploid species such as cotton. Here, we show that TORC1-S6K-RPS6, the major signaling components, are conserved and further expanded in cotton genome. Though the cotton seedlings are insensitive to rapamycin, AZD8055, the second-generation inhibitor of TOR, can significantly suppress the growth in cotton. Global transcriptome analysis revealed that genes associated with jasmonic acid (JA) biosynthesis and transduction were significantly altered in AZD8055 treated cotton seedlings, suggesting the potential crosstalk between TOR and JA signaling. Pharmacological and genetic approaches have been employed to get further insights into the molecular mechanism of the crosstalk between TOR and JA. Combination of AZD8055 with methyl jasmonate can synergistically inhibit cotton growth, and additionally JA levels were significantly increased when cotton seedlings were subjected to AZD8055. JA biosynthetic and signaling mutants including jar1, coi1-2 and myc2-2 displayed TOR inhibitor-resistant phenotypes, whereas COI1 overexpression transgenic lines and jaz10 exhibited sensitivity to AZD8055. Consistently, cotton JAZ can partially rescue TOR-suppressed phenotypes in Arabidopsis. These evidences revealed that the crosstalk between TOR and JA pathway operates in cotton and Arabidopsis.

  12. Access and control of agro-biotechnology : Bt cotton, ecological change and risk in China

    NARCIS (Netherlands)

    Ho, Peter; Zhao, Jennifer H.; Xue, Dayuan

    2009-01-01

    This article argues that if the introduction of genetically modified crops (GM crops) in developing countries is to be successful, we can and should not evade questions of access and control of technology. It implies probing into the experiences, perceptions and understanding of GM crops by the

  13. Is Bt Cotton a Pro-Poor Technology? A Review and Critique of the Empirical Record

    NARCIS (Netherlands)

    Glover, D.

    2010-01-01

    Policy makers, journalists and other commentators have hailed genetically modified (GM) crops as a ‘pro-poor’ success in the developing world. Their confidence appears to be justified by the encouraging conclusions reached by academic studies on the performance and impacts of GM crops, which seem to

  14. Emergence of controversy in technology transitions: Green revolution and Bt cotton in India

    NARCIS (Netherlands)

    Ramani, S.V.; Thutupalli, A.

    2015-01-01

    Technology transitions following radical technological breakthroughs are often marked by controversies and the transitions to Green Revolution (GR) and Genetically Modified (GM) seeds in India were no exceptions to this rule. Controversies can trigger social dilemmas, but in economics we do not yet

  15. Single-Event Transgene Product Levels Predict Levels in Genetically Modified Breeding Stacks.

    Science.gov (United States)

    Gampala, Satyalinga Srinivas; Fast, Brandon J; Richey, Kimberly A; Gao, Zhifang; Hill, Ryan; Wulfkuhle, Bryant; Shan, Guomin; Bradfisch, Greg A; Herman, Rod A

    2017-09-13

    The concentration of transgene products (proteins and double-stranded RNA) in genetically modified (GM) crop tissues is measured to support food, feed, and environmental risk assessments. Measurement of transgene product concentrations in breeding stacks of previously assessed and approved GM events is required by many regulatory authorities to evaluate unexpected transgene interactions that might affect expression. Research was conducted to determine how well concentrations of transgene products in single GM events predict levels in breeding stacks composed of these events. The concentrations of transgene products were compared between GM maize, soybean, and cotton breeding stacks (MON-87427 × MON-89034 × DAS-Ø15Ø7-1 × MON-87411 × DAS-59122-7 × DAS-40278-9 corn, DAS-81419-2 × DAS-44406-6 soybean, and DAS-21023-5 × DAS-24236-5 × SYN-IR102-7 × MON-88913-8 × DAS-81910-7 cotton) and their component single events (MON-87427, MON-89034, DAS-Ø15Ø7-1, MON-87411, DAS-59122-7, and DAS-40278-9 corn, DAS-81419-2, and DAS-44406-6 soybean, and DAS-21023-5, DAS-24236-5, SYN-IR102-7, MON-88913-8, and DAS-81910-7 cotton). Comparisons were made within a crop and transgene product across plant tissue types and were also made across transgene products in each breeding stack for grain/seed. Scatter plots were generated comparing expression in the stacks to their component events, and the percent of variability accounted for by the line of identity (y = x) was calculated (coefficient of identity, I 2 ). Results support transgene concentrations in single events predicting similar concentrations in breeding stacks containing the single events. Therefore, food, feed, and environmental risk assessments based on concentrations of transgene products in single GM events are generally applicable to breeding stacks composed of these events.

  16. Drought coping strategies in cotton: increased crop per drop.

    Science.gov (United States)

    Ullah, Abid; Sun, Heng; Yang, Xiyan; Zhang, Xianlong

    2017-03-01

    The growth and yield of many crops, including cotton, are affected by water deficit. Cotton has evolved drought specific as well as general morpho-physiological, biochemical and molecular responses to drought stress, which are discussed in this review. The key physiological responses against drought stress in cotton, including stomata closing, root development, cellular adaptations, photosynthesis, abscisic acid (ABA) and jasmonic acid (JA) production and reactive oxygen species (ROS) scavenging, have been identified by researchers. Drought stress induces the expression of stress-related transcription factors and genes, such as ROS scavenging, ABA or mitogen-activated protein kinases (MAPK) signalling genes, which activate various drought-related pathways to induce tolerance in the plant. It is crucial to elucidate and induce drought-tolerant traits via quantitative trait loci (QTL) analysis, transgenic approaches and exogenous application of substances. The current review article highlights the natural as well as engineered drought tolerance strategies in cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  17. Flavonoid biosynthesis controls fiber color in naturally colored cotton

    Directory of Open Access Journals (Sweden)

    Hai-Feng Liu

    2018-04-01

    Full Text Available The existence of only natural brown and green cotton fibers (BCF and GCF, respectively, as well as poor fiber quality, limits the use of naturally colored cotton (Gossypium hirsutum L.. A better understanding of fiber pigment regulation is needed to surmount these obstacles. In this work, transcriptome analysis and quantitative reverse transcription PCR revealed that 13 and 9 phenylpropanoid (metabolic pathway genes were enriched during pigment synthesis, while the differential expression of phenylpropanoid (metabolic and flavonoid metabolic pathway genes occurred among BCF, GCF, and white cotton fibers (WCF. Silencing the chalcone flavanone isomerase gene in a BCF line resulted in three fiber phenotypes among offspring of the RNAi lines: BCF, almost WCF, and GCF. The lines with almost WCF suppressed chalcone flavanone isomerase, while the lines with GCF highly expressed the glucosyl transferase (3GT gene. Overexpression of the Gh3GT or Arabidopsis thaliana 3GT gene in BCF lines resulted in GCF. Additionally, the phenylpropanoid and flavonoid metabolites of BCF and GCF were significantly higher than those of WCF as assessed by a metabolomics analysis. Thus, the flavonoid biosynthetic pathway controls both brown and green pigmentation processes. Like natural colored fibers, the transgenic colored fibers were weaker and shorter than WCF. This study shows the potential of flavonoid pathway modifications to alter cotton fibers’ color and quality.

  18. Evaluation of stem borer resistance management strategies for Bt ...

    African Journals Online (AJOL)

    Stem borers are the major insect pests of maize in Kenya. The use of Bacillus thuringiensis (Bt) technology is an effective way of controlling lepidopteran pests. However, the likelihood of development of resistance to the Bt toxins by the target stem borer species is a concern. Forages, sorghum and maize varieties were ...

  19. Can Bt maize change the spatial distribution of predator Cycloneda ...

    African Journals Online (AJOL)

    Cultivation of Bt crops is an important tactic in integrated pest management. The effect of Bt maize on arthropod predators needs to be investigated because of the important role of these natural enemies in the absence of target pests. The objective of the present study was to generate information on the distribution model of ...

  20. Evaluation of cotton stalks destroyers

    OpenAIRE

    Bianchini, Aloisio; Borges, Pedro H. de M.

    2013-01-01

    The destruction of the cotton crop residues (cotton stalks) is a mandatory procedure in Brazil for prophylactic issues, but is a subject unexplored by the research and there are few studies that deal with this issue. However, this is not encouraged in recent decades, studies aimed at developing and evaluating equipment for this purpose. The present study had the objective to evaluate six methods for mechanical destruction of cotton crop residues. Each method was defined based on the principle...

  1. Apparent digestibility coefficients and consumption of corn silage with and without Bt gene in sheep

    Directory of Open Access Journals (Sweden)

    Camila Memari Trava

    2012-12-01

    Full Text Available Corn silage is the most important preserved food for ruminants. The transgenic corn was inserted into the genetic code Bt gene (Bacillus thuringiensis that expresses a toxic protein to caterpillars pests of maize, reducing production costs. To evaluate the varieties of plant corn silage DKB and AG with or without the Bt gene on the voluntary intake of DM (g/day and apparent digestibility coefficients (CDA of nutrients in sheep, the experiment was conducted at the Institute of Animal Science Nova Odessa-SP. Were used 20 sheep and the experimental design was randomized blocks in scheme factorial type 2x2 (two varieties of plant corn to silage, with the presence or absence of Bt gene, with five animals per treatment. These animals were housed in metabolism cages, with collector and separator feces and urine for 21 days, comprising 8 days for diet adaptation and 7 days for determination of intake, followed by 6 days of collection of feces, to measure DMI (g/day, CDA DM, CP and NDF. Samples of feed offered, leftovers and feces were identified and placed in a circulating air oven maintained at 55°C to constant weight. The analyses were performed in Bromatological Analysis Laboratory of the Institute of Animal Science. To CTMS (g/day was interaction effect (p<0.05 than in the variety AG (779.36 was greater than DKB (637.52, because the DM content of the sheet AG (31.09 was superior to DKB (29.17. The AG (779.36 was higher than your counterpart isogenic without the gene (575.15 p<0.05. The DKB without the gene (637.52 did not differ (p>0.05 from your counterpart DKBBt with the gene (590.78. The lowest total DM intake in g/day was observed for varieties with Bt gene insertion (genetically modified organism - GMO and a possible explanation is the higher value of NDF in the silages of variety with the Bt gene in relation to their isogenic counterparts without the gene. The CDA, DM and NDF no had interaction effect between varieties factors and GMO (p>0

  2. Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis).

    Science.gov (United States)

    Oliveira, Gustavo R; Silva, Maria C M; Lucena, Wagner A; Nakasu, Erich Y T; Firmino, Alexandre A P; Beneventi, Magda A; Souza, Djair S L; Gomes, José E; de Souza, José D A; Rigden, Daniel J; Ramos, Hudson B; Soccol, Carlos R; Grossi-de-Sa, Maria F

    2011-09-09

    The cotton boll weevil (Anthonomus grandis) is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis.

  3. Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis

    Directory of Open Access Journals (Sweden)

    Gomes José E

    2011-09-01

    Full Text Available Abstract Background The cotton boll weevil (Anthonomus grandis is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Results Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. Conclusions The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis.

  4. Biodiversity of ground beetles (Coleoptera: Carabidae) in genetically modified (Bt) and conventional (non-Bt) potato fields in Bulgaria

    Czech Academy of Sciences Publication Activity Database

    Kalushkov, P.; Gueorguiev, B.; Spitzer, L.; Nedvěd, Oldřich

    2009-01-01

    Roč. 23, č. 3 (2009), s. 1346-1350 ISSN 1310-2818 Grant - others:Bulgarian National Research Fund(BG) B-1508; Bulgarian National Research Fund(BG) B-1105 Institutional research plan: CEZ:AV0Z50070508 Keywords : ground beetles * Bt potatoes * non-Bt potatoes Subject RIV: EH - Ecology, Behaviour Impact factor: 0.291, year: 2009

  5. Density Dependence and Growth Rate: Evolutionary Effects on Resistance Development to Bt (Bacillus thuringiensis).

    Science.gov (United States)

    Martinez, Jeannette C; Caprio, Michael A; Friedenberg, Nicholas A

    2018-02-09

    It has long been recognized that pest population dynamics can affect the durability of a pesticide, but dose remains the primary component of insect resistance management (IRM). For transgenic pesticidal traits such as Bt (Bacillus thuringiensis Berliner (Bacillales: Bacillaceae)), dose (measured as the mortality of susceptibles caused by a toxin) is a relatively fixed characteristic and often falls below the standard definition of high dose. Hence, it is important to understand how pest population dynamics modify durability and what targets they present for IRM. We used a deterministic model of a generic arthropod pest to examine how timing and strength of density dependence interacted with population growth rate and Bt mortality to affect time to resistance. As in previous studies, durability typically reached a minimum at intermediate doses. However, high population growth rates could eliminate benefits of high dose. The timing of density dependence had a more subtle effect. If density dependence operated simultaneously with Bt mortality, durability was insensitive to its strengths. However, if density dependence was driven by postselection densities, decreasing its strength could increase durability. The strength of density dependence could affect durability of both single traits and pyramids, but its influence depended on the timing of density dependence and size of the refuge. Our findings suggest the utility of a broader definition of high dose, one that incorporates population-dynamic context. That maximum growth rates and timing and strength of interactions causing density dependent mortality can all affect durability, also highlights the need for ecologically integrated approaches to IRM research. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Composition of arthropod species assemblages in Bt-expressing and near isogenic eggplants in experimental fields.

    Science.gov (United States)

    Arpaia, Salvatore; Di Leo, Grazia M; Fiore, Maria C; Schmidt, Jörg E U; Scardi, Michele

    2007-02-01

    The environmental impact of genetically modified (GM) plants in experimental fields has been examined in several ways, in particular with respect to the dynamics of specific nontarget organisms. The approach of sampling for biodiversity in agroecosystems to compare complex patterns could also be useful in studying potential disruptions caused by GM crops. In this study, we set up replicated field plots of Bt-expressing eggplants and near isogenic untransformed eggplants as a control. We monitored the presence and abundance of herbivore and predator arthropods in weekly visual samplings of the plant canopy for three growing seasons (2001-2003). Insect species were pooled in organismal taxonomic units (OTUs); three multivariate methods were used to compare species assemblage as an estimate of insect biodiversity. This multistep statistical approach proved to be efficient in recognizing association patterns, as evidenced by the data for the target species Leptinotarsa decemlineata Say (Coleoptera: Chrysomelidae) clearly showing a significant association with the control plots. All the analyses indicate a comparable species assemblage between transgenic and near isogenic eggplant areas. Our results suggest that some taxa may warrant more specific study. For example, Alticinae beetles (Coleoptera: Chrysomelidae) were alternatively more abundant in either of the two treatments, and their overall abundance was significantly higher on transgenic eggplants. In light of these results and because of their taxonomic proximity to the target species, these herbivores may represent an important nontarget group to be further studied. Moreover, some sap feeders (e.g., Homoptera: Cicadellidae) were more abundant on Bt-expressing plants in some samples in all 3 yr.

  7. Capillary electrophoretic profiling of tryptic digests of water soluble proteins from Bacillus thuringiensis-transgenic and non-transgenic maize species

    Czech Academy of Sciences Publication Activity Database

    Sázelová, Petra; Kašička, Václav; Leon, C.; Ibanez, E.; Cifuentes, A.

    2012-01-01

    Roč. 134, č. 3 (2012), s. 1607-1615 ISSN 0308-8146 R&D Projects: GA ČR(CZ) GA203/08/1428 Grant - others:AV ČR(CZ) 2008CZ0019 Institutional research plan: CEZ:AV0Z40550506 Keywords : Bt-transgenic maize * capillary zone electrophoresis * maize proteins Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 3.334, year: 2012

  8. Pest control and resistance management through release of insects carrying a male-selecting transgene.

    Science.gov (United States)

    Harvey-Samuel, Tim; Morrison, Neil I; Walker, Adam S; Marubbi, Thea; Yao, Ju; Collins, Hilda L; Gorman, Kevin; Davies, T G Emyr; Alphey, Nina; Warner, Simon; Shelton, Anthony M; Alphey, Luke

    2015-07-16

    Development and evaluation of new insect pest management tools is critical for overcoming over-reliance upon, and growing resistance to, synthetic, biological and plant-expressed insecticides. For transgenic crops expressing insecticidal proteins from the bacterium Bacillus thuringiensis ('Bt crops') emergence of resistance is slowed by maintaining a proportion of the crop as non-Bt varieties, which produce pest insects unselected for resistance. While this strategy has been largely successful, multiple cases of Bt resistance have now been reported. One new approach to pest management is the use of genetically engineered insects to suppress populations of their own species. Models suggest that released insects carrying male-selecting (MS) transgenes would be effective agents of direct, species-specific pest management by preventing survival of female progeny, and simultaneously provide an alternative insecticide resistance management strategy by introgression of susceptibility alleles into target populations. We developed a MS strain of the diamondback moth, Plutella xylostella, a serious global pest of crucifers. MS-strain larvae are reared as normal with dietary tetracycline, but, when reared without tetracycline or on host plants, only males will survive to adulthood. We used this strain in glasshouse-cages to study the effect of MS male P. xylostella releases on target pest population size and spread of Bt resistance in these populations. Introductions of MS-engineered P. xylostella males into wild-type populations led to rapid pest population decline, and then elimination. In separate experiments on broccoli plants, relatively low-level releases of MS males in combination with broccoli expressing Cry1Ac (Bt broccoli) suppressed population growth and delayed the spread of Bt resistance. Higher rates of MS male releases in the absence of Bt broccoli were also able to suppress P. xylostella populations, whereas either low-level MS male releases or Bt broccoli

  9. Environmental effect of conventional and GM crops of cotton (Gossipium hirsitum L. and corn (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Kelly Ávila

    2011-12-01

    Full Text Available In the corn belt of Valle de San Juan and in the cotton zone of El Espinal, municipalities in the department of Tolima (Colombia, 10 conventional corn producers, 10 producers of genetically modified corn, five producers of conventional cotton and 15 producers of transgenic cotton were surveyed in the first half of 2009 to contrast the differences in the environmental impact associated with use of insecticides and herbicides, which were evaluated by estimating the environmental index quotient-EIQ. In the case of maize, an EIQ of 42 was found in the conventional type, while transgenic technology had an EIQ of 3.03. In the cultivation of cotton, an EIQ of 263.59 was found for the conventional type while for transgenic technology this value varied between 335.75 (Nuopal BG/RR and 324.79 (DP 455 BG/RR. These data showed a lower environmental impact using GM technology in the cultivation of maize when compared to the conventional counterpart, in connection with the use of insecticides and herbicides, in the context of time, space and genotypic analysis. This effect was not observed in the case of cotton, where environmental impacts were similar

  10. Superhydrophobic cotton by fluorosilane modification

    CSIR Research Space (South Africa)

    Erasmus, E

    2009-12-01

    Full Text Available the treatment with fluorinated or silicon compounds)1-4 and by enhancing the surface roughness with a fractal structure5-8. Cotton, a cellulose-based material, that is greatly hydrophilic, is more benefited when made hydrophobic. Modification of cotton...

  11. TRANSGENIC PLANTS - INSECTICIDAL TOXIN IN ROOT EXUDATES FROM BT CORN. (R826107)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  12. New methods for the safety testing of transgenic food

    DEFF Research Database (Denmark)

    Knudsen, Ib; Poulsen, Morten; Kledal, S. T.

    2004-01-01

    for guiding the precise design of the animal study. The genetically modified food plants to be used for this test development will be 3 transgenic rice varieties (2 types of lectins and the Bt toxin). Objectives The overall objective of this project is to develop and validate the scientific methodology which......Background This project proposal deals with the development of a sensitive and specific animal test which is necessary for safety analysis of genetically modified plants according to the Opinion of the Scientific Committee for Food on the assessment of novels foods. The test will be based...

  13. Harmonia axyridis (Coleoptera: Coccinellidae) Exhibits No Preference between Bt and Non-Bt Maize Fed Spodoptera frugiperda (Lepidoptera: Noctuidae)

    Science.gov (United States)

    Dutra, Carla C.; Koch, Robert L.; Burkness, Eric C.; Meissle, Michael; Romeis, Joerg; Hutchison, William D.; Fernandes, Marcos G.

    2012-01-01

    A recent shift in managing insect resistance to genetically engineered (GE) maize consists of mixing non-GE seed with GE seed known as “refuge in a bag”, which increases the likelihood of predators encountering both prey fed Bt and prey fed non-Bt maize. We therefore conducted laboratory choice-test feeding studies to determine if a predator, Harmonia axyridis, shows any preference between prey fed Bt and non-Bt maize leaves. The prey species was Spodoptera frugiperda, which were fed Bt maize (MON-810), expressing the single Cry1Ab protein, or non-Bt maize. The predators were third instar larvae and female adults of H. axyridis. Individual predators were offered Bt and non-Bt fed prey larvae that had fed for 24, 48 or 72 h. Ten and 15 larvae of each prey type were offered to third instar and adult predators, respectively. Observations of arenas were conducted at 1, 2, 3, 6, 15 and 24 h after the start of the experiment to determine the number and type of prey eaten by each individual predator. Prey larvae that fed on non-Bt leaves were significantly larger than larvae fed Bt leaves. Both predator stages had eaten nearly all the prey by the end of the experiment. However, in all combinations of predator stage and prey age, the number of each prey type consumed did not differ significantly. ELISA measurements confirmed the presence of Cry1Ab in leaf tissue (23–33 µg/g dry weight) and S. frugiperda (2.1–2.2 µg/g), while mean concentrations in H. axyridis were very low (0.01–0.2 µg/g). These results confirm the predatory status of H. axyridis on S. frugiperda and that both H. axyridis adults and larvae show no preference between prey types. The lack of preference between Bt-fed and non-Bt-fed prey should act in favor of insect resistance management strategies using mixtures of GE and non-GE maize seed. PMID:23024772

  14. Impact of Bollgard cotton on Indian cotton production and Income of ...

    Indian Academy of Sciences (India)

    Impact of Bollgard cotton on Indian cotton production and Income of cotton farmers. Presentation made in the Seventy Second Annual Meeting Indian Academy of Sciences, Bangalore at Devi Ahilya Vishwavidyalaya Indore 11th November 2006.

  15. Quantification of toxins in a Cry1Ac?+?CpTI cotton cultivar and its potential effects on the honey bee Apis mellifera L.

    OpenAIRE

    Han, Peng; Niu, Chang-Ying; Lei, Chao-Liang; Cui, Jin-Jie; Desneux, Nicolas

    2010-01-01

    Transgenic Cry1Ac?+?CpTI cotton (CCRI41) is increasingly planted throughout China. However, negative effects of this cultivar on the honey bee Apis mellifera L., the most important pollinator for cultivated ecosystem, remained poorly investigated. The objective of our study was to evaluate the potential side effects of transgenic Cry1Ac?+?CpTI pollen from cotton on young adult honey bees A. mellifera L. Two points emphasized the significance of our study: (1) A higher expression level of inse...

  16. Effects of ensiling of Bacillus thuringiensis (Bt) maize (MON810) on ...

    African Journals Online (AJOL)

    The study investigated the degradation of the Bt protein (Cry1Ab) in Bt maize during ensiling and chemical composition of the silage. Two laboratory studies were conducted at the University of Fort Hare. One Bacillus thuringiensis (Bt) maize cultivar (DKC80-12B) and its isoline (DKC80-10) in the 2008/2009 study and two Bt ...

  17. Agrobacterium-mediated transformation of cotton (Gossypium hirsutum) shoot apex with a fungal phytase gene improves phosphorus acquisition.

    Science.gov (United States)

    Ma, Zhiying; Liu, Jianfeng; Wang, Xingfen

    2013-01-01

    Cotton is an important world economic crop plant. It is considered that cotton is recalcitrant to in vitro proliferation. Somatic embryogenesis and plant regeneration has been successful by using hypocotyl, whereas it is highly genotype dependent. Here, a genotype-independent cotton regeneration protocol from shoot apices is presented. Shoot apices from 3- to 5-day-old seedlings of cotton are infected with an Agrobacterium strain, EHA105, carrying the binary vector pC-KSA contained phytase gene (phyA) and the marker gene neomycin phosphotransferase (NPTII), and directly regenerated as shoots in vitro. Rooted shoots can be obtained within 6-8 weeks. Plants that survived by leaf painting kanamycin (kan) were -further analyzed by DNA and RNA blottings. The transgenic plants with increased the phosphorus (P) acquisition efficiency were obtained following the transformation method.

  18. Consumption of Bt Rice Pollen Containing Cry1C or Cry2A Protein Poses a Low to Negligible Risk to the Silkworm Bombyx mori (Lepidoptera: Bombyxidae)

    Science.gov (United States)

    Yang, Yan; Liu, Yue; Cao, Fengqin; Chen, Xiuping; Cheng, Lisheng; Romeis, Jörg; Li, Yunhe; Peng, Yufa

    2014-01-01

    By consuming mulberry leaves covered with pollen from nearby genetically engineered, insect-resistant rice lines producing Cry proteins derived from Bacillus thuringiensis (Bt), larvae of the domestic silkworm, Bombyx mori (Linnaeus) (Lepidoptera: Bombyxidae), could be exposed to insecticidal proteins. Laboratory experiments were conducted to assess the potential effects of Cry1C- or Cry2A-producing transgenic rice (T1C-19, T2A-1) pollen on B. mori fitness. In a short-term assay, B. mori larvae were fed mulberry leaves covered with different densities of pollen from Bt rice lines or their corresponding near isoline (control) for the first 3 d and then were fed mulberry leaves without pollen. No effect was detected on any life table parameter, even at 1800 pollen grains/cm2 leaf, which is much higher than the mean natural density of rice pollen on leaves of mulberry trees near paddy fields. In a long-term assay, the larvae were fed Bt and control pollen in the same way but for their entire larval stage (approximately 27 d). Bt pollen densities ≥150 grains/cm2 leaf reduced 14-d larval weight, increased larval development time, and reduced adult eclosion rate. ELISA analyses showed that 72.6% of the Cry protein was still detected in the pollen grains excreted with the feces. The low exposure of silkworm larvae to Cry proteins when feeding Bt rice pollen may be the explanation for the relatively low toxicity detected in the current study. Although the results demonstrate that B. mori larvae are sensitive to Cry1C and Cry2A proteins, the exposure levels that harmed the larvae in the current study are far greater than natural exposure levels. We therefore conclude that consumption of Bt rice pollen will pose a low to negligible risk to B. mori. PMID:25014054

  19. Spodoptera frugiperda (J.E. Smith) with field-evolved resistance to Bt maize are susceptible to Bt pesticides.

    Science.gov (United States)

    Jakka, S R K; Knight, V R; Jurat-Fuentes, J L

    2014-10-01

    Field-evolved resistance to maize event TC1507 expressing the Cry1Fa toxin from Bacillus thuringiensis (Bt) was detected in populations of Spodoptera frugiperda from Puerto Rico. We tested for cross-resistance to purified Cry1A toxins and commercial Bt pesticides in susceptible (Benzon) and TC1507-resistant (456) strains of S. frugiperda. Larvae from the 456 strain exhibited cross-resistance to Cry1Ab and Cry1Ac toxins, while no differences in susceptibility to XenTari WG and DiPel ES pesticides were detected. These data support cross-resistance to toxins that share binding sites with Cry1Fa and no cross-resistance to Bt pesticides in S. frugiperda with field-evolved resistance to Bt maize. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Developing Analytic Rating Guides for "TOEFL iBT"® Integrated Speaking Tasks. "TOEFL iBT"® Research Report, TOEFL iBT-20. ETS Research Report. RR-13-13

    Science.gov (United States)

    Jamieson, Joan; Poonpon, Kornwipa

    2013-01-01

    Research and development of a new type of scoring rubric for the integrated speaking tasks of "TOEFL iBT"® are described. These "analytic rating guides" could be helpful if tasks modeled after those in TOEFL iBT were used for formative assessment, a purpose which is different from TOEFL iBT's primary use for admission…

  1. Comparative diversity of arthropods on Bt maize and non-Bt maize in two different cropping systems in South Africa.

    Science.gov (United States)

    Truter, J; Van Hamburg, H; Van Den Berg, J

    2014-02-01

    The biodiversity of an agroecosystem is not only important for its intrinsic value but also because it influences ecological functions that are vital for crop production in sustainable agricultural systems and the surrounding environment. A concern about genetically modified (GM) crops is the potential negative impact that such crops could have on diversity and abundance of nontarget organisms, and subsequently on ecosystem functions. Therefore, it is essential to assess the potential environmental risk of the release of a GM crop and to study its effect on species assemblages within that ecosystem. Assessment of the impact of Bt maize on the environment is hampered by the lack of basic checklists of species present in maize agroecosystems. The aims of the study were to compile a checklist of arthropods that occur on maize in South Africa and to compare the diversity and abundance of arthropods and functional groups on Bt maize and non-Bt maize. Collections of arthropods were carried out during two growing seasons on Bt maize and non-Bt maize plants at two localities. Three maize fields were sampled per locality during each season. Twenty plants, each of Bt maize and non-Bt maize, were randomly selected from the fields at each site. The arthropods collected during this study were classified to morphospecies level and grouped into the following functional groups: detritivores, herbivores, predators, and parasitoids. Based on feeding strategy, herbivores and predators were further divided into sucking herbivores or predators (piercing-sucking mouthparts) and chewing herbivores or predators (chewing mouthparts). A total of 8,771 arthropod individuals, comprising 288 morphospecies and presenting 20 orders, were collected. Results from this short-term study indicated that abundance and diversity of arthropods in maize and the different functional guilds were not significantly affected by Bt maize, either in terms of diversity or abundance.

  2. in transgenic cucumber

    African Journals Online (AJOL)

    Jane

    2011-07-18

    Jul 18, 2011 ... College of Horticulture, South China Agriculture University, Guangzhou 510642, Guangdong ... The pattern of expression vector pBI-PacPAP. ..... Disease scale ... These transgenic T0 plants were self-pollinated and the.

  3. Transgene mus som sygdomsmodeller

    DEFF Research Database (Denmark)

    Schuster, Mikkel Bruhn; Porse, Bo Torben

    2003-01-01

    Transgenic animal models have proven to be useful tools in understanding both basic biology and the events associated with disease. Recent technical advances in the area of genomic manipulation in combination with the availability of the human and murine genomic sequences now allow the precise...... tailoring of the mouse genome. In this review we describe a few systems in which transgenic animal models have been employed for the purpose of studying the etiology of human diseases. Udgivelsesdato: 2003-Feb-17...

  4. Efficient genetic transformation of okra (Abelmoschus esculentus (L.) Moench) and generation of insect-resistant transgenic plants expressing the cry1Ac gene.

    Science.gov (United States)

    Narendran, M; Deole, Satish G; Harkude, Satish; Shirale, Dattatray; Nanote, Asaram; Bihani, Pankaj; Parimi, Srinivas; Char, Bharat R; Zehr, Usha B

    2013-08-01

    Agrobacterium -mediated transformation system for okra using embryos was devised and the transgenic Bt plants showed resistance to the target pest, okra shoot, and fruit borer ( Earias vittella ). Okra is an important vegetable crop and progress in genetic improvement via genetic transformation has been impeded by its recalcitrant nature. In this paper, we describe a procedure using embryo explants for Agrobacterium-mediated transformation and tissue culture-based plant regeneration for efficient genetic transformation of okra. Twenty-one transgenic okra lines expressing the Bacillus thuringiensis gene cry1Ac were generated from five transformation experiments. Molecular analysis (PCR and Southern) confirmed the presence of the transgene and double-antibody sandwich ELISA analysis revealed Cry1Ac protein expression in the transgenic plants. All 21 transgenic plants were phenotypically normal and fertile. T1 generation plants from these lines were used in segregation analysis of the transgene. Ten transgenic lines were selected randomly for Southern hybridization and the results confirmed the presence of transgene integration into the genome. Normal Mendelian inheritance (3:1) of cry1Ac gene was observed in 12 lines out of the 21 T0 lines. We selected 11 transgenic lines segregating in a 3:1 ratio for the presence of one transgene for insect bioassays using larvae of fruit and shoot borer (Earias vittella). Fruit from seven transgenic lines caused 100 % larval mortality. We demonstrate an efficient transformation system for okra which will accelerate the development of transgenic okra with novel agronomically useful traits.

  5. Severity of cotton whitefly (bemisia tabaci genn.) population with special reference to abiotic factors

    International Nuclear Information System (INIS)

    Zia, K.; Bashir, M.H.; Khan, B.S.; Khan, R.R.; Hafeez, F.

    2013-01-01

    Bemisia tabaci is serious insect and constantly destabilizing the cotton production. The research was conducted to evaluate cotton cultivars (transgenic and non transgenic) for resistance against whitefly and further correlated with weather factors such as temperature, relative humidity and rainfall, during the cropping seasons 2010 and 2011. However, peak population (6.36 per leaf) was recorded from FH-113 followed FH-167 and FH-114, whereas minimum population was recorded from FH-4243 in transgenic group whereas peak population (5.24 per leaf) was recorded from FH- 941 followed by FH-100 and FH- 901 while minimum population was recorded from FH-207, in non transgenic group of cultivars in the year 2010. The incidence and abundance was much high and reaching towards two folds in the year 2011 but the trend of whitefly varied with peak population (11.03 per leaf) recorded from FH -167 followed by FH- 4243 and FH113 (from transgenic group of cultivars) whereas a peak of 10.77 per leaf population of whitefly, recorded followed by FH-901 and FH-941 (from non transgenic group of cultivars). FH-207 found more resistant from all ten cultivars studied in 2011. Correlation among weather factors and whitefly population showed that rainfall was negatively correlated while temperature and relative humidity were positively correlated with whitefly population. In addition to that situation is becoming worse because of shifting from conventional to more advanced transgenic cultivars that are susceptible and serve as host. Moreover, climatic conditions provide addition favor and helps in population buildup, abundance and incidence. (author)

  6. Effects of Bacillus thuringiensis CRY1A(c) d-endotoxin on growth ...

    African Journals Online (AJOL)

    The recent introduction of Bt maize and Bt cotton transgenic crops into Africa has raised concerns on their potential short and long-term ecological effects on the environment. The effects of Bacillus thuringiensis (Bt) Cry1A(c) d-endotoxin on the growth, nodulation and productivity of two leguminous plants grown in clay soil ...

  7. Nutrient Uptake by High-Yielding Cotton Crop in Brazil

    Directory of Open Access Journals (Sweden)

    José Luís Vilela Vieira

    2018-02-01

    Full Text Available ABSTRACT: Determining nutrient uptake and accumulation rates by cotton crops is important to define management strategies, especially for transgenic varieties, which are cultivated using high-technology approaches that require substantial investment to maximize yield. Currently in Brazil, the states of Bahia and Mato Grosso are responsible for 84.4 % of the total cotton growing area. In the present study, two trials were conducted in 2013, one that involved planting FM 940 GLT, FM 980 GLT, and FM 913 GLT varieties in the state of Bahia and the other which involved FM 940 GLT and FM 980 GLT varieties in the state of Mato Grosso. The aim of the two trials was to represent the two regions that currently encompass the largest areas of cotton cultivation. Tissue samples, consisting of leaves, stems, and reproductive components, were collected eleven times during the crop cycle for determination of nutrient content and shoot dry matter. After weighing, plant tissue samples were dried and ground to determine nutrient contents. Because there were no overall differences in nutrient contents and biomass accumulation of the varieties during the crop cycle, we undertook joint analysis of the data from all varieties at each site. Favorable climatic conditions in Bahia promoted plant biomass production that was twice as much as plants grown in Mato Grosso, with cotton yields of 6.2 and 3.8 t ha−1 of lint and seed, respectively. The maximum nutrient accumulation occurred between 137-150 days after emergence (DAE for N; 143-148 for P; 172-185 for K; 100 for Ca; 144-149 for Mg; and 153-158 for S. Maximum uptake ranged from 218-362 kg ha−1 N; 26-53 kg ha−1 P; 233-506 kg ha−1 K; 91-202 kg ha−1 Ca; 28-44 kg ha−1 Mg; and 19-61 kg ha−1 S. On average, the sites revealed nutrient export of 14, 2, 23, 3, 2, and 2 kg t−1 of lint and seed for N, P, K, Ca, Mg, and S, respectively, with little variation among sites. Extraction of nutrients per area by cotton

  8. Agrobacterium rhizogenes-induced cotton hairy root culture as an alternative tool for cotton functional genomics

    Science.gov (United States)

    Although well-accepted as the ultimate method for cotton functional genomics, Agrobacterium tumefaciens-mediated cotton transformation is not widely used for functional analyses of cotton genes and their promoters since regeneration of cotton in tissue culture is lengthy and labor intensive. In cer...

  9. Genetic engineering of cotton with a novel cry2AX1 gene to impart insect resistance against Helicoverpa armigera

    Directory of Open Access Journals (Sweden)

    Karunamurthy Dhivya

    2016-09-01

    Full Text Available Embryogenic calli of cotton (Coker310 were cocultivated with the Agrobacterium tumefaciens strain LBA4404 harbouring the codon-optimised, chimeric cry2AX1 gene consisting of sequences from cry2Aa and cry2Ac genes isolated from Indian strains of Bacillus thuringiensis. Forty-eight putative transgenic plants were regenerated, and PCR analysis of these plants revealed the presence of the cry2AX1 gene in 40 plants. Southern blot hybridisation analysis of selected transgenic plants confirmed stable T-DNA integration in the genome of transformed plants. The level of Cry2AX1 protein expression in PCR positive plants ranged from 4.9 to 187.5 ng g-1 of fresh tissue. A transgenic cotton event, TP31, expressing the cry2AX1 gene showed insecticidal activity of 56.66 per cent mortality against Helicoverpa armigera in detached leaf disc bioassay. These results indicate that the chimeric cry2AX1 gene expressed in transgenic cotton has insecticidal activity against H. armigera.

  10. CRISPR/Cas9-mediated targeted mutagenesis in upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Janga, Madhusudhana R; Campbell, LeAnne M; Rathore, Keerti S

    2017-07-01

    The clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR associated (Cas)9 protein system has emerged as a simple and efficient tool for genome editing in eukaryotic cells. It has been shown to be functional in several crop species, yet there are no reports on the application of this or any other genome editing technologies in the cotton plant. Cotton is an important crop that is grown mainly for its fiber, but its seed also serves as a useful source of edible oil and feed protein. Most of the commercially-grown cotton is tetraploid, thus making it much more difficult to target both sets of homeologous alleles. Therefore, in order to understand the efficacy of the CRISPR/Cas9 system to target a gene within the genome of cotton, we made use of a transgenic cotton line previously generated in our laboratory that had a single copy of the green fluorescent protein (GFP) gene integrated into its genome. We demonstrate, for the first time, the use of this powerful new tool in targeted knockout of a gene residing in the cotton genome. By following the loss of GFP fluorescence, we were able to observe the cells that had undergone targeted mutations as a result of CRISPR/Cas9 activity. In addition, we provide examples of the different types of indels obtained by Cas9-mediated cleavage of the GFP gene, guided by three independent sgRNAs. The results provide useful information that will help us target important native genes in the cotton plant in future.

  11. Synthesis of Cotton from Tossa Jute Fiber and Comparison with Original Cotton

    Directory of Open Access Journals (Sweden)

    Md. Mizanur Rahman

    2015-01-01

    Full Text Available Cotton fibers were synthesized from tossa jute and characteristics were compared with original cotton by using FTIR and TGA. The FTIR results indicated that the peak intensity of OH group from jute cotton fibers occurred at 3336 cm−1 whereas the peak intensity of original cotton fibers occurred at 3338 cm−1. This indicated that the synthesized cotton fiber properties were very similar to the original cotton fibers. The TGA result showed that maximum rate of mass loss, the onset of decomposition, end of decomposition, and activation energy of synthesized cotton were higher than original cotton. The activation energy of jute cotton fibers was higher than the original cotton fibers.

  12. Bt rice in China - focusing the nontarget risk assessment.

    Science.gov (United States)

    Li, Yunhe; Zhang, Qingling; Liu, Qingsong; Meissle, Michael; Yang, Yan; Wang, Yanan; Hua, Hongxia; Chen, Xiuping; Peng, Yufa; Romeis, Jörg

    2017-10-01

    Bt rice can control yield losses caused by lepidopteran pests but may also harm nontarget species and reduce important ecosystem services. A comprehensive data set on herbivores, natural enemies, and their interactions in Chinese rice fields was compiled. This together with an analysis of the Cry protein content in arthropods collected from Bt rice in China indicated which nontarget species are most exposed to the insecticidal protein and should be the focus of regulatory risk assessment. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  13. Scoring Strategies for the TOEFL iBT A Complete Guide

    CERN Document Server

    Stirling, Bruce

    2012-01-01

    TOEFL students all ask: How can I get a high TOEFL iBT score? Answer: Learn argument scoring strategies. Why? Because the TOEFL iBT recycles opinion-based and fact-based arguments for testing purposes from start to finish. In other words, the TOEFL iBT is all arguments. That's right, all arguments. If you want a high score, you need essential argument scoring strategies. That is what Scoring Strategies for the TOEFL iBT gives you, and more!. TEST-PROVEN STRATEGIES. Learn essential TOEFL iBT scoring strategies developed in American university classrooms and proven successful on the TOEFL iBT. R

  14. Cotton : Market setting, trade policies, and issues

    OpenAIRE

    Baffes, John

    2004-01-01

    The value of world cotton production in 2000-01 has been estimated at about $20 billion, down from $35 billion in 1996-97 when cotton prices were 50 percent higher. Although cotton's share in world merchandise trade is insignificant (about 0.12 percent), it is very important to a number of developing countries. Cotton accounts for approximately 40 percent of total merchandise export earnin...

  15. Screen of Bacillus thuringiensis toxins for transgenic rice to control Sesamia inferens and Chilo suppressalis.

    Science.gov (United States)

    Gao, Yulin; Hu, Yang; Fu, Qiang; Zhang, Jie; Oppert, Brenda; Lai, Fengxiang; Peng, Yufa; Zhang, Zhitao

    2010-09-01

    Transgenic rice to control stem borer damage is under development in China. To assess the potential of Bacillus thuringiensis (Bt) transgenes in stem borer control, the toxicity of five Bt protoxins (Cry1Aa, Cry1Ab, Cry1Ac, Cry1Ba and Cry1Ca) against two rice stem borers, Sesamia inferens (pink stem borer) and Chilo suppressalis (striped stem borer), was evaluated in the laboratory by feeding neonate larvae on artificial diets containing Bt protoxins. The results indicated that Cry1Ca exhibited the highest level of toxicity to both stem borers, with an LC(50) of 0.24 and 0.30 microg/g for C. suppressalis and S. inferens, respectively. However, S. inferens was 4-fold lower in susceptibility to Cry1Aa, and 6- and 47-fold less susceptible to Cry1Ab and Cry1Ba, respectively, compared to C. suppressalis. To evaluate interactions among Bt protoxins in stem borer larvae, toxicity assays were performed with mixtures of Cry1Aa/Cry1Ab, Cry1Aa/Cry1Ca, Cry1Ac/Cry1Ca, Cry1Ac/Cry1Ba, Cry1Ab/Cry1Ac, Cry1Ab/Cry1Ba, and Cry1Ab/Cry1Ca at 1:1 (w/w) ratios. All protoxin mixtures demonstrated significant synergistic toxicity activity against C. suppressalis, with values of 1.6- to 11-fold higher toxicity than the theoretical additive effect. Surprisingly, all but one of the Bt protoxin mixtures were antagonistic in toxicity to S. inferens. In mortality-time response experiments, S. inferens demonstrated increased tolerance to Cry1Ab and Cry1Ac compared to C. suppressalis when treated with low or high protoxin concentrations. The data indicate the utility of Cry1Ca protoxin and a Cry1Ac/Cry1Ca mixture to control both stem borer populations. Copyright 2010 Elsevier Inc. All rights reserved.

  16. Bioinspiration and Biomimicry: Possibilities for Cotton Byproducts

    Science.gov (United States)

    The byproducts from cotton gins have commonly been referred to as cotton gin trash or cotton gin waste primarily because the lint and seed were the main focus of the operation and the byproducts were a financial liability that did not have a consistent market. Even though the byproducts were called ...

  17. The water footprint of cotton consumption

    NARCIS (Netherlands)

    Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.; Gautam, R.

    2005-01-01

    The consumption of a cotton product is connected to a chain of impacts on the water resources in the countries where cotton is grown and processed. The aim of this report is to assess the ‘water footprint’ of worldwide cotton consumption, identifying both the location and the character of the

  18. Evidence of multiple/cross resistance to Bt and organophosphate insecticides in Puerto Rico population of the fall armyworm, Spodoptera frugiperda.

    Science.gov (United States)

    Zhu, Yu Cheng; Blanco, Carlos A; Portilla, Maribel; Adamczyk, John; Luttrell, Randall; Huang, Fangneng

    2015-07-01

    Fall armyworm (FAW) is a damaging pest of many economic crops. Long-term use of chemical control prompted resistance development to many insecticide classes. Many populations were found to be significantly less susceptible to major Bt toxins expressed in transgenic crops. In this study, a FAW strain collected from Puerto Rico (PR) with 7717-fold Cry1F-resistance was examined to determine if it had also developed multiple/cross resistance to non-Bt insecticides. Dose response assays showed that the PR strain developed 19-fold resistance to acephate. Besides having a slightly smaller larval body weight and length, PR also evolved a deep (2.8%) molecular divergence in mitochondrial oxidase subunit II. Further examination of enzyme activities in the midgut of PR larvae exhibited substantial decreases of alkaline phosphatase (ALP), aminopeptidase (APN), 1-NA- and 2-NA-specific esterase, trypsin, and chymotrypsin activities, and significant increases of PNPA-specific esterase and glutathione S-transferase (GST) activities. When enzyme preparations from the whole larval body were examined, all three esterase, GST, trypsin, and chymotrypsin activities were significantly elevated in the PR strain, while ALP and APN activities were not significantly different from those of susceptible strain. Data indicated that multiple/cross resistances may have developed in the PR strain to both Bt toxins and conventional insecticides. Consistently reduced ALP provided evidence to support an ALP-mediated Bt resistance mechanism. Esterases and GSTs may be associated with acephate resistance through elevated metabolic detoxification. Further studies are needed to clarify whether and how esterases, GSTs, and other enzymes (such as P450s) are involved in cross resistance development to Bt and other insecticide classes. Published by Elsevier Inc.

  19. Evaluating the non-rice host plant species of Sesamia inferens (Lepidoptera: Noctuidae) as natural refuges: resistance management of Bt rice.

    Science.gov (United States)

    Liu, Zhuorong; Gao, Yulin; Luo, Ju; Lai, Fengxiang; Li, Yunhe; Fu, Qiang; Peng, Yufa

    2011-06-01

    Although rice (Oryza sativa L.) lines that express Bacillus thuringiensis (Bt) toxins have shown great potential for managing the major Lepidoptera pests of rice in southern China, including Sesamia inferens, their long-term use is dependent on managing resistance development to Bt toxins in pest populations. The maintenance of "natural" refuges, non-Bt expressing plants that are hosts for a target pest, has been proposed as a means to minimize the evolution of resistance to Bt toxins in transgenic plants. In the current study, field surveys and greenhouse experiments were conducted to identify host plants of S. inferens that could serve as "natural" refuges in rice growing areas of southern China. A field survey showed that 34 plant species in four families can be alternative host plants of S. inferens. Based on injury level under field conditions, rice (Oryza sativa L.); water oat (Zizania latifolia Griseb.); corn (Zea mays L.); tidalmarsh flatsedge (Cyperus serotinus Rottb.); and narrow-leaved cat-tail (Typha angustifolia Linn.) were identified as the primary host plant species of S. inferens. Greenhouse experiments further demonstrated that water oat, corn, and narrow-leaved cat-tail could support the survival and development of S. inferens. Interestingly, greenhouse experiments showed that S. inferens preferred to lay eggs on tidalmarsh flatsedge compared with the other three nonrice host species, although no pupae were found in the plants examined in field surveys. Few larvae were found to survive on tidalmarsh flatsedge in greenhouse bioassays, suggesting that tidalmarsh flatsedge could serve as a "dead-end" trap crop for S. inferens, but is not a candidate to serve as natural refuge to maintain susceptible S. inferens. Overall, these results suggest that water-oat, corn, and narrow-leaved cat-tail might serve as "natural refuge" for S. inferens in rice planting area of southern China when Bt rice varieties are planted.

  20. Expression of Cry1Ab and Cry2Ab by a polycistronic transgene with a self-cleavage peptide in rice.

    Directory of Open Access Journals (Sweden)

    Qichao Zhao

    Full Text Available Insect resistance to Bacillus thuringiensis (Bt crystal protein is a major threat to the long-term use of transgenic Bt crops. Gene stacking is a readily deployable strategy to delay the development of insect resistance while it may also broaden insecticidal spectrum. Here, we report the creation of transgenic rice expressing discrete Cry1Ab and Cry2Ab simultaneously from a single expression cassette using 2A self-cleaving peptides, which are autonomous elements from virus guiding the polycistronic viral gene expression in eukaryotes. The synthetic coding sequences of Cry1Ab and Cry2Ab, linked by the coding sequence of a 2A peptide from either foot and mouth disease virus or porcine teschovirus-1, regardless of order, were all expressed as discrete Cry1Ab and Cry2Ab at high levels in the transgenic rice. Insect bioassays demonstrated that the transgenic plants were highly resistant to lepidopteran pests. This study suggested that 2A peptide can be utilized to express multiple Bt genes at high levels in transgenic crops.

  1. Thwarting one of cotton's nemeses

    International Nuclear Information System (INIS)

    Senft, D.

    1991-01-01

    There's not much good to be said for the pink bollworm, cotton's most destructive pest, except that it is being controlled to cut crop damage. Scientists have developed strategies, such as increasing native populations of predatory insects and pest-resistant cotton varieties. Thanks to research, growers today can also use cultural practices such as early plowdown of harvested cotton to break up stalks and bury overwintering pink bollworms. And they can disrupt normal mating by releasing sterile insects and using copies of natural compounds, called pheromones, that the pink bollworm uses to attract mates. Such strategies, together with judicious use of insecticides, put together in various combinations, form what is called an integrated pest management system

  2. Transgenics in Agriculture

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 2. Transgenics in Agriculture. D Rex Arunraj B Gajendra Babu. Classroom Volume 6 Issue 2 February 2001 pp 83-92. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/006/02/0083-0092 ...

  3. Gene pyramiding as a Bt resistance management strategy: How ...

    African Journals Online (AJOL)

    Reports on the emergence of insect resistance to Bacillus thuringiensis delta endotoxins have raised doubts on the sustainability of Bt-toxin based pest management technologies. Corporate industry has responded to this challenge with innovations that include gene pyramiding among others. Pyramiding entails stacking ...

  4. A biannual study on the environmental impact of Bt maize

    Czech Academy of Sciences Publication Activity Database

    Sehnal, František; Habuštová, Oxana; Spitzer, L.; Hussein, Hany; Růžička, Vlastimil

    2004-01-01

    Roč. 27, č. 3 (2004), s. 147-160 [Ecological Impact of Genetically Modified Organisms. Praha, 26.11.2003-29.11.2003] R&D Projects: GA ČR GA522/02/1507 Institutional research plan: CEZ:AV0Z5007907 Keywords : Bt maize * GM crops * European corn borer Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection

  5. Insect communities on maize expressing a Bt-toxin

    Czech Academy of Sciences Publication Activity Database

    Habuštová, Oxana; Sehnal, František; Hussein, Hany

    2005-01-01

    Roč. 1, - (2005), s. 9-11 ISSN 1335-258X R&D Projects: GA AV ČR(CZ) KJB6007304 Institutional research plan: CEZ:AV0Z50070508 Keywords : GMO * arthropod communities * Bt maize Subject RIV: EH - Ecology, Behaviour

  6. Attitudes in China about Crops and Foods Developed by Biotechnology

    OpenAIRE

    Han, Fei; Zhou, Dingyang; Liu, Xiaoxia; Cheng, Jie; Zhang, Qingwen; Shelton, Anthony M.

    2015-01-01

    Transgenic Bt cotton has been planted in China since 1997 and, in 2009, biosafety certificates for the commercial production of Bt rice and phytase corn were issued by the Chinese government. The public attitude in China toward agricultural biotechnology and genetically modified (GM) crops and foods has received considerable attention worldwide. We investigated the attitudes of consumers, Bt cotton farmers and scientists in China regarding GM crops and foods and the factors influencing their ...

  7. screening of new isolates of bt and cloning of their dna amplicons

    African Journals Online (AJOL)

    NEMAPPA

    2012-09-18

    Sep 18, 2012 ... Nine new indigenous isolates of Bacillus thuringiensis (Bt) were characterized for their colony type, ... Bt. New gene sequences encoding more active toxins could be ..... Toxicity of a Bacillus thuringiensis israelensis-like strain.

  8. Acute, sublethal, and combination effects of azadirachtin and Bacillus thuringiensis on the cotton bollworm, Helicoverpa armigera.

    Science.gov (United States)

    Abedi, Zahra; Saber, Moosa; Vojoudi, Samad; Mahdavi, Vahid; Parsaeyan, Ehsan

    2014-02-26

    The cotton bollworm, Helicoverpa armigera Hübner (Lepidoptera: Noctuidae) is a polyphagous and cosmopolitan insect pest that causes damage to various plants. In this study, the lethal and sublethal effects of azadirachtin and Bacillus thuringiensis Berliner sub sp . kurstaki (Bacillales: Bacillaceae) were evaluated on third instar H. armigera under laboratory conditions. The LC50 values of azadirachtin and Bt were 12.95 and 96.8 µg a.i./mL, respectively. A total mortality of 56.7% was caused on third instar larvae when LC20 values of the insecticides were applied in combination with each other. The LT50 values of azadirachtin and Bt were 4.8 and 3.6 days, respectively. The results of the sublethal study showed that the application of LC30 value of azadirachtin and Bt reduced the larval and pupal weight and increased larval and pupal duration of H. armigera. The longevity and fecundity of female adults were affected significantly by the insecticides. Female fecundity was reduced by the treatments, respectively. The lowest adult emergence ratio and pupation ratio were observed in the azadirachtin treatment. The results indicated that both insecticides have high potential for controlling of the pest. This is an open access paper. We use the Creative Commons Attribution 3.0 license that permits unrestricted use, provided that the paper is properly attributed.

  9. Immunotoxicological studies of genetically modified rice expressing PHA-E lectin or Bt toxin in Wistar rats

    International Nuclear Information System (INIS)

    Kroghsbo, Stine; Madsen, Charlotte; Poulsen, Morten; Schroder, Malene; Kvist, Peter H.; Taylor, Mark; Gatehouse, Angharad; Shu, Qingyao; Knudsen, Ib

    2008-01-01

    As part of the SAFOTEST project the immunmodulating effect of Cry1Ab protein from Bacillus thuringiensis (Bt) and PHA-E lectin from kidney bean (Phaseolus vulgaris erythroagglutinin) was examined in 28- and 90-day feeding studies in Wistar rats. PHA-E lectin was chosen as positive control. Rats were fed control rice, transgenic rice expressing Cry1Ab protein or PHA-E lectin, or transgenic rice spiked with the purified recombinant protein. Total immunoglobulin levels, mitogen-induced cell proliferation, T-dependent antibody response to sheep red blood cells and the antigen-specific antibody response in serum were examined at the end of the studies. A dose-dependent increase in mesenteric lymph node weight and total immunoglobulin A was seen when feeding PHA-E transgenic rice alone or spiked with 0.1% purified PHA-E lectin for 90 days indicating a local effect of PHA-E in the intestine. No adverse effects of Cry1Ab protein were found. An anti-PHA-E and anti-Cry1Ab antibody response was induced both after inhalation (control groups) and after inhalation/ingestion (groups fed recombinant protein alone or together with transgenic rice). In conclusion, only PHA-E lectin was found to have an immunomodulating effect when feeding rats for 90 days with approximately 70 mg PHA-E/kg bodyweight per day. As both PHA-E lectin and Cry1Ab protein were capable of inducing an antigen-specific antibody response it is important to make careful considerations when designing future animal studies to avoid intake of proteins from the other groups by inhalation as well as to examine the sensitization and elicitation potential of 'foreign' proteins before introduction to the world market

  10. Test Takers' Attitudes about the TOEFL iBT[TM]. TOEFL iBT Research Report. RR-10-2

    Science.gov (United States)

    Stricker, Lawrence J.; Attali, Yigal

    2010-01-01

    The principal aims of this study, a conceptual replication of an earlier investigation of the TOEFL[R] computer-based test, or TOEFL CBT, in Buenos Aires, Cairo, and Frankfurt, were to assess test takers' reported acceptance of the TOEFL Internet-based test, or TOEFL iBT[TM], and its associations with possible determinants of this acceptance and…

  11. SNS ønsker kommentarer om oplysninger fra Syngenta Seeds vedr forurening med Bt10 i Bt11-majsen ændrer konklusionerne i risikovurderingen. Zea mays (Bt11) . Supplerende informationer om Bt11 - evt. konsekvenser for tidligere vurderinger. Modtaget 04-05-2005, deadline 06-06-2005, svar 24-05-2005

    DEFF Research Database (Denmark)

    Kjellsson, Gøsta

    2012-01-01

    "Vedr. oplysningerne om iblanding af Bt-10 majsen i Bt-11 viser det tilsendte materiale, at Syngenta har undersøgt og fået bekræftet at undersøgelserne til grundlag for risikovurderingen blev foretaget på Bt-11 majs. DMU ser derfor ingen grund til at ændre konklusionerne i den tidligere risikovur...

  12. Cocoa/Cotton Comparative Genomics

    Science.gov (United States)

    With genome sequence from two members of the Malvaceae family recently made available, we are exploring syntenic relationships, gene content, and evolutionary trajectories between the cacao and cotton genomes. An assembly of cacao (Theobroma cacao) using Illumina and 454 sequence technology yielded ...

  13. Genome Editing in Cotton with the CRISPR/Cas9 System

    Directory of Open Access Journals (Sweden)

    Wei Gao

    2017-08-01

    Full Text Available Genome editing is an important tool for gene functional studies as well as crop improvement. The recent development of the CRISPR/Cas9 system using single guide RNA molecules (sgRNAs to direct precise double strand breaks in the genome has the potential to revolutionize agriculture. Unfortunately, not all sgRNAs are equally efficient and it is difficult to predict their efficiency by bioinformatics. In crops such as cotton (Gossypium hirsutum L., with labor-intensive and lengthy transformation procedures, it is essential to minimize the risk of using an ineffective sgRNA that could result in the production of transgenic plants without the desired CRISPR-induced mutations. In this study, we have developed a fast and efficient method to validate the functionality of sgRNAs in cotton using a transient expression system. We have used this method to validate target sites for three different genes GhPDS, GhCLA1, and GhEF1 and analyzed the nature of the CRISPR/Cas9-induced mutations. In our experiments, the most frequent type of mutations observed in cotton cotyledons were deletions (∼64%. We prove that the CRISPR/Cas9 system can effectively produce mutations in homeologous cotton genes, an important requisite in this allotetraploid crop. We also show that multiple gene targeting can be achieved in cotton with the simultaneous expression of several sgRNAs and have generated mutations in GhPDS and GhEF1 at two target sites. Additionally, we have used the CRISPR/Cas9 system to produce targeted gene fragment deletions in the GhPDS locus. Finally, we obtained transgenic cotton plants containing CRISPR/Cas9-induced gene editing mutations in the GhCLA1 gene. The mutation efficiency was very high, with 80.6% of the transgenic lines containing mutations in the GhCLA1 target site resulting in an intense albino phenotype due to interference with chloroplast biogenesis.

  14. Resistance evolution to Bt crops: predispersal mating of European corn borers.

    Directory of Open Access Journals (Sweden)

    Ambroise Dalecky

    2006-06-01

    Full Text Available Over the past decade, the high-dose refuge (HDR strategy, aimed at delaying the evolution of pest resistance to Bacillus thuringiensis (Bt toxins produced by transgenic crops, became mandatory in the United States and is being discussed for Europe. However, precopulatory dispersal and the mating rate between resident and immigrant individuals, two features influencing the efficiency of this strategy, have seldom been quantified in pests targeted by these toxins. We combined mark-recapture and biogeochemical marking over three breeding seasons to quantify these features directly in natural populations of Ostrinia nubilalis, a major lepidopteran corn pest. At the local scale, resident females mated regardless of males having dispersed beforehand or not, as assumed in the HDR strategy. Accordingly, 0-67% of resident females mating before dispersal did so with resident males, this percentage depending on the local proportion of resident males (0% to 67.2%. However, resident males rarely mated with immigrant females (which mostly arrived mated, the fraction of females mating before dispersal was variable and sometimes substantial (4.8% to 56.8%, and there was no evidence for male premating dispersal being higher. Hence, O. nubilalis probably mates at a more restricted spatial scale than previously assumed, a feature that may decrease the efficiency of the HDR strategy under certain circumstances, depending for example on crop rotation practices.

  15. Genotype-by-sowing date interaction effects on cotton yield and quality in irrigated condition of dera ismail khan, pakistan

    International Nuclear Information System (INIS)

    Usman, K.; Khan, S.; Ayatullah, A.

    2016-01-01

    Cotton is a major export commodity of Pakistan. It is affected by variable environmental conditions throughout the country which limits its production. A 2-year field study was conducted in 2012 and 2013 at Cotton Research Station, Dera Ismail Khan, Pakistan to evaluate the effects of six sowing dates on yield and quality attributes of four cotton genotypes. The experiments were laid out in split-plot within a randomized complete block design with three replications. Main plots treatments were six sowing dates, namely March 20, April 4, April 19, May 4, May 19, and June 3 while subplots treatments were four approved transgenic varieties of cotton (CIM-598, CIM-599, CIM-602, and Ali Akber-703). Results revealed that earlier planting produced more vegetative growth rather than lint yield while late planting induced flowering and boll formation when temperature was much cold that adversely affected cotton yield and quality. The results further indicate that the genotype CIM-599 scored first rank in number of bolls plant-1, boll weight, seed cotton yield, ginning out turn, fiber length, fiber strength, fiber fineness, and fiber uniformity when sown on April 19. CIM-598 was the next suitable genotype after CIM-599 which produced higher yield and quality traits in April 19 sowing. Earlier and later sowing than April 19 resulted in lower cotton yield and quality characters due to unfavorable environmental conditions and shorter growth period, respectively. Thus it is concluded that the genotype, CIM-599 sown on April 19 suits well to the study area and had the potential to optimize cotton yield and quality in irrigated condition of Dera Ismail Khan, Pakistan. (author)

  16. Cotton fiber quality determined by fruit position, temperature and management

    OpenAIRE

    Wang, X.; Evers, J.B.; Zhang, L.; Mao, L.; Pan, X.; Li, Z.

    2013-01-01

    CottonXL is a tool to explore cotton fiber quality in relation to fruit position, to improve cotton quality by optimizing cotton plant structure, as well as to help farmers understand how the structure of the cotton plant determines crop growth and quality.

  17. 7 CFR 1205.319 - Cotton-producing region.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region: Alabama...

  18. Predator Preference for Bt-Fed Spodoptera frugiperda (Lepidoptera: Noctuidae) Prey: Implications for Insect Resistance Management in Bt Maize Seed Blends.

    Science.gov (United States)

    Svobodová, Z; Burkness, E C; Skoková Habuštová, O; Hutchison, W D

    2017-06-01

    Understanding indirect, trophic-level effects of genetically engineered plants, expressing insecticidal proteins derived from the bacterium, Bacillus thuringiensis (Bt), is essential to the ecological risk assessment process. In this study, we examine potential indirect, trophic-level effects of Bt-sensitive prey using the predator, Harmonia axyridis (Pallas), feeding upon Spodoptera frugiperda (J.E. Smith) larvae, which had delayed development (lower body mass) following ingestion of Cry1Ab maize leaves. We found no adverse effects on development and survival when H. axyridis larvae were fed S. frugiperda larvae that had fed on Cry1Ab maize tissue. Presence of Cry1Ab in H. axyridis decreased considerably after switching to another diet within 48 h. In a no-choice assay, H. axyridis larvae consumed more Bt-fed S. frugiperda than non-Bt-fed larvae. Preference for S. frugiperda feeding on Bt maize was confirmed in subsequent choice assays with H. axyridis predation on Bt-fed, 1-5-d-old S. frugiperda larvae. We suggest that H. axyridis preferred prey, not based on whether it had fed on Bt or non-Bt maize, but rather on larval mass, and they compensated for the nutritional deficiency of lighter larvae through increased consumption. Pest larvae with variable levels of resistance developing on Bt diet are often stunted versus sensitive larvae developing on non-Bt diet. It is possible that such larvae may be preferentially removed from local field populations. These results may have implications for insect resistance management and may be played out under field conditions where seed blends of Bt and non-Bt hybrids are planted. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Calculation and Analysis of B/T (Burning and/or Transmutation Rate of Minor Actinides and Plutonium Performed by Fast B/T Reactor

    Directory of Open Access Journals (Sweden)

    Marsodi

    2006-01-01

    Full Text Available Calculation and analysis of B/T (Burning and/or Transmutation rate of MA (minor actinides and Pu (Plutonium has been performed in fast B/T reactor. The study was based on the assumption that the spectrum shift of neutron flux to higher side of neutron energy had a potential significance for designing the fast B/T reactor and a remarkable effect for increasing the B/T rate of MA and/or Pu. The spectrum shifts of neutron have been performed by change MOX to metallic fuel. Blending fraction of MA and or Pu in B/T fuel and the volume ratio of fuel to coolant in the reactor core were also considered. Here, the performance of fast B/T reactor was evaluated theoretically based on the calculation results of the neutronics and burn-up analysis. In this study, the B/T rate of MA and/or Pu increased by increasing the blending fraction of MA and or Pu and by changing the F/C ratio. According to the results, the total B/T rate, i.e. [B/T rate]MA + [B/T rate]Pu, could be kept nearly constant under the critical condition, if the sum of the MA and Pu inventory in the core is nearly constant. The effect of loading structure was examined for inner or outer loading of concentric geometry and for homogeneous loading. Homogeneous loading of B/T fuel was the good structure for obtaining the higher B/T rate, rather than inner or outer loading

  20. Changes in bacillus thuringiensis tolerance levels due to hybridization of Bt-tolerant and susceptible silkworm populations

    International Nuclear Information System (INIS)

    Begumad, H.A.; Hassana, E.; Dingleb, J.; Alshehic, A.A.

    2012-01-01

    Males and females of a Bt-tolerant mulberry silkworm (Bombyx mori L.) population were crossed with females and males of a Bt-susceptible population, to produce Bt-tolerant silkworm hybrids, and to determine the expression of the Bt-tolerance pattern in the F 1 hybrids. It was observed that when a Bt-tolerant (42% larval mortality) female (BtT ) silkworm was crossed with a Bt-susceptible (85% larval mortality) male (BtS ), the resultant F 1 offspring showed lower levels of Bt-tolerance (87% larval mortality). On the other hand, when a Bt-tolerant male (BtT ) was crossed with a Bt-susceptible female (BtS ), the F 1 hybrid showed higher levels of Bt-tolerance (35% larval mortality) characteristic. The probit statistics showed that both hybrids expressed Bt-tolerance or susceptible levels similar to their male parents. These different patterns of Bt-tolerance in F 1 hybrids might be due to the transferring of a Bt-tolerant gene, from the parents to offspring, through the homozygotic male (ZZ) silkworm. (author)

  1. Investigating the Value of Section Scores for the "TOEFL iBT"® Test. "TOEFL iBT"® Research Report. TOEFL iBT-21. ETS Research Report RR-13-35

    Science.gov (United States)

    Sawaki, Yasuyo; Sinharay, Sandip

    2013-01-01

    This study investigates the value of reporting the reading, listening, speaking, and writing section scores for the "TOEFL iBT"® test, focusing on 4 related aspects of the psychometric quality of the TOEFL iBT section scores: reliability of the section scores, dimensionality of the test, presence of distinct score profiles, and the…

  2. Discourse Characteristics of Writing and Speaking Task Types on the "TOEFL iBT"® Test: A Lexico-Grammatical Analysis. "TOEFL iBT"® Research Report. TOEFL iBT-19. Research Report. RR-13-04

    Science.gov (United States)

    Biber, Douglas; Gray, Bethany

    2013-01-01

    One of the major innovations of the "TOEFL iBT"® test is the incorporation of integrated tasks complementing the independent tasks to which examinees respond. In addition, examinees must produce discourse in both modes (speech and writing). The validity argument for the TOEFL iBT includes the claim that examinees vary their discourse in…

  3. Use of Industrial Components in SL/BT Equipment Controls

    CERN Document Server

    Carlier, E

    1999-01-01

    The control system of all SPS target stations, beam absorbers and other aperture limiting devices is presently being refurbished, using solely standard industrial hardware and software components. SIEMENS Simatic S7-300 programmable logic controllers serve as equipment controllers. They are connected through Profibus to a WinNT front-end running the SIEMENS WinCC SCADA package which acts as local controller and gateway for remote access. A variant configuration, where the PLCs are directly linked to Ethernet, has been used for controlling the SPS Q measurement kickers. These and some other SL/BT projects will be reviewed where fully off-the-shelf components have been successfully integrated into the SL accelerator controls infrastructure. The arguments leading to the various technical choices will be laid down including a report of the experience gained. Finally, the presentation will address the perspective and current ideas for using industrial components in controlling SL/BT equipment during the LHC era.

  4. Marketingový plán pro BT SERVIS

    OpenAIRE

    Bilíková, Eva

    2015-01-01

    Předmětem diplomové práce je sestavení marketingového plánu pro společnost BT servis, která plánuje otevřít novou pobočku v Jihomoravském kraji. V první části jsou představena teoretická východiska, která se vztahují ke zkoumané problematice. Následuje analýza současného stavu podniku a jeho okolí. Získané informace jsou vyhodnoceny a poté je sestaven marketingový plán na období jednoho roku. The scope of this diploma thesis is the creation of a marketing strategy for the BT servis company...

  5. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    Science.gov (United States)

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

    2001-01-01

    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  6. Post test analysis of the LOBI BT17 experiment

    International Nuclear Information System (INIS)

    Farkas, I.T.; Hozer, Z.; Takacs, A.

    1994-12-01

    The LOBI experimental facility and the BT17 experiment. This experiment represents a loss-of-feedwater transient with feed and bleed procedure. The computational analysis has been performed by the CATHARE thermal hydraulic system code. The results of calculations are in satisfactory agreement with the experimental values. A comparison has been made with a Loss-of-Feedwater test performed on the PMK-2 facility. (author). 16 refs., 22 figs., 5 tabs

  7. In situ degrability of dry matter of sheep fed with corn silage with or without Bt gene

    Directory of Open Access Journals (Sweden)

    Camila Memari Trava

    2012-12-01

    Full Text Available Silage corn is a food widely used, composing the bulk of feed for ruminants, because its present high nutritional value. Since the release by CNTBio seeds of modified genetically corn, many of it began to use transgenic silage corn, which was inserted into genetic code the Bt (Bacillus thuringiensis gene that expresses a toxic protein to caterpillar pests of corn, so occurs the reduction of production costs and pesticide use. Due to rapid expansion of transgenic maize and your wide use in animal feed by producers, the aim of this study was to evaluate the degrability in situ in animal rumen, in order to estimate the nutritional value of silage corn with and without the Bt gene. The experiment was conducted at the Institute of Animal Science Nova Odessa-SP. Were used four rumen fistulated sheep housed in individual pens for 56 days, including four periods. The animals were fed with silage with two varieties of plant corn to silage - DKB and AG, and their isogenic counterparts with the Bt gene, comprising four treatments. The degradability determination of dry matter (DM digestibility of silage corn treatments was determined by means of nylon bag in situ. After removal, the bags were washed and incubated, then placed in forced-circulation at 55°C to constant weight to determine the DM concentration. Data from in situ degradation of DM was adjusted in the mathematical model proposed by Ørskov and McDonald (1979. For the degradability of DM, the fraction “a” showed the interaction (p <0.05, where the variety DKB do not showed difference (p> 0.05 for the gene insertion. For AG, showed a slight decrease (p <0.05 when compared to its isogenic counterpart with the gene (35.68% and 37.85% respectively, means that the Bt gene reduced the solubility of DM of this fraction for AG range. The fact of the variety AG with and without the gene have suffered lower solubility of DM when compared the DKB with and without the gene is due to the fact of being

  8. Transgenic algae engineered for higher performance

    Science.gov (United States)

    Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

    2014-10-21

    The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

  9. Principal variance component analysis of crop composition data: a case study on herbicide-tolerant cotton.

    Science.gov (United States)

    Harrison, Jay M; Howard, Delia; Malven, Marianne; Halls, Steven C; Culler, Angela H; Harrigan, George G; Wolfinger, Russell D

    2013-07-03

    Compositional studies on genetically modified (GM) and non-GM crops have consistently demonstrated that their respective levels of key nutrients and antinutrients are remarkably similar and that other factors such as germplasm and environment contribute more to compositional variability than transgenic breeding. We propose that graphical and statistical approaches that can provide meaningful evaluations of the relative impact of different factors to compositional variability may offer advantages over traditional frequentist testing. A case study on the novel application of principal variance component analysis (PVCA) in a compositional assessment of herbicide-tolerant GM cotton is presented. Results of the traditional analysis of variance approach confirmed the compositional equivalence of the GM and non-GM cotton. The multivariate approach of PVCA provided further information on the impact of location and germplasm on compositional variability relative to GM.

  10. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.

    Science.gov (United States)

    Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey

    2015-05-01

    Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.

  11. Population dynamics of Sesamia inferens on transgenic rice expressing Cry1Ac and CpTI in southern China.

    Science.gov (United States)

    Han, Lanzhi; Liu, Peilei; Wu, Kongming; Peng, Yufa; Wang, Feng

    2008-10-01

    Genetically modified insect-resistant rice lines containing the cry1Ac gene from Bacillus thuringiensis (Bt) or the CpTI (cowpea trypsin inhibitor) gene developed for the management of lepidopterous pests are highly resistant to the major target pests, Chilo suppressalis (Walker), Cnaphalocrocis medinalis (Guenée), and Scirpophaga incertulas (Walker), in the main rice-growing areas of China. However, the effects of these transgenic lines on Sesamia inferens (Walker), an important lepidopterous rice pest, are currently unknown. Because different insect species have varying susceptibility to Bt insecticidal proteins that may affect population dynamics, research into the effects of these transgenic rice lines on the population dynamics of S. inferens was conducted in Fuzhou, southern China, in 2005 and 2006. The results of laboratory, field cage, and field plot experiments show that S. inferens has comparatively high susceptibility to the transgenic line during the early growing season, with significant differences observed in larval density and infestation levels between transgenic and control lines. Because of a decrease in Cry1Ac levels in the plant as it ages, the transgenic line provided only a low potential for population suppression late in the growing season. There is a correlation between the changing expression of Cry1Ac and the impact of transgenic rice on the population dynamics of S. inferens during the season. These results indicate that S. inferens may become a major pest in fields of prospective commercially released transgenic rice, and more attention should be paid to developing an effective alternative management strategy.

  12. Aqueous supercapacitors on conductive cotton

    KAUST Repository

    Pasta, Mauro; La Mantia, Fabio; Hu, Liangbing; Deshazer, Heather Dawn; Cui, Yi

    2010-01-01

    Wearable electronics offer the combined advantages of both electronics and fabrics. In this article, we report the fabrication of wearable supercapacitors using cotton fabric as an essential component. Carbon nanotubes are conformally coated onto the cotton fibers, leading to a highly electrically conductive interconnecting network. The porous carbon nanotube coating functions as both active material and current collector in the supercapacitor. Aqueous lithium sulfate is used as the electrolyte in the devices, because it presents no safety concerns for human use. The supercapacitor shows high specific capacitance (~70-80 F·g-1 at 0.1 A·g-1) and cycling stability (negligible decay after 35,000 cycles). The extremely simple design and fabrication process make it applicable for providing power in practical electronic devices. © 2010 Tsinghua University Press and Springer-Verlag Berlin Heidelberg.

  13. Aqueous supercapacitors on conductive cotton

    KAUST Repository

    Pasta, Mauro

    2010-06-01

    Wearable electronics offer the combined advantages of both electronics and fabrics. In this article, we report the fabrication of wearable supercapacitors using cotton fabric as an essential component. Carbon nanotubes are conformally coated onto the cotton fibers, leading to a highly electrically conductive interconnecting network. The porous carbon nanotube coating functions as both active material and current collector in the supercapacitor. Aqueous lithium sulfate is used as the electrolyte in the devices, because it presents no safety concerns for human use. The supercapacitor shows high specific capacitance (~70-80 F·g-1 at 0.1 A·g-1) and cycling stability (negligible decay after 35,000 cycles). The extremely simple design and fabrication process make it applicable for providing power in practical electronic devices. © 2010 Tsinghua University Press and Springer-Verlag Berlin Heidelberg.

  14. Plant biotechnology: transgenic crops.

    Science.gov (United States)

    Shewry, Peter R; Jones, Huw D; Halford, Nigel G

    2008-01-01

    Transgenesis is an important adjunct to classical plant breeding, in that it allows the targeted manipulation of specific characters using genes from a range of sources. The current status of crop transformation is reviewed, including methods of gene transfer, the selection of transformed plants and control of transgene expression. The application of genetic modification technology to specific traits is then discussed, including input traits relating to crop production (herbicide tolerance and resistance to insects, pathogens and abiotic stresses) and output traits relating to the composition and quality of the harvested organs. The latter include improving the nutritional quality for consumers as well as the improvement of functional properties for food processing.

  15. Field-Evolved Mode 1 Resistance of the Fall Armyworm to Transgenic Cry1Fa-Expressing Corn Associated with Reduced Cry1Fa Toxin Binding and Midgut Alkaline Phosphatase Expression

    Science.gov (United States)

    Jakka, Siva R. K.; Gong, Liang; Hasler, James; Banerjee, Rahul; Sheets, Joel J.; Narva, Kenneth; Blanco, Carlos A.

    2015-01-01

    Insecticidal protein genes from the bacterium Bacillus thuringiensis (Bt) are expressed by transgenic Bt crops (Bt crops) for effective and environmentally safe pest control. The development of resistance to these insecticidal proteins is considered the most serious threat to the sustainability of Bt crops. Resistance in fall armyworm (Spodoptera frugiperda) populations from Puerto Rico to transgenic corn producing the Cry1Fa insecticidal protein resulted, for the first time in the United States, in practical resistance, and Bt corn was withdrawn from the local market. In this study, we used a field-collected Cry1Fa corn-resistant strain (456) of S. frugiperda to identify the mechanism responsible for field-evolved resistance. Binding assays detected reduced Cry1Fa, Cry1Ab, and Cry1Ac but not Cry1Ca toxin binding to midgut brush border membrane vesicles (BBMV) from the larvae of strain 456 compared to that from the larvae of a susceptible (Ben) strain. This binding phenotype is descriptive of the mode 1 type of resistance to Bt toxins. A comparison of the transcript levels for putative Cry1 toxin receptor genes identified a significant downregulation (>90%) of a membrane-bound alkaline phosphatase (ALP), which translated to reduced ALP protein levels and a 75% reduction in ALP activity in BBMV from 456 compared to that of Ben larvae. We cloned and heterologously expressed this ALP from susceptible S. frugiperda larvae and demonstrated that it specifically binds with Cry1Fa toxin. This study provides a thorough mechanistic description of field-evolved resistance to a transgenic Bt crop and supports an association between resistance and reduced Cry1Fa toxin binding and levels of a putative Cry1Fa toxin receptor, ALP, in the midguts of S. frugiperda larvae. PMID:26637593

  16. [TSA improve transgenic porcine cloned embryo development and transgene expression].

    Science.gov (United States)

    Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

    2011-07-01

    Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

  17. Effects of water management practices on residue decomposition and degradation of Cry1Ac protein from crop-wild Bt rice hybrids and parental lines during winter fallow season.

    Science.gov (United States)

    Xiao, Manqiu; Dong, Shanshan; Li, Zhaolei; Tang, Xu; Chen, Yi; Yang, Shengmao; Wu, Chunyan; Ouyang, Dongxin; Fang, Changming; Song, Zhiping

    2015-12-01

    Rice is the staple diet of over half of the world's population and Bacillus thuringiensis (Bt) rice expressing insecticidal Cry proteins is ready for deployment. An assessment of the potential impact of Bt rice on the soil ecosystem under varied field management practices is urgently required. We used litter bags to assess the residue (leaves, stems and roots) decomposition dynamics of two transgenic rice lines (Kefeng6 and Kefeng8) containing stacked genes from Bt and sck (a modified CpTI gene encoding a cowpea trypsin inhibitor) (Bt/CpTI), a non-transgenic rice near-isoline (Minghui86), wild rice (Oryza rufipogon) and crop-wild Bt rice hybrid under contrasting conditions (drainage or continuous flooding) in the field. No significant difference was detected in the remaining mass, total C and total N among cultivars under aerobic conditions, whereas significant differences in the remaining mass and total C were detected between Kefeng6 and Kefeng8 and Minghui86 under the flooded condition. A higher decomposition rate constant (km) was measured under the flooded condition compared with the aerobic condition for leaf residues, whereas the reverse was observed for root residues. The enzyme-linked immunosorbent assay (ELISA), which was used to monitor the changes in the Cry1Ac protein in Bt rice residues, indicated that (1) the degradation of the Cry1Ac protein under both conditions best fit first-order kinetics, and the predicted DT50 (50% degradation time) of the Cry1Ac protein ranged from 3.6 to 32.5 days; (2) the Cry1Ac protein in the residue degraded relatively faster under aerobic conditions; and (3) by the end of the study (~154 days), the protein was present at a low concentration in the remaining residues under both conditions. The degradation rate constant was negatively correlated with the initial carbon content and positively correlated with the initial Cry1Ac protein concentration, but it was only correlated with the mass decomposition rate constants under

  18. Effect of phosphate solubilizing bacteria on the phosphorus availability and yield of cotton (gossypium)

    International Nuclear Information System (INIS)

    Akhtar, N.; Iqbal, A.; Qureshi, M.A.; Khan, K.H

    2010-01-01

    Phosphate solubilizing bacteria (PSB) and plants have symbiotic relationship, as bacteria provide soluble phosphate for the plants and plants supply root borne carbon compounds which can be metabolized for bacterial growth. PSB solubilize the applied and fixed soil phosphorus resulting in higher crop yield. Intensive cropping has resulted in wide spread deficiency of Phosphorus in our soils and situation is becoming more serious because of a drastic increase in the cost of phosphatic fertilizers. Keeping in view the capabilities of microbes (Bacillus sp.), a field experiment was conducted on cotton at farmer field district Faisalabad in 2008. Effect of PSM (Bacillus spp.) was studied at three phosphorus levels i.e.20, 40 and 60 kg ha-l while N was applied at recommended dose (120 kg ha/sup -1/). Bacillus spp. was applied as seed coating to the cotton crop (Var. BT 121). Recommended plant protection measures were adopted. Results revealed that Bacillus spp. significantly increased the seed cotton yield; number of boll plant-I, boll weight, plant height, GOT (%), staple length, plant P and available P in the soil. Maximum seed cotton yield 4250 kg ha/sup -l/ was obtained with Bacillus inoculation along with 60 kg of P followed by 4162 kg ha/sup -1/ with Bacillus inoculation and 40 kg of P compared with their respective controls i.e.4093 and 3962 kg ha/sup -1/ respectively. Soil P was improved from 8.1 to 9.5 ppm by Bacillus inoculation. Phosphorus in plant matter was also higher (0.39%) as compare with control (0.36%). Rhizosphere soil pH was found slightly decreased (8.12 to 8.0) by Bacillus inoculation compare with control. It is concluded that PSB inoculation not only exerts beneficial effect on crop growth but also enhances the phosphorus concentration in the plant and soil. (author)

  19. Characteristics of a broad lytic spectrum endolysin from phage BtCS33 of Bacillus thuringiensis

    Directory of Open Access Journals (Sweden)

    Yuan Yihui

    2012-12-01

    Full Text Available Abstract Background Endolysins produced by bacteriophages lyse bacteria, and are thus considered a novel type of antimicrobial agent. Several endolysins from Bacillus phages or prophages have previously been characterized and used to target Bacillus strains that cause disease in animals and humans. B. thuringiensis phage BtCS33 is a Siphoviridae family phage and its genome has been sequenced and analyzed. In the BtCS33 genome, orf18 was found to encode an endolysin protein (PlyBt33. Results Bioinformatic analyses showed that endolysin PlyBt33 was composed of two functional domains, the N-terminal catalytic domain and the C-terminal cell wall binding domain. In this study, the entire endolysin PlyBt33, and both the N- and C-termini,were expressed in Escherichia coli and then purified. The lytic activities of PlyBt33 and its N-terminus were tested on bacteria. Both regions exhibited lytic activity, although PlyBt33 showed a higher lytic activity than the N-terminus. PlyBt33 exhibited activity against all Bacillus strains tested from five different species, but was not active against Gram-negative bacteria. Optimal conditions for PlyBt33 reactivity were pH 9.0 and 50°C. PlyBt33 showed high thermostability, with 40% of initial activity remaining following 1 h of treatment at 60°C. The C-terminus of PlyBt33 bound to B. thuringiensis strain HD-73 and Bacillus subtilis strain 168. This cell wall binding domain might be novel, as its amino acid sequence showed little similarity to previously reported endolysins. Conclusions PlyBt33 showed potential as a novel antimicrobial agent at a relatively high temperature and had a broad lytic spectrum within the Bacillus genus. The C-terminus of PlyBt33 might be a novel kind of cell wall binding domain.

  20. RNA interference of GhPEPC2 enhanced seed oil accumulation and salt tolerance in Upland cotton.

    Science.gov (United States)

    Zhao, Yanpeng; Huang, Yi; Wang, Yumei; Cui, Yupeng; Liu, Zhengjie; Hua, Jinping

    2018-06-01

    Phosphoenolpyruvate carboxylase (PEPCase) mainly produces oxaloacetic acid for tricarboxylic acid (TCA) cycle. Here we reported that GhPEPC2 silencing with PEPC2-RNAi vector could regulate oil and protein accumulation in cottonseeds. In GhPEPC2 transgenic plants, PEPCase activities in immature embryos were significantly reduced, and the oil content in seed kernel was increased 7.3 percentages, whereas total proteins decreased 5.65 percentages. Compared to wild type, agronomical traits of transgenic plant were obviously unaffected. Furthermore, gene expression profile of GhPEPC2 transgenic seeds were investigated using RNA-seq, most lipid synthesis related genes were up-regulated, but amino acid metabolic related genes were down-regulated. In addition, the GhPEPC2 transgenic cotton seedlings were stressed using sodium salts at seedling stage, and the salt tolerance was significantly enhanced. Our observations of GhPEPC2 in cotton would shade light on understanding the regulation of oil content, protein accumulation and salt tolerance enhancement in other plants. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. TL transgenic mouse strains

    International Nuclear Information System (INIS)

    Obata, Y.; Matsudaira, Y.; Hasegawa, H.; Tamaki, H.; Takahashi, T.; Morita, A.; Kasai, K.

    1993-01-01

    As a result of abnormal development of the thymus of these mice, TCR αβ lineage of the T cell differentiation is disturbed and cells belonging to the TCR γδ CD4 - CD8 - double negative (DN) lineage become preponderant. The γδ DN cells migrate into peripheral lymphoid organs and constitute nearly 50% of peripheral T cells. Immune function of the transgenic mice is severely impaired, indicating that the γδ cells are incapable of participating in these reactions. Molecular and serological analyses of T-cell lymphomas reveal that they belong to the γδ lineage. Tg.Tla a -3-1 mice should be useful in defining the role of TL in normal and abnormal T cell differentiation as well as in the development of T-cell lymphomas, and further they should facilitate studies on the differentiation and function of γδ T cells. We isolated T3 b -TL gene from B6 mice and constructed a chimeric gene in which T3 b -TL is driven by the promoter of H-2K b . With the chimeric gene, two transgenic mouse strains, Tg. Con.3-1 and -2 have been derived in C3H background. Both strains express TL antigen in various tissues including skin. The skin graft of transgenic mice on C3H and (B6 X C3H)F 1 mice were rejected. In the mice which rejected the grafts, CD8 + TCRαβ cytotoxic T cells (CTL) against TL antigens were recognized. The recognition of TL by CTL did not require the antigen presentation by H-2 molecules. The results indicated that TL antigen in the skin becomes a transplantation antigen and behaves like a typical allogeneic MHC class I antigen. The facts that (B6 X C3H)F 1 mice rejected the skin expressing T3 b -TL antigen and induced CTL that killed TL + lymphomas of B6 origin revealed that TL antigen encoded by T3 b -TL is recognized as non-self in B6 mice. Experiments are now extended to analyze immune responses to TL antigen expressed on autochthonous T cell lymphomas. (J.P.N.)

  2. Passive and active protection of cotton textiles

    NARCIS (Netherlands)

    Bochove, C. van

    1967-01-01

    In rotproofing of cotton a distinction is made between passive and active protection. In passive protection, the structure of the cotton fibre is modified in such a way that the fibre can longer be attacked. This modification of structure can be effected on different levels: microscopical,

  3. Fiber quality challenges facing the cotton industry

    Science.gov (United States)

    The cotton industry is in the midst of an exciting time with increased domestic consumption, but also facing pressure from other crops and the global marketplace. In order to ensure the US cotton crop remains the fiber of choice for the world it is important to keep an eye on the challenges to fibe...

  4. Within canopy distribution of cotton seed N

    Science.gov (United States)

    Whole cotton seeds can be an important component of dairy rations. Nitrogen content of the seed is an important determinant of the feed value of the seed. Efforts to increase the seed value as feed will be enhanced with knowledge of the range and distribution of seed N within the cotton crop. This s...

  5. Milkweed, stink bugs, and Georgia cotton

    Science.gov (United States)

    In peanut-cotton farmscapes in Georgia, stink bugs, i.e., Nezara viridula (L.)(Say) and Chinavia hilaris (Say), develop in peanut and then disperse at the crop-to-crop interface to feed on fruit in cotton. The main objective of this study was to examine the influence of a habitat of tropical milkwe...

  6. Cotton in Benin: governance and pest management

    NARCIS (Netherlands)

    Togbe, C.E.

    2013-01-01

    Key words: cotton, synthetic pesticides, neem oil (Azadirachta indica), Beauveria bassiana,

    Bacillus thuringiensis, field experiment, farmers’ participation

    Pests are one of the main factors limiting cotton production worldwide. Most of the pest

    control

  7. Post test analysis of the LOBI BT01 experiment

    International Nuclear Information System (INIS)

    Hozer, Z.; Takacs, A.

    1994-12-01

    The LOBI experimental facility and the BT01 experiment is described. The experiment represents a small break transient in the secondary side (steam line) followed by special conditions for the establishment of pressurized thermal shock and accident management procedures. The computational analysis has been performed by the CATHARE thermal hydraulic system code. The results of calculations are in satisfactory agreement with the experimental values. A comparison has been made with a secondary side break test performed on the PMK-2 facility. (author). 14 refs., 26 figs., 6 tabs

  8. Susceptibility of Anthonomus grandis (cotton boll weevil) and Spodoptera frugiperda (fall armyworm) to a cry1ia-type toxin from a Brazilian Bacillus thuringiensis strain.

    Science.gov (United States)

    Grossi-de-Sa, Maria Fatima; Quezado de Magalhaes, Mariana; Silva, Marilia Santos; Silva, Shirley Margareth Buffon; Dias, Simoni Campos; Nakasu, Erich Yukio Tempel; Brunetta, Patricia Sanglard Felipe; Oliveira, Gustavo Ramos; Neto, Osmundo Brilhante de Oliveira; Sampaio de Oliveira, Raquel; Soares, Luis Henrique Barros; Ayub, Marco Antonio Zachia; Siqueira, Herbert Alvaro Abreu; Figueira, Edson L Z

    2007-09-30

    Different isolates of the soil bacterium Bacillus thuringiensis produce multiple crystal (Cry) proteins toxic to a variety of insects, nematodes and protozoans. These insecticidal Cry toxins are known to be active against specific insect orders, being harmless to mammals, birds, amphibians, and reptiles. Due to these characteristics, genes encoding several Cry toxins have been engineered in order to be expressed by a variety of crop plants to control insectpests. The cotton boll weevil, Anthonomus grandis, and the fall armyworm, Spodoptera frugiperda, are the major economically devastating pests of cotton crop in Brazil, causing severe losses, mainly due to their endophytic habit, which results in damages to the cotton boll and floral bud structures. A cry1Ia-type gene, designated cry1Ia12, was isolated and cloned from the Bt S811 strain. Nucleotide sequencing of the cry1Ia12 gene revealed an open reading frame of 2160 bp, encoding a protein of 719 amino acid residues in length, with a predicted molecular mass of 81 kDa. The amino acid sequence of Cry1Ia12 is 99% identical to the known Cry1Ia proteins and differs from them only in one or two amino acid residues positioned along the three domains involved in the insecticidal activity of the toxin. The recombinant Cry1Ia12 protein, corresponding to the cry1Ia12 gene expressed in Escherichia coli cells, showed moderate toxicity towards first instar larvae of both cotton boll weevil and fall armyworm. The highest concentration of the recombinant Cry1Ia12 tested to achieve the maximum toxicities against cotton boll weevil larvae and fall armyworm larvae were 230 microg/mL and 5 microg/mL, respectively. The herein demonstrated insecticidal activity of the recombinant Cry1Ia12 toxin against cotton boll weevil and fall armyworm larvae opens promising perspectives for the genetic engineering of cotton crop resistant to both these devastating pests in Brazil.

  9. Toxicity to cotton boll weevil Anthonomus grandis of a trypsin inhibitor from chickpea seeds.

    Science.gov (United States)

    de P G Gomes, Angélica; Dias, Simoni C; Bloch, Carlos; Melo, Francislete R; Furtado, José R; Monnerat, Rose G; Grossi-de-Sá, Maria F; Franco, Octávio L

    2005-02-01

    Cotton (Gossypium hirsutum L.) is an important agricultural commodity, which is attacked by several pests such as the cotton boll weevil Anthonomus grandis. Adult A. grandis feed on fruits and leaf petioles, reducing drastically the crop production. The predominance of boll weevil digestive serine proteinases has motivated inhibitor screenings in order to discover new ones with the capability to reduce the digestion process. The present study describes a novel proteinase inhibitor from chickpea seeds (Cicer arietinum L.) and its effects against A. grandis. This inhibitor, named CaTI, was purified by using affinity Red-Sepharose Cl-6B chromatography, followed by reversed-phase HPLC (Vydac C18-TP). SDS-PAGE and MALDI-TOF analyses, showed a unique monomeric protein with a mass of 12,877 Da. Purified CaTI showed significant inhibitory activity against larval cotton boll weevil serine proteinases (78%) and against bovine pancreatic trypsin (73%), when analyzed by fluorimetric assays. Although the molecular mass of CaTI corresponded to alpha-amylase/trypsin bifunctional inhibitors masses, no inhibitory activity against insect and mammalian alpha-amylases was observed. In order to observe CaTI in vivo effects, an inhibitor rich fraction was added to an artificial diet at different concentrations. At 1.5% (w/w), CaTI caused severe development delay, several deformities and a mortality rate of approximately 45%. These results suggested that CaTI could be useful in the production of transgenic cotton plants with enhanced resistance toward cotton boll weevil.

  10. Phytoremediation of small organic contaminants using transgenic plants

    Science.gov (United States)

    James, C Andrew; Strand, Stuart E

    2010-01-01

    The efficacy of transgenic plants in the phytoremediation of small organic contaminants has been investigated. Two principal strategies have been pursued (1) the manipulation of phase I metabolic activity to enhance in planta degradation rates, or to impart novel metabolic activity, and (2) the enhanced secretion of reactive enzymes from roots leading to accelerated ex planta degradation of organic contaminants. A pair of dehalogenase genes from Xanthobacter autotrophicus was expressed in tobacco resulting in the dehalogenation of 1,2-dichloroethane, which was otherwise recalcitrant. A laccase gene from cotton was overexpressed in Arabidopsis thaliana resulting in increased secretory laccase activity and the enhanced resistance to trichlorophenol in soils. Although the results to date are promising, much of the work has been limited to laboratory settings; field demonstrations are needed. PMID:19342219

  11. Using cotton plant residue to produce briquettes

    Energy Technology Data Exchange (ETDEWEB)

    Coates, W. [University of Arizona, Tucson, AZ (United States). Bioresources Research Facility

    2000-07-01

    In Arizona, cotton (Gossypium) plant residue left in the field following harvest must be buried to prevent it from serving as an overwintering site for insects such as the pink bollworm. Most tillage operations employed to incorporate the residue into the soil are energy intensive and often degrade soil structure. Trials showed that cotton plant residue could be incorporated with pecan shells to produce commercially acceptable briquettes. Pecan shell briquettes containing cotton residue rather than waste paper were slightly less durable, when made using equivalent weight mixtures and moisture contents. Proximate and ultimate analyses showed the only difference among briquette samples to be a higher ash content in those made using cotton plant residue. Briquettes made with paper demonstrated longer flame out time, and lower ash percentage, compared to those made with cotton plant residue. (author)

  12. Cotton for removal of aquatic oil spills

    International Nuclear Information System (INIS)

    Parker, H.W.; Fedler, C.B.; Heintz, C.E.; Nash, P.T.; Carr, D.L.; Lu, M.

    1992-01-01

    Raw cotton has considerable potential for selective removal of spilled oil and oil products from surface waters, since the natural waxes on the raw cotton make it preferentially oil wet. This potential was recognized in the early seventies at Texas Tech University. More recently other research workers have considered cotton as an adsorbent for spilled oil. The adsorbent market is now dominated by synthetic materials, such as air-blown polypropylene fiber, inorganic clays, and recycled paper and paper products. This paper further examines the potential of cotton in relation to these other adsorbents. Emphasis is placed on the potential for complete biodegradation of oil-soaked cotton adsorbents as a means avoiding the expense for incineration and/or the long-term environmental risk associated with placing the used adsorbents in landfills

  13. on microbial populations in the cotton rhizosphere

    African Journals Online (AJOL)

    Swilla

    2016-05-25

    May 25, 2016 ... The binding of Bt toxin onto soil ... Monsanto Company to produce the Cry2Ab2 insect control protein, which provides effective .... analysis of variance (ANOVA) and principal components analysis. (PCA). For ANOVA, the data ...

  14. Evaluation for the retention of reproductive structures by Bt and non ...

    African Journals Online (AJOL)

    The retention of the reproductive structures (bolls) was evaluated at 90,120 and 160 days of maturity in eight Bt and non-Bt hybrids from three Private R&D establishments on three dates of sowings (90,120 and 160 days of maturity) and two spacings of 67.5 x 60 cm and 100 x 30 cm. Ankur group Bt hybrids; 651, 2226 and ...

  15. Superamphiphobic cotton fabrics with enhanced stability

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Bi, E-mail: xubi@dhu.edu.cn [National Engineering Research Center for Dyeing and Finishing of Textiles, Donghua University, Shanghai 201620 (China); Key Laboratory of Science & Technology of Eco-Textile, Ministry of Education, Donghua University, Shanghai 201620 (China); College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Ding, Yinyan; Qu, Shaobo [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Cai, Zaisheng, E-mail: zshcai@dhu.edu [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China)

    2015-11-30

    Highlights: • Superamphiphobic cotton fabrics were prepared. • Water and hexadecane contact angels reach to 164.4° and 156.3°, respectively. • Nanoporous organically modified silica alcogel particles were synthesized. • The superamphiphobic cotton fabrics exhibit enhanced stability against abrasion, laundering and acid. - Abstract: Superamphiphobic cotton fabrics were prepared by alternately depositing organically modified silica alcogel (ormosil) particles onto chitosan precoated cotton fabrics and subsequent 1H, 1H, 2H, 2H-perfluorooctyltrimethoxysilane (PFOTMS) modification. Transmission electron microscopy and scanning electron microscopy images reveal that the ormosil particles display a fluffy, sponge-like nanoporous structure, and the entire cotton fiber surface is covered with highly porous networks. PFOTMS acts as not only a modifier to lower the surface energy of the cotton fabric but also a binder to enhance the coating stability against abrasion and washing. The treated cotton fabrics show highly liquid repellency with the water, cooking oil and hexadecane contact angels reaching to 164.4°, 160.1° and 156.3°, respectively. Meanwhile, the treated cotton fabrics exhibit good abrasion resistance and high laundering durability, which can withstand 10,000 cycles of abrasion and 30 cycles of machine wash without apparently changing the superamphiphobicity. The superamphiphobic cotton fabric also shows high acid stability, and can withstand 98% H{sub 2}SO{sub 4}. Moreover, the superamphiphobic coating has almost no influence on the other physical properties of the cotton fabrics including tensile strength, whiteness and air permeability. This durable non-wetting surface may provide a wide range of new applications in the future.

  16. 7 CFR 27.21 - Preparation of samples of cotton.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this section...

  17. Minimization of operational impacts on spectrophotometer color measurements for cotton

    Science.gov (United States)

    A key cotton quality and processing property that is gaining increasing importance is the color of the cotton. Cotton fiber in the U.S. is classified for color using the Uster® High Volume Instrument (HVI), using the parameters Rd and +b. Rd and +b are specific to cotton fiber and are not typical ...

  18. Increasing cotton stand establishment in soils prone to soil crusting

    Science.gov (United States)

    Many factors can contribute to poor cotton stand establishment, and cotton is notorious for its weak seedling vigor. Soil crusting can be a major factor hindering cotton seedling emergence in many of the cotton production regions of the US and the world. Crusting is mainly an issue in silty soils ...

  19. (Pleurotus pulmonarius) grown on cotton waste and cassava peel

    African Journals Online (AJOL)

    This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

  20. Two-step B/T (burning and/or transmutation) method for self-completed nuclear fuel cycle with thermal and fast B/T reactors

    International Nuclear Information System (INIS)

    Kitamoto, A.; Mulyanto, M.R.; Marsodi, M.R.

    1995-01-01

    The total cost minimization for P and T (partitioning and transmutation) treatment with appropriate recycle period through out-core optimization was examined in order to find the possibility of P and T treatment of minor actinides (MA) and/or long lived fission products (LLFP) and the technology to be improved and/or developed in self-completed nuclear fuel cycle. The P and T should be done for B/T (burning and/or transmutation) treatment based on three criteria, and the grouping was closely related to the effectiveness of Two-Step B/T Method in B/T treatment. (authors)

  1. Expression of hybrid fusion protein (Cry1Ac::ASAL) in transgenic rice plants imparts resistance against multiple insect pests.

    Science.gov (United States)

    Boddupally, Dayakar; Tamirisa, Srinath; Gundra, Sivakrishna Rao; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2018-05-31

    To evolve rice varieties resistant to different groups of insect pests a fusion gene, comprising DI and DII domains of Bt Cry1Ac and carbohydrate binding domain of garlic lectin (ASAL), was constructed. Transgenic rice lines were generated and evaluated to assess the efficacy of Cry1Ac::ASAL fusion protein against three major pests, viz., yellow stem borer (YSB), leaf folder (LF) and brown planthopper (BPH). Molecular analyses of transgenic plants revealed stable integration and expression of the fusion gene. In planta insect bioassays on transgenics disclosed enhanced levels of resistance compared to the control plants. High insect mortality of YSB, LF and BPH was observed on transgenics compared to that of control plants. Furthermore, honeydew assays revealed significant decreases in the feeding ability of BPH on transgenic plants as compared to the controls. Ligand blot analysis, using BPH insects fed on cry1Ac::asal transgenic rice plants, revealed a modified receptor protein-binding pattern owing to its ability to bind to additional receptors in insects. The overall results authenticate that Cry1Ac::ASAL protein is endowed with remarkable entomotoxic effects against major lepidopteran and hemipteran insects. As such, the fusion gene appears promising and can be introduced into various other crops to control multiple insect pests.

  2. Transgenics, agroindustry and food sovereignty

    Directory of Open Access Journals (Sweden)

    Xavier Alejandro León Vega

    2014-10-01

    Full Text Available Food sovereignty has been implemented constitutionally in Ecuador; however, many of the actions and policies are designed to benefit the dominant model of food production, based in agroindustry, intensive monocultures, agrochemicals and transgenics. This article reflects upon the role of family farming as a generator of food sovereignty, and secondly the threat to them by agroindustry agriculture based in transgenic. The role played by food aid in the introduction of transgenic in Latin America and other regions of the world is also analyzed.

  3. Separation and recycling of cotton from cotton/PET blends by depolymerization of PET catalyzed by bases and ionic liquids

    NARCIS (Netherlands)

    Bouwhuis, G.H. (Gerrit); Brinks, G.J. (Ger); Groeneveld, R.A.J. (Richard); Oelerich, J. (Jens)

    2014-01-01

    The recycling of post consumer cotton textile waste is highly requested, due to the high environmental impact of cotton production. Often cotton is mixed in blends with polyethylene terephthalate (PET). For the generation of high value products from recycled cotton, it essential that PET is

  4. Weed flora, yield losses and weed control in cotton crop

    OpenAIRE

    Jabran, Khawar

    2016-01-01

    Cotton (Gossypium spp.) is the most important fiber crop of world and provides fiber, oil, and animals meals. Weeds interfere with the growth activities of cotton plants and compete with it for resources. All kinds of weeds (grasses, sedges, and broadleaves) have been noted to infest cotton crop. Weeds can cause more than 30% decrease in cotton productivity. Several methods are available for weed control in cotton. Cultural control carries significance for weed control up to a certain extent....

  5. Energy usage for cotton ginning in Australia

    Energy Technology Data Exchange (ETDEWEB)

    Ismail, S.A. [MARA Univ. of Technology, Shah Alam (Malaysia). Faculty of Applied Sciences; Southern Queensland Univ., Toowoomba, QLD (Australia). National Centre for Engineering in Agriculture; Chen, G.; Baillie, C.; Symes, T. [Southern Queensland Univ., Toowoomba, QLD (Australia). National Centre for Engineering in Agriculture

    2010-07-01

    This paper reported on a study that evaluated the energy consumption of cotton gins used in Australia. The average electricity use is 52.3 kWh per bale. In practicality, the electricity consumption for different gins is correlated linearly with the bale numbers produced. The cost of electricity is therefore important in cotton ginning operations. The power factor in all the gins monitored in this study was greater than 0.85. The study showed that the use of gas dryers was highly influenced by the cotton moisture and regulated drying temperature. In general, electricity and gas consumption comprised 61 and 39 per cent of total energy use respectively. The study showed that 60.38 kg of carbon dioxide are emitted for ginning each bale of cotton. This paper described a newly developed method for monitoring the energy performance in cotton gins. Detailed monitoring and analysis carried out at 2 gin sites revealed that electricity consumption is not influenced much by changes in trash content in the module, degree of moisture and lint quality. However, the cotton variety influences the energy consumption. Cotton handling constituted nearly 50 per cent of the power used in both gins.

  6. A brachytherapy photon radiation quality index Q(BT) for probe-type dosimetry.

    Science.gov (United States)

    Quast, Ulrich; Kaulich, Theodor W; Álvarez-Romero, José T; Carlsson Tedgren, Sa; Enger, Shirin A; Medich, David C; Mourtada, Firas; Perez-Calatayud, Jose; Rivard, Mark J; Zakaria, G Abu

    2016-06-01

    In photon brachytherapy (BT), experimental dosimetry is needed to verify treatment plans if planning algorithms neglect varying attenuation, absorption or scattering conditions. The detector's response is energy dependent, including the detector material to water dose ratio and the intrinsic mechanisms. The local mean photon energy E¯(r) must be known or another equivalent energy quality parameter used. We propose the brachytherapy photon radiation quality indexQ(BT)(E¯), to characterize the photon radiation quality in view of measurements of distributions of the absorbed dose to water, Dw, around BT sources. While the external photon beam radiotherapy (EBRT) radiation quality index Q(EBRT)(E¯)=TPR10(20)(E¯) is not applicable to BT, the authors have applied a novel energy dependent parameter, called brachytherapy photon radiation quality index, defined as Q(BT)(E¯)=Dprim(r=2cm,θ0=90°)/Dprim(r0=1cm,θ0=90°), utilizing precise primary absorbed dose data, Dprim, from source reference databases, without additional MC-calculations. For BT photon sources used clinically, Q(BT)(E¯) enables to determine the effective mean linear attenuation coefficient μ¯(E) and thus the effective energy of the primary photons Eprim(eff)(r0,θ0) at the TG-43 reference position Pref(r0=1cm,θ0=90°), being close to the mean total photon energy E¯tot(r0,θ0). If one has calibrated detectors, published E¯tot(r) and the BT radiation quality correction factor [Formula: see text] for different BT radiation qualities Q and Q0, the detector's response can be determined and Dw(r,θ) measured in the vicinity of BT photon sources. This novel brachytherapy photon radiation quality indexQ(BT) characterizes sufficiently accurate and precise the primary photon's penetration probability and scattering potential. Copyright © 2016. Published by Elsevier Ltd.

  7. Assessing Potential Impact of Bt Eggplants on Non-Target Arthropods in the Philippines

    Science.gov (United States)

    Navasero, Mario V.; Candano, Randolph N.; Hautea, Desiree M.; Hautea, Randy A.; Shotkoski, Frank A.; Shelton, Anthony M.

    2016-01-01

    Studies on potential adverse effects of genetically engineered crops are part of an environmental risk assessment that is required prior to the commercial release of these crops. Of particular concern are non-target organisms (NTOs) that provide important ecosystem services. Here, we report on studies conducted in the Philippines over three cropping seasons with Bt eggplants expressing Cry1Ac for control of the eggplant fruit and shoot borer (EFSB), Leucinodes orbonalis, to examine potential effects on field abundance, community composition, structure and biodiversity of NTO’s, particularly non-target arthropod (NTA) communities. We document that many arthropod taxa are associated with Bt eggplants and their non-Bt comparators and that the number of taxa and their densities varied within season and across trials. However, we found few significant differences in seasonal mean densities of arthropod taxa between Bt and non-Bt eggplants. As expected, a lower abundance of lepidopteran pests was detected in Bt eggplants. Higher abundance of a few non-target herbivores was detected in non-Bt eggplants as were a few non-target beneficials that might control them. Principal Response Curve (PRC) analyses showed no statistically significant impact of Bt eggplants on overall arthropod communities through time in any season. Furthermore, we found no significant adverse impacts of Bt eggplants on species abundance, diversity and community dynamics, particularly for beneficial NTAs. These results support our previous studies documenting that Bt eggplants can effectively and selectively control the main pest of eggplant in Asia, the EFSB. The present study adds that it can do so without adverse effects on NTAs. Thus, Bt eggplants can be a foundational component for controlling EFSB in an Integrated Pest Management (IPM) program and dramatically reduce dependence on conventional insecticides. PMID:27798662

  8. Examining cotton in rotation with rice and cotton in rotation with other crops using natural experiment

    Science.gov (United States)

    Sun, Ling; Zhu, Zesheng

    2017-08-01

    This paper is to show the ability of remote sensing image analysis combined with statistical analysis to characterize the environmental risk assessment of cotton in rotation with rice and cotton in rotation with other crops in two ways: (1) description of rotation period of cotton in rotation with rice and cotton in rotation with other crops by the observational study or natural experiment; (2) analysis of rotation period calculation of cotton in rotation with rice and cotton in rotation with other crops. Natural experimental results show that this new method is very promising for determining crop rotation period for estimating regional averages of environmental risk. When it is applied to determining crop rotation period, two requested remote sensing images of regional crop are required at least.

  9. Transgene teknikker erstatter problematisk avl

    DEFF Research Database (Denmark)

    Alstrup, Aage Kristian Olsen; Hansen, Axel Kornerup

    2016-01-01

    Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder.......Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder....

  10. Effects of Bacillus thuringiensis CRY1A(c) δ-endotoxin on growth ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... The recent introduction of Bt maize and Bt cotton transgenic crops ... interfere with the host plant growth, nodulation and productivity in clay soil. ... productivity but are also essential for maintenance of ... size) and chemical (soil pH, % total Nitrogen, % organic carbon, ... per, iron, zinc and sodium) analyses.

  11. U.S. Cotton Prices and the World Cotton Market: Forecasting and Structural Change

    OpenAIRE

    Isengildina-Massa, Olga; MacDonald, Stephen

    2009-01-01

    The purpose of this study was to analyze structural changes that took place in the cotton industry in recent years and develop a statistical model that reflects the current drivers of U.S. cotton prices. Legislative changes authorized the U.S. Department of Agriculture to resume publishing cotton price forecasts for the first time in 79 years. In addition, systematic problems have become apparent in the forecasting models used by USDA and elsewhere, highlighting the need for an updated review...

  12. Identification of a New Cotton Disease Caused by an Atypical Cotton Leafroll Dwarf Virus in Argentina.

    Science.gov (United States)

    Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J

    2017-03-01

    An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.

  13. Delta's Key to the TOEFL iBT[R]: Advanced Skill Practice. Revised Edition

    Science.gov (United States)

    Gallagher, Nancy

    2012-01-01

    Delta's Key to the TOEFL iBT: Advanced Skill Practice is a revised and updated edition of Delta's Key to the Next Generation TOEFL Test. Since the introduction of the TOEFL iBT in 2005, there have been significant changes to some of the test questions, particularly the integrated writing and integrated speaking tasks. The new 2011 edition of…

  14. Interpreting the Relationships between TOEFL iBT Scores and GPA: Language Proficiency, Policy, and Profiles

    Science.gov (United States)

    Ginther, April; Yan, Xun

    2018-01-01

    This study examines the predictive validity of the TOEFL iBT with respect to academic achievement as measured by the first-year grade point average (GPA) of Chinese students at Purdue University, a large, public, Research I institution in Indiana, USA. Correlations between GPA, TOEFL iBT total and subsection scores were examined on 1990 mainland…

  15. The Management of Insect Pests in Australian Cotton: An Evolving Story.

    Science.gov (United States)

    Wilson, Lewis J; Whitehouse, Mary E A; Herron, Grant A

    2018-01-07

    The Australian cotton industry progressively embraced integrated pest management (IPM) to alleviate escalating insecticide resistance issues. A systems IPM approach was used with core principles that were built around pest ecology/biology and insecticide resistance management; together, these were integrated into a flexible, year-round approach that facilitated easy incorporation of new science, strategies, and pests. The approach emphasized both strategic and tactical elements to reduce pest abundance and rationalize decisions about pest control, with insecticides as a last resort. Industry involvement in developing the approach was vital to embedding IPM within the farming system. Adoption of IPM was facilitated by the introduction of Bt cotton, availability of selective insecticides, economic validation, and an industry-wide extension campaign. Surveys indicate IPM is now embedded in industry, confirming the effectiveness of an industry-led, backed-by-science approach. The amount of insecticide active ingredient applied per hectare against pests has also declined dramatically. Though challenges remain, pest management has transitioned from reactively attempting to eradicate pests from fields to proactively managing them year-round, considering the farm within the wider landscape.

  16. The Role of Transgenic Crops in the Future of Global Food and Feed

    OpenAIRE

    O. Škubna; H. Řezbová

    2012-01-01

    The paper is aimed on the problematic of biotech crops planting (GM, transgenic crops). The main aim of this paper is to analyze the trends in the main biotech crops planting groups in the sense of their use for food and feed in the future. The selected groups of biotech crops analyzed in this article are soybeans, maize (corn), cotton and rapeseed (canola). The used methods are chain and basic indexes and regression analysis of times series/ trend data - for predicting on next four years (20...

  17. Mutagenesis in naturally coloured cotton

    International Nuclear Information System (INIS)

    Khatod, J.P.; Meshram, L.D.; Jain, P.P.

    2000-01-01

    The seeds of naturally coloured cotton were treated with 15 kR, 20 kR doses of gamma rays and 0.5% Ethyl Methane Sulphonate (EMS) and their combinations. The M 1 and M 2 generations were studied for mutagenic effectiveness and efficiency in inducing the useful mutants, spectrum of mutation and their effects on bract characters. Results obtained revealed that 15 kR and 20 kR doses were more effective in inducing the mutations. In G. hirsutum, significant differences were found for bract size and dry weight of bract was noted in 20 kR dose and low in 0.5% EMS in M 1 . In the M 2 generation increased ratio of bract surface area to lint weight per boll was noted in 20 kR + 0.5% EMS. (author)

  18. Producing Organic Cotton: A Toolkit - Crop Guide, Projekt guide, Extension tools

    OpenAIRE

    Eyhorn, Frank

    2005-01-01

    The CD compiles the following extension tools on organic cotton: Organic Cotton Crop Guide, Organic Cotton Training Manual, Soil Fertility Training Manual, Organic Cotton Project Guide, Record keeping tools, Video "Organic agriculture in the Nimar region", Photos for illustration.

  19. Contesting Corporate Transgenic Crops in a Semi Peripheral Context: The Case of the Anti-GM movement in India

    Directory of Open Access Journals (Sweden)

    Devparna Roy

    2015-08-01

    Full Text Available Market penetration by the hegemonic core state's agricultural biotechnology firms has been preceded and accompanied by a vigorous anti-genetically modified seeds (anti-GM movement in semi-peripheral India. To understand the extent of anti-imperialism and anti-capitalism exhibited by the Indian state, it is useful to investigate the character of democratizing forces-such as the anti-GM movement-which interact with and shape the state. I use primary and secondary data sources to analyze the anti-GM movement in India and argue that the movement is anti-corporate without being anti-capitalist. Further, it is counter-hegemonic but not anti-systemic. These four traits reflect the strengths and weaknesses of exemplary coalition-building between right-wing nationalists, centrists, and left activists. The Indian anti-GM movement suffered an early failure when the Indian state commercialized Bt cotton seeds in 2002, following the entry of unauthorized Bt cotton seeds and lobbying by farmers' groups for legalization of Bt cotton seeds. However, an effective coalition between the right-wing, centrist, and left elements was built by about 2006. This was followed by a most significant victory for the anti-GM movement in February 2010, when the Indian state placed an indefinite moratorium on the commercialization of Bt brinjal seeds. A second, more qualified, victory was achieved by the anti-GM movement when the Indian state placed a hold on field trials of GM crops in July 2014. The anti-GM coalition has been successful in pressing ideologically different political parties to take steps against the multinational seed firms based in core states. Further, it has enabled the Indian state to move from a sub-imperialist to an anti-imperialist role regarding GM seeds. But until the anti-GM coalition in India resolves its inner contradictions and becomes resolutely anti-capitalist and anti-systemic, it will not be able to effectively challenge the anti

  20. Cotton Transportation and Logistics: A Dynamic System

    OpenAIRE

    Robinson, John R.; Park, John L.; Fuller, Stephen

    2007-01-01

    The paper reviews the evolution of U.S. cotton transportation and logistics patterns over the last three decades. There have been many forces of change over this time period, with the largest change being a shift from primarily domestic market destinations to the international market. We describe the pre-1999 system and flow patterns when domestic consumption of U.S. cotton was dominant. We contrast this with current flow patterns as measured by available secondary export data and a sample of...

  1. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Hong Zhang Teng-Long Guo Qing-Lian Wang · More Details Abstract Fulltext PDF. Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton.

  2. The water footprint of cotton consumption: An assessment of the impact of worldwide consumption of cotton products on the water resources in the cotton producing countries

    NARCIS (Netherlands)

    Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.; Gautam, R.

    2006-01-01

    The consumption of a cotton product is connected to a chain of impacts on the water resources in the countries where cotton is grown and processed. The aim of this paper is to assess the ‘water footprint’ of worldwide cotton consumption, identifying both the location and the character of the

  3. STIFFNESS MODIFICATION OF COTTON IN CHITOSAN TREATMENT

    Directory of Open Access Journals (Sweden)

    CAMPOS Juan

    2017-05-01

    Full Text Available Chitosan is a biopolymer obtained from chitin, and among their most important aspects highlights its applications in a lot of industrial sectors due to its intrinsic properties, especially in the textile sector. In the last years, chitosan is widely used in the cotton and wool finishing processes due to its bond between them and its properties as an antifungical and antimicrobial properties. In this paper three different molecular weight chitosan are used in the finishing process of cotton to evaluate its influence in the surface properties modification. In order to evaluate the effect of the treatment with chitosan, flexural stiffness test is performed in warp and weft direction, and then the total value is calculated. The cotton fabric is treated with 5 g/L of different types of chitosan in an impregnation bath. This study shows the extent of surface properties modification of the cotton provided by three types of chitosan treatment. The results show that all types of chitosan modify the cotton flexural rigidity properties but the one which modifies it in a relevant manner is chitosan originated from shrimps. Chitosan, textile, flexural stiffnes, chitin, cotton.

  4. Suppression of cotton leaf curl disease symptoms in Gossypium hirsutum through over expression of host-encoded miRNAs.

    Science.gov (United States)

    Akmal, Mohd; Baig, Mirza S; Khan, Jawaid A

    2017-12-10

    Cotton leaf curl disease (CLCuD), a major factor resulting in the enormous yield losses in cotton crop, is caused by a distinct monopartite begomovirus in association with Cotton leaf curl Multan betasatellite (CLCuMB). Micro(mi)RNAs are known to regulate gene expression in eukaryotes, including antiviral defense in plants. In a previous study, we had computationally identified a set of cotton miRNAs, which were shown to have potential targets in the genomes of Cotton leaf curl Multan virus (CLCuMuV) and CLCuMB at multiple loci. In the current study, effect of Gossypium arboreum-encoded miRNAs on the genome of CLCuMuV and CLCuMB was investigated in planta. Two computationally predicted cotton-encoded miRNAs (miR398 and miR2950) that showed potential to bind multiple Open Reading Frames (ORFs; C1, C4, V1, and non- coding intergenic region) of CLCuMuV, and (βC1) of CLCuMB were selected. Functional validation of miR398 and miR2950 was done by overexpression approach in G. hirsutum var. HS6. A total of ten in vitro cotton plants were generated from independent events and subjected to biological and molecular analyses. Presence of the respective Precursor (pre)-miRNA was confirmed through PCR and Southern blotting, and their expression level was assessed by semi quantitative RT-PCR, Real Time quantitative PCR and northern hybridization in the PCR-positive lines. Southern hybridization revealed 2-4 copy integration of T-DNA in the genome of the transformed lines. Remarkably, expression of pre-miRNAs was shown up to 5.8-fold higher in the transgenic (T 0 ) lines as revealed by Real Time PCR. The virus resistance was monitored following inoculation of the transgenic cotton lines with viruliferous whitefly (Bemisia tabaci) insect vector. After inoculation, four of the transgenic lines remained apparently symptom free. While a very low titre of viral DNA could be detected by Rolling circle amplification, betasatellite responsible for symptom induction could not be detected

  5. Susceptibility and aversion of Spodoptera frugiperda to Cry1F Bt maize and considerations for insect resistance management

    Science.gov (United States)

    Bacillus thuringiensis (Bt) maize was developed primarily for North American pests such as European corn borer (Ostrinia nubilalis Hubner). However, most Bt maize products also are cultivated outside of North America, where the primary pests are different and often have lower susceptibility to Bt to...

  6. A high-throughput liquid bead array-based screening technology for Bt presence in GMO manipulation.

    Science.gov (United States)

    Fu, Wei; Wang, Huiyu; Wang, Chenguang; Mei, Lin; Lin, Xiangmei; Han, Xueqing; Zhu, Shuifang

    2016-03-15

    The number of species and planting areas of genetically modified organisms (GMOs) has been rapidly developed during the past ten years. For the purpose of GMO inspection, quarantine and manipulation, we have now devised a high-throughput Bt-based GMOs screening method based on the liquid bead array. This novel method is based on the direct competitive recognition between biotinylated antibodies and beads-coupled antigens, searching for Bt presence in samples if it contains Bt Cry1 Aa, Bt Cry1 Ab, Bt Cry1 Ac, Bt Cry1 Ah, Bt Cry1 B, Bt Cry1 C, Bt Cry1 F, Bt Cry2 A, Bt Cry3 or Bt Cry9 C. Our method has a wide GMO species coverage so that more than 90% of the whole commercialized GMO species can be identified throughout the world. Under our optimization, specificity, sensitivity, repeatability and availability validation, the method shows a high specificity and 10-50 ng/mL sensitivity of quantification. We then assessed more than 1800 samples in the field and food market to prove capacity of our method in performing a high throughput screening work for GMO manipulation. Our method offers an applicant platform for further inspection and research on GMO plants. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Development and validation of SUCROS-Cotton : A potential crop growth simulation model for cotton

    NARCIS (Netherlands)

    Zhang, L.; Werf, van der W.; Cao, W.; Li, B.; Pan, X.; Spiertz, J.H.J.

    2008-01-01

    A model for the development, growth and potential production of cotton (SUCROS-Cotton) was developed. Particular attention was given to the phenological development of the plant and the plasticity of fruit growth in response to temperature, radiation, daylength, variety traits, and management. The

  8. 75 FR 50847 - Cotton Program Changes for Upland Cotton, Adjusted World Price, and Active Shipping Orders

    Science.gov (United States)

    2010-08-18

    ... Cotton Program Changes for Upland Cotton, Adjusted World Price, and Active Shipping Orders AGENCY... Assistance Program (EAAP) and clarifying the definition of ``active shipping order.'' DATES: Effective Date... address that matter this rule amends in the payment calculation for semi-processed and reginned motes in 7...

  9. 76 FR 32067 - Common Crop Insurance Regulations; Extra Long Staple Cotton Crop Provisions

    Science.gov (United States)

    2011-06-03

    ... ``Any AUP cotton'' and replacing it with the phrase ``Mature AUP cotton'' to clarify the AUP cotton must be mature in order to calculate a conversion factor between AUP cotton and ELS cotton. List of... dividing Price A by 85 percent of Price B. * * * * * (f) Mature AUP cotton harvested or appraised from...

  10. HVI Colorimeter and Color Spectrophotometer Relationships and Their Impacts on Developing "Traceable" Cotton Color Standards

    Science.gov (United States)

    Color measurements of cotton fiber and cotton textile products are important quality parameters. The Uster® High Volume Instrument (HVI) is an instrument used globally to classify cotton quality, including cotton color. Cotton color by HVI is based on two cotton-specific color parameters—Rd (diffuse...

  11. Influence of transgenic rice expressing a fused Cry1Ab/1Ac protein on frogs in paddy fields.

    Science.gov (United States)

    Wang, Jia-Mei; Chen, Xiu-Ping; Liang, Yu-Yong; Zhu, Hao-Jun; Ding, Jia-Tong; Peng, Yu-Fa

    2014-11-01

    As genetic engineering in plants is increasingly used to control agricultural pests, it is important to determine whether such transgenic plants adversely affect non-target organisms within and around cultivated fields. The cry1Ab/1Ac fusion gene from Bacillus thuringiensis (Bt) has insecticidal activity and has been introduced into rice line Minghui 63 (MH63). We evaluated the effect of transgenic cry1Ab/1Ac rice (Huahui 1, HH1) on paddy frogs by comparing HH1 and MH63 rice paddies with and without pesticide treatment. The density of tadpoles in rice fields was surveyed at regular intervals, and Cry1Ab/1Ac protein levels were determined in tissues of tadpoles and froglets collected from the paddy fields. In addition, Rana nigromaculata froglets were raised in purse nets placed within these experimental plots. The survival, body weight, feeding habits, and histological characteristics of the digestive tract of these froglets were analyzed. We found that the tadpole density was significantly decreased immediately after pesticide application, and the weight of R. nigromaculata froglets of pesticide groups was significantly reduced compared with no pesticide treatment, but we found no differences between Bt and non-Bt rice groups. Moreover, no Cry1Ab/1Ac protein was detected in tissue samples collected from 192 tadpoles and froglets representing all four experimental groups. In addition, R. nigromaculata froglets raised in purse seines fed primarily on stem borer and non-target insects, and showed no obvious abnormality in the microstructure of their digestive tracts. Based on these results, we conclude that cultivation of transgenic cry1Ab/1Ac rice does not adversely affect paddy frogs.

  12. Managing fall armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae), with Bt maize and insecticides in southern Brazil.

    Science.gov (United States)

    Burtet, Leonardo M; Bernardi, Oderlei; Melo, Adriano A; Pes, Maiquel P; Strahl, Thiago T; Guedes, Jerson Vc

    2017-12-01

    Maize plants expressing insecticidal proteins of Bacillus thuringiensis are valuable options for managing fall armyworm (FAW), Spodoptera frugiperda, in Brazil. However, control failures were reported, and therefore insecticides have been used to control this species. Based on these, we evaluated the use of Bt maize and its integration with insecticides against FAW in southern Brazil. Early-planted Agrisure TL, Herculex, Optimum Intrasect and non-Bt maize plants were severely damaged by FAW and required up to three insecticidal sprays. In contrast, YieldGard VT Pro, YieldGard VT Pro 3, PowerCore, Agrisure Viptera and Agrisure Viptera 3 showed little damage and did not require insecticides. Late-planted Bt maize plants showed significant damage by FAW and required up to four sprays, with the exceptions of Agrisure Viptera and Agrisure Viptera 3. Exalt (first and second sprays); Lannate + Premio (first spray) and Avatar (second spray); and Karate + Match (first spray) and Ampligo (second spray) were the most effective insecticides against FAW larvae in Bt and non-Bt maize. Maize plants expressing Cry proteins exhibited FAW control failures in southern Brazil, necessitating insecticidal sprays. In contrast, Bt maize containing the Vip3Aa20 protein remained effective against FAW. However, regardless of the insecticide used against FAW surviving on Bt maize, grain yields were similar. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  13. Multi Stakeholders' Attitudes toward Bt rice in Southwest, Iran: Application of TPB and Multi Attribute Models.

    Science.gov (United States)

    Ghoochani, Omid M; Ghanian, Mansour; Baradaran, Masoud; Azadi, Hossein

    2017-03-01

    Organisms that have been genetically engineered and modified (GM) are referred to as genetically modified organisms (GMOs). Bt crops are plants that have been genetically modified to produce certain proteins from the soil bacteria Bacillus thuringiensis (Bt), which makes these plants resistant to certain lepidopteran and coleopteran species. Genetically Modified (GM) rice was produced in 2006 by Iranian researchers from Tarom Mowla'ii and has since been called 'Bt rice'. As rice is an important source of food for over 3 billion inhabitants on Earth, this study aims to use a correlational survey in order to shed light on the predicting factors relating to the extent of stakeholders' behavioral intentions towards Bt rice. It is assumed and the results confirm that "attitudes toward GM crops" can be used as a bridge in the Attitude Model and the Behavioral Intention Model in order to establish an integrated model. To this end, a case study was made of the Southwest part of Iran in order to verify this research model. This study also revealed that as a part of the integrated research framework in the Behavior Intention Model both constructs of attitude and the subjective norm of the respondents serve as the predicting factors of stakeholders' intentions of working with Bt rice. In addition, the Attitude Model, as the other part of the integrated research framework, showed that the stakeholders' attitudes toward Bt rice can only be determined by the perceived benefits (e.g. positive outcomes) of Bt rice.

  14. New Coll–HA/BT composite materials for hard tissue engineering

    Energy Technology Data Exchange (ETDEWEB)

    Zanfir, Andrei Vlad [Department of Science and Engineering of Oxide Materials and Nanomaterials, Faculty of Applied Chemistry and Material Science, “Politehnica” University of Bucharest, 1-7 Gh. Polizu Street, RO-011061 Bucharest (Romania); Voicu, Georgeta, E-mail: getav2001@yahoo.co.uk [Department of Science and Engineering of Oxide Materials and Nanomaterials, Faculty of Applied Chemistry and Material Science, “Politehnica” University of Bucharest, 1-7 Gh. Polizu Street, RO-011061 Bucharest (Romania); Busuioc, Cristina; Jinga, Sorin Ion [Department of Science and Engineering of Oxide Materials and Nanomaterials, Faculty of Applied Chemistry and Material Science, “Politehnica” University of Bucharest, 1-7 Gh. Polizu Street, RO-011061 Bucharest (Romania); Albu, Madalina Georgiana [Department of Collagen, Branch of Leather and Footwear Research, National Institute of Research and Development for Textile and Leather, 93 I. Minulescu Street, RO-031215 Bucharest (Romania); Iordache, Florin [Department of Fetal and Adult Stem Cell Therapy, “Nicolae Simionescu” Institute of Cellular Biology and Pathology of Romanian Academy, 8 B.P. Hasdeu Street, RO-050568 Bucharest (Romania)

    2016-05-01

    The integration of ceramic powders in composite materials for bone scaffolds can improve the osseointegration process. This work was aimed to the synthesis and characterization of new collagen–hydroxyapatite/barium titanate (Coll–HA/BT) composite materials starting from barium titanate (BT) nanopowder, hydroxyapatite (HA) nanopowder and collagen (Coll) gel. BT nanopowder was produced by combining two wet-chemical approaches, sol–gel and hydrothermal methods. The resulting materials were characterized in terms of phase composition and microstructure by X-ray diffraction, Raman spectroscopy, scanning electron microscopy and transmission electron microscopy. Moreover, the biocompatibility and bioactivity of the composite materials were assessed by in vitro tests. The synthesized BT particles exhibit an average size of around 35 nm and a spherical morphology, with a pseudo-cubic or tetragonal symmetry. The diffraction spectra of Coll–HA and Coll–HA/BT composite materials indicate a pronounced interaction between Col and the mineral phases, meaning a good mineralization of Col fibres. As well, the in vitro tests highlight excellent osteoinductive properties for all biological samples, especially for Coll–HA/BT composite materials, fact that can be attributed to the ferromagnetic properties of BT. - Highlights: • Collagen–hydroxyapatite/barium titanate composite materials were synthesized. • Barium titanate was produced by combining the sol–gel and hydrothermal methods. • The in vitro tests highlight excellent osteoinductive properties for all samples.

  15. New Coll–HA/BT composite materials for hard tissue engineering

    International Nuclear Information System (INIS)

    Zanfir, Andrei Vlad; Voicu, Georgeta; Busuioc, Cristina; Jinga, Sorin Ion; Albu, Madalina Georgiana; Iordache, Florin

    2016-01-01

    The integration of ceramic powders in composite materials for bone scaffolds can improve the osseointegration process. This work was aimed to the synthesis and characterization of new collagen–hydroxyapatite/barium titanate (Coll–HA/BT) composite materials starting from barium titanate (BT) nanopowder, hydroxyapatite (HA) nanopowder and collagen (Coll) gel. BT nanopowder was produced by combining two wet-chemical approaches, sol–gel and hydrothermal methods. The resulting materials were characterized in terms of phase composition and microstructure by X-ray diffraction, Raman spectroscopy, scanning electron microscopy and transmission electron microscopy. Moreover, the biocompatibility and bioactivity of the composite materials were assessed by in vitro tests. The synthesized BT particles exhibit an average size of around 35 nm and a spherical morphology, with a pseudo-cubic or tetragonal symmetry. The diffraction spectra of Coll–HA and Coll–HA/BT composite materials indicate a pronounced interaction between Col and the mineral phases, meaning a good mineralization of Col fibres. As well, the in vitro tests highlight excellent osteoinductive properties for all biological samples, especially for Coll–HA/BT composite materials, fact that can be attributed to the ferromagnetic properties of BT. - Highlights: • Collagen–hydroxyapatite/barium titanate composite materials were synthesized. • Barium titanate was produced by combining the sol–gel and hydrothermal methods. • The in vitro tests highlight excellent osteoinductive properties for all samples.

  16. Aquatic degradation of Cry1Ab protein and decomposition dynamics of transgenic corn leaves under controlled conditions.

    Science.gov (United States)

    Böttger, Rita; Schaller, Jörg; Lintow, Sven; Gert Dudel, E

    2015-03-01

    The increasing cultivation of genetically modified corn plants (Zea mays) during the last decades is suggested as a potential risk to the environment. One of these genetically modified variety expressed the insecticidal Cry1Ab protein originating from Bacillus thuringiensis (Bt), resulting in resistance against Ostrinia nubilalis, the European corn borer. Transgenic litter material is extensively studied regarding the decomposition in soils. However, only a few field studies analyzed the fate of the Cry1Ab protein and the impact of green and senescent leaf litter from corn on the decomposition rate and related ecosystem functions in aquatic environments. Consequently, a microbial litter decomposition experiment was conducted under controlled semi-natural conditions in batch culture using two maize varieties: one variety with Cry1Ab and another one with the appertaining Iso-line as control treatment. The results showed no significant differences between the treatment with Cry1Ab and the Iso-line regarding loss of total mass in dry weight of 43% for Iso-line and 45% for Bt-corn litter, lignin content increased to 137.5% (Iso-line) and 115.7% (Bt-corn), and phenol loss decreased by 53.6% (Iso-line), 62.2% (Bt-corn) during three weeks of the experiment. At the end of the experiment Cry1Ab protein was still detected with 6% of the initial concentration. A slightly but significant lower cellulose content was found for the Cry1Ab treatment compared to the Iso-line litter at the end of the experiment. The significant higher total protein (25%) and nitrogen (25%) content in Bt corn, most likely due to the additionally expression of the transgenic protein, may increase the microbial cellulose degradation and decrease microbial lignin degradation. In conclusion a relevant year by year input of protein and therefore nitrogen rich Bt corn litter into aquatic environments may affect the balanced nutrient turnover in aquatic ecosystems. Copyright © 2014 Elsevier Inc. All rights

  17. Performance of novel vs traditional insecticides for the control of amrascs biguttula biguttula (homoptera, cicadellidae) on cotton

    International Nuclear Information System (INIS)

    Karar, H.; Babar, T.K.; Shahzad, F.; Saleem, M.; Ali, A.; Akram, M.

    2013-01-01

    Amrasca biguttula biguttula (ishida) can reduce the yield of cotton approximately 25%. no potential predators have been recorded in the field for its control. to overcome this pest insecticides play significant role in the improvement of crop yields all over the world during the last four to five decades. to save the crop from this notorious pest, ten formulations of insecticides viz., acephate 75sp (acephate) at the rate 625g, imidacloprid 25wp (imidacloprid) at the rate188g, thiamethaxim 25wg (actara) at the rate 60g, imidacloprid 70wg (confidor) at the rate 43g, dimethoat e 40ec (sanitox) at the rate 1000 ml, nytonpyron 10sl (pyramid) at the rate 500ml, lambdacyhlothrin 2.5e (kango) at the rate 825 ml, thiachloprid 480sc (talent) at the rate 63 ml, imidacloprid 25sl (confidor) at the rate 500ml, and diafenthiuron 500sc (polo), at the rate 500ml, per hectare were sprayed in the field having maximum population of nymphs and adults of jassid at cotton research station, multan on cotton variety bt-886 in the month of july, 2011 and 2012. the maximum mortality of Jassid was observed in those treatments, where acephate was applied with 79, 72, 65 mortality, nytonpyron with 69, 63, 55 and imidacloprid 68, 63, 57 percent mortality after 24, 72 and 168 h of spray. minimum mortality of jassid was observed in the treatments where talent was applied having 25, 17 and 16 percent mortality 24, 72 and 168 h after spray. By the application of acephate, pyramid and confidor 25sl on cotton crop the yield can be increased. (author)

  18. How To Produce and Characterize Transgenic Plants.

    Science.gov (United States)

    Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

    2002-01-01

    Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

  19. Complex Outcomes from Insect and Weed Control with Transgenic Plants: Ecological Surprises?

    Directory of Open Access Journals (Sweden)

    Thomas Bøhn

    2017-09-01

    Full Text Available Agriculture is fundamental for human survival through food production and is performed in ecosystems that, while simplified, still operate along ecological principles and retain complexity. Agricultural plants are thus part of ecological systems, and interact in complex ways with the surrounding terrestrial, soil, and aquatic habitats. We discuss three case studies that demonstrate how agricultural solutions to pest and weed control, if they overlook important ecological and evolutionary factors, cause “surprises”: (i the fast emergence of resistance against the crop-inserted Bt-toxin in South Africa, (ii the ecological changes generated by Bt-cotton landscapes in China, and (iii the decline of the monarch butterfly, Danaus plexippus, in North America. The recognition that we work with complex systems is in itself important, as it should limit the belief in reductionist solutions. Agricultural practices lacking eco-evolutionary understanding result in “surprises” like resistance evolution both in weeds and pest insects, risking the reappearance of the “pesticide treadmill”—with increased use of toxic pesticides as the follow-up. We recommend prioritization of research that counteracts the tendencies of reductionist approaches. These may be beneficial on a short term, but with trade-off costs on a medium- to long-term. Such costs include loss of biodiversity, ecosystem services, long-term soil productivity, pollution, and reduced food quality.

  20. Straight talk with...BT Slingsby. Interviewed by Cassandra Willyard.

    Science.gov (United States)

    Slingsby, B T

    2013-12-01

    Japan boasts the second-largest pharmaceutical industry in the world. With its rich background in medical research, the country has turned its attention to diseases of the developing world with this year's launch of the Global Health Innovative Technology (GHIT) Fund--a new public-private partnership between five Japanese pharmaceutical companies, two government ministries and the Bill & Melinda Gates Foundation. In November, the Tokyo-based fund announced its first round of awards totaling $5.7 million. The six grants will go to partnerships aimed at developing new drugs and vaccines to fight malaria, tuberculosis and Chagas disease, a neglected disease endemic to Latin America. Leading the new $120 million, five-year initiative is BT Slingsby, a US-born scholar of the Japanese healthcare industry who most recently served as director of global partner solutions at Eisai, a Tokyo-based drugmaker. On a recent trip to New York, Slingsby, who serves as GHIT's executive director and CEO, met with Cassandra Willyard to discuss the new fund and how Japan can help drive development of medicines and vaccines for diseases of the developing world.

  1. The chemical recycle of cotton

    Directory of Open Access Journals (Sweden)

    Alice Beyer Schuch

    2016-08-01

    Full Text Available The chemical recycle of cotton textiles and/or other cellulosic materials for the purpose of manufacturing regenerated high quality textiles fibres is a novel process. The objective of related research is based on the forecast of population growth, on resource scarcity predictions, and on the negative environmental impact of the textile industry. These facts lead the need of broadening the scope for long-term textile-to-textile recycle - as the mechanical recycle of natural fibres serve for limited number of cycles, still depends on input of virgin material, and offer a reduced-in-quality output. Critical analysis of scientific papers, relevant related reports, and personal interviews were the base of this study, which shows viable results in laboratorial scale of using low-quality cellulosic materials as input for the development of high-quality regenerated textile fibres though ecological chemical process. Nevertheless, to scale up and implement this innovative recycle method, other peripheral structures are requested, such as recover schemes or appropriate sort, for instance. Further researches should also be considered in regards to colours and impurities.

  2. PREDICTING DEMAND FOR COTTON YARNS

    Directory of Open Access Journals (Sweden)

    SALAS-MOLINA Francisco

    2017-05-01

    Full Text Available Predicting demand for fashion products is crucial for textile manufacturers. In an attempt to both avoid out-of-stocks and minimize holding costs, different forecasting techniques are used by production managers. Both linear and non-linear time-series analysis techniques are suitable options for forecasting purposes. However, demand for fashion products presents a number of particular characteristics such as short life-cycles, short selling seasons, high impulse purchasing, high volatility, low predictability, tremendous product variety and a high number of stock-keeping-units. In this paper, we focus on predicting demand for cotton yarns using a non-linear forecasting technique that has been fruitfully used in many areas, namely, random forests. To this end, we first identify a number of explanatory variables to be used as a key input to forecasting using random forests. We consider explanatory variables usually labeled either as causal variables, when some correlation is expected between them and the forecasted variable, or as time-series features, when extracted from time-related attributes such as seasonality. Next, we evaluate the predictive power of each variable by means of out-of-sample accuracy measurement. We experiment on a real data set from a textile company in Spain. The numerical results show that simple time-series features present more predictive ability than other more sophisticated explanatory variables.

  3. Effects of feeding Bt MON810 maize to pigs for 110 days on peripheral immune response and digestive fate of the cry1Ab gene and truncated Bt toxin.

    Directory of Open Access Journals (Sweden)

    Maria C Walsh

    Full Text Available BACKGROUND: The objective of this study was to evaluate potential long-term (110 days and age-specific effects of feeding genetically modified Bt maize on peripheral immune response in pigs and to determine the digestive fate of the cry1Ab gene and truncated Bt toxin. METHODOLOGY/PRINCIPAL FINDINGS: Forty day old pigs (n = 40 were fed one of the following treatments: 1 isogenic maize-based diet for 110 days (isogenic; 2 Bt maize-based diet (MON810 for 110 days (Bt; 3 Isogenic maize-based diet for 30 days followed by Bt maize-based diet for 80 days (isogenic/Bt; and 4 Bt maize-based diet (MON810 for 30 days followed by isogenic maize-based diet for 80 days (Bt/isogenic. Blood samples were collected during the study for haematological analysis, measurement of cytokine and Cry1Ab-specific antibody production, immune cell phenotyping and cry1Ab gene and truncated Bt toxin detection. Pigs were sacrificed on day 110 and digesta and organ samples were taken for detection of the cry1Ab gene and the truncated Bt toxin. On day 100, lymphocyte counts were higher (P<0.05 in pigs fed Bt/isogenic than pigs fed Bt or isogenic. Erythrocyte counts on day 100 were lower in pigs fed Bt or isogenic/Bt than pigs fed Bt/isogenic (P<0.05. Neither the truncated Bt toxin nor the cry1Ab gene were detected in the organs or blood of pigs fed Bt maize. The cry1Ab gene was detected in stomach digesta and at low frequency in the ileum but not in the distal gastrointestinal tract (GIT, while the Bt toxin fragments were detected at all sites in the GIT. CONCLUSIONS/SIGNIFICANCE: Perturbations in peripheral immune response were thought not to be age-specific and were not indicative of Th 2 type allergenic or Th 1 type inflammatory responses. There was no evidence of cry1Ab gene or Bt toxin translocation to organs or blood following long-term feeding.

  4. Progress on researches of transgenic alfalfa

    International Nuclear Information System (INIS)

    Guo Huiqin; Wang Mi; Ren Weibo; Xu Zhu; Chen Libo

    2010-01-01

    In this paper, the progress on the researches of transgenic alfalfa in the past two decades had been reviewed in the aspects of regeneration system, transformation, improvement of the important traits and so on. Moreover, such problems as variation of transgene expression and safety of transgenic plant had also been discussed and propose had been given for the future research work. (authors)

  5. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  6. Direct transcriptional activation of BT genes by NLP transcription factors is a key component of the nitrate response in Arabidopsis.

    Science.gov (United States)

    Sato, Takeo; Maekawa, Shugo; Konishi, Mineko; Yoshioka, Nozomi; Sasaki, Yuki; Maeda, Haruna; Ishida, Tetsuya; Kato, Yuki; Yamaguchi, Junji; Yanagisawa, Shuichi

    2017-01-29

    Nitrate modulates growth and development, functioning as a nutrient signal in plants. Although many changes in physiological processes in response to nitrate have been well characterized as nitrate responses, the molecular mechanisms underlying the nitrate response are not yet fully understood. Here, we show that NLP transcription factors, which are key regulators of the nitrate response, directly activate the nitrate-inducible expression of BT1 and BT2 encoding putative scaffold proteins with a plant-specific domain structure in Arabidopsis. Interestingly, the 35S promoter-driven expression of BT2 partially rescued growth inhibition caused by reductions in NLP activity in Arabidopsis. Furthermore, simultaneous disruption of BT1 and BT2 affected nitrate-dependent lateral root development. These results suggest that direct activation of BT1 and BT2 by NLP transcriptional activators is a key component of the molecular mechanism underlying the nitrate response in Arabidopsis. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Effects of Bacillus thuringiensis (Bt) corn on soil Folsomia fimetaria, Folsomia candida (Collembola), Hypoaspis aculeifer (Acarina) and Enchytraeus crypticus (Oligochaeta)

    DEFF Research Database (Denmark)

    Ke, X.; Krogh, P. H.

    The effects of the Cry1Ab toxin from Bacillus thuringiensis (corn variety Cascade Bt MON810 and DeKalb variety 618 Bt) were studied on survival and reproduction of the soil collembolan Folsomia fimetaria, Folsomia candida, the collembolan predator mite Hypoaspis aculeifer and enchytraeids....... There was a weak significant reduction by 30% on the reproduction of F. fimetaria fed Bt corn in Petri dishes for 21 days. Likewise there was a weak significant reduction by 40% of the reproduction of H. aculeifer by Bt corn in amounts corresponding to 20 g plant material kg-1 soil in the two species soil......-litter microcosm systems. There were no effects of Bt corn materials on the reproduction of F. fimetaria and E. crypticus in the single species soil-litter microcosms. No effects of Bt corn materials on mortality of all the 4 species were observed in all treatments. The tendency of effects of the Bt corn...

  8. Use of transgenic seeds in Brazilian agriculture and concentration of agricultural production to large agribusinesses.

    Science.gov (United States)

    Marinho, C D; Martins, F J O; Amaral Júnior, A T; Gonçalves, L S A; Amaral, S C S; de Mello, M P

    2012-07-19

    We identified the commercial releases of genetically modified organisms (GMOs) in Brazil, their characteristics, the types of genetic transformation used, and the companies responsible for the development of these GMOs, classifying them into two categories: private companies, subdivided into multinational and national, and public institutions. The data came from the data bank of the national registration of cultivars and the service of national protection of cultivars of the Ministry of Agriculture, Fishing and Supply (MAPA). This survey was carried out from 1998 to February 12, 2011. Until this date, 27 GMOs had been approved, including five for soybean, 15 for maize and seven for cotton cultivars. These GMOs have been used for the development of 766 cultivars, of which, 305 are soybean, 445 are maize, and 13 are cotton cultivars. The Monsato Company controls 73.2% of the transgenic cultivars certified by the MAPA; a partnership between Dow AgroSciences and DuPont accounts for 21.4%, and Syngenta controls 4.96%. Seed supply by these companies is almost a monopoly supported by law, giving no choice for producers and leading to the fast replacement of conventional cultivars by transgenic cultivars, which are expensive and exclude small producers from the market, since seeds cannot be kept for later use. This situation concentrates production in the hands of a few large national agribusiness entrepreneurs.

  9. High-efficiency Agrobacterium-mediated transformation of chickpea (Cicer arietinum L.) and regeneration of insect-resistant transgenic plants.

    Science.gov (United States)

    Mehrotra, Meenakshi; Sanyal, Indraneel; Amla, D V

    2011-09-01

    To develop an efficient genetic transformation system of chickpea (Cicer arietinum L.), callus derived from mature embryonic axes of variety P-362 was transformed with Agrobacterium tumefaciens strain LBA4404 harboring p35SGUS-INT plasmid containing the uidA gene encoding β-glucuronidase (GUS) and the nptII gene for kanamycin selection. Various factors affecting transformation efficiency were optimized; as Agrobacterium suspension at OD(600) 0.3 with 48 h of co-cultivation period at 20°C was found optimal for transforming 10-day-old MEA-derived callus. Inclusion of 200 μM acetosyringone, sonication for 4 s with vacuum infiltration for 6 min improved the number of GUS foci per responding explant from 1.0 to 38.6, as determined by histochemical GUS assay. For introducing the insect-resistant trait into chickpea, binary vector pRD400-cry1Ac was also transformed under optimized conditions and 18 T(0) transgenic plants were generated, representing 3.6% transformation frequency. T(0) transgenic plants reflected Mendelian inheritance pattern of transgene segregation in T(1) progeny. PCR, RT-PCR, and Southern hybridization analysis of T(0) and T(1) transgenic plants confirmed stable integration of transgenes into the chickpea genome. The expression level of Bt-Cry protein in T(0) and T(1) transgenic chickpea plants was achieved maximum up to 116 ng mg(-1) of soluble protein, which efficiently causes 100% mortality to second instar larvae of Helicoverpa armigera as analyzed by an insect mortality bioassay. Our results demonstrate an efficient and rapid transformation system of chickpea for producing non-chimeric transgenic plants with high frequency. These findings will certainly accelerate the development of chickpea plants with novel traits.

  10. Evidence of field-evolved resistance of Spodoptera frugiperda to Bt corn expressing Cry1F in Brazil that is still sensitive to modified Bt toxins.

    Science.gov (United States)

    Monnerat, Rose; Martins, Erica; Macedo, Cristina; Queiroz, Paulo; Praça, Lilian; Soares, Carlos Marcelo; Moreira, Helio; Grisi, Isabella; Silva, Joseane; Soberon, Mario; Bravo, Alejandra

    2015-01-01

    Brazil ranked second only to the United States in hectares planted to genetically modified crops in 2013. Recently corn producers in the Cerrado region reported that the control of Spodoptera frugiperda with Bt corn expressing Cry1Fa has decreased, forcing them to use chemicals to reduce the damage caused by this insect pest. A colony of S. frugiperda was established from individuals collected in 2013 from Cry1Fa corn plants (SfBt) in Brazil and shown to have at least more than ten-fold higher resistance levels compared with a susceptible colony (Sflab). Laboratory assays on corn leaves showed that in contrast to SfLab population, the SfBt larvae were able to survive by feeding on Cry1Fa corn leaves. The SfBt population was maintained without selection for eight generations and shown to maintain high levels of resistance to Cry1Fa toxin. SfBt showed higher cross-resistance to Cry1Aa than to Cry1Ab or Cry1Ac toxins. As previously reported, Cry1A toxins competed the binding of Cry1Fa to brush border membrane vesicles (BBMV) from SfLab insects, explaining cross-resistance to Cry1A toxins. In contrast Cry2A toxins did not compete Cry1Fa binding to SfLab-BBMV and no cross-resistance to Cry2A was observed, although Cry2A toxins show low toxicity to S. frugiperda. Bioassays with Cry1AbMod and Cry1AcMod show that they are highly active against both the SfLab and the SfBt populations. The bioassay data reported here show that insects collected from Cry1Fa corn in the Cerrado region were resistant to Cry1Fa suggesting that resistance contributed to field failures of Cry1Fa corn to control S. frugiperda.

  11. Test Takers' Writing Activities during the "TOEFL iBT"® Writing Tasks: A Stimulated Recall Study. "TOEFL iBT"® Research Report. TOEFL iBT-25. ETS Research Report No. RR-15-04

    Science.gov (United States)

    Barkaoui, Khaled

    2015-01-01

    This study aimed to describe the writing activities that test takers engage in when responding to the writing tasks in the "TOEFL iBT"[superscript R] test and to examine the effects of task type and test-taker English language proficiency (ELP) and keyboarding skills on the frequency and distribution of these activities. Each of 22 test…

  12. Stakeholders' Beliefs about the "TOEFL iBT"® Test as a Measure of Academic Language Ability. "TOEFL iBT"® Research Report. TOEFL iBT-22. ETS Research Report. RR-14-42

    Science.gov (United States)

    Malone, Margaret E.; Montee, Megan

    2014-01-01

    The "TOEFL iBT"® test presents test takers with tasks meant to simulate the tasks required of students in English-medium universities. Research establishing the validity argument for the test provides evidence for score interpretation and the use of the test for university admissions and placement. Now that the test has been operational…

  13. The Effects of Different Levels of Performance Feedback on "TOEFL iBT"® Reading Practice Test Performance. TOEFL iBT Research Report. TOEFL iBT-29. ETS Research Report. RR-17-31

    Science.gov (United States)

    Sawaki, Yasuyo

    2017-01-01

    The purpose of the present study is to examine whether performance on the "TOEFL iBT"® Reading practice test is affected by 3 different levels of feedback provided to learners upon completion of reading exercises: (a) correctness of learner response (the knowledge of correct results [KCR] feedback), (b) KCR feedback and rationales for…

  14. Fiber sample presentation system for spectrophotometer cotton fiber color measurements

    Science.gov (United States)

    The Uster® High Volume Instrument (HVI) is used to class U.S. cotton for fiber color, yielding the industry accepted, cotton-specific color parameters Rd and +b. The HVI examines a 9 square inch fiber sample, and it is also used to test large AMS standard cotton “biscuits” or rectangles. Much inte...

  15. At-line cotton color measurements by portable color spectrophotometers

    Science.gov (United States)

    As a result of reports of cotton bales that had significant color changes from their initial Uster® High Volume Instrument (HVI™) color measurements, a program was implemented to measure cotton fiber color (Rd, +b) at-line in remote locations (warehouse, mill, etc.). The measurement of cotton fiber...

  16. IMPROVED SPECTROPHOTOMETER FIBER SAMPLING SYSTEM FOR COTTON FIBER COLOR MEASUREMENTS

    Science.gov (United States)

    Cotton in the U.S. is classified for color using the Uster® High Volume Instrument (HVI), and the parameters Rd and +b are used to designate color grades for cotton fiber. However, Rd and +b are cotton-specific color parameters, and the need existed to demonstrate the relationships of Rd and +b to...

  17. 78 FR 68983 - Cotton Futures Classification: Optional Classification Procedure

    Science.gov (United States)

    2013-11-18

    ...-AD33 Cotton Futures Classification: Optional Classification Procedure AGENCY: Agricultural Marketing... regulations to allow for the addition of an optional cotton futures classification procedure--identified and... response to requests from the U.S. cotton industry and ICE, AMS will offer a futures classification option...

  18. Insecticide use and practices among cotton farmers in northern ...

    African Journals Online (AJOL)

    Cotton (Gossypium hirsutum L.) is an important cash crop in Uganda. Insecticide application practices among cotton growers in northern Uganda were examined to determine the pests targeted and the compliance of control measures with the standards recommended by the Uganda's Cotton Development Organization ...

  19. MicroRNA expression profiling during upland cotton gland forming ...

    African Journals Online (AJOL)

    Jane

    2011-08-15

    Aug 15, 2011 ... 2Key Laboratory of Cotton Genetic Improvement, Cotton Research Institute of the Chinese Academy of Agricultural. Sciences, Ministry of ... terpenoid aldehyde biosynthesis pathway, genetic engineering and molecular breeding of cotton. ... toxic to non-ruminant animals and humans, which means that large ...

  20. THE ELASTICITY OF EXPORT DEMAND FOR US COTTON

    OpenAIRE

    Paudel, Laxmi; Houston, Jack E.; Adhikari, Murali; Devkota, Nirmala

    2004-01-01

    There exist conflicting views among the researchers about the magnitudes of US cotton export demand elasticity, ranging from the highly inelastic to highly elastic. An Armington model was used to analyze the export demand elasticity of US Cotton. Our analysis confirms an elastic nature of US cotton export demand.

  1. Changes in cotton gin energy consumption apportioned by ten functions

    Science.gov (United States)

    The public is concerned about air quality and sustainability. Cotton producers, gin owners and plant managers are concerned about rising energy prices. Both have an interest in cotton gin energy consumption trends. Changes in cotton gins’ energy consumption over the past fifty years, a period of ...

  2. 7 CFR 27.25 - Additional samples of cotton; drawing.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Additional samples of cotton; drawing. 27.25 Section... Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore prescribed, separate samples, if desired, may be drawn and furnished to the owner of the cotton. ...

  3. 7 CFR 1427.23 - Cotton loan deficiency payments.

    Science.gov (United States)

    2010-01-01

    ..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan... intentions to receive a loan deficiency payment on the identified commodity or (ii) A completed request for a... cotton based on a locked-in adjusted world price, provide identifying numbers for modules or other...

  4. CATEGORIZATION OF EXTRANEOUS MATTER IN COTTON USING MACHINE VISION SYSTEMS

    Science.gov (United States)

    The Cotton Trash Identification System (CTIS) was developed at the Southwestern Cotton Ginning Research Laboratory to identify and categorize extraneous matter in cotton. The CTIS bark/grass categorization was evaluated with USDA-Agricultural Marketing Service (AMS) extraneous matter calls assigned ...

  5. 7 CFR 1427.174 - Maturity of seed cotton loans.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427.174 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION... Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31 following...

  6. farmers' knowledge and perceptions of cotton insect pests and their

    African Journals Online (AJOL)

    Prince Acheampong

    A survey of 337 cotton farmers in the three northern regions of Ghana was ... five applications were made during the season. ... Keywords: cotton, farmer knowledge and perception, insect pest control, Ghana. .... bordered on tests of farmers' knowledge of cotton insect pests, their damage ..... Agricultural Experiment Station.

  7. Zinc comprising coordination compounds as growth stimulants of cotton seeds

    International Nuclear Information System (INIS)

    Yusupov, Z.N.; Nurmatov, T.M.; Rakhimova, M.M.; Dzhafarov, M.I.; Nikolaeva, T.B.

    1991-01-01

    Present article is devoted to zinc comprising coordination compounds as growth stimulants of cotton seeds. The influence of zinc coordination compounds with physiologically active ligands on germinative energy and seed germination of cotton was studied. The biogical activity and effectiveness of zinc comprising coordination compounds at application them for humidification of cotton seeds was studied as well.

  8. 7 CFR 1427.1203 - Eligible ELS cotton.

    Science.gov (United States)

    2010-01-01

    ... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton... must be either: (1) Baled lint, including baled lint classified by USDA's Agricultural Marketing..., under the provisions of this subpart, has been made available; (2) Imported ELS cotton; (3) Raw...

  9. Fourier transform infrared imaging of Cotton trash mixtures

    Science.gov (United States)

    There is much interest in the identification of trash types comingled with cotton lint. A good understanding of the specific trash types present can lead to the fabrication of new equipment which can identify and sort cotton trash found with cotton fiber. Conventional methods, including the High Vo...

  10. Cotton Production in Mali: Subsidies or Sustainable Development?

    Science.gov (United States)

    Moore, Lindsey

    2007-01-01

    Current trade rules concerning cotton subsidies are intricately linked with poverty and hunger in Mali. Over half of Mali's economy and over 30 million people depend directly on cotton. It is the main cash crop and the most important source of export revenue. Cotton also plays a key role in development policies and in the fight against poverty by…

  11. Impact of Bt crops on non-target organisms – 3 systematic reviews

    Science.gov (United States)

    The cultivation of genetically modified (GM) crops producing Cry toxins, originating from the bacterium Bacillus thuringiensis (Bt), has raised environmental concerns over their sustainable use and consequences for biodiversity and ecosystem services in agricultural land. During the last two decades...

  12. Bt crop effects on functional guilds of non-target arthropods: A meta-analysis (journal)

    Science.gov (United States)

    Background: Uncertainty persists over the environmental effects of genetically-engineered crops that produce the insecticidal Cry proteins of Bacillus thuringiensis (Bt). We performed meta-analyses on a modified public database to synthesize current knowledge about the effects of...

  13. The effect of feeding Bt MON810 maize to pigs for 110 days on intestinal microbiota.

    Directory of Open Access Journals (Sweden)

    Stefan G Buzoianu

    Full Text Available OBJECTIVE: To assess the effects of feeding Bt MON810 maize to pigs for 110 days on the intestinal microbiota. METHODOLOGY/PRINCIPAL FINDINGS: Forty male pigs (∼40 days old were blocked by weight and litter ancestry and assigned to one of four treatments; 1 Isogenic maize-based diet for 110 days (Isogenic; 2 Bt maize-based diet (MON810 for 110 days (Bt; 3 Isogenic maize-based diet for 30 days followed by a Bt maize-based diet for 80 days (Isogenic/Bt; 4 Bt maize-based diet for 30 days followed by an isogenic maize-based diet for 80 days (Bt/Isogenic. Enterobacteriaceae, Lactobacillus and total anaerobes were enumerated in the feces using culture-based methods on days 0, 30, 60 and 100 of the study and in ileal and cecal digesta on day 110. No differences were found between treatments for any of these counts at any time point. The relative abundance of cecal bacteria was also determined using high-throughput 16 S rRNA gene sequencing. No differences were observed in any bacterial taxa between treatments, with the exception of the genus Holdemania which was more abundant in the cecum of pigs fed the isogenic/Bt treatment compared to pigs fed the Bt treatment (0.012 vs 0.003%; P≤0.05. CONCLUSIONS/SIGNIFICANCE: Feeding pigs a Bt maize-based diet for 110 days did not affect counts of any of the culturable bacteria enumerated in the feces, ileum or cecum. Neither did it influence the composition of the cecal microbiota, with the exception of a minor increase in the genus Holdemania. As the role of Holdemania in the intestine is still under investigation and no health abnormalities were observed, this change is not likely to be of clinical significance. These results indicate that feeding Bt maize to pigs in the context of its influence on the porcine intestinal microbiota is safe.

  14. Role and time of brachytherapy (BT) in the radiosurgical treatment of early endometrial cancer

    International Nuclear Information System (INIS)

    Poitevin, A; Gerbaulet, A; Rey, A; Albano, M

    1996-01-01

    Introduction: Endometrial carcinoma is the most frequent gynecological cancer in developed countries. Until the latest FIGO classification on 1988, the times of BT and surgery were uncertain for early stages. This paper reviews the results of the retrospective analysis of patients with early endometrial carcinoma (stages I and II) treated with pre- or postoperative BT +/- external radiotherapy (ERT) at the Institute Gustave Roussy from january 1985 to december 1989. Materials and Methods: 220 patients stage I and 21 patients stage II were eligible. The protocol was primary BT (106 patients) 50 Gy to the upper third of the vagina, an immediate radical hysterectomy with pelvic lymph node picking and according to the histological results, ERT (33 patients). After the surgical classification, postop BT was performed in 47 patients. 55 patients received another radiosurgical treatment. Results: With a follow-up of 3 years, the results were: after primary BT, the dose to pelvic walls, the kerma, the volume thickness and the reference isodose volume were higher. Surgery post BT was performed on a mean of 12 days, and postop BT on a mean of 97 days. Among 181 lymph node dissections, only 5 patients had N+, 38 histologies showed no myometrial invasion: 112, (1(3)); 64, (2(2)); and 20, (3(3)). The differentiation of the tumor was indirectly correlated with myometrial invasion. 88 patients received ERT, to a mean dose of 45 Gy. The overall survival was 91% at 2 years and 81% at 5 years. For patients with primary BT, the survival was 96% at 2 and 5 years. For primary surgery was 98 and 88% at 2 and 5 years DFS at 2 and 5 years for preop BT was 85% and 76%, for postop BT 95% and 92%, 5 patients had grade 3 complications. The metastases, including paraaortic lymph nodes were 6. 14 recurrences occurred, in external iliac nodes, common iliacs, pelvis, abdomen, and 4 in vagina. The prognostic factors were in univariate study, the surgical stage. In multivariate, myometrial invasion

  15. Induced mutations for improvement of desi cotton

    International Nuclear Information System (INIS)

    Waghmare, V.N.; Mohan, Punit; Singh, Phundan; Gururajan, K.N.

    2000-01-01

    Desi cotton varieties of Gossypium arboreum have wide adaptability and are relatively tolerant to biotic (insect pests and diseases) and abiotic (moisture and salt) stresses. Desi varieties have got potential to yield even under adverse and low input situations. Most of them are synchronous in maturity and possess consistent fibre properties. Despite such merits, very little attention has been paid for improvement of desi cotton. The present area under arboreum varieties is 17.0% (15.30 lakh ha.) against 65% (35.75 lakh ha) during 1947-48. Deliberate attempts are required to improve G. arboreum for its economic and quality characters to compete with upland varieties in rainfed cotton ecology

  16. Biotechnology network promotes knowledge of transgenics

    International Nuclear Information System (INIS)

    Blanco Picado, Patricia; Valdez Melara, Marta

    2015-01-01

    Red de Ingenieria Genetica Aplicada al Mejoramiento de Cultivos Tropicales (Rigatrop) integrated by a group of scientists from the Universidad de Costa Rica (UCR), Universidad Nacional (UNA) and of the Instituto Tecnologico de Costa Rica (TEC) have organized two forums on the topic of transgenics. The first forum has shown successful experiences of development of transgenic crops in Latin America, as for example: the transgenic bean, project realized in Brazil and transgenic eggplant in Bangladesh. The second forum has been about transgenics and environment effected at the UCR, on the occasion of World Environment Day. Rigatrop members are working currently in two projects applying biotechnological tools to coffee [es

  17. Impact of transgenic cotton expressing cry1Ac and cry2Ab genes on ...

    African Journals Online (AJOL)

    Moreover, the studied culturable bacterial and fungal groups were positively correlated (p>0.001) with soil respiration and microbial biomass, which exhibited uneven trend with the treatments. Generally Soil from 06Z604D showed the slight higher microbial populations and CFU count, whilst HART 89M showed slight lower ...

  18. Impact of transgenic soybean expressing Cry1Ac and Cry1F proteins on the non-target arthropod community associated with soybean in Brazil.

    Science.gov (United States)

    Marques, Luiz H; Santos, Antonio C; Castro, Boris A; Storer, Nicholas P; Babcock, Jonathan M; Lepping, Miles D; Sa, Verissimo; Moscardini, Valéria F; Rule, Dwain M; Fernandes, Odair A

    2018-01-01

    Field-scale studies that examine the potential for adverse effects of Bt crop technology on non-target arthropods may supplement data from laboratory studies to support an environmental risk assessment. A three year field study was conducted in Brazil to evaluate potential for adverse effects of cultivating soybean event DAS-81419-2 that produces the Cry1Ac and Cry1F proteins. To do so, we examined the diversity and abundance of non-target arthropods (NTAs) in Bt soybean in comparison with its non-Bt near isoline, with and without conventional insecticide applications, in three Brazilian soybean producing regions. Non-target arthropod abundance was surveyed using Moericke traps (yellow pan) and pitfall trapping. Total abundance (N), richness (S), Shannon-Wiener (H'), Simpson's (D) and Pielou's evenness (J) values for arthropod samples were calculated for each treatment and sampling period (soybean growth stages). A faunistic analysis was used to select the most representative NTAs which were used to describe the NTA community structure associated with soybean, and to test for effects due to the treatments effects via application of the Principal Response Curve (PRC) method. Across all years and sites, a total of 254,054 individuals from 190 taxa were collected by Moericke traps, while 29,813 individuals from 100 taxa were collected using pitfall traps. Across sites and sampling dates, the abundance and diversity measurements of representative NTAs were not significantly affected by Bt soybean as compared with non-sprayed non-Bt soybean. Similarly, community analyses and repeated measures ANOVA, when applicable, indicated that neither Bt soybean nor insecticide sprays altered the structure of the NTA communities under study. These results support the conclusion that transgenic soybean event DAS-81419-2 producing Cry1Ac and Cry1F toxins does not adversely affect the NTA community associated with soybean.

  19. Biological control of cotton aphid (Aphis gossypii Glover) in cotton (inter)cropping systems in China : a simulation study

    NARCIS (Netherlands)

    Xia, J.

    1997-01-01

    Cotton aphid ( Aphis gossypii Glover) is the key insect pest of seedling cotton ( Gossypium hirsutum L. ) in China, particularly in the North China cotton region. The resulting annual losses amount to 10-15% of the attainable yield. Sole reliance on

  20. Probabilistic, Multivariable Flood Loss Modeling on the Mesoscale with BT-FLEMO.

    Science.gov (United States)

    Kreibich, Heidi; Botto, Anna; Merz, Bruno; Schröter, Kai

    2017-04-01

    Flood loss modeling is an important component for risk analyses and decision support in flood risk management. Commonly, flood loss models describe complex damaging processes by simple, deterministic approaches like depth-damage functions and are associated with large uncertainty. To improve flood loss estimation and to provide quantitative information about the uncertainty associated with loss modeling, a probabilistic, multivariable Bagging decision Tree Flood Loss Estimation MOdel (BT-FLEMO) for residential buildings was developed. The application of BT-FLEMO provides a probability distribution of estimated losses to residential buildings per municipality. BT-FLEMO was applied and validated at the mesoscale in 19 municipalities that were affected during the 2002 flood by the River Mulde in Saxony, Germany. Validation was undertaken on the one hand via a comparison with six deterministic loss models, including both depth-damage functions and multivariable models. On the other hand, the results were compared with official loss data. BT-FLEMO outperforms deterministic, univariable, and multivariable models with regard to model accuracy, although the prediction uncertainty remains high. An important advantage of BT-FLEMO is the quantification of prediction uncertainty. The probability distribution of loss estimates by BT-FLEMO well represents the variation range of loss estimates of the other models in the case study. © 2016 Society for Risk Analysis.

  1. Radiation degradation of short-cotton linters

    International Nuclear Information System (INIS)

    Ma Zue Teh; Zhou Rui Min

    1984-01-01

    Radiation degradation of short-cotton linters has been studied by using X-ray diffraction, an infrared spectrometer and a viscosimeter. Average molecular weight and crystallinity of short-cotton linters and the change of reducing sugar in γ-radiation degradation were examined. It was found that cellulosic saccharification in hydrolysis was enhanced with preirradiation of linter. This probably resulted from the radiation induced change of cellulosic structure. Sensitizers to promote radiation degradation effect were investigated. Carbon tetrachloride has been found to be effective. (author)

  2. Transgenic Epigenetics: Using Transgenic Organisms to Examine Epigenetic Phenomena

    Directory of Open Access Journals (Sweden)

    Lori A. McEachern

    2012-01-01

    Full Text Available Non-model organisms are generally more difficult and/or time consuming to work with than model organisms. In addition, epigenetic analysis of model organisms is facilitated by well-established protocols, and commercially-available reagents and kits that may not be available for, or previously tested on, non-model organisms. Given the evolutionary conservation and widespread nature of many epigenetic mechanisms, a powerful method to analyze epigenetic phenomena from non-model organisms would be to use transgenic model organisms containing an epigenetic region of interest from the non-model. Interestingly, while transgenic Drosophila and mice have provided significant insight into the molecular mechanisms and evolutionary conservation of the epigenetic processes that target epigenetic control regions in other model organisms, this method has so far been under-exploited for non-model organism epigenetic analysis. This paper details several experiments that have examined the epigenetic processes of genomic imprinting and paramutation, by transferring an epigenetic control region from one model organism to another. These cross-species experiments demonstrate that valuable insight into both the molecular mechanisms and evolutionary conservation of epigenetic processes may be obtained via transgenic experiments, which can then be used to guide further investigations and experiments in the species of interest.

  3. Toxicological evaluation of genetically modified cotton (Bollgard) and Dipel WP on the non-target soil mite Scheloribates praeincisus (Acari: Oribatida).

    Science.gov (United States)

    Oliveira, Anibal R; Castro, Thiago R; Capalbo, Deise M F; Delalibera, Italo

    2007-01-01

    Insecticides derived from the bacterium Bacillus thuringiensis (Bt) and plants genetically modified (GM) to express B. thuringiensis toxins are important alternatives for insect pest control worldwide. Risk assessment of B. thuringiensis toxins to non-target organisms has been extensively studied but few toxicological tests have considered soil invertebrates. Oribatid mites are one of the most diverse and abundant arthropod groups in the upper layers of soil and litter in natural and agricultural systems. These mites are exposed to the toxic compounds of GM crops or pesticides mainly when they feed on vegetal products incorporated in the soil. Although some effects of B. thuringiensis products on Acari have been reported, effects on oribatid mites are still unknown. This study investigated the effects of the ingestion of Bt cotton Bollgard and of the B. thuringiensis commercial product Dipel WP on the pantropical species Scheloribates praeincisus (Scheloribatidae). Ingestion of Bollgard and Dipel did not affect adult and immature survivorship and food consumption (estimated by number of fecal pellets produced daily) or developmental time of immature stages of S. praeincisus. These results indicate the safety of Bollgard and Dipel to S. praeincisus under field conditions where exposition is lower and other food sources besides leaves of Bt plants are available. The method for toxicological tests described here can be adapted to other species of Oribatida, consisting on a new option to risk assessment studies.

  4. Loop-Mediated Isothermal Amplification for Detection of Endogenous Sad1 Gene in Cotton: An Internal Control for Rapid Onsite GMO Testing.

    Science.gov (United States)

    Singh, Monika; Bhoge, Rajesh K; Randhawa, Gurinderjit

    2018-04-20

    Background : Confirming the integrity of seed samples in powdered form is important priorto conducting a genetically modified organism (GMO) test. Rapid onsite methods may provide a technological solution to check for genetically modified (GM) events at ports of entry. In India, Bt cotton is the commercialized GM crop with four approved GM events; however, 59 GM events have been approved globally. GMO screening is required to test for authorized GM events. The identity and amplifiability of test samples could be ensured first by employing endogenous genes as an internal control. Objective : A rapid onsite detection method was developed for an endogenous reference gene, stearoyl acyl carrier protein desaturase ( Sad1 ) of cotton, employing visual and real-time loop-mediated isothermal amplification (LAMP). Methods : The assays were performed at a constant temperature of 63°C for 30 min for visual LAMP and 62ºC for 40 min for real-time LAMP. Positive amplification was visualized as a change in color from orange to green on addition of SYBR ® Green or detected as real-time amplification curves. Results : Specificity of LAMP assays was confirmed using a set of 10 samples. LOD for visual LAMP was up to 0.1%, detecting 40 target copies, and for real-time LAMP up to 0.05%, detecting 20 target copies. Conclusions : The developed methods could be utilized to confirm the integrity of seed powder prior to conducting a GMO test for specific GM events of cotton. Highlights : LAMP assays for the endogenous Sad1 gene of cotton have been developed to be used as an internal control for onsite GMO testing in cotton.

  5. Yield and economic performance of organic and conventional cotton-based farming systems--results from a field trial in India.

    Science.gov (United States)

    Forster, Dionys; Andres, Christian; Verma, Rajeev; Zundel, Christine; Messmer, Monika M; Mäder, Paul

    2013-01-01

    The debate on the relative benefits of conventional and organic farming systems has in recent time gained significant interest. So far, global agricultural development has focused on increased productivity rather than on a holistic natural resource management for food security. Thus, developing more sustainable farming practices on a large scale is of utmost importance. However, information concerning the performance of farming systems under organic and conventional management in tropical and subtropical regions is scarce. This study presents agronomic and economic data from the conversion phase (2007-2010) of a farming systems comparison trial on a Vertisol soil in Madhya Pradesh, central India. A cotton-soybean-wheat crop rotation under biodynamic, organic and conventional (with and without Bt cotton) management was investigated. We observed a significant yield gap between organic and conventional farming systems in the 1(st) crop cycle (cycle 1: 2007-2008) for cotton (-29%) and wheat (-27%), whereas in the 2(nd) crop cycle (cycle 2: 2009-2010) cotton and wheat yields were similar in all farming systems due to lower yields in the conventional systems. In contrast, organic soybean (a nitrogen fixing leguminous plant) yields were marginally lower than conventional yields (-1% in cycle 1, -11% in cycle 2). Averaged across all crops, conventional farming systems achieved significantly higher gross margins in cycle 1 (+29%), whereas in cycle 2 gross margins in organic farming systems were significantly higher (+25%) due to lower variable production costs but similar yields. Soybean gross margin was significantly higher in the organic system (+11%) across the four harvest years compared to the conventional systems. Our results suggest that organic soybean production is a viable option for smallholder farmers under the prevailing semi-arid conditions in India. Future research needs to elucidate the long-term productivity and profitability, particularly of cotton and

  6. Yield and economic performance of organic and conventional cotton-based farming systems--results from a field trial in India.

    Directory of Open Access Journals (Sweden)

    Dionys Forster

    Full Text Available The debate on the relative benefits of conventional and organic farming systems has in recent time gained significant interest. So far, global agricultural development has focused on increased productivity rather than on a holistic natural resource management for food security. Thus, developing more sustainable farming practices on a large scale is of utmost importance. However, information concerning the performance of farming systems under organic and conventional management in tropical and subtropical regions is scarce. This study presents agronomic and economic data from the conversion phase (2007-2010 of a farming systems comparison trial on a Vertisol soil in Madhya Pradesh, central India. A cotton-soybean-wheat crop rotation under biodynamic, organic and conventional (with and without Bt cotton management was investigated. We observed a significant yield gap between organic and conventional farming systems in the 1(st crop cycle (cycle 1: 2007-2008 for cotton (-29% and wheat (-27%, whereas in the 2(nd crop cycle (cycle 2: 2009-2010 cotton and wheat yields were similar in all farming systems due to lower yields in the conventional systems. In contrast, organic soybean (a nitrogen fixing leguminous plant yields were marginally lower than conventional yields (-1% in cycle 1, -11% in cycle 2. Averaged across all crops, conventional farming systems achieved significantly higher gross margins in cycle 1 (+29%, whereas in cycle 2 gross margins in organic farming systems were significantly higher (+25% due to lower variable production costs but similar yields. Soybean gross margin was significantly higher in the organic system (+11% across the four harvest years compared to the conventional systems. Our results suggest that organic soybean production is a viable option for smallholder farmers under the prevailing semi-arid conditions in India. Future research needs to elucidate the long-term productivity and profitability, particularly of cotton

  7. Detecting mismatches in the phenology of cotton bollworm larvae and cotton flowering in response to climate change

    Science.gov (United States)

    Huang, Jian; Hao, HongFei

    2018-05-01

    Current evidence suggests that climate change has directly affected the phenology of many invertebrate species associated with agriculture. Such changes in phenology have the potential to cause temporal mismatches between predators and prey and may lead to a disruption in natural pest control ecosystem. Understanding the synchrony between pest insects and host plant responses to climate change is a key step to improve integrated pest management strategies. Cotton bollworm larvae damage cotton, and thus, data from Magaiti County, China, collected during the period of 1990-2015 were analyzed to assess the effects of climate change on cotton bollworm larvae and cotton flowering. The results showed that a warming climate advanced the phenology of cotton bollworm larvae and cotton flowering. However, the phenological rate of change was faster in cotton bollworm larvae than that in cotton flowering, and the larval period was prolonged, resulting in a great increase of the larval population. The abrupt phenological changes in cotton bollworm larvae occurred earlier than that in cotton, and the abrupt phenological changes in cotton flowering occurred earlier than that in larval abundance. However, the timing of abrupt changes in larval abundance all occurred later than that in temperature. Thus, the abrupt changes that occurred in larvae, cotton flowering and climate were asynchronous. The interval days between the cotton flowering date (CFD) and the half-amount larvae date (HLD) expanded by 3.41 and 4.41 days with a 1 °C increase of T mean in May and June, respectively. The asynchrony between cotton bollworm larvae and cotton flowering will likely broaden as the climate changes. The effective temperature in March and April and the end date of larvae (ED) were the primary factors affecting asynchrony.

  8. Detecting mismatches in the phenology of cotton bollworm larvae and cotton flowering in response to climate change.

    Science.gov (United States)

    Huang, Jian; Hao, HongFei

    2018-05-11

    Current evidence suggests that climate change has directly affected the phenology of many invertebrate species associated with agriculture. Such changes in phenology have the potential to cause temporal mismatches between predators and prey and may lead to a disruption in natural pest control ecosystem. Understanding the synchrony between pest insects and host plant responses to climate change is a key step to improve integrated pest management strategies. Cotton bollworm larvae damage cotton, and thus, data from Magaiti County, China, collected during the period of 1990-2015 were analyzed to assess the effects of climate change on cotton bollworm larvae and cotton flowering. The results showed that a warming climate advanced the phenology of cotton bollworm larvae and cotton flowering. However, the phenological rate of change was faster in cotton bollworm larvae than that in cotton flowering, and the larval period was prolonged, resulting in a great increase of the larval population. The abrupt phenological changes in cotton bollworm larvae occurred earlier than that in cotton, and the abrupt phenological changes in cotton flowering occurred earlier than that in larval abundance. However, the timing of abrupt changes in larval abundance all occurred later than that in temperature. Thus, the abrupt changes that occurred in larvae, cotton flowering and climate were asynchronous. The interval days between the cotton flowering date (CFD) and the half-amount larvae date (HLD) expanded by 3.41 and 4.41 days with a 1 °C increase of T mean in May and June, respectively. The asynchrony between cotton bollworm larvae and cotton flowering will likely broaden as the climate changes. The effective temperature in March and April and the end date of larvae (ED) were the primary factors affecting asynchrony.

  9. Variation among conventional cultivars could be used as a criterion for environmental safety assessment of Bt rice on nontarget arthropods

    Science.gov (United States)

    Wang, Fang; Dang, Cong; Chang, Xuefei; Tian, Junce; Lu, Zengbin; Chen, Yang; Ye, Gongyin

    2017-02-01

    The current difficulty facing risk evaluations of Bacillus thuringiensis (Bt) crops on nontarget arthropods (NTAs) is the lack of criteria for determining what represents unacceptable risk. In this study, we investigated the biological parameters in the laboratory and field population abundance of Nilaparvata lugens (Hemiptera: Delphacidae) on two Bt rice lines and the non-Bt parent, together with 14 other conventional rice cultivars. Significant difference were found in nymphal duration and fecundity of N. lugens fed on Bt rice KMD2, as well as field population density on 12 October, compared with non-Bt parent. However, compared with the variation among conventional rice cultivars, the variation of each parameter between Bt rice and the non-Bt parent was much smaller, which can be easily seen from low-high bar graphs and also the coefficient of variation value (C.V). The variation among conventional cultivars is proposed to be used as a criterion for the safety assessment of Bt rice on NTAs, particularly when statistically significant differences in several parameters are found between Bt rice and its non-Bt parent. Coefficient of variation is suggested as a promising parameter for ecological risk judgement of IRGM rice on NTAs.

  10. Bistand til risikovurdering Supplerende oplysninger fra Syngenta Seeds om overvågningsplanen (evt. ændret risikovurdering). Zea mays (Bt11). Supplerende materiale om Bt11

    DEFF Research Database (Denmark)

    Kjellsson, Gøsta; Strandberg, Morten Tune; Damgaard, Christian

    2005-01-01

    "Mail: Den supplerende information om Bt-11 majsen (C/F/96/05-10) der er modtaget d. 02-03-2005, indeholder en ny udgave af den generelle overvågningsplan med enkelte ændringer (forbedringer) i forhold til forrige udgave (kommenteret 24-02-2005). Vi har ikke fundet nogen nye oplysninger der ændre...

  11. Can interactions between Bt proteins be predicted and how should effects on non-target organisms of GM crops with multiple Bt Proteins be assessed?

    NARCIS (Netherlands)

    Schrijver, De A.; Clercq, de P.; Booij, K.; Maagd, de R.A.; Frankenhuyzen, van K.

    2014-01-01

    Genes expressing Bacillus thuringiensis (Bt) toxins have been incorporated into genetically modified (GM) plants to render these resistant to certain insect pests. Of particular interest have been the genes encoding Cry (Crystal) proteins, but also the gene encoding the vegetative insecticidal

  12. Does Content Knowledge Affect TOEFL iBT[TM] Reading Performance? A Confirmatory Approach to Differential Item Functioning. TOEFL iBT Research Report. RR-09-29

    Science.gov (United States)

    Liu, Ou Lydia; Schedl, Mary; Malloy, Jeanne; Kong, Nan

    2009-01-01

    The TOEFL iBT[TM] has increased the length of the reading passages in the reading section compared to the passages on the TOEFL[R] computer-based test (CBT) to better approximate academic reading in North American universities, resulting in a reduced number of passages in the reading test. A concern arising from this change is whether the decrease…

  13. Influence of Tencel/cotton blends on knitted fabric performance

    Directory of Open Access Journals (Sweden)

    Alaa Arafa Badr

    2016-09-01

    Full Text Available The requirements in terms of wearing comfort with sportswear, underwear and outerwear are widely linked to the use of new fibers. Today, Tencel fiber is one of the most important developments in regenerated cellulosic fiber. However, the relation between Tencel fiber properties and fabric characteristics has not been enough studied in the literature especially the influence of fiber materials on mechanical, Ultraviolet Protection Factor (UPF and absorption properties. Therefore, in this study, knitted fabric samples were manufactured with eight different yarns with two fabric types (single jersey and single jersey with Lycra. 30/1-Ne yarns from natural and regenerated cellulosic fibers: 50% Tencel-LF/50% cotton, 67% Tencel-LF/33% cotton, 67% Tencel-STD/33% cotton, 70% bamboo/30% cotton, 100% bamboo, 100% Modal, 100% Micro-Modal and 100% cotton were employed. Then, all the produced fabrics were subjected to five cycles laundering and then flat dried. The results show that 67% Tencel-LF/33% cotton has more flexural rigidity and withdrawing handle force than 67% Tencel-STD/33% cotton fabric, while 67% Tencel-STD/33% cotton has a merit of durability during bursting test. Blending Egyptian cotton fibers with bamboo and Tencel as in 70/30% bamboo/cotton and 50/50% Tencel-LF/cotton improve UPF of the produced fabric.

  14. Gene cloning: exploring cotton functional genomics and genetic improvement

    Institute of Scientific and Technical Information of China (English)

    Diqiu LIU; Xianlong ZHANG

    2008-01-01

    Cotton is the most important natural fiber plant in the world. The genetic improvement of the quality of the cotton fiber and agricultural productivity is imperative under the situation of increasing consumption and rapid development of textile technology. Recently, the study of cotton molecular biology has progressed greatly. A lot of specifically or preferentially expressed cotton fiber genes were cloned and analyzed. On the other hand, identification of stress response genes expressed in cotton was performed by other research groups. The major stress factors were studied including the wilt pathogens Verticillium dahliae, Fusarium oxy-sporum f. sp. vasinfectum, bacterial blight, root-knot nematode, drought, and salt stress. What is more, a few genes related to the biosynthesis of gossypol, other sesquiterpene phytoalexins and the major seed oil fatty acids were isolated from cotton. In the present review, we focused on the major advances in cotton gene cloning and expression profiling in the recent years.

  15. Functional characterization of AGAMOUS-subfamily members from cotton during reproductive development and in response to plant hormones.

    Science.gov (United States)

    de Moura, Stéfanie Menezes; Artico, Sinara; Lima, Cássio; Nardeli, Sarah Muniz; Berbel, Ana; Oliveira-Neto, Osmundo Brilhante; Grossi-de-Sá, Maria Fátima; Ferrándiz, Cristina; Madueño, Francisco; Alves-Ferreira, Márcio

    2017-03-01

    Expression analysis of the AG -subfamily members from G. hirsutum during flower and fruit development. Reproductive development in cotton, including the fruit and fiber formation, is a complex process; it involves the coordinated action of gene expression regulators, and it is highly influenced by plant hormones. Several studies have reported the identification and expression of the transcription factor family MADS-box members in cotton ovules and fibers; however, their roles are still elusive during the reproductive development in cotton. In this study, we evaluated the expression profiles of five MADS-box genes (GhMADS3, GhMADS4, GhMADS5, GhMADS6 and GhMADS7) belonging to the AGAMOUS-subfamily in Gossypium hirsutum. Phylogenetic and protein sequence analyses were performed using diploid (G. arboreum, G. raimondii) and tetraploid (G. barbadense, G. hirsutum) cotton genomes, as well as the AG-subfamily members from Arabidopsis thaliana, Petunia hybrida and Antirrhinum majus. qPCR analysis showed that the AG-subfamily genes had high expression during flower and fruit development in G. hirsutum. In situ hybridization analysis also substantiates the involvement of AG-subfamily members on reproductive tissues of G. hirsutum, including ovule and ovary. The effect of plant hormones on AG-subfamily genes expression was verified in cotton fruits treated with gibberellin, auxin and brassinosteroid. All the genes were significantly regulated in response to auxin, whereas only GhMADS3, GhMADS4 and GhMADS7 genes were also regulated by brassinosteroid treatment. In addition, we have investigated the GhMADS3 and GhMADS4 overexpression effects in Arabidopsis plants. Interestingly, the transgenic plants from both cotton AG-like genes in Arabidopsis significantly altered the fruit size compared to the control plants. This alteration suggests that cotton AG-like genes might act regulating fruit formation. Our results demonstrate that members of the AG-subfamily in G. hirsutum

  16. The Impacts of U.S. Cotton Programs on the West and Central African Countries Cotton Export Earnings

    OpenAIRE

    Fadiga, Mohamadou L.; Mohanty, Samarendu; Pan, Suwen

    2005-01-01

    This study uses a stochastic simulation approach based on a partial equilibrium structural econometric model of the world fiber market to examine the effects of a removal of U.S. cotton programs on the world market. The effects on world cotton prices and African export earnings were analyzed. The results suggest that on average an elimination of U.S. cotton programs would lead to a marginal increase in the world cotton prices thus resulting in minimal gain for cotton exporting countries in Af...

  17. Transgenic Arabidopsis Gene Expression System

    Science.gov (United States)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  18. Effects of rotation of cotton (Gossypium hirsutum L.) and soybean [Glycine max (L.) Merr.] crops on soil fertility in Elizabeth, Mississippi, USA

    OpenAIRE

    H.A., Reddy, K. and Pettigrew, W.T.

    2018-01-01

    The effects of cotton (Gossypium hirsutum L.): soybean [Glycine max (L.) Merr.] rotation on the soil fertility levels are limited. An irrigated soybean: cotton rotation experiment was conducted from 2012 through 2015 near Elizabeth, Mississippi, USA. The crop rotation sequences were included continuous cotton (CCCC), continuous soybean (SSSS), cotton-soybean-cotton-soybean (CSCS), cotton-soybean-soybean-cotton (CSSC), soybean-cotton-cotton-soybean (SCCS), soybean-cotton-soybean-cotton (SCSC)....

  19. Evaluating cotton seed gland initiation by microscopy

    Science.gov (United States)

    Gossypol is a terpenoid aldehyde found in cotton (Gossypium hirsutum L.) glands and helps protect the seed from pests and pathogens. However, gossypol is toxic to many animals, so the seed is used mainly in cattle feed, as ruminants are tolerant to the effects of gossypol. In order to develop strat...

  20. Pilot scale cotton gin trash energy recovery

    Energy Technology Data Exchange (ETDEWEB)

    Harp, S.L. [Oklahoma State Univ., Stillwater, OK (United States)

    1993-12-31

    During the summer of 1992 a 520,000 kcal/h (2,064,400 Btu/hr) biomass combustor was installed at a cotton gin in southwestern Oklahoma. The gin has a capacity of approximately 35 bales per hour. Each bale of cotton ginned weighs about 227 kg (500 lb) and produces about 68 kg (150 lb) of trash. Therefore, this gin produces about 52,360 kg (115,500 lb) of trash per day during a typical ginning season. Approximately 2 million kg (4 million lb) of gin trash are produced at this site each year. Cotton must first be dried to about 3-5% moisture content before the ginning process is begun. To accomplish this at this gin, two six million Btu/hour direct fired gas heaters are used to heat air for drying the cotton. The biomass combustor was installed to operate in parallel with one of the heaters to supply heated air for the drying process. A pneumatic conveying system was installed to intercept a portion of the gin trash and divert it to the burner. The burner was operated during the 1992 ginning season, which lasted from September through November, with few problems.

  1. Satellite-based monitoring of cotton evapotranspiration

    Science.gov (United States)

    Dalezios, Nicolas; Dercas, Nicholas; Tarquis, Ana Maria

    2016-04-01

    Water for agricultural use represents the largest share among all water uses. Vulnerability in agriculture is influenced, among others, by extended periods of water shortage in regions exposed to droughts. Advanced technological approaches and methodologies, including remote sensing, are increasingly incorporated for the assessment of irrigation water requirements. In this paper, remote sensing techniques are integrated for the estimation and monitoring of crop evapotranspiration ETc. The study area is Thessaly central Greece, which is a drought-prone agricultural region. Cotton fields in a small agricultural sub-catchment in Thessaly are used as an experimental site. Daily meteorological data and weekly field data are recorded throughout seven (2004-2010) growing seasons for the computation of reference evapotranspiration ETo, crop coefficient Kc and cotton crop ETc based on conventional data. Satellite data (Landsat TM) for the corresponding period are processed to estimate cotton crop coefficient Kc and cotton crop ETc and delineate its spatiotemporal variability. The methodology is applied for monitoring Kc and ETc during the growing season in the selected sub-catchment. Several error statistics are used showing very good agreement with ground-truth observations.

  2. Airborne multispectral detection of regrowth cotton fields

    Science.gov (United States)

    Regrowth of cotton, Gossypium hirsutum L., can provide boll weevils, Anthonomus grandis Boheman, with an extended opportunity to feed and reproduce beyond the production season. Effective methods for timely areawide detection of these potential host plants are critically needed to achieve eradicati...

  3. Absolute moisture sensing for cotton bales

    Science.gov (United States)

    With the recent prevalence of moisture restoration systems in cotton gins, more and more gins are putting moisture back into the bales immediately before the packaging operation. There are two main reasons for this recent trend, the first is that it has been found that added moisture at the bale pre...

  4. Integrated nutrients management for 'desi' cotton

    International Nuclear Information System (INIS)

    Qazi, M.A.; Akram, M.; Ahmad, N.; Khattak, M.A.

    2007-01-01

    Intensive cropping with no return of crop residues and other organic inputs result in the loss of soil organic matter (SOM) and nutrient supply in (Desi) cotton-wheat cropping system in Pakistan. For appraisal of problem and finding solution to sustainability, we evaluated six treatments comprised of two fertilizer doses and three management techniques over a period of three years (2003-05) monitoring their effects on seed cotton yield and soil fertility. The techniques included chemical fertilizers, municipal solid waste manure (MSWM) integrated with chemical fertilizers in 1:4 ratios with, and without pesticides. The results revealed that cotton yields. Were enhanced by 19% due to site-specific fertilizer dose over conventional dose. Ignoring weeds control by means of herbicided application resulted in 5% decrease of seed cotton yield in IPNM technique positive effect of MSWM integration was noted on soil test phosphorus and SOM. Site-specific fertilizer application and integrated plant nutrient management by MSWM proved their suitability as the techniques not only improve soil quality in terms of sustained levels of organic matter and phosphorus but also provide a safe way of waste disposal. (author)

  5. Cotton genetic resources and crop vulnerability

    Science.gov (United States)

    A report on the genetic vulnerability of cotton was provided to the National Genetic Resources Advisory Council. The report discussed crop vulnerabilities associated with emerging diseases, emerging pests, and a narrowing genetic base. To address these crop vulnerabilities, the report discussed the ...

  6. PESTICIDE CONTAMINATION OF THE DRIDJI COTTON ...

    African Journals Online (AJOL)

    ruud

    pesticide contamination in the Dridji cotton production area poses a risk to public ... the Kiti River as well as bean leaves grown near the river were sampled and ... Sediments were analysed at the Institute of Environmental Studies of the VU .... Empty bottles of pesticides were recycled to buy oil from the market and to bring.

  7. Locally Grown: Examining Attitudes and Perceptions About Organic Cotton Production and Manufacturing Between Mississippi Cotton Growers and Consumers

    Directory of Open Access Journals (Sweden)

    Charles Freeman

    2016-06-01

    Full Text Available The purpose of this study is to examine attitudes and perceptions about organic cotton of Mississippi cotton growers and producers in comparison to fashion-conscious consumers, including advantages/disadvantages of growing and production processes, quality control, consumer preferences, and competitive price structures/profit margins. A sample size of 16 local Mississippi growers and/or producers and 44 undergraduate students at a mid-major Southeastern university were chosen to participate in the study. Instruments were developed based on current research and the definition of organic cotton production defined by the United States Department of Agriculture. Results indicate 75% of growers and producers do not perceive a quality difference between organic and conventionally grown cotton, while 72.7% of the consumers report organically grown cotton is capable of producing a higher quality product compared to conventionally grown cotton. Even with an increase in organic cotton prices (25- 40% higher premium, only 25% of growers and producers would be willing to convert, while a majority (52.3% of consumers would not be willing to spend more than 25% extra for an organically grown cotton product. Consumers indicate the negative effects of conventionally grown cotton, yet many report little knowledge about organic cotton production, while growers/producers immediately dismiss organically grown cotton as a retail marketing strategy.

  8. Resilient modulus of black cotton soil

    Directory of Open Access Journals (Sweden)

    K.H. Mamatha

    2017-03-01

    Full Text Available Resilient modulus (MR values of pavement layers are the basic input parameters for the design of pavements with multiple layers in the current mechanistic empirical pavement design guidelines. As the laboratory determination of resilient modulus is costly, time consuming and cumbersome, several empirical models are developed for the prediction of resilient modulus for different regions of the world based on the database of resilient modulus values of local soils. For use of these relationships there is a need to verify the suitability of these models for local conditions. Expansive clay called black cotton soil (BC soil is found in several parts of India and is characterized by low strength and high compressibility. This soil shows swell – shrink behaviour upon wetting and drying and are problematic. The BC soil shows collapse behaviour on soaking and therefore the strength of the soil needs to be improved. Additive stabilization is found to be very effective in stabilizing black cotton soils and generally lime is used to improve the strength and durability of the black cotton soil. In this paper, the results of repeated load tests on black cotton soil samples for the determination of MR under soaked and unsoaked conditions at a relative compaction levels of 100% and 95% of both standard and modified proctor conditions are reported. The results indicate that the black cotton soil fails to meet the density requirement of the subgrade soil and shows collapse behaviour under soaked condition. To overcome this, lime is added as an additive to improve the strength of black cotton soil and repeated load tests were performed as per AASHTO T 307 - 99 for MR determination. The results have shown that the samples are stable under modified proctor condition with MR values ranging from 36 MPa to 388 MPa for a lime content of 2.5% and curing period ranging from 7 to 28 days. Also, it is observed that, the CBR based resilient modulus is not in agreement

  9. Effects of nematicides on cotton root mycobiota.

    Science.gov (United States)

    Baird, R E; Carling, D E; Watson, C E; Scruggs, M L; Hightower, P

    2004-02-01

    Baseline information on the diversity and population densities of fungi collected from soil debris and cotton (Gossypium hirsutum L.) roots was determined. Samples were collected from Tifton, GA, and Starkville, MS containing cotton field soil treated with the nematicides 1,3-dichloroproprene (fumigant) and aldicarb (granules). A total of 10,550 and 13,450 fungal isolates were collected from these two study sites, respectively. Of this total, 34 genera of plant pathogenic or saprophytic species were identified. Pathogenic root fungi included Fusarium spp. (40% of all isolations), Macrophomina, Pythium, Rhizoctonia, and Sclerotium. Fusarium and Rhizoctonia were the most common fungal species identified and included F. oxysporum, F. verticillioides and F. solani, the three Fusarium species pathogenic on cotton plants. Population densities of Fusarium were not significantly different among locations or tissue types sampled. Macrophomina was isolated at greater numbers near the end of the growing seasons. Anastomosis groups of R. solani isolated from roots and soil debris included AG-3, -4, -7, 2-2, and -13 and anastomosis groups of binucleate Rhizoctonia included CAG-2, -3, and -5. Occurrences and frequency of isolations among sampling dates were not consistent. Fluctuations in the frequency of isolation of Rhizoctonia did not correspond with changes in frequency of isolation of the biological control fungus, Trichoderma. When individual or pooled frequencies of the mycobiota were compared to nematicide treatments, no specific trends occurred between treatments, application methods or rates. Results from this study show that use of 1,3-D and aldicarb in cotton fields does not significantly impact plant pathogenic fungi or saprophytic fungal populations. Thus cotton producers need not adjust seedling disease control measures when these two nematicides are used.

  10. Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection

    Directory of Open Access Journals (Sweden)

    Broder Christopher C

    2009-05-01

    Full Text Available Abstract Background Current small animal models for studying HIV-1 infection are very limited, and this continues to be a major obstacle for studying HIV-1 infection and pathogenesis, as well as for the urgent development and evaluation of effective anti-HIV-1 therapies and vaccines. Previously, it was shown that HIV-1 can infect cotton rats as indicated by development of antibodies against all major proteins of the virus, the detection of viral cDNA in spleen and brain of challenged animals, the transmission of infectious virus, albeit with low efficiency, from animal to animal by blood, and an additional increase in the mortality in the infected groups. Results Using in vitro experiments, we now show that cotton rat cell lines engineered to express human receptor complexes for HIV-1 (hCD4 along with hCXCR4 or hCCR5 support virus entry, viral cDNA integration, and the production of infectious virus. Conclusion These results further suggest that the development of transgenic cotton rats expressing human HIV-1 receptors may prove to be useful small animal model for HIV infection.

  11. Functional characterization of a strong bi-directional constitutive plant promoter isolated from cotton leaf curl Burewala virus.

    Directory of Open Access Journals (Sweden)

    Zainul A Khan

    Full Text Available Cotton leaf curl Burewala virus (CLCuBuV, belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV were fused with β-glucuronidase (GUS and green fluorescent protein (GFP reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells.

  12. Test Review: Test of English as a Foreign Language[TM]--Internet-Based Test (TOEFL iBT[R])

    Science.gov (United States)

    Alderson, J. Charles

    2009-01-01

    In this article, the author reviews the TOEFL iBT which is the latest version of the TOEFL, whose history stretches back to 1961. The TOEFL iBT was introduced in the USA, Canada, France, Germany and Italy in late 2005. Currently the TOEFL test is offered in two testing formats: (1) Internet-based testing (iBT); and (2) paper-based testing (PBT).…

  13. Processing and properties of PCL/cotton linter compounds

    Energy Technology Data Exchange (ETDEWEB)

    Bezerra, Elieber Barros; Franca, Danyelle Campos; Morais, Dayanne Diniz de Souza; Araujo, Edcleide Maria [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Departamento de Engenharia de Materiais; Rosa, Morsyleide de Freitas; Morais, Joao Paulo Saraiva [Embrapa Tropical Agroindustia, Fortaleza, CE (Brazil); Wellen, Renate Maria Ramos, E-mail: wellen.renate@gmail.com [Universidade Federal da Paraiaba (UFPB), Joao Pessoa, PB (Brazil)

    2017-03-15

    Biodegradable compounds of poly(ε-caprolactone) (PCL)/ cotton linter were melting mixed with filling content ranging from 1% to 5% w/w. Cotton linter is an important byproduct of textile industry; in this work it was used in raw state and after acid hydrolysis. According to the results of torque rheometry no decaying of viscosity took place during compounding, evidencing absence of breaking down in molecular weight. The thermal stability increased by 20% as observed in HDT for PCL/cotton nanolinter compounds. Adding cotton linter to PCL did not change its crystalline character as showed by XRD; however an increase in degree of crystallinity was observed by means of DSC. From mechanical tests in tension was observed an increase in ductility of PCL, and from mechanical tests in flexion an increase in elastic modulus upon addition of cotton linter, whereas impact strength presented lower values for PCL/cotton linter and PCL/cotton nanolinter compounds. SEM images showed that PCL presents plastic fracture and cotton linter has an interlacing fibril structure with high L/D ratio, which are in agreement with matrix/fibril morphology observed for PCL/cotton linter compounds. PCL/cotton linter compounds made in this work cost less than neat PCL matrix and presented improved properties making feasible its commercial use. (author)

  14. Cover Crop Biomass Harvest Influences Cotton Nitrogen Utilization and Productivity

    Directory of Open Access Journals (Sweden)

    F. Ducamp

    2012-01-01

    Full Text Available There is a potential in the southeastern US to harvest winter cover crops from cotton (Gossypium hirsutum L. fields for biofuels or animal feed use, but this could impact yields and nitrogen (N fertilizer response. An experiment was established to examine rye (Secale cereale L. residue management (RM and N rates on cotton productivity. Three RM treatments (no winter cover crop (NC, residue removed (REM and residue retained (RET and four N rates for cotton were studied. Cotton population, leaf and plant N concentration, cotton biomass and N uptake at first square, and cotton biomass production between first square and cutout were higher for RET, followed by REM and NC. However, leaf N concentration at early bloom and N concentration in the cotton biomass between first square and cutout were higher for NC, followed by REM and RET. Seed cotton yield response to N interacted with year and RM, but yields were greater with RET followed by REM both years. These results indicate that a rye cover crop can be beneficial for cotton, especially during hot and dry years. Long-term studies would be required to completely understand the effect of rye residue harvest on cotton production under conservation tillage.

  15. Dielectric properties of BNT-xBT prepared by hydrothermal process

    Directory of Open Access Journals (Sweden)

    Natheer B. Mahmood

    2017-06-01

    Full Text Available The BNT ceramic sample might be a good replacement for PZT piezoelectric in industrial applications, especially in energy harvesting from crystal vibrations. In order to enhance the performance of BNT ceramic, the solid solution was chosen by substitution with Ba+2 at Morphtropic Phase Boundary (MPB. The BNT-xBT powders with x=1, 0.07, 0.06 and 0 were prepared by the hydrothermal method with average particle size (65–150nm at (90∘C/72h. The ceramic disc was sintered at (1150∘C/4h and showed excellent relative density of about 96%. The results of X-ray diffraction (XRD confirmed the MPB for x=0.06 and 0.07, while the BNT had a rhombohedral structure and BT had a tetragonal structure. The dielectric measurements showed that BNT, BNT-7BT, BNT-6BT behave as the relaxator ferroelectric and showed a strong dependence on frequency, especially in the MPB region while BT behaves as a normal ferroelectric. Both the Curie temperature and depolarization temperature decrease at the MPB region and showed strong dependency on frequency.

  16. Effects of Transgenic cry1Ca Rice on the Development of Xenopus laevis.

    Directory of Open Access Journals (Sweden)

    Xiuping Chen

    Full Text Available In fields of genetically modified, insect-resistant rice expressing Bacillus thuringiensis (Bt proteins, frogs are exposed to Bt Cry proteins by consuming both target and non-target insects, and through their highly permeable skin. In the present study, we assessed the potential risk posed by transgenic cry1Ca rice (T1C-19 on the development of a frog species by adding purified Cry1Ca protein or T1C-19 rice straw into the rearing water of Xenopus laevis tadpoles, and by feeding X. laevis froglets diets containing rice grains of T1C-19 or its non-transformed counterpart MH63. Our results showed that there were no significant differences among groups receiving 100 μg L-1 or 10 μg L-1 Cry1Ca and the blank control in terms of time to completed metamorphosis, survival rate, body weight, body length, organ weight and liver enzyme activity after being exposed to the Cry1Ca (P > 0.05. Although some detection indices in the rice straw groups were significantly different from those of the blank control group (P < 0.05, there was no significant difference between the T1C-19 and MH63 rice straw groups. Moreover, there were no significant differences in the mortality rate, body weight, daily weight gain, liver and fat body weight of the froglets between the T1C-19 and MH63 dietary groups after 90 days, and there were no abnormal pathological changes in the stomach, intestines, livers, spleens and gonads. Thus, we conclude that the planting of transgenic cry1Ca rice will not adversely affect frog development.

  17. Comparison of nutrition composition of transgenic maize (chitinase gene) with its non-transgenic counterpart

    OpenAIRE

    Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun

    2011-01-01

    In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...

  18. Expression of multiple resistance genes enhances tolerance to environmental stressors in transgenic poplar (Populus × euramericana 'Guariento'.

    Directory of Open Access Journals (Sweden)

    Xiaohua Su

    Full Text Available Commercial and non-commercial plants face a variety of environmental stressors that often cannot be controlled. In this study, transgenic hybrid poplar (Populus × euramericana 'Guariento' harboring five effector genes (vgb, SacB, JERF36, BtCry3A and OC-I were subjected to drought, salinity, waterlogging and insect stressors in greenhouse or laboratory conditions. Field trials were also conducted to investigate long-term effects of transgenic trees on insects and salt tolerance in the transformants. In greenhouse studies, two transgenic lines D5-20 and D5-21 showed improved growth, as evidenced by greater height and basal diameter increments and total biomass relative to the control plants after drought or salt stress treatments. The improved tolerance to drought and salt was primarily attributed to greater instantaneous water use efficiency (WUEi in the transgenic trees. The chlorophyll concentrations tended to be higher in the transgenic lines under drought or saline conditions. Transformed trees in drought conditions accumulated more fructan and proline and had increased Fv/Fm ratios (maximum quantum yield of photosystem II under waterlogging stress. Insect-feeding assays in the laboratory revealed a higher total mortality rate and lower exuviation index of leaf beetle [Plagiodera versicolora (Laicharting] larvae fed with D5-21 leaves, suggesting enhanced insect resistance in the transgenic poplar. In field trials, the dominance of targeted insects on 2-year-old D5-21 transgenic trees was substantially lower than that of the controls, indicating enhanced resistance to Coleoptera. The average height and DBH (diameter at breast height of 2.5-year-old transgenic trees growing in naturally saline soil were 3.80% and 4.12% greater than those of the control trees, but these increases were not significant. These results suggested that multiple stress-resistance properties in important crop tree species could be simultaneously improved, although

  19. Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

    Science.gov (United States)

    Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

  20. 75 FR 70850 - Common Crop Insurance Regulations; Extra Long Staple Cotton Crop Provisions

    Science.gov (United States)

    2010-11-19

    ... dividing Price A by 85 percent of Price B. * * * * * (f) Any AUP cotton harvested or appraised from acreage... dividing the price per pound for AUP cotton by the price per pound for ELS cotton. The prices used for AUP...

  1. 77 FR 51867 - Cotton Board Rules and Regulations: Adjusting Supplemental Assessment on Imports

    Science.gov (United States)

    2012-08-28

    ... Advertising, Agricultural research, Cotton, Marketing agreements, Reporting and recordkeeping requirements... supplemental assessments collected for use by the Cotton Research and Promotion Program. An amendment is..., Chief, Research and Promotion Staff, Cotton and Tobacco Programs, AMS, USDA, 100 Riverside Parkway...

  2. Modern trends on development of cotton production and processing chain Uzbekistan

    OpenAIRE

    Abdimumin Alikulov

    2010-01-01

    The cotton production complex of Uzbekistan has high rating comparing other export oriented branches. Cotton fiber value in 2008 share made 12% from total export of the country. The paper observes some trends and policy developments in cotton industry development.

  3. Regulation of auxin on secondary cell wall cellulose biosynthesis in developing cotton fibers

    Science.gov (United States)

    Cotton (Gossypium hirsutum L.) fibers are unicellular trichomes that differentiate from epidermal cells of developing cotton ovules. Mature fibers exhibit thickened secondary walls composed of nearly pure cellulose. Cotton fiber development is divided into four overlapping phases, 1) initiation sta...

  4. Fabrication of cotton fabric with superhydrophobicity and flame retardancy.

    Science.gov (United States)

    Zhang, Ming; Wang, Chengyu

    2013-07-25

    A simple and facile method for fabricating the cotton fabric with superhydrophobicity and flame retardancy is described in the present work. The cotton fabric with the maximal WCA of 160° has been prepared by the covalent deposition of amino-silica nanospheres and the further graft with (heptadecafluoro-1,1,2,2-tetradecyl) trimethoxysilane. The geometric microstructure of silica spheres was measured by transmission electron microscopy (TEM). The cotton textiles before and after treatment were characterized by using scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS). The wetting behavior of cotton samples was investigated by water contact angle measurement. Moreover, diverse performances of superhydrophobic cotton textiles have been evaluated as well. The results exhibited the outstanding superhydrophobicity, excellent waterproofing durability and flame retardancy of the cotton fabric after treatment, offering a good opportunity to accelerate the large-scale production of superhydrophobic textiles materials for new industrial applications. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. SN 2006bt: A PERPLEXING, TROUBLESOME, AND POSSIBLY MISLEADING TYPE Ia SUPERNOVA

    International Nuclear Information System (INIS)

    Foley, Ryan J.; Narayan, Gautham; Challis, Peter J.; Kirshner, Robert P.; Filippenko, Alexei V.; Silverman, Jeffrey M.; Steele, Thea N.

    2010-01-01

    SN 2006bt displays characteristics unlike those of any other known Type Ia supernova (SN Ia). We present optical light curves and spectra of SN 2006bt which demonstrate the peculiar nature of this object. SN 2006bt has broad, slowly declining light curves indicative of a hot, high-luminosity SN, but lacks a prominent second maximum in the i band as do low-luminosity SNe Ia. Its spectra are similar to those of low-luminosity SNe Ia, containing features that are only present in cool SN photospheres. Light-curve fitting methods suggest that SN 2006bt is reddened by a significant amount of dust; however, it occurred in the outskirts of its early-type host galaxy and has no strong Na D absorption in any of its spectra, suggesting a negligible amount of host-galaxy dust absorption. C II is possibly detected in our pre-maximum spectra, but at a much lower velocity than other elements. The progenitor was likely very old, being a member of the halo population of a galaxy that shows no signs of recent star formation. SNe Ia have been very successfully modeled as a one-parameter family, and this is fundamental to their use as cosmological distance indicators. SN 2006bt is a challenge to that picture, yet its relatively normal light curves allowed SN 2006bt to be included in cosmological analyses. We generate mock SN Ia data sets which indicate that contamination by similar objects will both increase the scatter of a SN Ia Hubble diagram and systematically bias measurements of cosmological parameters. However, spectra and rest-frame i-band light curves should provide a definitive way to identify and eliminate such objects.

  6. Field-Evolved Resistance to Bt Maize by Western Corn Rootworm

    Science.gov (United States)

    Gassmann, Aaron J.; Petzold-Maxwell, Jennifer L.; Keweshan, Ryan S.; Dunbar, Mike W.

    2011-01-01

    Background Crops engineered to produce insecticidal toxins derived from the bacterium Bacillus thuringiensis (Bt) are planted on millions of hectares annually, reducing the use of conventional insecticides and suppressing pests. However, the evolution of resistance could cut short these benefits. A primary pest targeted by Bt maize in the United States is the western corn rootworm Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae). Methodology/Principal Findings We report that fields identified by farmers as having severe rootworm feeding injury to Bt maize contained populations of western corn rootworm that displayed significantly higher survival on Cry3Bb1 maize in laboratory bioassays than did western corn rootworm from fields not associated with such feeding injury. In all cases, fields experiencing severe rootworm feeding contained Cry3Bb1 maize. Interviews with farmers indicated that Cry3Bb1 maize had been grown in those fields for at least three consecutive years. There was a significant positive correlation between the number of years Cry3Bb1 maize had been grown in a field and the survival of rootworm populations on Cry3Bb1 maize in bioassays. However, there was no significant correlation among populations for survival on Cry34/35Ab1 maize and Cry3Bb1 maize, suggesting a lack of cross resistance between these Bt toxins. Conclusions/Significance This is the first report of field-evolved resistance to a Bt toxin by the western corn rootworm and by any species of Coleoptera. Insufficient planting of refuges and non-recessive inheritance of resistance may have contributed to resistance. These results suggest that improvements in resistance management and a more integrated approach to the use of Bt crops may be necessary. PMID:21829470

  7. Transgenic loblolly pine (Pinus taeda L.) plants expressing a modified delta-endotoxin gene of Bacillus thuringiensis with enhanced resistance to Dendrolimus punctatus Walker and Crypyothelea formosicola Staud.

    Science.gov (United States)

    Tang, Wei; Tian, Yingchuan

    2003-02-01

    A synthetic version of the CRY1Ac gene of Bacillus thuringiensis has been used for the transformation of loblolly pine (Pinus taeda L.) using particle bombardment. Mature zygotic embryos were used to be bombarded and to generate organogenic callus and transgenic regenerated plants. Expression vector pB48.215 DNA contained a synthetic Bacillus thuringiensis (B.t.) CRY1Ac coding sequence flanked by the double cauliflower mosaic virus (CaMV) 35S promoter and nopaline synthase (NOS) terminator sequences, and the neomycin phosphotransferase II (NPTII) gene controlled by the promoter of the nopaline synthase gene was introduced into loblolly pine tissues by particle bombardment. The transformed tissues were proliferated and selected on media with kanamycin. Shoot regeneration was induced from the kanamycin-resistant calli, and transgenic plantlets were then produced. More than 60 transformed plants from independent transformation events were obtained for each loblolly pine genotype tested. The integration and expression of the introduced genes in the transgenic loblolly pine plants was confirmed by polymerase chain reactions (PCR) analysis, by Southern hybridization, by Northern blot analysis, and by Western blot analysis. Effective resistance of transgenic plants against Dendrolimus punctatus Walker and Crypyothelea formosicola Staud was verified in feeding bioassays with the insects. The transgenic plants recovered could represent a good opportunity to analyse the impact of genetic engineering of pine for sustainable resistance to pests using a B. thuringiensis insecticidal protein. This protocol enabled the routine transformation of loblolly pine plants that were previously difficult to transform.

  8. Initial mechanisms for the decomposition of electronically excited energetic materials: 1,5′-BT, 5,5′-BT, and AzTT

    International Nuclear Information System (INIS)

    Yuan, Bing; Yu, Zijun; Bernstein, Elliot R.

    2015-01-01

    Decomposition of nitrogen-rich energetic materials 1,5′-BT, 5,5′-BT, and AzTT (1,5′-Bistetrazole, 5,5′-Bistetrazole, and 5-(5-azido-(1 or 4)H-1,2,4-triazol-3-yl)tetrazole, respectively), following electronic state excitation, is investigated both experimentally and theoretically. The N 2 molecule is observed as an initial decomposition product from the three materials, subsequent to UV excitation, with a cold rotational temperature (<30 K). Initial decomposition mechanisms for these three electronically excited materials are explored at the complete active space self-consistent field (CASSCF) level. Potential energy surface calculations at the CASSCF(12,8)/6-31G(d) level illustrate that conical intersections play an essential role in the decomposition mechanism. Electronically excited S 1 molecules can non-adiabatically relax to their ground electronic states through (S 1 /S 0 ) CI conical intersections. 1,5′-BT and 5,5′-BT materials have several (S 1 /S 0 ) CI conical intersections between S 1 and S 0 states, related to different tetrazole ring opening positions, all of which lead to N 2 product formation. The N 2 product for AzTT is formed primarily by N–N bond rupture of the –N 3 group. The observed rotational energy distributions for the N 2 products are consistent with the final structures of the respective transition states for each molecule on its S 0 potential energy surface. The theoretically derived vibrational temperature of the N 2 product is high, which is similar to that found for energetic salts and molecules studied previously

  9. Recent progress on technologies and applications of transgenic ...

    African Journals Online (AJOL)

    USER

    2010-06-14

    Jun 14, 2010 ... this, the methods for producing transgenic poultry must become routine. ... and spermatogonial stem cells (SSCs) have been developed to generate transgenic chickens. ... any procedure aimed at generating transgenic birds.

  10. A New Developed GIHS-BT-SFIM Fusion Method Based On Edge and Class Data

    Directory of Open Access Journals (Sweden)

    S. Dehnavi

    2013-09-01

    Full Text Available The objective of image fusion (or sometimes pan sharpening is to produce a single image containing the best aspects of the source images. Some desirable aspects are high spatial resolution and high spectral resolution. With the development of space borne imaging sensors, a unified image fusion approach suitable for all employed imaging sources becomes necessary. Among various image fusion methods, intensity-hue-saturation (IHS and Brovey Transforms (BT can quickly merge huge amounts of imagery. However they often face color distortion problems with fused images. The SFIM fusion is one of the most frequently employed approaches in practice to control the tradeoff between the spatial and spectral information. In addition it preserves more spectral information but suffer more spatial information loss. Its effectiveness is heavily depends on the filter design. In this work, two modifications were tested to improve the spectral quality of the images and also investigating class-based fusion results. First, a Generalized Intensity-Hue-Saturation (GIHS, Brovey Transform (BT and smoothing-filter based intensity modulation (SFIM approach was implemented. This kind of algorithm has shown computational advantages among other fusion methods like wavelet, and can be extended to different number of bands as in literature discussed. The used IHS-BT-SFIM algorithm incorporates IHS, IHS-BT, BT, BT-SFIM and SFIM methods by two adjustable parameters. Second, a method was proposed to plus edge information in previous GIHS_BT_SFIM and edge enhancement by panchromatic image. Adding panchromatic data to images had no much improvement. Third, an edge adaptive GIHS_BT_SFIM was proposed to enforce fidelity away from the edges. Using MS image off edges has shown spectral improvement in some fusion methods. Fourth, a class based fusion was tested, which tests different coefficients for each method due to its class. The best parameters for vegetated areas was k1 = 0.6, k2

  11. Decrease in catalase activity of Folsomia candida fed a Bt rice diet

    DEFF Research Database (Denmark)

    Yuan, Yiyang; Ke, Xin; Chen, Fajun

    2011-01-01

    Here we report the effects of three Bt-rice varieties and their non-Bt conventional isolines on biological traits including survival, reproduction, and the activities of three antioxidant enzymes superoxide dismutase, catalase and peroxidase, in the Collembolan, Folsomia candida. The reproduction...... was significantly lower when fed Kemingdao and Huahui1 than those feeding on their non-GM near-isogenic varieties Xiushui and Minghui63 respectively, this can be explained by the differences of plant compositions depended on variety of rice. The catalase activity of F. candida was significantly lower when fed...

  12. An Assessment of Current Policy Initiatives in Zambia's Cotton Sector

    OpenAIRE

    Zulu, Ballard; Tschirley, David L.

    2004-01-01

    This paper assesses three of these policy initiatives: input credit provision for smallholder producers of selected cash crops including cotton, the proposed creation of a Cotton Board, and the emergence in 2003 of District Council levies as a point of conflict between local governments and cotton companies. The purpose of the paper is to provide guidance to public and private decision makers regarding key modifications which may need to be made to these policies to ensure continued healthy d...

  13. Processing and Properties of PCL/Cotton Linter Compounds

    OpenAIRE

    Bezerra,Elieber Barros; França,Danyelle Campos; Morais,Dayanne Diniz de Souza; Rosa,Morsyleide de Freitas; Morais,João Paulo Saraiva; Araújo,Edcleide Maria; Wellen,Renate Maria Ramos

    2017-01-01

    Biodegradable compounds of poly(ε-caprolactone) (PCL)/ cotton linter were melting mixed with filling content ranging from 1% to 5% w/w. Cotton linter is an important byproduct of textile industry; in this work it was used in raw state and after acid hydrolysis. According to the results of torque rheometry no decaying of viscosity took place during compounding, evidencing absence of breaking down in molecular weight. The thermal stability increased by 20% as observed in HDT for PCL/cotton...

  14. THE WORLD TRADE ORGANIZATION AND SOUTHERN AGRICULTURE: THE COTTON PERSPECTIVE

    OpenAIRE

    Hudson, Darren

    2000-01-01

    The World Trade Organization (WTO) negotiations could have important implications for Southern Agriculture. This paper explores some of the issues surrounding the WTO negotiations for cotton. Specifically, this paper examines the impacts of the phase-out of the Multi-Fiber Arrangement (MFA) on the location of textile production and cotton trade flows. Generally, it is believed that the WTO negotiations will have little direct impact on cotton, but will have indirect impacts through textile po...

  15. EVALUATION OF FOUR INTEGRATED PEST MANAGEMENT PACKAGES FOR CONTROLLING MAIN PESTS OF COTTON IN RAINFED FIELDS

    OpenAIRE

    Nurindah Nurindah; Dwi Adi Sunarto

    2014-01-01

    Cotton production nationally is low due to various constraints, including pests. Two main pests commonly found in cotton plantation in rain fed fields are cotton leafhopper (Amrasca biguttula) and cotton bollworm (Helicoverpa armigera). The study aimed to evaluate four packages of integrated pest management (IPM) techniques to control cotton leafhopper and cotton bollworm in rain fed fields. The experiment was conducted in farmers’ fields at Asembagus, East Java, between January and July 2012...

  16. Screening Pakistani cotton for drought tolerance

    International Nuclear Information System (INIS)

    Soomro, M.H.; Markhand, G.S.

    2011-01-01

    The drought is one of the biggest abiotic stresses for crop production in arid and semi-arid agriculture. Thus it is a challenge for plant scientists to screen and develop the drought tolerant cotton lines. In this study, 31 cotton genotypes/cultivars were evaluated under two irrigation regimes i. e., seven irrigations (Control) and two irrigations (Stress), using split plot design with four replications. The crop growth, yield and some physiological parameters were studied. There were high inter-varietal differences for all the parameters under control as well as drought stress. Although all the varieties for all parameters were significantly affected by drought but however, CRIS-9, MARVI, CRIS-134, CRIS-126, CRIS-337, CRIS-355 and CRIS-377 maintained highest performance for all the parameters studied under high drought conditions. (author)

  17. Nematode neuropeptides as transgenic nematicides.

    Directory of Open Access Journals (Sweden)

    Neil D Warnock

    2017-02-01

    Full Text Available Plant parasitic nematodes (PPNs seriously threaten global food security. Conventionally an integrated approach to PPN management has relied heavily on carbamate, organophosphate and fumigant nematicides which are now being withdrawn over environmental health and safety concerns. This progressive withdrawal has left a significant shortcoming in our ability to manage these economically important parasites, and highlights the need for novel and robust control methods. Nematodes can assimilate exogenous peptides through retrograde transport along the chemosensory amphid neurons. Peptides can accumulate within cells of the central nerve ring and can elicit physiological effects when released to interact with receptors on adjoining cells. We have profiled bioactive neuropeptides from the neuropeptide-like protein (NLP family of PPNs as novel nematicides, and have identified numerous discrete NLPs that negatively impact chemosensation, host invasion and stylet thrusting of the root knot nematode Meloidogyne incognita and the potato cyst nematode Globodera pallida. Transgenic secretion of these peptides from the rhizobacterium, Bacillus subtilis, and the terrestrial microalgae Chlamydomonas reinhardtii reduce tomato infection levels by up to 90% when compared with controls. These data pave the way for the exploitation of nematode neuropeptides as a novel class of plant protective nematicide, using novel non-food transgenic delivery systems which could be deployed on farmer-preferred cultivars.

  18. Consequences for Protaphorura armata (Collembola: Onychiuridae) following exposure to genetically modified Bacillus thuringiensis (Bt) maize and non-Bt maize

    DEFF Research Database (Denmark)

    Heckmann, Lars-Henrik; Griffiths, Bryan S; Caul, Sandra

    2006-01-01

    Studies on the effect of genetically modified Bacillus thuringiensis (Bt) crops on true soil dwelling non-target arthropods are scarce. The objective of this study was to assess the influence of a 4-week exposure to two Bt maize varieties (Cry1Ab) Cascade and MEB307 on the collembolan Protaphorur...

  19. Cotton genotypes selection through artificial neural networks.

    Science.gov (United States)

    Júnior, E G Silva; Cardoso, D B O; Reis, M C; Nascimento, A F O; Bortolin, D I; Martins, M R; Sousa, L B

    2017-09-27

    Breeding programs currently use statistical analysis to assist in the identification of superior genotypes at various stages of a cultivar's development. Differently from these analyses, the computational intelligence approach has been little explored in genetic improvement of cotton. Thus, this study was carried out with the objective of presenting the use of artificial neural networks as auxiliary tools in the improvement of the cotton to improve fiber quality. To demonstrate the applicability of this approach, this research was carried out using the evaluation data of 40 genotypes. In order to classify the genotypes for fiber quality, the artificial neural networks were trained with replicate data of 20 genotypes of cotton evaluated in the harvests of 2013/14 and 2014/15, regarding fiber length, uniformity of length, fiber strength, micronaire index, elongation, short fiber index, maturity index, reflectance degree, and fiber quality index. This quality index was estimated by means of a weighted average on the determined score (1 to 5) of each characteristic of the HVI evaluated, according to its industry standards. The artificial neural networks presented a high capacity of correct classification of the 20 selected genotypes based on the fiber quality index, so that when using fiber length associated with the short fiber index, fiber maturation, and micronaire index, the artificial neural networks presented better results than using only fiber length and previous associations. It was also observed that to submit data of means of new genotypes to the neural networks trained with data of repetition, provides better results of classification of the genotypes. When observing the results obtained in the present study, it was verified that the artificial neural networks present great potential to be used in the different stages of a genetic improvement program of the cotton, aiming at the improvement of the fiber quality of the future cultivars.

  20. Ecoinformatics reveals effects of crop rotational histories on cotton yield.

    Science.gov (United States)

    Meisner, Matthew H; Rosenheim, Jay A

    2014-01-01

    Crop rotation has been practiced for centuries in an effort to improve agricultural yield. However, the directions, magnitudes, and mechanisms of the yield effects of various crop rotations remain poorly understood in many systems. In order to better understand how crop rotation influences cotton yield, we used hierarchical Bayesian models to analyze a large ecoinformatics database consisting of records of commercial cotton crops grown in California's San Joaquin Valley. We identified several crops that, when grown in a field the year before a cotton crop, were associated with increased or decreased cotton yield. Furthermore, there was a negative association between the effect of the prior year's crop on June densities of the pest Lygus hesperus and the effect of the prior year's crop on cotton yield. This suggested that some crops may enhance L. hesperus densities in the surrounding agricultural landscape, because residual L. hesperus populations from the previous year cannot continuously inhabit a focal field and attack a subsequent cotton crop. In addition, we found that cotton yield declined approximately 2.4% for each additional year in which cotton was grown consecutively in a field prior to the focal cotton crop. Because L. hesperus is quite mobile, the effects of crop rotation on L. hesperus would likely not be revealed by small plot experimentation. These results provide an example of how ecoinformatics datasets, which capture the true spatial scale of commercial agriculture, can be used to enhance agricultural productivity.