WorldWideScience

Sample records for transfusion dependent homozygous

  1. Colloid clearance rate changes in children with homozygous-β-thalassemia in relation to blood transfusion

    International Nuclear Information System (INIS)

    Dimitriou, P.A.; Karpathios, T.E.; Antipas, S.E.; Fretzayias, A.M.; Kasfiki, A.G.; Melissinos, K.G.; Matsaniotis, N.S.

    1980-01-01

    The plasma clearance rate of heat denatured human serum albumin (DHAI-125, 5 mg/kg body weight) was studied in 20 children with homozygous-β-thalassemia before and 7-10 days after blood transfusion. A significant increase of the DHAI-125 clearance rate (P < 0.02) was found 7-10 days after blood transfusion while the spleen presented its minimum size. This finding may be relevant to the improved intrasplenic blood circulation after blood transfusion due to the release of the blood trapped within the spleen. (orig.)

  2. [Blood transfusion assessment to 112 homozygous sickle-cell disease patients in university hospital of Brazzaville].

    Science.gov (United States)

    Dokekias, A Elira; Ossini, L Ngolet; Tsiba, F O Atipo; Malanda, F; Koko, I; De Montalembert, M

    2009-01-01

    Homozygous, sickle-cell disease (SCD) is responsible for acute complication, especially anaemic crisis and special situation such as acute chest syndrome, stroke and acute priapism. Pregnancy sickle-cell disease presents high risk for the mother and the fetus. In these indications, blood transfusion is the main therapy aiming to reduce anaemia in order to restore hemoglobin's rate or to increase normal Hb proportion. This study aims to assess the short-term efficiency of the red cell transfusion in SCD homozygous form. One hundred and twelve homozygous sickle-cell patients were enrolled in this prospective study: 59 females and 53 males, median age is 21,8 years (extremes: 2 and 45 years). These patients are mostly with very low income. Two groups of patients are included in this study. In the first group, patients present acute anemia crisis caused by infections disease (malaria, bacterial infections). In the second group (20 cases), SCD patients have particularly situations: pregnancy (10 cases); stroke (six cases); cardiac failure (two cases) and priapism (two cases). Transfusion treatment in first group is simple regimen. Transfusion of EC increased median Hb level at 2,9 g/dl (extremes: 1,1 and 4,7). In the second group of patients, 16 cases were transfused by manual partial exchange (1-3) and four patients received simple regimen of transfusion. Median Hb level was 3,1g/dl (extremes: 2,4-4,9 g/dl). HbS percentage reduction was after PTE between -30 and -66,8% (median: -52,6%). According to our diagnostic possibilities (blood serologic test), we have not found any contamination by HIV, HBV and HCV (virus).

  3. Non-transfusion-dependent thalassemias

    Science.gov (United States)

    Musallam, Khaled M.; Rivella, Stefano; Vichinsky, Elliott; Rachmilewitz, Eliezer A.

    2013-01-01

    Non-transfusion-dependent thalassemias include a variety of phenotypes that, unlike patients with beta (β)-thalassemia major, do not require regular transfusion therapy for survival. The most commonly investigated forms are β-thalassemia intermedia, hemoglobin E/β-thalassemia, and α-thalassemia intermedia (hemoglobin H disease). However, transfusion-independence in such patients is not without side effects. Ineffective erythropoiesis and peripheral hemolysis, the hallmarks of disease process, lead to a variety of subsequent pathophysiologies including iron overload and hypercoagulability that ultimately lead to a number of serious clinical morbidities. Thus, prompt and accurate diagnosis of non-transfusion-dependent thalassemia is essential to ensure early intervention. Although several management options are currently available, the need to develop more novel therapeutics is justified by recent advances in our understanding of the mechanisms of disease. Such efforts require wide international collaboration, especially since non-transfusion-dependent thalassemias are no longer bound to low- and middle-income countries but have spread to large multiethnic cities in Europe and the Americas due to continued migration. PMID:23729725

  4. Improving transfusion practice in transfusion dependent thalassaemia patients

    Directory of Open Access Journals (Sweden)

    Chathupa Wickremaarachchi

    2017-10-01

    Full Text Available The aim of this study was to improve current transfusion practice in transfusiondependent thalassaemia patients by determining whether safe transition from triplewashed red cells (TWRC to leucodepleted red cells (LDRC, increasing transfusion rates, reducing the use of frusemide and creating uniform practice across patients is possible. In patients receiving regular transfusions (50, triple-washed red blood cells were changed to LDRC, transfusion rates were increased to 5 mL/kg/h (in line with the Cooley’s Foundation guidelines to a maximum of 300 mL/h and frusemide was ceased. Medical review occurred at completion of the transfusion. Of the 20 patients on TWRC, 18 were transitioned to leucodepleted red cells (90%. Recurrent allergic reactions in 2 patients required re-institution of TWRC. 7 of the 8 patients on regular frusemide ceased this practice with no documented transfusion-related fluid overload. One patient refused. Of the eligible 50 patients, 20 patients (40% were increased to the maximum transfusion rate of 300 mLs/h; 6 (12% increased rate but refused to go to the maximum; 9 (18% refused a change in practice and 15 (30% were already at the maximum rate. There was only one documented transfusion reaction (palpitations however this patient was able to tolerate a higher transfusion rate on subsequent transfusions. Thalassemia patients on TWRC were safely transitioned to LDRC. Transfusion rates were safely increased, with a calculated reduction in day-stay bed time of 17.45 h per month. This confirms a guideline of 5 mL/kg/h for transfusion-dependant thalassaemia patients with preserved cardiac function is well tolerated and may be translated to other centres worldwide.   本研究的目的是通过确定是否有可能进行从三洗红细胞(TWRC)到去白细胞红细胞(LDRC)的安全过渡,提高输血速率,减少速尿的使用,并在患者中实施统一规则,从而改进输血依赖型地中海贫血患者中

  5. Spleen size changes in children with homozygous β-thalassaemia in relation to blood transfusion

    International Nuclear Information System (INIS)

    Karpathios, Th.; Antypas, A.; Dimitriou, P.; Nicolaidou, P.; Fretzayas, A.; Thomaidis, Th.; Matsaniotis, N.

    1982-01-01

    18 thalassaemic children, aged 3.5 to 13 years comprise our clinical material. In 14 of them, clinically elicited spleen markings, haematocrit, blood platelet count and red cell morphology were studied daily for a whole period between 2 transfusions. In 10 patients considerable changes in spleen size were noticed. According to our clinical observations the spleen size starts decreasing 1 to 3 d after blood transfusion up to the 10th posttransfusion day fluctuating thereafter to reach its maximum size again prior to the next blood transfusion. The decrease of spleen size was followed by an increase of haematocrit and blood platelet count and vice versa. 4 additional children were studied clinically only twice: prior to and 7 to 10 d after blood transfusion. A definite decrease of the spleen size following blood transfusion was observed. Spleen and liver sup(99m)Tc-sulfur colloid uptake was studied in 10 of the above children prior to and 7 to 10 d after blood transfusion. Statistically significant post-transfusion increase of the spleen uptake was demonstrated. Our findings suggest that (a) splenic size is relevant to blood volume sequestrated int this organ, (b) splenic radioactive uptake increases with its post-transfusion reductin in size. (author)

  6. Hydroxyurea for reducing blood transfusion in non-transfusion dependent beta thalassaemias.

    Science.gov (United States)

    Foong, Wai Cheng; Ho, Jacqueline J; Loh, C Khai; Viprakasit, Vip

    2016-10-18

    Non-transfusion dependent beta thalassaemia is a subset of inherited haemoglobin disorders characterised by reduced production of the beta globin chain of the haemoglobin molecule leading to anaemia of varying severity. Although blood transfusion is not a necessity for survival, it is required when episodes of chronic anaemia occur. This chronic anaemia can impair growth and affect quality of life. People with non-transfusion dependent beta thalassaemia suffer from iron overload due to their body's increased capability of absorbing iron from food sources. Iron overload becomes more pronounced in those requiring blood transfusion. People with a higher foetal haemoglobin level have been found to require fewer blood transfusions. Hydroxyurea has been used to increase foetal haemoglobin level; however, its efficacy in reducing transfusion, chronic anaemia complications and its safety need to be established. To assess the effectiveness, safety and appropriate dose regimen of hydroxyurea in people with non-transfusion dependent beta thalassaemia (haemoglobin E combined with beta thalassaemia and beta thalassaemia intermedia). We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group's Haemoglobinopathies Trials Register, compiled from electronic database searches and handsearching of relevant journals. We also searched ongoing trials registries and the reference lists of relevant articles and reviews.Date of last search: 30 April 2016. Randomised or quasi-randomised controlled trials of hydroxyurea in people with non-transfusion dependent beta thalassaemia comparing hydroxyurea with placebo or standard treatment or comparing different doses of hydroxyurea. Two authors independently applied the inclusion criteria in order to select trials for inclusion. Both authors assessed the risk of bias of trials and extracted the data. A third author verified these assessments. No trials comparing hydroxyurea with placebo or standard care were found. However, we included

  7. Non-transfusion Dependent Thalassemias: A Developing Country Perspective.

    Science.gov (United States)

    Mukherjee, Somnath; Das, Rashmi R; Raghuwanshi, Babita

    2015-01-01

    Non-transfusion-dependent thalassemias (NTDT) encompass a group of hereditary chronic hemolytic anemia, which, as the name indicates, not require regular blood transfusion for survival. These include β-thalassemia intermedia, hemoglobin E/β-thalassemia, and Hemoglobin H disease (α- thalassemia intermedia). Individuals with structural variant of hemoglobin especially Hemoglobin S and Hemoglobin C associated with "α" or "β" thalassemia in heterozygous condition may also present with similar features of NTDT. NTDT patients are not immune to the development of transfusion unrelated complications in the long run. These hereditary chronic hemolytic anemias are still under-recognized in developing countries like India, where the disease burden might be high causing significant morbidity. The pathophysiologic hallmark that characterizes this group of disorders (ineffective erythropoiesis, hemolysis, chronic anemia) leads to a number of serious complications, similar to transfusion dependent thalassemia. So, timely diagnosis and institution of appropriate preventive/remedial measures as well as education of patient population can help decrease the morbidity to a significant extent. In the present review, focus will be on the pathophysiological mechanisms and available management options of NTDT from a developing country perspective like India.

  8. Effective RES blood flow changes in children with homozygous β-thalassemia in relation to blood transfusion

    International Nuclear Information System (INIS)

    Karpathios, T.; Dimitriou, P.; Giamouris, J.; Nicolaidou, P.; Antipas, S.E.; Matsaniotis, N.

    1983-01-01

    Denatured radioiodinated human serum albumin (DHA) clearance studies at a dose of 1 mg/kg body wt., were carried out in 16 thalassemic children, prior to and 7-10 days following blood transfusion, to investigate changes of the effective RES blood flow which might accompany the posttransfusion spleen size diminution. A statistically significant increase (P<0.001) of the DHA plasma clearance rate was observed 7-10 days following blood transfusion denoting an increase of the blood flow to the effective RES while at the same time the spleen diminished in size. It is suggested that changes in the effective RES blood flow in these patients are directly related to changes in the intrasplenic circulatory capacity. (orig.)

  9. Non-transfusion dependent thalassemia: translating evidence to guidelines

    Directory of Open Access Journals (Sweden)

    Afif R. Harb

    2014-12-01

    Full Text Available The thalassemias are a group of inherited disorders of hemoglobin synthesis characterized by various degrees of defective production of the α- or β-globin chains of adult hemoglobin A. Non-transfusion- dependent thalassemia (NTDT includes a group of thalassemia patients who do not require regular RBC transfusions for survival, but may require occasional transfusions due to infection or pregnancy or may require more regular transfusions later in life due to splenomegaly or other complications. Due to the rising phenomenon of global migration, this previously well-localized entity is currently spreading more and more worldwide reaching Northern America and Northern Europe. The clinical picture of NTDT is governed by the severity of the ineffective erythropoiesis and the chronic hemolytic anemia, which, in turn, lead to iron overload, hypercoagulability, and an array of clinical complications involving almost every organ system. Patients with NTDT suffer from complications that are distinct from those encountered in patients with transfusion- dependent thalassemia (TDT in addition to the complications shared by both TDT and NTDT. As a consequence, patients with NTDT deserve a care specifically tailored to their needs. In the care of patients with NTDT, aiming at a standardized yet personalized care is not an easy task especially that NTDT patients lie on a heterogeneous spectrum with a wide variability in their clinical presentation and response to therapy. Therefore, guidelines emerge as a necessity to answer the specific needs of NTDT patients and the clinicians caring for them. In this article, we summarize the complications most commonly associated with NTDT and the recommendations of the guidelines for the management of patients with NTDT, based on the best available evidence.

  10. Physical growth in children with transfusion-dependent thalassemia

    Directory of Open Access Journals (Sweden)

    Harish K Pemde

    2011-02-01

    Full Text Available Harish K Pemde, Jagdish Chandra, Divya Gupta, Varinder Singh, Rajni Sharma, AK DuttaDepartment of Pediatrics, Lady Hardinge Medical College, Kalawati Saran Children's Hospital, New Delhi, IndiaObjective: To describe physical growth and related factors in transfusion-dependent thalassemia patients.Methods: This is a cross-sectional analysis of the records of the patients registered at and being followed up by the Thalassemia Day Care Center (TDCC at Kalawati Saran Children's Hospital, New Delhi, India. Clinical and laboratory parameters were recorded on a spreadsheet for analysis. Clinical parameters included weight, height, sexual maturity ratings, and general and systemic physical examination. Laboratory parameters included pretransfusion hemoglobin (Hb, periodic serum ferritin, and tests for viral markers of human immunodeficiency virus (HIV and hepatitis B and C. Z-scores for weight, height, and body mass index (BMI were calculated using World Health Organization reference data. Statistical analysis was carried out using Microsoft Excel® and Stata® software.Results: Out of 214 patients registered at the TDCC since 2001, 154 were included in this study. The mean age of patients was 9.19 years (range 0.5–20 years. Pretransfusion Hb was well maintained (mean 9.21 g/dL; 95% confidence interval [CI]: 9.06–9.36, but the mean serum ferritin levels were approximately three times (3112 ng/mL the desired value despite the patients being on deferiprone (72% or deferasirox (25%. One-third (33.11% of the patients had short stature, 13% were thin, and 10.82% were very thin (BMI z-score <-3. No patient was overweight or obese. Linear regression coefficient showed that for every 1-year increase in age, the mean ferritin value increased by 186.21 pg/mL (95% CI: 143.31–228.27. Height z-scores had significant correlation with mean ferritin levels, whereas correlation with mean pretransfusion Hb was not significant statistically. Mean ferritin levels

  11. Novel homozygous missense mutation in ALDH7A1 causes neonatal pyridoxine dependent epilepsy.

    Science.gov (United States)

    Coci, Emanuele G; Codutti, Luca; Fink, Christian; Bartsch, Sophie; Grüning, Gunnar; Lücke, Thomas; Kurth, Ingo; Riedel, Joachim

    2017-04-01

    Pyridoxine dependent epilepsy (PDE) (OMIM#266100) is a neonatal form of epilepsy, caused by dysfunction of the enzyme α-aminoadipic semialdehyde dehydrogenase (ALDH7A1 or Antiquitin). This enzyme converts α-aminoadipic semialdehyde (α-AASA) into α-aminoadipate (AAA), a critical step in the lysine metabolism of the brain. ALDH7A1 dysfunction causes an accumulation of α-AASA and δ 1 -piperideine-6-carboxylic acid (P6C), which are in equilibrium with each other. P6C binds and inactivates pyridoxal 5'-phosphate (PLP), the active form of pyridoxine. Individuals affected by ALDH7A1 deficiency show pre-natal and post-natal seizures, which respond to oral pyridoxine but not to other pediatric anti-epileptic drugs. We discovered a novel missense mutation (c.566G > A, p.Gly189Glu) in homozygous state residing in the NAD+ binding domain coding region of exon 6 and affecting an highly conserved amino acid residue. The seizures stopped under post-natal pyridoxine therapy, nevertheless a longer follow-up is needed to evaluate the intellectual development of the child, who is additionally treated with oral l-arginine since the 13th month of life. Developmental delay with or without structural cortex abnormalities were reported in several patients. A brain MRI scan revealed hyperintense white matter in the right cerebellum compatible with cerebellar gliosis. Taken together, our studies enlarge the group of missense pathogenic mutations of ALDH7A1 gene and reveal a novel cerebellar finding within the PDE patients cohort. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Iron overload across the spectrum of non-transfusion-dependent thalassaemias: role of erythropoiesis, splenectomy and transfusions.

    Science.gov (United States)

    Porter, John B; Cappellini, Maria Domenica; Kattamis, Antonis; Viprakasit, Vip; Musallam, Khaled M; Zhu, Zewen; Taher, Ali T

    2017-01-01

    Non-transfusion-dependent thalassaemias (NTDT) encompass a spectrum of anaemias rarely requiring blood transfusions. Increased iron absorption, driven by hepcidin suppression secondary to erythron expansion, initially causes intrahepatic iron overload. We examined iron metabolism biomarkers in 166 NTDT patients with β thalassaemia intermedia (n = 95), haemoglobin (Hb) E/β thalassaemia (n = 49) and Hb H syndromes (n = 22). Liver iron concentration (LIC), serum ferritin (SF), transferrin saturation (TfSat) and non-transferrin-bound iron (NTBI) were elevated and correlated across diagnostic subgroups. NTBI correlated with soluble transferrin receptor (sTfR), labile plasma iron (LPI) and nucleated red blood cells (NRBCs), with elevations generally confined to previously transfused patients. Splenectomised patients had higher NTBI, TfSat, NRBCs and SF relative to LIC, than non-splenectomised patients. LPI elevations were confined to patients with saturated transferrin. Erythron expansion biomarkers (sTfR, growth differentiation factor-15, NRBCs) correlated with each other and with iron overload biomarkers, particularly in Hb H patients. Plasma hepcidin was similar across subgroups, increased with >20 prior transfusions, and correlated inversely with TfSat, NTBI, LPI and NRBCs. Hepcidin/SF ratios were low, consistent with hepcidin suppression relative to iron overload. Increased NTBI and, by implication, risk of extra-hepatic iron distribution are more likely in previously transfused, splenectomised and iron-overloaded NTDT patients with TfSat >70%. © 2016 The Authors. British Journal of Haematology published by John Wiley & Sons Ltd.

  13. MR marrow signs of iron overload in transfusion-dependent patients with sickle cell disease

    International Nuclear Information System (INIS)

    Levin, T.L.; Sheth, S.S.; Hurlet, A.; Comerci, S.C.; Ruzal-Shapiro, C.; Piomelli, S.; Berdon, W.E.

    1995-01-01

    Magnetic resonance (MR) marrow signal in the axial and appendicular skeleton of 13 transfusion-dependent and chelated pediatric patients with sickle cell anemia (SSD) was compared with marrow signal in six non-transfusion-dependent patients with SSD. Hepatic, pancreatic, and renal MR signal were also evaluated. Indication for hypertransfusion therapy was primarily prior history of stroke. Transfusion-dependent patients had evidence of iron deposition throughout the imaged marrow and the liver, despite deferoxamine chelation therapy. Non-transfusion-dependent patients did not demonstrate grossly apparent signs of iron overload. Red marrow restoration was present in the spine, pelvis, and long bones and, in some patients, within the epiphyses. Marrow edema secondary to vaso-occlusive crises was evident in the metaphyses and diaphyses of long bones in areas of both red and fatty marrow and was best seen using fat-saturated T2-weighted imaging techniques. (orig.). With 4 figs., 2 tabs

  14. Cost of transfusion-dependent myelodysplastic syndrome (MDS) from a German payer?s perspective

    OpenAIRE

    2010-01-01

    Abstract No curative treatment exists for patients with myelodysplastic syndrome (MDS) besides allogeneic stem cell transplantation. Hence, palliative treatment is provided for a life time accruing high health care cost. As no study in cost of MDS exists in Germany, the objective of this study was to assess and analyze costs of transfusion-dependent low/intermediate-1-risk MDS in Germany from a payers? perspective. From seven centers, 116 low/intermediate-1-risk transfusion-depende...

  15. Treating iron overload in patients with non-transfusion-dependent thalassemia

    Science.gov (United States)

    Taher, Ali T; Viprakasit, Vip; Musallam, Khaled M; Cappellini, M Domenica

    2013-01-01

    Despite receiving no or only occasional blood transfusions, patients with non-transfusion-dependent thalassemia (NTDT) have increased intestinal iron absorption and can accumulate iron to levels comparable with transfusion-dependent patients. This iron accumulation occurs more slowly in NTDT patients compared to transfusion-dependent thalassemia patients, and complications do not arise until later in life. It remains crucial for these patients' health to monitor and appropriately treat their iron burden. Based on recent data, including a randomized clinical trial on iron chelation in NTDT, a simple iron chelation treatment algorithm is presented to assist physicians with monitoring iron burden and initiating chelation therapy in this group of patients. Am. J. Hematol. 88:409–415, 2013. © 2013 Wiley Periodicals, Inc. PMID:23475638

  16. C-reactive (CRP) protein in transfusion dependent thalassaemic patients

    International Nuclear Information System (INIS)

    Jokhio, R.; Mughal, Z.U.N.

    2009-01-01

    In thalassaemic patients iron overload, secondary to blood transfusion, results toxic effects by producing reactive radicals. Iron overload can be studied using serum ferritin level which has a direct correlation with the body's iron status. While oxidative damage can be studied using biomarker of inflammation like hsC-reactive proteins. Blood samples of 55 thalassaemic patients (39 males, 16 females) were collected from Fatmid Foundation (Hyderabad). The samples were analyzed for CBC, serum ferritin level and hsC-reactive proteins. High mean serum ferritin levels was found in all the patients regardless of the frequency of blood transfusion (4774.2135+-3143.3040 mu g/L), indicating the iron overload. High mean hsC-reactive protein was found (2.5151+-1.3712) with a positive correlation with ferritin (r= 0.8371198, p= 0.0000) and platelets (r= 0.43293443, p=0.000962175). C-reactive proteins serve as biomarker of various inflammatory conditions, progression of cardiovascular diseases and as indicator of morbidity and mortality. High C-reactive proteins in these patients indicate ongoing iron overload toxicity related damage in these patients. The estimation of hsC-reactive proteins and other biomarkers of inflammation and oxidation may help in better management of these patients. (author)

  17. Non-Transfusion-Dependent Thalassemia: An Update on Complications and Management

    Directory of Open Access Journals (Sweden)

    Joseph Sleiman

    2018-01-01

    Full Text Available Patients with non-transfusion-dependent thalassemia (NTDT experience many clinical complications despite their independence from frequent transfusions. Morbidities in NTDT stem from the interaction of multiple pathophysiological factors: ineffective erythropoiesis, iron overload (IOL, and hypercoagulability. Ineffective erythropoiesis and hemolysis are associated with chronic hypoxia and a hypercoagulable state. The latter are linked to a high prevalence of thromboembolic and cerebrovascular events, as well as leg ulcers and pulmonary hypertension. IOL in NTDT patients is a cumulative process that can lead to several iron-related morbidities in the liver (liver fibrosis, kidneys, endocrine glands (endocrinopathies, and vascular system (vascular disease. This review sheds light on the pathophysiology underlying morbidities associated with NTDT and summarizes the mainstays of treatment and some of the possible future therapeutic interventions.

  18. Phase I/II safety study of transfusion of prion-filtered red cell concentrates in transfusion-dependent patients.

    LENUS (Irish Health Repository)

    Cahill, M R

    2010-08-01

    Variant Creutzfeldt-Jakob (vCJD) is a fatal transfusion transmissible prion infection. No test for vCJD in the donor population is currently available. Therefore, prion removal by filtration of red cell concentrate (RCC) is an attractive option for prevention.

  19. Increased mitochondrial DNA deletions and copy number in transfusion-dependent thalassemia

    Science.gov (United States)

    Calloway, Cassandra

    2016-01-01

    BACKGROUND. Iron overload is the primary cause of morbidity in transfusion-dependent thalassemia. Increase in iron causes mitochondrial dysfunction under experimental conditions, but the occurrence and significance of mitochondrial damage is not understood in patients with thalassemia. METHODS. Mitochondrial DNA (mtDNA) to nuclear DNA copy number (Mt/N) and frequency of the common 4977-bp mitochondrial deletion (ΔmtDNA4977) were quantified using a quantitative PCR assay on whole blood samples from 38 subjects with thalassemia who were receiving regular transfusions. RESULTS. Compared with healthy controls, Mt/N and ΔmtDNA4977 frequency were elevated in thalassemia (P = 0.038 and P 15 mg/g dry-weight or splenectomy, with the highest levels observed in subjects who had both risk factors (P = 0.003). Myocardial iron (MRI T2* 40/1 × 107 mtDNA, respectively (P = 0.025). Subjects with Mt/N values below the group median had significantly lower Matsuda insulin sensitivity index (5.76 ± 0.53) compared with the high Mt/N group (9.11 ± 0.95, P = 0.008). CONCLUSION. Individuals with transfusion-dependent thalassemia demonstrate age-related increase in mtDNA damage in leukocytes. These changes are markedly amplified by splenectomy and are associated with extrahepatic iron deposition. Elevated mtDNA damage in blood cells may predict the risk of iron-associated organ damage in thalassemia. FUNDING. This project was supported by Children’s Hospital & Research Center Oakland Institutional Research Award and by the National Center for Advancing Translational Sciences, NIH, through UCSF-CTSI grant UL1 TR000004. PMID:27583305

  20. Diffuse Hepatic Calcifications in a Transfusion-Dependent Patient with Beta-Thalassemia: A Case Report

    Directory of Open Access Journals (Sweden)

    Forough Saki

    2013-09-01

    Full Text Available Hepatic calcification is usually associated with infectious, vascular, or neoplastic processes in the liver. We report the first case of beta-thalassemia major with isolated diffuse hepatic calcification in a 23 year old woman, who had been transfusion-dependent since the age of 6 months. She was referred to our center with a chief complaint of abdominal pain. Computed tomography scan of the abdomen revealed diffuse hepatic calcification in the right, left, and caudate lobes of the liver. Her medical history disclosed hypoparathyroidism as well as chronic hepatitis C virus infection, which was successfully treated but led to early micronodular cirrhosis on liver biopsy. Other studies done to search for the cause of hepatic calcification failed to reveal any abnormalities. We suspect that hypoparathyroidism caused liver calcification, and should be, therefore, considered in the differential diagnosis of hepatic calcification if other causative factors have been ruled out.

  1. Iron Overload and Chelation Therapy in Non-Transfusion Dependent Thalassemia.

    Science.gov (United States)

    Bou-Fakhredin, Rayan; Bazarbachi, Abdul-Hamid; Chaya, Bachar; Sleiman, Joseph; Cappellini, Maria Domenica; Taher, Ali T

    2017-12-20

    Iron overload (IOL) due to increased intestinal iron absorption constitutes a major clinical problem in patients with non-transfusion-dependent thalassemia (NTDT), which is a cumulative process with advancing age. Current models for iron metabolism in patients with NTDT suggest that suppression of serum hepcidin leads to an increase in iron absorption and subsequent release of iron from the reticuloendothelial system, leading to depletion of macrophage iron, relatively low levels of serum ferritin, and liver iron loading. The consequences of IOL in patients with NTDT are multiple and multifactorial. Accurate and reliable methods of diagnosis and monitoring of body iron levels are essential, and the method of choice for measuring iron accumulation will depend on the patient's needs and on the available facilities. Iron chelation therapy (ICT) remains the backbone of NTDT management and is one of the most effective and practical ways of decreasing morbidity and mortality. The aim of this review is to describe the mechanism of IOL in NTDT, and the clinical complications that can develop as a result, in addition to the current and future therapeutic options available for the management of IOL in NTDT.

  2. Iron Overload and Chelation Therapy in Non-Transfusion Dependent Thalassemia

    Directory of Open Access Journals (Sweden)

    Rayan Bou-Fakhredin

    2017-12-01

    Full Text Available Iron overload (IOL due to increased intestinal iron absorption constitutes a major clinical problem in patients with non-transfusion-dependent thalassemia (NTDT, which is a cumulative process with advancing age. Current models for iron metabolism in patients with NTDT suggest that suppression of serum hepcidin leads to an increase in iron absorption and subsequent release of iron from the reticuloendothelial system, leading to depletion of macrophage iron, relatively low levels of serum ferritin, and liver iron loading. The consequences of IOL in patients with NTDT are multiple and multifactorial. Accurate and reliable methods of diagnosis and monitoring of body iron levels are essential, and the method of choice for measuring iron accumulation will depend on the patient’s needs and on the available facilities. Iron chelation therapy (ICT remains the backbone of NTDT management and is one of the most effective and practical ways of decreasing morbidity and mortality. The aim of this review is to describe the mechanism of IOL in NTDT, and the clinical complications that can develop as a result, in addition to the current and future therapeutic options available for the management of IOL in NTDT.

  3. Alloimmunization and autoimmunization in transfusion dependent thalassemia major patients: Study on 319 patients

    Directory of Open Access Journals (Sweden)

    Hari Krishan Dhawan

    2014-01-01

    Full Text Available Background: The development of anti-red blood cell antibodies (both allo-and autoantibodies remains a major problem in thalassemia major patients. We studied the frequency of red blood cell (RBC alloimmunization and autoimmunization among thalassemia patients who received regular transfusions at our center and analyzed the factors, which may be responsible for development of these antibodies. Materials and Methods: The study was carried out on 319 multiply transfused patients with β-thalassemia major registered with thalassemia clinic at our institute. Clinical and transfusion records of all the patients were examined for age of patients, age at initiation of transfusion therapy, total number of blood units transfused, transfusion interval, status of splenectomy or other interventions. Alloantibody screening and identification was done using three cell and 11 cell panel (Diapanel, Bio-rad, Switzerland respectively. To detect autoantibodies, autocontrol was carried out using polyspecific coombs (IgG + C3d gel cards. Results: Eighteen patients out of total 319 patients (5.64% developed alloantibodies and 90 (28.2% developed autoantibodies. Nine out of 18 patients with alloantibodies also had autoantibodies. Age at first transfusion was significantly higher in alloimmunized than non-immunized patients (P = 0.042. Out of 23 alloantibodies, 52.17% belonged to Rh blood group system (Anti-E = 17%, Anti D = 13%, Anti-C = 13%, Anti-C w = 9%, 35% belonged to Kell blood group system, 9% of Kidd and 4% of Xg blood group system. Conclusion: Alloimmunization was detected in 5.64% of multitransfused thalassemia patients. Rh and Kell blood group system antibodies accounted for more than 80% of alloantibodies. This study re-emphasizes the need for RBC antigen typing before first transfusion and issue of antigen matched blood (at least for Rh and Kell antigen. Early institution of transfusion therapy after diagnosis is another means of decreasing

  4. Limited clinical efficacy of azacitidine in transfusion-dependent, growth factor-resistant, low- and Int-1-risk MDS

    DEFF Research Database (Denmark)

    Holm, Mette; Dybedahl, I; Holm, Mette

    2014-01-01

    This prospective phase II study evaluated the efficacy of azacitidine (Aza)+erythropoietin (Epo) in transfusion-dependent patients with lower-risk myelodysplastic syndrome (MDS). Patients ineligible for or refractory to full-dose Epo+granulocyte colony stimulation factors for >8 weeks and a trans...... patients, but efficacy is limited, toxicity substantial and most responses of short duration. This treatment cannot be generally recommended in lower-risk MDS. Mutational screening revealed a high frequency of mutations....

  5. Transfusion-dependent anaemia of undetermined origin: a distinctive syndrome in paediatric medical tourism.

    Science.gov (United States)

    Lee, Anselm C W

    2012-07-01

    The underlying diagnosis of severe anaemic illnesses in children may not be easy to identify at times, especially when regular blood transfusion has been started. International children patients attending a haematology clinic for diagnostic evaluation were identified retrospectively if they had to receive repeated blood transfusions with an undiagnosed illness or an incorrect diagnosis. Their demographic data, presenting features, and eventual diagnosis were described. Twelve children including 7 boys were enrolled from March 2007 to August 2011. Five came from Vietnam; 2 each came from Bangladesh and Indonesia; and 1 each from Hong Kong, Myanmar, and Ukraine. Their illnesses started at a mean age of 1.5 years (0.1 to 6.6) and they had been receiving blood transfusion for a mean duration of 2.5 years (0.1 to 9.9) years prior to the evaluation. Thalassemia major was the fi rst diagnosis in 5 cases; one had been treated for autoimmune haemolytic anaemia while the rest had not been given a diagnosis. After the evaluation, 4 children were diagnosed with Diamond Blackfan anaemia, 3 were diagnosed with hereditary spherocytosis, and one each with hereditary pyropoikilocytosis, congenital sideroblastic anaemia, congenital thrombotic thrombocytopenic purpura, transient erythroblastopenia of childhood, and autoimmune myelofibrosis associated with human immunodeficiency virus infection. A definitive diagnosis can be identified in this cohort of children on medical tourism with severe anaemic illnesses requiring repeated transfusions with diagnostic approaches that circumvent the interference of transfused cells.

  6. Current Trends of Drug Resistance Patterns of Acinetobacter baumannii Infection in Blood Transfusion-dependent Thalassemia Patients.

    Science.gov (United States)

    Almani, Suhail Ahmed; Naseer, Ali; Maheshwari, Sanjay Kumar; Maroof, Pir; Naseer, Raza; Khoharo, Haji Khan

    2017-01-01

    The present study aimed to evaluate the current trends of drug resistance patterns of Acinetobacter baumannii infection in blood transfusion-dependent thalassemia patients. This study was a cross sectional study, conducted at the Liaquat University of Medical and Health Sciences, Jamshoro/Hyderabad, Sindh, Pakistan from October 2014 to January 2016. Of 921 blood samples, A. baumannii strains were isolated from 100 blood samples. Blood samples were processed for the isolation, identification, and drugs sensitivity as per the Clinical and Laboratory Standards Institute. A. baumannii strains were identified by microbiological methods and Gram's staining. API 20 E kit (Biomeriuex, USA) was also used for identification. Data were analyzed on Statisti × 8.1 (USA). Mean ± standard deviation age was 11.5 ± 2.8 years. Nearly 70% were male and 30% were female ( P = 0.0001). Of 921 blood transfusion-dependent thalassemia patients, 100 (10.8%) patients showed growth of A. baumannii . Drug resistance was observed against the ceftazidime, cefixime, cefepime, imipenem, meropenem, amikacin, minocycline, tigecycline, and tazocin except for the colistin. The present study reports drug-resistant A. baumannii in blood transfusion-dependent thalassemia patients. National multicenter studies are recommended to estimate the size of the problem.

  7. A pharmaco-economic evaluation of deferasirox for treating patients with iron overload caused by transfusion-dependent thalassemia in Taiwan

    Directory of Open Access Journals (Sweden)

    Wan-Ling Ho

    2013-04-01

    Conclusion: Compared with infusional deferoxamine, oral deferasirox improved clinical outcomes and quality of life in terms of iron chelation in transfusion-dependent patients with thalassemia at a reasonable cost from a healthcare perspective.

  8. Clinical Course of Homozygous Hemoglobin Constant Spring in Pediatric Patients.

    Science.gov (United States)

    Komvilaisak, Patcharee; Jetsrisuparb, Arunee; Fucharoen, Goonnapa; Komwilaisak, Ratana; Jirapradittha, Junya; Kiatchoosakun, Pakaphan

    2018-04-17

    Hemoglobin (Hb) Constant Spring is an alpha-globin gene variant due to a mutation of the stop codon resulting in the elongation of the encoded polypeptide from 141 to 172 amino acid residues. Patients with homozygous Hb Constant Spring are usually mildly anemic. We retrospectively describe clinical manifestations, diagnosis, laboratory investigations, treatment, and associated findings in pediatric patients with homozygous Hb Constant Spring followed-up at Srinagarind Hospital. Sixteen pediatric cases (5 males and 11 females) were diagnosed in utero (N=6) or postnatal (n=10). Eleven cases were diagnosed with homozygous Hb Constant Spring, 4 with homozygous Hb Constant Spring with heterozygous Hb E, and 1 with homozygous Hb Constant Spring with homozygous Hb E. Three cases were delivered preterm. Six patients had low birth weights. Clinical manifestations included fetal anemia in 6 cases, hepatomegaly in 1 case, hepatosplenomegaly in 2 cases, splenomegaly in 1 case. Twelve cases exhibited early neonatal jaundice, 9 of which required phototherapy. Six cases received red cell transfusions; 1 (3), >1 (3). After the first few months of life, almost all patients had mild microcytic hypochromic anemia and an increased reticulocyte count with a wide red cell distribution (RDW), but no longer required red cell transfusion. At 1 to 2 years of age, some patients still had mild microcytic hypochromic anemia and some had normocytic hypochromic anemia with Hb around 10 g/dL, increased reticulocyte count and wide RDW. Associated findings included hypothyroidism (2), congenital heart diseases (4), genitourinary abnormalities (3), gastrointestinal abnormalities (2), and developmental delay (1). Pediatric patients with homozygous Hb Constant Spring developed severe anemia in utero and up to the age of 2 to 3 months postnatal, requiring blood transfusions. Subsequently, their anemia was mild with no evidence of hepatosplenomegaly. Their Hb level was above 9 g/dL with hypochromic

  9. Transfusion in Haemoglobinopathies: Review and recommendations for local blood banks and transfusion services in Oman

    Directory of Open Access Journals (Sweden)

    Arwa Z. Al-Riyami

    2018-04-01

    Full Text Available Sickle cell disease and homozygous β-thalassaemia are common haemoglobinopathies in Oman, with many implications for local healthcare services. The transfusions of such patients take place in many hospitals throughout the country. Indications for blood transfusions require local recommendations and guidelines to ensure standardised levels of care. This article summarises existing transfusion guidelines for this group of patients and provides recommendations for blood banks and transfusion services in Oman. This information is especially pertinent to medical professionals and policy-makers developing required services for the standardised transfusion support of these patients.

  10. Reducing the iron burden and improving survival in transfusion-dependent thalassemia patients: current perspectives

    Directory of Open Access Journals (Sweden)

    Bayanzay K

    2016-08-01

    Full Text Available Karim Bayanzay, Lama Alzoebie Department of Hematology, Gulf Medical University, Ajman, United Arab Emirates Abstract: Hypertransfusion regimens for thalassemic patients revolutionized the management of severe thalassemia; transforming a disease which previously led to early infant death into a chronic condition. The devastating effect of the accrued iron from chronic blood transfusions necessitates a more finely tuned approach to limit the complications of the disease, as well as its treatment. A comprehensive approach including carefully tailored transfusion protocol, continuous monitoring and assessment of total body iron levels, and iron chelation are currently the mainstay in treating iron overload. There are also indications for ancillary treatments, such as splenectomy and fetal hemoglobin induction. The main cause of death in iron overload continues to be related to cardiac complications. However, since the widespread use of iron chelation started in the 1970s, there has been a general improvement in survival in these patients. Keywords: hematology, chelators, deferoxamine, deferiserox, deferiprone, liver iron concentration, iron overload, serum ferritin concentration, hepatic iron storage, iron chelation therapy

  11. Blood transfusions

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000431.htm Blood transfusions To use the sharing features on this page, ... There are many reasons you may need a blood transfusion: After knee or hip replacement surgery, or other ...

  12. Prevalence of hepatitis G virus in Pakistani children with transfusion dependent beta- thalassemia major.

    Science.gov (United States)

    Moatter, T; Adil, S; Haroon, S; Azeemuddin, S; Hassan, F; Khurshid, M

    1999-10-01

    We ought to obtain data on the prevalence of the newly discovered tranfusion transmittable hepatitis G virus in polytransfused b- thalassemia major children. Each individual had received multiple blood transfusions, from 12 to 36 per year. No documentation of prior hepatic infection was available. Serum samples were collected prospectively from the randomly selected subjects and were analyzed for HGV RNA by polymerase chain reaction using primer specific for two different regions of the HGV genome. Among the 100 individuals examined 21 were positive for HGV RNA. Four patients had evidence of dual infection, both HGV RNA and HCV RNA were isolated from their sera. While in one sample presence of both HGV RNA and HBV DNA was established. Only one child was positive for hepatitis E antibodies. The sera of 10 children were reactive for hepatitis B surface antigen whereas 35 individuals were positive for hepatitis C virus antibody. The ALT levels were variable in HGV infected children. Four out of 16 (25%) showed peak ALT levels of 218 IU/I, 8/16 (50%) children demonstrated slightly elevated ALT levels whereas 25% individuals showed normal ALT levels. Alkaline Phosphatase levels were elevated in 90% of the children and 20% patients of this series also had higher GGT levels. The observed AP levels were not statistically different among HGV, HGV/HCV or HGV/HBV groups. Even though the ALT levels were deranged in the children with HGV alone but none of the children had demonstrated symptoms of liver disease, their direct and total bilirubin levels were normal and no complain of jaundice was recorded. In conclusion, our findings suggested that like other blood borne hepatic viruses, HGV is also prevalent in the high risk group of multiple transfused patients in Pakistan but our results support the absence of any causal relationship between HGV and hepatitis.

  13. The spectrum of non-classical Diamond-Blackfan anemia: a case of late beginning transfusion dependency associated to a new RPL5 mutation

    Directory of Open Access Journals (Sweden)

    Piero Farruggia

    2012-04-01

    Full Text Available Diamond Blackfan anemia typically presents in infants and is often associated with many kinds of malformations. Severity of anemia often needs transfusional support in the first months of life. We describe here a patient with Diamond Blackfan anemia related to a RPL5 mutation. The patient had no physical abnormalities and experienced a very late onset of transfusion dependency.

  14. Vitamin D deficiency and its relationship with cardiac iron and function in patients with transfusion-dependent thalassemia at Chiang Mai University Hospital.

    Science.gov (United States)

    Dejkhamron, Prapai; Wejaphikul, Karn; Mahatumarat, Tuanjit; Silvilairat, Suchaya; Charoenkwan, Pimlak; Saekho, Suwit; Unachak, Kevalee

    2018-02-01

    Vitamin D deficiency is common in patients with thalassemia. Vitamin D deficiency could be related to cardiac dysfunction. Increased parathyroid hormone (PTH) is also known to be associated with heart failure. To determine the prevalence of Vitamin D deficiency and to explore the impact of Vitamin D deficiency on cardiac iron and function in patients with transfusion-dependent thalassemia. A cross-sectional study in patients with Transfusion-dependent thalassemia was conducted. Patients with liver disease, renal disease, type 1 diabetes, malabsorption, hypercortisolism, malignancy, and contraindication for MRI were excluded. Calcium, phosphate, PTH, vitamin D-25OH were measured. CardiacT2 * and liver iron concentration (LIC) and left ventricular ejection fraction (LVEF) were determined. Results Sixty-one (33M/28F) patients with Transfusion-dependent thalassemia were enrolled. The prevalence of Vitamin D deficiency was 50.8%. Patients with cardiac siderosis had tendency for lower D-25OH than those without siderosis (15.9 (11.7-20.0) vs. 20.2 (15.85-22.3) ng/mL); p = 0.06). Serum calcium, phosphate, PTH, LIC, cardiac T2 * , and LVEF were not different between the groups with or without Vitamin D deficiency. Patients with Vitamin D deficiency had significantly lower hemoglobin levels compared to those without Vitamin D deficiency (7.5 (6.93-8.33) vs. 8.1 (7.30-8.50) g/dL; p = 0.04). The median hemoglobin in the last 12 months was significantly correlated with D-25OH. Cardiac T2 * had significant correlation with PTH. Vitamin D deficiency is prevalent in patients with Transfusion-dependent thalassemia. Vitamin D level is correlated with hemoglobin level. Vitamin D status should be routinely assessed in these patients. Low PTH is correlated with increased cardiac iron. This study did not demonstrate an association between Vitamin D deficiency and cardiac iron or function in patients with Transfusion-dependent thalassemia.

  15. Homozygous familial hypercholesterolaemia

    DEFF Research Database (Denmark)

    Cuchel, Marina; Bruckert, Eric; Ginsberg, Henry N

    2014-01-01

    AIMS: Homozygous familial hypercholesterolaemia (HoFH) is a rare life-threatening condition characterized by markedly elevated circulating levels of low-density lipoprotein cholesterol (LDL-C) and accelerated, premature atherosclerotic cardiovascular disease (ACVD). Given recent insights into the......AIMS: Homozygous familial hypercholesterolaemia (HoFH) is a rare life-threatening condition characterized by markedly elevated circulating levels of low-density lipoprotein cholesterol (LDL-C) and accelerated, premature atherosclerotic cardiovascular disease (ACVD). Given recent insights...... into the heterogeneity of genetic defects and clinical phenotype of HoFH, and the availability of new therapeutic options, this Consensus Panel on Familial Hypercholesterolaemia of the European Atherosclerosis Society (EAS) critically reviewed available data with the aim of providing clinical guidance...... 5 and no later than 8 years. The number of therapeutic approaches has increased following approval of lomitapide and mipomersen for HoFH. Given the severity of ACVD, we recommend regular follow-up, including Doppler echocardiographic evaluation of the heart and aorta annually, stress testing and...

  16. Complications of Transfusion-Dependent β-Thalassemia Patients in Sistan and Baluchistan, South-East of Iran

    Science.gov (United States)

    Yaghobi, Maryam; Miri-Moghaddam, Ebrahim; Majid, Naderi; Bazi, Ali; Navidian, Ali; Kalkali, Asiyeh

    2017-01-01

    Background: Thalassemia syndromes are among prevalent hereditary disorders imposing high expenses on health-care system worldwide and in Iran. Organ failure represents a life-threatening challenge in transfusion- dependent β-thalassemia (TDT) patients. The purpose of the present study was to determine the frequency of organ dysfunctions among TDT patients in Sistan and Baluchistan province in South-East of Iran. Materials and Methods: Laboratory and clinical data were extracted from medical records as well as by interviews. Standard criteria were applied to recognize cardiac, gonadal, endocrine and renal dysfunctions. The collected data were analyzed using the SPSS statistics software (Ver.19). Results: A total of 613 TDT patients (54.3% males and 45.7% females) were included in this study. The mean age of patients was 13.3 ±7.7 years old. Cardiac events comprised the most encountered complications (76.4%), following by hypogonadism (46.8%), parathyroid dysfunction (22%), thyroid abnormalities (8.3%), diabetes (7.8%) and renal disease (1.8%). Hypogonadism comprised the most identified complication in patient 15 years old (P<0.01). Conclusion: As cardiac events are significantly more common among TDT patients, close monitoring of the heart function is recommended for identifying patients with cardiac problems. PMID:29340121

  17. Blood Transfusion

    Science.gov (United States)

    ... transfusions, you're at risk of developing iron overload, which, if not treated, can damage your heart ... of proteins in plasma that play a key role in preventing infection. Severely low levels of gamma ...

  18. Transfusion Medicine

    Directory of Open Access Journals (Sweden)

    Smit Sibinga CT

    2013-07-01

    Full Text Available Cees Th. Smit Sibinga ID Consulting, Zuidhorn, The NetherlandsTransfusion Medicine is a bridging science, spanning the evidence-based practice at the bedside with the social sciences in the community.     Transfusion Medicine starts at the bedside. Surprisingly, only recently that has become rediscovered with the development of ‘patient blood management’ and ‘patient centered’ approaches to allow the growth of an optimal and rational patient care through supportive hemotherapy – safe and effective, affordable and accessible.1    Where transfusion of blood found its origin in the need of a patient, it has drifted away for a long period of time from the bedside and has been dominated for almost a century by laboratory sciences. At least the first ten editions of the famous and well reputed textbook Mollison’s Blood Transfusion in Clinical Medicine contained only a fraction on the actual bedside practice of transfusion medicine and did not focus at all on patient blood management.2    This journal will focus on all aspects of the transfusion chain that immediately relate to the bedside practice and clinical use of blood and its components, and plasma derivatives as integral elements of a human transplant tissue. That includes legal and regulatory aspects, medical, ethical and cultural aspects, pure science and pathophysiology of disease and the impact of transfusion of blood, as well as aspects of the epidemiology of blood transfusion and clinical indications, and cost-effectiveness. Education through timely and continued transfer of up to date knowledge and the application of knowledge in clinical practice to develop and maintain clinical skills and competence, with the extension of current educational approaches through e-learning and accessible ‘apps’ will be given a prominent place.

  19. Red Blood Cell Transfusion Dependency and Hyperferritinemia Are Associated with Impaired Survival in Patients Diagnosed with Myelodysplastic Syndromes: Results from the First Polish MDS-PALG Registry.

    Science.gov (United States)

    Waszczuk-Gajda, Anna; Mądry, Krzysztof; Machowicz, Rafał; Drozd-Sokołowska, Joanna; Stella-Hołowiecka, Beata; Mital, Andrzej; Obara, Agata; Szmigielska-Kapłon, Anna; Sikorska, Anna; Subocz, Edyta; Jędrzejczak, Wiesław W; Dwilewicz-Trojaczek, Jadwiga

    2016-01-01

    Myelodysplastic syndromes (MDS) are a heterogeneous group of clonal stem cell disorders characterized by ineffective hematopoiesis, cytopenias and a risk of progression to acute myeloid leukemia (AML). Anemia is the most frequent cytopenia diagnosed in patients with MDS. Regular RBC transfusions are the only treatment option for about 40% of patients. Transfusion-dependent patients develop secondary iron overload. The influence of serum ferritin (SF) concentration on survival and acute myeloid leukemia transformation in MDS patients remains controversial. The data for the Central European population is scarce and so far there is no description for Poland. The aim of this study was to perform a retrospective analysis of the relationship of SF concentration with red blood cell transfusion dependency, survival and transformation to acute myeloid leukemia. We retrospectively evaluated the data of the 819 MDS patients (58% male; median age 70 years) included in the MDS Registry of the MDS Section of the Polish Adult Leukemia Group (PALG). Analyses were performed on 190 patients diagnosed with MDS, maximal 6 months before inclusion to the registry in order to avoid selection bias (a shorter survival of higher risk MDS patients). Patients with hyperferritinemia higher than 1000 ng/L vs. patients with SF concentration lower than 1000 ng/L had a median survival of 320 days vs. 568 days, respectively (p log-rank = 0.014). The following factors were found to significantly worsen survival: RBC-transfusion dependence (p = 0.0033; HR 2.67L), platelet transfusion dependence (p = 0.0071; HR 3.321), hemoglobin concentration lower than 10 g/dL (p = 0.0036; HR 2.97), SF concentration higher than 1000 ng/L (p = 0.0023; HR = 2.94), platelet count lower than 10 G/L (p = 0.0081 HR = 5.04), acute leukemia transformation (p = 0.0081; HR 1.968). Taking into account the relatively low number of patients in previous studies exploring hyperferritinemia in MDS, the results of the first Polish

  20. Transfusion strategy

    DEFF Research Database (Denmark)

    Jakobsen, Carl-Johan

    2014-01-01

    Blood transfusion is associated with increased morbidity and mortality and numerous reports have emphasised the need for reduction. Following this there is increased attention to the concept of patient blood management. However, bleeding is relatively common following cardiac surgery and is furth....... In conclusion the evidence supports that each institution establishes its own patient blood management strategy to both conserve blood products and maximise outcome.......Blood transfusion is associated with increased morbidity and mortality and numerous reports have emphasised the need for reduction. Following this there is increased attention to the concept of patient blood management. However, bleeding is relatively common following cardiac surgery and is further...

  1. Urinary iron excretion induced by intravenous infusion of deferoxamine in ß-thalassemia homozygous patients

    Directory of Open Access Journals (Sweden)

    Boturão-Neto E.

    2002-01-01

    Full Text Available The purpose of the present study was to identify noninvasive methods to evaluate the severity of iron overload in transfusion-dependent ß-thalassemia and the efficiency of intensive intravenous therapy as an additional tool for the treatment of iron-overloaded patients. Iron overload was evaluated for 26 ß-thalassemia homozygous patients, and 14 of them were submitted to intensive chelation therapy with high doses of intravenous deferoxamine (DF. Patients were classified into six groups of increasing clinical severity and were divided into compliant and non-compliant patients depending on their adherence to chronic chelation treatment. Several methods were used as indicators of iron overload. Total gain of transfusion iron, plasma ferritin, and urinary iron excretion in response to 20 to 60 mg/day subcutaneous DF for 8 to 12 h daily are useful to identify iron overload; however, urinary iron excretion in response to 9 g intravenous DF over 24 h and the increase of urinary iron excretion induced by high doses of the chelator are more reliable to identify different degrees of iron overload because of their correlation with the clinical grades of secondary hemochromatosis and the significant differences observed between the groups of compliant and non-compliant patients. Finally, the use of 3-9 g intravenous DF for 6-12 days led to a urinary iron excretion corresponding to 4.1 to 22.4% of the annual transfusion iron gain. Therefore, continuous intravenous DF at high doses may be an additional treatment for these patients, as a complement to the regular subcutaneous infusion at home, but requires individual planning and close monitoring of adverse reactions.

  2. Safety and efficacy of the CD95-ligand inhibitor asunercept in transfusion-dependent patients with low and intermediate risk MDS.

    Science.gov (United States)

    Boch, Tobias; Luft, Thomas; Metzgeroth, Georgia; Mossner, Maximilian; Jann, Johann-Christoph; Nowak, Daniel; Meir, Franziska La; Schumann, Christiane; Klemmer, Jennifer; Brendel, Susanne; Fricke, Harald; Kunz, Claudia; Weiß, Christel; Hofmann, Wolf-Karsten; Nolte, Florian

    2018-05-01

    In low risk MDS, increased apoptosis of erythroid progenitors mediated via CD95 (Fas) activation has been described to result in peripheral cytopenia. Blockade of the CD95 system can improve erythropoiesis in MDS. Asunercept (APG101) is a fusion protein consisting of the extracellular domain of human CD95 and the Fc domain of human IgG1 blocking the interaction between CD95 and its ligand. Here we report on results from a phase I study in 20 transfusion-dependent low and intermediate risk MDS patients treated with intravenous asunercept (EudraCT 2012-003027-37). Primary objectives were safety and tolerability as well as pharmacodynamic effects. Secondary objectives were hematologic improvement, incidence and time to leukemic progression as well as overall survival. Frequency and severity of adverse events were in range of what could be expected in a patient cohort comprising of elderly MDS patients. Two patients experienced a serious adverse event with a suspected relationship to asunercept. The incidence of disease progression was low. In the 20 patients a decrease of the transfusion need from a mean of 10,8 (±5,1) pRBCs during the 12 weeks treatment phase to a mean of 10,0 (±4,2) pRBCs at the end of the study was observed. In conclusion, asunercept was well tolerated and showed efficacy in transfusion-dependent low and intermediate risk MDS patients. Further clinical investigation is warranted, particularly in combination with erythropoiesis stimulating agents (ESAs). Copyright © 2018. Published by Elsevier Ltd.

  3. Transfusion medicine

    International Nuclear Information System (INIS)

    Murawski, K.; Peetoom, F.

    1986-01-01

    These proceedings contain 24 selections, including papers presented at the conference of American Red Cross held in May 1985, on the Subject of transfusion medicine. Some of the titles are: Fluosol/sup R/-DA in Radiation Therapy; Expression of Cloned Human Factor VIII and the Molecular Basis of Gene Defects that Cause Hemophilia; DNA-Probing Assay in the Detection of Hepatitis B Virus Genome in Human Peripheral Blood Cells; and Monoclonal Antibodies: Convergence of Technology and Application

  4. Blood Transfusion and Donation

    Science.gov (United States)

    ... people in the United States receive life-saving blood transfusions. During a transfusion, you receive whole blood or ... have liver failure or a severe infection. Most blood transfusions go very smoothly. Some infectious agents, such as ...

  5. Frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism in patients with homozygous/compound heterozygous beta thalassaemia.

    Science.gov (United States)

    Ali, Nadir; Ayyub, Muhammad; Khan, Saleem Ahmed; Ahmed, Suhaib; Abbas, Kazim; Malik, Hamid Saeed; Tashfeen, Sunila

    2015-03-01

    Response to hydroxyurea therapy in homozygous or compound heterozygous beta thalassaemia (BT) has been reported as more favourable in the presence of XmnI polymorphism. The prevalence of XmnI polymorphism may vary with BT phenotypes and genotypes, and differs geographically in distribution. Prevalence of XmnI polymorphism is not known in northern Pakistan. To determine the frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism (XmnI polymorphism) in patients with homozygous or compound heterozygous beta thalassaemia. Polymerase chain reaction (PCR) for common beta thalassaemia mutations and Gγ-globin promoter -158 (C>T) XmnI polymorphism was performed on 107 blood samples of transfusion dependent beta thalassaemia (BT) patients in Pakistan. One hundred samples of unrelated BT traits and 94 samples of healthy subjects as controls were also analysed for BT mutations and XmnI polymorphism. Out of 301 DNA samples, XmnI polymorphism was detected in 71(24%); in normal controls, XmnI polymorphism was detected in 34/94 (36%) subjects; while in homozygous/compound heterozygous BT, it was detected in 14/107(13%) patients (Fisher's exact test, p=.0002). In heterozygous BT group, XmnI polymorphism was detected in 23/100 subjects (Fisher's exact test, p=.03 with normal controls, and p=.049 with homozygous/compound heterozygous BT). The most common BT genotype was Frame Shift (Fr) 8-9/Fr 8-9, and none of the patients with this genotype had XmnI polymorphism. The second most common genotype was IVSI-5/IVSI-5; 4/26 (15%). Cases with this genotype had XmnI polymorphism. XmnI polymorphism in homozygous/compound heterozygous BT group is 13%. The most common genotype associated with XmnI polymorphism was IVSI-5/IVSI-5. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

  6. Blood Transfusions (For Teens)

    Science.gov (United States)

    ... Staying Safe Videos for Educators Search English Español Blood Transfusions KidsHealth / For Teens / Blood Transfusions What's in this ... in his or her body. What Is a Blood Transfusion? A transfusion is a simple medical procedure that ...

  7. Epidemiology of massive transfusion

    DEFF Research Database (Denmark)

    Halmin, M A; Chiesa, F; Vasan, S K

    2015-01-01

    and to describe characteristics and mortality of massively transfused patients. Methods: We performed a retrospective cohort study based on the Scandinavian Donations and Transfusions (SCANDAT2) database, linking data on blood donation, blood components and transfused patients with inpatient- and population.......4% among women transfused for obstetrical bleeding. Mortality increased gradually with age and among all patients massively transfused at age 80 years, only 26% were alive [TABLE PRESENTED] after 5 years. The relative mortality, early after transfusion, was high and decreased with time since transfusion...

  8. Cost effectiveness of once-daily oral chelation therapy with deferasirox versus infusional deferoxamine in transfusion-dependent thalassaemia patients: US healthcare system perspective.

    Science.gov (United States)

    Delea, Thomas E; Sofrygin, Oleg; Thomas, Simu K; Baladi, Jean-Francois; Phatak, Pradyumna D; Coates, Thomas D

    2007-01-01

    Deferasirox is a recently approved once-daily oral iron chelator that has been shown to reduce liver iron concentrations and serum ferritin levels to a similar extent as infusional deferoxamine. To determine the cost effectiveness of deferasirox versus deferoxamine in patients with beta-thalassaemia major from a US healthcare system perspective. A Markov model was used to estimate the total additional lifetime costs and QALYs gained with deferasirox versus deferoxamine in patients with beta-thalassaemia major and chronic iron overload from blood transfusions. Patients were assumed to be 3 years of age at initiation of chelation therapy and to receive prescribed dosages of deferasirox and deferoxamine that have been shown to be similarly effective in such patients. Compliance with chelation therapy and probabilities of iron overload-related cardiac disease and death by degree of compliance were estimated using data from published studies. Costs ($US, year 2006 values) of deferoxamine administration and iron overload-related cardiac disease were based on analyses of health insurance claims of transfusion-dependent thalassaemia patients. Utilities were based on a study of patient preferences for oral versus infusional chelation therapy, as well as published literature. Probabilistic and deterministic sensitivity analyses were employed to examine the robustness of the results to key assumptions. Deferasirox resulted in a gain of 4.5 QALYs per patient at an additional expected lifetime cost of $US126,018 per patient; the cost per QALY gained was $US28,255. The cost effectiveness of deferasirox versus deferoxamine was sensitive to the estimated costs of deferoxamine administration and the quality-of-life benefit associated with oral versus infusional therapy. Cost effectiveness was also relatively sensitive to the equivalent daily dose of deferasirox, and the unit costs of deferasirox and deferoxamine, and was more favourable in younger patients. Results of this analysis

  9. Magnetic resonance imaging signal reduction may precede volume loss in the pituitary gland of transfusion-dependent beta-thalassemic patients

    Energy Technology Data Exchange (ETDEWEB)

    Hekmatnia, Ali; Rahmani, Ali Asghar; Adibi, Atoosa (Image Processing and Signal Research Center, Dept. of Radiology, Isfahan Univ. of Medical Sciences, Isfahan (Iran)); Radmard, Amir Reza (Dept. of Radiology, Shariati Hospital, Tehran Univ. of Medical Sciences, Tehran (Iran)); Khademi, Hooman (Shariati Hospital, Tehran Univ. of Medical Sciences, Tehran (Iran)), e-mail: radmard@ams.ac.ir

    2010-01-15

    Background: Pituitary iron overload in patients with transfusion-dependent beta-thalassemia may lead to delayed puberty. Magnetic resonance imaging (MRI) has the potential to estimate tissue iron concentration by detecting its paramagnetic effect and hypophyseal damage by measuring its dimensions indirectly. Purpose: To investigate the association of pituitary MRI findings and pubertal status in thalassemic patients as well as to demonstrate any priority in appearance of them. Material and Methods: Twenty-seven beta-thalassemic patients, aged 15-25 years, were divided into 13 with (group A) and 14 without hypogonadism (group B), matched by age, gender, duration of transfusion, and chelation therapy. Thirty-eight age- and sex-adjusted healthy control individuals were also included (group C). All participants underwent pituitary MRI using a 1.5T unit. Pituitary-to-fat signal intensity ratios (SIR) were calculated from coronal T2-weighted images. Estimated pituitary volumes were measured using pituitary height, width, and length on T1-weighted images. Results: The mean values of pituitary-to-fat SIRs were significantly lower in group A as compared with group B (P <0.001), and likewise group B had statistically lower values than group C (P=0.03). The pituitary height and volume were significantly decreased in group A compared to group B (P = 0.006 and P = 0.002, respectively), while these differences did not demonstrate statistically significance between groups B and C. Conclusion: Pituitary MRI findings such as signal intensity reduction and decrease in volume can be useful markers in estimating pituitary dysfunction in beta-thalassemic patients. Compared to healthy controls, lower values of pituitary-to-fat SIRs in thalassemic patients experiencing normal puberty, without marked decrease in volume, indicate that signal reduction may precede volume loss and could be expected first on MRI

  10. Acute splenic sequestration in a pregnant woman with homozygous sickle-cell anemia

    Directory of Open Access Journals (Sweden)

    Carolina Bastos Maia

    Full Text Available CONTEXT Homozygous (SS sickle-cell anemia complicated by acute splenic sequestration in adults is a rare event, and it has never been reported during pregnancy. CASE REPORT A 25-year-old woman with homozygous (SS sickle-cell disease was hospitalized at 32 weeks' of gestation presenting weakness, abdominal pain, fever and hemoglobin of 2.4 g/dl. Abnormal fetal heart rate was detected by means of cardiotocography, and 5 units of packed red cells were transfused. Cesarean was performed at 37 weeks. Both mother and baby were discharged in a good general condition. CONCLUSION This case report demonstrates the importance of immediate blood transfusion for treatment of fetal distress in cases of splenic sequestration during pregnancy. This treatment is essential for avoiding maternal and fetal complications.

  11. Acute splenic sequestration in a pregnant woman with homozygous sickle-cell anemia.

    Science.gov (United States)

    Maia, Carolina Bastos; Nomura, Roseli Mieko Yamamoto; Igai, Ana Maria Kondo; Fonseca, Guilherme Hencklain; Gualandro, Sandra Menosi; Zugaib, Marcelo

    2013-01-01

    Homozygous (SS) sickle-cell anemia complicated by acute splenic sequestration in adults is a rare event, and it has never been reported during pregnancy. A 25-year-old woman with homozygous (SS) sickle-cell disease was hospitalized at 32 weeks' of gestation presenting weakness, abdominal pain, fever and hemoglobin of 2.4 g/dl. Abnormal fetal heart rate was detected by means of cardiotocography, and 5 units of packed red cells were transfused. Cesarean was performed at 37 weeks. Both mother and baby were discharged in a good general condition. This case report demonstrates the importance of immediate blood transfusion for treatment of fetal distress in cases of splenic sequestration during pregnancy. This treatment is essential for avoiding maternal and fetal complications.

  12. Transfusion reaction - hemolytic

    Science.gov (United States)

    ... Names Blood transfusion reaction Images Surface proteins causing rejection References Choate JD, Maitta RW, Tormey CA, Wu ... PA: Elsevier Saunders; 2016:chap 177. Hall JE. Blood types; transfusion; tissue and organ transplantation. In: Hall JE, ...

  13. Transfusion Related Emergencies

    OpenAIRE

    Osborn, Megan Boysen; Tran, Min-Ha

    2016-01-01

    Audience: This exercise is appropriate for all emergency medicine learners (residents and medical students) and learners from other specialties (internal medicine, family medicine, anesthesia). Introduction: About 85 million red blood cell units are transfused worldwide each year. Transfusion reactions can complicate up to 8% of blood transfusions and can range from benign to life threatening. An emergency physician must be able to discuss the risks and benefits of blood transfusion...

  14. Blood Transfusion (For Parents)

    Science.gov (United States)

    ... Staying Safe Videos for Educators Search English Español Blood Transfusions KidsHealth / For Parents / Blood Transfusions What's in this ... and help put your child at ease. About Blood Transfusions Blood is like the body's transportation system. As ...

  15. Liver disease in adult transfusion-dependent beta-thalassaemic patients: investigating the role of iron overload and chronic HCV infection.

    Science.gov (United States)

    Kountouras, Dimitrios; Tsagarakis, Nikolaos J; Fatourou, Evangelia; Dalagiorgos, Efthimios; Chrysanthos, Nikolaos; Berdoussi, Helen; Vgontza, Niki; Karagiorga, Markissia; Lagiandreou, Athanasios; Kaligeros, Konstantinos; Voskaridou, Ersi; Roussou, Paraskevi; Diamanti-Kandarakis, Evanthia; Koskinas, John

    2013-03-01

    Iron overload and hepatitis-C virus (HCV) infection, have been implicated in the evolution of liver disease, in patients with transfusion-dependent beta-thalassaemia major (BTM). However, the impact of these factors in late stages of liver disease in adults with BTM, has not been extensively studied. To investigate serum indices of iron overload, HCV infection and liver disease, in a cohort of 211 adult Greek patients with BTM, in relation with the findings from liver biopsies. In this cross-sectional study, 211 patients with BTM were enrolled and studied, in relation with HCV infection, ferritin, transaminases, chelation treatment and antiviral treatment. Based on 109 patients biopsied, we correlated liver fibrosis, haemosiderosis and inflammation, with serum indices and HCV status Among all patients, 74.4% were anti-HCV positive (HCV+). Ferritin was positively correlated with transaminases and negatively correlated with age, while it was not significantly different among HCV+ and HCV- patients. Among the HCV+ patients, 55.4% reported antiviral treatment, while genotype 1 predominated. In a subfraction of 109 patients, in which liver biopsy was performed, 89% were HCV+ and 11% HCV-. Fibrosis was significantly correlated with age (P = 0.046), AST (P = 0.004), ALT (P = 0.044) and inflammation (P overload may be the critical determinant, since fibrosis is related to the minimal haemosiderosis, independently of HCV history. © 2012 John Wiley & Sons A/S.

  16. Transfusion issues in surgery

    Directory of Open Access Journals (Sweden)

    Paramjit Kaur

    2013-01-01

    Full Text Available Transfusion, just as any other medical intervention has both benefits and risks, which should be balanced for each patient so that the benefits outweigh the risks. Blood and its products are considered drugs and hence careful consideration of therapy is essential to minimize the potential adverse reactions. Moreover, alternative modes of treatment should be considered and final decision to transfuse should be based on individual patient evaluation. Reviews of blood transfusion practices have found that most surgical procedures do not require blood transfusion. This review is focused on the transfusion needs of the surgical patients.

  17. Survival after blood transfusion

    DEFF Research Database (Denmark)

    Kamper-Jørgensen, Mads; Ahlgren, Martin; Rostgaard, Klaus

    2008-01-01

    of transfusion recipients in Denmark and Sweden followed for up to 20 years after their first blood transfusion. Main outcome measure was all-cause mortality. RESULTS: A total of 1,118,261 transfusion recipients were identified, of whom 62.0 percent were aged 65 years or older at the time of their first...... the SMR remained significantly 1.3-fold increased. CONCLUSION: The survival and relative mortality patterns among blood transfusion recipients were characterized with unprecedented detail and precision. Our results are relevant to assessments of the consequences of possible transfusion-transmitted disease...... as well as for cost-benefit estimation of new blood safety interventions....

  18. PROGRESS IN BLOOD TRANSFUSION SERVICES IN KENYA ...

    African Journals Online (AJOL)

    2009-12-02

    Dec 2, 2009 ... Background: Provision of safe and adequate supplies of blood is dependent on a well organised blood ... effective legislative policies governing operations of blood transfusion .... policy and push for semi autonomy. (iv) Put up ...

  19. Developments in the treatment of transfusion-dependent anemia in patients with myelodysplastic syndromes: epidemiology, etiology, genetics, and targeted therapies

    Directory of Open Access Journals (Sweden)

    Raza A

    2014-07-01

    Full Text Available Azra Raza, Nicholas Iverson, Abdullah M AliThe MDS Center, Columbia University, New York, NY, USAAbstract: Myelodysplastic syndromes are malignant hematopoietic stem cell disorders that present with variable cytopenias and predominantly affect the elderly. Treatment options are limited, with allogeneic transplant being the only potentially curative strategy. Recent mutational profiling studies have led to cataloguing of driver and passenger mutations most commonly affecting the epigenetic regulators and genes involved in RNA splicing. Despite improved understanding of the disease biology, these emerging molecular insights have not led to identification of novel therapeutic strategies. Although several drugs approved in the last decade improve the cytopenias, the relief is temporary, most likely due to the sequential activation of clones. Future advances depend upon identification of signaling pathways in dominant clones and targeting these with agents that might be known but need to be matched to suit the needs of individual patients in a longitudinal, dynamic fashion. Myelodysplastic syndromes are ideally suited for the development of such personalized medicine.Keywords: cancer, epigenetics, iron, MDS, myelodysplasia, splicing

  20. [Ethics and blood transfusion].

    Science.gov (United States)

    Tissot, J-D; Garraud, O; Danic, B; Cabaud, J-J; Lefrère, J-J

    2013-09-01

    Blood donation is an act of solidarity. Most often, this act is done on a volunteer basis and, depending on countries and circumstances, is not remunerated. The increase in need, the always-greater number of deferral criteria, the safety issues and the changes in the structures of our societies are among the many subjects for ethical debates. Taking these into account, the actors of the transfusion must analyze certain parameters: the value of a donation, the meaning of volunteering, the appropriateness of remunerating the act of giving a part of one's self, no longer as a donation or an expression of altruism and solidarity, but as a commercial act regimented by economic laws. Copyright © 2013. Published by Elsevier SAS.

  1. Limited clinical efficacy of azacitidine in transfusion-dependent, growth factor-resistant, low- and Int-1-risk MDS: Results from the nordic NMDSG08A phase II trial

    International Nuclear Information System (INIS)

    Tobiasson, M; Dybedahl, I; Holm, M S; Karimi, M; Brandefors, L; Garelius, H; Grövdal, M; Högh-Dufva, I; Grønbæk, K; Jansson, M; Marcher, C; Nilsson, L; Kittang, A O; Porwit, A; Saft, L; Möllgård, L; Hellström-Lindberg, E

    2014-01-01

    This prospective phase II study evaluated the efficacy of azacitidine (Aza)+erythropoietin (Epo) in transfusion-dependent patients with lower-risk myelodysplastic syndrome (MDS). Patients ineligible for or refractory to full-dose Epo+granulocyte colony stimulation factors for >8 weeks and a transfusion need of ⩾4 units over 8 weeks were included. Aza 75 mg m −2 d −1 , 5/28 days, was given for six cycles; non-responding patients received another three cycles combined with Epo 60 000 units per week. Primary end point was transfusion independence (TI). All patients underwent targeted mutational screen for 42 candidate genes. Thirty enrolled patients received ⩾one cycle of Aza. Ten patients discontinued the study early, 7 due to adverse events including 2 deaths. Thirty-eight serious adverse events were reported, the most common being infection. Five patients achieved TI after six cycles and one after Aza+Epo, giving a total response rate of 20%. Mutational screening revealed a high frequency of recurrent mutations. Although no single mutation predicted for response, SF3A1 (n=3) and DNMT3A (n=4) were only observed in non-responders. We conclude that Aza can induce TI in severely anemic MDS patients, but efficacy is limited, toxicity substantial and most responses of short duration. This treatment cannot be generally recommended in lower-risk MDS. Mutational screening revealed a high frequency of mutations

  2. Platelet alloimmunization after transfusion

    DEFF Research Database (Denmark)

    Taaning, E; Simonsen, A C; Hjelms, E

    1997-01-01

    BACKGROUND AND OBJECTIVES: The frequency of platelet-specific antibodies after one series of blood transfusions has not been reported, and in multiply transfused patients is controversial. MATERIALS AND METHODS: We studied the frequency of alloimmunization against platelet antigens in 117 patient...

  3. Transfusion practices in trauma

    Directory of Open Access Journals (Sweden)

    V Trichur Ramakrishnan

    2014-01-01

    Full Text Available Resuscitation of a severely traumatised patient with the administration of crystalloids, or colloids along with blood products is a common transfusion practice in trauma patients. The determination of this review article is to update on current transfusion practices in trauma. A search of PubMed, Google Scholar, and bibliographies of published studies were conducted using a combination of key-words. Recent articles addressing the transfusion practises in trauma from 2000 to 2014 were identified and reviewed. Trauma induced consumption and dilution of clotting factors, acidosis and hypothermia in a severely injured patient commonly causes trauma-induced coagulopathy. Early infusion of blood products and early control of bleeding decreases trauma-induced coagulopathy. Hypothermia and dilutional coagulopathy are associated with infusion of large volumes of crystalloids. Hence, the predominant focus is on damage control resuscitation, which is a combination of permissive hypotension, haemorrhage control and haemostatic resuscitation. Massive transfusion protocols improve survival in severely injured patients. Early recognition that the patient will need massive blood transfusion will limit the use of crystalloids. Initially during resuscitation, fresh frozen plasma, packed red blood cells (PRBCs and platelets should be transfused in the ratio of 1:1:1 in severely injured patients. Fresh whole blood can be an alternative in patients who need a transfusion of 1:1:1 thawed plasma, PRBCs and platelets. Close monitoring of bleeding and point of care coagulation tests are employed, to allow goal-directed plasma, PRBCs and platelets transfusions, in order to decrease the risk of transfusion-related acute lung injury.

  4. Epidemiology of Massive Transfusion

    DEFF Research Database (Denmark)

    Halmin, Märit; Chiesa, Flaminia; Vasan, Senthil K

    2016-01-01

    in Sweden from 1987 and in Denmark from 1996. A total of 92,057 patients were included. Patients were followed until the end of 2012. MEASUREMENTS AND MAIN RESULTS: Descriptive statistics were used to characterize the patients and indications. Post transfusion mortality was expressed as crude 30-day...... mortality and as long-term mortality using the Kaplan-Meier method and using standardized mortality ratios. The incidence of massive transfusion was higher in Denmark (4.5 per 10,000) than in Sweden (2.5 per 10,000). The most common indication for massive transfusion was major surgery (61.2%) followed...

  5. Outcomes in transfusion.

    Science.gov (United States)

    Sherman, L A

    1999-07-01

    Outcomes data in medicine can be limited by subjective methodologic issues such as poor selection of end points and use of nonvalidated systems for quality adjustment. Blood transfusion analyses are further complicated by the fact that transfusion seldom is primary therapy but is usually supportive or adjunctive. Thus, much of the outcome data in transfusion medicine are either unavailable or in one of two areas. The first area is prevention of bad sequelae of various cytopenias or factor deficiencies. The second is decreasing adverse effects of transfusion itself. A different useful area for outcome and root cause approaches in individual institutions is examining preanalytical and postanalytical processes of their own. Examples are sample labeling accuracy, quality and timeliness of blood suppliers, internal delivery processes and times, and product wastage. Use review can be changed to real time from retrospective time. By reducing complaints about service to objective data, realistic change can be made in internal and external processes.

  6. Assessment of Iron Overload in Homozygous and Heterozygous Beta Thalassemic Children below 5 Years of Age

    Directory of Open Access Journals (Sweden)

    Dhiraj J. Trivedi

    2014-07-01

    Full Text Available Background: Thalassemia is a genetic disease having 3-7% carrier rate in Indians. It is transfusion dependent anemia having high risk of iron overloading. A clinical symptom of iron overload becomes detectable in second decade causing progressive liver, heart and endocrine glands damage. There is a need to assess iron overload in thalassemics below 5 years of age to protect them from complications at later age of life. Aims and objectives: Present study was undertaken to estimate serum iron status and evaluate serum transferrin saturation in both homozygous & heterozygous form of thalassemia as an index of iron overload among children of one to five years of age. Materials and Methods: Clinically diagnosed thirty cases of β thalassemia major & thirty cases of β thalassemia minor having severe anemia, hepatospleenomegaly and between 1 year to 5 years of age were included in study group and same age matched healthy controls were included in the study. RBC indices and HbA, HbA2 and HbF were estimated along with serum iron & serum Total Iron Binding Capacity (TIBC and serum transferrin levels. Results: Significant difference was observed in hemoglobin levels between control and both beta thalassemia groups. Mean Corpuscular Volume (MCV and Mean Corpuscular Hemoglobin (MCH values were reduced. Hemoglobin electrophoresis showed the elevated levels of HbF and HbA2 in both beta thalassemia groups. Among serum iron parameters, serum iron, TIBC and transferrin saturation were elevated whereas serum transferrin levels were low in thalassemia major in children below 5 years of age. Conclusion: Although clinical symptoms of iron overload have been absent in thalassemic children below five years of age, biochemical iron overloading has started at much lower age which is of great concern.

  7. The production of homozygous tree material

    Science.gov (United States)

    Reinhard F. Stettler; George E. Howe

    1966-01-01

    Homozygous trees will never be the desired ultimate step in a forest tree improvement program. However, they will serve many purposes in forest genetics research: (1) in the detection of genetic markers; (2) in the isolation of traits under simple genetic control for the study of growth and differentiation phenomena; (3) as a tool as well as reference material in the...

  8. Prenatal diagnosis of homozygous familial hypercholesterolaemia

    International Nuclear Information System (INIS)

    Brown, M.S.; Kovanen, P.T.; Goldstein, J.L.; Eeckels, R.; Vandenberghe, K.; Van Den Berghe, H.; Fryns, J.P.; Cassiman, J.J.

    1978-01-01

    Cultured amniotic-fluid cells from a fetus at risk for homozygous familial hypercholesterolaemia (F.H.) almost completely lacked cell-surface receptors for plasma low-density lipoprotein (L.D.L.), as evidenced by direct measurement of binding, uptake, and degradation of 125 I-L.D.L. Functional consequences of L.D.L. binding to the receptor - i.e., suppression of 3-hydroxy-3-methylglutaryl coenzyme A reductase and stimulation of cholesterol esterification - were proportionately reduced when compared with results in cultured amniotic cells from two control fetuses. On the basis of these findings, homozygous F.H. was diagnosed and the pregnancy was terminated at the 20th week. The diagnosis of homozygous F.H. was confirmed by a serum-cholesterol of the aborted fetus of 279 mg/dl, a value 9 times the mean of four control fetuses of similar gestational age. More than 80% of the serum-cholesterol of the affected fetus was contained within L.D.L. Prenatal diagnosis of homozygous F.H. now seems practical; moreover, the finding of a raised serum-L.D.L. in the affected fetus indicates that the L.D.L. receptor is normally functional as early as the 20th week of fetal life. (author)

  9. Intraoperative transfusion practices in Europe

    DEFF Research Database (Denmark)

    Meier, J; Filipescu, D; Kozek-Langenecker, S

    2016-01-01

    BACKGROUND: Transfusion of allogeneic blood influences outcome after surgery. Despite widespread availability of transfusion guidelines, transfusion practices might vary among physicians, departments, hospitals and countries. Our aim was to determine the amount of packed red blood cells (p......RBC) and blood products transfused intraoperatively, and to describe factors determining transfusion throughout Europe. METHODS: We did a prospective observational cohort study enrolling 5803 patients in 126 European centres that received at least one pRBC unit intraoperatively, during a continuous three month...... period in 2013. RESULTS: The overall intraoperative transfusion rate was 1.8%; 59% of transfusions were at least partially initiated as a result of a physiological transfusion trigger- mostly because of hypotension (55.4%) and/or tachycardia (30.7%). Haemoglobin (Hb)- based transfusion trigger alone...

  10. Haemostatic function and biomarkers of endothelial damage before and after RBC transfusion in patients with haematologic disease

    DEFF Research Database (Denmark)

    Larsen, A M; Leinøe, E B; Johansson, P I

    2015-01-01

    function and the endothelium) to RBC transfusion. MATERIALS AND METHODS: Blood was sampled from patients with various transfusion-dependent haematologic diseases before 1 and 24 h after RBC transfusion. Primary and secondary haemostasis was evaluated by whole-blood impedance aggregometry (Multiplate....... Compared to before transfusion, patients had slightly reduced coagulability 1 h after RBC transfusion, assessed by TEG. However, transfusion of older RBC products (>14 days) was associated with increased coagulability (all P level of syndecan-1 increased slightly 24 h after transfusion (median....... The changes observed were small to moderate and the clinical relevance of these findings should be investigated in larger studies....

  11. Predicting blood transfusion in patients undergoing minimally invasive oesophagectomy.

    Science.gov (United States)

    Schneider, Crispin; Boddy, Alex P; Fukuta, Junaid; Groom, William D; Streets, Christopher G

    2014-12-01

    To evaluate predictors of allogenic blood transfusion requirements in patients undergoing minimal invasive oesophagectomy at a tertiary high volume centre for oesophago-gastric surgery. Retrospective analysis of all patients undergoing minimal access oesophagectomy in our department between January 2010 and December 2011. Patients were divided into two groups depending on whether they required a blood transfusion at any time during their index admission. Factors that have been shown to influence perioperative blood transfusion requirements in major surgery were included in the analysis. Binary logistic regression analysis was performed to determine the impact of patient and perioperative characteristics on transfusion requirements during the index admission. A total of 80 patients underwent minimal access oesophagectomy, of which 61 patients had a laparoscopic assisted oesophagectomy and 19 patients had a minimal invasive oesophagectomy. Perioperative blood transfusion was required in 28 patients at any time during hospital admission. On binary logistic regression analysis, a lower preoperative haemoglobin concentration (p blood transfusion requirements. It has been reported that requirement for blood transfusion can affect long-term outcomes in oesophageal cancer resection. Two factors which could be addressed preoperatively; haemoglobin concentration and type of oesophageal resection, may be valuable in predicting blood transfusions in patients undergoing minimally invasive oesophagectomy. Our analysis revealed that preoperative haemoglobin concentration, occurrence of significant complications and type of minimal access oesophagectomy predicted blood transfusion requirements in the patient population examined. Copyright © 2014 Surgical Associates Ltd. Published by Elsevier Ltd. All rights reserved.

  12. Quantifying risk of transfusion in children undergoing spine surgery.

    Science.gov (United States)

    Vitale, Michael G; Levy, Douglas E; Park, Maxwell C; Choi, Hyunok; Choe, Julie C; Roye, David P

    2002-01-01

    The risks and costs of transfusion are a great concern in the area of pediatric spine surgery, because it is a blood-intensive procedure with a high risk for transfusion. Therefore, determining the predictors of transfusion in this patient population is an important first step and has the potential to improve upon the current approaches to reducing transfusion rates. In this study, we reveal several predictors of transfusion in a pediatric patient population undergoing spine surgery. In turn, we present a general rule of thumb ("rule of two's") for gauging transfusion risk, thus enhancing the surgeon's approach to avoiding transfusion in certain clinical scenarios. This study was conducted to determine the main factors of transfusion in a population of pediatric patients undergoing scoliosis surgery. The goal was to present an algorithm for quantifying the true risk of transfusion for various patient groups that would highlight patients "at high risk" for transfusion. This is especially important in light of the various risks associated with undergoing a transfusion, as well as the costs involved in maintaining and disposing of exogenous blood materials. This is a retrospective review of a group of children who underwent scoliosis surgery between 1988 and 1995 at an academic institution. A total of 290 patients were analyzed in this study, of which 63 were transfused and 227 were not. No outcomes measures were used in this study. A retrospective review of 290 patients presenting to our institution for scoliosis surgery was conducted, with a focus on socioclinical data related to transfusion risk. Univariate analysis and logistic regression were used to quantify the determinants of transfusion risk. Univariate analysis identified many factors that were associated with the risk of transfusion. However, it is clear that several of these factors are dependent on each other, obscuring the true issues driving transfusion need. We used multivariate analysis to control for

  13. Precautions and Adverse Reactions during Blood Transfusion

    Science.gov (United States)

    ... the Professional Version Blood Transfusion Overview of Blood Transfusion Blood Donation Process Blood Products Special Blood Donation Procedures ... CORTEF, SOLU-CORTEF Blood Transfusion Overview of Blood Transfusion Blood Donation Process Blood Products Special Blood Donation Procedures ...

  14. Microbes and blood transfusion

    Directory of Open Access Journals (Sweden)

    Narayan S

    2001-01-01

    Full Text Available Transfusion medicine has been constantly evolving through the years with improved technologies that enhance the capability of identifying existing and newer emerging transfusion transmissible infections (TTI. In spite of the efforts made by blood banks the risk of TTI remains. This article deals with the various steps involved in ensuring blood safety, i.e. donor selection, role of screening donated blood for known and emerging infections, issues and assessment of threat posed by the risk, methodologies employed for testing and possible suggestions to improve transfusion services. While the threat of TTI remains, with a concerted effort of private and government organisations, and co-operation from the diagnostic companies, it is possible to raise the levels of blood safety. A surveillance system is also essential to identify any new agents that might pose a threat in a geographic area and to include them too in the screening process.

  15. Metabolomics in transfusion medicine.

    Science.gov (United States)

    Nemkov, Travis; Hansen, Kirk C; Dumont, Larry J; D'Alessandro, Angelo

    2016-04-01

    Biochemical investigations on the regulatory mechanisms of red blood cell (RBC) and platelet (PLT) metabolism have fostered a century of advances in the field of transfusion medicine. Owing to these advances, storage of RBCs and PLT concentrates has become a lifesaving practice in clinical and military settings. There, however, remains room for improvement, especially with regard to the introduction of novel storage and/or rejuvenation solutions, alternative cell processing strategies (e.g., pathogen inactivation technologies), and quality testing (e.g., evaluation of novel containers with alternative plasticizers). Recent advancements in mass spectrometry-based metabolomics and systems biology, the bioinformatics integration of omics data, promise to speed up the design and testing of innovative storage strategies developed to improve the quality, safety, and effectiveness of blood products. Here we review the currently available metabolomics technologies and briefly describe the routine workflow for transfusion medicine-relevant studies. The goal is to provide transfusion medicine experts with adequate tools to navigate through the otherwise overwhelming amount of metabolomics data burgeoning in the field during the past few years. Descriptive metabolomics data have represented the first step omics researchers have taken into the field of transfusion medicine. However, to up the ante, clinical and omics experts will need to merge their expertise to investigate correlative and mechanistic relationships among metabolic variables and transfusion-relevant variables, such as 24-hour in vivo recovery for transfused RBCs. Integration with systems biology models will potentially allow for in silico prediction of metabolic phenotypes, thus streamlining the design and testing of alternative storage strategies and/or solutions. © 2015 AABB.

  16. Prenatal diagnosis of homozygous β-thalassemia

    International Nuclear Information System (INIS)

    Loukopoulos, D.

    1980-11-01

    An in vitro test for the prenatal diagnosis of homozygous β-thalassaemia and its application is described. The basic methodology consists in obtaining a minute specimen of placental blood by blind aspiration or foetoscopy at the 18th to 20th week of gestation, incubating a sample in the presence of 3 H-leucine, separating the labelled globin chains by chromatography on sodium carboxymethyl cellulose microcolumns with 8M urea-mercaptoethanol and measuring the radioactivity associated with the β- and γ-chains. The β/(pre-γ+γ) radioactivity ratio is used as an index of adequacy of β-chain synthesis, a value greater than 0.07 being taken as indicative of freedom from disease and a value less than 0.03 indicative of homozygous β-thalassaemia. From 350 women seeking the test, 344 samples were tested; 269 were judged normal or heterozygous, 75 homozygous for β-thalassaemia. Four false negatives were identified, 3 having given borderline β/(pre-γ+γ) ratios. Complications leading to foetal loss fell from 16% over the first year's experience to 8% over the second and 5% over the third. The test is now judged suitable for general use and is indeed being so used

  17. [Proteomics and transfusion medicine].

    Science.gov (United States)

    Lion, N; Prudent, M; Crettaz, D; Tissot, J-D

    2011-04-01

    The term "proteomics" covers tools and techniques that are used to analyze and characterize complex mixtures of proteins from various biological samples. In this short review, a typical proteomic approach, related to the study of particular and illustrative situation related to transfusion medicine is reported. This "case report" will allow the reader to be familiar with a practical proteomic approach of a real situation, and will permit to describe the tools that are usually used in proteomic labs, and, in a second part, to present various proteomic applications in transfusion medicine. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  18. [European Union and blood transfusion].

    Science.gov (United States)

    Rouger, P

    2003-06-01

    Blood transfusion is progressing, Europe is growing, European blood transfusion organisations are developing rapidly. The first step was the publication of a new directive (2002/98/CE). The directive is the result of a compromise between technocracy, lobbying and blood transfusion professionals. European blood transfusion must be based on medical, scientific and social criteria. Two imperatives must be considered: the respect of ethics and; independence from the commercial system. The primary objective is to give satisfaction to patients while respecting blood donors.

  19. Update on massive transfusion.

    Science.gov (United States)

    Pham, H P; Shaz, B H

    2013-12-01

    Massive haemorrhage requires massive transfusion (MT) to maintain adequate circulation and haemostasis. For optimal management of massively bleeding patients, regardless of aetiology (trauma, obstetrical, surgical), effective preparation and communication between transfusion and other laboratory services and clinical teams are essential. A well-defined MT protocol is a valuable tool to delineate how blood products are ordered, prepared, and delivered; determine laboratory algorithms to use as transfusion guidelines; and outline duties and facilitate communication between involved personnel. In MT patients, it is crucial to practice damage control resuscitation and to administer blood products early in the resuscitation. Trauma patients are often admitted with early trauma-induced coagulopathy (ETIC), which is associated with mortality; the aetiology of ETIC is likely multifactorial. Current data support that trauma patients treated with higher ratios of plasma and platelet to red blood cell transfusions have improved outcomes, but further clinical investigation is needed. Additionally, tranexamic acid has been shown to decrease the mortality in trauma patients requiring MT. Greater use of cryoprecipitate or fibrinogen concentrate might be beneficial in MT patients from obstetrical causes. The risks and benefits for other therapies (prothrombin complex concentrate, recombinant activated factor VII, or whole blood) are not clearly defined in MT patients. Throughout the resuscitation, the patient should be closely monitored and both metabolic and coagulation abnormalities corrected. Further studies are needed to clarify the optimal ratios of blood products, treatment based on underlying clinical disorder, use of alternative therapies, and integration of laboratory testing results in the management of massively bleeding patients.

  20. in blood transfusion

    African Journals Online (AJOL)

    gestion de la transfusion des patients se traduit par une diminution spectaculaire de .... lABoRAToRy pERFoRMANCE ChECKs ... CoNTRôlEs DE pERFoRMANCE DE ...... mesure de fournir des packs ayant un faible volume de sang et une.

  1. Neonatal transfusion practices

    NARCIS (Netherlands)

    Lindern, Jeannette Susanne von

    2011-01-01

    Red blood cells (RBCs) are probably the most frequently used drug given to very preterm infants; more than 90% of infants with a birth weight <1000 grams receive one or more RBC transfusions. Except for reduction of the amount of blood drawn for laboratory tests and use of a single donor program, no

  2. Design and rationale of the QUAZAR Lower-Risk MDS (AZA-MDS-003) trial: a randomized phase 3 study of CC-486 (oral azacitidine) plus best supportive care vs placebo plus best supportive care in patients with IPSS lower-risk myelodysplastic syndromes and poor prognosis due to red blood cell transfusion-dependent anemia and thrombocytopenia.

    Science.gov (United States)

    Garcia-Manero, Guillermo; Almeida, Antonio; Giagounidis, Aristoteles; Platzbecker, Uwe; Garcia, Regina; Voso, Maria Teresa; Larsen, Stephen R; Valcarcel, David; Silverman, Lewis R; Skikne, Barry; Santini, Valeria

    2016-01-01

    CC-486 is an oral formulation of the epigenetic modifier azacitidine. In an expanded phase 1 trial, CC-486 demonstrated clinical and biological activity in patients with International Prognostic Scoring System (IPSS) lower-risk (low- and intermediate-1-risk) myelodysplastic syndromes (MDS) with poor prognostic features including anemia and/or thrombocytopenia who may have required red blood cell or platelet transfusions. The overall response rate was 40 %, including hematologic improvement in 28 % of patients and RBC transfusion independence sustained for 56 days in 47 % of patients with baseline transfusion dependence. Based on the results of this study, the randomized, placebo-controlled phase 3 QUAZAR Lower-Risk MDS trial (AZA-MDS-003) was initiated. The design and rationale for this trial comparing CC-486 with placebo for the treatment of patients with IPSS lower-risk MDS with poor prognostic features are described. Patients must have IPSS lower-risk MDS with red blood cell (RBC) transfusion-dependent anemia and thrombocytopenia. Eligible patients are randomized 1:1 to receive 300 mg of CC-486 or placebo once daily for the first 21 days of 28-day treatment cycles. Disease status assessments occur at the end of cycle 6 and patients may continue to receive treatment unless there is evidence of progressive disease, lack of efficacy, or unacceptable toxicity. The primary endpoint is RBC transfusion independence for ≥ 84 days, assessed according to International Working Group 2006 criteria. Secondary endpoints include overall survival, hematologic response including platelet response and erythroid response, RBC transfusion independence for ≥ 56 days, duration of RBC transfusion independence, time to RBC transfusion independence, rate of acute myeloid leukemia (AML) progression, time to AML progression, clinically significant bleeding events, safety, health-related quality of life, and healthcare resource utilization. This study will provide data

  3. Restrictive versus liberal transfusion strategy for red blood cell transfusion

    DEFF Research Database (Denmark)

    Holst, Lars B; Petersen, Marie W; Haase, Nicolai

    2015-01-01

    OBJECTIVE: To compare the benefit and harm of restrictive versus liberal transfusion strategies to guide red blood cell transfusions. DESIGN: Systematic review with meta-analyses and trial sequential analyses of randomised clinical trials. DATA SOURCES: Cochrane central register of controlled...... differences with 95% confidence intervals. RESULTS: 31 trials totalling 9813 randomised patients were included. The proportion of patients receiving red blood cells (relative risk 0.54, 95% confidence interval 0.47 to 0.63, 8923 patients, 24 trials) and the number of red blood cell units transfused (mean...... were associated with a reduction in the number of red blood cell units transfused and number of patients being transfused, but mortality, overall morbidity, and myocardial infarction seemed to be unaltered. Restrictive transfusion strategies are safe in most clinical settings. Liberal transfusion...

  4. Diploid yeast cells yield homozygous spontaneous mutations

    Science.gov (United States)

    Esposito, M. S.; Bruschi, C. V.; Brushi, C. V. (Principal Investigator)

    1993-01-01

    A leucine-requiring hybrid of Saccharomyces cerevisiae, homoallelic at the LEU1 locus (leu1-12/leu1-12) and heterozygous for three chromosome-VII genetic markers distal to the LEU1 locus, was employed to inquire: (1) whether spontaneous gene mutation and mitotic segregation of heterozygous markers occur in positive nonrandom association and (2) whether homozygous LEU1/LEU1 mutant diploids are generated. The results demonstrate that gene mutation of leu1-12 to LEU1 and mitotic segregation of heterozygous chromosome-VII markers occur in strong positive nonrandom association, suggesting that the stimulatory DNA lesion is both mutagenic and recombinogenic. In addition, genetic analysis of diploid Leu+ revertants revealed that approximately 3% of mutations of leu1-12 to LEU1 result in LEU1/LEU1 homozygotes. Red-white sectored Leu+ colonies exhibit genotypes that implicate post-replicational chromatid breakage and exchange near the site of leu1-12 reversion, chromosome loss, and subsequent restitution of diploidy, in the sequence of events leading to mutational homozygosis. By analogy, diploid cell populations can yield variants homozygous for novel recessive gene mutations at biologically significant rates. Mutational homozygosis may be relevant to both carcinogenesis and the evolution of asexual diploid organisms.

  5. [Prospects in blood transfusion].

    Science.gov (United States)

    Rouger, P

    2003-04-01

    What will be the evolution of blood transfusion in the next 10 years? What are the scientific and medical arguments to help the decision makers to propose the developments? Many scientific and clinical studies show that blood substitutes are not ready for use in man. So, for a long time, blood collection in man will still be a necessity to prepare cell concentrates (red blood cells and platelets) and fresh frozen plasma. During this period, blood safety will be based on development of testing technics and preparation processes of blood products. Another major point will be a better clinical use of blood derivates. Cellular therapy will be probably only a way of diversification in blood transfusion centers in partnership with hospitals.

  6. [Alternatives to allogenous blood transfusion].

    Science.gov (United States)

    Cernea, Daniela; Vlădoianu, Alice; Stoica, Maria; Novac, M; Berteanu, Cristina

    2009-01-01

    Blood transfusion is usually meant to lower morbidity and mortality rates. Allogenous blood transfusion implies certain risks that can be avoided by autologous blood transfusions techniques including: preoperatory autologous blood donation, acute normovolemic hemodilution, intraoperatory and postoperatory blood salvage. Preoperatory blood donation and acute normovolemic hemodilution are used for planned interventions with an estimated blood loss higher than 20% of blood volume. These methods imply Erythropoietin and iron treatment. Intraoperatory and postoperatory blood salvage is performed by personnel trained in blood donation, handling and storage. Autologous blood transfusions are used for certain surgical procedures that commonly require transfusions: orthopedic surgery, radical prostatectomy, cardiovascular surgery, organ transplantation. An alternative to allogenous blood transfusion is the use of artificial oxygen transporters: human or animal hemoglobin solutions or pefluorocarbonate solutions. These solutions do not require cross reactions, do not carry diseases and are generally well tolerated and easily stored in the operating room, ambulance and other transport means. They have however a slight degree of toxicity.

  7. Isogenic transgenic homozygous fish induced by artificial parthenogenesis.

    Science.gov (United States)

    Nam, Y K; Cho, Y S; Kim, D S

    2000-12-01

    As a model system for vertebrate transgenesis, fish have many attractive advantages, especially with respect to the characteristics of eggs, allowing us to produce isogenic, transgenic, homozygous vertebrates by combining with chromosome-set manipulation. Here, we describe the large-scale production of isogenic transgenic homozygous animals using our experimental organism, the mud loach Misgurnus mizolepis, by the simple process of artificial parthenogenesis in a single generation. These isogenic fish have retained transgenic homozygous status in a stable manner during the subsequent 5 years, and exhibited increased levels of transgene expression. Furthermore, their isogenic nature was confirmed by cloned transgenic homozygous offspring produced via another step of parthenogenic reproduction of the isogenic homozygous transgenic fish. These results demonstrate that a combination of transgenesis and artificial parthenogenesis will make the rapid utilization of genetically pure homozygous transgenic system in vertebrate transgenesis possible.

  8. [Ethical issues in transfusion medicine].

    Science.gov (United States)

    Tissot, J-D; Danic, B; Cabaud, J-J; Garraud, O

    2016-09-01

    Ethics is on the cross road of off values that are present along the ways of transfusion medicine. This is an important tool to afford opinions as well as debates that always emerge when discussing transfusion medicine. The wording is particularly important; this was one among several others that characterized the soul of Jean-Jacques Lefrère when he opened the doors of the ethical issues of transfusion medicine. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  9. Limb defects in homozygous {alpha}-thalassemia: Report of three cases

    Energy Technology Data Exchange (ETDEWEB)

    Chitayat, D.; Thomas, M.; Silver, M.M. [Univ. of Toronto, Ontario (Canada)] [and others

    1997-01-20

    Homozygosity for the South-Asian {alpha}-thalassemia (--{sup SEA}/) deletion is a serious hematological condition that results, in most cases, in intrauterine or postnatal death due to anemia and severe hypoxia of prenatal onset. A relationship between congenital abnormalities and intrauterine hypoxia has been postulated. However, since homozygosity for the (--{sup SEA}/) deletion is most common in underdeveloped countries where detailed autopsies are lacking, the incidence of congenital abnormalities among these babies has not been well delineated. We report on three newborn infants, homozygous for the (--{sup SEA}/) deletion, who were born with limb defects. We postulate that this combination is the result of prenatal hypoxia which may affect other fetal body organs. This should be taken into consideration when prenatal treatment of affected fetuses, with intrauterine blood transfusion, is suggested. 47 refs., 3 figs.

  10. Blood transfusion exposure in Denmark and Sweden

    DEFF Research Database (Denmark)

    Kamper-Jørgensen, Mads; Edgren, Gustaf; Rostgaard, Klaus

    2009-01-01

    Although essential for the evaluation of blood transfusion safety, the prevalence of blood transfusion in the general population is not presently known. This study estimated the exposure to blood transfusion in the general Scandinavian population.......Although essential for the evaluation of blood transfusion safety, the prevalence of blood transfusion in the general population is not presently known. This study estimated the exposure to blood transfusion in the general Scandinavian population....

  11. Spectrum of mutations in homozygous familial hypercholesterolemia in India, with four novel mutations.

    Science.gov (United States)

    Setia, Nitika; Saxena, Renu; Arora, Anjali; Verma, Ishwar C

    2016-12-01

    Homozygous familial hypercholesterolemia (FH) is a rare but serious, inherited disorder of lipid metabolism characterized by very high total and LDL cholesterol levels from birth. It presents as cutaneous and tendon xanthomas since childhood, with or without cardiac involvement. FH is commonly caused by mutations in three genes, i.e. LDL receptor (LDLR), apolipoprotein B (ApoB) and PCSK9. We aimed to determine the spectrum of mutations in cases of homozygous FH in Asian Indians and evaluate if there was any similarity to the mutations observed in Caucasians. Sixteen homozygous FH subjects from eleven families were analyzed for mutations by Sanger sequencing. Large rearrangements in LDLR gene were evaluated by multiplex ligation probe dependent amplification (MLPA) technique. Ten mutations were observed in LDLR gene, of which four mutations were novel. No mutation was detected in ApoB gene and common PCSK9 mutation (p.D374Y). Fourteen cases had homozygous mutations; one had compound heterozygous mutation, while no mutation was detected in one clinically homozygous case. We report an interesting "Triple hit" case with features of homozygous FH. The spectrum of mutations in the Asian Indian population is quite heterogeneous. Of the mutations identified, 40% were novel. No mutation was observed in exons 3, 9 and 14 of LDLR gene, which are considered to be hot spots in studies done on Asian Indians in South Africa. Early detection followed by aggressive therapy, and cascade screening of extended families has been initiated to reduce the morbidity and mortality in these patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. Transfusion medicine on American television.

    Science.gov (United States)

    Karp, J K

    2014-02-01

    Television is a beloved American pastime and a frequent American export. As such, American television shapes how the global public views the world. This study examines how the portrayal of blood transfusion and blood donation on American television may influence how domestic and international audiences perceive the field of transfusion medicine. American television programming of the last quarter-century was reviewed to identify programmes featuring topics related to blood banking/transfusion medicine. The included television episodes were identified through various sources. Twenty-seven television episodes airing between 1991 and 2013 were identified as featuring blood bank/transfusion medicine topics. Although some accurate representations of the field were identified, most television programmes portrayed blood banking/transfusion medicine inaccurately. The way in which blood banking/transfusion medicine is portrayed on American television may assist clinicians in understanding their patient's concerns about blood safety and guide blood collection organisations in improving donor recruitment. © 2013 The Author. Transfusion Medicine © 2013 British Blood Transfusion Society.

  13. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  14. Overall survival in lower IPSS risk MDS by receipt of iron chelation therapy, adjusting for patient-related factors and measuring from time of first red blood cell transfusion dependence: an MDS-CAN analysis.

    Science.gov (United States)

    Leitch, Heather A; Parmar, Ambica; Wells, Richard A; Chodirker, Lisa; Zhu, Nancy; Nevill, Thomas J; Yee, Karen W L; Leber, Brian; Keating, Mary-Margaret; Sabloff, Mitchell; St Hilaire, Eve; Kumar, Rajat; Delage, Robert; Geddes, Michelle; Storring, John M; Kew, Andrea; Shamy, April; Elemary, Mohamed; Lenis, Martha; Mamedov, Alexandre; Ivo, Jessica; Francis, Janika; Zhang, Liying; Buckstein, Rena

    2017-10-01

    Analyses suggest iron overload in red blood cell (RBC) transfusion-dependent (TD) patients with myleodysplastic syndrome (MDS) portends inferior overall survival (OS) that is attenuated by iron chelation therapy (ICT) but may be biassed by unbalanced patient-related factors. The Canadian MDS Registry prospectively measures frailty, comorbidity and disability. We analysed OS by receipt of ICT, adjusting for these patient-related factors. TD International Prognostic Scoring System (IPSS) low and intermediate-1 risk MDS, at RBC TD, were included. Predictive factors for OS were determined. A matched pair analysis considering age, revised IPSS, TD severity, time from MDS diagnosis to TD, and receipt of disease-modifying agents was conducted. Of 239 patients, 83 received ICT; frailty, comorbidity and disability did not differ from non-ICT patients. Median OS from TD was superior in ICT patients (5·2 vs. 2·1 years; P MDS, adjusting for age, frailty, comorbidity, disability, revised IPSS, TD severity, time to TD and receiving disease-modifying agents. This provides additional evidence that ICT may confer clinical benefit. © 2017 John Wiley & Sons Ltd.

  15. Transfusion in critically ill children

    DEFF Research Database (Denmark)

    Secher, E L; Stensballe, J; Afshari, A

    2013-01-01

    Transfusion of blood products is a cornerstone in managing many critically ill children. Major improvements in blood product safety have not diminished the need for caution in transfusion practice. In this review, we aim to discuss the interplay between benefits and potential adverse effects...... of transfusion in critically ill children by including 65 papers, which were evaluated based on previously agreed selection criteria. Current practice on transfusing critically ill children is mainly founded on the basis of adult studies, common practices with cut-off values, and expert opinions, rather than...... evidence-based medicine. Paediatric patients have explicit physiological challenges and requirements to be addressed. Critically ill children often suffer from anaemia, have substantial iatrogenic blood loss with subsequent transfusions, and are at a higher risk of complications, often due to human errors...

  16. Epistatic association mapping in homozygous crop cultivars.

    Directory of Open Access Journals (Sweden)

    Hai-Yan Lü

    Full Text Available The genetic dissection of complex traits plays a crucial role in crop breeding. However, genetic analysis and crop breeding have heretofore been performed separately. In this study, we designed a new approach that integrates epistatic association analysis in crop cultivars with breeding by design. First, we proposed an epistatic association mapping (EAM approach in homozygous crop cultivars. The phenotypic values of complex traits, along with molecular marker information, were used to perform EAM. In our EAM, all the main-effect quantitative trait loci (QTLs, environmental effects, QTL-by-environment interactions and QTL-by-QTL interactions were included in a full model and estimated by empirical Bayes approach. A series of Monte Carlo simulations was performed to confirm the reliability of the new method. Next, the information from all detected QTLs was used to mine novel alleles for each locus and to design elite cross combination. Finally, the new approach was adopted to dissect the genetic basis of seed length in 215 soybean cultivars obtained, by stratified random sampling, from 6 geographic ecotypes in China. As a result, 19 main-effect QTLs and 3 epistatic QTLs were identified, more than 10 novel alleles were mined and 3 elite parental combinations, such as Daqingdou and Zhengzhou790034, were predicted.

  17. Effects of blood transfusion on oxygen extraction ratio and central venous saturation in children after cardiac surgery.

    Science.gov (United States)

    Nasser, Bana; Tageldein, Mohmad; AlMesned, Abdulrahman; Kabbani, Mohammad

    2017-01-01

    Red blood cell transfusion is common in critically ill children after cardiac surgery. Since the threshold for hemoglobin (Hb) transfusion need is not well defined, the threshold Hb level at which dependent critical oxygen uptake-to-delivery (VO2-DO2) status compensation is uncertain. To assess the effects of blood transfusion on the oxygen extraction ratio (O2ER) and central venous oxygen saturation (ScvO2) to identify a critical O2ER value that could help us determine the critical need for blood transfusion. Prospective, observational cohort study. Cardiac Surgical Intensive Care Unit at Prince Sultan Cardiac Center in Qassim, Saudi Arabia. Between January 2013 and December 2015, we included all children with cardiac disease who underwent surgery and needed a blood transfusion. Demographic and laboratory data with physiological parameters before and 1 and 6 hours after transfusion were recorded and O2ER before and 6 hours after transfusion was computed. Cases were divided into two groups based on O2ER: Patients with increased O2ER (O2ER > 40%) and normal patients without increased O2ER (O2ER transfusion. Changes in O2ER and ScvO2 following blood transfusion. Of 103 patients who had blood transfusion, 75 cases had normal O2ER before transfusion while 28 cases had increased O2ER before transfusion. Following blood transfusion, O2ER and ScvO2 improved in the group that had increased O2ER before transfusion, but not in the group that had normal O2ER before transfusion. The clinical and hemodynamic indicators O2ER and ScvO2 may be considered as markers that can indicate a need for blood transfusion. The limitation of this study is the small number of patients that had increased O2ER before transfusion. There were few available variables to assess oxygen consumption.

  18. Alternatives to allogeneic platelet transfusion.

    Science.gov (United States)

    Desborough, Michael J R; Smethurst, Peter A; Estcourt, Lise J; Stanworth, Simon J

    2016-11-01

    Allogeneic platelet transfusions are widely used for the prevention and treatment of bleeding in thrombocytopenia. Recent evidence suggests platelet transfusions have limited efficacy and are associated with uncertain immunomodulatory risks and concerns about viral or bacterial transmission. Alternatives to transfusion are a well-recognised tenet of Patient Blood Management, but there has been less focus on different strategies to reduce bleeding risk by comparison to platelet transfusion. Direct alternatives to platelet transfusion include agents to stimulate endogenous platelet production (thrombopoietin mimetics), optimising platelet adhesion to endothelium by treating anaemia or increasing von Willebrand factor levels (desmopressin), increasing formation of cross-linked fibrinogen (activated recombinant factor VII, fibrinogen concentrate or recombinant factor XIII), decreasing fibrinolysis (tranexamic acid or epsilon aminocaproic acid) or using artificial or modified platelets (cryopreserved platelets, lyophilised platelets, haemostatic particles, liposomes, engineered nanoparticles or infusible platelet membranes). The evidence base to support the use of these alternatives is variable, but an area of active research. Much of the current randomised controlled trial focus is on evaluation of the use of thrombopoietin mimetics and anti-fibrinolytics. It is also recognised that one alternative strategy to platelet transfusion is choosing not to transfuse at all. © 2016 John Wiley & Sons Ltd.

  19. Restrictive versus liberal transfusion strategy for red blood cell transfusion

    DEFF Research Database (Denmark)

    Holst, Lars B; Petersen, Marie W; Haase, Nicolai

    2015-01-01

    OBJECTIVE: To compare the benefit and harm of restrictive versus liberal transfusion strategies to guide red blood cell transfusions. DESIGN: Systematic review with meta-analyses and trial sequential analyses of randomised clinical trials. DATA SOURCES: Cochrane central register of controlled...... trials, SilverPlatter Medline (1950 to date), SilverPlatter Embase (1980 to date), and Science Citation Index Expanded (1900 to present). Reference lists of identified trials and other systematic reviews were assessed, and authors and experts in transfusion were contacted to identify additional trials....... TRIAL SELECTION: Published and unpublished randomised clinical trials that evaluated a restrictive compared with a liberal transfusion strategy in adults or children, irrespective of language, blinding procedure, publication status, or sample size. DATA EXTRACTION: Two authors independently screened...

  20. Risk of Erectile Dysfunction in Transfusion-naive Thalassemia Men

    Science.gov (United States)

    Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung

    2015-01-01

    Abstract Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities. PMID:25837766

  1. THREAT helps to identify epistaxis patients requiring blood transfusions

    Science.gov (United States)

    2013-01-01

    Objective To analyze the characteristics of patients who needed a blood transfusion due to epistaxis-caused anemia and to define potential risk factors. Design Retrospective cohort study. Setting A total cohort of 591 epistaxis patients, prospectively included between March 2007 and April 2008 at the ENT department of the University Hospital of Zurich, was evaluated concerning the need for blood transfusions. Methods The clinical charts and medical histories of these patients were evaluated. Main outcome measures Common parameters that increase the risk for severe anemia due to epistaxis. Results Twenty-two patients required blood transfusions due to their medical condition. 22.7% suffered from traumatic nosebleeds. Another 27.3% had a known medical condition with an increased bleeding tendency. These proportions were significantly higher than in the group of patients without need of blood transfusion. The odds ratio for receiving a blood transfusion was 14.0 in patients with hematologic disorders, 4.3 in traumatic epistaxis and 7.7 in posterior bleeders. The transfusion-dependent epistaxis patients suffered significantly more often from severe posterior nosebleeds with the need for a surgical therapeutic approach. Conclusions Patients with severe nosebleeds either from the posterior part of the nose or with known hematologic disorders or traumatic epistaxis should be closely monitored by blood parameter analyses to evaluate the indication for hemotransfusion. The acronym THREAT (Trauma, Hematologic disorder, and REAr origin of bleeding → Transfusion) helps to remember and identify the factors associated with an increased risk of receiving blood transfusion. PMID:23663751

  2. Marrow transfusions into normal recipients

    International Nuclear Information System (INIS)

    Brecher, G.

    1983-01-01

    During the past several years we have explored the transfusion of bone marrow into normal nonirradiated mice. While transfused marrow proliferates readily in irradiated animals, only minimal proliferation takes place in nonirradiated recipients. It has generally been assumed that this was due to the lack of available proliferative sites in recipients with normal marrow. Last year we were able to report that the transfusion of 200 million bone marrow cells (about 2/3 of the total complement of marrow cells of a normal mouse) resulted in 20% to 25% of the recipient's marrow being replaced by donor marrow. Thus we can now study the behavior of animals that have been transfused (donor) and endogenous (recipient) marrow cells, although none of the tissues of either donor or recipient have been irradiated. With these animals we hope to investigate the nature of the peculiar phenomenon of serial exhaustion of marrow, also referred to as the limited self-replicability of stem cells

  3. Red Blood Cell Transfusion Independence Following the Initiation of Iron Chelation Therapy in Myelodysplastic Syndrome

    Directory of Open Access Journals (Sweden)

    Maha A. Badawi

    2010-01-01

    Full Text Available Iron chelation therapy is often used to treat iron overload in patients requiring transfusion of red blood cells (RBC. A 76-year-old man with MDS type refractory cytopenia with multilineage dysplasia, intermediate-1 IPSS risk, was referred when he became transfusion dependent. He declined infusional chelation but subsequently accepted oral therapy. Following the initiation of chelation, RBC transfusion requirement ceased and he remained transfusion independent over 40 months later. Over the same time course, ferritin levels decreased but did not normalize. There have been eighteen other MDS patients reported showing improvement in hemoglobin level with iron chelation; nine became transfusion independent, nine had decreased transfusion requirements, and some showed improved trilineage myelopoiesis. The clinical features of these patients are summarized and possible mechanisms for such an effect of iron chelation on cytopenias are discussed.

  4. Transfusion related acute lung injury

    Directory of Open Access Journals (Sweden)

    Sharma Ratti

    2009-10-01

    Full Text Available Transfusion related acute lung injury (TRALI is an uncommon but potentially fatal adverse reaction to transfusion of plasma containing blood components. We describe a case of 10-year-old male child with aplastic anemia, platelet count of 7800/΅l, B positive blood group who developed fever (39.2΀C, difficulty in breathing and cyanosis within 2 hrs after transfusion of a random platelet concentrate. Despite the best resuscitative efforts, the child died within next 24 hrs. The present case highlights the fact that TRALI should be kept as a differential diagnosis in all patients developing acute respiratory discomfort within 6 hrs of transfusion. Without a ′gold standard′ the diagnosis of TRALI relies on a high index of suspicion and on excluding other types of transfusion reactions. Notification to transfusion services is crucial to ensure that a proper investigation is carried out and at-risk donor and recipients can be identified, and risk reduction measures can be adopted.

  5. Avascular necrosis in sickle cell (homozygous S) patients: Predictive ...

    African Journals Online (AJOL)

    2013-04-24

    Apr 24, 2013 ... Results: The prevalence of AVN in sickle cell patients was ... Key words: Avascular necrosis, homozygous S, platelet count, sickle cell anemia, white cell count .... frequency of vaso‑occlusive crisis, platelet, and white cell.

  6. Role of blood transfusion product type and amount in deep vein thrombosis after cardiac surgery.

    Science.gov (United States)

    Ghazi, Lama; Schwann, Thomas A; Engoren, Milo C; Habib, Robert H

    2015-12-01

    Postoperative deep vein thrombosis (DVT) is associated with significant morbidity. Even with maximal thromboprophylaxis, postoperative DVT is present in 10% of cardiac surgery patients, and is linked to receiving transfusion. We hypothesized that the incidence of DVT varies with the transfused blood product type, and increases with transfusion dose. 139/1070 cardiac surgery patients have DVT despite maximal chemo and mechanical prophylaxis. DVTs were detected via serial perioperative duplex venous scans (DVS). Red blood cells (RBC), platelets (PLT), plasma (FFP) and cryoprecipitate transfusion data were collected. Transfusion was used in 506(47%) patients: RBC [468(44%); 4.0 ± 4.2u]; FFP [155(14.5%); 3.5 ± 2.3 u]; PLT [185(17.3%); 2.2 ± 1.3 u] and Cryoprecipitate [51(4.8%); 1.3 ± 0.6 u]. Isolated RBC transfusion accounted for 92.6% patients receiving one product, and their DVT rate was increased considerably compared to no transfusion (16.7% versus 7.3%; Pproduct transfusions; particularly when both RBC and FFP are used (25%-40%). Relative to no RBC (n=602), multivariate logistic regression analysis identified a significant RBC-DVT dose dependent relation (Pfashion that is exacerbated when accompanied with FFP. Postoperative screening diagnostic DVS are warranted in this transfused, high risk for DVT population to facilitate timely therapeutic intervention. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Survival of red blood cells after transfusion: processes and consequences

    Directory of Open Access Journals (Sweden)

    Giel eBosman

    2013-12-01

    Full Text Available The currently available data suggest that efforts towards improving the quality of red blood cell (RBC blood bank products should concentrate on: (1 preventing the removal of a considerable fraction of the transfused RBCs that takes place within the first hours after transfusion; (2 minimizing the interaction of the transfused RBCs with the patient's immune system. These issues are important in reducing the number and extent of the damaging side effects of transfusions, such as generation of alloantibodies and autoantibodies and iron accumulation, especially in transfusion-dependent patients. Thus, it becomes important for blood bank research not only to assess the classical RBC parameters for quality control during storage, but even more so to identify the parameters that predict RBC survival, function and behaviour in the patient after transfusion. These parameters are likely to result from elucidation of the mechanisms that underly physiological RBC aging in vivo, and that lead to the generation of senescent cell antigens and the accumulation of damaged molecules in vesicles. Also, study of RBC pathology-related mechanisms, such as encountered in various hemoglobinopathies and membranopathies, may help to elucidate the mechanisms underlying a storage-associated increase in susceptibility to physiological stress conditions. Recent data indicate that a combination of new approaches in vitro to mimick RBC behaviour in vivo, the growing knowledge of the signaling networks that regulate RBC structure and function, and the rapidly expanding set of proteomic and metabolomic data, will be instrumental to identify the storage-associated processes that control RBC survival after transfusion.

  8. [Economic environment and blood transfusion].

    Science.gov (United States)

    Durand-Zaleski, I

    2015-08-01

    The increasing pressure on healthcare resources affects blood donation and transfusion. We attempted a survey of the efficiency of different strategies, actual or proposed to improve the management of blood products. We found an important disconnect between the cost effectiveness ratio of strategies and their uptake by policy makers. In other words, the least efficient strategies are those which increase transfusion safety by increasing the number of biological markers and are those preferred by health authorities in developed countries. Other more efficient strategies are more slowly implemented and included a systematic use of transfusion guidelines, reducing blood losses or increasing pre operative blood levels in elective surgeries. Copyright © 2015. Published by Elsevier SAS.

  9. Benchmarking: applications to transfusion medicine.

    Science.gov (United States)

    Apelseth, Torunn Oveland; Molnar, Laura; Arnold, Emmy; Heddle, Nancy M

    2012-10-01

    Benchmarking is as a structured continuous collaborative process in which comparisons for selected indicators are used to identify factors that, when implemented, will improve transfusion practices. This study aimed to identify transfusion medicine studies reporting on benchmarking, summarize the benchmarking approaches used, and identify important considerations to move the concept of benchmarking forward in the field of transfusion medicine. A systematic review of published literature was performed to identify transfusion medicine-related studies that compared at least 2 separate institutions or regions with the intention of benchmarking focusing on 4 areas: blood utilization, safety, operational aspects, and blood donation. Forty-five studies were included: blood utilization (n = 35), safety (n = 5), operational aspects of transfusion medicine (n = 5), and blood donation (n = 0). Based on predefined criteria, 7 publications were classified as benchmarking, 2 as trending, and 36 as single-event studies. Three models of benchmarking are described: (1) a regional benchmarking program that collects and links relevant data from existing electronic sources, (2) a sentinel site model where data from a limited number of sites are collected, and (3) an institutional-initiated model where a site identifies indicators of interest and approaches other institutions. Benchmarking approaches are needed in the field of transfusion medicine. Major challenges include defining best practices and developing cost-effective methods of data collection. For those interested in initiating a benchmarking program, the sentinel site model may be most effective and sustainable as a starting point, although the regional model would be the ideal goal. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Transfusion-Associated Microchimerism in Combat Casualties

    National Research Council Canada - National Science Library

    Dunne, James R; Lee, Tzong-Hae; Burns, Christopher; Cardo, Lisa J; Curry, Kathleen; Busch, Michael P

    2007-01-01

    ...) in civilian trauma patients receiving allogenic red blood cell (RBC) transfusions. We explored the incidence of TA-MC in combat casualties receiving FrWB compared with patients receiving standard stored RBC transfusions. Methods...

  11. Transfusion transmissible viral infections among potential blood ...

    African Journals Online (AJOL)

    effective approach for prevention and control of transfusion-transmissible infections (TTIs). Also, it has been documented that sub-standard test kits are mostly used in resource limited settings for transfusion related diagnosis. However, the role of ...

  12. Bacteriological Controls at Czechoslovakia Blood Transfusion Centers

    National Research Council Canada - National Science Library

    Jezkova, Zdenka

    1961-01-01

    .... Bacterial contamination may come about: 1. Through incorrect preparation of the transfusion material, such as the withdrawal equipment,transfusion flasks, reservative solution, and, particularly, through inadequate sterilization; 2...

  13. Transfusion complications:Estimate of the residual risk of transfusion ...

    African Journals Online (AJOL)

    Background: Sub-Saharan Africa remains the epicenter of the human immunodeficiency virus (HIV) pan- demic. However, there is a lack of multicenter data on the risk of transfusion-transmitted HIV from blood centers in sub-Saharan Africa. Study design and methods: The incidence of HIV infections in the blood donations ...

  14. Health economics of blood transfusion safety

    NARCIS (Netherlands)

    Hulst, Marinus van

    2008-01-01

    The HIV/AIDS disaster in transfusion medicine shaped the future agendas for blood transfusion safety. More than ever before, the implementation of interventions which could improve blood transfusion safety was driven merely by availability of technology. The introduction of new expensive

  15. Transfusion data: from collection to reflection

    NARCIS (Netherlands)

    van Hoeven, L.R.

    2017-01-01

    Blood transfusion is an important medical treatment for many and diverse patients groups, saving lives but sometimes also causing adverse transfusion reactions in transfusion recipients. For this reason blood use should ideally be as low as possible. The fact that significant differences exist in

  16. Proposed Formulae for Determining Blood Transfusion ...

    African Journals Online (AJOL)

    Background: Blood replacement remains a crucial component of the treatment of severe anaemia irrespective of the cause. The transfusion of an adequate amount of blood is important to prevent under- or over-transfusion. Existing formulae used for the calculation of blood transfusion requirements, while being useful, still ...

  17. Comparative analysis of autologous blood transfusion and allogeneic blood transfusion in surgical patients

    OpenAIRE

    Long, Miao-Yun; Liu, Zhong-Han; Zhu, Jian-Guang

    2014-01-01

    Objective: To investigate application effects of autologous blood transfusion and allogeneic blood transfusion in surgically treated patients receiving spine surgery, abdomen surgery and ectopic pregnancy surgery. Methods: 130 patients who would undergo selective operations were divided into autologous transfusion group and allogeneic transfusion group. Both groups received the same anesthesia, and there was no significant difference in transfusion volume or fluid infusion volume. Results: Th...

  18. What Is a Blood Transfusion?

    Science.gov (United States)

    ... Transfusions Researchers are trying to find ways to make blood. There's currently no man-made alternative to human blood. However, researchers have developed medicines that may help do the job of some blood parts. For ... that helps their bodies make more red blood cells. This means they may ...

  19. Blood transfusion and hepatitis viruses

    African Journals Online (AJOL)

    virus in blood donors: investigation of type-specific differences in serologic reactivity and rate of alanine aminotransferase abnormalities. Transfusion 1993;. 33: 7-13. 45. McFarlane IG, Smith HM, Johnson PJ, Bray GP, Vergani 0, Williams R. Hepatitis. C virus antibodies in chronic active hepatitis: pathogenetic factor or false-.

  20. Delayed hemolytic transfusion reaction presenting as a painful crisis in a patient with sickle cell anemia.

    Science.gov (United States)

    Fabron, A; Moreira, G; Bordin, J O

    1999-01-07

    Patients with sickle cell anemia (SCA) are frequently transfused with red blood cells (RBC). Recently we reported that the calculated risk of RBC alloimmunization per transfussed unit in Brazilian patients with SCA is 1.15%. We describe a delayed hemolytic transfusion reaction (DHTR) presenting as a painful crisis in a patient with SCA. A 35-year-old Brazilian female with homozygous SCA was admitted for a program of partial exchange transfusion prior to cholecystectomy. Her blood group was O RhD positive and no atypical RBC alloantibody was detected using the indirect antiglobulin technique. Pre-transfusional hemoglobin (Hb) was 8.7 g/dL and isovolumic partial exchange transfusion was performed using 4 units of ABO compatible packed RBC. Five days after the last transfusion she developed generalized joint pain and fever of 39 degrees C. Her Hb level dropped from 12.0 g/dL to 9.3 g/dL and the unconjugated bilirrubin level rose to 27 mmol/L. She was jaundiced and had hemoglobinuria. Hemoglobin electrophoresis showed 48.7% HbS, 46.6% HbA1, 2.7% HbA2, and 2.0% HbF. The patient's extended RBC phenotype was CDe, K-k+, Kp(a-b+), Fy(a-b-), M+N+s+, Le(a+b-), Di(a-). An RBC alloantibody with specificity to the Rh system (anti-c, titer 1:16.384) was identified by the indirect antiglobulin test. The Rh phenotype of the RBC used in the last packed RBC transfusion was CcDEe. The patient was discharged, asymptomatic, 7 days after admission.

  1. Hepatitis B Virus Infection In Patients With Homozygous Sickle Cell ...

    African Journals Online (AJOL)

    Nnebe-Agumadu U H, and Abiodun P O. Hepatitis B Virus Infection in Patients with Homozygous Sickle Cell Disease (HbSS): Need for Intervention. Annals Biomedical Sciences 2002; 1:79-87. This is a prospective study of 213 patients with sickle cell anaemia (SCA) (112 males and 101 females) aged 6 months to 18 years ...

  2. Homozygous mutation in the NPHP3 gene causing foetal nephronophthisis

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Fatima, Ambrin

    2017-01-01

    We present a case of a foetal sonographic finding of hyper-echogenic kidneys, which led to a strategic series of genetic tests and identified a homozygous mutation (c.424C > T, p. R142*) in the NPHP3 gene. Our study provides a rare presentation of NPHP3-related ciliopathy and adds to the mutation...

  3. Avascular necrosis in sickle cell (homozygous S) patients: Predictive ...

    African Journals Online (AJOL)

    ... with the development of AVN. Conclusion: In conclusion, patients with a raised steady state platelet count may have a higher tendency to develop AVN and may require closer orthopedic review and prophylactic intervention. Key words: Avascular necrosis, homozygous S, platelet count, sickle cell anemia, white cell count ...

  4. Effectiveness of a nursing intervention during transfusion of packed red cells on the patient´s anxiety state receiver

    Directory of Open Access Journals (Sweden)

    Jesús Fernando Martín Díaz

    2012-05-01

    Full Text Available The transfusion provokes anxiety and this one compromises the improvement of the patient. Objetive: The study aims to evaluate whether a nursing intervention protocol-through oral and written submissions previous to the transfusion of packed red blood cells decreases anxiety levels in pretransfusion and postransfusion recipient patients through a randomized clinical trial. Methodology: Be conducted in patients over 18 years admitted in the Hospitable complex of Toledo, prescription transfusion of packed red blood cells. For an alpha error 0.05, beta error of 0.90, with an expected effect of 10%, need 70 subjects in each group. The allocation to the intervention group and the control group was randomly made simple. The performance in the normal control group will be done in the hospital, patients receiving transfusion. As dependent variables evaluated:- The anxiety level pretransfusion and postransfusion. Using the questionnaire was validated by Spielberger (STAI. - The level of satisfaction perceived by the user on the information received prior to transfusion. By design developed for this study. Also recorded other control variables: sex, age, socio-cultural level, marital status, reason for transfusion, or no knowledge of the prescription of transfusion, incidents during transfusion.Scientific and sociosanitary relevancy of the study: The results will allow to know if the transfusion increases the anxiety and if an educational intervention nurse can diminish it; and to do the intervention before every transfusion.

  5. Anemia of prematurity: time for a change in transfusion management?

    OpenAIRE

    Khodabux, Chantal Muriel

    2013-01-01

    In this thesis we investigated clinical effects of allogeneic red blood cell (RBC) transfusions in premature infants, different transfusion volumes in relation to neonatal outcome in premature infants and the use of autologous cord blood (CB) as an alternative for allogeneic transfusions. Despite the use of a national transfusion guideline, we observed significant differences concerning the total amount of administered transfusions. A liberal transfusion strategy and a higher transfusion volu...

  6. Transfusion practice and knowledge in Mozambique

    Science.gov (United States)

    Hartford, Emily; Muanantatha, Olegario; Valigy, Valigy Ismael; Salimo, Sara; Ziman, Alyssa; DeUgarte, Daniel A.

    2016-01-01

    BACKGROUND In Mozambique, there is a limited supply of blood and elevated risks for transmission of infections. Prior studies have documented that many transfusions in Mozambique are potentially avoidable. Transfusion training workshops with a survey and exam were held for providers to understand their perceptions and to improve knowledge and clinical practice. STUDY DESIGN AND METHODS Health care providers completed a survey and a knowledge assessment. The Wilcoxon signed rank test was utilized to compare the relative importance of each factor in the survey, and pre- and posttraining exam scores were compared using Fisher’s exact test. RESULTS A total of 216 health care providers participated; the majority worked in a referral hospital (74%) and reported transfusing blood at least once per week (56%). Most acknowledged the limited blood supply and transfusion risks. Providers rated low hemoglobin (Hb) levels and pallor as significantly important indications for transfusion (p transfuse with age under 5 years when compared to other ages (p transfusion practice were increased reliability of the blood supply, education about transfusion indications, and assessment of perfusion. Before training, the majority of participants identified an incorrect Hb threshold for preoperative or critically ill patients. Overall exam scores improved from a mean of 58% to 74% (p blood transfusions. Preoperative patients, the critically ill, and children appear to be at highest risk for receiving an avoidable blood transfusion. These results will help guide planning for future provider training. PMID:25648912

  7. Occult hepatitis B infection and transfusion-transmission risk.

    Science.gov (United States)

    Candotti, D; Boizeau, L; Laperche, S

    2017-09-01

    Advances in serology and viral nucleic acid testing (NAT) over the last decades significantly reduced the risk of transfusion-transmitted hepatitis B virus (HBV). The combination of HBsAg testing and NAT efficiently prevents the majority of HBV transmission. However, a specific residual risk remains associated with extremely low viral DNA levels in blood donors with occult HBV infection (OBI) that are intermittently or not detectable even by highly sensitive individual donation (ID) NAT. Studies have reported HBV transfusion-transmission with blood components from donors with OBI that contained low amount of viruses (transfusion-transmission seems to depend on a combination of several factors including the volume of plasma associated with the infected blood components transfused, the anti-HBV immune status of both recipient and donor, and possibly the viral fitness of the infecting HBV strain. Models based on clinical and experimental evidences estimate a residual transmission risk of 3-14% associated with OBI donations testing HBsAg and ID-NAT non-reactive. Anti-HBc testing has the potential to improve further blood safety but it may also compromise blood availability in settings with medium/high HBV prevalence. Pathogen reduction procedures might be considered. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Bilateral leukocoria in a patient with homozygous protein C deficiency

    International Nuclear Information System (INIS)

    Khan, Nasrat M.; Al-Dohayan, Noura D.; Al-Batiniji, Fatima S.

    2007-01-01

    We describe a bilateral leukocoria and neonatal purpura fulminans in a male infant, born at full term after an unremarkable pregnancy to a healthy consanguineous married couple. Multiple hemorrhagic skin bullae were found at birth on various parts of the body with bilateral leukocoria, organized vitreous hemorrhage, retinal detachment, and intracranial hemorrhage with undetectable levels of protein C activity. We report a clinical case of homozygous protein-C deficiency with severe purpura fulminans and bilateral leukocoria. (author)

  9. Malabsorption of vitamin B12 in homozygous β-thalassemia

    International Nuclear Information System (INIS)

    Vlachos, P.; Liakakos, D.

    1976-01-01

    Schilling tests were performed in ten children aged 5-12 years suffering from homozygous β-thalassemia. 57 Co labelled vitamin B 12 values excreted in the urine have been found much lower than normal and remained low when the same procedure was repeated with the addition of intrinsic factor. The possible factors responsible for this malabsorption of vitamin B 12 seemed to be liver damage and folic acid deficiency. (orig.) [de

  10. Prevention of Post Transfusion Hepatitis Employing Sensitive Assay for Hepatitis B Surface Antigen Screening(Topics in Transfusion Medicine 1990 : Autologous Transfusion and Post-Transfusion Hepatitis)

    OpenAIRE

    小島, 秀男; 大竹, 幸子; 富樫, 和枝; 石口, 重子; 山田, 恵子; 品田, 章二; Kojima, Hideo; Ohtake, Sachiko; Togashi, Kazue; Ishiguchi, Shigeko; Yamada, Keiko; Shinada, Shoji

    1990-01-01

    Post transfusion Hepatitis (PTH) is one of serious side effects and some times lead to fulminant hepatic failure in case transfused blood contain very low level (under the sensitivity of usual screening method) of hepatitis B virus (HBV). Redcross blood center and blood transfusion devision of our hospital have been employed reverse passive hemmaglutination method (RPHA) for HBsAg screening. Authors employed EIA for sensitive HBsAg test system and compared with RPHA method. Of 2,255 sera from...

  11. [Fetomaternal transfusion and diagnosis of gestational choriocarcinoma].

    Science.gov (United States)

    Emin, L; Izard, A; Schiavone, S; Kermanach, P; Deramecourt, M; Duclusaud, A; Gertych, W; Girard, S

    2015-03-01

    Choriocarcinoma is a rare but agressive malignant trophoblastic neoplasm. Fetomaternal transfusion can be the first sign of choriocarcinoma. We describe two cases of gestational choriocarinoma whose first manifestation was a fetomaternal transfusion. Fetomaternal transfusion is a rare demonstration of choriocarcinoma but its diagnosis must lead to a placenta examination with specific research of choriocarcinoma. The more the therapeutic care is precise, the better is the forecast. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  12. Premature Valvular Heart Disease in Homozygous Familial Hypercholesterolemia.

    Science.gov (United States)

    Fahed, Akl C; Shibbani, Kamel; Andary, Rabih R; Arabi, Mariam T; Habib, Robert H; Nguyen, Denis D; Haddad, Fady F; Moubarak, Elie; Nemer, Georges; Azar, Sami T; Bitar, Fadi F

    2017-01-01

    Valvular heart disease frequently occurs as a consequence of premature atherosclerosis in individuals with familial hypercholesterolemia (FH). Studies have primarily focused on aortic valve calcification in heterozygous FH, but there is paucity of data on the incidence of valvular disease in homozygous FH. We performed echocardiographic studies in 33 relatively young patients (mean age: 26 years) with homozygous FH (mean LDL of 447 mg/dL, 73% on LDL apheresis) to look for subclinical valvulopathy. Twenty-one patients had evidence of valvulopathy of the aortic or mitral valves, while seven subjects showed notable mitral regurgitation. Older patients were more likely to have aortic valve calcification (>21 versus ≤21 years: 59% versus 12.5%; p = 0.01) despite lower LDL levels at the time of the study (385 versus 513 mg/dL; p = 0.016). Patients with valvulopathy were older and had comparable LDL levels and a lower carotid intima-media thickness. Our data suggests that, in homozygous FH patients, valvulopathy (1) is present across a wide age spectrum and LDL levels and (2) is less likely to be influenced by lipid-lowering treatment. Echocardiographic studies that focused on aortic root thickening and stenosis and regurgitation are thus likely an effective modality for serial follow-up of subclinical valvular heart disease.

  13. Premature Valvular Heart Disease in Homozygous Familial Hypercholesterolemia

    Directory of Open Access Journals (Sweden)

    Akl C. Fahed

    2017-01-01

    Full Text Available Valvular heart disease frequently occurs as a consequence of premature atherosclerosis in individuals with familial hypercholesterolemia (FH. Studies have primarily focused on aortic valve calcification in heterozygous FH, but there is paucity of data on the incidence of valvular disease in homozygous FH. We performed echocardiographic studies in 33 relatively young patients (mean age: 26 years with homozygous FH (mean LDL of 447 mg/dL, 73% on LDL apheresis to look for subclinical valvulopathy. Twenty-one patients had evidence of valvulopathy of the aortic or mitral valves, while seven subjects showed notable mitral regurgitation. Older patients were more likely to have aortic valve calcification (>21 versus ≤21 years: 59% versus 12.5%; p = 0.01 despite lower LDL levels at the time of the study (385 versus 513 mg/dL; p = 0.016. Patients with valvulopathy were older and had comparable LDL levels and a lower carotid intima-media thickness. Our data suggests that, in homozygous FH patients, valvulopathy (1 is present across a wide age spectrum and LDL levels and (2 is less likely to be influenced by lipid-lowering treatment. Echocardiographic studies that focused on aortic root thickening and stenosis and regurgitation are thus likely an effective modality for serial follow-up of subclinical valvular heart disease.

  14. Secondary polycythaemia in a Malay girl with homozygous Hb Tak.

    Science.gov (United States)

    Amran, H S; Aziz, M A; George, E; Mahmud, N; Lee, T Y; Md Noor, S

    2017-12-01

    Hb Tak is one of more than 200 high affinity haemoglobin variants reported worldwide. It results from the insertion of two nucleotides (AC) at the termination codon, between codon 146 and codon 147 of the beta-globin gene [Beta 147 (+AC)]. Polycythaemia is the main clinical feature although affected carriers are usually asymptomatic and do not require intervention. Several case studies in this region have reported the co-inheritance of Hb Tak with Hb E, delta beta and beta thalassaemia with one case of homozygous Hb Tak in a Thai boy. In this case report, a cluster of haemoglobin Tak was found in a family of Malay ethnic origin. Cascade family screening was conducted while investigating a 4-year old girl who presented with symptomatic polycythaemia. She had 2 previous Hb analysis done, at 7-month and 2-year-old with the diagnosis of possible Hb Q Thailand and Homozygous Hb D, respectively. Both diagnosis did not fit her clinical presentations. She was plethoric, had reduced exercise tolerance as well as cardiomyopathy. Her parents were consanguineously married and later diagnosed as asymptomatic carriers of Hb Tak. Consequently, re-analysis of the girl's blood sample revealed a homozygous state of Hb Tak. In conclusion, high oxygen affinity haemoglobin like Hb Tak should be considered in the investigation of polycythaemic patients with abnormal Hb analyses. In this case, DNA analysis was crucial in determining the correct diagnosis.

  15. [Results of Training for Personnel Involved in Blood-Transfusion Testing Outside of Regular Work Hours at Saga University Hospital].

    Science.gov (United States)

    Yamada, Marie; Yamada, Naotomo; Higashitani, Takanori; Ohta, Shoichiro; Sueoka, Eisaburo

    2015-11-01

    Laboratory testing prior to blood transfusion outside of regular hours in many hospitals and clinics is frequently conducted by technicians without sufficient experience in such testing work. To obtain consistent test results regardless of the degree of laboratory experience with blood transfusion testing, the number of facilities introducing automated equipment for testing prior to blood transfusion is increasing. Our hospital's blood transfusion department introduced fully automated test equipment in October of 2010 for use when blood transfusions are conducted outside of regular hours. However, excessive dependence on automated testing can lead to an inability to do manual blood typing or cross-match testing when necessitated by breakdowns in the automated test equipment, in the case of abnormal specimen reactions, or other such case. In addition, even outside of normal working hours there are more than a few instances in which transfusion must take place based on urgent communications from clinical staff, with the need for prompt and flexible timing of blood transfusion test and delivery of blood products. To address this situation, in 2010 we began training after-hours laboratory personnel in blood transfusion testing to provide practice using test tubes manually and to achieve greater understanding of blood transfusion test work (especially in cases of critical blood loss). Results of the training and difficulties in its implementation for such after-hours laboratory personnel at our hospital are presented and discussed in this paper. [Original

  16. Coagulation parameters as a guide for fresh frozen plasma transfusion practice: A tertiary hospital experience

    Directory of Open Access Journals (Sweden)

    Wan Haslindawani W

    2010-01-01

    Full Text Available Introduction: The appropriate use of blood and blood products means the transfusion of safe blood products only to treat a condition leading to significant morbidity or mortality, which cannot be prevented or managed effectively by other means. The safety and effectiveness of transfusion depend on the appropriate clinical use of blood and blood products. This study was conducted to review the practice of fresh frozen plasma usage (FFP for transfusion, based on the coagulation profile, requested by various departments in the Hospital Universiti Sains Malaysia (HUSM. Methodology: A retrospective review of blood bank records and coagulation profile results of the patients given FFP from October to December 2006, in Hospital USM was undertaken. The criteria set by the College of American Pathologists in 1994, were used as the guidelines. Results: One thousand six hundred and ninety-eight units of FFP were used during this study period. Only 806 (47.47% FFP units were deemed appropriate. 20.38% were based on studies without any coagulation tests prior to transfusion and 21.13% were transfused for mild prolongation of coagulation test results. About 6.41% requested FFP in the setting of normal coagulation results. Conclusion: Our results showed that a significant proportion of the FFP transfusion was not guided by the coagulation profile. We recommend that a continuous education on FFP transfusion may help to guide the appropriate request for FFP.

  17. Transfusion management using a remote-controlled, automated blood storage.

    Science.gov (United States)

    Pagliaro, Pasqualepaolo; Turdo, Rosalia

    2008-04-01

    Generally, the safety of transfusion terapies for patients depends in part on the distribution of the blood products. The prevention of adverse events can be aided by technological means, which, besides improving the traceability of the process, make errors less likely. In this context, the latest frontier in automation and computerisation is the remote-controlled, automated refrigerator for blood storage. Computer cross-matching is an efficient and safe method for assigning blood components, based on Information Technology applied to typing and screening. This method can be extended to the management of an automated blood refrigerator, the programme of which is interfaced with the Transfusion Service's information system. The connection we made in our Service between EmoNet and Hemosafe enables real-time, remote-controlled management of the following aspects of blood component distribution: a) release of autologous and allogeneic units already allocated to a patient, b) release of available units, which can be allocated by remote-control to known patients, in the presence of a valid computer cross-match, c) release of O-negative units of blood for emergencies. Our system combines an information database, which enables computer cross-matching, with an automated refrigerator for blood storage with controlled access managed remotely by the Transfusion Service. The effectiveness and safety of the system were validated during the 4 months of its routine use in the Transfusion Service's outpatient department. The safety and efficiency of the distribution of blood products can and must be increased by the use of technological innovations. With the EmoNet/Hemosafe system, the responsibility for the remote-controlled distribution of red blood cell concentrates remains with the chief of the Transfusion Services, through the use of automated computer procedures and supported by continuous training of technicians and nursing staff.

  18. Alternative Blood Products and Clinical Needs in Transfusion Medicine

    OpenAIRE

    Whitsett, Carolyn; Vaglio, Stefania; Grazzini, Giuliano

    2012-01-01

    The primary focus of national blood programs is the provision of a safe and adequate blood supply. This goal is dependent on regular voluntary donations and a regulatory infrastructure that establishes and enforces standards for blood safety. Progress in ex vivo expansion of blood cells from cell sources including peripheral blood, cord blood, induced pluripotent stem cells, and human embryonic stem cell lines will likely make alternative transfusion products available for clinical use in the...

  19. Measuring Post-transfusion Recovery and Survival of Red Blood Cells: Strengths and Weaknesses of Chromium-51 Labeling and Alternative Methods

    Directory of Open Access Journals (Sweden)

    Camille Roussel

    2018-05-01

    Full Text Available The proportion of transfused red blood cells (RBCs that remain in circulation is an important surrogate marker of transfusion efficacy and contributes to predict the potential benefit of a transfusion process. Over the last 50 years, most of the transfusion recovery data were generated by chromium-51 (51Cr-labeling studies and were predominantly performed to validate new storage systems and new processes to prepare RBC concentrates. As a consequence, our understanding of transfusion efficacy is strongly dependent on the strengths and weaknesses of 51Cr labeling in particular. Other methods such as antigen mismatch or biotin-based labeling can bring relevant information, for example, on the long-term survival of transfused RBC. These radioactivity-free methods can be used in patients including from vulnerable groups. We provide an overview of the methods used to measure transfusion recovery in humans, compare their strengths and weaknesses, and discuss their potential limitations. Also, based on our understanding of the spleen-specific filtration of damaged RBC and historical transfusion recovery data, we propose that RBC deformability and morphology are storage lesion markers that could become useful predictors of transfusion recovery. Transfusion recovery can and should be accurately explored by more than one method. Technical optimization and clarification of concepts is still needed in this important field of transfusion and physiology.

  20. [Ethics and transfusion--seminar report].

    Science.gov (United States)

    Hervé, C; Tissot, J-D; Bouësseau, M-C; Pottier, R; Monsellier, M; Garraud, O; Hermine, O; Sannié, T; Cazenave, J-P; Cabaud, J-J; Lefrère, J-J

    2014-05-01

    This paper brings together the abstracts and proceedings of a seminar held on the topic of "ethics and transfusion", October 15, 2013 at the National Institute of Blood Transfusion, Paris. Copyright © 2014. Published by Elsevier SAS.

  1. Evidence Based Studies in Clinical Transfusion Medicine

    NARCIS (Netherlands)

    A.J.G. Jansen (Gerard)

    2007-01-01

    textabstractAfter the introduction of blood component therapy in the 1960s, more and more attention is given to clinical transfusion medicine. Although blood transfusion is an important treatment in different clinical settings, there are still lack of much randomized clinical trials. Nowadays

  2. [Blood transfusion: the challenges for tomorrow?].

    Science.gov (United States)

    Folléa, Gilles; Garraud, Olivier; Tiberghien, Pierre

    2015-02-01

    As any therapeutic means, blood transfusion requires regular evaluation, particularly for its indications, effectiveness and risks. The availability of randomized clinical trials, the evolution of the quality of blood components, and the economic constraints shared by all countries, all lead to rethink both transfusion therapy as a whole and the organization of the transfusion chain from donor to recipient. The main tools available to improve transfusion and the transfusion chain management are the following: programs of patient blood management (PBM) to optimize the use of blood products with a patient centred approach, blood supply management tools to improve the effectiveness and efficiency of the transfusion chain, donor management tools to adapt donor collections to the patients' needs in compliance with safety requirements for patients and donors, and coordination of these activities. A better understanding of these tools and their implementation will certainly be major challenges for transfusion medicine in the near future. Integrating these evolutions in regulations through the revision of the European Directives on blood and blood components (the review process is expected to be launched in 2015) should enroll them in the long term, for the benefit of patients, donors and all other stakeholders involved in the transfusion chain. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  3. Why an alternative to blood transfusion?

    Science.gov (United States)

    Shander, Aryeh; Goodnough, Lawrence Tim

    2009-04-01

    Allogeneic blood transfusions have been associated with several risks and complications and with worse outcomes in a substantial number of patient populations and clinical scenarios. Allogeneic blood is costly and difficult to procure, transport, and store. Global and local shortages are imminent. Alternatives to transfusion provide many advantages, and their use is likely to improve outcomes as safer and more effective agents are developed.

  4. Platelet transfusion therapy: from 1973 to 2005.

    NARCIS (Netherlands)

    Brand, A.; Novotny, V.M.J.; Tomson, B.

    2006-01-01

    Platelet transfusions are indispensable for supportive care of patients with hematological diseases. We describe the developments in platelet products for transfusion since the 1970s, when, in particular, support for patients with allo-antibodies against human leukocyte antigens was a laborious

  5. Reducing transfusion requirements in liver transplantation.

    Science.gov (United States)

    Donohue, Ciara I; Mallett, Susan V

    2015-12-24

    Liver transplantation (LT) was historically associated with massive blood loss and transfusion. Over the past two decades transfusion requirements have reduced dramatically and increasingly transfusion-free transplantation is a reality. Both bleeding and transfusion are associated with adverse outcomes in LT. Minimising bleeding and reducing unnecessary transfusions are therefore key goals in the perioperative period. As the understanding of the causes of bleeding has evolved so too have techniques to minimize or reduce the impact of blood loss. Surgical "piggyback" techniques, anaesthetic low central venous pressure and haemodilution strategies and the use of autologous cell salvage, point of care monitoring and targeted correction of coagulopathy, particularly through use of factor concentrates, have all contributed to declining reliance on allogenic blood products. Pre-emptive management of preoperative anaemia and adoption of more restrictive transfusion thresholds is increasingly common as patient blood management (PBM) gains momentum. Despite progress, increasing use of marginal grafts and transplantation of sicker recipients will continue to present new challenges in bleeding and transfusion management. Variation in practice across different centres and within the literature demonstrates the current lack of clear transfusion guidance. In this article we summarise the causes and predictors of bleeding and present the evidence for a variety of PBM strategies in LT.

  6. A clinical study on the feasibility of autologous cord blood transfusion for anemia of prematurity.

    Science.gov (United States)

    Khodabux, Chantal M; von Lindern, Jeannette S; van Hilten, Joost A; Scherjon, Sicco; Walther, Frans J; Brand, Anneke

    2008-08-01

    The objective was to investigate the use of autologous red blood cells (RBCs) derived from umbilical cord blood (UCB), as an alternative for allogeneic transfusions in premature infants admitted to a tertiary neonatal center. UCB collection was performed at deliveries of less than 32 weeks of gestation and processed into autologous RBC products. Premature infants requiring a RBC transfusion were randomly assigned to an autologous or allogeneic product. The primary endpoint was an at least 50 percent reduction in allogeneic transfusion needs. Fifty-seven percent of the collections harvested enough volume (> or =15 mL) for processing. After being processed, autologous products (> or =10 mL/kg) were available for 36 percent of the total study population and for 27 percent of the transfused infants and could cover 58 percent (range, 25%-100%) of the transfusion needs within the 21-day product shelf life. Availability of autologous products depended most on the gestational age. Infants born between 24 and 28 weeks had the lowest availability (17%). All products, however, would be useful in view of their high (87%) transfusion needs. Availability was highest (48%) for the infants born between 28 and 30 weeks. For 42 percent of the infants with transfusion needs in this group, autologous products were available. For the infants born between 30 and 32 weeks, autologous products were available for 36 percent of the infants. Transfusion needs in this group were, however, much lower (19%) compared to the other gestational groups. Autologous RBCs derived from UCB could not replace 50 percent of allogeneic transfusions due to the low UCB volumes collected and subsequent low product availability.

  7. Patient inclusion in transfusion medicine: current perspectives

    Directory of Open Access Journals (Sweden)

    Friedman MT

    2015-01-01

    Full Text Available Mark T Friedman,1 Peyman Bizargity,1 Sandra Gilmore,2 Arnold Friedman3 1Blood Bank and Transfusion Medicine Service, Department of Pathology, Mount Sinai St Luke's–Roosevelt Hospital Center, 2Patient Blood Management Program, Center for Blood Management and Bloodless Medicine and Surgery, Mount Sinai Beth Israel Medical Center, 3Department of Obstetrics, Gynecology, and Reproductive Science, Icahn School of Medicine at Mount Sinai, New York, NY, USA Abstract: Patients may have differing perceptions about blood transfusions based on their backgrounds, values, education levels, or cultural or religious beliefs, which may or may not be accurate. Unfortunately, despite the fact that transfusions are associated with a number of infectious and noninfectious risks, and in spite of the fact that there are ethical, accreditation, and regulatory requirements to provide information regarding transfusion risks, benefits, and alternatives to patients, transfusion consent remains inconsistently obtained. This can partly be attributed to the fact that clinicians may take on a paternalistic approach to transfusion decisions as well as to the fact that many clinicians have knowledge gaps in transfusion medicine that prevent them from obtaining transfusion consent adequately. As a result, unlike the case with other medical and surgical therapies, most patients are not included in the making of informed decisions regarding the need for transfusion versus alternative therapies, leading to many situations in which the transfusions provide little benefit to them. Recently however, a number of organizations, such as the American Association of Blood Banks and The Joint Commission in the US, have promoted multidisciplinary, evidence-based treatment strategies that aim to minimize the need for blood transfusion, the so-called patient blood management (PBM protocols. PBM strategies are expected to improve blood utilization through optimization of patients who may need

  8. Association of Blood Transfusion From Female Donors With and Without a History of Pregnancy With Mortality Among Male and Female Transfusion Recipients.

    Science.gov (United States)

    Caram-Deelder, Camila; Kreuger, Aukje L; Evers, Dorothea; de Vooght, Karen M K; van de Kerkhof, Daan; Visser, Otto; Péquériaux, Nathalie C V; Hudig, Francisca; Zwaginga, Jaap Jan; van der Bom, Johanna G; Middelburg, Rutger A

    2017-10-17

    Transfusion of red blood cells from female donors has been associated with increased mortality in male recipients. To quantify the association between red blood cell transfusion from female donors with and without a history of pregnancy and mortality of red blood cell recipients. Retrospective cohort study of first-time transfusion recipients at 6 major Dutch hospitals enrolled from May 30, 2005, to September 1, 2015; the final follow-up date was September 1, 2015. The primary analysis was the no-donor-mixture cohort (ie, either all red blood cell transfusions exclusively from male donors, or all exclusively from female donors without a history of pregnancy, or all exclusively from female donors with a history of pregnancy). The association between mortality and exposure to transfusions from ever-pregnant or never-pregnant female donors was analyzed using life tables and time-varying Cox proportional hazards models. Red blood cell transfusions from ever-pregnant or never-pregnant female donors, compared with red blood cell transfusions from male donors. All-cause mortality during follow-up. The cohort for the primary analyses consisted of 31 118 patients (median age, 65 [interquartile range, 42-77] years; 52% female) who received 59 320 red blood cell transfusions exclusively from 1 of 3 types of donors (88% male; 6% ever-pregnant female; and 6% never-pregnant female). The number of deaths in this cohort was 3969 (13% mortality). For male recipients of red blood cell transfusions, all-cause mortality rates after a red blood cell transfusion from an ever-pregnant female donor vs male donor were 101 vs 80 deaths per 1000 person-years (time-dependent "per transfusion" hazard ratio [HR] for death, 1.13 [95% CI, 1.01-1.26]). For receipt of transfusion from a never-pregnant female donor vs male donor, mortality rates were 78 vs 80 deaths per 1000 person-years (HR, 0.93 [95% CI, 0.81-1.06]). Among female recipients of red blood cell transfusions, mortality rates for

  9. Transmission of Neurodegenerative Disorders Through Blood Transfusion

    DEFF Research Database (Denmark)

    Edgren, Gustaf; Hjalgrim, Henrik; Rostgaard, Klaus

    2016-01-01

    BACKGROUND: The aggregation of misfolded proteins in the brain occurs in several neurodegenerative disorders. Aberrant protein aggregation is inducible in rodents and primates by intracerebral inoculation. Possible transfusion transmission of neurodegenerative diseases has important public health...... implications. OBJECTIVE: To investigate possible transfusion transmission of neurodegenerative disorders. DESIGN: Retrospective cohort study. SETTING: Nationwide registers of transfusions in Sweden and Denmark. PARTICIPANTS: 1 465 845 patients who received transfusions between 1968 and 2012. MEASUREMENTS.......9% received a transfusion from a donor diagnosed with one of the studied neurodegenerative diseases. No evidence of transmission of any of these diseases was found, regardless of approach. The hazard ratio for dementia in recipients of blood from donors with dementia versus recipients of blood from healthy...

  10. Blood platelet kinetics and platelet transfusion.

    Science.gov (United States)

    Aster, Richard H

    2013-11-01

    The discovery of citrate anticoagulant in the 1920s and the development of plastic packs for blood collection in the 1960s laid the groundwork for platelet transfusion therapy on a scale not previously possible. A major limitation, however, was the finding that platelet concentrates prepared from blood anticoagulated with citrate were unsuitable for transfusion because of platelet clumping. We found that this could be prevented by simply reducing the pH of platelet-rich plasma to about 6.5 prior to centrifugation. We used this approach to characterize platelet kinetics and sites of platelet sequestration in normal and pathologic states and to define the influence of variables such as anticoagulant and ABO incompatibility on post-transfusion platelet recovery. The "acidification" approach enabled much wider use of platelet transfusion therapy until alternative means of producing concentrates suitable for transfusion became available.

  11. Infection after injury: association with blood transfusion.

    Science.gov (United States)

    Rosemurgy, A S; Hart, M B; Murphy, C G; Albrink, M H; Piazza, A; Leparc, G F; Harris, R E

    1992-02-01

    This study was undertaken to evaluate the association between red blood cell transfusions and infections in an easily stratified, homogenous group of injured adults. All received their initial transfusions upon arrival to the emergency department. Over 5 years, 390 uncross-matched trauma patients received type "O" red blood cells (RBCs) during initial resuscitation. One hundred fifty-four (39%) died within 7 days because of injuries sustained: 236 (61%) survived at least 7 days. Of these 236, clear differences could be seen between those receiving 6 or fewer or 7 or more units of RBCs. When adjusted for age, sex, and severity of injury (Champion Trauma Score, Injury Severity Score, TRISS), the risk of infection was higher in those receiving 7 or more units of RBCs. Similarly, risk of infection was related to units of RBCs transfused in a dose-related fashion. Blood transfusions should be avoided, if possible. Arbitrary "trigger points" for transfusions should be abandoned.

  12. Clinical Practice Guidelines From the AABB: Red Blood Cell Transfusion Thresholds and Storage.

    Science.gov (United States)

    Carson, Jeffrey L; Guyatt, Gordon; Heddle, Nancy M; Grossman, Brenda J; Cohn, Claudia S; Fung, Mark K; Gernsheimer, Terry; Holcomb, John B; Kaplan, Lewis J; Katz, Louis M; Peterson, Nikki; Ramsey, Glenn; Rao, Sunil V; Roback, John D; Shander, Aryeh; Tobian, Aaron A R

    2016-11-15

    is 10 g/dL (strong recommendation, moderate quality evidence). A restrictive RBC transfusion threshold of 8 g/dL is recommended for patients undergoing orthopedic surgery, cardiac surgery, and those with preexisting cardiovascular disease (strong recommendation, moderate quality evidence). The restrictive transfusion threshold of 7 g/dL is likely comparable with 8 g/dL, but RCT evidence is not available for all patient categories. These recommendations do not apply to patients with acute coronary syndrome, severe thrombocytopenia (patients treated for hematological or oncological reasons who are at risk of bleeding), and chronic transfusion-dependent anemia (not recommended due to insufficient evidence). Recommendation 2: patients, including neonates, should receive RBC units selected at any point within their licensed dating period (standard issue) rather than limiting patients to transfusion of only fresh (storage length: transfusion medicine has significantly advanced the science in recent years and provides high-quality evidence to inform guidelines. A restrictive transfusion threshold is safe in most clinical settings and the current blood banking practices of using standard-issue blood should be continued.

  13. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells.

    Science.gov (United States)

    Byrne, Susan M; Ortiz, Luis; Mali, Prashant; Aach, John; Church, George M

    2015-02-18

    Sequence-specific nucleases such as TALEN and the CRISPR/Cas9 system have so far been used to disrupt, correct or insert transgenes at precise locations in mammalian genomes. We demonstrate efficient 'knock-in' targeted replacement of multi-kilobase genes in human induced pluripotent stem cells (iPSC). Using a model system replacing endogenous human genes with their mouse counterpart, we performed a comprehensive study of targeting vector design parameters for homologous recombination. A 2.7 kilobase (kb) homozygous gene replacement was achieved in up to 11% of iPSC without selection. The optimal homology arm length was around 2 kb, with homology length being especially critical on the arm not adjacent to the cut site. Homologous sequence inside the cut sites was detrimental to targeting efficiency, consistent with a synthesis-dependent strand annealing (SDSA) mechanism. Using two nuclease sites, we observed a high degree of gene excisions and inversions, which sometimes occurred more frequently than indel mutations. While homozygous deletions of 86 kb were achieved with up to 8% frequency, deletion frequencies were not solely a function of nuclease activity and deletion size. Our results analyzing the optimal parameters for targeting vector design will inform future gene targeting efforts involving multi-kilobase gene segments, particularly in human iPSC. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Successful Treatment Of Homozygous Familial Hypercholesterolemia Using Cascade Filtration Plasmapheresis

    Directory of Open Access Journals (Sweden)

    Fatih Kardas

    2012-12-01

    Full Text Available OBJECTIVE: The aim of our study is to discuss the efficacy of low-density lipoprotein-cholesterol (LDL-C apheresis procedure using the cascade filtration system for pediatric patients with homozygous familial hypercholesterolemia (FH, and to clarify the adverse effects and difficulties. METHODS: LDL apheresis using the cascade filtration system was performed in 3 pediatric patients with homozygous FH. In total, 120 apheresis sessions were performed for all patients. RESULTS: Cascade filtration therapy significantly reduced the mean LDL-C values from 418 ± 62 mg/dl to 145 ± 43 mg/dl (p<0.05. We determined an acute mean reduction in the plasma levels of total cholesterol (57.9%, LDL cholesterol (70.8%, and high-density lipoprotein (HDL cholesterol (40.7%. Treatments were well tolerated. The most frequent clinical adverse effects were hypotension in 3 sessions (2.5%, chills/feeling cold (1.7% in 2 sessions, and nausea and vomiting in 3 sessions (2.5%. CONCLUSION: Our experience with three patients using the cascade filtration system were, good clinical outcomes, laboratory findings, safety of usage, minor adverse effects and technical problems.

  15. Successful treatment of homozygous familial hypercholesterolemia using cascade filtration plasmapheresis.

    Science.gov (United States)

    Kardaş, Fatih; Cetin, Aysun; Solmaz, Musa; Büyükoğlan, Rüksan; Kaynar, Leylagül; Kendirci, Mustafa; Eser, Bülent; Unal, Ali

    2012-12-01

    The aim of this study was to report the efficacy of low-density lipoprotein cholesterol (LDL-C) apheresisusing a cascade filtration system in pediatric patients with homozygous familial hypercholesterolemia (FH), and toclarify the associated adverse effects and difficulties. LDL-C apheresis using a cascade filtration system was performed in 3 pediatric patientswith homozygous FH; in total, 120 apheresis sessions were performed. Cascade filtration therapy significantly reduced the mean LDL-C values from 418 ± 62 mg/dL to 145 ± 43 mg/dL (p= 0.011). We observed an acute mean reduction in the plasma level of total cholesterol (57.9%), LDL-C (70.8%),and high-density lipoprotein cholesterol (HDL-C) (40.7%). Treatments were well tolerated. The most frequent clinicaladverse effects were hypotension in 3 sessions (2.5%), chills (1.7%) in 2 sessions, and nausea/vomiting in 3 sessions(2.5%). Our experience using the cascade filtration system with 3 patients included good clinical outcomes andlaboratory findings, safe usage, and minor adverse effects and technical problems. None declared.

  16. Homozygous STIL mutation causes holoprosencephaly and microcephaly in two siblings.

    Directory of Open Access Journals (Sweden)

    Charlotte Mouden

    Full Text Available Holoprosencephaly (HPE is a frequent congenital malformation of the brain characterized by impaired forebrain cleavage and midline facial anomalies. Heterozygous mutations in 14 genes have been identified in HPE patients that account for only 30% of HPE cases, suggesting the existence of other HPE genes. Data from homozygosity mapping and whole-exome sequencing in a consanguineous Turkish family were combined to identify a homozygous missense mutation (c.2150G>A; p.Gly717Glu in STIL, common to the two affected children. STIL has a role in centriole formation and has previously been described in rare cases of microcephaly. Rescue experiments in U2OS cells showed that the STIL p.Gly717Glu mutation was not able to fully restore the centriole duplication failure following depletion of endogenous STIL protein indicating the deleterious role of the mutation. In situ hybridization experiments using chick embryos demonstrated that expression of Stil was in accordance with a function during early patterning of the forebrain. It is only the second time that a STIL homozygous mutation causing a recessive form of HPE was reported. This result also supports the genetic heterogeneity of HPE and increases the panel of genes to be tested for HPE diagnosis.

  17. Triggers of blood transfusion in percutaneous nephrolithotomy

    International Nuclear Information System (INIS)

    Zehri, A.K.; Biyabani, S.R.; Siddiqui, K.M.; Memon, A.

    2011-01-01

    To determine the triggers of blood transfusion in patients undergoing percutaneous nephrolithotomy (PCNL). The percutaneous surgery database was retrospectively reviewed to identify patients with postoperative haemorrhage and need for blood transfusion. Blood loss was estimated by the postoperative drop in haemoglobin factored by the quantity of any blood transfusion. Various patients and procedure-related factors were assessed for association with total blood loss or blood transfusion requirement using stepwise univariate, forward multivariate regression analysis. A total of 326 procedures were performed in 316 patients. Two hundred and thirty two procedures were included in the study. There were 167 males and 65 females. The mean age was 41+14 years. The mean haemoglobin drop was 1.68 +1.3 gm/dL. The overall blood transfusion rate was 14.2%. Stepwise multivariate regression analysis showed that female gender (p = 0.003), staghorn stone (p = 0.023), stone fragmentation with ultrasound (p = 0.054) and chronic renal failure (p = 0.001) were significantly predictive of the need for blood transfusion. Chronic renal failure, female gender, presence of staghorn calculi and stone fragmentation using ultrasonic device were predictive of blood transfusion in this cohort of patients. (author)

  18. Association of Blood Transfusion From Female Donors With and Without a History of Pregnancy With Mortality Among Male and Female Transfusion Recipients

    Science.gov (United States)

    Caram-Deelder, Camila; Kreuger, Aukje L.; Evers, Dorothea; de Vooght, Karen M. K.; van de Kerkhof, Daan; Visser, Otto; Péquériaux, Nathalie C. V.; Hudig, Francisca; Zwaginga, Jaap Jan; van der Bom, Johanna G.

    2017-01-01

    Importance Transfusion of red blood cells from female donors has been associated with increased mortality in male recipients. Objective To quantify the association between red blood cell transfusion from female donors with and without a history of pregnancy and mortality of red blood cell recipients. Design, Setting, and Participants Retrospective cohort study of first-time transfusion recipients at 6 major Dutch hospitals enrolled from May 30, 2005, to September 1, 2015; the final follow-up date was September 1, 2015. The primary analysis was the no-donor-mixture cohort (ie, either all red blood cell transfusions exclusively from male donors, or all exclusively from female donors without a history of pregnancy, or all exclusively from female donors with a history of pregnancy). The association between mortality and exposure to transfusions from ever-pregnant or never-pregnant female donors was analyzed using life tables and time-varying Cox proportional hazards models. Exposures Red blood cell transfusions from ever-pregnant or never-pregnant female donors, compared with red blood cell transfusions from male donors. Main Outcomes and Measures All-cause mortality during follow-up. Results The cohort for the primary analyses consisted of 31 118 patients (median age, 65 [interquartile range, 42-77] years; 52% female) who received 59 320 red blood cell transfusions exclusively from 1 of 3 types of donors (88% male; 6% ever-pregnant female; and 6% never-pregnant female). The number of deaths in this cohort was 3969 (13% mortality). For male recipients of red blood cell transfusions, all-cause mortality rates after a red blood cell transfusion from an ever-pregnant female donor vs male donor were 101 vs 80 deaths per 1000 person-years (time-dependent “per transfusion” hazard ratio [HR] for death, 1.13 [95% CI, 1.01-1.26]). For receipt of transfusion from a never-pregnant female donor vs male donor, mortality rates were 78 vs 80 deaths per 1000 person-years (HR

  19. Transfusion regimens in thalassemia intermedia

    Directory of Open Access Journals (Sweden)

    Z. Karakas

    2011-12-01

    Full Text Available Thalassemia intermedia (TI is a heterogeneous disease, in terms of both clinical manifestations and underlying molecular defects. Some TI patients are asymptomatic until adult life, whereas others are symptomatic from early childhood. In contrast with patients with Thalassemia major (TM, the severity of anemia is less and the patients do not require transfusions during at least the first few years of life. Many patients with TI, especially older ones, have been exposed to the multiple long-term effects of chronic anemia and tissue hypoxia and their compensatory reactions, including enhanced erythropoiesis and increased iron absorption. Bone marrow expansion and extramedullary hematopoiesis lead to bone deformities and liver and spleen enlargement. Therapeutic strategies in TI are not clear and different criteria are used to decide the initiation of transfusion and chelation therapy, modulation of fetal hemoglobin production, and hematopoietic stem cell transplantation on an individual basis. The clinical picture of well-treated TM patients with regular transfusionchelation therapy is better from TI patients who have not received adequate transfusion therapy. There is a significant role of early blood transfusion to prevent and treat complications commonly associated with TI, such as extramedullary erythropoiesis and bone deformities, autoimmune hemolytic anemia, leg ulcers, gallstones, pseudoxantoma elasticum, hyperuricosuria, gout and pulmonary hypertension, which are rarely seen in thalassemia major. Nowadays, indications of transfusion in patients with TI are chronic anemia (Hb < 7 g/dL, bone deformities, growth failure, extramedullary erythropoiesis, heart failure, pregnancy and preparation for surgical procedures. Conclusion: Adequate (regular or tailored transfusion therapy is an important treatment modality for increasing the quality of life in patients with thalassemia intermedia during childhood. 就临床表象和潜在的分子缺

  20. Twin-twin transfusion syndrome - diagnosis and prognosis

    Directory of Open Access Journals (Sweden)

    Hajrić-Egić Amira

    2003-01-01

    Full Text Available Twin-twin transfusion syndrome is a serious complication of monozygotic, monochorionic, diamniotic twins resulting from transplacental vascular communications. In this syndrome blood is thought to be shunted from one twin - donor,who develops anaemia,growth retardation and oligoamnios, to the other twin - recipient,who becomes plethoric,macrosomic and develops polyhydroamnios. The incidence of twin-twin transfusion syndrome ranges from 5-15% of all twin pregnancies. If this condition develops in the second trimester, it is usually associated with spontaneous abortion and death of one or both fetuses before viability. Developing the syndrome in the third trimester has better perinatal outcome. Mortality rates ranging from 56%-100%, depending on gestational age and severity of the syndrome. The ultrasound criterias for diagnosis, in this study,were the presence of twins of the same sex with discordant growth, with oligohydroamnios in one twin sac and polyhydroamnios in the other one, one placenta and thin membrane between twins. The present study shows clinical course of 14 cases and value of Doppler ultrasound to analyze the usefulness of umbilical artery blood flow velocimetry for predicting the risk of twin-twin transfusion syndrome. 14 twin pregnancies with twin-twin transfusion syndrome were diagnosed during the last four years period and prospectivelly followed. 9 cases were diagnosed before the completion od 28 weeks of gestation.The mean gestational age was 21,6_+4,2 weeks at diagnosis and 23,2+_3,6 weeks at delivery. 5 cases were diagnosed after 28 weeks of gestation. The mean gestational age in this group was 29,6+_2,1 weeks at diagnosis and 33+_3,3 weeks at delivery. The survival rate in this study was 29%(8/28.9 cases ended in spontaneous abortion between 18th and 27th weeks of pregnancy (table 1 and 5 in premature labor (table 2.There were 7 intrauterine death (5 at admission and 2 few days after admission and 13 neonatal deaths

  1. [Blood transfusion, an investigation on its brief history].

    Science.gov (United States)

    Wang, B; Peng, X

    2000-07-01

    Transfusion has developed as a practical clinical technique. Its development has experienced from ignorance to science and from cruelty to civilization for hundreds of year. Transfusion has made great contribution for saving lives and expanding operation coverage. To understand the history of transfusion, we can have reference to promote again the development of transfusion technique.

  2. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  3. Transfusion management of patients with alloanti-Gerbich antibodies: Case report

    Directory of Open Access Journals (Sweden)

    Jovanović Radmila

    2011-01-01

    Full Text Available Introduction. Transfusion management of patients who are alloimmunized against high-prevalence erythrocyte antigens is often problematic. Strategy management depends, not only on the specific clinical circumstances of the patient, but also on the acceptable time frame. In patients without clinically significant antibody incompatible transfusion it may be less harmful than delaying medical intervention. Case Outline. We report a 57-year-old female from Libya, blood group O, RhD-positive, who was treated at the Institute of Cardiovascular Diseases of Vojvodina. At the Blood Transfusion Institute of Vojvodina, during pretransfusion testing an IgG alloantibody of unknown specificity was determined. A total of 200 blood units (O, RhD-positive were crossmatched, but positive reactions indicating that the donor units were incompatible for that specific patient. By testing the patient’s family members in Tripoli, six compatible blood units were found and applied during and after surgery. Due to the deterioration of the patient’s condition a rapid transfusion was required; however cross-match compatible blood was not available. After a biological crossmatch to predict the clinical significance of this antibody, 12 units of erythrocytes with the lowest positive cross-match reactions, were transfused to the patient without any adverse effects. Good tolerance of the units suggested that the present antibodies were not clinically significant. Later on, a rare alloantibody directed to the high frequency Gerbich blood group antigens was identified by the Foundation Central Laboratory, Blood Transfusion Service in Bern, Switzerland. Conclusion. In cases of emergency patients with alloantibodies against high frequency Gerbich, when autologous or compatible alogenous transfusion is unavailable, blood with the lowest positive cross-match reaction could be transfused if the biological cross-match is negative. Formation of a national register of donors with rare

  4. Blood doping: the flip side of transfusion and transfusion alternatives.

    Science.gov (United States)

    Cacic, Daniel Limi; Hervig, Tor; Seghatchian, Jerard

    2013-08-01

    Blood doping in sports has been a hot topic of present. Longitudinal follow up of hematological parameters in different endurance sports, during the 1990s and early 2000s, has provided considerable suspicions about extensive blood manipulation, with performance enhancing effects. Recent doping revelations in the media also prove that blood doping is not an anticipated myth but it is, in fact, real. Erythropoiesis stimulating agents and autologous blood transfusions are used in synergy with substantial effect on the maximum oxygen uptake and delivery to muscles. Whilst both methods of blood manipulation represent a potential health hazard, in the context of an elevated hematocrit, nevertheless despite a number of suspicious deaths amongst athletes, this has not yet been fully documented. A reliable test for detection of recombinant human erythropoietin was implemented in 2000, but this is probably circumvented by microdose regimens. The Athlete's Biological Passport represents the progeny of the idea of an indirect approach based on long term monitoring of hematological parameters, thus making it possible to detect autologous blood doping and erythropoietin use after the substance is excreted. Nevertheless with advances in anti-doping measures it is possible that the levels of excretion of substances used can be masked. Clearly more sensitive and specific diagnostic tools and research/development in these areas of major concern are warranted, which, combined with changes in the athlete's attitude, will help in reaching the vision of fair play. Copyright © 2013. Published by Elsevier Ltd.

  5. Genotyping Applications for Transplantation and Transfusion Management: The Emory Experience.

    Science.gov (United States)

    Fasano, Ross M; Sullivan, Harold Cliff; Bray, Robert A; Gebel, Howard M; Meyer, Erin K; Winkler, Annie M; Josephson, Cassandra D; Stowell, Sean R; Sandy Duncan, Alexander; Roback, John D

    2017-03-01

    Current genotyping methodologies for transplantation and transfusion management employ multiplex systems that allow for simultaneous detection of multiple HLA antigens, human platelet antigens, and red blood cell (RBC) antigens. The development of high-resolution, molecular HLA typing has led to improved outcomes in unrelated hematopoietic stem cell transplants by better identifying compatible alleles of the HLA-A, B, C, DRB1, and DQB1 antigens. In solid organ transplantation, the combination of high-resolution HLA typing with solid-phase antibody identification has proven of value for highly sensitized patients and has significantly reduced incompatible crossmatches at the time of organ allocation. This database-driven, combined HLA antigen/antibody testing has enabled routine implementation of "virtual crossmatching" and may even obviate the need for physical crossmatching. In addition, DNA-based testing for RBC antigens provides an alternative typing method that mitigates many of the limitations of hemagglutination-based phenotyping. Although RBC genotyping has utility in various transfusion settings, it has arguably been most useful for minimizing alloimmunization in the management of transfusion-dependent patients with sickle cell disease or thalassemia. The availability of high-throughput RBC genotyping for both individuals and large populations of donors, along with coordinated informatics systems to compare patients' antigen profiles with available antigen-negative and/or rare blood-typed donors, holds promise for improving the efficiency, reliability, and extent of RBC matching for this population.

  6. [French training program for medical students in transfusion medicine. Transfusion Medicine Teachers' College].

    Science.gov (United States)

    Wautier, J-L; Cabaud, J-J; Cazenave, J-P; Fialon, P; Fruchart, M-F; Joussemet, M; Leblond, V; Muller, J-Y; Rouger, P; Vignon, D; Waller, C; Lefrère, J-J; Worms, B; Vileyn, F

    2005-02-01

    In France, transfusion medicine training program has been updated. A national committee of professors in transfusion medicine propose a series of 13 items which represent the minimum knowledge that general practitioners should possess. This overview of transfusion medicine is far below the level that specialists should reach and they will need an additional specialized training. Several French universities have set up their own training program which is quite similar to the work of the committee of professors. The following recommendations are not strict guidelines but is a common basis which will be improved in 2005 according to new evidence based transfusion medicine.

  7. Effect of Blood Transfusions on the Outcome of Very Low Body Weight Preterm Infants under Two Different Transfusion Criteria

    Directory of Open Access Journals (Sweden)

    Hsiu-Lin Chen

    2009-06-01

    Conclusion: Both criteria of PRBC transfusion had similar clinical outcomes, although liberal transfusion resulted in a greater amount of blood transfused and a low reticulocyte count at 30 days of age. We suggest restrictive criteria for minimizing the overall amount of transfusion to less than 30 mL may be a better way of preventing CLD in VLBW infants.

  8. Blood transfusion practices in obstetric anaesthesia

    Directory of Open Access Journals (Sweden)

    Ashok Jadon

    2014-01-01

    Full Text Available Blood transfusion is an essential component of emergency obstetric care and appropriate blood transfusion significantly reduces maternal mortality. Obstetric haemorrhage, especially postpartum haemorrhage, remains one of the major causes of massive haemorrhage and a prime cause of maternal mortality. Blood loss and assessment of its correct requirement are difficult in pregnancy due to physiological changes and comorbid conditions. Many guidelines have been used to assess the requirement and transfusion of blood and its components. Infrastructural, economic, social and religious constraints in blood banking and donation are key issues to formulate practice guidelines. Available current guidelines for transfusion are mostly from the developed world; however, they can be used by developing countries keeping available resources in perspective.

  9. Transfusion syndromes in monochorionic multiplets: An overview

    African Journals Online (AJOL)

    come for attention to be focused on an area of gemellology, feto‑fetal transfusion syndromes in multiplets, in order ... These health hazards, all causes of very high perinatal ..... of monochorionic twin pregnancy complicated with selective fetal.

  10. Red blood cell transfusion in neurosurgery.

    Science.gov (United States)

    Linsler, Stefan; Ketter, Ralf; Eichler, Hermann; Schwerdtfeger, Karsten; Steudel, Wolf-Ingo; Oertel, Joachim

    2012-07-01

    The necessity of red blood cell (RBC) transfusions in neurosurgical procedures is under debate. Although detailed recommendations exist for many other surgical disciplines, there are very limited data on the probability of transfusions during neurosurgical procedures. Three-thousand and twenty-six consecutive adult patients undergoing neurosurgical procedures at Saarland University Hospital from December 2006 to June 2008 were retrospectively analyzed for administration of RBCs. The patients were grouped into 11 main diagnostic categories for analysis. The transfusion probability and cross-match to transfusion ratio (C/T ratio) were calculated. Overall, the transfusion probability for neurosurgical procedures was 1.7 % (52/3,026). The probability was 6.5 % for acute subdural hematoma (7/108), 6.2 % for spinal tumors (5/80), 4.6 % for intracerebral hemorrhage (ICH, 4/98), 2.8 % for abscess (3/108), 2.4 % for traumatic brain injury (4/162), 2.3 % for cerebral ischemia (1/44), 1.9 % for subarachnoid hemorrhage (SAH) /aneurysms (4/206), 1.4 % for brain tumors (10/718), 0.8 % for hydrocephalus (2/196), 0.4 % for degenerative diseases of the spine (5/1290), including 3.6 % (3/82) for posterior lumbar interbody fusion (PLIF) and 0 % for epidural hematoma (0/15). The transfusion probabilities for clipping and coiling of SAH were 2.9 % (2/68) and 1.7 % (2/120) respectively. The probability of blood transfusion during neurosurgical procedures is well below the 10 % level which is generally defined as the limit for preoperative appropriation of RBCs. Patients with spinal tumors, acute subdural hematomas or ICH, i.e., patients undergoing large decompressive procedures of bone or soft tissue, had a higher probability of transfusion.

  11. [Beginning Knowledge of Transfusion in Japan].

    Science.gov (United States)

    Mazda, Toshio; Shimizu, Masaru

    2015-01-01

    Blood components and plasma derivatives are two of the most useful tools in modern medicine. When the Portuguese opened the maritime routes to the Far East in the 16th century. Western medicine traveled to Japan on the trading vessels that carried physicians and barber-surgeons to care for the body and Christian missionaries to care for the soul. Skilled interpreters such as Kōgyū Yoshio translated and studied Dutch editions of early medical books, like Lorenz Heister's "Chirurgie" (Nürnberg, 1719), that illustrate the concept of transfusion. The oldest description of transfusion originating in Japan is a handwritten manuscript entitled "Bansui Sensi Chojutsu Shomoku" by Masamichi Nishijima, a student of Bansui Otsuki. It is a list of Otsuki's translated works. He described book names and chapter names in the manuscript, and when he finished translation of a chapter, he marked a circle on the chapter name. The transfusion chapter had a circle. That dates the earliest writing on transfusion in Japanese to 1804, shortly after the death of Kōgyū. Unfortunately, the manuscript translation no longer exists. In 1814, Shunzō Yoshio, grandson of Kōgyū, and in 1820, Tokki Koshimura, translated the figure legends of "Chirurgie." Soon afterwards, after the first report of transfusion from human-to-human by James Blundell in London in 1818, Western medical books published on the subject began to arrive. The works of Christoph Wilhelm Hufeland, Georg Friedrich Most and Carl Canstatt all mentioning transfusion, albeit without details, were translated by Kōan Ogata and Shinryō Tsuboi. During the Edo period, Japan was a closed country; only open to the Dutch through a tiny island in Nagasaki. But Japanese doctors in the Edo period learned about blood transfusion through Dutch-translated versions of Western medical Books. Transfusion began being practiced in Japan in 1919, almost exactly 100 years after the concept was introduced

  12. Risk factors for blood transfusion after shoulder arthroplasty.

    Science.gov (United States)

    Padegimas, E M; Clyde, C T; Zmistowski, B M; Restrepo, C; Williams, G R; Namdari, S

    2016-02-01

    Currently, there is little information about the need for peri-operative blood transfusion in patients undergoing shoulder arthroplasty. The purpose of this study was to identify the rate of transfusion and its predisposing factors, and to establish a blood conservation strategy. We identified all patients who had undergone shoulder arthroplasty at our hospital between 1 January 2011 and 31 December 2013. The rate of transfusion was determined from the patient's records. While there were exceptions, patients typically underwent transfusion if they had a level of haemoglobin of transfusion. High- and low-risk cohorts for transfusion were identified from a receiver operating characteristic (ROC) curve. Of 1174 shoulder arthroplasties performed on 1081 patients, 53 cases (4.5%) required transfusion post-operatively. Predictors of blood transfusion were a lower pre-operative haematocrit (p transfusion. In total 48 of the 436 (11%) shoulder arthroplasties with a pre-operative haematocrit transfusion compared with five of the 738 (0.70%) shoulder arthroplasties with a haematocrit above this level. We found that transfusion was needed less frequently than previously described for shoulder arthroplasty. Patients with a pre-operative haematocrit blood transfusion, while those with a haematocrit above this level are unlikely to require transfusion. The rate of transfusion after shoulder arthroplasty is under 5%, and those with a pre-operative haematocrit greater than or equal to 39.6% have a very low likelihood (transfusion. ©2016 The British Editorial Society of Bone & Joint Surgery.

  13. Blood Transfusion Delay and Outcome in County Hospitals in Kenya.

    Science.gov (United States)

    Thomas, Julius; Ayieko, Philip; Ogero, Morris; Gachau, Susan; Makone, Boniface; Nyachiro, Wycliffe; Mbevi, George; Chepkirui, Mercy; Malla, Lucas; Oliwa, Jacquie; Irimu, Grace; English, Mike

    2017-02-08

    Severe anemia is a leading indication for blood transfusion and a major cause of hospital admission and mortality in African children. Failure to initiate blood transfusion rapidly enough contributes to anemia deaths in sub-Saharan Africa. This article examines delays in accessing blood and outcomes in transfused children in Kenyan hospitals. Children admitted with nonsurgical conditions in 10 Kenyan county hospitals participating in the Clinical Information Network who had blood transfusion ordered from September 2013 to March 2016 were studied. The delay in blood transfusion was calculated from the date when blood transfusion was prescribed to date of actual transfusion. Five percent (2,875/53,174) of admissions had blood transfusion ordered. Approximately half (45%, 1,295/2,875) of children who had blood transfusion ordered at admission had a documented hemoglobin transfusions, 82% were administered and documented in clinical records, and three-quarters of these (75%, 1,760/2,352) were given on the same day as ordered but these proportions varied from 71% to 100% across the 10 hospitals. Children who had a transfusion ordered but did not receive the prescribed transfusion had a mortality of 20%, compared with 12% among those transfused. Malaria-associated anemia remains the leading indication for blood transfusion in acute childhood illness admissions. Delays in transfusion are common and associated with poor outcomes. Variance in delay across hospitals may be a useful indicator of health system performance. © The American Society of Tropical Medicine and Hygiene.

  14. The Nlrp3 Inflammasome Does Not Regulate Alloimmunization to Transfused Red Blood Cells in Mice

    Directory of Open Access Journals (Sweden)

    David R. Gibb

    2016-07-01

    Full Text Available Red blood cell (RBC transfusions are essential for patients with hematological disorders and bone marrow failure syndromes. Despite ABO matching, RBC transfusions can lead to production of alloantibodies against “minor” blood group antigens. Non-ABO alloimmunization is a leading cause of transfusion-associated mortality in the U.S. Despite its clinical importance, little is known about the immunological factors that promote alloimmunization. Prior studies indicate that inflammatory conditions place patients at higher risk for alloimmunization. Additionally, co-exposure to pro-inflammatory pathogen associated molecular patterns (PAMPs promotes alloimmunization in animal models, suggesting that RBC alloimmunization depends on innate immune cell activation. However, the specific innate immune stimuli and sensors that induce a T cell-dependent alloantibody response to transfused RBCs have not been identified. The NLRP3 inflammasome senses chemically diverse PAMPs and damage associated molecular patterns (DAMPs, including extracellular ATP and iron-containing heme. We hypothesized that activation of the NLRP3 inflammasome by endogenous DAMPs from RBCs promotes the alloimmune response to a sterile RBC transfusion. Using genetically modified mice lacking either NLRP3 or multiple downstream inflammasome response elements, we ruled out a role for the NLRP3 inflammasome or any Caspase-1 or -11 dependent inflammasome in regulating RBC alloantibody production to a model antigen.

  15. Preoperative blood transfusions for sickle cell disease

    Science.gov (United States)

    Estcourt, Lise J; Fortin, Patricia M; Trivella, Marialena; Hopewell, Sally

    2016-01-01

    Background Sickle cell disease is one of the commonest severe monogenic disorders in the world, due to the inheritance of two abnormal haemoglobin (beta globin) genes. Sickle cell disease can cause severe pain, significant end-organ damage, pulmonary complications, and premature death. Surgical interventions are more common in people with sickle cell disease, and occur at much younger ages than in the general population. Blood transfusions are frequently used prior to surgery and several regimens are used but there is no consensus over the best method or the necessity of transfusion in specific surgical cases. This is an update of a Cochrane review first published in 2001. Objectives To determine whether there is evidence that preoperative blood transfusion in people with sickle cell disease undergoing elective or emergency surgery reduces mortality and perioperative or sickle cell-related serious adverse events. To compare the effectiveness of different transfusion regimens (aggressive or conservative) if preoperative transfusions are indicated in people with sickle cell disease. Search methods We searched for relevant trials in The Cochrane Library, MEDLINE (from 1946), Embase (from 1974), the Transfusion Evidence Library (from 1980), and ongoing trial databases; all searches current to 23 March 2016. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Trials Register: 18 January 2016. Selection criteria All randomised controlled trials and quasi-randomised controlled trials comparing preoperative blood transfusion regimens to different regimens or no transfusion in people with sickle cell disease undergoing elective or emergency surgery. There was no restriction by outcomes examined, language or publication status. Data collection and analysis Two authors independently assessed trial eligibility and the risk of bias and extracted data. Main results Three trials with 990 participants were eligible for inclusion in the review. There were no

  16. Do autologous blood transfusion systems reduce allogeneic blood transfusion in total knee arthroplasty?

    Science.gov (United States)

    Pawaskar, Aditya; Salunke, Abhijeet Ashok; Kekatpure, Aashay; Chen, Yongsheng; Nambi, G I; Tan, Junhao; Sonawane, Dhiraj; Pathak, Subodhkumar

    2017-09-01

    To study whether autologus blood transfusion systems reduce the requirement of allogneic blood transfusion in patients undergoing total knee arthroplasty. A comprehensive search of the published literature with PubMed, Scopus and Science direct database was performed. The following search terms were used: (total knee replacement) OR (total knee arthroplasty) OR (TKA) AND (blood transfusion) OR (autologous transfusion) OR (autologous transfusion system). Using search syntax, a total of 748 search results were obtained (79 from PubMed, 586 from Science direct and 83 from Scopus). Twenty-one randomized control trials were included for this meta-analysis. The allogenic transfusion rate in autologus blood transfusion (study) group was significantly lower than the control group (28.4 and 53.5 %, respectively) (p value 0.0001, Relative risk: 0.5). The median units of allogenic blood transfused in study control group and control group were 0.1 (0.1-3.0) and 1.3 (0.3-2.6), respectively. The median hospital stay in study group was 9 (6.7-15.6) days and control group was 8.7 (6.6-16.7) days. The median cost incurred for blood transfusion per patient in study and control groups was 175 (85.7-260) and 254.7 (235-300) euros, respectively. This meta-analysis demonstrates that the use of auto-transfusion systems is a cost-effective method to reduce the need for and quantity of allogenic transfusion in elective total knee arthroplasty. Level I.

  17. Blood transfusion : Transfusion-related acute lung injury: back to basics

    NARCIS (Netherlands)

    Peters, A.L.

    2017-01-01

    Transfusion-related acute lung injury (TRALI) is a life-threatening disease affecting the lungs. TRALI can develop within 6 hours after transfusion and almost all patients with TRALI require mechanical ventilation at the intensive care department. Nevertheless up to 40% of patients do not recover

  18. Inhibition of IL-1 activity induced with allogeneic transfusion of UV-irradiated blood

    International Nuclear Information System (INIS)

    Horvat, B.; Poljak-Blazi, M.; Hadija, M.

    1991-01-01

    Treatment with UV-irradiated donor-specific blood transfusion is known to induce specific unresponsiveness in recipient animals and prolong allograft survival. Mixed lymphocyte response in transfused mice was decreased towards spleen cells of the blood donor strain, but was not altered to third-party cells. Sera from treated mice showed significantly lower interleukin-1 (IL-1) activity, which was increased with higher dilutions of sera, indicating the presence of IL-1 inhibitor. Furthermore, sera decreased rIL-1-induced cell proliferation in dose-dependent manner, while the response to rIL-2 neither depended on the concentration of sera, nor differed between non-treated controls and treated mice. These results indicate that UV-irradiated allogeneic blood transfusion could induce an inhibitor, specifically directed to IL-1 activity, which may be involved in the generation of immunological unresponsiveness in treated animals. (author)

  19. Blood transfusion safety: a new philosophy.

    Science.gov (United States)

    Franklin, I M

    2012-12-01

    Blood transfusion safety has had a chequered history, and there are current and future challenges. Internationally, there is no clear consensus for many aspects of the provision of safe blood, although pan-national legislation does provide a baseline framework in the European Union. Costs are rising, and new safety measures can appear expensive, especially when tested against some other medical interventions, such as cancer treatment and vaccination programmes. In this article, it is proposed that a comprehensive approach is taken to the issue of blood transfusion safety that considers all aspects of the process rather than considering only new measures. The need for an agreed level of safety for specified and unknown risks is also suggested. The importance of providing care and support for those inadvertently injured as a result of transfusion problems is also made. Given that the current blood safety decision process often uses a utilitarian principle for decision making--through the calculation of Quality Adjusted Life Years--an alternative philosophy is proposed. A social contract for blood safety, based on the principles of 'justice as fairness' developed by John Rawls, is recommended as a means of providing an agreed level of safety, containing costs and providing support for any adverse outcomes. © 2012 The Author. Transfusion Medicine © 2012 British Blood Transfusion Society.

  20. Red blood cell transfusion in septic shock

    DEFF Research Database (Denmark)

    Rosland, Ragnhild G; Hagen, Marte U; Haase, Nicolai

    2014-01-01

    Sepsis-related Organ Failure Assessment (SOFA) scores (days 1 and 5), more days in shock (5 (3-10) vs. 2 (2-4), p = 0.0001), more days in ICU (10 (4-19) vs. 4 (2-8), p = 0.0001) and higher 90-day mortality (66 vs. 43%, p = 0.001). The latter association was lost after adjustment for admission category....../dl and independent of shock day and bleeding. Patients with cardiovascular disease were transfused at higher haemoglobin levels. Transfused patients had higher Simplified Acute Physiology Score (SAPS) II (56 (45-69) vs. 48 (37-61), p = 0.0005), more bleeding episodes, lower haemoglobin levels days 1 to 5, higher...... and SAPS II and SOFA-score on day 1. CONCLUSIONS: The decision to transfuse patients with septic shock was likely affected by disease severity and bleeding, but haemoglobin level was the only measure that consistently differed between transfused and non-transfused patients....

  1. Transfusion and blood donation in comic strips.

    Science.gov (United States)

    Lefrère, Jean-Jacques; Danic, Bruno

    2013-07-01

    The representation of blood transfusion and donation of blood in the comic strip has never been studied. The comic strip, which is a relatively recent art, emerged in the 19th century before becoming a mass medium during the 20th century. We have sought, by calling on collectors and using the resources of Internet, comic strips devoted, wholly or in part, to the themes of transfusion and blood donation. We present some of them here in chronologic order, indicating the title, country of origin, year of publication, and names of authors. The theme of the superhero using transfusion to transmit his virtues or his powers is repeated throughout the 20th century in North American comic strips. More recently, comic strips have been conceived from the outset with a promotional aim. They perpetuate positive images and are directed toward a young readership, wielding humor to reduce the fear of venipuncture. Few comic strips denounce the abuse of the commercialization of products derived from the human body. The image of transfusion and blood donation given by the comic strips is not to be underestimated because their readership is primarily children, some of whom will become blood donors. Furthermore, if some readers are transfused during their lives, the impact of a memory more or less conscious of these childhood readings may resurface, both in hopes and in fears. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation

    Science.gov (United States)

    Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip

    2016-01-01

    Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745

  3. Diagnosis of Beta-thalassaemia major in previously transfused patients

    International Nuclear Information System (INIS)

    Ahmed, S.; Rehman, Z.; Karamat, K.A.

    2003-01-01

    Objective: The study was conducted to evaluate the effects of blood transfusion(s) on the haematological picture of beta-thalassaemia major. Results: Out of the 280 patients 109 (39%) had received one or more blood transfusions (cases). The remaining 171 patients who did not receive any transfusion served as controls. The mean MCV, MCH and Hb-F in cases were significantly higher than in the controls (p 4 transfusions (17%) (p=0.016). In the occasionally transfused patients Hb-F level was directly related to the time since last transfusion. In 44/109 (40%) transfused patients (Hb-F>30%) the diagnosis of thalassaemia was not difficult. In 54/109 (50%) patients (Hb-:5-30%) the diagnosis was aided by parent's study, while PCR for thalassaemia mutation was required in 11/109 (10%) patients (Hb-F <5%). Conclusion: In most transfused patients of thalassaemia major MCV and MCH were significantly higher while Hb-F was lower than in the un-transfused patients. There was a linear correlation between Hb-F level and time since last transfusion in the occasionally transfused patients. However, the reduction in Hb-F level was more marked and sustained in multipally transfused patients. Parent's study and PCR are useful aids in establishing the correct diagnosis in these patients. (author)

  4. Quality indicators for the hospital transfusion chain : A national survey conducted in 100 dutch hospitals

    NARCIS (Netherlands)

    Zijlker-Jansen, Pauline Y.; Janssen, M. P.; van Tilborgh-de Jong, A. J W; Schipperus, M. R.; Wiersum-Osselton, J. C.

    2015-01-01

    Background: The 2011 Dutch Blood Transfusion Guideline for hospitals incorporates seven internal quality indicators for evaluation of the hospital transfusion chain. The indicators aim to measure guideline compliance as shown by the instatement of a hospital transfusion committee and transfusion

  5. [Blood transfusion and supply chain management safety].

    Science.gov (United States)

    Quaranta, Jean-François; Caldani, Cyril; Cabaud, Jean-Jacques; Chavarin, Patricia; Rochette-Eribon, Sandrine

    2015-02-01

    The level of safety attained in blood transfusion now makes this a discipline better managed care activities. This was achieved both by scientific advances and policy decisions regulating and supervising the activity, as well as by the quality system, which we recall that affects the entire organizational structure, responsibilities, procedures, processes and resources in place to achieve quality management. So, an effective quality system provides a framework within which activities are established, performed in a quality-focused way and continuously monitored to improve outcomes. This system quality has to irrigate all the actors of the transfusion, just as much the establishments of blood transfusion than the health establishments. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  6. Transfusion strategy for acute upper gastrointestinal bleeding.

    Science.gov (United States)

    Handel, James; Lang, Eddy

    2015-09-01

    Clinical question Does a hemoglobin transfusion threshold of 70 g/L yield better patient outcomes than a threshold of 90 g/L in patients with acute upper gastrointestinal bleeding? Article chosen Villanueva C, Colomo A, Bosch A, et al. Transfusion strategies for acute upper gastrointestinal bleeding. N Engl J Med 2013;368(1):11-21. Study objectives The authors of this study measured mortality, from any cause, within the first 45 days, in patients with acute upper gastrointestinal bleeding, who were managed with a hemoglobin threshold for red cell transfusion of either 70 g/L or 90 g/L. The secondary outcome measures included rate of further bleeding and rate of adverse events.

  7. Blood transfusion in burn patients: Triggers of transfusion in a referral burn center in Iran.

    Science.gov (United States)

    Tavousi, S H; Ahmadabadi, A; Sedaghat, A; Khadem-Rezaiyan, M; Yaghoubi Moghaddam, Z; Behrouzian, M J; Nemati, S; Saghafi, H

    2018-02-01

    Blood and its derivatives are one of the most lifesaving products in the modern medicine practice. However, it is not an absolutely safe prescription. Many adverse effects such as infection, transfusion-related acute lung injury, immunosuppression, multi-organ dysfunction, acute respiratory syndrome, transfusion errors, transmission of infectious agents such as HIV, HBV, HCV are attributable to blood transfusion. The aim of this study was to describe how and when blood products were transfused in a referral burn center. This cross-sectional study was performed on medical records of all admitted patients in the Department of Burns and Reconstructive Surgery of Imam Reza Hospital, Mashhad, Iran during September 2014 up to August 2015. Transfusion measures such as Hb, Hct and demographic data were extracted from patient records. SPSS version 11.5 was used for data analysis. During the study period, 701 acute burnt patients were admitted with the mean age of 25.5±20.5 years. Sixty-four percent were male and burnt percentage of total body surface area (TBSA) was 30.9±24.3%. About one third (240) of patients received at least one blood product. Mean of the transfused packed red blood cell was 274.1±674.6mL per patient and 8.85mL per 1% of burnt TBSA. Anemia was the most common transfusion trigger. Mortality in burnt patients who received blood products was two folds more than patients who did not receive any blood products. We prescribed less blood products compared with other reviewed burn centers. However, following a written blood transfusion protocol by all clinicians may reduce blood transfusion in unnecessary situations even more significantly. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Blood platelet kinetics and platelet transfusion

    OpenAIRE

    Aster, Richard H.

    2013-01-01

    The discovery of citrate anticoagulant in the 1920s and the development of plastic packs for blood collection in the 1960s laid the groundwork for platelet transfusion therapy on a scale not previously possible. A major limitation, however, was the finding that platelet concentrates prepared from blood anticoagulated with citrate were unsuitable for transfusion because of platelet clumping. We found that this could be prevented by simply reducing the pH of platelet-rich plasma to about 6.5 pr...

  9. Cancer incidence in blood transfusion recipients

    DEFF Research Database (Denmark)

    Hjalgrim, Henrik; Edgren, Gustaf; Rostgaard, Klaus

    2007-01-01

    of the observed to the expected numbers of cancers, that is, standardized incidence ratios (SIRs), using incidence rates for the general Danish and Swedish populations as a reference. All statistical tests were two-sided. RESULTS: During 5,652,918 person-years of follow-up, 80,990 cancers occurred......, the standardized incidence ratios for cancers of the tongue, mouth, pharynx, esophagus, liver, and respiratory and urinary tracts and for squamous cell skin carcinoma remained elevated beyond 10 years after the transfusion. CONCLUSIONS: The marked increase in cancer risk shortly after a blood transfusion may...

  10. One-year period prevalence of blood transfusion

    DEFF Research Database (Denmark)

    Madsen, J T; Kimper-Karl, M L; Sprogøe, U

    2010-01-01

    was 9.2/1000 citizens. Most of the transfused patients had a main diagnosis of neoplasm (22% of recipients), diseases of the circulatory system (15%), the digestive system (15%), injuries (13%) and diseases of the blood (8%). Age standardization reversed the relation between sex specific 1-YPPRs......Transfusion practice is reported to differ considerably between countries. Comparisons often rely on transfusion rates, incidence - or prevalence rates. In this paper, the one-year period prevalence rate (1-YPPR) of transfusion of red cells (RBC) is presented. Transfusion data, demographic data...... and patient data were retrospectively combined to calculate sex and diagnosis specific and age standardized 1-YPPR s of RBC transfusion for the complete population in a Danish county. During the calendar year of 2006, 4427 patients received RBC transfusion in Funen County. The crude 1-YPPR of RBC transfusion...

  11. Association of blood transfusion with increased mortality in myocardial infarction

    DEFF Research Database (Denmark)

    Chatterjee, Saurav; Wetterslev, Jørn; Sharma, Abhishek

    2013-01-01

    The benefit of blood transfusion in patients with myocardial infarction is controversial, and a possibility of harm exists.......The benefit of blood transfusion in patients with myocardial infarction is controversial, and a possibility of harm exists....

  12. Reappraising the concept of massive transfusion in trauma

    DEFF Research Database (Denmark)

    Stanworth, Simon J; Morris, Timothy P; Gaarder, Christine

    2010-01-01

    ABSTRACT : INTRODUCTION : The massive-transfusion concept was introduced to recognize the dilutional complications resulting from large volumes of packed red blood cells (PRBCs). Definitions of massive transfusion vary and lack supporting clinical evidence. Damage-control resuscitation regimens o...

  13. Several aspects of some techniques avoiding homologous blood transfusions

    NARCIS (Netherlands)

    E.C.S.M. van Woerkens (Liesbeth)

    1998-01-01

    textabstractThe use of homologous blood products during anesthesia and surgery is not without risks. Complications due to homologous blood transfusions include transfusion reactions, isosensitization, transmission of infections (including HIV, hepatitis, CMV) and immunosuppression (resuiting in

  14. Features of transfusion therapy in patients undergoing hematopoietic stem cell transplantation. Review of the literature

    Directory of Open Access Journals (Sweden)

    D. N. Balashov

    2014-07-01

    Full Text Available The indications for transfusion of blood components support after stem cell transplantation (SCT usually do not differ form other clinical situations, but the rules for such therapy have a number of features. One of them is the possibility of inconsistence of AB0 group between donor and recipient of hematopoietic stem cells, which is not only fraught with the development of various alloimmune complications, but also fundamentally changes the standards for the selection of blood components for transfusion. A major problem after HSCT is a secondary immunodeficiency, which is important to consider for ensuring prevention of transfusion-transmitted infections (eg, CMV, as well as to carry out activities aimed for the prevention of transfusion- associated graft-versus-host disease. HSCT is a medical technology today, the effectiveness of which is often dependent on the accuracy and integrity of its implementation. So, serious attitude to various supportive therapy, including transfusions of blood components is an important component which determines the success of the treatment.

  15. The effect of prior transfusion history on blood donor anti-hepatitis C virus antibody.

    Science.gov (United States)

    Mazda, T; Nakata, K; Ota, K; Kaminuma, Y; Katayama, T

    1993-01-01

    In Japan, the major transfusion-associated disease is non-A, non-B hepatitis. We studied the relationship between transfusion history and blood donor antibodies to hepatitis C virus (HCV). The positive rate of antibodies to the HCV nonstructural protein (c100-3) depended on age and the time elapsed since transfusion. The anti-c100-3 ratio for subjects with transfusions made prior to 20 years ago was high. One quarter century ago, a change occurred in national blood policy from paid to non-paid voluntary donations. We also have studied the anti-HCV positive rate among donors with prior transfusion using a second generation HCV test kit which includes anti-HCV core antibody detection. The anti-HCV positive rate for the second generation test was higher than that for the anti-c100-3 test. Introduction of the second generation test is therefore more useful in screening than the anti-c100-3 test for blood programs.

  16. Features of transfusion therapy in patients undergoing hematopoietic stem cell transplantation. Review of the literature

    Directory of Open Access Journals (Sweden)

    D. N. Balashov

    2013-01-01

    Full Text Available The indications for transfusion of blood components support after stem cell transplantation (SCT usually do not differ form other clinical situations, but the rules for such therapy have a number of features. One of them is the possibility of inconsistence of AB0 group between donor and recipient of hematopoietic stem cells, which is not only fraught with the development of various alloimmune complications, but also fundamentally changes the standards for the selection of blood components for transfusion. A major problem after HSCT is a secondary immunodeficiency, which is important to consider for ensuring prevention of transfusion-transmitted infections (eg, CMV, as well as to carry out activities aimed for the prevention of transfusion- associated graft-versus-host disease. HSCT is a medical technology today, the effectiveness of which is often dependent on the accuracy and integrity of its implementation. So, serious attitude to various supportive therapy, including transfusions of blood components is an important component which determines the success of the treatment.

  17. Transfusion thresholds and other strategies for guiding allogeneic red blood cell transfusion.

    Science.gov (United States)

    Carson, Jeffrey L; Carless, Paul A; Hebert, Paul C

    2012-04-18

    Most clinical practice guidelines recommend restrictive red cell transfusion practices, with the goal of minimising exposure to allogeneic blood. The purpose of this review is to compare clinical outcomes in patients randomised to restrictive versus liberal transfusion thresholds (triggers). To examine the evidence for the effect of transfusion thresholds on the use of allogeneic and/or autologous red cell transfusion, and the evidence for any effect on clinical outcomes. We identified trials by searching; The Cochrane Injuries Group Specialised Register (searched 01 Feb 2011), Cochrane Central Register of Controlled Trials 2011, issue 1 (The Cochrane Library), MEDLINE (Ovid) 1948 to January Week 3 2011, EMBASE (Ovid) 1980 to 2011 (Week 04), ISI Web of Science: Science Citation Index Expanded (1970 to Feb 2011), ISI Web of Science: Conference Proceedings Citation Index- Science (1990 to Feb 2011). We checked reference lists of other published reviews and relevant papers to identify any additional trials. Controlled trials in which patients were randomised to an intervention group or to a control group. Trials were included where intervention groups were assigned on the basis of a clear transfusion 'trigger', described as a haemoglobin (Hb) or haematocrit (Hct) level below which a red blood cell (RBC) transfusion was to be administered. Risk ratios of requiring allogeneic blood transfusion, transfused blood volumes and other clinical outcomes were pooled across trials, using a random effects model. Data extraction and assessment of the risk of bias was performed by two people. Nineteen trials involving a total of 6264 patients were identified, and were similar enough that the results could be combined. Restrictive transfusion strategies reduced the risk of receiving a RBC transfusion by 39% (RR 0.61, 95% CI 0.52 to 0.72). This equates to an average absolute risk reduction (ARR) of 34% (95% CI 24% to 45%). The volume of RBCs transfused was reduced on average by 1

  18. Association of Donor Age and Sex With Survival of Patients Receiving Transfusions

    DEFF Research Database (Denmark)

    Edgren, Gustaf; Ullum, Henrik; Rostgaard, Klaus

    2017-01-01

    Importance: Following animal model data indicating the possible rejuvenating effects of blood from young donors, there have been at least 2 observational studies conducted with humans that have investigated whether donor age affects patient outcomes. Results, however, have been conflicting...... and Denmark who received at least 1 red blood cell transfusion of autologous blood or blood from unknown donors between January 1, 2003, and December 31, 2012. Patients were followed up from the first transfusion until death, emigration, or end of follow-up. Data analysis was performed from September 15...... to November 15, 2016. Exposures: The number of transfusions from blood donors of different age and sex. Exposure was treated time dependently throughout follow-up. Main Outcomes and Measures: Hazard ratios (HRs) for death and adjusted cumulative mortality differences, both estimated using Cox proportional...

  19. Blood Transfusion Strategies in Patients Undergoing Extracorporeal Membrane Oxygenation

    Directory of Open Access Journals (Sweden)

    Hyoung Soo Kim

    2017-02-01

    Full Text Available Extracorporeal membrane oxygenation (ECMO is frequently associated with bleeding and coagulopathy complications, which may lead to the need for transfusion of multiple blood products. However, blood transfusions are known to increase morbidity and mortality, as well as hospital cost, in critically ill patients. In current practice, patients on ECMO receive a transfusion, on average, of 1-5 packed red blood cells (RBCs/day, with platelet transfusion accounting for the largest portion of transfusion volume. Generally, adult patients require more transfusions than neonates or children, and patients receiving venovenous ECMO for respiratory failure tend to need smaller transfusion volumes compared to those receiving venoarterial ECMO for cardiac failure. Observation studies have reported that a higher transfusion volume was associated with increased mortality. To date, the evidence for transfusion in patients undergoing ECMO is limited; most knowledge on transfusion strategies was extrapolated from studies in critically ill patients. However, current data support a restrictive blood transfusion strategy for ECMO patients, and a low transfusion trigger seems to be safe and reasonable.

  20. Blood Discards in a Nigerian Transfusion Service Centre: The ...

    African Journals Online (AJOL)

    Background: Blood discards have not attracted much attention in transfusion practice in Nigeria, where pre-donation screening is the practice in most health facilities with its attendant deferral of donors reactive to transfusion transmissible infections. The National Blood Transfusion Service of Nigeria lays emphasis on ...

  1. Transfusion associated hepatitis B virus infection among sickle cell ...

    African Journals Online (AJOL)

    Background: Transfusion of blood products is a recognised way of transmitting infections particularly viruses. The extent to which blood transfusion contributes to hepatitis B virus (HBV) infections in transfused patients with sickle cell anaemia (SCA) has been found to be 20% in Lagos, Nigeria. Mamman in Zaria however ...

  2. Blood Transfusion In Surgical Children: The Advantages And Hazards

    African Journals Online (AJOL)

    The increasing opposition to blood transfusion makes the management of surgical children who require blood very challenging. This retrospective study reviews records of blood transfusion so as to determine the advantages and hazards in surgical children. The advantages and hazards of blood transfusion in surgical ...

  3. Survey of facilities for appropriate training in blood transfusion

    African Journals Online (AJOL)

    2018-06-01

    Jun 1, 2018 ... Objective. To survey training facilities for blood transfusion in Anglophone West. Africa for ... to provide workforce for blood transfusion establishments. However, ... A standard blood service is a multi-disciplinary organization in which .... and good manufacturing practices in the blood transfusion laboratory.

  4. Clinical and immunological aspects of pretransplant blood transfusions

    NARCIS (Netherlands)

    Waanders, Marloes Maria

    2009-01-01

    Blood transfusions can lead to immunization or tolerance in the recipient. The latter is characterized by an improved transplant outcome after pretransplant blood transfusions. First observations of improved kidney graft outcome after blood transfusion date 35 years back, however no exclusive

  5. Transfusion-related acute lung injury: a change of perspective

    NARCIS (Netherlands)

    Vlaar, A. P.; Schultz, M. J.; Juffermans, N. P.

    2009-01-01

    Two decades ago, transfusion-related acute lung injury (TRALI) was considered a rare complication of transfusion medicine. Nowadays, TRALI has emerged as the leading cause of transfusion-related mortality, presumably as a consequence of reaching international agreement on defining TRALI with

  6. Red blood cell transfusion during septic shock in the ICU

    DEFF Research Database (Denmark)

    Perner, A; Smith, S H; Carlsen, S

    2012-01-01

    Transfusion of red blood cells (RBCs) remains controversial in patients with septic shock, but current practice is unknown. Our aim was to evaluate RBC transfusion practice in septic shock in the intensive care unit (ICU), and patient characteristics and outcome associated with RBC transfusion....

  7. Anemia of prematurity : time for a change in transfusion management?

    NARCIS (Netherlands)

    Khodabux, Chantal Muriel

    2013-01-01

    In this thesis we investigated clinical effects of allogeneic red blood cell (RBC) transfusions in premature infants, different transfusion volumes in relation to neonatal outcome in premature infants and the use of autologous cord blood (CB) as an alternative for allogeneic transfusions. Despite

  8. Hepatitis C and blood transfusion among children attending the ...

    African Journals Online (AJOL)

    EB

    2013-06-02

    Jun 2, 2013 ... Background: Hepatitis C virus (HCV) accounts for 90% of post-transfusion hepatitis. In Uganda, there has been limited research ... Of these, 159 (65%) had a history of blood transfusion. Among the transfused, five patients were .... 6.4 computer software package. Analysis was done using SPSS Version 11,.

  9. Acute splenic sequestration in a pregnant woman with homozygous sickle-cell anemia Sequestro esplênico agudo em uma mulher grávida com anemia falciforme homozigótica

    Directory of Open Access Journals (Sweden)

    Carolina Bastos Maia

    2013-04-01

    Full Text Available CONTEXT Homozygous (SS sickle-cell anemia complicated by acute splenic sequestration in adults is a rare event, and it has never been reported during pregnancy. CASE REPORT A 25-year-old woman with homozygous (SS sickle-cell disease was hospitalized at 32 weeks' of gestation presenting weakness, abdominal pain, fever and hemoglobin of 2.4 g/dl. Abnormal fetal heart rate was detected by means of cardiotocography, and 5 units of packed red cells were transfused. Cesarean was performed at 37 weeks. Both mother and baby were discharged in a good general condition. CONCLUSION This case report demonstrates the importance of immediate blood transfusion for treatment of fetal distress in cases of splenic sequestration during pregnancy. This treatment is essential for avoiding maternal and fetal complications. CONTEXTO Anemia falciforme homozigótica (SS complicada por sequestro esplênico agudo em adultos é evento raro, e nunca foi relatado durante a gravidez. RELATO DO CASO Uma mulher de 25 anos, portadora de doença falciforme homozigótica (SS, com 32 semanas de gestação, foi internada apresentando fraqueza, dor abdominal, febre e hemoglobina de 2,4 g/dl. Frequência cardíaca fetal anormal foi detectada pela cardiotocografia e a paciente recebeu 5 unidades de concentrado de hemácias. Cesariana foi realizada com 37 semanas. Mãe e filho receberam alta em bom estado geral. CONCLUSÃO Este relato de caso demonstra a importância da transfusão imediata para o tratamento de sofrimento fetal nos casos de sequestro esplênico durante a gestação. Este tratamento é imprescindível para se evitarem complicações maternas e fetais.

  10. Genotyping applications for transplantation and transfusion management: The Emory Experience

    Science.gov (United States)

    Fasano, Ross M.; Sullivan, Harold Cliff; Bray, Bob; Gebel, Howie; Meyer, Erin K.; Winkler, Annie M.; Josephson, Cassandra D.; Stowell, Sean R.; Duncan, Sandy; Roback, John D.

    2018-01-01

    Current genotyping methodologies for transplantation and transfusion management employ multiplex systems that allow for the simultaneous detection of multiple human leukocyte antigens (HLA), human platelet antigens (HPA) and red blood cell (RBC) antigens. The development of high resolution molecular HLA typing has led to improved outcomes of unrelated hematopoietic stem cell transplants by better identifying suitable donors typed at the allele level for HLA-A, B, C, DRB1 and DQB1 antigens. In solid organ transplantation, the combination of high resolution HLA typing along with solid-phase antibody identification and the calculated PRA have shown to be of specific benefit to highly sensitized patients, and have resulted in significant reductions of incompatible crossmatches at the time of organ allocation. This database-driven combined HLA antigen/antibody testing has promoted the routine implementation of the virtual crossmatch, in which an electronic crossmatch is performed, and perhaps even obviates the need for a physical crossmatch. Additionally, DNA-based testing for RBC antigens provides as an alternative typing method that mitigates many of the limitations of hemagglutination-based phenotyping. Although there are many applications of RBC genotyping in various transfusion settings, it has arguably been most useful in the management of transfusion-dependent patients with sickle cell disease (SCD) and thalassemia to minimize alloimmunization. The availability of high-throughput RBC genotyping for both patients and large populations of donors, along with coordinated informatics systems to link patients’ antigen needs with available antigen-negative and/or rare blood-typed donors, offer promise toward improving the efficiency, reliability, and extent of RBC matching for this population. PMID:28234571

  11. Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9.

    Science.gov (United States)

    Paquet, Dominik; Kwart, Dylan; Chen, Antonia; Sproul, Andrew; Jacob, Samson; Teo, Shaun; Olsen, Kimberly Moore; Gregg, Andrew; Noggle, Scott; Tessier-Lavigne, Marc

    2016-05-05

    The bacterial CRISPR/Cas9 system allows sequence-specific gene editing in many organisms and holds promise as a tool to generate models of human diseases, for example, in human pluripotent stem cells. CRISPR/Cas9 introduces targeted double-stranded breaks (DSBs) with high efficiency, which are typically repaired by non-homologous end-joining (NHEJ) resulting in nonspecific insertions, deletions or other mutations (indels). DSBs may also be repaired by homology-directed repair (HDR) using a DNA repair template, such as an introduced single-stranded oligo DNA nucleotide (ssODN), allowing knock-in of specific mutations. Although CRISPR/Cas9 is used extensively to engineer gene knockouts through NHEJ, editing by HDR remains inefficient and can be corrupted by additional indels, preventing its widespread use for modelling genetic disorders through introducing disease-associated mutations. Furthermore, targeted mutational knock-in at single alleles to model diseases caused by heterozygous mutations has not been reported. Here we describe a CRISPR/Cas9-based genome-editing framework that allows selective introduction of mono- and bi-allelic sequence changes with high efficiency and accuracy. We show that HDR accuracy is increased dramatically by incorporating silent CRISPR/Cas-blocking mutations along with pathogenic mutations, and establish a method termed 'CORRECT' for scarless genome editing. By characterizing and exploiting a stereotyped inverse relationship between a mutation's incorporation rate and its distance to the DSB, we achieve predictable control of zygosity. Homozygous introduction requires a guide RNA targeting close to the intended mutation, whereas heterozygous introduction can be accomplished by distance-dependent suboptimal mutation incorporation or by use of mixed repair templates. Using this approach, we generated human induced pluripotent stem cells with heterozygous and homozygous dominant early onset Alzheimer's disease-causing mutations in

  12. Why was this transfusion given? Identifying clinical indications for blood transfusion in health care data

    Directory of Open Access Journals (Sweden)

    van Hoeven LR

    2018-03-01

    Full Text Available Loan R van Hoeven,1,2 Aukje L Kreuger,3,4 Kit CB Roes,1 Peter F Kemper,2,4 Hendrik Koffijberg,5 Floris J Kranenburg,3,4,6 Jan MM Rondeel,7 Mart P Janssen1,2 1Julius Center for Health Sciences and Primary Care, University Medical Center Utrecht, Utrecht, the Netherlands; 2Transfusion Technology Assessment Department, Sanquin Research, Amsterdam, the Netherlands; 3Department of Clinical Epidemiology, Leiden University Medical Center, Leiden, the Netherlands; 4Center for Clinical Transfusion Research, Sanquin Research, Leiden, the Netherlands; 5Department of Health Technology & Services Research, MIRA Institute for Biomedical Technology and Technical Medicine, University of Twente, Enschede, the Netherlands; 6Department of Intensive Care, Leiden University Medical Center, Leiden, the Netherlands; 7Department of Clinical Chemistry, Isala, Zwolle, the Netherlands Background: To enhance the utility of transfusion data for research, ideally every transfusion should be linked to a primary clinical indication. In electronic patient records, many diagnostic and procedural codes are registered, but unfortunately, it is usually not specified which one is the reason for transfusion. Therefore, a method is needed to determine the most likely indication for transfusion in an automated way.Study design and methods: An algorithm to identify the most likely transfusion indication was developed and evaluated against a gold standard based on the review of medical records for 234 cases by 2 experts. In a second step, information on misclassification was used to fine-tune the initial algorithm. The adapted algorithm predicts, out of all data available, the most likely indication for transfusion using information on medical specialism, surgical procedures, and diagnosis and procedure dates relative to the transfusion date.Results: The adapted algorithm was able to predict 74.4% of indications in the sample correctly (extrapolated to the full data set 75.5%. A kappa

  13. Red blood cell alloimmunization after blood transfusion

    NARCIS (Netherlands)

    Schonewille, Henk

    2008-01-01

    Current pretransfusion policy requires the patients’ serum to be tested for the presence of irregular red blood cell antibodies. In case of an antibody, red blood cells lacking the corresponding antigen are transfused after an antiglobulin crossmatch. The aim of the studies in this thesis is

  14. Prevalence of exchange blood transfusion in severe ...

    African Journals Online (AJOL)

    Background: Exchange blood transfusion (EBT) is carried out for the treatment of conditions presenting with severe hyperbilirubinaemia and anaemia, such as ABO incompatibility, sepsis, prematurity and birth trauma among others. While it is fast being abandoned as treatment modality for severe neonatal jaundice in the ...

  15. Utilization Management in the Blood Transfusion Service

    Science.gov (United States)

    Peña, Jeremy Ryan Andrew; Dzik, Walter “Sunny”

    2015-01-01

    The scope of activity of the Blood Transfusion Service (BTS) makes it unique among the clinical laboratories. The combination of therapeutic and diagnostic roles necessitates a multi-faceted approach to utilization management in the BTS. We present our experience in utilization management in large academic medical center. PMID:24080431

  16. Massive transfusion protocols: current best practice

    Directory of Open Access Journals (Sweden)

    Hsu YM

    2016-03-01

    Full Text Available Yen-Michael S Hsu,1 Thorsten Haas,2 Melissa M Cushing1 1Department of Pathology and Laboratory Medicine, Weill Cornell Medical College, New York, NY, USA; 2Department of Anesthesia, University Children's Hospital Zurich, Zurich, Switzerland Abstract: Massive transfusion protocols (MTPs are established to provide rapid blood replacement in a setting of severe hemorrhage. Early optimal blood transfusion is essential to sustain organ perfusion and oxygenation. There are many variables to consider when establishing an MTP, and studies have prospectively evaluated different scenarios and patient populations to establish the best practices to attain improved patient outcomes. The establishment and utilization of an optimal MTP is challenging given the ever-changing patient status during resuscitation efforts. Much of the MTP literature comes from the trauma population, due to the fact that massive hemorrhage is the leading cause of preventable trauma-related death. As we come to further understand the positive and negative clinical impacts of transfusion-related factors, massive transfusion practice can be further refined. This article will first discuss specific MTPs targeting different patient populations and current relevant international guidelines. Then, we will examine a wide selection of therapeutic products to support MTPs, including newly available products and the most suitable of the traditional products. Lastly, we will discuss the best design for an MTP, including ratio-based MTPs and MTPs based on the use of point-of-care coagulation diagnostic tools. Keywords: hemorrhage, MTP, antifibrinolytics, coagulopathy, trauma, ratio, logistics, guidelines, hemostatic

  17. Autologous blood transfusion during emergency trauma operations.

    Science.gov (United States)

    Brown, Carlos V R; Foulkrod, Kelli H; Sadler, Holli T; Richards, E Kalem; Biggan, Dennis P; Czysz, Clea; Manuel, Tony

    2010-07-01

    Intraoperative cell salvage (CS) of shed blood during emergency surgical procedures provides an effective and cost-efficient resuscitation alternative to allogeneic blood transfusion, which is associated with increased morbidity and mortality in trauma patients. Retrospective matched cohort study. Level I trauma center. All adult trauma patients who underwent an emergency operation and received CS as part of their intraoperative resuscitation. The CS group was matched to a no-CS group for age, sex, Injury Severity Score, mechanism of injury, and operation performed. Amount and cost of allogeneic transfusion of packed red blood cells and plasma. The 47 patients in the CS group were similar to the 47 in the no-CS group for all matched variables. Patients in the CS group received an average of 819 mL of autologous CS blood. The CS group received fewer intraoperative (2 vs 4 U; P = .002) and total (4 vs 8 U; P blood cells. The CS group also received fewer total units of plasma (3 vs 5 U; P = .03). The cost of blood product transfusion (including the total cost of CS) was less in the CS group ($1616 vs $2584 per patient; P = .004). Intraoperative CS provides an effective and cost-efficient resuscitation strategy as an alternative to allogeneic blood transfusion in trauma patients undergoing emergency operative procedures.

  18. Autologous Blood Transfusion for Postpartum Hemorrhage.

    Science.gov (United States)

    Greenawalt, Julia A; Zernell, Denise

    Postpartum hemorrhage (PPH) is a leading contributor to maternal morbidity and mortality in the United States and globally. Although the rate of PPH is generally decreasing nationally, severity of PPH appears to be increasing, potentially related to the various comorbidities associated with women of childbearing age. There is increasing evidence of risks associated with allogeneic blood transfusion, which has historically been the classic therapeutic approach for treatment to PPH. Pregnant women are particularly susceptible to the implications of sensitization to red cell antigens, a common sequela to allogenic blood transfusion. Autologous blood transfusion eliminates the potential of communicable disease transmission as well as the conceivable threat of a blood transfusion reaction. Recent technological advances allow cell salvage coupled with the use of a leukocyte filter to be used as an alternative approach for improving the outcome for women experiencing a PPH. Modest changes in standard operating procedure and continued training in use and application of cell salvaged blood may assist in minimizing negative outcomes from PPH. Salvaged blood has been demonstrated to be at least equal and often superior to banked blood. We discuss nursing implications for application of this technology for women with PPH. Continued research is warranted to evaluate the impact that application of cell salvage with filtration has on the patient experiencing a PPH.

  19. Intraoperative transfusion threshold and tissue oxygenation

    DEFF Research Database (Denmark)

    Nielsen, K; Dahl, B; Johansson, P I

    2012-01-01

    Transfusion with allogeneic red blood cells (RBCs) may be needed to maintain oxygen delivery during major surgery, but the appropriate haemoglobin (Hb) concentration threshold has not been well established. We hypothesised that a higher level of Hb would be associated with improved subcutaneous...... oxygen tension during major spinal surgery....

  20. 1. Transfusion Transmissible Infections among Voluntary Blood ...

    African Journals Online (AJOL)

    Esem

    ABSTRACT. Background: HIV1&2, HBsAg, anti-HCV and syphilis antibody are mandatory disease marker tests of Transfusion Transmissible Infections (TTIs) conducted on every donated unit of blood in Zambia. Blood is donated by first time voluntary donors and repeat/regular donors ofages between 16 and 65 years.

  1. Platelet transfusion therapy in sub-Saharan Africa: bacterial contamination, recipient characteristics and acute transfusion reactions

    Science.gov (United States)

    Hume, Heather A.; Ddungu, Henry; Angom, Racheal; Baluku, Hannington; Kajumbula, Henry; Kyeyune-Byabazaire, Dorothy; Orem, Jackson; Ramirez-Arcos, Sandra; Tobian, Aaron A.R.

    2017-01-01

    Background Little data are available on bacterial contamination (BC) of platelet units or acute transfusion reactions to platelet transfusions (PT) in sub-Saharan Africa (SSA). Methods This prospective observational study evaluated the rate of BC of whole blood derived platelet units (WB-PU), the utility of performing Gram stains (GS) to prevent septic reactions, characteristics of patients receiving PT and the rate of acute reactions associated with PT at the Uganda Cancer Institute in Kampala, Uganda. An aliquot of each WB-PU studied was taken to perform GS and culture using the Bactec™ 9120 instrument. Study participants were monitored for reactions. Results 337 WB-PU were evaluated for BC, of which 323 units were transfused in 151 transfusion episodes to 50 patients. The frequency of BC ranged from 0.3%–2.1% (according to criteria used to define BC). The GS had high specificity (99.1%), but low sensitivity to detect units with BC. The median platelet count prior to PT was 10,900 (IQR 6,000–18,900) cells/μL. 78% of PT were given to patients with no bleeding. Acute reactions occurred in 11 transfusion episodes, involving 13 WB-PU, for a rate of 7.3% (95%CI=3.7–12.7%) per transfusion episode. All recipients of units with positive bacterial cultures were receiving antibiotics at the time of transfusion; none experienced a reaction. Conclusions The rate of BC observed in this study is lower than previously reported in SSA, but still remains a safety issue. As GS appears to be an ineffective screening tool, alternate methods should be explored to prevent transfusing bacterially-contaminated platelets in SSA. PMID:27079627

  2. Cost of allogeneic and autologous blood transfusion in Canada. Canadian Cost of Transfusion Study Group.

    OpenAIRE

    Tretiak, R; Laupacis, A; Rivière, M; McKerracher, K; Souêtre, E

    1996-01-01

    OBJECTIVE: To determine the cost, from a societal perspective, of blood transfusion in Canada. STUDY DESIGN: Cost-structure analysis. SETTING: Data were collected from eight hospitals and from six blood centres operated by the Canadian Red Cross Society in four provinces. OUTCOME MEASURES: Costs associated with four stages of transfusion-- collection, production, distribution and delivery--in 1933 were assessed. Costs were divided into the following categories; personnel, purchases, external ...

  3. Serial haematology results in transfused and non-transfused dogs naturally infected with Babesia rossi

    Directory of Open Access Journals (Sweden)

    E. Scheepers

    2011-04-01

    Full Text Available This prospective longitudinal study investigated the progression of haematological changes in 32 transfused and 54 non-transfused dogs naturally infected with Babesia rossi over the 1st 6 days following diagnosis and treatment. The effect of patient age on the results of complete blood counts was determined. Haematology data were analysed at presentation and at 24 hours, 3 days and 6 days after presentation. Dogs were treated with diminazene aceturate at diagnosis and a blood transfusion was given if deemed clinically required. Mildly to moderately regenerative normocytic normochromic anaemia was observed in all dogs throughout the study period. Transfused dogs more often had an inflammatory leukogram at presentation and at 24 hours, than dogs that were not transfused. In dogs with a left shift, a concurrent normal or decreased segmented neutrophil count was found more commonly than neutrophilia. Severe thrombocytopenia that resolved within a week was common. Blood transfusion alleviated the anaemia, but had no significant effect on white blood cell or platelet responses. Blood cell responses were not significantly influenced by age. In conclusion, the red blood cell and white blood cell responses were less than expected in dogs with babesiosis, given the degree of anaemia and inflammation present. The magnitude of thrombocytopenia and rapid return of the platelet count to normal suggested a possible immune-mediated mechanism for the thrombocytopenia.

  4. The risk of transfusion-transmitted viral infections at the Gabonese National Blood Transfusion Centre

    Science.gov (United States)

    Rerambiah, Leonard Kounegnigan; Rerambiah, Laurence Essola; Bengone, Calixte; Djoba Siawaya, Joel F.

    2014-01-01

    Background Blood transfusions carry the risk of transmitting blood-borne infections. In contrast to the situation in the developed world, there is a limited number of studies examining this problem in sub-Saharan Africa. In this study we aimed to calculate the risks of acquiring human immunodeficiency virus (HIV), hepatitis B virus (HBV), and hepatitis C virus (HCV) infection from units of blood issued by the Gabonese Blood Transfusion Centre between 2009 and 2011. Materials and methods All the donations were tested for infectious diseases and the seroconversion incidence rates of HIV, HBV and HCV were calculated. The residual risk of transfusion-associated transmission for each virus was calculated by multiplying the seroconversion rates by the window period expressed in fractions of a year. Results The risks of becoming infected with HIV, HCV, and HBV in subjects receiving units of blood from the Gabonese Blood Transfusion Centre were 64.7, 207.94 and 534.53 per million donations, respectively. Conclusions This study, which is the first to quantify the true risks of transfusion-transmitted infections in Gabon, reveals and confirms the need to reinforce preventative and screening strategies to improve transfusion safety in sub-Saharan Africa. PMID:24333085

  5. Indications and Effects of Plasma Transfusions in Critically Ill Children

    DEFF Research Database (Denmark)

    Karam, Oliver; Demaret, Pierre; Shefler, Alison

    2015-01-01

    indications for plasma transfusion were critical bleeding in 22.3%, minor bleeding in 21.2%, planned surgery or procedure in 11.7%, and high risk of postoperative bleeding in 10.6%. No bleeding or planned procedures were reported in 34.1%. Before plasma transfusion, the median international normalized ratio......-third of transfused patients were not bleeding and had no planned procedure. In addition, in most patients, coagulation tests are not sensitive to increases in coagulation factors resulting from plasma transfusion. Studies assessing appropriate plasma transfusion strategies are urgently needed....

  6. Design of a Mobile Application for Transfusion Medicine.

    Science.gov (United States)

    Albornoz, M A; Márquez, S; Rubin, L; Luna, D

    2017-01-01

    One of the most frequent error in transfusion medicine is the failure in verifying the patient's identity prior to transfusion. This paper describes the design and development of a Mobile Application (MA) for transfusion medicine. The app uses barcode and QR reading technology for the verification of the patient's identity and the administration of blood components when making a blood transfusion. Physicians, developers, technicians of transfusion medicine and a User Centered Design team participated in the design. The inclusion of end users was fundamental to get full representativeness of their workflow. The project was based on agile methodologies of project management and software development.

  7. Mesomelic dwarfism of the Langer type as a homozygous form of dyschondrosteosis

    Energy Technology Data Exchange (ETDEWEB)

    Kemperdick, H.; Majewski, F.

    1982-05-01

    A family is described containing a daughter suffering from mesomelic dwarfism of the Langer type and both parents showing a dyschondrosteosis. This family supports the thesis that mesomelic dwarfism of the Langer type represents the homozygous form of dyschondrosteosis.

  8. Simplified methodology for large scale isolation of homozygous transgenic lines of lettuce

    Directory of Open Access Journals (Sweden)

    Flavia S. Darqui

    2018-01-01

    Conclusions: This protocol allows a simplified scaling-up of the production of multiple homozygous transgenic progeny lines in the early generations avoiding expensive and time-consuming molecular assays.

  9. Effect of blood transfusions on canine renal allograft survival

    International Nuclear Information System (INIS)

    van der Linden, C.J.; Buurman, W.A.; Vegt, P.A.; Greep, J.M.; Jeekel, J.

    1982-01-01

    In this study significantly prolonged canine renal allograft survival has been demonstrated after transfusion of 100 ml of third-party whole blood given peroperatively. Peroperative transfusions of third-party leukocyte-free blood or pure lymphocyte cell suspensions did not influence graft survival. Furthermore, no improvement in graft survival has been found after a peroperative transfusion of irradiated whole blood (2500 rad). These data suggest that delayed graft rejection after blood transfusions can only be expected after the administration of whole blood. The role of competent lymphocytes in whole blood is questionable, since a transfusion or irradiated whole blood in combination with nonirradiated lymphocytes did not lead to prolonged graft survival. Immunosuppression of the recipient directly after transfusion seems to be essential to induce the beneficial effect of blood transfusions. This has been demonstrated for a transfusion of whole blood 14 days before transplantation. A single transfusion of 100 ml of whole blood 14 days before transplantation could effectively prolong graft survival if immunosuppression with azathioprine and prednisone was started on the day of transfusion. No improvement in graft survival has been found with such a transfusion if preoperative immunosuppression has been omitted

  10. Segregation distortion in homozygous lines obtained via anther culture and maize doubled haploid methods in comparison to single seed descent in wheat (Triticum aestivum L.)

    OpenAIRE

    Adamski,Tadeusz; Krystkowiak,Karolina; Kuczynska,Anetta; Mikolajczak,Krzysztof; Ogrodowicz,Piotr; Ponitka,Aleksandra; Surma,Maria; Slusarkiewicz-Jarzina,Aurelia

    2014-01-01

    Background: The quality of wheat grain depends on several characteristics, among which the composition of high molecular weight glutenin subunits, encoded by Glu-1 loci, are the most important. Application of biotechnological tools to accelerate the attainment of homozygous lines may influence the proportion of segregated genotypes. The objective was to determine, whether the selection pressure generated by the methods based on in vitro cultures, may cause a loss of genotypes with desirable G...

  11. Transfusion practice in hip arthroplasty - a nationwide study

    DEFF Research Database (Denmark)

    Jans, Øivind; Kehlet, H; Hussain, Zubair Butt

    2011-01-01

    ) in Denmark. Materials and Methods We performed a retrospective cohort study of all patients undergoing THA or RTHA in Denmark in 2008. Primary outcomes were intercentre variation in red blood cell (RBC) transfusion rates and the timing of transfusion related to surgery. Results Six thousand nine hundred......Background and Objectives The optimal transfusion strategy in hip arthroplasty remains controversial despite existing guidelines. The aim of this study was to evaluate the transfusion practice in patients undergoing primary total hip arthroplasty (THA) or revision total hip arthroplasty (RTHA...... thirty-two THA patients and 1132 RTHA patients were included for analysis of which 1674 (24%) THA and 689 (61%) RTHA patients received RBC transfusion. Of these, 47% of THA and 73% of RTHA patients received transfusion on the day of surgery. Transfusion rates between centres varied from 7 to 71...

  12. The new Scandinavian Donations and Transfusions database (SCANDAT2)

    DEFF Research Database (Denmark)

    Edgren, Gustaf; Rostgaard, Klaus; Vasan, Senthil K

    2015-01-01

    : It is possible to create a binational, nationwide database with almost 50 years of follow-up of blood donors and transfused patients for a range of health outcomes. We aim to use this database for further studies of donor health, transfusion-associated risks, and transfusion-transmitted disease....... AND METHODS: We have previously created the anonymized Scandinavian Donations and Transfusions (SCANDAT) database, containing data on blood donors, blood transfusions, and transfused patients, with complete follow-up of donors and patients for a range of health outcomes. Here we describe the re......-creation of SCANDAT with updated, identifiable data. We collected computerized data on blood donations and transfusions from blood banks covering all of Sweden and Denmark. After data cleaning, two structurally identical databases were created and the entire database was linked with nationwide health outcomes...

  13. The Non-Hemostatic Aspects of Transfused Platelets

    Directory of Open Access Journals (Sweden)

    Caroline Sut

    2018-02-01

    Full Text Available Platelets transfusion is a safe process, but during or after the process, the recipient may experience an adverse reaction and occasionally a serious adverse reaction (SAR. In this review, we focus on the inflammatory potential of platelet components (PCs and their involvement in SARs. Recent evidence has highlighted a central role for platelets in the host inflammatory and immune responses. Blood platelets are involved in inflammation and various other aspects of innate immunity through the release of a plethora of immunomodulatory cytokines, chemokines, and associated molecules, collectively termed biological response modifiers that behave like ligands for endothelial and leukocyte receptors and for platelets themselves. The involvement of PCs in SARs—particularly on a critically ill patient’s context—could be related, at least in part, to the inflammatory functions of platelets, acquired during storage lesions. Moreover, we focus on causal link between platelet activation and immune-mediated disorders (transfusion-associated immunomodulation, platelets, polyanions, and bacterial defense and alloimmunization. This is linked to the platelets’ propensity to be activated even in the absence of deliberate stimuli and to the occurrence of time-dependent storage lesions.

  14. The Non-Hemostatic Aspects of Transfused Platelets

    Science.gov (United States)

    Sut, Caroline; Tariket, Sofiane; Aubron, Cécile; Aloui, Chaker; Hamzeh-Cognasse, Hind; Berthelot, Philippe; Laradi, Sandrine; Greinacher, Andreas; Garraud, Olivier; Cognasse, Fabrice

    2018-01-01

    Platelets transfusion is a safe process, but during or after the process, the recipient may experience an adverse reaction and occasionally a serious adverse reaction (SAR). In this review, we focus on the inflammatory potential of platelet components (PCs) and their involvement in SARs. Recent evidence has highlighted a central role for platelets in the host inflammatory and immune responses. Blood platelets are involved in inflammation and various other aspects of innate immunity through the release of a plethora of immunomodulatory cytokines, chemokines, and associated molecules, collectively termed biological response modifiers that behave like ligands for endothelial and leukocyte receptors and for platelets themselves. The involvement of PCs in SARs—particularly on a critically ill patient’s context—could be related, at least in part, to the inflammatory functions of platelets, acquired during storage lesions. Moreover, we focus on causal link between platelet activation and immune-mediated disorders (transfusion-associated immunomodulation, platelets, polyanions, and bacterial defense and alloimmunization). This is linked to the platelets’ propensity to be activated even in the absence of deliberate stimuli and to the occurrence of time-dependent storage lesions. PMID:29536007

  15. Multiple Patterns of FHIT Gene Homozygous Deletion in Egyptian Breast Cancer Patients

    International Nuclear Information System (INIS)

    Ismail, H.M.S.; Zakhary, N.I.; Medhat, A.M.; Karim, A.M.

    2011-01-01

    Fragile histidine triad (FHIT) gene encodes a putative tumour suppressor protein. Loss of Fhit protein in cancer is attributed to different genetic alterations that affect the FHIT gene structure. In this study, we investigated the pattern of homozygous deletion that target the FHIT gene exons 3 to 9 genomic structure in Egyptian breast cancer patients. We have found that 65% (40 out of 62) of the cases exhibited homozygous deletion in at least one FHIT exon. The incidence of homozygous deletion was not associated with patients clinico pathological parameters including patients age, tumour grade, tumour type, and lymph node involvement. Using correlation analysis, we have observed a strong correlation between homozygous deletions of exon 3 and exon 4 (P<0.0001). Deletions in exon 5 were positively correlated with deletions in exon 7 (P<0.0001), Exon 8 (P<0.027), and exon 9 (P=0.04). Additionally, a strong correlation was observed between exons 8 and exon 9 (P<0.0001).We conclude that FHIT gene exons are homozygously deleted at high frequency in Egyptian women population diagnosed with breast cancer. Three different patterns of homozygous deletion were observed in this population indicating different mechanisms of targeting FHIT gene genomic structure.

  16. Perioperative bleeding and blood transfusion are major risk factors for venous thromboembolism following bariatric surgery.

    Science.gov (United States)

    Nielsen, Alexander W; Helm, Melissa C; Kindel, Tammy; Higgins, Rana; Lak, Kathleen; Helmen, Zachary M; Gould, Jon C

    2018-05-01

    Morbidly obese patients are at increased risk for venous thromboembolism (VTE) after bariatric surgery. Perioperative chemoprophylaxis is used routinely with bariatric surgery to decrease the risk of VTE. When bleeding occurs, routine chemoprophylaxis is often withheld due to concerns about inciting another bleeding event. We sought to evaluate the relationship between perioperative bleeding and postoperative VTE in bariatric surgery. The American College of Surgeons-National Surgical Quality Improvement Program (NSQIP) dataset between 2012 and 2014 was queried to identify patients who underwent bariatric surgery. Gastric bypass (n = 28,145), sleeve gastrectomy (n = 30,080), bariatric revision (n = 324), and biliopancreatic diversion procedures (n = 492) were included. Univariate and multivariate regressions were used to determine perioperative factors predictive of postoperative VTE within 30 days in patients who experience a bleeding complication necessitating transfusion. The rate of bleeding necessitating transfusion was 1.3%. Bleeding was significantly more likely to occur in gastric bypass compared to sleeve gastrectomy (1.6 vs. 1.0%) (p surgeries, increased age, length of stay, operative time, and comorbidities including hypertension, dyspnea with moderate exertion, partially dependent functional status, bleeding disorder, transfusion prior to surgery, ASA class III/IV, and metabolic syndrome increased the perioperative bleeding risk (p Bariatric surgery patients who receive postoperative blood transfusion are at a significantly increased risk for VTE. The etiology of VTE in those who are transfused is likely multifactorial and possibly related to withholding chemoprophylaxis and the potential of a hypercoagulable state induced by the transfusion. In those who bleed, consideration should be given to reinitiating chemoprophylaxis when safe, extending treatment after discharge, and screening ultrasound.

  17. Red Blood Cell Transfusions Impact Pneumonia Rates After Coronary Artery Bypass Grafting Surgery

    Science.gov (United States)

    Likosky, Donald S.; Paone, Gaetano; Zhang, Min; Rogers, Mary A.M.; Harrington, Steven D.; Theurer, Patricia F.; DeLucia, Alphonse; Fishstrom, Astrid; Camaj, Anton; Prager, Richard L.

    2016-01-01

    Background Pneumonia, a known complication of coronary artery bypass (CABG) surgery, significantly increases a patient’s risk of morbidity and mortality. While not well characterized, red blood cell transfusions (RBC) may increase a patient’s risk of pneumonia. We describe the relationship between RBC transfusion and post-operative pneumonia after CABG surgery. Methods A total of 16,182 consecutive patients underwent isolated CABG surgery between 2011 and 2013 at one of 33 hospitals in the state of Michigan. We used multivariable logistic regression to estimate the odds of pneumonia associated with the use or number (0, 1, 2, 3, 4, 5, >6) of RBC units. We adjusted for predicted risk of mortality, pre-operative hematocrit, history of pneumonia, cardiopulmonary bypass duration and medical center. We confirmed the strength and direction of these relationships among selected clinical subgroups in a secondary analysis. Results 576 (3.6%) patients developed pneumonia and 6,451 (39.9%) received RBC transfusions. There was a significant association between any RBC transfusion and pneumonia (ORadj 3.4, p<0.001). There was a dose-response between number of units and odds of pneumonia, ptrend<0.001. Patients receiving only 2 units of RBCs had twofold (ORadj 2.1, p<0.001) increased odds of pneumonia. These findings were consistent across clinical subgroups. Conclusions We found a significant, volume-dependent association between an increasing number of RBCs and odds of pneumonia, which persisted after adjusting for pre-operative patient characteristics. Clinical teams should explore opportunities for preventing a patient’s risk of RBC transfusions, including reducing hemodilution or adopting a lower transfusion threshold in a stable patient. PMID:26209489

  18. Economic analysis of blood product transfusions according to the treatment of acute myeloid leukemia in the elderly.

    Science.gov (United States)

    Cannas, G; Fattoum, J; Boukhit, M; Thomas, X

    2015-01-01

    Blood transfusion requirement represents one of the most significant cost driver associated with acute myeloid leukemia (AML). Low-intensity treatments (low-dose cytarabine, hypomethylating agents) have the potential to reduce transfusion dependence, and improve health-related quality of life. We assessed the cost-effectiveness of treatment types regarding blood product transfusions in a cohort of 214 AML patients aged ≥ 70 years. Analyzes did not indicate any significant overall survival (OS) advantage of intensive chemotherapy comparatively to low-intensity treatment. The difference was significant when compared to best supportive care (BSC) (Ptransfusion cost per patient was 1.3 times lower with low-intensity therapy and 2.7 times lower with BSC than with intensive chemotherapy. Mean transfusion cost per patient according to OS varied from 2.4 to 1.3 times less with low-intensity treatment comparatively to intensive chemotherapy for patients having OS ≤ 13.3 months. Costs varied from 3.5 to 2.6 times less with BSC comparatively to intensive chemotherapy. In contrast, mean transfusion costs were comparable among treatments for patients with OS>13.3 months. Low-intensity treatments represent a cost-effective alternative to BSC and require a reduced number of transfused blood products comparatively to intensive chemotherapy, while OS was not significantly different. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  19. Perioperative Allogeneic Red Blood-Cell Transfusion Associated with Surgical Site Infection After Total Hip and Knee Arthroplasty.

    Science.gov (United States)

    Everhart, Joshua S; Sojka, John H; Mayerson, Joel L; Glassman, Andrew H; Scharschmidt, Thomas J

    2018-02-21

    Perioperative allogeneic red blood-cell transfusion is a suspected risk factor for surgical site infection (SSI) after total joint arthroplasty (TJA), but the interrelationships among SSI risk, transfusion dose, preoperative anemia, and the presence of coagulopathies have not been well described. Data on SSI within 1 year after surgery as well as on transfusion with blood products within 30 days after surgery were obtained for 6,788 patients who had undergone primary or revision total hip or knee arthroplasty from 2000 to 2011 in a single hospital system. Multivariate logistic regression modeling was used to determine the independent association between allogeneic red blood-cell transfusion and SSI. There was a dose-dependent association between allogeneic red blood-cell transfusion and SSI, with the infection rate increasing as the transfusion dose increased from 1 unit (odds ratio [OR] = 1.97; 95% confidence interval [CI] = 1.38, 2.79; p 3 units (OR = 7.40; CI = 4.91, 11.03; p conservation strategies. Therapeutic Level III. See Instructions for Authors for a complete description of levels of evidence.

  20. Risk of erectile dysfunction in transfusion-naive thalassemia men: a nationwide population-based retrospective cohort study.

    Science.gov (United States)

    Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung

    2015-04-01

    Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction. This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities.

  1. Use of an identification system based on biometric data for patients requiring transfusions guarantees transfusion safety and traceability.

    Science.gov (United States)

    Bennardello, Francesco; Fidone, Carmelo; Cabibbo, Sergio; Calabrese, Salvatore; Garozzo, Giovanni; Cassarino, Grazia; Antolino, Agostino; Tavolino, Giuseppe; Zisa, Nuccio; Falla, Cadigia; Drago, Giuseppe; Di Stefano, Giovanna; Bonomo, Pietro

    2009-07-01

    One of the most serious risks of blood transfusions is an error in ABO blood group compatibility, which can cause a haemolytic transfusion reaction and, in the most severe cases, the death of the patient. The frequency and type of errors observed suggest that these are inevitable, in that mistakes are inherent to human nature, unless significant changes, including the use of computerised instruments, are made to procedures. In order to identify patients who are candidates for the transfusion of blood components and to guarantee the traceability of the transfusion, the Securblood system (BBS srl) was introduced. This system records the various stages of the transfusion process, the health care workers involved and any immediate transfusion reactions. The patients and staff are identified by fingerprinting or a bar code. The system was implemented within Ragusa hospital in 16 operative units (ordinary wards, day hospital, operating theatres). In the period from August 2007 to July 2008, 7282 blood components were transfused within the hospital, of which 5606 (77%) using the Securblood system. Overall, 1777 patients were transfused. In this year of experience, no transfusion errors were recorded and each blood component was transfused to the right patient. We recorded 33 blocks of the terminals (involving 0.6% of the transfused blood components) which required the intervention of staff from the Service of Immunohaematology and Transfusion Medicine (SIMT). Most of the blocks were due to procedural errors. The Securblood system guarantees complete traceability of the transfusion process outside the SIMT and eliminates the possibility of mistaken identification of patients or blood components. The use of fingerprinting to identify health care staff (nurses and doctors) and patients obliges the staff to carry out the identification procedures directly in the presence of the patient and guarantees the presence of the doctor at the start of the transfusion.

  2. Red blood cell transfusion and mortality in trauma patients: risk-stratified analysis of an observational study.

    Directory of Open Access Journals (Sweden)

    Pablo Perel

    2014-06-01

    Full Text Available Haemorrhage is a common cause of death in trauma patients. Although transfusions are extensively used in the care of bleeding trauma patients, there is uncertainty about the balance of risks and benefits and how this balance depends on the baseline risk of death. Our objective was to evaluate the association of red blood cell (RBC transfusion with mortality according to the predicted risk of death.A secondary analysis of the CRASH-2 trial (which originally evaluated the effect of tranexamic acid on mortality in trauma patients was conducted. The trial included 20,127 trauma patients with significant bleeding from 274 hospitals in 40 countries. We evaluated the association of RBC transfusion with mortality in four strata of predicted risk of death: 50%. For this analysis the exposure considered was RBC transfusion, and the main outcome was death from all causes at 28 days. A total of 10,227 patients (50.8% received at least one transfusion. We found strong evidence that the association of transfusion with all-cause mortality varied according to the predicted risk of death (p-value for interaction 50% predicted risk of death (OR 0.59, 95% CI 0.47-0.74, p<0.0001. Transfusion was associated with an increase in fatal and non-fatal vascular events (OR 2.58, 95% CI 2.05-3.24, p<0.0001. The risk associated with RBC transfusion was significantly increased for all the predicted risk of death categories, but the relative increase was higher for those with the lowest (<6% predicted risk of death (p-value for interaction <0.0001. As this was an observational study, the results could have been affected by different types of confounding. In addition, we could not consider haemoglobin in our analysis. In sensitivity analyses, excluding patients who died early; conducting propensity score analysis adjusting by use of platelets, fresh frozen plasma, and cryoprecipitate; and adjusting for country produced results that were similar.The association of transfusion

  3. Blood transfusion: patient identification and empowerment.

    Science.gov (United States)

    Stout, Lynn; Joseph, Sundari

    Positive patient identification is pivotal to several steps of the transfusion process; it is integral to ensuring that the correct blood is given to the correct patient. If patient misidentification occurs, this has potentially fatal consequences for patients. Historically patient involvement in healthcare has focused on clinical decision making, where the patient, having been provided with medical information, is encouraged to become involved in the decisions related to their individualised treatment. This article explores the aspects of patient contribution to patient safety relating to positive patient identification in transfusion. When involving patients in their care, however, clinicians must recognise the diversity of patients and the capacity of the patient to be involved. It must not be assumed that all patients will be willing or indeed able to participate. Additionally, clinicians' attitudes to patient involvement in patient safety can determine whether cultural change is successful.

  4. Detrimental effects of perioperative blood transfusion

    DEFF Research Database (Denmark)

    Nielsen, Hans Jørgen

    1995-01-01

    Evidence suggests that perioperative allogeneic blood transfusion increases the risk of infectious complications after major surgery and of cancer recurrence after curative operation. This has been attributed to immunosuppression. Several authors have suggested that filtered whole blood and/or red...... cell concentrate, or leucocyte- and buffy coat-reduced red cells in artificial medium or their own plasma, may reduce postoperative immunosuppression. It was also anticipated that the use of autologous blood might minimize the risk of perioperative transfusion, but studies have unexpectedly shown...... similar postoperative infectious complications and cancer recurrence and/or survival rates in patients receiving autologous blood donated before operation and those receiving allogeneic blood. Future studies should identify common risk factors associated with blood storage....

  5. Results of a protocol of transfusion threshold and surgical technique on transfusion requirements in burn patients.

    Science.gov (United States)

    O'Mara, Michael S; Hayetian, Fernando; Slater, Harvey; Goldfarb, I William; Tolchin, Eric; Caushaj, Philip F

    2005-08-01

    Blood loss and high rates of transfusion in burn centers remains an area of ongoing concern. Blood use brings the risk of infection, adverse reaction, and immunosuppression. A protocol to reduce blood loss and blood use was implemented. Analysis included 3-year periods before and after institution of the protocol. All patients were transfused for a hemoglobin below 8.0 gm/dL. Operations per admission did not change during the two time periods (0.78 in each). Overall units transfused per operation decreased from 1.56+/-0.06 to 1.25+/-0.14 units after instituting the protocol (pburns of less than 20% surface area, declining from 386 to 46 units after protocol institution, from 0.37 to 0.04 units per admission, and from 0.79 to 0.08 units per operation in this group of smallest burns. There was no change noted in the larger burns. This study suggests that a defined protocol of hemostasis, technique, and transfusion trigger should be implemented in the process of burn excision and grafting. This will help especially those patients with the smallest burns, essentially eliminating transfusion need in that group.

  6. Autologous Blood Transfusion in Sports: Emerging Biomarkers.

    Science.gov (United States)

    Salamin, Olivier; De Angelis, Sara; Tissot, Jean-Daniel; Saugy, Martial; Leuenberger, Nicolas

    2016-07-01

    Despite being prohibited by the World Anti-Doping Agency, blood doping through erythropoietin injection or blood transfusion is frequently used by athletes to increase oxygen delivery to muscles and enhance performance. In contrast with allogeneic blood transfusion and erythropoietic stimulants, there is presently no direct method of detection for autologous blood transfusion (ABT) doping. Blood reinfusion is currently monitored with individual follow-up of hematological variables via the athlete biological passport, which requires further improvement. Microdosage is undetectable, and suspicious profiles in athletes are often attributed to exposure to altitude, heat stress, or illness. Additional indirect biomarkers may increase the sensitivity and specificity of the longitudinal approach. The emergence of "-omics" strategies provides new opportunities to discover biomarkers for the indirect detection of ABT. With the development of direct quantitative methods, transcriptomics based on microRNA or messenger RNA expression is a promising approach. Because blood donation and blood reinfusion alter iron metabolism, quantification of proteins involved in metal metabolism, such as hepcidin, may be applied in an "ironomics" strategy to improve the detection of ABT. As red blood cell (RBC) storage triggers changes in membrane proteins, proteomic methods have the potential to identify the presence of stored RBCs in blood. Alternatively, urine matrix can be used for the quantification of the plasticizer di(2-ethyhexyl)phthalate and its metabolites that originate from blood storage bags, suggesting recent blood transfusion, and have an important degree of sensitivity and specificity. This review proposes that various indirect biomarkers should be applied in combination with mathematical approaches for longitudinal monitoring aimed at improving ABT detection. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Blood transfusion before radiation for malignancies

    International Nuclear Information System (INIS)

    Hunt, T.K.

    1989-01-01

    This editorial discusses the situation of administering blood to patients prior to radiotherapy in an attempt to increase tissue/tumor oxygen tension. The author believes that since the rate at which tumor cells consume oxygen is highly variable, the aim of achieving high cellular oxygen tension may be met better by maintaining a high blood perfusion rate. Blood volume can be maintained without relying on transfusion, and safer alternatives are available

  8. [Hemorrhagic syndrome after transfusion of incompatible blood].

    Science.gov (United States)

    Fedorova, Z D; Bsryshev, B A; Khanin, A Z; Chuslov, A G

    1979-11-01

    The patients were observed by a reanimation-hematological team of the Leningrad emergency service. It has been established that the hemorrhagic syndrome is the main one deterimining the unity of pathogenesis and clinical picture of the hemotransfusional complication. Phase character of the changes in the homeostasis system during the transfusion of incompatible blood was noted. The express diagnosis of the disorders and a scheme of the sequence of administration of hemostatic drugs are proposed. Mortality among such patients was reduced.

  9. Effect of blood transfusions on canine renal allograft survival

    International Nuclear Information System (INIS)

    Van Der Linden, C.J.; Buurman, W.A.; Vegt, P.A.; Greep, J.M.; Jeekel, J.

    1982-01-01

    In this study significantly prolonged canine renal allograft survival has been demonstrated after transfusion of 100 ml of third-party whole blood given peroperatively. Peroperative transfusions of third-party leukocyte-free blood or pure lymphocyte cell suspensions did not influence graft survival. Futhermore, no improvement in graft survival has been found after a peroperative transfuson of irradiated whole blood (2500 rad). These data suggest that delayed graft rejection after blood transfusions can only be expected after the administration of whole blood. The role of competent lymphocytes in whole blood is questionable, since a transfusion of irradiated whole blood in combination with nonirradiated lymphocytes did not lead to prolonged graft survival. Immunosuppression of the recipient directly after transfusion seems to be essential to induce the beneficial effect of blood transfusions. This has been demonstrated for a transfusion of whole blood 14 days before transplantation. A single transfusion of 100 ml of whole blood 14 days before transplantation could effectively prolong graft survival if immunosuppression with azathioprine and prednisone was started on the day of transfusion. No improvement in graft survival has been found with such a transfusion if preoperative immunosuppression has been omitted

  10. Potential Harm of Prophylactic Platelet Transfusion in Adult Dengue Patients.

    Science.gov (United States)

    Lee, Tau-Hong; Wong, Joshua G X; Leo, Yee-Sin; Thein, Tun-Linn; Ng, Ee-Ling; Lee, Linda K; Lye, David C

    2016-03-01

    Thrombocytopenia is a hallmark of dengue infection, and bleeding is a dreaded complication of dengue fever. Prophylactic platelet transfusion has been used to prevent bleeding in the management of dengue fever, although the evidence for its benefit is lacking. In adult dengue patients with platelet count Tan Tock Seng Hospital from January 2005 to December 2008. Baseline characteristics and clinical outcomes were compared between the non-transfused vs. transfused groups. Outcomes studied were clinical bleeding, platelet increment, hospital length of stay, intensive care unit admission and death. Of the 788 patients included, 486 received prophylactic platelet transfusion. There was no significant difference in the presence of clinical bleeding in the two groups (18.2% in non-transfused group vs. 23.5% in transfused group; P = 0.08). Patients in the transfused group took a median of 1 day longer than the non-transfused group to increase their platelet count to 50,000/mm3 or more (3 days vs. 2 days, P hospital stay in the non-transfused group was 5 days vs. 6 days in the transfused group (P50,000/mm3 and increasing length of hospitalization.

  11. Autoimmune hemolytic anemia: transfusion challenges and solutions

    Directory of Open Access Journals (Sweden)

    Barros MM

    2017-03-01

    Full Text Available Melca M O Barros, Dante M Langhi Jr, José O Bordin Department of Clinical and Experimental Oncology, Universidade Federal de São Paulo, São Paulo, Brazil Abstract: Autoimmune hemolytic anemia (AIHA is defined as the increased destruction of red blood cells (RBCs in the presence of anti-RBC autoantibodies and/or complement. Classification of AIHA is based on the optimal auto-RBC antibody reactivity temperatures and includes warm, cold-reactive, mixed AIHA, and drug-induced AIHA subtypes. AIHA is a rare disease, and recommendations for transfusion are based mainly on results from retrospective data and relatively small cohort studies, including heterogeneous patient samples or single case reports. In this article, we will review the challenges and solutions to safely transfuse AIHA patients. We will reflect on the indication for transfusion in AIHA and the difficulty in the accomplishment of immunohematological procedures for the selection of the safest and most compatible RBC units. Keywords: hemolytic anemia, RBC autoantibodies, autoimmunity, hemolysis, direct ­antiglobulin test

  12. Blood transfusion indications in neurosurgical patients: A systematic review.

    Science.gov (United States)

    Bagwe, Shefali; Chung, Lawrance K; Lagman, Carlito; Voth, Brittany L; Barnette, Natalie E; Elhajjmoussa, Lekaa; Yang, Isaac

    2017-04-01

    Neurosurgical procedures can be complicated by significant blood losses that have the potential to decrease tissue perfusion to critical brain tissue. Red blood cell transfusion is used in a variety of capacities both inside, and outside, of the operating room to prevent untoward neurologic damage. However, evidence-based guidelines concerning thresholds and indications for transfusion in neurosurgery remain limited. Consequently, transfusion practices in neurosurgical patients are highly variable and based on institutional experiences. Recently, a paradigm shift has occurred in neurocritical intensive care units, whereby restrictive transfusion is increasingly favored over liberal transfusion but the ideal strategy remains in clinical equipoise. The authors of this study perform a systematic review of the literature with the objective of capturing the changing landscape of blood transfusion indications in neurosurgical patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. PTEN and DMBT1 homozygous deletion and expression in medulloblastomas and supratentorial primitive neuroectodermal tumors.

    Science.gov (United States)

    Inda, María Mar; Mercapide, Javier; Muñoz, Jorge; Coullin, Philippe; Danglot, Giséle; Tuñon, Teresa; Martínez-Peñuela, José María; Rivera, José María; Burgos, Juan J; Bernheim, Alain; Castresana, Javier S

    2004-12-01

    Medulloblastoma, which accounts for 20-25% of all childhood brain tumors, is defined as a primitive neuroectodermal tumor (PNET) located in the cerebellum. Supratentorial PNET are less frequent than medulloblastoma. But their clinical outcome is worse than in medulloblastomas. Chromosome 10q contains at least 2 tumor suppressor genes that might play a role in brain tumor development: PTEN and DMBT1. The aim of this study was to compare the status of homozygous deletion and expression of PTEN and DMBT1 genes in PNET primary tumor samples and cell lines. Homozygous deletions of PTEN and DMBT1 were studied in 32 paraffin-embedded PNET samples (23 medulloblastomas and 9 supratentorial PNET) and in 7 PNET cell lines, by differential PCR and by FISH. PTEN homozygous losses were demonstrated in 7 medulloblastomas (32%) and in no supratentorial PNET, while homozygous deletions of DMBT1 appeared in 1 supratentorial PNET (20%) and in 7 medulloblastomas (33%). No homozygous deletion of PTEN or DMBT1 was detected in any of the PNET cell lines either by differential PCR or by FISH. Expression study of the 2 genes was performed in the 7 PNET cell lines by RT-PCR. One PNET cell line lacked PTEN and DMBT1 expression, while 2 medulloblastoma cell lines did not express DMBT1. Our results add some positive data to the hypothesis that supratentorial PNETs and medulloblastomas might be genetically different.

  14. Risk Factors for Blood Transfusion With Primary Posterior Lumbar Fusion.

    Science.gov (United States)

    Basques, Bryce A; Anandasivam, Nidharshan S; Webb, Matthew L; Samuel, Andre M; Lukasiewicz, Adam M; Bohl, Daniel D; Grauer, Jonathan N

    2015-11-01

    Retrospective cohort study. To identify factors associated with blood transfusion for primary posterior lumbar fusion surgery, and to identify associations between blood transfusion and other postoperative complications. Blood transfusion is a relatively common occurrence for patients undergoing primary posterior lumbar fusion. There is limited information available describing which patients are at increased risk for blood transfusion, and the relationship between blood transfusion and short-term postoperative outcomes is poorly characterized. The American College of Surgeons National Surgical Quality Improvement Program (ACS-NSQIP) database was used to identify patients undergoing primary posterior lumbar fusion from 2011 to 2013. Multivariate analysis was used to find associations between patient characteristics and blood transfusion, along with associations between blood transfusion and postoperative outcomes. Out of 4223 patients, 704 (16.7%) had a blood transfusion. Age 60 to 69 (relative risk [RR] 1.6), age greater than equal to 70 (RR 1.7), American Society of Anesthesiologists class greater than equal to 3 (RR 1.1), female sex (RR 1.1), pulmonary disease (RR 1.2), preoperative hematocrit less than 36.0 (RR 2.0), operative time greater than equal to 310 minutes (RR 2.9), 2 levels (RR 1.6), and 3 or more levels (RR 2.1) were independently associated with blood transfusion. Interbody fusion (RR 0.9) was associated with decreased rates of blood transfusion. Receiving a blood transfusion was significantly associated with any complication (RR 1.7), sepsis (RR 2.6), return to the operating room (RR 1.7), deep surgical site infection (RR 2.6), and pulmonary embolism (RR 5.1). Blood transfusion was also associated with an increase in postoperative length of stay of 1.4 days (P risk factors for these occurrences were characterized. Strategies to minimize blood loss might be considered in these patients to avoid the associated complications. 3.

  15. Reappraising the concept of massive transfusion in trauma

    DEFF Research Database (Denmark)

    Stanworth, Simon J; Morris, Timothy P; Gaarder, Christine

    2010-01-01

    ABSTRACT : INTRODUCTION : The massive-transfusion concept was introduced to recognize the dilutional complications resulting from large volumes of packed red blood cells (PRBCs). Definitions of massive transfusion vary and lack supporting clinical evidence. Damage-control resuscitation regimens...... of modern trauma care are targeted to the early correction of acute traumatic coagulopathy. The aim of this study was to identify a clinically relevant definition of trauma massive transfusion based on clinical outcomes. We also examined whether the concept was useful in that early prediction of massive...... transfusion as a concept in trauma has limited utility, and emphasis should be placed on identifying patients with massive hemorrhage and acute traumatic coagulopathy....

  16. Transfusion Medicine and Coagulation Management in Organ Transplantation.

    Science.gov (United States)

    Madisetty, Jaswanth; Wang, Cynthia

    2017-09-01

    Organ transplantation recipients present unusual challenges with regard to blood transfusion. Although this patient population requires a larger proportion of blood product resources, liberal transfusion of allogeneic blood products can lead to a plethora of complications. Recent trends suggest that efforts to minimize bleeding, conserve products, and target transfusion to specific deficits and needs are increasingly becoming the standard practice; these must all occur with optimization of graft function and preservation in mind. With newer monitoring modalities and factor concentrates, the approach toward transfusion and bleeding in organ transplantation has rapidly improved in recent years. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Desmopressin use for minimising perioperative blood transfusion

    Science.gov (United States)

    Desborough, Michael J; Oakland, Kathryn; Brierley, Charlotte; Bennett, Sean; Doree, Carolyn; Trivella, Marialena; Hopewell, Sally; Stanworth, Simon J; Estcourt, Lise J

    2017-01-01

    Background Blood transfusion is administered during many types of surgery, but its efficacy and safety are increasingly questioned. Evaluation of the efficacy of agents, such as desmopressin (DDAVP; 1-deamino-8-D-arginine-vasopressin), that may reduce perioperative blood loss is needed. Objectives To examine the evidence for the efficacy of DDAVP in reducing perioperative blood loss and the need for red cell transfusion in people who do not have inherited bleeding disorders. Search methods We searched for randomised controlled trials (RCTs) in the Cochrane Central Register of Controlled Trials (2017, issue 3) in the Cochrane Library, MEDLINE (from 1946), Embase (from 1974), the Cumulative Index to Nursing and Allied Health Literature (CINAHL) (from 1937), the Transfusion Evidence Library (from 1980), and ongoing trial databases (all searches to 3 April 2017). Selection criteria We included randomised controlled trials comparing DDAVP to placebo or an active comparator (e.g. tranexamic acid, aprotinin) before, during, or immediately after surgery or after invasive procedures in adults or children. Data collection and analysis We used the standard methodological procedures expected by Cochrane. Main results We identified 65 completed trials (3874 participants) and four ongoing trials. Of the 65 completed trials, 39 focused on adult cardiac surgery, three on paediatric cardiac surgery, 12 on orthopaedic surgery, two on plastic surgery, and two on vascular surgery; seven studies were conducted in surgery for other conditions. These trials were conducted between 1986 and 2016, and 11 were funded by pharmaceutical companies or by a party with a commercial interest in the outcome of the trial. The GRADE quality of evidence was very low to moderate across all outcomes. No trial reported quality of life. DDAVP versus placebo or no treatment Trial results showed considerable heterogeneity between surgical settings for total volume of red cells transfused (low

  18. Pregnancy in a Woman with Homozygous Familial Hypercholesterolemia Not on Low-Density Lipoprotein Apheresis

    Directory of Open Access Journals (Sweden)

    Akl C. Fahed

    2012-11-01

    Full Text Available Pregnancy in women with homozygous familial hypercholesterolemia (FH has been rarely reported and might pose risks on the mother and her fetus. Although most reported cases remained on low-density lipoprotein (LDL apheresis, there are no clear guidelines regarding the management of this entity. We report the first case of an uncomplicated pregnancy in a 24-year-old homozygous FH woman who was not maintained on LDL apheresis. FH expresses a wide variability in the phenotype, and management of homozygous FH cases who desire to become pregnant should be individualized based on preconceptional assessment with frequent antenatal follow-up. Decisions on management should be made after weighing the risks versus benefits of LDL apheresis.

  19. The Ratio of Blood Products Transfused Affects Mortality in Patients Receiving Massive Transfusions at a Combat Support Hospital

    Science.gov (United States)

    2007-10-01

    therapy resuscitation, and exacer- bated by hemorrhagic shock, metabolic acidosis, hypother- mia, hyperfibrinolysis, hypocalcemia , and anemia.11,14–19...outcome studies examining the effect of blood product transfusion ratios for trauma patients requiring massive transfusion. Most deaths (80% to 85%) that...calculation of apheresis platelet units transfused, though FWB has previously been shown to be as effective as 10 units of platelet concentrate.33 The

  20. Transfusion Practices Committee of a public blood bank network in Minas Gerais, Brazil.

    Science.gov (United States)

    de Carvalho, Ricardo Vilas Freire; Brener, Stela; Ferreira, Angela Melgaço; do Valle, Marcele Cunha Ribeiro; Moraes-Souza, Helio

    2012-01-01

    This study aimed to verify the performance of blood transfusion committees in transfusion services linked to the public blood bank network of the state of Minas Gerais. A cross-sectional observational study was conducted between 2007 and 2008 using questionnaires and proficiency tests to evaluate the reporting and investigation of transfusion reactions comparing transfusion services with and without transfusion committees in the public transfusion services of the state of Minas Gerais. Nineteen of Hemominas own transfusion services and 207 that contracted the services of the foundation located in 178 municipalities were visited between 2007 and 2008. Established transfusion committees were present in 63.4% of the services visited. Transfusion incidents were reported by 53 (36.8%) transfusion services with transfusion committees and by eight (9.6%) without transfusion committees (p < 0.001) with 543 (97.5%) and 14 (2.5%) notifications, respectively. Of the reported transfusion incidents, 40 (75.5%) transfusion services with transfusion committees and only two (25%) of those without transfusion committees investigated the causes. The incidence of notification and investigation of the causes of transfusion reactions was higher in transfusion services where a transfusion committee was present. Despite these results, the performance of these committees was found to be incipient and a better organization and more effective operation are required.

  1. A homozygous PMS2 founder mutation with an attenuated constitutional mismatch repair deficiency phenotype.

    Science.gov (United States)

    Li, Lili; Hamel, Nancy; Baker, Kristi; McGuffin, Michael J; Couillard, Martin; Gologan, Adrian; Marcus, Victoria A; Chodirker, Bernard; Chudley, Albert; Stefanovici, Camelia; Durandy, Anne; Hegele, Robert A; Feng, Bing-Jian; Goldgar, David E; Zhu, Jun; De Rosa, Marina; Gruber, Stephen B; Wimmer, Katharina; Young, Barbara; Chong, George; Tischkowitz, Marc D; Foulkes, William D

    2015-05-01

    Inherited mutations in DNA mismatch repair genes predispose to different cancer syndromes depending on whether they are mono-allelic or bi-allelic. This supports a causal relationship between expression level in the germline and phenotype variation. As a model to study this relationship, our study aimed to define the pathogenic characteristics of a recurrent homozygous coding variant in PMS2 displaying an attenuated phenotype identified by clinical genetic testing in seven Inuit families from Northern Quebec. Pathogenic characteristics of the PMS2 mutation NM_000535.5:c.2002A>G were studied using genotype-phenotype correlation, single-molecule expression detection and single genome microsatellite instability analysis. This PMS2 mutation generates a de novo splice site that competes with the authentic site. In homozygotes, expression of the full-length protein is reduced to a level barely detectable by conventional diagnostics. Median age at primary cancer diagnosis is 22 years among 13 NM_000535.5:c.2002A>G homozygotes, versus 8 years in individuals carrying bi-allelic truncating mutations. Residual expression of full-length PMS2 transcript was detected in normal tissues from homozygotes with cancers in their 20s. Our genotype-phenotype study of c.2002A>G illustrates that an extremely low level of PMS2 expression likely delays cancer onset, a feature that could be exploited in cancer preventive intervention. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  2. Craniofacial abnormalities in homozygous Small eye (Sey/Sey) embryos and newborn mice.

    OpenAIRE

    Kaufman, M H; Chang, H H; Shaw, J P

    1995-01-01

    The Small eye (Sey) gene in the mouse is lethal in the homozygous state. It is located on chromosome 2, is a mutation in the Pax-6 gene, and is genetically homologous with the human aniridia 2 (AN2) gene mutation. Numerous studies over the last few years, using genetic and molecular biological approaches, have investigated both the location of the gene as well as its possible mode of action. In the homozygous state, the primary defect appears to be limited to the failure of differentiation of...

  3. Simulation-based education for transfusion medicine.

    Science.gov (United States)

    Morgan, Shanna; Rioux-Masse, Benjamin; Oancea, Cristina; Cohn, Claudia; Harmon, James; Konia, Mojca

    2015-04-01

    The administration of blood products is frequently determined by physicians without subspecialty training in transfusion medicine (TM). Education in TM is necessary for appropriate utilization of resources and maintaining patient safety. Our institution developed an efficient simulation-based TM course with the goal of identifying key topics that could be individualized to learners of all levels in various environments while also allowing for practice in an environment where the patient is not placed at risk. A 2.5-hour simulation-based educational activity was designed and taught to undergraduate medical students rotating through anesthesiology and TM elective rotations and to all Clinical Anesthesia Year 1 (CA-1) residents. Content and process evaluation of the activity consisted of multiple-choice tests and course evaluations. Seventy medical students and seven CA-1 residents were enrolled in the course. There was no significant difference on pretest results between medical students and CA-1 residents. The posttest results for both medical students and CA-1 residents were significantly higher than pretest results. The results of the posttest between medical students and CA-1 residents were not significantly different. The TM knowledge gap is not a trivial problem as transfusion of blood products is associated with significant risks. Innovative educational techniques are needed to address the ongoing challenges with knowledge acquisition and retention in already full curricula. Our institution developed a feasible and effective way to integrate TM into the curriculum. Educational activities, such as this, might be a way to improve the safety of transfusions. © 2014 AABB.

  4. Intrauterine transfusion combined with partial exchange transfusion for twin anemia polycythemia sequence: modeling a novel technique

    NARCIS (Netherlands)

    Slaghekke, F.; van den Wijngaard, J. P. H. M.; Akkermans, J.; van Gemert, M. J. C.; Middeldorp, J. M.; Klumper, F. J.; Oepkes, D.; Lopriore, E.

    2015-01-01

    Twin anemia-polycythemia sequence (TAPS) is a newly described disease in monochorionic twin pregnancies, characterized by large inter-twin hemoglobin differences. Optimal management for TAPS is not clear. One of the possible treatment modalities is intrauterine blood transfusion (IUT) in the donor

  5. A preliminary study of placental umbilical cord whole blood transfusion in under resourced patients with malaria in the background of anaemia.

    Science.gov (United States)

    Bhattacharya, Niranjan

    2006-03-23

    transfusion was 0.5 gm/dl to 1.6 gm/dl. Each patient received two to six units of freshly collected cord blood transfusion (two units at a time), depending on availability and compatibility. No clinical immunological or non-immunological reaction has been encountered in this series. Properly screened cord blood is safe for transfusion, in victims of severe malarial anaemia who need transfusion support.

  6. A preliminary study of placental umbilical cord whole blood transfusion in under resourced patients with malaria in the background of anaemia

    Directory of Open Access Journals (Sweden)

    Bhattacharya Niranjan

    2006-03-01

    two units of freshly collected cord blood transfusion was 0.5 gm/dl to 1.6 gm/dl. Each patient received two to six units of freshly collected cord blood transfusion (two units at a time, depending on availability and compatibility. No clinical immunological or non-immunological reaction has been encountered in this series. Conclusion Properly screened cord blood is safe for transfusion, in victims of severe malarial anaemia who need transfusion support.

  7. Thrombocytopenia responding to red blood cell transfusion

    International Nuclear Information System (INIS)

    Mubarak, Ahmad A.; Awidi, Abdalla; Rasul, Kakil I.; Al-Homsi, Ussama

    2004-01-01

    Three patients with severe symptomatic iron defficiency anemia and thrombocytopenia had a significant rise in the platelet count a few days following packed red blood cell transfusion. Pretransfusion platelet count of of patient one was 17x10/L. 22x10/Lin patient two and 29x10/L in patient three. On the 6th day of post tranfusion, the platelet count rose to 166x10/Lin patient one, 830x10/L in patient two and 136x10/L in patient three. The possible mechcnism behind such an unreported observation are discussed. (author)

  8. Severe iron intoxication treated with exchange transfusion

    DEFF Research Database (Denmark)

    Carlsson, M; Cortes, D; Jepsen, S

    2009-01-01

    An 18-month-old previous healthy girl who had ingested 442 mg elemental iron/kg was admitted to a paediatric intensive care unit. The child was treated with gastric lavage, whole bowel irrigation and intravenous deferoxamine. After 2 h of standard therapy serum iron had risen threefold to 1362 µg....../dl (244 µmol/l). The child was treated with exchange transfusion (ET; 52 ml/kg) and serum iron fell to 134 µg/dl (24 µmol/l). The patient made an uncomplicated recovery. ET should be considered in severe iron poisoning when standard therapy is inadequate....

  9. Severe iron intoxication treated with exchange transfusion

    DEFF Research Database (Denmark)

    Carlsson, Marcella; Cortes, Dina; Jepsen, Søren

    2008-01-01

    An 18-month-old previous healthy girl who had ingested 442 mg elemental iron/kg was admitted to a paediatric intensive care unit. The child was treated with gastric lavage, whole bowel irrigation and intravenous deferoxamine. After 2 h of standard therapy serum iron had risen threefold to 1362 mi...... microg/dl (244 micromol/l). The child was treated with exchange transfusion (ET; 52 ml/kg) and serum iron fell to 134 microg/dl (24 micromol/l). The patient made an uncomplicated recovery. ET should be considered in severe iron poisoning when standard therapy is inadequate....

  10. Long-term detection of microchimaerism in peripheral blood after pretransplantation blood transfusion

    NARCIS (Netherlands)

    Vervoordeldonk, S. F.; Doumaid, K.; Remmerswaal, E. B.; ten Berge, I. J.; Wilmink, J. M.; de Waal, L. P.; Boog, C. J.

    1998-01-01

    Renal allograft survival is prolonged after pretransplantation blood transfusion. The aim of this study was to test retrospectively the development and persistence of microchimaerism after pretransplantation blood transfusion and to assess whether the type of blood transfusion (partially matched [=

  11. Transfusion-related transmission of yellow fever vaccine virus--California, 2009.

    Science.gov (United States)

    2010-01-22

    In the United States, yellow fever (YF) vaccination is recommended for travelers and active duty military members visiting endemic areas of sub-Saharan Africa and Central/South America. The American Red Cross recommends that recipients of YF vaccine defer blood product donation for 2 weeks because of the theoretical risk for transmission from a viremic donor. On April 10, 2009, a hospital blood bank supervisor learned that, on March 27, blood products had been collected from 89 U.S. active duty trainees who had received YF vaccine 4 days before donation. This report summarizes the subsequent investigation by the hospital and CDC to identify lapses in donor deferral and to determine whether transfusion-related transmission of YF vaccine virus occurred. The investigation found that a recent change in the timing of trainee vaccination had occurred and that vaccinees had not reported recent YF vaccination status at time of donation. Despite a prompt recall, six units of blood products were transfused into five patients. No clinical evidence or laboratory abnormalities consistent with a serious adverse reaction were identified in four recipients within the first month after transfusion; the fifth patient, who had prostate cancer and end-stage, transfusion-dependent, B-cell lymphoma, died while in hospice care. Three of the four surviving patients had evidence of serologic response to YF vaccine virus. This report provides evidence that transfusion-related transmission of YF vaccine virus can occur and underscores the need for careful screening and deferral of recently vaccinated blood donors.

  12. Red blood cell transfusion probability and associated costs in neurosurgical procedures.

    Science.gov (United States)

    Barth, Martin; Weiss, Christel; Schmieder, Kirsten

    2018-03-20

    The extent of red blood cell units (RBC) needed for different neurosurgical procedures and the time point of their administration are widely unknown, which results in generously cross-matching prior to surgery. However, RBC are increasingly requested in the aging western populations, and blood donations are significantly reduced. Therefore, the knowledge of the extent and time point of administration of RBC is of major importance. This is a retrospective single center analysis. The incidence of RBC transfusion during surgery or within 48 h after surgery was analyzed for all neurosurgical patients within 3 years. Costs for cross-matched and transfused RBC were calculated and risk factors for RBC transfusion analyzed. The risk of intraoperative RBC administration was low for spinal and intracranial tumor resections (1.87%) and exceeded 10% only in spinal fusion procedures. This was dependent on the number of fused segments with an intraoperative transfusion risk of > 12.5% with fusion of more than three levels. Multiple logistic regression analysis showed a significantly increased risk for RBC transfusion for female gender (p = 0.006; OR 1.655), higher age (N = 4812; p < 0.0001; OR 1.028), and number of fused segments (N = 737; p < 0.0001; OR 1.433). Annual costs for cross-matching were 783,820.88 USD and for intraoperative RBC administration 121,322.13 USD. Neurosurgical procedures are associated with a low number of RBC needed intraoperatively. Only elective spine fusion procedures with ≥ 3 levels involved and AVM resections seem to require cross-matching of RBC. The present data may allow changing the preoperative algorithm of RBC cross-matching in neurosurgical procedures and help to save resources and costs.

  13. Valuation of transfusion-free living in MDS: results of health utility interviews with patients

    Directory of Open Access Journals (Sweden)

    Lübbert Michael

    2009-09-01

    Full Text Available Abstract Background This study measured how myelodysplastic syndrome (MDS patients value transfusion independence (TI, reduced transfusions (RT and transfusion-dependence (TD using health utility assessment methodology. Methods 47 MDS patients were interviewed, US (n = 8, France (n = 9, Germany (n = 9 and the UK (n = 21, to elicit the utility value of TI, RT and TD. Health states were developed based on literature; patient forum discussions; and were validated by a hematologist. Face-to-face interviews used the feeling thermometer Visual Analogue Scale (VAS and the Time Trade-Off (TTO method to value the health states on a 0 (dead to 1 (perfect health scale. Socio-demographic, clinical, and quality-of-life (EQ-5D characteristics were surveyed to describe the patient sample. Results and Discussion The mean age was 67 years (range: 29-83; 45% male, 70% retired; 40% had secondary/high school education, or higher (32%, and 79% lived with family, a partner or spouse, or friends. The mean time from MDS diagnosis was 5 years (range:1-23. Most patients (87% received previous transfusions and 49% had received a transfusion in the last 3 months. Mean EQ-5D index score was 0.78; patients reported at least some problem with mobility (45%, usual activities (40%, pain/discomfort (47%, and anxiety/depression (34%. Few patients had difficulty understanding the VAS (n = 3 and TTO (n = 4 exercises. Utility scores for TI were higher than for RT (0.84 vs. 0.77; p Conclusion Patients value TI, suggesting an important role for new treatments aiming to achieve greater TI in MDS. These results can be used in preference-based health economic evaluation of new MDS treatments, such as in future cost-utility studies.

  14. History of blood transfusion in sub-saharan Africa.

    Science.gov (United States)

    Schneider, William H

    2013-01-01

    The adequacy and safety of blood transfusion in sub-Saharan Africa is the subject of much concern, yet there have been very few studies of its history. An overview of that record finds that transfusions were first reported in Africa (sub-Saharan and excluding South Africa) in the early 1920s, and organized transfusion practices were established before the Second World War. Blood transfusion grew rapidly after 1945, along with the construction of new hospitals and expanded health services in Africa. Significant differences existed between colonial powers in the organization of transfusion services, but these converged after independence as their use continued to grow and decentralized and hospital-based practices were adopted. It was only after the oil crisis in the mid-1970s that health spending declined and the collection, testing, and transfusion of blood began to level off. Thus, when the AIDS crisis hit transfusion services, they were already struggling to meet the needs of patients. At this time, foreign assistance as well as the World Health Organization and the League of Red Cross Societies helped respond to both the immediate problem of testing blood, and for some countries, support existed for the broader reorganization of transfusion. Overall, the history shows that transfusion was adopted widely and quickly, limited mainly by the availability of knowledgeable doctors and hospital facilities. There was less resistance than expected by Africans to receive transfusions, and the record shows a remarkable flexibility in obtaining blood. The dangers of disease transmission were recognized from an early date but were balanced against the potential lifesaving benefits of transfusion. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Blood transfusion and resuscitation using penile corpora: an experimental study.

    Science.gov (United States)

    Abolyosr, Ahmad; Sayed, M A; Elanany, Fathy; Smeika, M A; Shaker, S E

    2005-10-01

    To test the feasibility of using the penile corpora cavernosa for blood transfusion and resuscitation purposes. Three male donkeys were used for autologous blood transfusion into the corpus cavernosum during three sessions with a 1-week interval between each. Two blood units (450 mL each) were transfused per session to each donkey. Moreover, three dogs were bled up until a state of shock was produced. The mean arterial blood pressure decreased to 60 mm Hg. The withdrawn blood (mean volume 396.3 mL) was transfused back into their corpora cavernosa under 150 mm Hg pressure. Different transfusion parameters were assessed. The Assiut faculty of medicine ethical committee approved the study before its initiation. For the donkey model, the mean time of blood collection was 12 minutes. The mean time needed to establish corporal access was 22 seconds. The mean time of blood transfusion was 14.2 minutes. The mean rate of blood transfusion was 31.7 mL/min. Mild penile elongation with or without mild penile tumescence was observed on four occasions. All penile shafts returned spontaneously to their pretransfusion state at a maximum of 5 minutes after cessation of blood transfusion. No extravasation, hematoma formation, or color changes occurred. Regarding the dog model, the mean rate of transfusion was 35.2 mL/min. All dogs were resuscitated at the end of the transfusion. The corpus cavernosum is a feasible, simple, rapid, and effective alternative route for blood transfusion and venous access. It can be resorted to whenever necessary. It is a reliable means for volume replacement and resuscitation in males.

  16. Transfusion medicine and solid organ transplant – Update and review of some current issues

    OpenAIRE

    Sarkar, R.S.; Philip, J.; Yadav, Pramod

    2013-01-01

    Transfusion medicine holds a place of prime importance in organ transplant surgeries. There is a huge demand of organs worldwide with long waiting periods before the organ is available for transplant. Currently the dependency on ABO and HLA matching has decreased considerably with the use of modern immunosuppressant drugs and transplant techniques. The greatest advance in clinical implementation of ABO-incompatible transplants came about through desensitization and isoagglutinin elimination t...

  17. Contemporary issues in transfusion medicine informatics

    Directory of Open Access Journals (Sweden)

    Gaurav Sharma

    2011-01-01

    Full Text Available The Transfusion Medicine Service (TMS covers diverse clinical and laboratory-based services that must be delivered with accuracy, efficiency and reliability. TMS oversight is shared by multiple regulatory agencies that cover product manufacturing and validation standards geared toward patient safety. These demands present significant informatics challenges. Over the past few decades, TMS information systems have improved to better handle blood product manufacturing, inventory, delivery, tracking and documentation. Audit trails and access to electronic databases have greatly facilitated product traceability and biovigilance efforts. Modern blood bank computing has enabled novel applications such as the electronic crossmatch, kiosk-based blood product delivery systems, and self-administered computerized blood donor interview and eligibility determination. With increasing use of barcoding technology, there has been a marked improvement in patient and specimen identification. Moreover, the emergence of national and international labeling standards such as ISBT 128 have facilitated the availability, movement and tracking of blood products across national and international boundaries. TMS has only recently begun to leverage the electronic medical record to address quality issues in transfusion practice and promote standardized documentation within institutions. With improved technology, future growth is expected in blood bank automation and product labeling with applications such as radio frequency identification devices. This article reviews several of these key informatics issues relevant to the contemporary practice of TMS.

  18. [Hepatitis E virus: Blood transfusion implications].

    Science.gov (United States)

    Gallian, P; Piquet, Y; Assal, A; Djoudi, R; Chiaroni, J; Izopet, J; Tiberghien, P

    2014-11-01

    Hepatitis E virus (HEV) is a non-enveloped RNA virus transmitted by the fecal-oral route. Autochthonous hepatitis E occurring in developed countries is caused by genotypes 3 and 4 and is a zoonotic infection. Humans are infected mostly after ingestion of undercooked meat from infected animals. Most HEV 3 and 4 infections are clinically inapparent. However, genotype 3 (HEV 3) can lead to chronic hepatitis in immuno-compromised patients such as organ-transplant recipients and patients with haematological malignancies. In Europe, HEV 3 is implicated in transfusion-transmitted HEV infection. In France, as observed in several European countries, prevalence of HEV RNA and specific IgG antibodies are high indicating that viral circulation is important. The systematic HEV NAT screening of blood donations used for preparation of solvent detergent plasma indicate that 1 to 2218 donation is infected by HEV RNA. The need or implementation's impacts of safety measures to prevent HEV transmission by blood transfusion are under reflexion by French's health authorities. The HEV NAT screening is the only available tool of prevention. Alternative strategies are under investigation including individual or mini pool NAT testing all or part of blood donations. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  19. Effects of massive transfusion on oxygen availability

    Directory of Open Access Journals (Sweden)

    José Otávio Costa Auler Jr

    Full Text Available OBJECTIVE: To determine oxygen derived parameters, hemodynamic and biochemical laboratory data (2,3 Diphosphoglycerate, lactate and blood gases analysis in patients after cardiac surgery who received massive blood replacement. DESIGN: Prospective study. SETTING: Heart Institute (Instituto do Coração, Hospital das Clínicas, Faculdade de Medicina, Universidade de São Paulo, Brazil. PARTICIPANTS: Twelve patients after cardiac surgery who received massive transfusion replacement; six of them evolved to a fatal outcome within the three-day postoperative follow-up. MEASUREMENTS AND MAIN RESULTS: The non-survivors group (n=6 presented high lactate levels and low P50 levels, when compared to the survivors group (p<0.05. Both groups presented an increase in oxygen consumption and O2 extraction, and there were no significant differences between them regarding these parameters. The 2,3 DPG levels were slightly reduced in both groups. CONCLUSIONS: This study shows that patients who are massively transfused following cardiovascular surgery present cell oxygenation disturbances probably as a result of O2 transport inadequacy.

  20. Contemporary issues in transfusion medicine informatics.

    Science.gov (United States)

    Sharma, Gaurav; Parwani, Anil V; Raval, Jay S; Triulzi, Darrell J; Benjamin, Richard J; Pantanowitz, Liron

    2011-01-07

    The Transfusion Medicine Service (TMS) covers diverse clinical and laboratory-based services that must be delivered with accuracy, efficiency and reliability. TMS oversight is shared by multiple regulatory agencies that cover product manufacturing and validation standards geared toward patient safety. These demands present significant informatics challenges. Over the past few decades, TMS information systems have improved to better handle blood product manufacturing, inventory, delivery, tracking and documentation. Audit trails and access to electronic databases have greatly facilitated product traceability and biovigilance efforts. Modern blood bank computing has enabled novel applications such as the electronic crossmatch, kiosk-based blood product delivery systems, and self-administered computerized blood donor interview and eligibility determination. With increasing use of barcoding technology, there has been a marked improvement in patient and specimen identification. Moreover, the emergence of national and international labeling standards such as ISBT 128 have facilitated the availability, movement and tracking of blood products across national and international boundaries. TMS has only recently begun to leverage the electronic medical record to address quality issues in transfusion practice and promote standardized documentation within institutions. With improved technology, future growth is expected in blood bank automation and product labeling with applications such as radio frequency identification devices. This article reviews several of these key informatics issues relevant to the contemporary practice of TMS.

  1. Hepatitis B Surface AntigenemiaAmong Transfused Children with ...

    African Journals Online (AJOL)

    Patients with sickle cell anaemia (SCA), a common haematological disorder inNigeria,may have complications that require blood transfusion, thus exposing them to the risk. Objective: To determine the prevalence of hepatitis B surface antigen (HBsAg) among transfused childrenwith SCAin Enugu. Subjects and Method: ...

  2. Collection and Transfusion of Blood in Jos University Teaching ...

    African Journals Online (AJOL)

    Objective: This study was embarked on to investigate the pattern of blood collection and transfusion in Jos University Teaching Hospital (JUTH), Jos between 2000 and 2005 in the face of the present human immunodeficiency virus (HIV) pandemic. Methodology: Blood bank records of blood donors and transfusions were ...

  3. Perceived blood transfusion safety: A cross-European comparison

    NARCIS (Netherlands)

    Merz, E.M.; Zijlstra, B.J.H.; de Kort, W.L.A.M.

    2016-01-01

    Background and Objectives During the past decades, blood transfusions have become an ever safer clinical procedure in developed countries. Extensive donor screening together with improved infectious disease testing has led to a minimization of risks for transfusion recipients. Still, the general

  4. Perceived blood transfusion safety: a cross-European comparison

    NARCIS (Netherlands)

    Merz, E.-M.; Zijlstra, B. J. H.; de Kort, W. L. A. M.

    2016-01-01

    During the past decades, blood transfusions have become an ever safer clinical procedure in developed countries. Extensive donor screening together with improved infectious disease testing has led to a minimization of risks for transfusion recipients. Still, the general public perceives the process

  5. Perceived blood transfusion safety. A cross-European comparison

    NARCIS (Netherlands)

    Merz, E.M.; Zijlstra, B.J.H.; De Kort, W.L.A.M.

    2016-01-01

    Background and Objectives: During the past decades, blood transfusions have become an ever safer clinical procedure in developed countries. Extensive donor screening together with improved infectious disease testing has led to a minimization of risks for transfusion recipients. Still, the general

  6. Pattern of requests for interspousal donation and transfusion in ...

    African Journals Online (AJOL)

    Background: The cases of 66 female patients who needed transfusion and requested for interspousal directed blood donations from their husbands at the UMTH Blood Bank from 1997 to 2001 were reviewed. The patients required blood for elective procedures, and wanted to be transfused with the blood of their husbands ...

  7. Age of blood and survival after massive transfusion.

    Science.gov (United States)

    Sanz, C C; Pereira, A

    2017-11-01

    Massive transfusion is the clinical scenario where the presumed adverse effects of stored blood are expected to be more evident because the whole patient's blood volume is replaced by stored blood. To analyse the association between age of transfused red blood cells (RBC) and survival in massively transfused patients. In this retrospective study, clinical and transfusion data of all consecutive patients massively transfused between 2008 and 2014 in a large, tertiary-care hospital were electronically extracted from the Transfusion Service database and the patients' electronic medical records. Prognostic factors for in-hospital mortality were investigated by multivariate logistic regression. A total of 689 consecutive patients were analysed (median age: 61 years; 65% males) and 272 died in-hospital. Projected mortality at 2, 30, and 90 days was 21%, 35% and 45%, respectively. The odds ratio (OR) for in-hospital mortality among patients who survived after the 2nd day increased with patient age (OR: 1.037, 95% CI: 1.021-1.054; per year Ptransfused in the first 48hours (OR: 1.060; 95% CI: 1.038-1.020 per unit; Ptransfusion was associated with a higher proportion of old RBCs transfused in the first 48hours. Other factors associated with poor prognosis were older patient's age and larger volumes of transfused RBCs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Low vs. high haemoglobin trigger for transfusion in vascular surgery

    DEFF Research Database (Denmark)

    Møller, A; Nielsen, H B; Wetterslev, J

    2017-01-01

    of the infrarenal aorta or infrainguinal arterial bypass surgery undergo a web-based randomisation to one of two groups: perioperative RBC transfusion triggered by hb ...-up of serious adverse events in the Danish National Patient Register within 90 days is pending. DISCUSSION: This trial is expected to determine whether a RBC transfusion triggered by hb

  9. Red blood cell transfusion in infants and children - Current perspectives.

    Science.gov (United States)

    Ali, Natasha

    2018-06-01

    Children routinely receive packed red blood transfusion when they are admitted in the intensive care unit or undergoing cardiac surgeries. These guidelines aim to summarize literature and provide transfusion triggers exclusively in infants and children. Copyright © 2017. Published by Elsevier B.V.

  10. Hepatitis C and blood transfusion among children attending the ...

    African Journals Online (AJOL)

    Background: Hepatitis C virus (HCV) accounts for 90% of post-transfusion hepatitis. In Uganda, there has been limited research of prevalence of HCV among sickle cell anaemia (SS) patients, a group at risk for multiple transfusions. Objectives: To establish prevalence of HCV infection and determine whether blood ...

  11. Profiles of blood and blood component transfusion recipients in Zimbabwe

    NARCIS (Netherlands)

    Mafirakureva, Nyashadzaishe; Khoza, Star; Hassall, Oliver; Faragher, Brian E.; Kajja, Isaac; Mvere, David A.; Emmanuel, Jean C.; Postma, Maarten J.; van Hulst, Marinus

    2015-01-01

    Background. There are limited published data on the characteristics of blood transfusion recipients in sub-Saharan Africa. This study describes the demographic characteristics of blood transfusion recipients and patterns of blood and blood component use in Zimbabwe. Materials and methods. Data on

  12. Cardiovascular responses to blood transfusion in children with ...

    African Journals Online (AJOL)

    Introduction: This study evaluated the cardiovascular responses to blood transfusion in children with anemic heart failure using mostly clinical parameters. Materials and Methods: Consecutive patients with anemic heart failure presenting to a childrenfs emergency room and requiring blood transfusion were assessed for ...

  13. Blood transfusion requirement in surgery for femoral artery aneurysms

    DEFF Research Database (Denmark)

    Levi, N; Schroeder, T V

    1997-01-01

    Audit of blood usage in various surgical specialities have shown that over-ordering of blood is widespread, causing unnecessary pressure on the transfusion facilities and giving growing concern over the expense of cross-matching blood. The aim of this study was to assess the blood transfusion...

  14. Blood transfusion and hepatitis viruses | Bird | South African Medical ...

    African Journals Online (AJOL)

    Transmission of hepatitis viruses has been recognised as an undesirable effect of blood transfusion since the 1940s, when large outbreaks occurred following inoculation with a yellow fever vaccine which contained pooled human plasma. Further reports followed of jaundice occurring several months after transfusions with ...

  15. Genetically Determined Hazards of Blood Transfusion Within and ...

    African Journals Online (AJOL)

    The risks of sensitizing the recipient of a blood transfusion to the antigens on the red blood cells of the donor have been calculated for the various populations of Southern Africa. Although many of these antigens vary markedly in their frequencies in different populations, the theoretical risks of incompatible transfusion with ...

  16. Rhesus Negative Woman Transfused With Rhesus Positive Blood ...

    African Journals Online (AJOL)

    Clinicians sometimes are confronted with the challenge of transfusing haemorrhaging Rhesus (Rh) D negative patients with Rh D positive blood to save their lives. There are concerns about alloimmunization and future haemolytic disease of the newborn in women of the reproductive age. Another fear is transfusion reaction ...

  17. Blood transfusion in obstetrics: attitude and perceptions of pregnant ...

    African Journals Online (AJOL)

    Background: Obstetrics haemorrhage is the leading cause of preventable maternal deaths worldwide. Blood transfusion is pivotal to death reduction, but are the women aware of its importance? Objectives: The study investigated the view of a population of pregnant women on obstetrics related blood transfusion. Methods: ...

  18. Rational use of blood transfusion during open reduction and internal ...

    African Journals Online (AJOL)

    Background: Blood transfusion can be a life saving intervention. However, if blood is given when it is not needed, the patient receives no benefit and is exposed to unnecessary risk. Therefore, transfusion should be prescribed only when the benefits to the patient are likely to outweigh the risks. Objective: To evaluate the ...

  19. Donor blood procurement and the risk of transfusion transmissible ...

    African Journals Online (AJOL)

    Background: Blood and blood products are scarce commodities. The demand often outweighs the supply. This study is directed at investigating the blood procurement sources and the risk of viral transfusion transmissible infection. Materials and Methods: The records of the blood transfusion unit of a tertiary health facility in ...

  20. Ranitidine prevents postoperative transfusion-induced depression of delayed hypersensitivity

    DEFF Research Database (Denmark)

    Nielsen, Hans Jørgen; Hammer, J H; Moesgaard, F

    1989-01-01

    The influence of perioperative blood transfusion on postoperative depression of cell-mediated immunity (CMI) and the effect of ranitidine on transfusion-induced changes in postoperative CMI were investigated. CMI was assessed preoperatively and postoperatively by skin testing with seven common...

  1. Reappraising the concept of massive transfusion in trauma

    NARCIS (Netherlands)

    Stanworth, Simon J.; Morris, Timothy P.; Gaarder, Christine; Goslings, J. Carel; Maegele, Marc; Cohen, Mitchell J.; König, Thomas C.; Davenport, Ross A.; Pittet, Jean-Francois; Johansson, Pär I.; Allard, Shubha; Johnson, Tony; Brohi, Karim

    2010-01-01

    The massive-transfusion concept was introduced to recognize the dilutional complications resulting from large volumes of packed red blood cells (PRBCs). Definitions of massive transfusion vary and lack supporting clinical evidence. Damage-control resuscitation regimens of modern trauma care are

  2. Advances and controversies in neonatal ICU platelet transfusion practice.

    Science.gov (United States)

    Christensen, Robert D

    2008-01-01

    Some of the platelet transfusions currently given to NICU patients are unnecessary and convey no benefits. Although ordered with good intentions, unnecessary platelet transfusions carry known and unknown risks. Identifying and eliminating any unnecessary platelet transfusions in NICUs would be a step toward better care, lower costs, and more careful preservation of blood component resources. A renewed interest in platelet transfusion studies is needed, if essential data is to be gathered to improve NICU platelet transfusion practice. Retrospective studies can be of value: for instance, seeking associations between bleeding events and platelet counts can suggest the possibility of cause and effect relationships. Such studies might identify approximate platelet count levels that convey high hemorrhagic risk and might help focus future prospective trials. Prospective indirect studies also can be of value, for instance, measuring the template bleeding time and the PFA-100 closure time as a function of platelet count and perhaps as a function of circulating platelet mass, and would provide new information with relevance to platelet transfusion benefits. Such studies might give a better awareness of how low the platelet count can fall before platelet plug formation is impaired. It seems inescapable, however, that new, multicentered, randomized, prospective studies are needed, where NICU patients are assigned different platelet transfusion triggers and then carefully tracked for bleeding events and long-term neurodevelopmental outcomes. Only that type of study is likely to generate the evidence base needed for widespread implementation of improvements in NICU platelet transfusion practice.

  3. Audit of blood transfusion practice during anaesthesia for spine ...

    African Journals Online (AJOL)

    Background: Blood loss during spine surgery is often considerable, necessitating blood transfusion. The elective nature and other peculiarities of most spine surgeries, however, make them amenable to several blood conservation techniques, such that reduction in allogeneic blood transfusion is considered high priority in ...

  4. Post-transfusion hemoglobin values and patient blood management

    DEFF Research Database (Denmark)

    Moerman, Jan; Vermeulen, Edith; Van Mullem, Mia

    2018-01-01

    Objectives: The objective of this retrospective study was to evaluate the added value of communicating post-transfusion hemoglobin values to clinicians as a strategy to improve RBC utilization in a 500-bed hospital. Methods: The total number of RBC transfusions, the mean number of RBC units...... transfused per patient, the mean pre- and post-transfusion hemoglobin values, the ratio of patients transfused and the ratio of patients with a post-transfusion hemoglobin > 10.5 g/dL were calculated per service and per department for six months. The data were reported to each service and compared...... with the data of the department as peer group. The impact of this communication strategy was evaluated in the following six months. Results: In the six months pre-intervention, the mean post-transfusion hemoglobin value was 9.2 g/dL. Post-transfusion hemoglobin was > 10.5 g/dL in 13.4% of patients (112...

  5. blood transfusion requirement during caesarean delivery: risk factors

    African Journals Online (AJOL)

    Factors predisposing to increased risk for blood transfusion identified from previous ... This study was conducted to determine the risk factors for blood transfusion during anaesthesia for caesarean section. ... study which could fall into either of the following conditions: satisfactory post- operative clinical status up to 48 hours ...

  6. Citrate metabolism and its complications in non-massive blood transfusions: association with decompensated metabolic alkalosis+respiratory acidosis and serum electrolyte levels.

    Science.gov (United States)

    Bıçakçı, Zafer; Olcay, Lale

    2014-06-01

    Metabolic alkalosis, which is a non-massive blood transfusion complication, is not reported in the literature although metabolic alkalosis dependent on citrate metabolism is reported to be a massive blood transfusion complication. The aim of this study was to investigate the effect of elevated carbon dioxide production due to citrate metabolism and serum electrolyte imbalance in patients who received frequent non-massive blood transfusions. Fifteen inpatients who were diagnosed with different conditions and who received frequent blood transfusions (10-30 ml/kg/day) were prospectively evaluated. Patients who had initial metabolic alkalosis (bicarbonate>26 mmol/l), who needed at least one intensive blood transfusion in one-to-three days for a period of at least 15 days, and whose total transfusion amount did not fit the massive blood transfusion definition (alkalosis+respiratory acidosis developed as a result of citrate metabolism. There was a positive correlation between cumulative amount of citrate and the use of fresh frozen plasma, venous blood pH, ionized calcium, serum-blood gas sodium and mortality, whereas there was a negative correlation between cumulative amount of citrate and serum calcium levels, serum phosphorus levels and amount of urine chloride. In non-massive, but frequent blood transfusions, elevated carbon dioxide production due to citrate metabolism causes intracellular acidosis. As a result of intracellular acidosis compensation, decompensated metabolic alkalosis+respiratory acidosis and electrolyte imbalance may develop. This situation may contribute to the increase in mortality. In conclusion, it should be noted that non-massive, but frequent blood transfusions may result in certain complications. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Cancer risk among 21st century blood transfusion recipients.

    Science.gov (United States)

    Yang, T O; Cairns, B J; Reeves, G K; Green, J; Beral, V

    2017-02-01

    Some carcinogenic viruses are known to be transmissible by blood transfusion. Intensive viral screening of transfused blood now exists in most countries. In the UK, high-sensitivity nucleic acid amplification tests for hepatitis C virus were introduced in 1999 and it was thought that this would reduce, and possibly eliminate, transfusion-related liver cancer. We aimed to investigate cancer risk in recipients of blood transfusion in 2000 or after. A total of 1.3 million UK women recruited in 1998 on average were followed for hospital records of blood transfusion and for cancer registrations. After excluding women with cancer or precancerous conditions before or at the time of transfusion, Cox regression yielded adjusted relative risks of 11 site-specific cancers for women with compared to without prior blood transfusion. During follow up, 11 274 (0.9%) women had a first recorded transfusion in 2000 or after, and 1648 (14.6%) of them were subsequently diagnosed with cancer, a mean 6.8 years after the transfusion. In the first 5 years after transfusion there were significant excesses for most site-specific cancers examined, presumably because some had preclinical cancer. However, 5 or more years (mean 8 years) after blood transfusion, there were significant excess risks only for liver cancer (adjusted relative risk = 2.63, 95%CI 1.45-4.78) and for non-Hodgkin lymphoma (adjusted relative risk = 1.74, 1.21-2.51). When analyses were restricted to those undergoing hip or knee replacement surgery, the commonest procedure associated with transfusion, these relative risks were not materially altered. In a large cohort of UK women, transfusions in the 21st century were associated with long-term increased risks of liver cancer and non-Hodgkin lymphoma. Some of these malignancies may have been caused by carcinogenic agents that are not currently screened for in transfused blood. © The Author 2016. Published by Oxford University Press on behalf of the European Society

  8. Worldwide audit of blood transfusion practice in critically ill patients.

    Science.gov (United States)

    Vincent, Jean-Louis; Jaschinski, Ulrich; Wittebole, Xavier; Lefrant, Jean-Yves; Jakob, Stephan M; Almekhlafi, Ghaleb A; Pellis, Tommaso; Tripathy, Swagata; Rubatto Birri, Paolo N; Sakr, Yasser

    2018-04-19

    The aim was to describe transfusion practice in critically ill patients at an international level and evaluate the effects of red blood cell (RBC) transfusion on outcomes in these patients. This was a pre-planned sub-study of the Intensive Care Over Nations audit, which involved 730 ICUs in 84 countries and included all adult patients admitted between 8 May and 18 May 2012, except admissions for routine postoperative surveillance. ICU and hospital outcomes were recorded. Among the 10,069 patients included in the audit, data related to transfusion had been completed for 9553 (mean age 60 ± 18 years, 60% male); 2511 (26.3%) of these had received a transfusion, with considerable variation among geographic regions. The mean lowest hemoglobin on the day of transfusion was 8.3 ± 1.7 g/dL, but varied from 7.8 ± 1.4 g/dL in the Middle East to 8.9 ± 1.9 g/dL in Eastern Europe. Hospital mortality rates were higher in transfused than in non-transfused patients (30.0% vs. 19.6%, p < 0.001) and increased with increasing numbers of transfused units. In an extended Cox proportional hazard analysis, the relative risk of in-hospital death was slightly lower after transfusion in the whole cohort (hazard ratio 0.98, confidence interval 0.96-1.00, p = 0.048). There was a stepwise decrease in the hazard ratio for mortality after transfusion with increasing admission severity scores. More than one fourth of critically ill patients are transfused during their ICU stay, with considerable variations in transfusion practice among geographic regions. After adjustment for confounders, RBC transfusions were associated with a slightly lower relative risk of in-hospital death, especially in the most severely ill patients, highlighting the importance of taking the severity of illness into account when making transfusion decisions.

  9. Thrombolytic therapy for the treatment of acute ischaemic stroke in adults with homozygous sickle cell disease.

    Science.gov (United States)

    Majhadi, Loubna; Calvet, David; Rosso, Charlotte; Bartolucci, Pablo

    2017-07-28

    Stroke is a significant cause of morbidity and mortality in patients with homozygous sickle cell disease (SCD). A specific large-vessel vasculopathy is often responsible for both haemorrhagic and ischaemic strokes in patients with SCD. Although intravenous thrombolysis has been considered as a therapeutic option for acute ischaemic strokes in SCD, its use remains debated because of an increased risk of spontaneous intracranial haemorrhage reported in this disease. This risk of haemorrhage is mainly supported by the presence of a Moyamoya syndrome often associated with the specific vasculopathy in patients with homozygous SCD. We report two cases of patients with homozygous SCD treated with intravenous thrombolysis for an acute ischaemic stroke without haemorrhagic transformation. Our cases suggest that reperfusion strategy in acute ischaemic stroke in patients with homozygous SCD can be considered once associated Moyamoya syndrome has been ruled out. An international registry would be of interest as these situations are rare. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  10. Efficacy of Rosuvastatin in Children With Homozygous Familial Hypercholesterolemia and Association With Underlying Genetic Mutations

    NARCIS (Netherlands)

    Stein, Evan A.; Dann, Eldad J.; Wiegman, Albert; Skovby, Flemming; Gaudet, Daniel; Sokal, Etienne; Charng, Min-Ji; Mohamed, Mafauzy; Luirink, Ilse; Raichlen, Joel S.; Sundén, Mattias; Carlsson, Stefan C.; Raal, Frederick J.; Kastelein, John J. P.

    2017-01-01

    BACKGROUND Homozygous familial hypercholesterolemia (HoFH), a rare genetic disorder, is characterized by extremely elevated levels of low-density lipoprotein cholesterol (LDL-C) and accelerated atherosclerotic cardiovascular disease. Statin treatment starts at diagnosis, but no statin has been

  11. Mesomelic dwarfism of the Langer type as a homozygous form of dyschondrosteosis

    International Nuclear Information System (INIS)

    Kemperdick, H.; Majewski, F.; Duesseldorf Univ.

    1982-01-01

    A family is described containing a daughter suffering from mesomelic dwarfism of the Langer type and both parents showing a dyschondrosteosis. This family supports the thesis that mesomelic dwarfism of the Langer type represents the homozygous form of dyschondrosteosis. (orig.) [de

  12. Premature Coronary Artery Disease due to Homozygous Familial Hypercholesterolemia in a 12-Year-Old Girl

    Directory of Open Access Journals (Sweden)

    Filiz Ekici

    2018-03-01

    Full Text Available Background: Homozygous familial hypercholesterolemia is a rare inherited metabolic disease caused by low-density lipoprotein receptor abnormality. Patients with homozygous familial hypercholesterolemia have an increased risk of cardiovascular complication that usually occurs in the first decade of life. Here, we report a 12-year-old girl with an unpredicted presentation for coronary artery disease and found to have homozygous familial hypercholesterolemia. Case Report: A 12-year-old girl was admitted to our unit with syncope. Chest X-ray showed bilateral diffuse pneumonic consolidation and mild cardiomegaly. We detected stable ST depression by electrocardiography. Echocardiography showed normal systolic functions. Troponin-1 levels were high (66 mcg/dL, upper limit: 0.04 mcg/dL. Influenza A virus DNA was detected by the respiratory viral panel. After her successful treatment for acute pneumonia and myocarditis due to Influenza A virus, her syncope attacks persisted. Marked ST elevation was observed during exercise electrocardiography. Coronary angiography showed severe occlusions in the coronary arteries. High serum levels of total cholesterol (756 mg/dL and low-density lipoprotein-C (556 mg/dL were noticed. She had no tendon xanthomas. Medical histories revealed that her family members were diagnosed with heterozygous familial hypercholesterolemia. A coronary bypass surgery was performed. Statin and ezetimibe treatments were started. We also planned lipid apheresis. Conclusion: Children with homozygous familial hypercholesterolemia may present with symptoms of premature coronary heart disease requiring a routine lipid test and careful anamnesis.

  13. A homozygous mutation in the NDUFS1 gene presents with a mild cavitating leukoencephalopathy

    NARCIS (Netherlands)

    Kashani, A.; Thiffault, I.; Dilenge, M.E.; Saint-Martin, C.; Guerrero, K.; Tran, L.T.; Shoubridge, E.; van der Knaap, M.S.; Braverman, N.; Bernard, G.

    2014-01-01

    We report a case of mild cavitating leukoencephalopathy associated with a homozygous c.755A > G (p.Asp252Gly) NDUFS1 mutation in a 7-year old boy. Biochemical analysis confirmed an isolated reduction in complex I activity. Magnetic resonance imaging of the brain showed a diffuse cystic

  14. Higher vs. lower haemoglobin threshold for transfusion in septic shock

    DEFF Research Database (Denmark)

    Rygård, S L; Holst, L B; Wetterslev, J

    2017-01-01

    . a lower haemoglobin threshold. METHODS: In post-hoc analyses of the full trial population of 998 patients from the Transfusion Requirements in Septic Shock (TRISS) trial, we investigated the intervention effect on 90-day mortality in patients with severe comorbidity (chronic lung disease, haematological......BACKGROUND: Using a restrictive transfusion strategy appears to be safe in sepsis, but there may be subgroups of patients who benefit from transfusion at a higher haemoglobin level. We explored if subgroups of patients with septic shock and anaemia had better outcome when transfused at a higher vs.......51), in those who had undergone surgery (P = 0.99) or in patients with septic shock by the new definition (P = 0.20). CONCLUSION: In exploratory analyses of a randomized trial in patients with septic shock and anaemia, we observed no survival benefit in any subgroups of transfusion at a haemoglobin threshold...

  15. [Immunologic risk analysis of blood transfusion: 1991-1998].

    Science.gov (United States)

    Rouger, P; Le Pennec, P Y; Noizat-Pirenne, F

    2000-02-01

    The immunologic risk associated to erythrocyte transfusions is bound to the polymorphism of blood group systems and to the respect of blood transfusion regulations. The results of three studies are presented, which were carried out respectively by the French Society of Blood Transfusion, the National Institute of Blood Transfusion and the National Haemovigilance Network. Two hundred and twenty-seven cases of immunologic accidents are analysed using the Kaplan's interpretation model and the traditional method of process analysis. The results show three critical factors in the occurrence of this type of incident: the relevance of the clinical examinations prescribed, the way in which the biological results are taken into account, and the relationship/exchange of information between private and public hospitals, and blood transfusion centers.

  16. [Teaching transfusion medicine research in the francophone world].

    Science.gov (United States)

    Lefrère, J-J; Shiboski, C; Fontanet, A; Murphy, E L

    2009-01-01

    A two-week, French language, clinical research course in transfusion medicine has recently been created at the Pasteur Institute in Paris under the joint leadership of faculty members from the University of California San Francisco (UCSF), the Blood Systems Research Institute (BSRI) and the National Institute of Transfusion of Paris. The goal is to train transfusion professionals from the developing world to conduct clinical research that will contribute to improving the quality of care and safety in transfusion practices in their respective countries. The course provides training on clinical and epidemiological research methods and their potential applications in transfusion medicine. As part of the course, each student develops a study protocol that can be implemented in his/her blood center of hospital.

  17. Toward a patient-based paradigm for blood transfusion.

    Science.gov (United States)

    Farrugia, Albert; Vamvakas, Eleftherios

    2014-01-01

    The current "manufacturing paradigm" of transfusion practice has detached transfusion from the clinical environment. As an example, fresh whole blood in large-volume hemorrhage may be superior to whole blood reconstituted from multiple components. Multicomponent apheresis can overcome logistical difficulties in matching patient needs with fresh component availability and can deliver the benefits of fresh whole blood. Because of the different transfusion needs of patients in emerging economies and the vulnerability of these blood systems to emerging infections, fresh whole blood and multicomponent apheresis can better meet patient needs when compared with transplants of the "manufacturing paradigm". We propose that patient blood management, along with panels of repeat, paid, accredited apheresis and fresh whole-blood donors can be used in emerging economies to support decentralized blood services. This alternative transfusion-medicine paradigm could eventually also be adopted by established economies to focus transfusion medicine on local patient needs and to alleviate the problem of the aging volunteer donor base.

  18. Transcriptomic biomarkers of altered erythropoiesis to detect autologous blood transfusion.

    Science.gov (United States)

    Salamin, Olivier; Mignot, Jonathan; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

    2018-03-01

    Autologous blood transfusion is a powerful means of improving performance and remains one of the most challenging methods to detect. Recent investigations have identified 3 candidate reticulocytes genes whose expression was significantly influenced by blood transfusion. Using quantitative reverse transcription polymerase chain reaction as an alternative quantitative method, the present study supports that delta-aminolevulinate synthase 2 (ALAS2), carbonic anhydrase (CA1), and solute carrier family 4 member 1 (SLC4A1) genes are down-regulated post-transfusion. The expression of these genes exhibited stronger correlation with immature reticulocyte fraction than with reticulocytes percentage. Moreover, the repression of reticulocytes' gene expression was more pronounced than the diminution of immature reticulocyte fraction and reticulocyte percentage following blood transfusion. It suggests that the 3 candidate genes are reliable predictors of bone marrow's response to blood transfusion and that they represent potential biomarkers for the detection of this method prohibited in sports. Copyright © 2017 John Wiley & Sons, Ltd.

  19. Proposed revised nomenclature for transfusion-related acute lung injury.

    Science.gov (United States)

    Toy, Pearl; Kleinman, Steven H; Looney, Mark R

    2017-03-01

    A decade ago, definitions of "transfusionߚrelated acute lung injury (TRALI)" and "possible TRALI" were standardized for research and clinical diagnosis. Since then, evidence has confirmed that TRALI is often due to transfusion of white blood cell antibodies to at-risk patients, and the term "TRALI, antibody mediated" is appropriate for such cases. Other TRALI cases are non-antibody mediated. Because specific, nonantibody transfusion factors have not yet been confirmed to cause TRALI in humans, the general term "TRALI, non-antibody mediated" is appropriate for such cases. In contrast, evidence is against possible TRALI being due to transfusion with the more likely cause of the acute respiratory distress syndrome (ARDS) being the alternative ARDS risk factor present in these patients. We propose to drop the misleading term "possible TRALI" and to rename this category of cases as "transfused ARDS." These nomenclature updates will more accurately categorize ARDS cases that develop after transfusion. © 2016 AABB.

  20. Searching for unknown transfusion-transmitted hepatitis viruses

    DEFF Research Database (Denmark)

    Edgren, G.; Hjalgrim, H.; Rostgaard, K.

    2018-01-01

    Background: Both hepatitis B and C viruses were transmitted through blood transfusion before implementation of donor screening. The existence of additional, yet unknown transfusion transmittable agents causing liver disease could have important public health implications. Methods: Analyses were...... 1992 to account for the effect of screening for hepatitis C virus. Results: A total of 1 482 922 transfused patients were included in the analyses. Analyses showed evidence of transfusion transmission of liver diseases before, but not after the implementation of hepatitis C virus screening in 1992...... for transfusion transmission of agents causing liver disease after the implementation of screening for hepatitis B and C, and suggest that if such transmission does occur, it is rare....

  1. [Transmission of parasites by blood transfusions and organ transplantation].

    Science.gov (United States)

    Burchard, G D

    1994-08-01

    The purpose of the present study consists in an updated review concerning the transmission of protozoa and worms by blood transfusion and organ transplantation. Prophylactic regimens and possible modifications will be discussed. The literature devoted to tropical medicine in recent years was screened and a search on Medline was performed. Relevant review articles were selected. Transfusion induced malaria and--especially in Latin America--transfusion associated Chagas' disease are the most important of these diseases. Prophylaxis of transfusion malaria is different in different countries, it is based primarily on donor selection and immunodiagnostic examinations. It is recommended that the German guidelines for prevention of transfusion malaria should be modified and that a donor selection should also take place concerning Chagas' disease.

  2. Clinical outcomes of transfusion-associated iron overload in patients with refractory chronic anemia

    Directory of Open Access Journals (Sweden)

    Gao C

    2014-04-01

    Full Text Available Chong Gao, Li Li, Baoan Chen, Huihui Song, Jian Cheng, Xiaoping Zhang, Yunyu SunDepartment of Hematology and Oncology, Key Department of Jiangsu Medicine, Zhongda Hospital, Medical School, Southeast University, Nanjing, Jiangsu Province, People’s Republic of ChinaBackground: The purpose of this study was to evaluate the clinical outcomes of transfusion-associated iron overload in patients with chronic refractory anemia.Methods: Clinical manifestations, main organ function, results of computed tomography (CT, endocrine evaluation, and serum ferritin levels were analyzed retrospectively in 13 patients who were transfusion-dependent for more than 1 year (receiving >50 units of red blood cells to determine the degree of iron overload and efficacy of iron-chelating therapy.Results: Serum ferritin levels increased to 1,830–5,740 ng/mL in all patients. Ten patients had abnormal liver function. The CT Hounsfield units in the liver increased significantly in eleven patients, and were proportional to their serum ferritin levels. Skin pigmentation, liver dysfunction, and endocrine dysfunction were observed in nine patients with serum ferritin >3,500 ng/mL, eight of whom have since died. Interestingly, serum ferritin levels did not decrease significantly in nine transfusion-dependent patients who had received 15–60 days of iron-chelating therapy.Conclusion: Transfusion-dependent patients may progress to secondary iron overload with organ impairment, which may be fatal in those who are heavily iron-overloaded. The CT Hounsfield unit is a sensitive indicator of iron overload in the liver. Iron chelation therapy should be initiated when serum ferritin is >1,000 ng/mL and continued until it is <1,000 ng/mL in transfusional iron-overloaded patients.Keywords: anemia, aplastic, iron overload, myelodysplastic syndromes

  3. Special proliferative sites are not needed for seeding and proliferation of transfused bone marrow cells in normal syngeneic mice

    International Nuclear Information System (INIS)

    Brecher, G.; Ansell, J.D.; Micklem, H.S.; Tjio, J.H.; Cronkite, E.P.

    1982-01-01

    The widely held view that transfused bone marrow cells will not proliferate in normal mice, not exposed to irradiation or other forms of bone marrow ablation, was reinvestigated. Forty million bone marrow cells from male donors were given to female recipients on each of 5 consecutive days, 5 to 10 times the number customarily used in the past. When the recipients were examined 2-13 weeks after the last transfusion, donor cells were found to average 16-25% of total marrow cells. Similar percentages of donor cells were found when variants of the enzyme phosphoglycerate kinase determined electrophoretically were used for identification of donor and recipient cells. Evidence is presented that the proportion of donor cells is compatible with a nonlinear dependence on the number of cells transfused over the range tested - i.e., 20-200 million bone marrow cells injected intravenously. Special proliferative sites thus do not appear to be required

  4. Estimation of the prevalence and rate of acute transfusion reactions occurring in Windhoek, Namibia

    Science.gov (United States)

    Meza, Benjamin P.L.; Lohrke, Britta; Wilkinson, Robert; Pitman, John P.; Shiraishi, Ray W.; Bock, Naomi; Lowrance, David W.; Kuehnert, Matthew J.; Mataranyika, Mary; Basavaraju, Sridhar V.

    2014-01-01

    Background Acute transfusion reactions are probably common in sub-Saharan Africa, but transfusion reaction surveillance systems have not been widely established. In 2008, the Blood Transfusion Service of Namibia implemented a national acute transfusion reaction surveillance system, but substantial under-reporting was suspected. We estimated the actual prevalence and rate of acute transfusion reactions occurring in Windhoek, Namibia. Methods The percentage of transfusion events resulting in a reported acute transfusion reaction was calculated. Actual percentage and rates of acute transfusion reactions per 1,000 transfused units were estimated by reviewing patients’ records from six hospitals, which transfuse >99% of all blood in Windhoek. Patients’ records for 1,162 transfusion events occurring between 1st January – 31st December 2011 were randomly selected. Clinical and demographic information were abstracted and Centers for Disease Control and Prevention National Healthcare Safety Network criteria were applied to categorize acute transfusion reactions1. Results From January 1 – December 31, 2011, there were 3,697 transfusion events (involving 10,338 blood units) in the selected hospitals. Eight (0.2%) acute transfusion reactions were reported to the surveillance system. Of the 1,162 transfusion events selected, medical records for 785 transfusion events were analysed, and 28 acute transfusion reactions were detected, of which only one had also been reported to the surveillance system. An estimated 3.4% (95% confidence interval [CI]: 2.3–4.4) of transfusion events in Windhoek resulted in an acute transfusion reaction, with an estimated rate of 11.5 (95% CI: 7.6–14.5) acute transfusion reactions per 1,000 transfused units. Conclusion The estimated actual rate of acute transfusion reactions is higher than the rate reported to the national haemovigilance system. Improved surveillance and interventions to reduce transfusion-related morbidity and mortality

  5. Limited Blood Transfusions Are Safe in Orthopaedic Trauma Patients.

    Science.gov (United States)

    Dolenc, Andrea J; Morris, William Z; Como, John J; Wagner, Karl G; Vallier, Heather A

    2016-12-01

    Controversy exists over association of blood transfusions with complications. The purpose was to assess effects of limited transfusions on complication rates and hospital course. Level 1 trauma center. Three hundred seventy-one consecutive patients with Injury Severity Score ≥16 underwent fixation of fractures of spine (n = 111), pelvis (n = 72), acetabulum (n = 57), and/or femur (n = 179). Those receiving >3 units of packed red blood cell were excluded. Fracture type, associated injuries, treatment details, ventilation time, complications, and hospital stay were prospectively recorded. Ninety-eight patients with 107 fractures received limited transfusion, and 119 patients with 123 fractures were not transfused. The groups did not differ in age, fracture types, time to fixation, or associated injuries. Lowest hematocrit was lower in the transfused group (22.8 vs. 30.0, P < 0.0001). Surgical duration (3:23 vs. 2:28) and estimated blood loss (462 vs. 211 mL) were higher in transfused patients (all P < 0.003). Pulmonary complications occurred in 12% of transfused and 4% of nontransfused, (P = 0.10). Mean days of mechanical ventilation (2.51 vs. 0.45), intensive care unit days (4.5 vs. 1.5) and total hospital stay (8.8 vs. 5.7) were higher in transfused patients (all P ≤ 0.006). After multivariate analysis, limited transfusion was associated with increased hospital and intensive care unit stays and mechanical ventilation time, but not with complications. Patients receiving ≤3 units of packed red blood cell had lower hematocrit and greater surgical burden, but no difference in complications versus the nontransfused group. Limited blood transfusions are likely safe, excepting a possible association with longer mechanical ventilation times and hospital stays. Therapeutic level III. See Instructions for Authors for a complete description of levels of evidence.

  6. Increased microerythrocyte count in homozygous alpha(+-thalassaemia contributes to protection against severe malarial anaemia.

    Directory of Open Access Journals (Sweden)

    Freya J I Fowkes

    2008-03-01

    Full Text Available The heritable haemoglobinopathy alpha(+-thalassaemia is caused by the reduced synthesis of alpha-globin chains that form part of normal adult haemoglobin (Hb. Individuals homozygous for alpha(+-thalassaemia have microcytosis and an increased erythrocyte count. Alpha(+-thalassaemia homozygosity confers considerable protection against severe malaria, including severe malarial anaemia (SMA (Hb concentration 1.1 x 10(12/l as a result of the reduced mean cell Hb in homozygous alpha(+-thalassaemia. In addition, children homozygous for alpha(+-thalassaemia require a 10% greater reduction in erythrocyte count than children of normal genotype (p = 0.02 for Hb concentration to fall to 50 g/l, the cutoff for SMA. We estimated that the haematological profile in children homozygous for alpha(+-thalassaemia reduces the risk of SMA during acute malaria compared to children of normal genotype (relative risk 0.52; 95% confidence interval [CI] 0.24-1.12, p = 0.09.The increased erythrocyte count and microcytosis in children homozygous for alpha(+-thalassaemia may contribute substantially to their protection against SMA. A lower concentration of Hb per erythrocyte and a larger population of erythrocytes may be a biologically advantageous strategy against the significant reduction in erythrocyte count that occurs during acute infection with the malaria parasite Plasmodium falciparum. This haematological profile may reduce the risk of anaemia by other Plasmodium species, as well as other causes of anaemia. Other host polymorphisms that induce an increased erythrocyte count and microcytosis may confer a similar advantage.

  7. Co-inheritance of α0 -thalassemia elevates Hb A2 level in homozygous Hb E: Diagnostic implications.

    Science.gov (United States)

    Singha, K; Srivorakun, H; Fucharoen, G; Fucharoen, S

    2017-10-01

    Differentiation of homozygous hemoglobin (Hb) E with and without α 0 -thalassemia is subtle on routine hematological ground. We examined in a large cohort of homozygous Hb E if the level of Hb A 2 is helpful. A total of 592 subjects with homozygous Hb E were recruited from ongoing thalassemia screening program. Additionally, five couples at risk of having fetuses with Hb Bart's hydrops fetalis who were homozygous Hb E were also investigated. Hb analysis was performed using capillary electrophoresis system. Globin genotypes were defined by DNA analysis. Subjects were classified into four groups including pure homozygous Hb E (n=532), homozygous Hb E/α 0 -thalassemia (n=48), Hb Constant Spring EE Bart's disease (n=8), and Hb EE Bart's disease (n=4). The levels of Hb A 2 were found, respectively, to be 4.97±0.69, 6.64±1.02, 4.86±0.87, and 7.60±1.04%. Among five couples at risk, α 0 -thalassemia was identified in three subjects with Hb A 2 >6.0%. Increased Hb A 2 level is a useful marker for differentiation of homozygous Hb E with and without α 0 -thalassemia. This should lead to a significant reduction in number of referral cases of homozygous Hb E for molecular testing of α 0 -thalassemia in routine practice. © 2017 John Wiley & Sons Ltd.

  8. Status of blood transfusion in World Health Organization-Eastern Mediterranean Region (WHO-EMR): Successes and challenges.

    Science.gov (United States)

    Darbandi, Arezoo; Mashati, Pargol; Yami, Amir; Gharehbaghian, Arshia; Namini, Mehdi Tabrizi; Gharehbaghian, Ahmad

    2017-06-01

    Blood products are used for patient treatment and survival in the cases of major surgery, hematological disorders or cancer therapy. Presently the main blood components are not yet replaceable by artificial products and all activities related to blood transfusion is highly dependent on the healthcare development of each country. The World Health Organization Eastern Mediterranean Region (WHO-EMR) comprises of 21 member states with variable socio-economic status effective on blood transfusion activities. The fundamental motivation behind this research was to accumulate some data of blood practices in this region and to have an appropriate image of the WHO-EMR region. The data were collected through the published papers or data, blood transfusion services websites, and the other health official websites like WHO. Among WHO-EMR countries there are some with a nationally organized blood transfusion establishment such as Egypt, Iran, Iraq, Kuwait, Morocco, Oman, Pakistan, and Syria. In a few, blood transfusion administrations are hospital-based like Saudi Arabia. The others are run by Red Crescent such as Bahrain, Tunisia and UEA or by Red Cross like Lebanon. Only Iran and UAE succeed to have 100% voluntary non-remunerated blood donors; however, most of them are still under the weight of family/replacement blood donation such as Afghanistan, Egypt, Iraq, Lebanon, Morocco, Saudi Arabia and Sudan or even paid donors like Pakistan and Yemen. The haemovigilance and training programs have been implemented in some countries including Bahrain, Iran, Jordan, Kuwait, Oman, Qatar, Saudi Arabia, Tunisia and UAE. Unfortunately, there are rare and inaccessible information about some EMR states like Djibouti, Palestine and Somalia so that little data can be independently discovered. In these countries different measures ought to be additionally designated to ensure blood products adequacy and safety such as the development of well-coordinated national blood transfusion centers with

  9. Transfusion medicine and solid organ transplant - Update and review of some current issues.

    Science.gov (United States)

    Sarkar, R S; Philip, J; Yadav, Pramod

    2013-04-01

    Transfusion medicine holds a place of prime importance in organ transplant surgeries. There is a huge demand of organs worldwide with long waiting periods before the organ is available for transplant. Currently the dependency on ABO and HLA matching has decreased considerably with the use of modern immunosuppressant drugs and transplant techniques. The greatest advance in clinical implementation of ABO-incompatible transplants came about through desensitization and isoagglutinin elimination techniques with immunoadsorption and anti-CD20 antibodies becoming the norm, and spleenectomy fading out. The implications and practices of transfusion medicine in organ transplant are also undergoing drastic changes. The practice of infusion of one unit of donor's blood preoperatively for immunomodulation is no longer practiced. Use of leuco-reduced products has shown decreasing trends of alloimmunization and graft rejection in cases of multiple surgeries related to organ transplants. Worldwide donor and recipient registry programmes are being setup and existing ones are being upgraded. Such a registry system has been opened in India for kidney transplant cases very recently. Due to such registry programmes the dependency on siblings and directed donations have decreased considerably. This review deals with some of the current issues contributing to the successful outcome of mismatched transplants and the changing concepts of transfusion medicine related to it.

  10. Bioactive substance accumulation and septic complications in a burn trauma patient: effect of perioperative blood transfusion?

    DEFF Research Database (Denmark)

    Nielsen, H J; Reimert, C M; Dybkjaer, E

    1997-01-01

    cationic protein (ECP), eosinophil protein X (EPX), neutrophil myeloperoxidase (MPO) and interleukin 6 (IL-6) were drawn frequently from the patient before, during and after the operations, and from all transfused red cell, platelet and fresh frozen plasma units. Urine was sampled every hour during......Evidence has emerged that suggests adverse effects to perioperative homologous blood transfusion are related to the age of the blood products. Recently, time-dependent accumulation of bioactive substances in red cell suspensions, standard platelet concentrates and fresh frozen plasma during storage...... have been shown. The potential adverse effects of these bioactive substances were analysed in a burn trauma patient. A patient with 40 per cent second and third degree burn trauma without other injuries underwent a two-step transplantation operation. Samples for analyses of histamine, eosinophil...

  11. Restrictive blood transfusion protocol in liver resection patients reduces blood transfusions with no increase in patient morbidity.

    Science.gov (United States)

    Wehry, John; Cannon, Robert; Scoggins, Charles R; Puffer, Lisa; McMasters, Kelly M; Martin, Robert C G

    2015-02-01

    Management of anemia in surgical oncology patients remains one of the key quality components in overall care and cost. Continued reports demonstrate the effects of hospital transfusion, which has been demonstrated to lead to a longer length of stay, more complications, and possibly worse overall oncologic outcomes. The hypothesis for this study was that a dedicated restrictive transfusion protocol in patients undergoing hepatectomy would lead to less overall blood transfusion with no increase in overall morbidity. A cohort study was performed using our prospective database from January 2000 to June 2013. September 2011 served as the separation point for the date of operation criteria because this marked the implementation of more restrictive blood transfusion guidelines. A total of 186 patients undergoing liver resection were reviewed. The restrictive blood transfusion guidelines reduced the percentage of patients that received blood from 31.0% before January 9, 2011 to 23.3% after this date (P = .03). The liver procedure that was most consistently associated with higher levels of transfusion was a right lobectomy (16%). Prior surgery and endoscopic stent were the 2 preoperative interventions associated with receiving blood. Patients who received blood before and after the restrictive period had similar predictive factors: major hepatectomies, higher intraoperative blood loss, lower preoperative hemoglobin level, older age, prior systemic chemotherapy, and lower preoperative nutritional parameters (all P blood did not have worse overall progression-free survival or overall survival. A restrictive blood transfusion protocol reduces the incidence of blood transfusions and the number of packed red blood cells transfused. Patients who require blood have similar preoperative and intraoperative factors that cannot be mitigated in oncology patients. Restrictive use of blood transfusions can reduce cost and does adversely affect patients undergoing liver resection

  12. Lack of effect of unrefrigerated young whole blood transfusion on patient outcomes after massive transfusion in a civilian setting.

    Science.gov (United States)

    Ho, Kwok M; Leonard, Anton D

    2011-08-01

    Warm fresh whole blood has been advocated for critical bleeding in the military setting. This study assessed whether unrefrigerated young whole blood transfusion, from donation to transfusion less than 24 hours, could reduce mortality of patients with critical bleeding in a civilian setting. A linked data cohort study was conducted on a total of 353 consecutive patients requiring massive transfusion, defined as 10 units or more of red blood cells or whole blood transfusion within 24 hours, in a quaternary health care center in Australia. Of the 353 patients with massive blood transfusion in the study, 77 received unrefrigerated young whole blood transfusion (mean, 4.0 units; interquartile range, 2-6). The diagnosis, severity of acute illness, age, sex, and ABO blood group were not significantly different between the patients who received unrefrigerated young whole blood and those who did not. Unrefrigerated young whole blood transfusions were associated with a slightly improved coagulation profile (lowest fibrinogen concentrations 1.7g/L vs. 1.4g/L, p=0.006; worst international normalization ratio, 2.4 vs. 2.8, p=0.05) but did not reduce the total utilization of allogeneic blood products and subsequent use of recombinant Factor VIIa (27% vs. 22%, p=0.358). Thirty-day mortality and 8-year survival after hospital discharge (hazard ratio, 1.05; 95% confidence interval, 0.41-2.65; p=0.93) were also not different after the use of unrefrigerated young whole blood transfusion. Unrefrigerated young whole blood transfusion was not associated with a reduced mortality of patients requiring massive transfusion in a civilian setting when other blood products were readily available. © 2010 American Association of Blood Banks.

  13. Transfusion therapy in paediatric trauma patients

    DEFF Research Database (Denmark)

    Nystrup, Kristin Brønnum; Stensballe, Jakob; Bøttger, Morten

    2015-01-01

    Haemorrhage is a leading cause of death in paediatric trauma patients. Predefined massive transfusion protocols (MTP) have the potential to significantly reduce mortality by treating haemorrhagic shock and coagulopathy, in adhering to the principles of haemostatic resuscitation with rapid...... in paediatric trauma patients is challenging, and the optimal blood product ratio that will increase survival in massively bleeding paediatric trauma patients has yet to be determined. To date, only a few small descriptive studies and case reports have investigated the use of predefined MTP in paediatric trauma...... patients.MTP with increased FFP or PLT to RBC ratios combined with viscoelastic haemostatic assay (VHA) guided haemostatic resuscitation have not yet been tested in paediatric populations but based on results from adult trauma patients, this therapeutic approach seems promising.Considering the high...

  14. Soluble vascular endothelial growth factor in various blood transfusion components

    DEFF Research Database (Denmark)

    Nielsen, Hans Jørgen; Werther, K; Mynster, T

    1999-01-01

    of sVEGF was determined in nonfiltered and prestorage white cell-reduced whole blood (WB), buffy coat-depleted saline-adenine-glucose-mannitol (SAGM) blood, platelet-rich plasma (PRP), and buffy coat-derived platelet (BCP) pools obtained from volunteer, healthy blood donors. As a control, total content......-123) ng per mL in lysed cells. In SAGM blood, the median total sVEGF content was 25.3 (3.3-48.4) ng per unit in nonfiltered units and undetectable in white cell-reduced units. Median total sVEGF content was 29.2 (24.8-124.9) ng per unit in nonfiltered PRP and 28.7 (24.5-118.6) ng per unit in white cell......-reduced PRP. The sVEGF accumulated significantly in WB, SAGM blood, and BCP pools, depending on the storage time. CONCLUSION: The sVEGF (isotype 165) appears to be present in various blood transfusion components, depending on storage time....

  15. Automated exchange transfusion and exchange rate.

    Science.gov (United States)

    Funato, M; Shimada, S; Tamai, H; Taki, H; Yoshioka, Y

    1989-10-01

    An automated blood exchange transfusion (BET) with a two-site technique has been devised by Goldmann et al and by us, using an infusion pump. With this method, we successfully performed exchange transfusions 189 times in the past four years on 110 infants with birth weights ranging from 530 g to 4,000 g. The exchange rate by the automated method was compared with the rate by Diamond's method. Serum bilirubin (SB) levels before and after BET and the maximal SB rebound within 24 hours after BET were: 21.6 +/- 2.4, 11.5 +/- 2.2, and 15.0 +/- 1.5 mg/dl in the automated method, and 22.0 +/- 2.9, 11.2 +/- 2.5, and 17.7 +/- 3.2 mg/dl in Diamond's method, respectively. The result showed that the maximal rebound of the SB level within 24 hours after BET was significantly lower in the automated method than in Diamond's method (p less than 0.01), though SB levels before and after BET were not significantly different between the two methods. The exchange rate was also measured by means of staining the fetal red cells (F cells) both in the automated method and in Diamond's method, and comparing them. The exchange rate of F cells in Diamond's method went down along the theoretical exchange curve proposed by Diamond, while the rate in the automated method was significantly better than in Diamond's, especially in the early stage of BET (p less than 0.01). We believe that the use of this automated method may give better results than Diamond's method in the rate of exchange, because this method is performed with a two-site technique using a peripheral artery and vein.

  16. Preventing blood transfusion failures: FMEA, an effective assessment method.

    Science.gov (United States)

    Najafpour, Zhila; Hasoumi, Mojtaba; Behzadi, Faranak; Mohamadi, Efat; Jafary, Mohamadreza; Saeedi, Morteza

    2017-06-30

    Failure Mode and Effect Analysis (FMEA) is a method used to assess the risk of failures and harms to patients during the medical process and to identify the associated clinical issues. The aim of this study was to conduct an assessment of blood transfusion process in a teaching general hospital, using FMEA as the method. A structured FMEA was recruited in our study performed in 2014, and corrective actions were implemented and re-evaluated after 6 months. Sixteen 2-h sessions were held to perform FMEA in the blood transfusion process, including five steps: establishing the context, selecting team members, analysis of the processes, hazard analysis, and developing a risk reduction protocol for blood transfusion. Failure modes with the highest risk priority numbers (RPNs) were identified. The overall RPN scores ranged from 5 to 100 among which, four failure modes were associated with RPNs over 75. The data analysis indicated that failures with the highest RPNs were: labelling (RPN: 100), transfusion of blood or the component (RPN: 100), patient identification (RPN: 80) and sampling (RPN: 75). The results demonstrated that mis-transfusion of blood or blood component is the most important error, which can lead to serious morbidity or mortality. Provision of training to the personnel on blood transfusion, knowledge raising on hazards and appropriate preventative measures, as well as developing standard safety guidelines are essential, and must be implemented during all steps of blood and blood component transfusion.

  17. Utilization of red blood cell transfusion in an obstetric setting.

    Science.gov (United States)

    Kamani, A A; McMorland, G H; Wadsworth, L D

    1988-11-01

    The transfusion experience for a 1-year period (September 1985 to August 1986) at a tertiary referral obstetric hospital was reviewed retrospectively. During the review period 7731 mothers were delivered and 6003 patients (83%) underwent type-and-screen procedures. A total of 1057 units of red blood cells were crossmatched, and 362 of these 1057 units were transfused to 100 parturient women so that the overall crossmatch/transfusion ratio was 2.9:1. Five percent of transfused patients received 1 unit; 52% of patients received 2 units, 19% received 3 units and 24% received greater than or equal to 4 units of packed red blood cells. Major indications for transfusion were uterine atony, 27%; retained placenta, 17%; trauma, 17%, placenta previa, 7%; and abruptio placentae, 5%. In 12% of patients transfusions were done because of anemia. This study shows the value of audit and confirms that the type-and-screen procedure is an effective way of reducing the crossmatch/transfusion ratio without compromising patient care, even in high-risk patients.

  18. Predeposit autologous blood transfusion: Do we require to promote it?

    Directory of Open Access Journals (Sweden)

    Gurjit Singh

    2015-01-01

    Full Text Available Introduction: Safest blood a patient can receive is his own. Quest for safe blood transfusion has remained of prime concern. To meet this aspiration, various forms of autologous blood transfusions can be practiced. It is especially suitable for patients with rare blood groups and religious sects such as Jehovah′s witness autologous transfusion is extremely safe. Cross matching is not required; iso-immunization to a foreign body is excluded. Fear of transfusion transmissible disease can be ignored. Therefore, autologous blood transfusion is required to be revisited. Materials and Methods: This is a prospective study carried out at Padmashree Dr. D. Y. Patil Medical College, Hospital and Research Centre, Pune between July 2010 and May 2012. Study comprised of 100 patients divided into two groups, autologous and homologous. Benefits of autologous transfusion were studied. Results: There was no significant change in hematocrit and blood parameters after blood donation. That is mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration (P < 0.001 after blood donation. Only one complication of vasovagal syncope was observed at the time of blood donation. Conclusion: Autologous blood transfusion is safe. Easy alternative to be practiced in elective surgeries, especially in patients with rare blood group or believers of Jehovah′s witness faith. It helps to reduce the shortfall in national blood inventory. Autologous blood donation should be practiced whenever possible.

  19. Optimizing transfusion in vascular surgery: is bloodless surgery an option?

    Science.gov (United States)

    Shander, Aryeh

    2008-01-01

    The prospect of surgery without blood loss is an emerging reality. Use of a blood conservation strategy is gaining increasing recognition as a sound and practical approach, especially for the majority of large blood loss surgeries. However, critical situations still occur in which transfusions are necessary or unavoidable for the short-term survival of the patient. The decision-making processes for determining when to transfuse, which blood products to give, and how much are presented here with an evaluation of the risks of transfusion and a discussion on blood conservation strategies. Modalities that may be used in such strategies include restricted phlebotomy, the implementation of restrictive transfusion triggers, acute normovolemic hemodilution, intraoperative and postoperative blood salvage, and refined operative techniques to achieve meticulous hemostasis. In addition, the proper use of erythropoiesis-stimulating agents well before surgery can reduce the number of units transfused. The risks and costs of allogeneic blood transfusions underscore the need for and value of blood conservation techniques. Increasingly, hospitals are adopting blood conservation strategies as part of their routine practice. Blood conservation is a rapidly evolving field in which active research is expanding our understanding of the molecular, physiologic, and clinical aspects of hematopoiesis, circulatory response, coagulation enigmas, artificial oxygen carriers, and the impact of anemia on organ function. Ongoing research offers the possibility of replacement or elimination of allogeneic blood transfusions in a variety of clinical settings.

  20. Profiles of blood and blood component transfusion recipients in Zimbabwe

    Science.gov (United States)

    Mafirakureva, Nyashadzaishe; Khoza, Star; Hassall, Oliver; Faragher, Brian E.; Kajja, Isaac; Mvere, David A.; Emmanuel, Jean C.; Postma, Maarten J.; van Hulst, Marinus

    2015-01-01

    Background There are limited published data on the characteristics of blood transfusion recipients in sub-Saharan Africa. This study describes the demographic characteristics of blood transfusion recipients and patterns of blood and blood component use in Zimbabwe. Materials and methods Data on the characteristics of the blood transfusion recipients (age, sex, blood group), blood components received (type, quantity), discharge diagnoses and outcomes following transfusion (discharge status, duration of stay in hospital), were retrospectively collected from four major hospitals for the period from January 1, 2012 to December 31, 2012. Diagnoses were grouped into broad categories according to the disease headings of the International Classification of Diseases (ICD-10). Surgical procedures were grouped into broad categories according to organ system using ICD-9. Results Most of the 1,793 transfusion recipients studied were female (63.2%) and in the reproductive age group, i.e. 15–49 years (65.3%). The median age of the recipients was 33 years (range, 0–93). The majority of these recipients (n=1,642; 91.6%) received a red blood cell transfusion. The majority of the patients were diagnosed with conditions related to pregnancy and childbirth (22.3%), and diseases of blood and blood-forming organs (17.7%). The median time spent in hospital was 8 days (range, 0–214) and in-hospital mortality was 15.4%. Discussion Our sample of blood transfusion recipients were fairly young and most of them received red blood cell transfusions. The majority of patients in the reproductive age group received blood transfusions for pregnancy and childbirth-related diagnoses. PMID:26192782

  1. Autologous blood transfusion in total knee replacement surgery.

    Science.gov (United States)

    Sarkanović, Mirka Lukić; Gvozdenović, Ljiljana; Savić, Dragan; Ilić, Miroslav P; Jovanović, Gordana

    2013-03-01

    Total knee replacement (TKR) surgery is one of the most frequent and the most extensive procedures in orthopedic surgery, accompanied with some serious complications. Perioperative blood loss is one of the most serious losses, so it is vital to recognize and treat such losses properly. Autologous blood transfusion is the only true alternative for the allogeneic blood. The aim of this study was to to examine if autologous blood transfusion reduces usage of allogenic blood in total knee replacement surgery, as well as to examine possible effect of autologous blood transfusion on postoperative complications, recovery and hospital stay of patients after total knee replacement surgery. During the controlled, prospective, randomised study we compared two groups of patients (n = 112) with total prosthesis implanted in their knee. The group I consisted of the patients who received the transfusion of other people's (allogeneic) blood (n = 57) and the group II of the patients whose blood was collected postoperatively and then given them [their own (autologous) blood] (n = 55). The transfusion trigger for both groups was hemoglobin level of 85 g/L. In the group of patients whose blood was collected perioperatively only 9 (0.9%) of the patients received transfusion of allogeneic blood, as opposed to the control group in which 98.24% of the patients received the transfusion of allogeneic blood (p blood was collected stayed in hospital for 6.18 days, while the patients of the control group stayed 7.67 days (p blood transfusion is a very effective method for reducing consumption of allogenic blood and thus, indirectly for reducing all complications related to allogenic blood transfusion. There is also a positive influence on postoperative recovery after total knee replacement surgery due to the reduction of hospital stay, and indirectly on the reduction of hospital costs.

  2. Clinical factors and the decision to transfuse chronic dialysis patients.

    Science.gov (United States)

    Whitman, Cynthia B; Shreay, Sanatan; Gitlin, Matthew; van Oijen, Martijn G H; Spiegel, Brennan M R

    2013-11-01

    Red blood cell transfusion was previously the principle therapy for anemia in CKD but became less prevalent after the introduction of erythropoiesis-stimulating agents. This study used adaptive choice-based conjoint analysis to identify preferences and predictors of transfusion decision-making in CKD. A computerized adaptive choice-based conjoint survey was administered between June and August of 2012 to nephrologists, internists, and hospitalists listed in the American Medical Association Masterfile. The survey quantified the relative importance of 10 patient attributes, including hemoglobin levels, age, occult blood in stool, severity of illness, eligibility for transplant, iron indices, erythropoiesis-stimulating agents, cardiovascular disease, and functional status. Triggers of transfusions in common dialysis scenarios were studied, and based on adaptive choice-based conjoint-derived preferences, relative importance by performing multivariable regression to identify predictors of transfusion preferences was assessed. A total of 350 providers completed the survey (n=305 nephrologists; mean age=46 years; 21% women). Of 10 attributes assessed, absolute hemoglobin level was the most important driver of transfusions, accounting for 29% of decision-making, followed by functional status (16%) and cardiovascular comorbidities (12%); 92% of providers transfused when hemoglobin was 7.5 g/dl, independent of other factors. In multivariable regression, Veterans Administration providers were more likely to transfuse at 8.0 g/dl (odds ratio, 5.9; 95% confidence interval, 1.9 to 18.4). Although transplant eligibility explained only 5% of decision-making, nephrologists were five times more likely to value it as important compared with non-nephrologists (odds ratio, 5.2; 95% confidence interval, 2.4 to 11.1). Adaptive choice-based conjoint analysis was useful in predicting influences on transfusion decisions. Hemoglobin level, functional status, and cardiovascular comorbidities

  3. Transfusion-associated graft-versus-host disease

    International Nuclear Information System (INIS)

    Rappeport, J.M.

    1990-01-01

    The clinical pathologic syndrome of graft-versus-host disease (GVHD) is usually a sequela of bone marrow transplantation. This disorder occurs as a result of recognition by engrafted donor-derived lymphocytes of foreign recipient transplantation antigens. GVHD may also result from engraftment of lymphocytes from other sources, including (1) transfusion of lymphocytes containing blood components, (2) transplacental maternal fetal transfusion, and (3) passive transfer of lymphocytes in solid organ transplantation. The recipients are usually severely immunodeficient and thus incapable of rejecting the transfused lymphocytes. This syndrome may, however, also develop in immunologically competent patients receiving blood products from individuals with histocompatibility antigens not recognized as foreign. 58 refs

  4. Blood transfusion in children with sickle cell disease undergoing tonsillectomy.

    Science.gov (United States)

    Atwood, Carlyn M; Gnagi, Sharon H; Teufel, Ronald J; Nguyen, Shaun A; White, David R

    2017-12-01

    Tonsillectomy is the second most common surgery in children with sickle cell disease. These children are at an increased risk of perioperative complications due to vaso-occlusive events. Although controversial, preoperative blood transfusions are sometimes given in an effort to prevent such complications. The purpose of this study is to analyze trends in the use of blood transfusion for management of children with sickle cell disease (SCD) undergoing tonsillectomy in a national database. Patients in the 1997-2012 KID with a primary procedure matching the ICD-9 procedure code for tonsillectomy (28.2-28.3) and diagnosis code for SCD (282.60-282.69) were examined. Patients were split into groups by blood transfusion status and compared across variables including complication rate, length of stay (LOS), and hospital charges. Statistical analysis included chi-square test for trend, Mann-Whitney U test, and independent t-test. 1133 patients with SCD underwent tonsillectomy. There was a strong positive correlation between increasing chronologic year and the proportion of patients receiving blood transfusions, 47 (30.1%) in 1997 to 78 (42.5%) in 2012 (r = 0.94, p = 0.005). During this period, there was no significant change in the rate of complications (r = -0.1, p = 0.87). Overall, patients receiving blood transfusion had a longer mean LOS (3.1 ± 2.4 days vs. 2.5 ± 2.2 days, p blood transfusion. The rate of complications in the transfusion group, 18 of 352(5.1%), was not significantly different (p = 0.48) from the group without transfusion, 40 of 626 (6.4%). From 1997 to 2012, there was a significant increase in the proportion of patients with SCD receiving perioperative blood transfusions for tonsillectomy. While the frequency of transfusion rose, those who received a transfusion had similar complication rates with increased charges and length of hospital stays compared to those who did not receive a transfusion. Copyright © 2017 Elsevier B.V. All

  5. The prevalence and assessment of blood transfusions in newborns

    Directory of Open Access Journals (Sweden)

    Hajieh Borna

    2017-06-01

    Full Text Available Background: Blood transfusion is common in infants. Due to the weakened immune system of newborns and the risk of blood transfusion complications, it is necessary to pay more attention following or after to blood transfusion. The aim of this study was to evaluate the frequency and risk factors of blood transfusions in hospitalized neonates. Methods: A cross-sectional study was performed on 1106 infants admitted in the neonatal intensive care unit (NICU of Mustafa Khomeini University Hospital, Tehran, Iran, from spring 2009 to 2012. Frequency and the reason for of blood components transfusion including fresh frozen plasma, platelets, whole blood, packed red blood cells, cryoprecipitate and relationship with gestational age, sex, birth weight, Apgar score, duration of hospitalization, use of mechanical ventilation were assessed. Statistical analysis was performed with SPSS statistical software, version 16 (IBM, Armonk, NY, USA and statistical test, chi-square test, independent t-test and analysis of variance (ANOVA. Results: Among 1106 infants admitted to the neonatal intensive care unit, 221 infants (%19.98 received blood products. 82 of all (37% were female and 139 (%63 were female. 113 (51% of neonate were preterm and 108 (48% were term. From 361 times of blood transfusions, 121 infant (54.75% received at least one blood product. The frequency of blood transfusion was between 39 and 1 times, with an average of 3.65 times per infant. Frequency of fresh frozen plasma infusion was 173 (47.9%, packed cell 122 (33%, platelet 32 (8.8%, cryoprecipitate 20 (5.1% and whole blood 3 unit (0.83%. The most common causes for fresh frozen plasma transfusion was replacement therapy 140 (80%, for packed cell, to correct symptomatic anemia 68 (55.6%, for platelet transfusions was to prevent bleeding in  neonates with thrombocytopenia 20 (62.5% and cryoprecipitate for bleeding caused by DIC in 18 infant (90%. There was significant relation between frequency of

  6. Red blood cell transfusion in preterm neonates: current perspectives

    Directory of Open Access Journals (Sweden)

    Chirico G

    2014-06-01

    Full Text Available Gaetano ChiricoNeonatology and Neonatal Intensive Care Unit, Children Hospital, Spedali Civili, Brescia, ItalyAbstract: Preterm neonates, especially very low birth weight infants, remain a category of patients with high transfusion needs; about 90% of those with <1,000 g birth weight may be transfused several times during their hospital stay. However, neonatal red blood cells (RBC transfusion is not without risks. In addition to well-known adverse events, several severe side effects have been observed unique to preterm infants, such as transfusion-related acute gut injury, intraventricular hemorrhage, and increased mortality risk. It is therefore important to reduce the frequency of RBC transfusion in critically ill neonates, by delayed clamping or milking the umbilical cord, using residual cord blood for initial laboratory investigations, reducing phlebotomy losses, determining transfusion guidelines, and ensuring the most appropriate nutrition, with the optimal supplementation of iron, folic acid, and vitamins. Ideally, RBC transfusion should be tailored to the individual requirements of the single infant. However, many controversies still remain, and the decision on whether to transfuse or not is often made on an empirical basis. Recently, a few clinical trials have been performed with the aim to compare the risk/benefit ratio of restrictive versus liberal transfusion criteria. No significant differences in short-term outcomes were observed, suggesting that the restrictive criteria may reduce the need for transfusion and the related side effects. Neurodevelopmental long-term outcome seemed more favorable in the liberal group at first evaluation, especially for boys, and significantly better in the restrictive group at a later clinical investigation. Magnetic resonance imaging scans, performed at an average age of 12 years, showed that intracranial volume was substantially smaller in the liberal group compared with controls. When sex effects

  7. A Survey on Transfusion Status in Orthopedic Surgery at a Trauma Center

    Directory of Open Access Journals (Sweden)

    Mehran Soleimanha

    2016-01-01

    Full Text Available Background: Increased costs and mortality associated with inappropriate blood transfusions have led to investigations about blood request and blood transfusion techniques. We investigated the transfusion status in patients who underwent orthopedic surgery in Poursina Hospital (Rasht, Iran to optimizing blood usage and determine if a scheduled transfusion program for every orthopedic surgery could improve blood transfusion management. Method: In this descriptive-prospective study, all orthopedic surgeries in Poursina Hospital, Rasht, between April to June 2013 were reviewed. All patient information was recorded, including: demographics, type of surgery, hemoglobin level, cross-match test, duration of surgery, and blood loss, and transfusion. Based on the one-way ANOVA and independent samples test analysis, cross-match to transfusion ratio and transfusion possibility, the transfusion index, and maximal surgical blood order schedule were calculated to determine blood transfusion status. Results: Among 872 selected orthopedic surgery candidates, 318 of them were cross-matched and among those, 114 patients received a blood transfusion. In this study, the cross-match to transfusion ratio was 6.4, transfusion possibility 36.47%, transfusion index 0.6, and maximal surgical blood order schedule 0.9. Conclusion: We found that blood ordering was moderately higher than the standard; so it is highly recommended to focus on the knowledge of evidence based on transfusion and standard guidelines for blood transfusion to avoid over-ordering.

  8. Protocol for a national blood transfusion data warehouse from donor to recipient

    NARCIS (Netherlands)

    van Hoeven, Loan R; Hooftman, Babette H; Janssen, Mart P; de Bruijne, Martine C; de Vooght, Karen M K; Kemper, Peter; Koopman, Maria M W

    2016-01-01

    INTRODUCTION: Blood transfusion has health-related, economical and safety implications. In order to optimise the transfusion chain, comprehensive research data are needed. The Dutch Transfusion Data warehouse (DTD) project aims to establish a data warehouse where data from donors and transfusion

  9. Red cell alloimmunization in multi‑transfused patients with sickle cell ...

    African Journals Online (AJOL)

    2014-12-09

    Dec 9, 2014 ... Key words: Alloimmunization, blood transfusion, sickle cell anemia ... of blood transfusion reaction and demographic variables were completed for each .... adverse effects associated with transfusion that can lead to serious short‑ and ... status in both blood donors and transfusion recipients has reduced the ...

  10. Suppression of cholesterol synthesis in cultured fibroblasts from a patient with homozygous familial hypercholesterolemia by her own low density lipoprotein density fraction. A possible role of apolipoprotein E

    NARCIS (Netherlands)

    Havekes, L.; Vermeer, B.J.; Wit, E. de

    1980-01-01

    The suppression of cellular cholesterol synthesis by low density lipoprotein (LDL) from a normal and from a homozygous familial hypercholesterolemic subject was measured on normal fibroblasts and on fibroblasts derived from the same homozygous familial hypercholesterolemic patient. On normal

  11. Investigation of the status quo of massive blood transfusion in China and a synopsis of the proposed guidelines for massive blood transfusion.

    Science.gov (United States)

    Yang, Jiang-Cun; Wang, Qiu-Shi; Dang, Qian-Li; Sun, Yang; Xu, Cui-Xiang; Jin, Zhan-Kui; Ma, Ting; Liu, Jing

    2017-08-01

    The aim of this study was to provide an overview of massive transfusion in Chinese hospitals, identify the important indications for massive transfusion and corrective therapies based on clinical evidence and supporting experimental studies, and propose guidelines for the management of massive transfusion. This multiregion, multicenter retrospective study involved a Massive Blood Transfusion Coordination Group composed of 50 clinical experts specializing in blood transfusion, cardiac surgery, anesthesiology, obstetrics, general surgery, and medical statistics from 20 tertiary general hospitals across 5 regions in China. Data were collected for all patients who received ≥10 U red blood cell transfusion within 24 hours in the participating hospitals from January 1 2009 to December 31 2010, including patient demographics, pre-, peri-, and post-operative clinical characteristics, laboratory test results before, during, and after transfusion, and patient mortality at post-transfusion and discharge. We also designed an in vitro hemodilution model to investigate the changes of blood coagulation indices during massive transfusion and the correction of coagulopathy through supplement blood components under different hemodilutions. The experimental data in combination with the clinical evidence were used to determine the optimal proportion and timing for blood component supplementation during massive transfusion. Based on the findings from the present study, together with an extensive review of domestic and international transfusion-related literature and consensus feedback from the 50 experts, we drafted the guidelines on massive blood transfusion that will help Chinese hospitals to develop standardized protocols for massive blood transfusion.

  12. Presentation of Complex Homozygous Allele in ABCA4 Gene in a Patient with Retinitis Pigmentosa

    Directory of Open Access Journals (Sweden)

    Māreta Audere

    2015-01-01

    Full Text Available Retinitis pigmentosa is a degenerative retinal disease characterized by progressive photoreceptor damage, which causes loss of peripheral and night vision and the development of tunnel vision and may result in loss of central vision. This study describes a patient with retinitis pigmentosa caused by a mutation in the ABCA4 gene with complex allele c.1622T>C, p.L541P; c.3113C>T, p.A1038V in homozygous state.

  13. Effect of RBC concentrate transfusions on serum ferritin content in children with acute leukaemia.

    Science.gov (United States)

    Bebeshko, V G; Bruslova, E M; Tsvietkova, N M; Iatsemirskii, S M; Puchkareva, T I; Gonchar, L A; Krukovska, V V; Zelinska, A V; Mishchenko, L P

    2013-01-01

    To study the serum ferritin levels in children with acute leukemia, depending on the number of transfusions of RBC concentrate and period of disease. We studied the red blood count, serum iron and ferritin levels in 54 patients with acute leukemia before chemotherapy, at the time of a standardized treatment protocol, and after transfusions of RBC concentrates. In the debute of acute leukemia just before treatment lauch the serum ferritin in 81.5% of children was 2.3-2.5 higher than normal. The need for transfusion of RBC concentrates was higher under serum ferritin level exceeding 500 ng/mL. The association was established between ferritin content and age of the children, variant of acute leukemia and period of the disease. The level of serum ferritin can be used as a marker of ferrokinetic status for timely diagnosis of iron overload in children with acute leukemias and for application of treatment-and-prophylactic actions. Bebeshko V. G., Bruslova K. M., Cvjetkova N. M., Jacemyrskyj S. M., Pushkarova T. I., Gonchar L. O., Krukovska V. V., Zelinska A. V., Mishhenko L. P., 2013.

  14. Homozygous deletion and expression of PTEN and DMBT1 in human primary neuroblastoma and cell lines.

    Science.gov (United States)

    Muñoz, Jorge; Lázcoz, Paula; Inda, María Mar; Nistal, Manuel; Pestaña, Angel; Encío, Ignacio J; Castresana, Javier S

    2004-05-01

    Neuroblastoma is the most common pediatric solid tumor. Although many allelic imbalances have been described, a bona fide tumor suppressor gene for this disease has not been found yet. In our study, we analyzed 2 genes, PTEN and DMBT1, mapping 10q23.31 and 10q25.3-26.1, respectively, which have been found frequently altered in other kinds of neoplasms. We screened both genes for homozygous deletions in 45 primary neuroblastic tumors and 12 neuroblastoma cell lines. Expression of these genes in cell lines was assessed by RT-PCR analysis. We could detect 2 of 41 (5%) primary tumors harboring PTEN homozygous deletions. Three of 41 (7%) primary tumors and 2 of 12 cell lines presented homozygous losses at the g14 STS on the DMBT1 locus. All cell lines analyzed expressed PTEN, but lack of DMBT1 mRNA expression was detected in 2 of them. We tried to see whether epigenetic mechanisms, such as aberrant promoter hypermethylation, had any role in DMBT1 silencing. The 2 cell lines lacking DMBT1 expression were treated with 5-aza-2'-deoxycytidine; DMBT1 expression was restored in only one of them (MC-IXC). From our work, we can conclude that PTEN and DMBT1 seem to contribute to the development of a small fraction of neuroblastomas, and that promoter hypermethylation might have a role in DMBT1 gene silencing. Copyright 2004 Wiley-Liss, Inc.

  15. Perioperative transfusion threshold and ambulation after hip revision surgery

    DEFF Research Database (Denmark)

    Nielsen, Kamilla; Johansson, Pär I; Dahl, Benny

    2014-01-01

    BACKGROUND: Transfusion with red blood cells (RBC) may be needed during hip revision surgery but the appropriate haemoglobin concentration (Hb) threshold for transfusion has not been well established. We hypothesized that a higher transfusion threshold would improve ambulation after hip revision...... surgery. METHODS: The trial was registered at Clinicaltrials.gov ( NCT00906295). Sixty-six patients aged 18 years or older undergoing hip revision surgery were randomized to receive RBC at a Hb threshold of either 7.3 g/dL (restrictive group) or 8.9 g/dL (liberal group). Postoperative ambulation...... received RBC. CONCLUSIONS: A Hb transfusion threshold of 8.9 g/dL was associated with a statistically significantly faster TUG after hip revision surgery compared to a threshold of 7.3 g/dL but the clinical importance is questionable and the groups did not differ in Hb at the time of testing....

  16. Seroprevalence of transfusion transmissible infections (TTI), in first ...

    African Journals Online (AJOL)

    gerian government in trying to meet WHO set goals of 100% voluntary ... unit blood procurement and transfusion surveillance program at .... also in agreement with our current report17. ... organizations in the fight against new HIV infections.

  17. [Guidelines for blood transfusion teaching to medical laboratory technology students].

    Science.gov (United States)

    Moncharmont, P; Tourlourat, M; Fourcade, C; Julien, E; Peyrard, T; Cabaud, J-J

    2012-02-01

    The new French law about clinical laboratory medicine, the requirements of the ISO/CEI 15189 standard, the numerous abilities expected from the medical laboratory technologists and their involvement in blood bank management has led the working group "Recherche et démarche qualité" of the French Society of Blood Transfusion to initiate an inventory of blood transfusion teaching syllabus for medical laboratory technology students and to propose transfusion medicine teaching guidelines. Seven worksheets have been established for that purpose including red blood cell antigen typing and antibody screening, blood sampling in immunohaematology, automation, clinical practices, blood products, blood delivery and haemovigilance. These guidelines aim at contributing to the harmonization of transfusion medicine teaching and at providing objective elements to the medical laboratory managers regarding the practical and theoretical skills of theirs collaborators. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  18. Best practices for transfusion for patients with sickle cell disease

    Science.gov (United States)

    Wun, Ted; Hassell, Kathryn

    2010-01-01

    The β-globin gene mutation in sickle cell anemia results in anemia and repeated bouts of vascular occlusion. The cumulative effect of these vasocclusive events is progressive damage to many organs including the kidneys, lungs, and brain. The transfusion of red blood cells (RBC) can ameliorate many of these complications, but can be associated with both acute and chronic complications, including iron overload. The objective of the Best Practices in Transfusion Medicine for Patients with Sickle Cell Disease (SCD) Conference was to review the available published evidence and clinical experience surrounding the use of RBC transfusions for sickle cell disease by a panel of experts. The expert panel developed explicit clinical guidelines for the use of RBC in SCD patients. The panel also made recommendations for further research. A set of guidelines were produced for dissemination to pertinent stakeholders. If implemented, these clinical pathways have the potential to optimize the use of red blood cell transfusions in SCD.

  19. Transfusion and Risk of Infection in Canada: Update 2006

    Directory of Open Access Journals (Sweden)

    Noni MacDonald

    2006-01-01

    Full Text Available In Canada and other developed countries, many steps are taken to minimize the risk of infection from transfusion of blood or blood products (1. However, the infection risk can never be zero because these are biological products taken from living donors who are never 'germ free' (2. This is in contrast to drugs that can be manufactured de novo under sterile conditions in a laboratory. The present note provides an update on transfusion infection risks in Canada. It replaces the 2005 note (3 and may be helpful to practitioners in discussions with patients and parents for informed consent before blood or blood product administration. The changes in this note include new Canadian data on risk of adverse transfusion events (ATEs, including risk of bacterial infection. Transfusion-related acute lung injury and major allergic or anaphylactic reactions are more common than serious infections (4.

  20. Utilisation of blood transfusion service in north eastern Nigeria ...

    African Journals Online (AJOL)

    . However, people still die or remain at risk of transfusion-transmissible infections due to poor donor recruitment and selection, use of poorly screened blood and inappropriate use of blood and blood components. Objectives: To evaluate the ...

  1. Transfusion transmitted malaria in three major blood banks of ...

    African Journals Online (AJOL)

    USER

    2010-08-16

    Aug 16, 2010 ... Full Length Research Paper ... waste products from these tissues in the body. There is ... person. In transfusion, the recipients receive whole blood or parts .... under microscope using 100x objectives with oil immersion. Slides.

  2. Lower versus Higher Hemoglobin Threshold for Transfusion in Septic Shock

    DEFF Research Database (Denmark)

    Holst, Lars B; Haase, Nicolai; Wetterslev, Jørn

    2014-01-01

    BACKGROUND: Blood transfusions are frequently given to patients with septic shock. However, the benefits and harms of different hemoglobin thresholds for transfusion have not been established. METHODS: In this multicenter, parallel-group trial, we randomly assigned patients in the intensive care...... unit (ICU) who had septic shock and a hemoglobin concentration of 9 g per deciliter or less to receive 1 unit of leukoreduced red cells when the hemoglobin level was 7 g per deciliter or less (lower threshold) or when the level was 9 g per deciliter or less (higher threshold) during the ICU stay...... were similar in the two intervention groups. CONCLUSIONS: Among patients with septic shock, mortality at 90 days and rates of ischemic events and use of life support were similar among those assigned to blood transfusion at a higher hemoglobin threshold and those assigned to blood transfusion...

  3. audit of blood transfusion practices in the paediatric medical ward

    African Journals Online (AJOL)

    2013-01-01

    Jan 1, 2013 ... AUDIT OF BLOOD TRANSFUSION PRACTICES IN THE PAEDIATRIC MEDICAL WARD OF A TERTIARY ..... services and even where available, beneficiaries have ... due to lack of existence of quality assurance protocol.

  4. blood transfusion requirement during caesarean delivery: risk factors

    African Journals Online (AJOL)

    PLWAs are getting pregnant and may require operative delivery on account of Preventing ... abnormalities such as bone marrow depression, anaemia9 and ... operative clinical status up to 48 hours post-delivery or death. Transfusion rate was.

  5. A Survey on Transfusion Status in Orthopedic Surgery at a Trauma Center

    OpenAIRE

    Soleimanha, Mehran; Haghighi, Mohammad; Mirbolook, Ahmadreza; Sedighinejad, Abbas; Mardani-Kivi, Mohsen; Naderi-Nabi, Bahram; Chavoshi, Tahereh; Mehrnoosh, Mehrnoosh Ghandili

    2016-01-01

    Background: Increased costs and mortality associated with inappropriate blood transfusions have led to investigations about blood request and blood transfusion techniques. We investigated the transfusion status in patients who underwent orthopedic surgery in Poursina Hospital (Rasht, Iran) to optimizing blood usage and determine if a scheduled transfusion program for every orthopedic surgery could improve blood transfusion management. Method: In this descriptive-prospective study, all orthop...

  6. The Efficacy and Safety of Autologous Transfusion in Unilateral Total Knee Arthroplasty

    OpenAIRE

    Yoo, Moon-Jib; Park, Hee-Gon; Ryu, Jee-Won; Kim, Jeong-Sang

    2015-01-01

    Purpose Although allogeneic blood transfusion is the most common method of transfusion in total knee arthroplasty (TKA), there are reports showing significant decrease in the amount of allogeneic transfusion and incidence of side effects after combined use of autologous transfusion. The purpose of this study is to investigate the efficacy of using an autologous transfusion device in TKA. Materials and Methods Patients who underwent TKA at our institution from January 2003 to January 2014 were...

  7. Transfusion-related mortality after primary hip arthroplasty - an analysis of mechanisms and confounders

    DEFF Research Database (Denmark)

    Jans, O; Kehlet, H; Johansson, P I

    2012-01-01

    Background and Objectives Bleeding and postoperative anaemia after total hip arthroplasty (THA) may trigger transfusion of red blood cells (RBC). However, large observational studies have reported associations between RBC transfusion and increased postoperative morbidity and mortality. As major...... bleeding or severe postoperative anaemia is intrinsically linked with RBC transfusion, direct causality between transfusion and adverse outcomes remains unclear. This study aimed to identify possible relations between RBC transfusion, severe bleeding or anaemia and mortality in all patients who died...

  8. Efficiency and Cost Analysis of Cell Saver Auto Transfusion System in Total Knee Arthroplasty

    OpenAIRE

    Mustafa Gökhan Bilgili; Ersin Erçin; Cemal Kural; Altuğ Duramaz; Cevdet Avkan; Gökhan Peker; Serdar Hakan Başaran

    2014-01-01

    Background: Blood loss and replacement is still a controversial issue in major orthopaedic surgery. Allogenic blood transfusion may cause legal problems and concerns regarding the transmission of transfusion-related diseases. Cellsaver Systems (CSS) were developed as an alternative to allogenic transfusion but CSS transfusion may cause coagulation, infection and haemodynamic instability. Aims: Our aim was to analyse the efficiency and cost analysis of a cell saver auto-transfusion system ...

  9. [Perioperative transfusion of erythrocyte concentrates during elective surgery: introduction of a protocol for indications].

    Science.gov (United States)

    Ortega Andrés, M C; Abad Gosálbez, A; López Sánchez, P; Martínez Aparisi, A; Ortí Lucas, R; Aranda Arrufat, A; Madrid Rondón, V

    1999-10-01

    The aim of this paper is, first, to know the actual situation of the perioperatory red cell transfusion for elective surgery in our hospital. In a second phase and prospectively, we tested guidelines for red cell perioperatory transfusion in order to observe the change of transfusions. Then, we compared the results between the basal and postintervention periods. We performed an aleatory assay with two periods, basal and interventionist. Basal period: 151 patients undergoing elective surgery with perioperatory blood requested and general anesthesia. Intervention period: We applied a transfusion guidelines protocol for perioperatory red cell transfusion from the Hospital's Transfusion Committee, also a questionnaire to evaluate the medical indication; We studied 164 patients with clinical features like the basal period. Study/results variables: preoperative blood request, perioperatively transfusion, number of packed red-cell units transfused, crossmatch--to--transfusion ratio, haemoglobin level pre and posttransfusion. No significant drop of the cross match-transfusion ratio was observed after intervention. There is a slight reduction of the crossmatch--to--transfusion ratio, although these value is high (4.48), due to an increase of the transfusion keeping the percentage of appropriate transfusions. The most frequent reason (53%) of inadequate transfusion is the active bleeding. 1) The transfusional activity of the Marina Alta Hospital supposes approximately 17% of the request and 6% of the global transfusion. 2) The introduction of a protocol of perioperative transfusion instructions suppose a small decrease of the crossmatch--to--transfusion ratio, without statistical significance. This slight reduction is due to an increase of transfusion in the post-intervention period, since in this period there is a group of older age patients and with greater percentage of associated pathology. 3) The rate of appropriate transfusions in both periods is similar. 4) The

  10. The single unit transfusion in post partum hemorrhage: A new perspective.

    Science.gov (United States)

    Nama, Vivek; Karoshi, Mahantesh; Kakumani, V

    2006-01-01

    Every year, about 210 million women become pregnant. Postpartum hemorrhage (PPH) is one of the major complications of pregnancy, accounting for 14 million cases annually. Of these, it is estimated that around 140,000 women die, resulting in a case fatality rate of 1%. PPH is defined by WHO as a blood loss > or = 500 mls. Most instances of PPH occur suddenly and without warning even in women without any of the known risks for this condition. If women do not receive timely medical treatment, as is often the case in many parts of the world, death can occur within two hours. The chance of receiving a safe blood transfusion as part of the therapy for PPH varies enormously from country to country, depending on whether a safe blood transfusion program has been set up as a part of the national health policy. The increasing realization of the potential deleterious effects of blood transfusion, including exposure to HIV and other viral agents, has changed the practices that were previously acceptable for the transfusion of blood, as has the recent recognition of specific patients who will benefit from a single unit of blood. In countries with limited resources, where a majority of women have anemia at the onset of their pregnancies, the slightest deviation from normality during labor and/or delivery leading to excessive hemorrhage can put a women's life at risk. In these instances, the patient needs urgent resuscitation, stabilization and transfer to a nearby center. Available blood, preferably typed cross matched and screened for infections, should be given until the patient receives specific treatment. This is especially true in bled- out obstetrics patients, where one unit may make the difference between a near death state and the possibility of slow recovery and survival.

  11. Prion diseases are efficiently transmitted by blood transfusion in sheep

    OpenAIRE

    Houston, F.; McCutcheon, S.; Goldmann, W.; Chong, A.; Foster, J.; Siso, S.; Gonzalez, L.; Jeffrey, M.; Hunter, N.

    2008-01-01

    The emergence of variant Creutzfeld-Jakob disease, following on from the bovine spongiform encephalopathy (BSE) epidemic, led to concerns about the potential risk of iatrogenic transmission of disease by blood transfusion and the introduction of costly control measures to protect blood supplies. We previously reported preliminary data demonstrating the transmission of BSE and natural scrapie by blood transfusion in sheep. The final results of this experiment, reported here, give unexpectedly ...

  12. Pratique de la transfusion sanguine perioperatoire au Togo: etude ...

    African Journals Online (AJOL)

    But: relever les différents types, les indications, les modalités et les complications de la transfusion sanguine périopératoire. Patients et méthodes : étude prospective, descriptive multicentrique sur 6 mois (1er août 2013 au 31 janvier 2014) sur les transfusions sanguines faites durant la préparation pré opératoire, en per ...

  13. Best practices for transfusion for patients with sickle cell disease

    OpenAIRE

    Ted Wun; Kathryn Hassell

    2010-01-01

    The beta-globin gene mutation in sickle cell anemia results in anemia and repeated bouts of vascular occlusion. The cumulative effect of these vasocclusive events is progressive damage to many organs including the kidneys, lungs, and brain. The transfusion of red blood cells (RBC) can ameliorate many of these complications, but can be associated with both acute and chronic complications, including iron overload. The objective of the Best Practices in Transfusion Medicine for Patients with S...

  14. The Effects of Blood Transfusion on Delirium Incidence.

    Science.gov (United States)

    van der Zanden, Vera; Beishuizen, Sara J; Scholtens, Rikie M; de Jonghe, Annemarieke; de Rooij, Sophia E; van Munster, Barbara C

    2016-08-01

    Both anemia and blood transfusion could be precipitating factors for delirium; hence in postoperative patients with anemia at high risk for delirium, it is controversial whether transfusion is the best option. The aim of this study is to investigate the association of anemia and delirium and the role of blood transfusion within the multicomponent prevention strategy of delirium. We conducted a substudy of a multicenter randomized controlled trial. Four hundred fifteen patients aged 65 to 102 years old admitted for hip fracture surgery were enrolled. Delirium was assessed daily using criteria of the Diagnostic and Statistical Manual of Mental Disorders, fourth edition. Data on hemoglobin values and transfusion were collected from the electronic medical records. One hundred fifteen (32.5%) patients experienced delirium during hospitalization, 238 (57.5%) had a hemoglobin level ≤ 6.0 mmol/L (9.7 g/dL) at any time during hospitalization, and 140 (33.7%) received a blood transfusion. Anemia (a hemoglobin level ≤ 6.0 mmol/L [9.7 g/dL]) was associated with delirium (odds ratio, 1.81; 95% confidence interval, 1.15-2.86). Blood transfusion was a protective factor for delirium in patients with the lowest measured hemoglobin level ≤ 6.0 mmol/L (9.7 g/dL) (odds ratio, 0.26; 95% confidence interval, 0.10-0.70). Low hemoglobin level is associated with delirium, and receiving a blood transfusion is associated with a lower delirium incidence. It would be interesting to investigate the effect of blood transfusion as part of the multicomponent treatment of delirium in patients with anemia. Copyright © 2016 AMDA – The Society for Post-Acute and Long-Term Care Medicine. Published by Elsevier Inc. All rights reserved.

  15. Jehovah's Witnesses and autonomy: honouring the refusal of blood transfusions.

    Science.gov (United States)

    Bock, Gregory L

    2012-11-01

    This paper explores the scriptural and theological reasons given by Jehovah's Witnesses (JWs) to refuse blood transfusions. Julian Savulescu and Richard W Momeyer argue that informed consent should be based on rational beliefs and that the refusal of blood transfusions by JWs is irrational, but after examining the reasons given by JWs, I challenge the claim that JW beliefs are irrational. I also question whether we should give up the traditional notion of informed consent.

  16. [Transfusion and its specific problems in pediatrics and neonatology].

    Science.gov (United States)

    Pérel, Y; Runel, C; Huguenin, Y; Renesme, L; Aladjidi, N

    2017-09-01

    Principles of transfusion strategy have been used for neonates and children similar to adults. However, due to substantial discrepancies between physiology/pathology in children and in their adult counterparts, decisions, indications, and doses are different from those of adults, especially in neonates. Specific data and practice guidelines for blood product transfusion are reported owing to the experience of pediatrics and neonatology units and partners of the French Blood product bank. Copyright © 2017. Published by Elsevier SAS.

  17. Toward a patient-based paradigm for blood transfusion

    OpenAIRE

    Farrugia, Albert; Vamvakas, Eleftherios

    2014-01-01

    Albert Farrugia,1,2 Eleftherios Vamvakas31College of Medicine, Biology and Environment, Australian National University, Acton, ACT, Australia; 2Centre for Orthopaedic Research, Department of Surgery, Faculty of Medicine and Surgery, University of Western Australia, Perth, WA, Australia; 3Cedars-Sinai Medical Center, Los Angeles, CA, USAAbstract: The current "manufacturing paradigm" of transfusion practice has detached transfusion from the clinical environment. As an example,...

  18. Transfusion requirements in elective cardiopulmonary bypass surgery patients

    DEFF Research Database (Denmark)

    Sivapalan, Praleene; Bäck, Anne Caroline; Ostrowski, Sisse Rye

    2017-01-01

    Managing haemostasis in patients undergoing cardiopulmonary bypass (CPB) surgery remains a challenge. There is no established laboratory test to predict transfusion requirements in cardiac surgery. We investigated whether preoperative Thromboelastography (TEG) with Platelet Mapping Assay (PMA......) or Multiple Electrode Aggrometry (MEA) could predict transfusion requirements in patients undergoing elective coronary artery bypass grafting (CABG) or combined CABG with aortic or mitral valve replacement. We prospectively investigated 199 patients undergoing elective CABG or combined procedures. PMA and MEA...

  19. Limiting excessive postoperative blood transfusion after cardiac procedures. A review.

    OpenAIRE

    Ferraris, V A; Ferraris, S P

    1995-01-01

    Analysis of blood product use after cardiac operations reveals that a few patients ( 80%). The risk factors that predispose a minority of patients to excessive blood use include patient-related factors, transfusion practices, drug-related causes, and procedure-related factors. Multivariate studies suggest that patient age and red blood cell volume are independent patient-related variables that predict excessive blood product transfusion aft...

  20. Impact of perioperative blood transfusion on immune function and prognosis in colorectal cancer patients.

    Science.gov (United States)

    Qiu, Li; Wang, Dao-Rong; Zhang, Xiang-Yun; Gao, Shan; Li, Xiao-Xia; Sun, Gong-Ping; Lu, Xiao-Bo

    2016-04-01

    To investigate the impacts of perioperative blood transfusion on the immune function and prognosis in colorectal cancer (CC) patients. A retrospective analysis was conducted in 1404 CC patients, including 1223 sporadic colorectal cancer (SCC) patients and 181 hereditary colorectal cancer (HCC) patients. Among them, 701 SCC and 102 HCC patients received perioperative blood transfusion. The amount of T lymphocyte subsets and natural killer (NK) cells was measured. All patients received a 10-year follow-up and relapse, metastasis and curative conditions were recorded. In SCC group, mortality, local recurrence and distant metastasis rate of transfused patients were significantly higher than non-transfused patients (all P transfused patients than non-transfused patients (P = 0.002). SCC patients transfused with ≥3 U of blood had significantly higher mortality than patients transfused with blood transfusion in SCC and HCC patients (all P blood transfusion (P blood transfusion had markedly lower 10-year survival rates as compared with those who did not receive (both P transfused with ≥3 U of blood had remarkably lower survival rates compared with SCC patients transfused with blood transfusion could impact immune function, increased postoperative mortality, local recurrence rate and distant metastasis rate in CC patients; and survival rate of CC patients is negatively related to blood transfusion volume. Copyright © 2016. Published by Elsevier Ltd.

  1. Emerging risks and outcomes of blood transfusion in surgery.

    Science.gov (United States)

    Shander, Aryeh

    2004-01-01

    Prior to 1900, blood transfusions were fraught with danger and often caused more complications than the underlying disease. Discovery of the ABO compatibility system in the early twentieth century opened the modern era of blood transfusion, yet ABO incompatibility-as a result of clerical error-remains a significant threat to the recipient today. The risk of disease transmission now includes new and emerging agents, such as Trepanosoma cruzii and West Nile Virus (WNV), as well as other existing pathogens. Transfusion-related immunomodulation (TRIM) presents a further risk to recipient patients. Confounding these problems are shortages of safe blood and the accelerated rise in the cost of blood due to increased testing. Outcome data on transfusion therapy have not always been favorable, particularly in the areas of postoperative infection, systemic inflammatory response syndrome (SIRS), multiple organ failure (MOF), and mortality. Such data have generated extensive efforts to determine association versus underlying cause of post-transfusion complications. In addition, unprecedented global initiatives to minimize the use of allogeneic blood are on the way. Options may include, but are not limited to, the use of "blood substitutes," although validation of such products is still required. In the meantime, blood product conservation techniques should become part of routine transfusion medicine.

  2. [New viral risks in blood transfusion by 2016].

    Science.gov (United States)

    Pozzetto, B; Garraud, O

    2016-02-01

    Viral safety remains a major concern in transfusion of blood products. Over years, the control measures applied to blood products were made more and more sophisticated; however, the number of infectious agents, and notably of viruses, that can be transmitted by transfusion is increasing continuously. The aim of this review paper is to actualize that published in the same journal by the same authors in 2011 with more details on some of actual vs virtual viral threats that were identified recently in the field of blood transfusion. The main subjects that are covered successively concern the transmission via transfusion of hepatitis E virus, the frequency of transfusion transmitted arboviruses, transfusion at the time of the Ebola epidemics in West Africa, the debated role of Marseillevirus (giant viruses infecting amoebae and suspected to infect human blood latently), and, finally, the recent report of the identification in blood donors of a new member of the Flaviviridae family. The addition of these new viral risks to those already identified-partially controlled or not-pleads for the urgent need to move forward to considering inactivation of infectious agents in blood products. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  3. Oral Tranexamic Acid Reduces Transfusions in Total Knee Arthroplasty.

    Science.gov (United States)

    Perreault, Roger E; Fournier, Christine A; Mattingly, David A; Junghans, Richard P; Talmo, Carl T

    2017-10-01

    Tranexamic acid (TXA) reduces intraoperative blood loss and transfusions in patients undergoing total knee arthroplasty. Although numerous studies demonstrate the efficacy of intravenous and topical TXA in these patients, few demonstrate the effectiveness and appropriate dosing recommendations of oral formulations. A retrospective cohort study was performed to evaluate differences in transfusion requirements in patients undergoing primary unilateral total knee arthroplasty with either no TXA (n = 866), a single-dose of oral TXA (n = 157), or both preoperative and postoperative oral TXA (n = 1049). Secondary outcomes included postoperative hemoglobin drop, total units transfused, length of stay, drain output, and cell salvage volume. Transfusion rates decreased from 15.4% in the no-oral tranexamic acid (OTA) group to 9.6% in the single-dose OTA group (P < .001) and 7% in the 2-dose group (P < .001), with no difference in transfusion rates between the single- and 2-dose groups (P = .390). In addition, postoperative hemoglobin drop was reduced from 4.2 g/dL in the no-OTA group to 3.5 g/dL in the single-dose group (P < .01) and to 3.4 g/dL in the 2-dose group (P < .01), without a difference between the single- and 2-dose groups (P = .233). OTA reduces transfusions, with greater ease of administration and improved cost-effectiveness relative to other forms of delivery. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Zika virus and blood transfusion: the experience of French Polynesia.

    Science.gov (United States)

    Bierlaire, Damien; Mauguin, Sylvie; Broult, Julien; Musso, Didier

    2017-03-01

    Between October 2013 and March 2014, French Polynesia experienced the largest Zika virus (ZIKV) outbreak ever described before the emergence of ZIKV in the Americas in 2015. As arbovirus transfusion-transmitted (TT) infections have been previously reported, we hypothesized that transfusion of blood products could also transmit ZIKV. Mitigation strategies to prevent ZIKV-TT infections included nonspecific measures and the implementation of a laboratory developed ZIKV-specific nucleic acid testing (NAT) assay. Donor sera were tested in pools of 3 and constitutive sera of ZIKV-reactive pools were tested individually. Donor sera were tested prospectively and retrospectively. A posttransfusion follow-up of a patient transfused with ZIKV RNA-reactive blood products was implemented. NAT detected 42 blood donor sera as ZIKV RNA reactive of 1505 tested (2.8%). Thirty ZIKV RNA-reactive blood products collected before the implementation of NAT were transfused to 26 recipients. Posttransfusion investigations were conducted by the hemovigilance unit and data were available for 12 recipients. Symptomatic ZIKV-TT infections were not reported. Predonation screening of blood donors, postdonation information, products discard, and quarantine of blood products were not effective enough to prevent transfusion of ZIKV RNA-reactive blood products. ZIKV NAT was an effective measure once implemented to prevent transfusion of ZIKV RNA-reactive blood products but it is difficult to evaluate the effectiveness of this measure to prevent ZIKV-TT infection, which is a rare event. © 2017 AABB.

  5. Blood transfusion risks and alternative strategies in pediatric patients.

    Science.gov (United States)

    Lavoie, Josée

    2011-01-01

    Although the safety of the blood supply has been greatly improved, there still remain both infectious and noninfectious risks to the patient. The incidence of noninfectious transfusion reactions is greater than that of infectious complications. Furthermore, the mortality associated with noninfectious risks is significantly higher. In fact, noninfectious risks account for 87-100% of fatal complications of transfusions. It is concerning to note that the majority of pediatric reports relate to human error such as overtransfusion and lack of knowledge of special requirements in the neonatal age group. The second most frequent category is acute transfusion reactions, majority of which are allergic in nature. It is estimated that the incidence of adverse outcome is 18:100,000 red blood cells issued for children aged less than 18 years and 37:100,000 for infants. The comparable adult incidence is 13:100,000. In order to decrease the risks associated with transfusion of blood products, various blood-conservation strategies can be utilized. Modalities such as acute normovolemic hemodilution, hypervolemic hemodilution, deliberate hypotension, antifibrinolytics, intraoperative blood salvage, and autologous blood donation are discussed and the pediatric literature is reviewed. A discussion of transfusion triggers, and algorithms as well as current research into alternatives to blood transfusions concludes this review. © 2010 Blackwell Publishing Ltd.

  6. Improved survival of newborns receiving leukocyte transfusions for sepsis

    International Nuclear Information System (INIS)

    Cairo, M.S.; Rucker, R.; Bennetts, G.A.; Hicks, D.; Worcester, C.; Amlie, R.; Johnson, S.; Katz, J.

    1984-01-01

    To determine the role of polymorphonuclear (PMN) leukocyte transfusions in neonates with sepsis, 23 consecutive newborns were prospectively randomly selected during an 18-month period in a treatment plan to receive polymorphonuclear leukocyte transfusions with supportive care or supportive care alone. Thirteen neonates received transfusions every 12 hours for a total of five transfusions. Each transfusion consisting of 15 mL/kg of polymorphonuclear leukocytes was subjected to 1,500 rads of radiation. The polymorphonuclear leukocytes were obtained by continuous-flow centrifugation leukapheresis and contained 0.5 to 1.0 X 10(9) granulocytes per 15 mL with less than 10% lymphocytes. Positive findings on blood cultures were obtained in 14/23 patients and seven were randomly selected for each treatment group. Absolute granulocyte counts were less than 1,500/microL in 13 patients but tibial bone marrow examinations revealed that the neutrophil supply pool was depleted in only three patients. The survival was significantly greater in the treatment group compared with the group that did not receive transfusions

  7. Blood transfusion safety; current status and challenges in Nigeria

    Directory of Open Access Journals (Sweden)

    John C Aneke

    2017-01-01

    Full Text Available The attainment of blood transfusion safety in Nigeria (and probably the rest of Sub-Saharan Africa remains an uphill task due to a number of factors, ranging from shortage of blood, poor implementation of blood transfusion guidelines, infrastructural deficits to high prevalence of transfusion-transmissible infections (TTIs, particularly hepatitis and human immune deficiency viruses. We reviewed available data on blood transfusion practices and safety in Nigeria using the PubMed, PubMed Central, Google Scholar, and African Index Medicus search engines, through a combination of word and phrases relevant to the subject. The World Health Organization has been in the forefront of efforts to establish safe, available, and affordable blood transfusion services in most parts of Africa through encouraging adequate blood donor recruitment, donor blood testing, and collection as well developing strategies for the rational use of blood. Even though modest improvement has been recorded, particularly with regards to donor blood screening for common TTIs, considerable efforts are needed in the form of robust public enlightenment campaigns (on blood donation and continuous system improvement to drive the current transfusion practices in the country toward safety and self-sustenance.

  8. [Allergic transfusion reactions in a patient with multiple food allergies].

    Science.gov (United States)

    Strobel, E; Schöniger, M; Münz, M; Hiefinger-Schindlbeck, R

    2012-07-01

    A 13-year-old girl with an osteosarcoma was treated by surgery and chemotherapy. During three transfusions of apheresis platelet concentrates allergic reactions occurred, partly in spite of premedication with an antihistamine and a corticoid. As the patient declared to be allergic to some foods, in-vitro tests for allergen-specific IgE antibodies were performed and showed markedly positive results for specific IgE to carrot and celery, less so to hazelnut, peanut and a lot of other food antigens. The donor of one of the unsuitable platelet concentrates remembered when questioned, that he had eaten carrots and chocolate with hazelnuts during the evening before platelet donation. Two washed platelet concentrates were transfused without any problem. Furthermore, transfusions of nine red blood cell concentrates and one unit of virus-inactivated frozen pooled plasma were well tolerated. Patients should be asked for allergies previous to transfusions to be alert to allergic reactions in patients with a positive history of food or drug allergies. If premedication with antihistamines does not prevent severe allergic transfusion reactions, transfusion of washed platelet concentrates and of virus-inactivated frozen pooled plasma can be considered. © Georg Thieme Verlag KG Stuttgart · New York.

  9. The Ratio of Blood Products Transfused Affects Mortality in Patients Receiving Massive Transfusions at a Combat Support Hospital

    National Research Council Canada - National Science Library

    Borgman, Matthew A; Spinella, Philip C; Perkins, Jeremy G; Grathwohl, Kurt W; Repine, Thomas; Beekley, Alec C; Sebesta, James; Jenkins, Donald; Wade, Charles E; Holcomb, John B

    2007-01-01

    ...:1 ratio of plasma to red blood cell (RBC) units. Methods: We performed a retrospective chart review of 246 patients at a US Army combat support hospital, each of who received a massive transfusion...

  10. The impact of evaluating platelet transfusion need by platelet mass index on reducing the unnecessary transfusions in newborns.

    Science.gov (United States)

    Kahvecioglu, Dilek; Erdeve, Omer; Alan, Serdar; Cakir, Ufuk; Yildiz, Duran; Atasay, Begum; Arsan, Saadet

    2014-11-01

    Almost 95% of the platelet transfusions (PTs) conducted in the neonatal intensive care unit (NICU) are prophylactic transfusions. Guidelines for prophylactic PTs are based on platelet counts, but not on platelet functions. Nowadays, in order to reduce unnecessary transfusions, utilizing platelet mass index (PMI) was investigated. The aim of study is to find out whether PTs performed in our NICU during last 2 years were in accordance with the current guideline and to evaluate whether the frequency of PTs should be reduced if PMI was considered. Forty-three infants who received 96 prophylactic PTs were enrolled in the study. The guideline utilized in our NICU advocate keeping the platelet count: (a) >100 000 in pre/post-operative, (b) >50 000 in unstable and (c) >20 000 in stable patients. According to PMI criteria, PT should be performed if PMI: (a) platelet functions into account may yield lower transfusion rate, lower costs and better conservation of blood bank resources.

  11. Disseminated fusariosis and endogenous fungal endophthalmitis in acute lymphoblastic leukemia following platelet transfusion possibly due to transfusion-related immunomodulation

    Directory of Open Access Journals (Sweden)

    Yong Ku

    2011-11-01

    Full Text Available Abstract Background To report a case of disseminated fusariosis with endogenous endophthalmitis in a patient with acute lymphoblastic leukemia. Transfusion-associated immune modulation secondary to platelet transfusion could play an important role in the pathophysiology of this case. Case Presentation A 9 year-old male with acute lymphoblastic leukemia complicated by pancytopenia and disseminated Intravascular coagulation was given platelet transfusion. He developed disseminated fusariosis and was referred to the ophthalmology team for right endogenous endophthalmitis. The infection was controlled with aggressive systemic and intravitreal antifungals. Conclusion Patients with acute lymphoblastic leukemia are predisposed to endogenous fungal endophthalmitis. Transfusion-associated immune modulation may further increase host susceptibility to such opportunistic infections.

  12. Platelet transfusions can induce transplantation tolerance

    International Nuclear Information System (INIS)

    Claas, F.H.J.; Blankert, J.J.; Ruigrok, R.; Moerel, L.

    1982-01-01

    Recently it was shown that the induction of antibodies against the H-2 antigens after multiple platelet transfusions is due to leukocyte contamination of the platelet suspensions. Pure platelets are not able to induce a primary antibody response. The present study shows that the platelets, however, can be recognized by the immune system but they induce a suppression of the response. Mice pretreated with donor platelets will not give a primary antibody response upon a subsequent injection of donor leukocytes and the survival of donor skin grafts will be prolonged. Similar results were obtained by pretreatment of the responder mice with heat-treated donor leukocytes. Furthermore, repeated injections of heat-treated leukocytes of the recipient strain to the donor before bone marrow grafting, will graft-versus-host mortality. The recipient mice were irradiated and received spleen cell injections. These data show that cells which have only class I antigens on their surface and no activating class II antigens, induce a suppression of the response against class I antigens. (Auth.)

  13. Rational approach to transfusion in liver transplantation.

    Science.gov (United States)

    Saner, Fuat H; Abeysundara, Lasitha; Hartmann, Matthias; Mallett, Susan V

    2018-03-01

    For over 50 years patients with liver cirrhosis were considered to be at markedly increased risk of bleeding. This dogma was seemingly supported by abnormalities in standard laboratory tests (SLTs), such as the prothrombin time, that were interpreted as indicating a bleeding diathesis. However, publications from the last decade have revealed SLTs to be poor predictors of bleeding and it is now understood that stable patients with cirrhosis have a rebalanced haemostatic system and preserved thrombin generation. Viscoelastic tests (VETs), such as ROTEM® or TEG™ allow dynamic assessment of the entire coagulation process and provide a better illustration of the interactions between pro- and anticoagulants as well as platelets. Despite their documented success in reducing transfusion rates in liver transplantation more than 30 years ago, the adoption of VETs has been met with some resistance and has only recently gained significant momentum. Bleeding risk should be assessed in every patient undergoing invasive intervention and must consider markers of disease severity, underlying coagulation incompetence, anaemia and surgical factors. The recognition that bleeding in this patient cohort is predominantly linked to mechanistic factors such as portal hypertension, rather than primary coagulopathy, has led to a paradigm shift in their perioperative management. Cognizant of their detrimental effect, the use of large volumes of fresh frozen plasma to correct derangements in SLTs has given way to more refined haemostatic management with specific factor concentrates guided by VETs, coupled with measures to minimize portal venous pressure and meticulous surgical hemostasis.

  14. Impact of antigenic exposures and role of molecular blood grouping in enhancing transfusion safety in chronically transfused thalassemics.

    Science.gov (United States)

    Makroo, Raj Nath; Agrawal, Soma; Bhatia, Aakanksha; Chowdhry, Mohit; Thakur, Uday Kumar

    2016-01-01

    Red cell alloimmunization is an acknowledged complication of blood transfusion. Current transfusion practices for thalassemia do not cater to this risk. Serological phenotyping is usually not reliable in these cases unless performed before the first transfusion. Under such circumstances, molecular blood grouping is an effective alternative. To perform molecular blood group genotyping in chronically transfused thalassemia patients and assess the risk of antigenic exposure and incidence of alloimmunization with current transfusion protocols. Molecular blood group genotyping was performed for 47 chronically transfused thalassemia patients. Their 1-year transfusion records were retrieved to assess the antigenic exposure and the frequency thereof. Of 47 patients, 6 were already alloimmunized (3 with anti-E and 3 with anti-K) and were receiving the corresponding antigen negative units. We observed that random selection of ABO and Rh D matched units resulted in 57.7% ±8.26% chance of Rh and Kell phenotype matching also. Forty-four patients had received one or more antigenic exposures at least once. The 6 already alloimmunized patients were further exposed to antigens other than the ones they were immunized to. During the study period, only one patient developed an alloantibody, anti-E with exposure to antigens C (92%) and/or E (32%) at each transfusion. Several factors apart from mere antigen exposure may influence the development of alloimmunization as most of our patients received antigenic exposures but not alloimmunized. Our data provide an impetus for future large-scale studies to understand the development of alloimmunization in such patients.

  15. Impact of antigenic exposures and role of molecular blood grouping in enhancing transfusion safety in chronically transfused thalassemics

    Directory of Open Access Journals (Sweden)

    Raj Nath Makroo

    2016-01-01

    Full Text Available Background: Red cell alloimmunization is an acknowledged complication of blood transfusion. Current transfusion practices for thalassemia do not cater to this risk. Serological phenotyping is usually not reliable in these cases unless performed before the first transfusion. Under such circumstances, molecular blood grouping is an effective alternative. Aim: To perform molecular blood group genotyping in chronically transfused thalassemia patients and assess the risk of antigenic exposure and incidence of alloimmunization with current transfusion protocols. Materials and Methods: Molecular blood group genotyping was performed for 47 chronically transfused thalassemia patients. Their 1-year transfusion records were retrieved to assess the antigenic exposure and the frequency thereof. Results: Of 47 patients, 6 were already alloimmunized (3 with anti-E and 3 with anti-K and were receiving the corresponding antigen negative units. We observed that random selection of ABO and Rh D matched units resulted in 57.7% ±8.26% chance of Rh and Kell phenotype matching also. Forty-four patients had received one or more antigenic exposures at least once. The 6 already alloimmunized patients were further exposed to antigens other than the ones they were immunized to. During the study period, only one patient developed an alloantibody, anti-E with exposure to antigens C (92% and/or E (32% at each transfusion. Conclusion: Several factors apart from mere antigen exposure may influence the development of alloimmunization as most of our patients received antigenic exposures but not alloimmunized. Our data provide an impetus for future large-scale studies to understand the development of alloimmunization in such patients.

  16. Study on effectiveness of transfusion program in thalassemia major patients receiving multiple blood transfusions at a transfusion centre in Western India

    Directory of Open Access Journals (Sweden)

    Shah Neeraj

    2010-01-01

    Full Text Available Background : Children suffering from beta-thalassemia major require repeated blood transfusions which may be associated with dangers like iron overload and contraction of infections such as HIV, HCV, and HBsAg which ultimately curtail their life span. On the other hand, inadequate transfusions lead to severe anemia and general fatigue and debility. Materials and Methods: Data were obtained from 142 beta-thalassemia major patients aged 3 years or more receiving regular blood transfusions at a transfusion centre in Western India from 1 April 2009 to 30 June 2009. The clinical data and laboratory results were subsequently analyzed. Results: Of the 142 patients, 76 (53.5% were undertransfused (mean Hb <10 gm%. 96 (67% of the patients were taking some form of chelation therapy but out of them only 2 (2% were adequately chelated (S. ferritin <1000 ng/ml. 5 (3.5% of the patients were known diabetics on insulin therapy. 103 (72% of the patients were retarded in terms of growth. The prevalence of transfusion-transmitted infections (TTIs such as HCV, HIV, and HBsAg was respectively 45%, 2%, and 2%, with the prevalence of HCV being significantly more than the general population. The HCV prevalence showed positive correlation with the age of the patients and with the total no of blood transfusions received. As many as 15% (6 out of 40 children who were born on or after 2002 were HCV positive despite the blood they received being subjected to screening for HCV. Conclusions: The study suggests the need to step up the transfusions to achieve hemoglobin goal of 10 gm% (as per the moderate transfusion regimen and also to institute urgent and effective chelation measures with the aim of keeping serum ferritin levels below 1000 ng/ml to avoid the systemic effects of iron overload. In addition, strict monitoring of the children for endocrinopathy and other systemic effects of iron overload should be done. Rigid implementation of quality control measures for the

  17. Monitoring compliance with transfusion guidelines in hospital departments by electronic data capture

    Science.gov (United States)

    Norgaard, Astrid; de Lichtenberg, Trine Honnens; Nielsen, Jens; Johansson, Pär I.

    2014-01-01

    Background The practice of transfusing red blood cells is still liberal in some centres suggesting a lack of compliance with guidelines recommending transfusion of red blood cells at haemoglobin levels of 6–8 g/dL in the non-bleeding patient. Few databases provide ongoing feedback of data on pre-transfusion haemoglobin levels at the departmental level. In a tertiary care hospital, no such data were produced before this study. Our aim was to establish a Patient Blood Management database based on electronic data capture in order to monitor compliance with transfusion guidelines at departmental and hospital levels. Materials and methods Hospital data on admissions, diagnoses and surgical procedures were used to define the populations of patients. Data on haemoglobin measurements and red blood cell transfusions were used to calculate pre-transfusion haemoglobin, percentage of transfused patients and transfusion volumes. Results The model dataset include 33,587 admissions, of which 10% had received at least one unit of red blood cells. Haemoglobin measurements preceded 96.7% of the units transfused. The median pre-transfusion haemoglobin was 8.9 g/dL (interquartile range 8.2–9.7) at the hospital level. In only 6.5% of the cases, transfusion was initiated at 7.3 g/dL or lower as recommended by the Danish national transfusion guideline. In 27% of the cases, transfusion was initiated when the haemoglobin level was 9.3 g/dL or higher, which is not recommended. A median of two units was transfused per transfusion episode and per hospital admission. Transfusion practice was more liberal in surgical and intensive care units than in medical departments. Discussion We described pre-transfusion haemoglobin levels, transfusion rates and volumes at hospital and departmental levels, and in surgical subpopulations. Initial data revealed an extensive liberal practice and low compliance with national transfusion guidelines, and identified wards in need of intervention. PMID

  18. Red blood cell transfusion for people undergoing hip fracture surgery.

    Science.gov (United States)

    Brunskill, Susan J; Millette, Sarah L; Shokoohi, Ali; Pulford, E C; Doree, Carolyn; Murphy, Michael F; Stanworth, Simon

    2015-04-21

    The incidence of hip fracture is increasing and it is more common with increasing age. Surgery is used for almost all hip fractures. Blood loss occurs as a consequence of both the fracture and the surgery and thus red blood cell transfusion is frequently used. However, red blood cell transfusion is not without risks. Therefore, it is important to identify the evidence for the effective and safe use of red blood cell transfusion in people with hip fracture. To assess the effects (benefits and harms) of red blood cell transfusion in people undergoing surgery for hip fracture. We searched the Cochrane Bone, Joint and Muscle Trauma Group Specialised Register (31 October 2014), the Cochrane Central Register of Controlled Trials (The Cochrane Library, 2014, Issue 10), MEDLINE (January 1946 to 20 November 2014), EMBASE (January 1974 to 20 November 2014), CINAHL (January 1982 to 20 November 2014), British Nursing Index Database (January 1992 to 20 November 2014), the Systematic Review Initiative's Transfusion Evidence Library, PubMed for e-publications, various other databases and ongoing trial registers. Randomised controlled trials comparing red blood cell transfusion versus no transfusion or an alternative to transfusion, different transfusion protocols or different transfusion thresholds in people undergoing surgery for hip fracture. Three review authors independently assessed each study's risk of bias and extracted data using a study-specific form. We pooled data where there was homogeneity in the trial comparisons and the timing of outcome measurement. We used GRADE criteria to assess the quality (low, moderate or high) of the evidence for each outcome. We included six trials (2722 participants): all compared two thresholds for red blood cell transfusion: a 'liberal' strategy to maintain a haemoglobin concentration of usually 10 g/dL versus a more 'restrictive' strategy based on symptoms of anaemia or a lower haemoglobin concentration, usually 8 g/dL. The exact

  19. Incidence of blood transfusion requirement and factors associated with transfusion following liver lobectomy in dogs and cats: 72 cases (2007-2015).

    Science.gov (United States)

    Hanson, Kayla R; Pigott, Armi M; J Linklater, Andrew K

    2017-10-15

    OBJECTIVE To determine the incidence of blood transfusion, mortality rate, and factors associated with transfusion in dogs and cats undergoing liver lobectomy. DESIGN Retrospective case series. ANIMALS 63 client-owned dogs and 9-client owned cats that underwent liver lobectomy at a specialty veterinary practice from August 2007 through June 2015. PROCEDURES Medical records were reviewed and data extracted regarding dog and cat signalment, hematologic test results before and after surgery, surgical method, number and identity of lobes removed, concurrent surgical procedures, hemoabdomen detected during surgery, incidence of blood transfusion, and survival to hospital discharge (for calculation of mortality rate). Variables were compared between patients that did and did not require transfusion. RESULTS 11 of 63 (17%) dogs and 4 of 9 cats required a blood transfusion. Mortality rate was 8% for dogs and 22% for cats. Pre- and postoperative PCV and plasma total solids concentration were significantly lower and mortality rate significantly higher in dogs requiring transfusion than in dogs not requiring transfusion. Postoperative PCV was significantly lower in cats requiring transfusion than in cats not requiring transfusion. No significant differences in any other variable were identified between dogs and cats requiring versus not requiring transfusion. CONCLUSIONS AND CLINICAL RELEVANCE Dogs and cats undergoing liver lobectomy had a high requirement for blood transfusion, and a higher requirement for transfusion should be anticipated in dogs with perioperative anemia and cats with postoperative anemia. Veterinarians performing liver lobectomies in dogs and cats should have blood products readily available.

  20. Blood transfusion at the time of the First World War--practice and promise at the birth of transfusion medicine.

    Science.gov (United States)

    Boulton, F; Roberts, D J

    2014-12-01

    The centenary of the start of the First World War has stirred considerable interest in the political, social, military and human factors of the time and how they interacted to produce and sustain the material and human destruction in the 4 years of the war and beyond. Medical practice may appear distant and static and perhaps seems to have been somewhat ineffectual in the face of so much trauma and in the light of the enormous advances in medicine and surgery over the last century. However, this is an illusion of time and of course medical, surgical and psychiatric knowledge and procedures were developing rapidly at the time and the war years accelerated implementation of many important advances. Transfusion practice lay at the heart of resuscitation, and although direct transfusion from donor to recipient was still used, Geoffrey Keynes from Britain, Oswald Robertson from America and his namesake Lawrence Bruce Robertson from Canada, developed methods for indirect transfusion from donor to recipient by storing blood in bottles and also blood-banking that laid the foundation of modern transfusion medicine. This review explores the historical setting behind the development of blood transfusion up to the start of the First World War and on how they progressed during the war and afterwards. A fresh look may renew interest in how a novel medical speciality responded to the needs of war and of post-war society. © 2015 British Blood Transfusion Society.

  1. Identification of low frequency anti-erythrocyte antibodies in chronically transfused patient with beta-thalassemia: a case report

    Directory of Open Access Journals (Sweden)

    Ana Rúbia Magalhães Ferreira

    2015-02-01

    Full Text Available The rate of erythrocyte alloimmunization in tranfusion-dependent patients can reach 50%, although the frequency of clinically relevant antibodies in transfused patients is not fully known, it is estimated that about 1% of patients are sensitized to each unit of transfused RBCs. The aim of this study is to report the case of  an 11-year-old girl with ?-thalassemia major, chronically transfused, which was detected in pre-transfusion protocol, the presence of two rare anti-erythrocyte antibodies: anti-Colton b (anti-Cob and anti-Lutheran 14 (anti-Lu14. To survey the clinical and laboratory patient history, research records filed in the archives of the university hospital in which the patient is monitored system was performed. The phenotyping erythrocyte in multitransfused patients is essential to decrease the risk of complications due to alloimmunization and estimate the availability of compatible blood. Thus, the report of this case may contribute to increase knowledge about of the real frequency of uncommon anti-erythrocyte antibodies in thalassemic patients.

  2. Allogeneic blood transfusion and prognosis following total hip replacement: a population-based follow up study

    DEFF Research Database (Denmark)

    Pedersen, Alma B; Mehnert, Frank; Overgaard, Søren

    2009-01-01

    BACKGROUND: Allogeneic red blood cell transfusion is frequently used in total hip replacement surgery (THR). However, data on the prognosis of transfused patients are sparse. In this study we compared the risk of complications following THR in transfused and non-transfused patients. METHODS......: A population-based follow-up study was performed using data from medical databases in Denmark. We identified 28,087 primary THR procedures performed from 1999 to 2007, from which we computed a propensity score for red blood cell transfusion based on detailed data on patient-, procedure-, and hospital......-related characteristics. We were able to match 2,254 transfused with 2,254 non-transfused THR patients using the propensity score. RESULTS: Of the 28,087 THR patients, 9,063 (32.3%) received at least one red blood cell transfusion within 8 days of surgery. Transfused patients had higher 90-day mortality compared...

  3. Platelet transfusion in chemotherapy patients: comparison of the effect of intravenous infusion pumps versus gravity transfusion.

    Science.gov (United States)

    Meess, A

    2015-01-01

    Platelet concentrates are given to patients suffering with severe thrombocytopenia usually by a gravity transfusion procedure. Increasing patient numbers that are in need of this treatment increase the pressure on hospital staff and space. In order to combat time issues, the use of medical devices such as intravenous infusion pumps are thought to be beneficial for time and simultaneously for safety in transfusion practices. By using infusion pumps, platelet concentrates can be transfused in less time and provide accurate volume measurements. Manufacturers of infusion pumps claim that these devices are safe to be used for blood products including platelet concentrates. However, published studies were performed on older models and newer devices are on the market now. The purpose of this study is to evaluate infusion pumps, which are claimed to be suitable for blood products and to investigate the impact the pumps had on platelets. Furthermore, the study revealed if the intravenous infusion pumps are safe to be used for platelet transfusion as claimed by manufacturers. A simulated transfusion was performed using the Carefusion Alaris GP Plus volumetric pump and Fresenius Kabi Volumat Agilia infusion pump. Samples were taken from expired platelet concentrates before and after passage through the pump. All samples were investigated for full blood count that included platelet count, mean platelet volume (MPV), platelet distribution width (PDW) and a plateletcrit (PCT). The samples were then centrifuged to achieve platelet-poor plasma and then tested for lactate dehydrogenase (LDH). A power calculation performed on the statistical power analysis program G*power indicated a requirement of 82 samples for a power of 80%. Statistical analysis was performed with the IBM SPSS statistic software. A paired sample t-test was used to calculate mean, standard deviation and P values for the infusion pumps used. The Wilcoxon Signed Rank Test was used to evaluate results that had a non

  4. Physical mapping of chromosome 8p22 markers and their homozygous deletion in a metastatic prostate cancer

    Energy Technology Data Exchange (ETDEWEB)

    Bova, G.S.; Pin, S.S.; Isaacs, W.B. [Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States)]|[Brady Urological Institute, Baltimore, MD (United States)] [and others

    1996-07-01

    Numerous studies have implicated the short arm of chromosome 8 as the site of one or more tumor suppressor genes inactivated in carcinogenesis of the prostate, colon, lung, and liver. Previously, we identified a homozygous deletion on chromosome 8p22 in a metastatic prostate cancer. To map this homozygous deletion physically, long-range restriction mapping was performed using yeast artificial chromosomes (YACs) spanning approximately 2 Mb of chromosome band 8p22. Subcloned genomic DNA and cDNA probes isolated by hybrid capture from these YACs were mapped in relation to one another, reinforcing map integrity. Mapped single-copy probes from the region were then applied to DNA isolated from a metastatic prostate cancer containing a chromosome 8p22 homozygous deletion and indicated that its deletion spans 730-970 kb. Candidate genes PRLTS (PDGF-receptor {beta}-like tumor suppressor) and CTSB (cathepsin B) are located outside the region of homozygous deletion. Genethon marker D8S549 is located approximately at the center of this region of homozygous deletion. Two new microsatellite polymorphisms, D8S1991 and D8S1992, also located within the region of homozygous deletion on chromosome 8p22, are described. Physical mapping places cosmid CI8-2644 telomeric to MSR (macrophage scavenger receptor), the reverse of a previously published map, altering the interpretation of published deletion studies. This work should prove helpful in the identification of candidate tumor suppressor genes in this region. 47 refs., 5 figs., 1 tab.

  5. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea.

    Science.gov (United States)

    Rim, Yeri Alice; Park, Narae; Nam, Yoojun; Ham, Dong-Sik; Kim, Ji-Won; Ha, Hye-Yeong; Jung, Ji-Won; Jung, Seung Min; Baek, In Cheol; Kim, Su-Yeon; Kim, Tai-Gyu; Song, Jihwan; Lee, Jennifer; Park, Sung-Hwan; Chung, Nak-Gyun; Yoon, Kun-Ho; Ju, Ji Hyeon

    2018-03-01

    Induced pluripotent stem cells (iPSCs) can be generated by introducing several factors into mature somatic cells. Banking of iPSCs can lead to wider application for treatment and research. In an economical view, it is important to store cells that can cover a high percentage of the population. Therefore, the use of homozygous human leukocyte antigen-iPSCs (HLA-iPSCs) is thought as a potential candidate for effective iPSC banking system for further clinical use. We screened the database stored in the Catholic Hematopoietic Stem Cell Bank of Korea and sorted the most frequent homozygous HLA types of the South Korean population. Blood cells with the selected homozygous HLA types were obtained and transferred to the GMP facility in the Catholic Institute of Cell Therapy. Cells were reprogrammed to iPSCs inside the facility and went through several quality controls. As a result, a total of 13 homozygous GMP-grade iPSC lines were obtained in the facility. The generated iPSCs showed high pluripotency and normal karyotype after reprogramming. Five HLA-homozygous iPSCs had the type that was included in the top five most frequent HLA types. Homozygous HLA-iPSCs can open a new opportunity for further application of iPSCs in clinical research and therapy. Copyright © 2017 John Wiley & Sons, Ltd.

  6. [Situation and perspectives of blood transfusion in Togo].

    Science.gov (United States)

    Ségbéna, A Y; Fétéké, L; Bikandou, B; Awitala, E J; Koura, A G

    2009-01-01

    We report the successive stages of the reorganization of the blood transfusion sector in Togo. The starting point was the elaboration of the national policy of blood transfusion, then the adoption of a decree organizing the sector as well the various decree of application, particularly that related to transfusion good practices. The current policy recommends two poles of qualification of the blood ant its components and the creation of six stations of collection and distribution attached to these poles. The reorganization started with the rehabilitation of the National Blood Transfusion Centre (CNTS) in Lomé. If the problem of human resources is alarming, especially the availability of hemobiologists, the rehabilitation allowed the increase of the blood collection passing from 5272 donations in December 2003 to 18 164 in December 2008. However, the requirement of blood products is satisfied in 50% in all the country. In 2003, 24% of the blood products were rejected for positive viral markers against 8.37% in 2008 in relation with the improvement of blood safety. Efforts must be continued to reinforce it in the CNTS and to make a better selection of the donors at the Regional Blood Transfusion Centre (CRTS) de Sokodé. The analysis of the weak points of the sector (human resource insufficiency, shortage of the blood products, blood safety) made it possible to indicate solutions to improve the sector of blood transfusion sector. Future outcome is funded in the blood transfusion safety development project in Togo financed by the Agence française de développement (AFD, French development agency).

  7. Platelet transfusion practice in a tertiary care hospital

    International Nuclear Information System (INIS)

    Rehman, Z.; Alam, M.

    2002-01-01

    Objective: Pakistan is a developing country where platelet concentrates are prepared and administered to patients in only a few large centres of the country. A study was designed for appraisal of the current situation and to review the progress made so far. Design: It was a prospective, non-interventional study. Place and duration of study: The study was conducted at PNS Shifa, Karachi from January, 1995 to December, 1998. Subjects and Methods: During this study 588 random donor platelet concentrates were transfused to 66 patients 148 occasions. Random donor platelet concentrates were prepared by fractionation of whole blood using triple blood collecting bags. Pre-transfusion and one hour posttransfusion platelet counts of the patients were done. The efficacy of the platelet transfusion was monitored by noting the clinical response as well as doing one hour posttransfusion corrected counts increment (CCI).Results: On 114 (77%) occasions platelets were transfused prophylactically and 34 (23%) times therapeutically to stop major bleeding episodes. The mean pre-transfusion platelet count varied from 15.5 x 10/sup 9/1 to 28.5 x 10/sup 9/l in different clinical conditions. On average, 4 random donor platelet concentrates were administered on each occasion. The best response was observed in patients of aplastic anaemia and worst in cases of disseminated intravascular coagulation (DIC). Conclusion: Platelet concentrates administration was inappropriate in significant number of patients, therefore, each hospital should form transfusion committee to review transfusion practices guidelines for blood components usage and compliance to these guidelines by the clinicians. (author)

  8. ABO incompatibility hemolytic disease following exchange transfusion 96 newborn

    Directory of Open Access Journals (Sweden)

    Khatami S.F

    2007-09-01

    Full Text Available Background: ABO incompatibility hemolytic disease of the newborn is a common cause of clinical jaundice and causes two-thirds of the hemolytic disease in newborns. This study was undertaken to determine the frequency of ABO incompatibility hemolytic disease and its complications in newborns undergoing exchange transfusion.Methods: This prospective and descriptive study was performed in jaundiced newborn infants during a three-year period. Inclusion criteria were: maternal blood type O, newborn blood type A or B, rising indirect hyperbilirubinemia in the first two days of life, positive immunohematologic test for newborns and exchange transfusion. Exclusion criteria were: incomplete information, other accompanying diseases that induce hyperbilirubinemia. All newborn infants received phototherapy before and after exchange transfusion. We did not use intravenous immunoglobulin, hemoxygenase inhibitor drugs and blood products before exchange transfusion.Results: Double-volume exchange transfusion via umbilical cord catheter was performed in 96 patients, 19 (20% of whom suffered from ABO incompatibility. Of these 19 newborns, two-thirds (13 were preterm infants. The minimum level of serum bilirubin was 10 mg/dl and the maximum serum bilirubin level was 35 mg/dl. In six patients (32% serum bilirubin levels were >25mg/dl. The most common blood group was type A for newborns. Immunohematologic tests were positive in 84% of the mothers. ABO incompatibility hemolytic disease was the fourth and second most common reasons for blood exchange transfusion in preterm and term infants, respectively. Laboratory complications were more common than clinical complications. The etiology of 48% of the alloimmunization and 42% of the hemolytic disease in these newborns was ABO incompatibility.Conclusions: Mothers with blood group O and newborns with blood group A or B with positive immunohematologic tests in first hours of life are at high risk for hemolytic disease

  9. Neonatal outcome after fetal anemia managed by intrauterine transfusion.

    Science.gov (United States)

    Garabedian, C; Rakza, T; Thomas, D; Wibaut, B; Vaast, P; Subtil, D; Houfflin-Debarge, V

    2015-11-01

    In-utero transfusion is now well under control and improves the survival of foetuses monitored for fetal anemia with a survival rate of more than 80 %. The aim was to evaluate short-term neonatal outcome after fetal severe anemia managed by intrauterine transfusions. We did a retrospective study of all neonates born after management of severe fetal anemia (n = 93) between January 1999 and January 2013 in our regional center. The two main causes of anemia were maternal red blood cell alloimmunization (N = 81, 87 %) and Parvovirus B19 infection (N = 10, 10.8 %). In the alloimmunization group, phototherapy was implemented in 85.2 % of cases with a maximum level of bilirubin of 114.4 ± 60.7 (mg/dl). Transfusion and exchange transfusion were, respectively, required in 51.9 % and in 34.6 % of cases. One neonate presented a convulsive episode, and we observed three neonatal deaths. In the parvovirus group, none of the child had anemia at birth and no management was necessary. Contemporary management of Rhesus disease is associated with encouraging neonatal outcomes. In case of Parvovirus infection, no specific management is necessary at. But, in all cases of fetal anemia, children should be followed up with particular attention to neurologic development. • In-utero transfusion is now well under control and improves the survival of fetuses monitored for fetal anemia. • Limited studies are available on the effect of IUT on postnatal outcome in infants with a history of fetal anemia. What is New: • Contemporary management of severe Rhesus disease is associated with encouraging neonatal outcomes. • The majority of infants can be managed with phototherapy and a limited number of top-up transfusions and exchange transfusions. In case of Parvovirus infection, the short-term neonatal outcome is excellent.

  10. Lesão pulmonar aguda associada à transfusão Transfusion-related acute lung injury

    Directory of Open Access Journals (Sweden)

    Antonio Fabron Junior

    2007-04-01

    Full Text Available Lesão pulmonar aguda associada à transfusão (transfusion-related acute lung injury, TRALI é uma complicação clínica grave relacionada à transfusão de hemocomponentes que contêm plasma. Recentemente, TRALI foi considerada a principal causa de morte associada à transfusão nos Estados Unidos e Reino Unido. É manifestada tipicamente por dispnéia, hipoxemia, hipotensão, febre e edema pulmonar não cardiogênico, que ocorre durante ou dentro de 6 h, após completada a transfusão. Embora o exato mecanismo não tenha sido totalmente elucidado, postula-se que TRALI esteja associada à infusão de anticorpos contra antígenos leucocitários (classes I ou II ou aloantígenos específicos de neutrófilos e a mediadores biologicamente ativos presentes em componentes celulares estocados. A maioria dos doadores implicados em casos da TRALI são mulheres multíparas. TRALI, além de ser pouco diagnosticada, pode ainda ser confundida com outras situações de insuficiência respiratória aguda. Um melhor conhecimento sobre TRALI pode ser crucial na prevenção e tratamento desta severa complicação transfusional.Transfusion-related acute lung injury (TRALI is a serious clinical syndrome associated with the transfusion of plasma-containing blood components. Recently, TRALI has come to be recognized as the leading cause of transfusion-related death in the United States and United Kingdom. This complication typically presents as shortness of breath, hypoxemia, hypotension, fever and noncardiogeneic pulmonary edema, all occurring during or within 6 h after transfusion. Although the mechanism of TRALI has not been fully elucidated, it has been associated with human leukocyte antigen antibodies (class I, class II or neutrophil alloantigens and with biologically active mediators in stored cellular blood components. Most of the donors implicated in cases of TRALI are multiparous women. Rarely diagnosed, TRALI can be confused with other causes of acute

  11. Laser for the treatment of twin to twin transfusion syndrome Laser na terapia da síndrome de transfusão feto-fetal

    Directory of Open Access Journals (Sweden)

    Denise Araújo Lapa Pedreira

    2005-12-01

    ície placentária. Aqueles vasos identificados como responsáveis pela transfusão foram coagulados através do laser. O procedimento combina a ultra-sonografia e a fetoscopia, no que se denomina uma abordagem sono-endoscópica (FETENDO. RESULTADOS: Dentre as oito gestações avaliadas, o procedimento foi realizado em cinco casos (10 fetos. Todos os fetos sobreviveram por um período mínimo de cinco semanas após a cirurgia. Na evolução, oito fetos nasceram vivos e cinco sobreviveram ao período neonatal. No seguimento pós-natal de 18 meses, todos os cinco estão vivos e bem, tendo atualmente uma idade média de 10,6 meses. A sobrevida geral foi de 50%, sendo que em três gestações, pelo menos um feto sobreviveu. CONCLUSÕES: A fetoscopia com laser é atualmente considerada "gold-standard" no tratamento da STT. No entanto, a técnica é sofisticada e depende de treinamento adequado. Nosso serviço é o primeiro do país a oferecer esta técnica cirúrgica e nossos índices de sucesso se comparam aos índices mundiais.

  12. Homozygous PMS2 deletion causes a severe colorectal cancer and multiple adenoma phenotype without extraintestinal cancer.

    Science.gov (United States)

    Will, Olivia; Carvajal-Carmona, Luis G; Gorman, Patricia; Howarth, Kimberley M; Jones, Angela M; Polanco-Echeverry, Guadalupe M; Chinaleong, Jo-Anne; Günther, Thomas; Silver, Andrew; Clark, Susan K; Tomlinson, Ian

    2007-02-01

    We report a patient of Indian descent with parental consanguinity, who developed 10 carcinomas and 35 adenomatous polyps at age 23 and duodenal adenocarcinoma at age 25. He also had dysmorphic features, mental retardation, and café-au-lait spots but no brain tumor. We aimed to establish his molecular diagnosis. Germ-line screening for APC and MYH/MUTYH mutations was normal as was immunohistochemistry for MLH1 and MSH2 proteins. Investigation by array-comparative genomic hybridization revealed deletion of a small region on chromosome 7. Using polymerase chain reaction, this region was refined to a 400-kilobase deletion, which included exons 9-15 of the PMS2 gene, and all coding regions of oncomodulin, TRIAD3, and FSCN1. The deletion was confirmed as homozygous, and both parents were carriers. Immunohistochemistry showed absent PMS2 expression in all tumors and normal tissue. Most tumors showed microsatellite instability, more marked at dinucleotide than mononucleotide repeats. The tumors harbored no somatic mutations in APC, BRAF, AXIN2, or beta-catenin, but KRAS2 and TGFBR2 mutations were found. Our patient represents a novel phenotype for homozygous PMS2 mutation and perhaps the most severe colorectal cancer phenotype-in terms of numbers of malignancies at an early age-described to date. PMS2 mutations-and perhaps other homozygous mismatch repair mutations-should be considered in any patient presenting with multiple gastrointestinal tumors, since our patient could not be distinguished clinically from cases with attenuated familial adenomatous polyposis or MUTYH-associated polyposis.

  13. Homozygous familial hypercholesterolemia (HoFH in Germany: an epidemiological survey

    Directory of Open Access Journals (Sweden)

    Walzer S

    2013-05-01

    Full Text Available S Walzer,1 K Travers,2 S Rieder,3 E Erazo-Fischer,3 D Matusiewicz41MArS Market Access and Pricing Strategy UG (hb, Weil am Rhein, Germany; 2United Biosource Corporation, Lexington, USA; 3Alcimed GmbH, Cologne, Germany; 4Institute for Health Care Management and Research, Faculty of Economics and Business Administration, University of Duisburg-Essen, Essen, GermanyIntroduction: In Europe a disease is recognized as rare if less than 1 in 2000 people suffer from the specific disease. In patients with familial homozygous hypercholesterolemia (HoFH the accumulation of low-density lipoprotein cholesterol (LDL-C leads to generalized atherosclerosis due to an insufficient functioning of the LDL-C receptors. Patients die early sometimes even in the mid-30s, from myocardial infarction or stroke. For the German population, insufficient epidemiological evidence exists.Methods: A systematic literature search in EMBASE and Medline was performed in conjunction with a targeted manual search for epidemiological HoFH studies. Additionally a nationwide survey was conducted in Germany in all identified apheresis- and lipid centers. The purpose of the survey was the validation of the systematic literature search results based on empirical (practice data.Results: In total 961 publications were found, 874 were excluded based on pre-defined exclusion criteria leaving only 87 for further review. After review of the identified abstracts (n = 87 23 publications were identified as epidemiological studies. Only one publication was found which reported a prevalence of 1:1,000,000. The qualitative survey among 187 physicians in Germany also revealed a low prevalence: 95 HoFH patients were identified in 35 centers.Conclusion: The estimated frequency of homozygous familial hypercholesterolemia patients in Germany is around 95 (1:860,000 and the disease should be recognized as rare according to the definition of the European Medical Agency.Keywords: epidemiology, homozygous

  14. Corneal arcus and xanthomas in homozygous familial hypercholesterolemia: First report from China

    Directory of Open Access Journals (Sweden)

    Xin Meng

    2013-01-01

    Full Text Available We report the case of a 12-year-old male who developed corneal arcus and multiple skin lesions with a 10-year history of xanthomas. The lesions appeared over his fingers, hands, elbows, knees, buttocks and feet. Laboratory studies showed a total serum cholesterol level of 752.1 mg/dL; a triglyceride level of 96.6 mg/dL; a low-density lipoprotein cholesterol level of 661.3 mg/dL. Findings were consistent with homozygous familial hypercholesterolemia. To our knowledge, this is the first such case to be reported from China.

  15. Spinal motor neuron involvement in a patient with homozygous PRUNE mutation.

    Science.gov (United States)

    Iacomino, Michele; Fiorillo, Chiara; Torella, Annalaura; Severino, Mariasavina; Broda, Paolo; Romano, Catia; Falsaperla, Raffaele; Pozzolini, Giulia; Minetti, Carlo; Striano, Pasquale; Nigro, Vincenzo; Zara, Federico

    2018-05-01

    In the last few years, whole exome sequencing (WES) allowed the identification of PRUNE mutations in patients featuring a complex neurological phenotype characterized by severe neurodevelopmental delay, microcephaly, epilepsy, optic atrophy, and brain or cerebellar atrophy. We describe an additional patient with homozygous PRUNE mutation who presented with spinal muscular atrophy phenotype, in addition to the already known brain developmental disorder. This novel feature expands the clinical consequences of PRUNE mutations and allow to converge PRUNE syndrome with previous descriptions of neurodevelopmental/neurodegenerative disorders linked to altered microtubule dynamics. Copyright © 2017 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  16. Factors influencing plasma transfusion practices in paediatric intensive care units around the world

    DEFF Research Database (Denmark)

    Karam, Oliver; Demaret, Pierre; Duhamel, Alain

    2017-01-01

    investigators of the 101 participating centres, in February 2016. Four areas were explored: beliefs regarding plasma transfusion, patients' case-mix in each unit, unit's characteristics, and local blood product transfusion policies and processes. RESULTS: The response rate was 82% (83/101). 43...... transfusions (P = 0·02 and P = 0·04, respectively). Case-mix, centre characteristics or local transfusion services were not identified as significant relevant factors. CONCLUSION: Factors influencing plasma transfusion practices reflect beliefs about indications and the efficacy of transfusion...

  17. Unexpected Anemia and Reticulocytopenia in an Adolescent With Sickle Cell Anemia Receiving Chronic Transfusion Therapy.

    Science.gov (United States)

    Blauel, Emily R; Grossmann, Lily T; Vissa, Madhav; Miller, Scott T

    2015-10-01

    In a patient with sickle cell disease receiving chronic transfusion, exacerbation of anemia with reticulocytopenia must prompt consideration of a delayed hemolytic transfusion reaction with hyperhemolysis, as further transfusion may worsen this condition; definitive diagnosis is sometimes difficult. Anemia evolving during parvovirus B19-induced erythroid hypoplasia (transient aplastic crisis) should be attenuated in chronic transfusion patients due to superior survival of transfused over endogenous red blood cells. A 16-year-old with sickle cell disease receiving chronic transfusion of modified intensity (goal to maintain hemoglobin S<50%) who developed symptomatic anemia with reticulocytopenia was later shown to have had transient aplastic crisis.

  18. Transfusão de plaquetas: do empirismo ao embasamento científico Platelet transfusion: from empiricism to scientific evidence

    Directory of Open Access Journals (Sweden)

    Aline A. Ferreira

    2010-01-01

    Full Text Available Despite major advances in Brazilian blood transfusion therapy with a growing number of scientific publications, an increased number of repeat donors and a decline in serological ineligibility, a lack of conformity in the application of pre-transfusion tests that may compromise transfusion safety is still observed at transfusion agencies in the fringes of the blood transfusion therapy system. Additionally, although high rates of platelet transfusion refractoriness and significant rates of alloimmunization have been demonstrated in the international literature, few Brazilian centers have been concerned with the study of platelet alloimmunization and even fewer centers have evaluated the efficacy of platelet concentrate transfusion. As more than one million Brazilians, including many repeat blood donors, are listed in the National Bone Marrow Donor Registry (Redome, why not grant transfusion therapy services access to the HLA typing of these blood and marrow donors after obtaining their consent? And why not make use of the Redome data to evaluate the HLA compatibility of donors for alloimmunized patients who are candidates for bone marrow transfusion and who have already been typed? These measures, together with the identification of ABO and HPA antigens, will permit a complete assessment of platelet immunology, will guarantee the transfusion safety of this blood component, and will put Brazil at the same level as the so-called developed countries in terms of transfusion medicine.

  19. [Blood transfusion in emergency settings: French military health service experience].

    Science.gov (United States)

    Sailliol, A; Ausset, S; Peytel, E

    2010-12-01

    Blood transfusion is required in a number of emergency settings and the French military health service (FMHS) has issued specific guidelines for the treatment of war casualties. These guidelines take into account European standards and laws, NATO standards, and also public sentiment regarding transfusion. These guidelines reflect a determination to control the process and to avoid the improvisation frequently associated with wartime transfusion. The evolution in warfare (terrorism and bombing more frequent than gunshot) and the wide use of body armor have deeply changed the clinical presentation of war injuries. These now involve the extremities in 80% of cases, with extensive tissue damage and heavy blood loss. The FMHS recommends that war casualties with hemorrhagic shock be brought quickly to a medical treatment facility (MTF) after first-line treatment applied through buddy aid or by medics. In the MTF, before an early Medevac, a damage control surgery will be performed, with resuscitation using freeze-dried plasma, red blood cells and fresh whole blood. The French military blood bank is responsible for blood product supply, training and medical advice regarding transfusion therapy during wartime, as well as hemovigilance. All transfusion therapy practices are periodically assessed but research on whole blood pathogen reduction is being conducted in order to reduce the residual infectious risk associated with this product. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  20. Decreasing Prevalence of Transfusion Transmitted Infection in Indian Scenario

    Directory of Open Access Journals (Sweden)

    Tulika Chandra

    2014-01-01

    Full Text Available Transfusion transmitted infections are major problem associated with blood transfusion. Accurate estimates of risk of TTIs are essential for monitoring the safety of blood supply and evaluating the efficacy of currently employed screening procedures. The present study was carried out to assess the percentage of voluntary donors and replacement donors and to find out prevalence and changing trends of various TTIs blood donors in recent years. A study was carried out on blood units of voluntary and replacement donors which were collected from January 2008 to December 2012. On screening of 180,371 replacement units, seropositivity of transfusion transmitted disease in replacement donors was 0.15% in HIV, 1.67% in hepatitis B surface antigen, 0.49% in hepatitis C virus, 0.01% in VDRL, and 0.009% in malaria. Of 11,977 voluntary units, seropositivity of transfusion transmitted disease in voluntary donors was 0.08% in HIV, 0.24% in hepatitis B surface antigen, 0.001% in hepatitis C virus, 0.008% in VDRL (sexually transmitted disease, and 0.01% in malaria. From results it has been concluded that prevalence of transfusion transmitted infection (HIV, HBV, HCV, VDRL, and malaria was more in replacement donors in comparison to voluntary donors. Extensive donor selection and screening procedures will help in improving the blood safety.

  1. Predictive factors for homologous transfusion during paediatric scoliosis surgery.

    Science.gov (United States)

    Dupuis, Claire; Michelet, Daphné; Hilly, Julie; Diallo, Thierno; Vidal, Christophe; Delivet, Honorine; Nivoche, Yves; Mazda, Keyvan; Dahmani, Souhayl

    2015-12-01

    Blood saving strategies during paediatric spinal surgery often include recombinant erythropoietin (rEPO) and antifibrinolytic therapy (AFT). The goal of this study was to investigate additional preventive factors involved in the risk of blood transfusion. This prospective study was designed with the aim of identifying factors associated with the perioperative (defined as the intraoperative and the first postoperative day) probability of homologous red cell transfusion during scoliosis surgery in children operated during a one year period in our institution. The predictors analysed were: age, weight less than the 3rd percentile (W 255 minutes. ROC analysis for the latter model found an area under the curve of 0.9 (95% confidence interval: 0.8-0.97). The accuracy of the model was 92.3% (97.4% for non-transfusion and 69.2% for transfusion). Multivariate sensitivity analysis excluding patients with no preoperative administration of EPO found similar results. The current results indicate that optimising nutritional status might prevent allogenic blood transfusion and requires further investigation. Copyright © 2015 Société française d’anesthésie et de réanimation (Sfar). Published by Elsevier Masson SAS. All rights reserved.

  2. Placental Transfusion and Cardiovascular Instability in the Preterm Infant

    Directory of Open Access Journals (Sweden)

    Zbynĕk Straňák

    2018-02-01

    Full Text Available Postnatal adaptation in preterm newborn comprises complex physiological processes that involve significant changes in the circulatory and respiratory system. Increasing hemoglobin level and blood volume following placental transfusion may be of importance in enhancing arterial oxygen content, increasing cardiac output, and improving oxygen delivery. The European consensus on resuscitation of preterm infants recommends delayed cord clamping (DCC for at least 60 s to promote placenta–fetal transfusion in uncompromised neonates. Recently, published meta-analyses suggest that DCC is associated with fewer infants requiring transfusions for anemia, a lower incidence of intraventricular hemorrhage, and lower risk for necrotizing enterocolitis. Umbilical cord milking (UCM has the potential to avoid some disadvantages associated with DCC including the increased risk of hypothermia or delay in commencing manual ventilation. UCM represents an active form of blood transfer from placenta to neonate and may have some advantages over DCC. Moreover, both methods are associated with improvement in hemodynamic parameters and blood pressure within first hours after delivery compared to immediate cord clamping. Placental transfusion appears to be beneficial for the preterm uncompromised infant. Further studies are needed to evaluate simultaneous placental transfusion with resuscitation of deteriorating neonates. It would be of great interest for future research to investigate advantages of this approach further and to assess its impact on neonatal outcomes, particularly in extremely preterm infants.

  3. The use of big data in transfusion medicine.

    Science.gov (United States)

    Pendry, K

    2015-06-01

    'Big data' refers to the huge quantities of digital information now available that describe much of human activity. The science of data management and analysis is rapidly developing to enable organisations to convert data into useful information and knowledge. Electronic health records and new developments in Pathology Informatics now support the collection of 'big laboratory and clinical data', and these digital innovations are now being applied to transfusion medicine. To use big data effectively, we must address concerns about confidentiality and the need for a change in culture and practice, remove barriers to adopting common operating systems and data standards and ensure the safe and secure storage of sensitive personal information. In the UK, the aim is to formulate a single set of data and standards for communicating test results and so enable pathology data to contribute to national datasets. In transfusion, big data has been used for benchmarking, detection of transfusion-related complications, determining patterns of blood use and definition of blood order schedules for surgery. More generally, rapidly available information can monitor compliance with key performance indicators for patient blood management and inventory management leading to better patient care and reduced use of blood. The challenges of enabling reliable systems and analysis of big data and securing funding in the restrictive financial climate are formidable, but not insurmountable. The promise is that digital information will soon improve the implementation of best practice in transfusion medicine and patient blood management globally. © 2015 British Blood Transfusion Society.

  4. Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.

    Science.gov (United States)

    Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe

    2010-09-16

    The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.

  5. Open Craniosynostosis Surgery: Effect of Early Intraoperative Blood Transfusion on Postoperative Course.

    Science.gov (United States)

    Kurnik, Nicole M; Bristol, Ruth; Maneri, Celia; Singhal, Raj; Singh, Davinder J

    2017-07-01

    Correction of craniosynostosis can result in blood loss when the patient already has physiologic anemia. The aim of this study was to determine whether patients benefit from early blood transfusion and whether the timing of blood transfusion affects metabolic disturbances and the postoperative course. In this retrospective review, 71 patients who underwent open calvarial vault remodeling for correction of craniosynostosis were separated into 2 groups according to whether they received blood transfusions early (within the first 30 minutes of surgery) or later (after the first 30 minutes of surgery). Patients were further separated into nonsyndromic and syndromic cohorts. Tracked variables included hemoglobin, hematocrit, arterial blood gas values, lactate level, length of stay, estimated blood loss, and amount of blood transfused in the operating room, amount transfused postoperatively, and total amount transfused.Among all patients, the early transfusion group had a higher hemoglobin nadir overall and received less postoperative blood. Within the nonsyndromic cohort, the early transfusion group had a higher estimated blood loss and received more transfused blood. In the syndromic cohort, the early transfusion group had a hemoglobin nadir that was significantly higher than in the late transfusion group and a lower estimated blood loss, shorter pediatric intensive care unit stay, and less postoperative blood transfused. Syndromic patients also received significantly more blood overall. For syndromic patients undergoing open calvarial vault remodeling, transfusion within the first 30 minutes of surgery should be considered.

  6. Hospital Blood Transfusion Patterns During Major Noncardiac Surgery and Surgical Mortality.

    Science.gov (United States)

    Chen, Alicia; Trivedi, Amal N; Jiang, Lan; Vezeridis, Michael; Henderson, William G; Wu, Wen-Chih

    2015-08-01

    We retrospectively examined intraoperative blood transfusion patterns at US veteran's hospitals through description of national patterns of intraoperative blood transfusion by indication for transfusion in the elderly; assessment of temporal trends in the use of intraoperative blood transfusion; and relationship of institutional use of intraoperative blood transfusion to hospital 30-day risk-adjusted postoperative mortality rates.Limited data exist on the pattern of intraoperative blood transfusion by indication for transfusion at the hospital level, and the relationship between intraoperative transfusion rates and institutional surgical outcomes.Using the Department of Veterans Affairs Surgical Quality Improvement Program database, we assigned 424,015 major noncardiac operations among elderly patients (≥65 years) in 117 veteran's hospitals, from 1997 to 2009, into groups based on indication for intraoperative blood transfusion according to literature and clinical guidelines. We then examined institutional variations and temporal trends in surgical blood use based on these indications, and the relationship between these institutional patterns of transfusion and 30-day postoperative mortality.Intraoperative transfusion occurred in 38,056/424,015 operations (9.0%). Among the 64,390 operations with an indication for transfusion, there was wide variation (median: 49.9%, range: 8.7%-76.2%) in hospital transfusion rates, a yearly decline in transfusion rates (average 1.0%/y), and an inverse relationship between hospital intraoperative transfusion rates and hospital 30-day risk-adjusted mortality (adjusted mortality of 9.8 ± 2.8% vs 8.3 ± 2.1% for lowest and highest tertiles of hospital transfusion rates, respectively, P = 0.02). In contrast, for the 225,782 operations with no indication for transfusion, there was little variation in hospital transfusion rates (median 0.7%, range: 0%-3.4%), no meaningful temporal change in transfusion (average 0.0%/y), and

  7. Homozygous LIPE mutation in siblings with multiple symmetric lipomatosis, partial lipodystrophy, and myopathy.

    Science.gov (United States)

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

    2017-01-01

    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Increased yield of heterologous viral glycoprotein in the seeds of homozygous transgenic tobacco plants cultivated underground.

    Science.gov (United States)

    Tackaberry, Eilleen S; Prior, Fiona; Bell, Margaret; Tocchi, Monika; Porter, Suzanne; Mehic, Jelica; Ganz, Peter R; Sardana, Ravinder; Altosaar, Illimar; Dudani, Anil

    2003-06-01

    The use of transgenic plants in the production of recombinant proteins for human therapy, including subunit vaccines, is being investigated to evaluate the efficacy and safety of these emerging biopharmaceutical products. We have previously shown that synthesis of recombinant glycoprotein B (gB) of human cytomegalovirus can be targeted to seeds of transgenic tobacco when directed by the rice glutelin 3 promoter, with gB retaining critical features of immunological reactivity (E.S. Tackaberry et al. 1999. Vaccine, 17: 3020-3029). Here, we report development of second generation transgenic plant lines (T1) homozygous for the transgene. Twenty progeny plants from two lines (A23T(1)-2 and A24T(1)-3) were grown underground in an environmentally contained mine shaft. Based on yields of gB in their seeds, the A23T(1)-2 line was then selected for scale-up in the same facility. Analyses of mature seeds by ELISA showedthat gB specific activity in A23T(1)-2 seeds was over 30-fold greater than the best T0 plants from the same transformation series, representing 1.07% total seed protein. These data demonstrate stable inheritance, an absence of transgene inactivation, and enhanced levels of gB expression in a homozygous second generation plant line. They also provide evidence for the suitability of using this environmentally secure facility to grow transgenic plants producing therapeutic biopharmaceuticals.

  9. A novel homozygous variant in the SMOC1 gene underlying Waardenburg anophthalmia syndrome.

    Science.gov (United States)

    Ullah, Asmat; Umair, Muhammad; Ahmad, Farooq; Muhammad, Dost; Basit, Sulman; Ahmad, Wasim

    2017-01-01

    Waardenburg anophthalmia syndrome (WAS), also known as ophthalmo-acromelic syndrome or anophthalmia-syndactyly, is a rare congenital disorder that segregates in an autosomal recessive pattern. Clinical features of the syndrome include malformation of the eyes and the skeleton. Mostly, WAS is caused by mutations in the SMOC-1 gene. The present report describes a large consanguineous family of Pakistani origin segregating Waardenburg anophthalmia syndrome in an autosomal recessive pattern. Genotyping followed by Sanger sequencing was performed to search for a candidate gene. SNP genotyping using AffymetrixGeneChip Human Mapping 250K Nsp array established a single homozygous region among affected members on chromosome 14q23.1-q24.3 harboring the SMOC1 gene. Sequencing of the gene revealed a novel homozygous missense mutation (c.812G>A; p.Cys271Tyr) in the family. This is the first report of Waardenburg anophthalmia syndrome caused by a SMOC1 variant in a Pakistani population. The mutation identified in the present investigation extends the body of evidence implicating the gene SMOC-1 in causing WAS.

  10. A novel homozygous truncating GNAT1 mutation implicated in retinal degeneration.

    Science.gov (United States)

    Carrigan, Matthew; Duignan, Emma; Humphries, Pete; Palfi, Arpad; Kenna, Paul F; Farrar, G Jane

    2016-04-01

    The GNAT1 gene encodes the α subunit of the rod transducin protein, a key element in the rod phototransduction cascade. Variants in GNAT1 have been implicated in stationary night-blindness in the past, but unlike other proteins in the same pathway, it has not previously been implicated in retinitis pigmentosa. A panel of 182 retinopathy-associated genes was sequenced to locate disease-causing mutations in patients with inherited retinopathies. Sequencing revealed a novel homozygous truncating mutation in the GNAT1 gene in a patient with significant pigmentary disturbance and constriction of visual fields, a presentation consistent with retinitis pigmentosa. This is the first report of a patient homozygous for a complete loss-of-function GNAT1 mutation. The clinical data from this patient provide definitive evidence of retinitis pigmentosa with late onset in addition to the lifelong night-blindness that would be expected from a lack of transducin function. These data suggest that some truncating GNAT1 variants can indeed cause a recessive, mild, late-onset retinal degeneration in human beings rather than just stationary night-blindness as reported previously, with notable similarities to the phenotype of the Gnat1 knockout mouse. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  11. Homozygous YME1L1 mutation causes mitochondriopathy with optic atrophy and mitochondrial network fragmentation.

    Science.gov (United States)

    Hartmann, Bianca; Wai, Timothy; Hu, Hao; MacVicar, Thomas; Musante, Luciana; Fischer-Zirnsak, Björn; Stenzel, Werner; Gräf, Ralph; van den Heuvel, Lambert; Ropers, Hans-Hilger; Wienker, Thomas F; Hübner, Christoph; Langer, Thomas; Kaindl, Angela M

    2016-08-06

    Mitochondriopathies often present clinically as multisystemic disorders of primarily high-energy consuming organs. Assembly, turnover, and surveillance of mitochondrial proteins are essential for mitochondrial function and a key task of AAA family members of metalloproteases. We identified a homozygous mutation in the nuclear encoded mitochondrial escape 1-like 1 gene YME1L1, member of the AAA protease family, as a cause of a novel mitochondriopathy in a consanguineous pedigree of Saudi Arabian descent. The homozygous missense mutation, located in a highly conserved region in the mitochondrial pre-sequence, inhibits cleavage of YME1L1 by the mitochondrial processing peptidase, which culminates in the rapid degradation of YME1L1 precursor protein. Impaired YME1L1 function causes a proliferation defect and mitochondrial network fragmentation due to abnormal processing of OPA1. Our results identify mutations in YME1L1 as a cause of a mitochondriopathy with optic nerve atrophy highlighting the importance of YME1L1 for mitochondrial functionality in humans.

  12. Homozygous YME1L1 mutation causes mitochondriopathy with optic atrophy and mitochondrial network fragmentation

    Science.gov (United States)

    Hartmann, Bianca; Wai, Timothy; Hu, Hao; MacVicar, Thomas; Musante, Luciana; Fischer-Zirnsak, Björn; Stenzel, Werner; Gräf, Ralph; van den Heuvel, Lambert; Ropers, Hans-Hilger; Wienker, Thomas F; Hübner, Christoph; Langer, Thomas; Kaindl, Angela M

    2016-01-01

    Mitochondriopathies often present clinically as multisystemic disorders of primarily high-energy consuming organs. Assembly, turnover, and surveillance of mitochondrial proteins are essential for mitochondrial function and a key task of AAA family members of metalloproteases. We identified a homozygous mutation in the nuclear encoded mitochondrial escape 1-like 1 gene YME1L1, member of the AAA protease family, as a cause of a novel mitochondriopathy in a consanguineous pedigree of Saudi Arabian descent. The homozygous missense mutation, located in a highly conserved region in the mitochondrial pre-sequence, inhibits cleavage of YME1L1 by the mitochondrial processing peptidase, which culminates in the rapid degradation of YME1L1 precursor protein. Impaired YME1L1 function causes a proliferation defect and mitochondrial network fragmentation due to abnormal processing of OPA1. Our results identify mutations in YME1L1 as a cause of a mitochondriopathy with optic nerve atrophy highlighting the importance of YME1L1 for mitochondrial functionality in humans. DOI: http://dx.doi.org/10.7554/eLife.16078.001 PMID:27495975

  13. A homozygous MYO7A mutation associated to Usher syndrome and unilateral auditory neuropathy spectrum disorder.

    Science.gov (United States)

    Xia, Hong; Hu, Pengzhi; Yuan, Lamei; Xiong, Wei; Xu, Hongbo; Yi, Junhui; Yang, Zhijian; Deng, Xiong; Guo, Yi; Deng, Hao

    2017-10-01

    Usher syndrome (USH) is an autosomal recessive disorder characterized by sensorineural hearing loss, progressive visual loss and night blindness due to retinitis pigmentosa (RP), with or without vestibular dysfunction. The purpose of this study was to detect the causative gene in a consanguineous Chinese family with USH. A c.3696_3706del (p.R1232Sfs*72) variant in the myosin VIIa gene (MYO7A) was identified in the homozygous state by exome sequencing. The co‑segregation of the MYO7A c.3696_3706del variant with the phenotype of deafness and progressive visual loss in the USH family was confirmed by Sanger sequencing. The variant was absent in 200 healthy controls. Therefore, the c.3696_3706del variant may disrupt the interaction between myosin VIIa and other USH1 proteins, and impair melanosome transport in retinal pigment epithelial cells. Notably, bilateral auditory brainstem responses were absent in two patients of the USH family, while distortion product otoacoustic emissions were elicited in the right ears of the two patients, consistent with clinical diagnosis of unilateral auditory neuropathy spectrum disorder. These data suggested that the homozygous c.3696_3706del variant in the MYO7A gene may be the disease‑causing mutation for the disorder in this family. These findings broaden the phenotype spectrum of the MYO7A gene, and may facilitate understanding of the molecular pathogenesis of the disease, and genetic counseling for the family.

  14. Uncoupling of sexual reproduction from homologous recombination in homozygous Oenothera species.

    Science.gov (United States)

    Rauwolf, U; Greiner, S; Mráček, J; Rauwolf, M; Golczyk, H; Mohler, V; Herrmann, R G; Meurer, J

    2011-07-01

    Salient features of the first meiotic division are independent segregation of chromosomes and homologous recombination (HR). In non-sexually reproducing, homozygous species studied to date HR is absent. In this study, we constructed the first linkage maps of homozygous, bivalent-forming Oenothera species and provide evidence that HR was exclusively confined to the chromosome ends of all linkage groups in our population. Co-segregation of complementary DNA-based markers with the major group of AFLP markers indicates that HR has only a minor role in generating genetic diversity of this taxon despite its efficient adaptation capability. Uneven chromosome condensation during meiosis in Oenothera may account for restriction of HR. The use of plants with ancient chromosomal arm arrangement demonstrates that limitation of HR occurred before and independent from species hybridizations and reciprocal translocations of chromosome arms-a phenomenon, which is widespread in the genus. We propose that consecutive loss of HR favored the evolution of reciprocal translocations, beneficial superlinkage groups and ultimately permanent translocation heterozygosity.

  15. Transfusion as an Inflammation Hit: Knowns and Unknowns

    Science.gov (United States)

    Garraud, Olivier; Tariket, S.; Sut, C.; Haddad, A.; Aloui, C.; Chakroun, T.; Laradi, S.; Cognasse, F.

    2016-01-01

    Transfusion of blood cell components is frequent in the therapeutic arsenal; it is globally safe or even very safe. At present, residual clinical manifestations are principally inflammatory in nature. If some rare clinical hazards manifest as acute inflammation symptoms of various origin, most of them linked with conflicting and undesirable biological material accompanying the therapeutic component (infectious pathogen, pathogenic antibody, unwanted antigen, or allergen), the general feature is subtler and less visible, and essentially consists of alloimmunization or febrile non-hemolytic transfusion reaction. The present essay aims to present updates in hematology and immunology that help understand how, when, and why subclinical inflammation underlies alloimmunization and circumstances characteristic of red blood cells and – even more frequently – platelets that contribute inflammatory mediators. Modern transfusion medicine makes sustained efforts to limit such inflammatory hazards; efforts can be successful only if one has a clear view of each element’s role. PMID:27965664

  16. Problems and Approaches for Blood Transfusion in the Developing Countries.

    Science.gov (United States)

    Roberts, David J; Field, Stephen; Delaney, Meghan; Bates, Imelda

    2016-04-01

    A safe supply of blood and the knowledge, skill, and resources for the appropriate use of blood are essential for medical services. Many problems are faced in the development of transfusion services in low- or medium-income countries (LMICs). Unfortunately, in many countries, providing safe blood is made more difficult by a lack of blood donors and the high frequency of transfusion-transmissible infections. The problems are compounded by the frequent need for urgent life-saving transfusions. This article examines the problems in supply, safety, and use of blood and how they are being addressed in LMICs, predominantly focusing on sub-Saharan Africa. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. The Effect of Blood Transfusion on Outcomes in Aortic Surgery.

    Science.gov (United States)

    Velasquez, Camilo A; Singh, Mrinal; Bin Mahmood, Syed Usman; Brownstein, Adam J; Zafar, Mohammad A; Saeyeldin, Ayman; Ziganshin, Bulat A; Elefteriades, John A

    2017-09-01

    The use of blood transfusion in cardiac surgery varies widely. The beneficial effects of blood products are offset by an increase in morbidity and mortality. Despite multiple studies showing an association between blood product exposure and adverse short- and long-term events, it is difficult to determine causality. Nevertheless, the implication is sufficient to warrant the search for alternative strategies to reduce the use of blood products while providing a standard of care that optimizes postoperative outcomes. Aortic surgery, in particular, is associated with an increased risk of bleeding requiring a blood transfusion. There is a paucity of evidence within aortic surgery regarding the deleterious effects of blood products. Here, we review the current evidence regarding patient outcomes after blood transfusion in cardiac surgery, with special emphasis on aortic surgery.

  18. Transfusion-associated anaphylaxis during anaesthesia and surgery

    DEFF Research Database (Denmark)

    Lindsted, G; Larsen, R; Krøigaard, M

    2014-01-01

    in Denmark. Our aims were to identify possible cases of TAA, to characterize their symptoms and tryptase levels and to investigate the reporting of TAA to the haemovigilance systems. MATERIAL AND METHODS: We reviewed 245 patients with suspected allergic reactions during anaesthesia and surgery, investigated...... and results of laboratory and clinical investigations were collected. TAA cases were identified according to the recommendations of the International Society of Blood Transfusion (ISBT). RESULTS: Ten possible TAA cases (30% of all transfused patients) were identified, all DAAC negative. The frequency...... at the Danish Anaesthesia Allergy Centre (DAAC). Based on the outcome of this investigation, the patients were classified as DAAC positive (confirmed hypersensitivity to identified agent, n = 112), or DAAC negative (no confirmed hypersensitivity, n = 133). Data on case history, details of blood transfusion...

  19. Usefulness of blood irradiation before transfusion to avoid transfusion associated graft versus host disease (TA-GVHD)

    International Nuclear Information System (INIS)

    Takahashi, Koki

    1997-01-01

    We summarize the pathology of the transfusion associated graft versus host disease (TA-GVHD) and examine the usefulness of the blood irradiation before transfusion as more widely used prophylaxis. The symptom of TA-GVHD was as follows: after (asymptomatic phase) for 1 to 2 weeks after blood transfusion, pyrexia and erythema appeared. Furthermore, hepatic disorder, diarrhea and bloody stool occurred. In no longer time, pancytopenia by aplastic crisis of the bone marrow appeard, and severe granulocytopenia occurred. Finally, by the complication with severe infectious disease such as septicemia, almost all the patients died with in 3 to 4 weeks after blood transfusion. TA-GVHD was found in some patients without immune deficiency syndrome. The cause of the frequent occurrence of the disease in Japan was shown by the probability of the one-way matching analysis. As the countermeasure of TA-GVHD, we examined the effectiveness of the blood irradiation before transfusion under the consideration of the safety and the emergency. After the responder cells were beforehand irradiated with various doses of radiation (X-ray or g-ray), the proliferative response was investigated through the uptake of 3 H-thymidine, and we obtained 15-50 Gy as the optimum dose of the radiation. We discuss the establishment of the countermeasure for the TA-GVHD and the formation of the nationwide support system for TV-GVHD (K.H.). 33 refs

  20. How do we reduce plasma transfusion in Rhode Island?

    Science.gov (United States)

    Nixon, Christian P; Tavares, Maria F; Sweeney, Joseph D

    2017-08-01

    Plasma transfusions are given to patients with coagulopathy, either prophylactically, before an invasive procedure; or therapeutically, in the presence of active bleeding; and as an exchange fluid in therapeutic plasma exchange for disorders such as thrombotic thrombocytopenic purpura. There is consensus that many prophylactic plasma transfusions are non-efficacious, and the misdiagnosis of thrombotic thrombocytopenic purpura results in unnecessary therapeutic plasma exchange. Beginning in 2001, programs to reduce plasma transfusion in the three major teaching hospitals in Rhode Island were initiated. The programs evolved through the establishment of guidelines, education for key prescribers of plasma, screening of plasma prescriptions, and engagement of individual prescribing physicians for out-of-guidelines prescriptions with modification or cancellation. Establishment of an in-house ADAMTS13 (ADAM metallopeptidase with thrombospondin type 1, motif 13) assay in 2013 was used to prevent therapeutic plasma exchange in patients with non-thrombotic thrombocytopenic purpura microangiopathy. Transfusion service data were gathered at the hospital level regarding blood component use, hospital data for discharges, inpatient mortality, and mean case-mix index, and, at the state level, for units of plasma shipped from the community blood center to in-state hospitals. Between 2006 and 2016, a reduction in plasma use from 11,805 to 2677 units (a 77% decrease) was observed in the three hospitals and was mirrored in the state as a whole. This decline was not associated with any increase in red blood cell transfusion. Inpatient mortality either declined or was unchanged. An active program focused on education and interdiction can achieve a large decrease in plasma transfusions without evidence of patient harm. © 2017 AABB.

  1. [Evaluation of the quality control system in blood transfusion service].

    Science.gov (United States)

    Jovanović, R

    2000-01-01

    Implementation of quality system improvement at the Blood Transfusion Institute Novi Sad, included adjustments in practice to the request of ISO 9001 standard. Quality improvement must be a permanent activity of the Institute. The audit is a management tool for monitoring the quality assurance system and is either a quality audit or a medical audit. A well planned, comprehensive quality audit covers each activity of the Blood Transfusion Institute. The procedures may be internal or external. Quality manager is responsible for annual internal quality audits. The purpose of internal audits is to check the efficiency of the quality system in terms of realization of quality policy, fulfullment of designed targets and implementation of quality system documents. An internal quality audit is performed in accordance with the procedure and audit findings are reported to the management in a form of internal quality report as a part of quality system review. The findings must be communicated to all persons responsible for the controlled area. Quality manager can initiate an internal quality audit whenever it is realized that problems about the quality system have occurred. Audits are conducted by the quality manager or an audit team. The accurate list of internal auditors is kept in the Institute archive. Medical audit carried out by a transfusion committee, evaluates the quality of blood transfusion for determining the degree of compliance with established local or national guidelines, in order to promote optimal transfusion practice. Audits are not only used for determining further quality management activities, but also make basis for creating and maintenance of excellent relations with product and service users. Considering all this, Blood Transfusion Institute exceeds the requirements of ISO 9000 standards series.

  2. [Ratio of erythrocyte and plasma in massive blood transfusion].

    Science.gov (United States)

    Wen, Xian-Hui; Liu, Feng-Xia; Zhang, Jun-Hua; Gui, Rong

    2014-06-01

    This study was purposed to explore the suitable ratio between fresh frozen plasma and erythrocyte by retrospective analysis of coagulation in patients with massive blood transfusion. The clinical data of 151 cases with massive blood transfusion from January 2011 to January 2013 were analyzed retrospectively. According to coagulation, patients were divided into coagulation normal group (138 cases) and coagulation dysfunction group (13 cases). Based on the ratio of 1:1 of fresh frozen plasma and erythrocyte, the patients were divided into high plasma group(2:1), medium plasma group (1:1) and low plasma (blood transfusion. The results showed that prothrombin time (PT), activated partial thromboplastin time (APTT) and thrombin time (TT) were prolonged, fibrinogen (FIB) level decreased significantly (all P blood transfusion 24 h; the high plasma and the medium plasma group of coagulation normal group had no significant changes in coagulation (P > 0.05); prothrombin time, activated partial thromboplastin time, thrombin time and fibrinogen level in the medium plasma and low plasma subgroup of coagulation dysfunction group after massive transfusion was still in abnormal levels (P > 0.05), coagulation function in high plasma subgroup was improved significantly (P blood transfusion, the ratio between fresh frozen plasma and erythrocyte is recommended to be 2:1 in patients of coagulation dysfunction in order to improve the patient's coagulation function and to reduce the incidence of adverse event, the ratio of fresh frozen plasma to erythrocyte is recommended to be 1:1 in patients with normal coagulation so as to reduce the dilutional coagulopathy and hypervolemia of blood.

  3. Prolonged storage of packed red blood cells for blood transfusion.

    Science.gov (United States)

    Martí-Carvajal, Arturo J; Simancas-Racines, Daniel; Peña-González, Barbra S

    2015-07-14

    A blood transfusion is an acute intervention, used to address life- and health-threatening conditions on a short-term basis. Packed red blood cells are most often used for blood transfusion. Sometimes blood is transfused after prolonged storage but there is continuing debate as to whether transfusion of 'older' blood is as beneficial as transfusion of 'fresher' blood. To assess the clinical benefits and harms of prolonged storage of packed red blood cells, in comparison with fresh, on recipients of blood transfusion. We ran the search on 1st May 2014. We searched the Cochrane Injuries Group Specialized Register, Cochrane Central Register of Controlled Trials (CENTRAL, The Cochrane Library), MEDLINE (OvidSP), Embase (OvidSP), CINAHL (EBSCO Host) and two other databases. We also searched clinical trials registers and screened reference lists of the retrieved publications and reviews. We updated this search in June 2015 but these results have not yet been incorporated. Randomised clinical trials including participants assessed as requiring red blood cell transfusion were eligible for inclusion. Prolonged storage was defined as red blood cells stored for ≥ 21 days in a blood bank. We did not apply limits regarding the duration of follow-up, or country where the study took place. We excluded trials where patients received a combination of short- and long-stored blood products, and also trials without a clear definition of prolonged storage. We independently performed study selection, risk of bias assessment and data extraction by at least two review authors. The major outcomes were death from any cause, transfusion-related acute lung injury, and adverse events. We estimated relative risk for dichotomous outcomes. We measured statistical heterogeneity using I(2). We used a random-effects model to synthesise the findings. We identified three randomised clinical trials, involving a total of 120 participants, comparing packed red blood cells with ≥ 21 days storage

  4. Transfusions of blood and blood products and viral infections

    Directory of Open Access Journals (Sweden)

    Marta Wróblewska

    2002-06-01

    Full Text Available Transfusions of blood and blood products are commonly used in medicine, but being biological materials they carry a risk of transmitting infections--viral, bacterial, parasitic, as well as prions. Laboratory tests used for screening of donated blood for viral infections at present cannot detect all infectious units. Criteria for selection of blood donors therefore must be very strict, while methods of inactivation of viruses and laboratory assays for detection of their presence must be improved. Indications for blood transfusion should be restricted.

  5. Transfusion-associated hazards: A revisit of their presentation.

    Science.gov (United States)

    Garraud, O; Sut, C; Haddad, A; Tariket, S; Aloui, C; Laradi, S; Hamzeh-Cognasse, H; Bourlet, T; Zeni, F; Aubron, C; Ozier, Y; Laperche, S; Peyrard, T; Buffet, P; Guyotat, D; Tavernier, E; Cognasse, F; Pozzetto, B; Andreu, G

    2018-04-03

    As a therapy or a support to other therapies, despite being largely beneficial to patients in general, transfusion it is not devoid of some risks. In a moderate number of cases, patients may manifest adverse reactions, otherwise referred to as transfusion-associated hazards (TAHs). The latest French 2016 haemovigilance report indicates that 93% of TAHs are minor (grade 1), 5.5% are moderate (grade 2) and 1.6% are severe (grade 3), with only five deaths (grade 4) being attributed to transfusion with relative certainty (imputability of level [or grade] 1 to 3). Health-care providers need to be well aware of the benefits and potential risks (to best evaluate and discuss the benefit-risk ratio), how to prevent TAHs, the overall costs and the availability of alternative therapeutic options. In high-income countries, most blood establishments (BEs) and hospital blood banks (HBBs) have developed tools for reporting and analysing at least severe transfusion reactions. With nearly two decades of haemovigilance, transfusion reaction databases should be quite informative, though there are four main caveats that prevent it from being fully efficient: (ai) reporting is mainly declarative and is thus barely exhaustive even in countries where it is mandatory by law; (aii) it is often difficult to differentiate between the different complications related to transfusion, diseases, comorbidities and other types of therapies in patients suffering from debilitating conditions; (aiii) there is a lack of consistency in the definitions used to describe and report some transfusion reactions, their severity and their likelihood of being related to transfusion; and (aiv) it is difficult to assess the imputability of a particular BC given to a patient who has previously received many BCs over a relatively short period of time. When compiling all available information published so far, it appears that TAHs can be analysed using different approaches: (bi) their pathophysiological nature; (bii

  6. Detection of alloimmunization to ensure safer transfusion practice

    Directory of Open Access Journals (Sweden)

    Rashmi Sood

    2013-01-01

    Full Text Available Background: Serological safety is an integral part of overall safety for blood banks. Emphasis is on the use of routinue Red Blood Cell (RBC antibody screen test, at set time intervals, to reduce risks related to alloantibodies. Also emphasis is on importance of issuing antigen negative blood to alloantibody positive patients. Effect of using leucodepleted blood on the rate of alloimmunization is highlighted. The concept of provision of phenotypically matched blood is suggested. Materials and Methods: Antibody screen test is important to select appropriate blood for transfusion. Repeat antibody screen testing, except if time interval between the earlier and subsequent transfusion was less than 72 hours, followed by antibody identification, if required, was performed in patients being treated with repeat multiple blood transfusions. Between February 2008 and June 2009, repeat samples of 306 multi-transfused patients were analyzed. Search for irregular antibodies and reading of results was conducted using RBC panels (three-cell panel of Column Agglutination Technology (CAT and two cell panel of the Solid Phase Red Cell Adherence Technology (SPRCAT. Specificities of antibodies were investigated using appropriate panels, 11 cell panel of CAT and 16 cell panel of SPRCA. These technologies, detecting agglutination in columns and reactions in solid phase, evaluate the attachment of irregular incomplete antibody to antigen in the first phase of immunological reaction more directly and hence improve the reading of agglutination. Three to four log leuco reduced red blood cells were transfused to patients in the study using blood collection bags with integral filters. Results: Alloimmunization rate of 4.24% was detected from 306 multiply transfused patients tested and followed up. The Transfusion therapy may become significantly complicated. Conclusion: Red cell antibody screening and identification and subsequent issue of antigen negative blood have a

  7. Neonatal Platelet Transfusions and Future Areas of Research.

    Science.gov (United States)

    Sola-Visner, Martha; Bercovitz, Rachel S

    2016-10-01

    Thrombocytopenia affects approximately one fourth of neonates admitted to neonatal intensive care units, and prophylactic platelet transfusions are commonly administered to reduce bleeding risk. However, there are few evidence-based guidelines to inform clinicians' decision-making process. Developmental differences in hemostasis and differences in underlying disease processes make it difficult to apply platelet transfusion practices from other patient populations to neonates. Thrombocytopenia is a risk factor for common preterm complications such as intraventricular hemorrhage; however, a causal link has not been established, and platelet transfusions have not been shown to reduce risk of developing intraventricular hemorrhage. Platelet count frequently drives the decision of whether to transfuse platelets, although there is little evidence to demonstrate what a safe platelet nadir is in preterm neonates. Current clinical assays of platelet function often require large sample volumes and are not valid in the setting of thrombocytopenia; however, evaluation of platelet function and/or global hemostasis may aid in the identification of neonates who are at the highest risk of bleeding. Although platelets' primary role is in establishing hemostasis, platelets also carry pro- and antiangiogenic factors in their granules. Aberrant angiogenesis underpins common complications of prematurity including intraventricular hemorrhage and retinopathy of prematurity. In addition, platelets play an important role in host immune defenses. Infectious and inflammatory conditions such as sepsis and necrotizing enterocolitis are commonly associated with late-onset thrombocytopenia in neonates. Severity of thrombocytopenia is correlated with mortality risk. The nature of this association is unclear, but preclinical data suggest that thrombocytopenia contributes to mortality rather than simply being a proxy for disease severity. Neonates are a distinct patient population in whom

  8. Effectiveness of autologous transfusion system in primary total hip and knee arthroplasty.

    LENUS (Irish Health Repository)

    Schneider, Marco M

    2014-01-01

    Autologous transfusion has become a cost-efficient and useful option in the treatment of patients with high blood loss following major orthopaedic surgery. However, the effectiveness of autologous transfusion in total joint replacement remains controversial.

  9. 75 FR 22817 - Emerging Infectious Diseases: Evaluation to Implementation for Transfusion and Transplantation...

    Science.gov (United States)

    2010-04-30

    ...] Emerging Infectious Diseases: Evaluation to Implementation for Transfusion and Transplantation Safety and... public workshops entitled ``Emerging Infectious Diseases: Evaluation to Implementation for Transfusion... Office of Science and Public Health, Centers for Disease Control and Prevention, National Institutes of...

  10. 75 FR 79006 - Submission for OMB Review; Comment Request; Transfusion-Transmitted Retrovirus and Hepatitis...

    Science.gov (United States)

    2010-12-17

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Submission for OMB Review; Comment Request; Transfusion- Transmitted Retrovirus and Hepatitis Virus Rates and Risk Factors: Improving... control number. Proposed Collection: Title: Transfusion-transmitted retrovirus and hepatitis virus rates...

  11. Age of transfused blood is not associated with increased postoperative adverse outcome after cardiac surgery.

    LENUS (Irish Health Repository)

    McKenny, M

    2011-05-01

    This study investigated the hypothesis that storage age of transfused red blood cells (RBCs) is associated with adverse outcome after cardiac surgery, and examined association between volume of RBC transfusions and outcome after cardiac surgery.

  12. Thrombelastography (TEG) or thromboelastometry (ROTEM) to monitor haemotherapy versus usual care in patients with massive transfusion

    DEFF Research Database (Denmark)

    Afshari, Arash; Wikkelsø, Anne; Brok, Jesper Sune

    2011-01-01

    Severe bleeding and coagulopathy as a result of massive transfusion are serious clinical conditions that are associated with high mortality. Thromboelastography (TEG) and thromboelastometry (ROTEM) are increasingly used to guide transfusion strategy but their roles remain disputed....

  13. Promoting High-Value Practice by Reducing Unnecessary Transfusions With a Patient Blood Management Program.

    Science.gov (United States)

    Sadana, Divyajot; Pratzer, Ariella; Scher, Lauren J; Saag, Harry S; Adler, Nicole; Volpicelli, Frank M; Auron, Moises; Frank, Steven M

    2018-01-01

    Although blood transfusion is a lifesaving therapy for some patients, transfusion has been named 1 of the top 5 overused procedures in US hospitals. As unnecessary transfusions only increase risk and cost without providing benefit, improving transfusion practice is an effective way of promoting high-value care. Most high-quality clinical trials supporting a restrictive transfusion strategy have been published in the past 5 to 10 years, so the value of a successful patient blood management program has only recently been recognized. We review the most recent transfusion practice guidelines and the evidence supporting these guidelines. We also discuss several medical societies' Choosing Wisely campaigns to reduce or eliminate overuse of transfusions. A blueprint is presented for developing a patient blood management program, which includes discussion of specific methods for optimizing transfusion practice.

  14. Impact on early and late mortality after blood transfusion in coronary artery bypass graft surgery.

    Science.gov (United States)

    Santos, Antonio Alceu dos; Sousa, Alexandre Gonçalves; Thomé, Hugo Oliveira de Souza; Machado, Roberta Longo; Piotto, Raquel Ferrari

    2013-03-01

    To assess the 30-day and 1-year mortality associated to the red blood cell transfusion after coronary artery bypass grafting surgery. This procedure has been questioned by the international medical community, but it is still widely used in cardiac surgery. Therefore, it is needed more evidence of this medical practice in our country. We retrospectively analyzed 3,004 patients who underwent coronary artery bypass grafting surgery between June 2009 and July 2010. Patients were divided into two groups: non-transfused and transfused. The transfused group totaled 1,888 (63%) and non-transfused 1,116 (37%). There were 129 deaths in 30 days, with 108 (84%) in the transfused group and 21 (16%) in the non-transfused (Pconservation strategies should be encouraged to reduce blood products transfusions.

  15. Comparing transfusion reaction rates for various plasma types: a systematic review and meta-analysis/regression.

    Science.gov (United States)

    Saadah, Nicholas H; van Hout, Fabienne M A; Schipperus, Martin R; le Cessie, Saskia; Middelburg, Rutger A; Wiersum-Osselton, Johanna C; van der Bom, Johanna G

    2017-09-01

    We estimated rates for common plasma-associated transfusion reactions and compared reported rates for various plasma types. We performed a systematic review and meta-analysis of peer-reviewed articles that reported plasma transfusion reaction rates. Random-effects pooled rates were calculated and compared between plasma types. Meta-regression was used to compare various plasma types with regard to their reported plasma transfusion reaction rates. Forty-eight studies reported transfusion reaction rates for fresh-frozen plasma (FFP; mixed-sex and male-only), amotosalen INTERCEPT FFP, methylene blue-treated FFP, and solvent/detergent-treated pooled plasma. Random-effects pooled average rates for FFP were: allergic reactions, 92/10 5 units transfused (95% confidence interval [CI], 46-184/10 5 units transfused); febrile nonhemolytic transfusion reactions (FNHTRs), 12/10 5 units transfused (95% CI, 7-22/10 5 units transfused); transfusion-associated circulatory overload (TACO), 6/10 5 units transfused (95% CI, 1-30/10 5 units transfused); transfusion-related acute lung injury (TRALI), 1.8/10 5 units transfused (95% CI, 1.2-2.7/10 5 units transfused); and anaphylactic reactions, 0.8/10 5 units transfused (95% CI, 0-45.7/10 5 units transfused). Risk differences between plasma types were not significant for allergic reactions, TACO, or anaphylactic reactions. Methylene blue-treated FFP led to fewer FNHTRs than FFP (risk difference = -15.3 FNHTRs/10 5 units transfused; 95% CI, -24.7 to -7.1 reactions/10 5 units transfused); and male-only FFP led to fewer cases of TRALI than mixed-sex FFP (risk difference = -0.74 TRALI/10 5 units transfused; 95% CI, -2.42 to -0.42 injuries/10 5 units transfused). Meta-regression demonstrates that the rate of FNHTRs is lower for methylene blue-treated compared with FFP, and the rate of TRALI is lower for male-only than for mixed-sex FFP; whereas no significant differences are observed between plasma types for allergic reactions, TACO

  16. Blood transfusion practices in a tertiary care center in Northern India

    OpenAIRE

    Kumari, Sonam

    2017-01-01

    Background: Blood transfusion plays vital roles in the medical and surgical practice. To achieve optimum use of blood, transfusion has to be appropriate and judicious consuming minimal resources and manpower. Objective: To evaluate the pattern of blood transfusion requests and utilization with the aim of determining transfusion practice. Materials and Methods: Blood request forms and cross-match worksheets at the blood bank were analyzed over a 6-month period. Numbers of requisitions, b...

  17. Acute Lung Injury Complicating Blood Transfusion in Post-Partum Hemorrhage: Incidence and Risk Factors

    OpenAIRE

    Teofili, Luciana; Bianchi, Maria; Zanfini, Bruno A.; Catarci, Stefano; Sicuranza, Rossella; Spartano, Serena; Zini, Gina; Draisci, Gaetano

    2014-01-01

    Background. We retrospectively investigated the incidence and risk factors for transfusion-related acute lung injury (TRALI) among patients transfused for post-partum hemorrhage (PPH).  Methods. We identified a series of 71 consecutive patients with PPH requiring the urgent transfusion of three or more red blood cell (RBC) units, with or without fresh frozen plasma (FFP) and platelet (PLT) transfusion. Clinical records were then retrieved and examined for respiratory distress events. Accor...

  18. Effect of perioperative blood transfusions on long term graft outcomes in renal transplant patients.

    LENUS (Irish Health Repository)

    O'Brien, Frank J

    2012-06-01

    It is established that blood transfusions will promote sensitization to human leucocyte antigen (HLA) antigens, increase time spent waiting for transplantation and may lead to higher rates of rejection. Less is known about how perioperative blood transfusion influence patient and graft outcome. This study aims to establish if there is an association between perioperative blood transfusion and graft or patient survival.

  19. Transplante hepático sem transfusão sanguínea

    Directory of Open Access Journals (Sweden)

    João Eduardo Leal Nicoluzzi

    Full Text Available Orthotopic liver transplantation (OLT usually requires large amounts of blood transfusion. Reports of OLT without transfusion are scarce and often associated to religious reasons. Herein we report two cases of OLT successfully managed without blood transfusion and not related to religious beliefs.

  20. The risk of transfusion-transmissible viral infections in the Niger ...

    African Journals Online (AJOL)

    Background and objectives: Million\\'s of lives are saved each year through blood transfusion. Nevertheless people have increased risk of becoming infected with transfusion - transmissible viral infections through transfusion of blood and blood products that have not been tested correctly. This study was undertaken to ...

  1. Intra-operative blood transfusion among adult surgical patients in a ...

    African Journals Online (AJOL)

    This retrospective study was designed to audit the pattern of intra-operative whole blood transfusion among adult surgical patients over a two-year period. Data were collected on the rate of intra-operative transfusion, estimated blood loss, units of donor blood transfused, pattern of use of autologous blood and circumstances ...

  2. Red cell alloimmunization in multi‑transfused patients with sickle cell ...

    African Journals Online (AJOL)

    Background: Sickle cell anemia (SCA) is an inherited hemoglobin disorder characterized by chronic anemia and occasional crises. Clinical features are variable. While some individuals are relatively stable and rarely require blood transfusion, others often require blood transfusion. Multiple blood transfusion is associated ...

  3. Bedside practice of blood transfusion in a large teaching hospital in Uganda : an observational study

    NARCIS (Netherlands)

    de Graaf, J D; Kajja, I; Bimenya, G S; Postma, Maarten; Smit Sibinga, C.Th.

    BACKGROUND: Adverse transfusion reactions can cause morbidity and death to patients who receive a blood transfusion. Blood transfusion practice in Mulago Hospital, Kampala, Uganda is analyzed to see if and when these practices play a role in the morbidity and mortality of patients. MATERIALS AND

  4. Hemoglobin and 2,3-diphosphoglycerate levels in transfused dialysis patients with myocardial infarction.

    Science.gov (United States)

    Crowley, J P; Valeri, C R; Metzger, J B; Pono, L; Chazan, J

    1992-01-01

    Thirty frequently transfused patients on long term hemodialysis were studied and a similar number of age and sex-matched patients who were infrequently transfused were used as a control group to ascertain the influence of a previous myocardial infarction (MI) on transfusion requirements. The frequency of previous MI on electrocardiogram (ECG) in the transfused and control groups was similar (40 percent and 37 percent, respectively). In frequently transfused dialysis patients with MI, the hemoglobin level (transfusion trigger) at which these patients were transfused was higher than that of frequently transfused patients without MI (8.3 +/- 1.5 g per dl vs. 6.9 +/- 1 g per dl, p less than 0.01) which indicated that patients without MI tolerated a greater degree of anemia than those with MI. The 2,3-diphosphoglycerate (2,3-DPG) levels were significantly elevated in all transfused patients when compared to matched controls. However, levels of 2,3-DPG were significantly higher in MI patients receiving frequent transfusions than in other transfused patients, suggesting oxygen demands may not have been fully met despite the frequent transfusions. The results suggest levels of 2,3-DPG deserve further study in relation to the adequacy of tissue oxygenation in anemic dialysis patients.

  5. Transfusion-related acute lung injury: Current understanding and preventive strategies

    NARCIS (Netherlands)

    Vlaar, A. P. J.

    2012-01-01

    Transfusion-related acute lung injury (TRALI) is the most serious complication of transfusion medicine. TRALI is defined as the onset of acute hypoxia within 6 hours of a blood transfusion in the absence of hydrostatic pulmonary oedema. The past decades have resulted in a better understanding of the

  6. Transfusion practice in Helsinki University Central Hospital: an analysis of diagnosis-related groups (DRG).

    Science.gov (United States)

    Syrjälä, M T; Kytöniemi, I; Mikkolainen, K; Ranimo, J; Lauharanta, J

    2001-12-01

    Transfusion data combined with data automatically recorded in hospital databases provides an outstanding tool for blood utilization reporting. When the reporting is performed with an online analytical processing (OLAP) tool, real time reporting can be provided to blood subscribers. When this data is combined with a common patient classification system, Diagnosis-Related Groups (DRG), it is possible to produce statistical results, that are similar in different institutions and may provide a means for international transfusion bench-marking and cost comparison. We use a DRG classification to describe the transfusion practice in Helsinki University Central Hospital. The key indicators include the percentage of transfused patients, the number of transfused units and costs in different DRG groups, as well as transfusion rates per DRG weighted treatment episodes. Ninety-three per cent of all transfusions could be classified into different DRGs. The largest blood-using DRG group was acute adult leukaemia (DRG 473), which accounted for 10.4% of all transfusion costs. The 13 largest blood consuming DRGs accounted for half the total costs in 1998. Currently, there is a lack of an internationally accepted standardized way to report institutional or national transfusion practices. DRG-based transfusion reporting might serve as a means for transfusion benchmarking and thus aid studies of variations in transfusion practice.

  7. Barriers to Timely and Safe Blood Transfusion for PPH Patients: Evidence from a Qualitative Study in Dhaka, Bangladesh.

    Science.gov (United States)

    Akhter, Sadika; Anwar, Iqbal; Akter, Rashida; Kumkum, Feroza Akhter; Nisha, Monjura Khatun; Ashraf, Fatema; Islam, Ferdousi; Begum, Nazneen; Chowdhury, Mahbub Elahi; Austin, Anne; Islam, Syed Shariful; Rahman, Aminur

    2016-01-01

    In Bangladesh, postpartum hemorrhage (PPH) is the leading cause of maternal mortality accounting for 31% of all blood transfusions in the country. Although safe blood transfusion is one of the 8 signal functions of Comprehensive Emergency Obstetric Care (CEmOC) strategy, most of the designated public sector CEmOC facilities do not have on-site blood storage system. Emergent blood is mainly available from external blood banks. As a result, emergent patients are to rely on an unregulated network of brokers for blood which may raise question about blood safety. This study explored lived experiences of patients' attendants, managers, providers, and blood brokers before and after the implementation of an on-line Blood Information and Management Application (BIMA) in regards to barriers and facilitators of blood transfusion for emergent patients. Data were collected at Dhaka Medical College Hospital (DMCH), a tertiary-level teaching hospital before (January 2014) and after (March 2015) the introduction of an online BIMA system. Data collection methods included 24 key informant interviews (KIIs) and 40 in-depth interviews (IDIs). KIIs were conducted with formal health service providers, health managers and unlicensed blood brokers. IDIs were conducted with the relatives and husbands of women who suffered PPH, and needed emergency blood. Patients' attendants were unaware of patients' blood type and availability of blood in emergency situation. Newly introduced online BIMA system could facilitate blood transfusion process for poor patients at lower cost and during any time of day and night. However, service providers and service recipients were heavily dependent on a network of unlicensed blood brokers for required blood for emergent PPH patients. Blood collected through unlicensed blood brokers is un-screened, unregulated and probably unsafe. Blood brokers feel that they are providing a needed service, acknowledged a financial incentive and unaware about safety of blood

  8. Barriers to Timely and Safe Blood Transfusion for PPH Patients: Evidence from a Qualitative Study in Dhaka, Bangladesh.

    Directory of Open Access Journals (Sweden)

    Sadika Akhter

    Full Text Available In Bangladesh, postpartum hemorrhage (PPH is the leading cause of maternal mortality accounting for 31% of all blood transfusions in the country. Although safe blood transfusion is one of the 8 signal functions of Comprehensive Emergency Obstetric Care (CEmOC strategy, most of the designated public sector CEmOC facilities do not have on-site blood storage system. Emergent blood is mainly available from external blood banks. As a result, emergent patients are to rely on an unregulated network of brokers for blood which may raise question about blood safety. This study explored lived experiences of patients' attendants, managers, providers, and blood brokers before and after the implementation of an on-line Blood Information and Management Application (BIMA in regards to barriers and facilitators of blood transfusion for emergent patients.Data were collected at Dhaka Medical College Hospital (DMCH, a tertiary-level teaching hospital before (January 2014 and after (March 2015 the introduction of an online BIMA system. Data collection methods included 24 key informant interviews (KIIs and 40 in-depth interviews (IDIs. KIIs were conducted with formal health service providers, health managers and unlicensed blood brokers. IDIs were conducted with the relatives and husbands of women who suffered PPH, and needed emergency blood.Patients' attendants were unaware of patients' blood type and availability of blood in emergency situation. Newly introduced online BIMA system could facilitate blood transfusion process for poor patients at lower cost and during any time of day and night. However, service providers and service recipients were heavily dependent on a network of unlicensed blood brokers for required blood for emergent PPH patients. Blood collected through unlicensed blood brokers is un-screened, unregulated and probably unsafe. Blood brokers feel that they are providing a needed service, acknowledged a financial incentive and unaware about safety

  9. Evaluation of a new tablet formulation of deferasirox to reduce chronic iron overload after long-term blood transfusions

    Directory of Open Access Journals (Sweden)

    Chalmers AW

    2016-02-01

    Full Text Available Anna W Chalmers, Jamile M Shammo Department of Internal Medicine, Division of Hematology/Oncology, Rush University Medical Center, Chicago, IL, USA Abstract: Transfusion-dependent anemia is a common feature in a wide array of hematological disorders, including thalassemia, sickle cell disease, aplastic anemia, myelofibrosis, and myelodysplastic syndromes. In the absence of a physiological mechanism to excrete excess iron, chronic transfusions ultimately cause iron overload. Without correction, iron overload can lead to end-organ damage, resulting in cardiac, hepatic, and endocrine dysfunction/failure. Iron chelating agents are utilized to reduce iron overload, as they form a complex with iron, leading to its clearance. Iron chelation has been proven to decrease organ dysfunction and improve survival in certain transfusion-dependent anemias, such as β-thalassemia. Several chelating agents have been approved by the United States Food and Drug Administration for the treatment of iron overload, including deferoxamine, deferiprone, and deferasirox. A variety of factors have to be considered when choosing an iron chelator, including dosing schedule, route of administration, tolerability, and side effect profile. Deferasirox is an orally administered iron chelator with proven efficacy and safety in multiple hematological disorders. There are two formulations of deferasirox, a tablet for suspension, and a new tablet form. This paper is intended to provide an overview of iron overload, with a focus on deferasirox, and its recently approved formulation Jadenu® for the reduction of transfusional iron overload in hematological disorders. Keywords: iron chelation therapy, transfusional iron overload, deferasirox

  10. Syphilis screening practices in blood transfusion facilities in Ghana

    Directory of Open Access Journals (Sweden)

    Francis Sarkodie

    2016-02-01

    Conclusions: Despite international and national recommendations, more than half of the studied health facilities that provide blood transfusions in Ghana are not screening blood donations for syphilis. These data show a considerable mismatch between recommendations and practice, with serious consequences for blood safety and public health.

  11. Blood banking and transfusion medicine for the nephrologist.

    Science.gov (United States)

    Wehrli, Gay

    2012-01-01

    Therapeutic Apheresis Medicine Services work closely with Blood Banking and Transfusion Medicine Services (BBTMS). The BBTMS performs patient testing and provides blood components for patients undergoing therapeutic apheresis procedures. This article will provide an overview of blood component descriptions, patient testing, and blood component options and preparations for therapeutic apheresis procedures. © 2012 Wiley Periodicals, Inc.

  12. Transfusion transmitted malaria in three major blood banks of ...

    African Journals Online (AJOL)

    This study estimates the risk of acquiring malaria from a single unit of blood in North of Pakistan. A prospective study was conducted to investigate transfusion transmitted malaria in three major blood banks of Peshawar, Pakistan. A total of 1558 (1534 males and 24 females) healthy volunteer blood donors were screened for ...

  13. Toward a patient-based paradigm for blood transfusion

    Directory of Open Access Journals (Sweden)

    Farrugia A

    2014-01-01

    Full Text Available Albert Farrugia,1,2 Eleftherios Vamvakas31College of Medicine, Biology and Environment, Australian National University, Acton, ACT, Australia; 2Centre for Orthopaedic Research, Department of Surgery, Faculty of Medicine and Surgery, University of Western Australia, Perth, WA, Australia; 3Cedars-Sinai Medical Center, Los Angeles, CA, USAAbstract: The current "manufacturing paradigm" of transfusion practice has detached transfusion from the clinical environment. As an example, fresh whole blood in large-volume hemorrhage may be superior to whole blood reconstituted from multiple components. Multicomponent apheresis can overcome logistical difficulties in matching patient needs with fresh component availability and can deliver the benefits of fresh whole blood. Because of the different transfusion needs of patients in emerging economies and the vulnerability of these blood systems to emerging infections, fresh whole blood and multicomponent apheresis can better meet patient needs when compared with transplants of the "manufacturing paradigm". We propose that patient blood management, along with panels of repeat, paid, accredited apheresis and fresh whole-blood donors can be used in emerging economies to support decentralized blood services. This alternative transfusion–medicine paradigm could eventually also be adopted by established economies to focus transfusion medicine on local patient needs and to alleviate the problem of the aging volunteer donor base.Keywords: indications, emerging countries, patient blood management

  14. Real-Time Clinical Decision Support Decreases Inappropriate Plasma Transfusion.

    Science.gov (United States)

    Shah, Neil; Baker, Steven A; Spain, David; Shieh, Lisa; Shepard, John; Hadhazy, Eric; Maggio, Paul; Goodnough, Lawrence T

    2017-08-01

    To curtail inappropriate plasma transfusions, we instituted clinical decision support as an alert upon order entry if the patient's recent international normalized ratio (INR) was 1.7 or less. The alert was suppressed for massive transfusion and within operative or apheresis settings. The plasma order was automatically removed upon alert acceptance while clinical exception reasons allowed for continued transfusion. Alert impact was studied comparing a 7-month control period with a 4-month intervention period. Monthly plasma utilization decreased 17.4%, from a mean ± SD of 3.40 ± 0.48 to 2.82 ± 0.6 plasma units per hundred patient days (95% confidence interval [CI] of difference, -0.1 to 1.3). Plasma transfused below an INR of 1.7 or less decreased from 47.6% to 41.6% (P = .0002; odds ratio, 0.78; 95% CI, 0.69-0.89). The alert recommendation was accepted 33% of the time while clinical exceptions were chosen in the remaining cases (active bleeding, 31%; other clinical indication, 33%; and apheresis, 2%). Alert acceptance rate varied significantly among different provider specialties. Clinical decision support can help curtail inappropriate plasma use but needs to be part of a comprehensive strategy including audit and feedback for comprehensive, long-term changes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  15. [Blood transfusion and inflammation as of yesterday, today and tomorrow].

    Science.gov (United States)

    Garraud, O; Hamzeh-Cognasse, H; Laradi, S; Pozzetto, B; Cognasse, F

    2015-08-01

    Blood transfusion is made possible principally by use of donated homologous components that - in turn - can be perceived as sources of danger by recipients. This may create an innate immune response dominated by inflammation, especially when transfusion is repeated. Residual leukocytes in blood components can source inflammatory lesions but considerably less than used to be prior to systematic, early and stringent - in process - leukoreduction. Every blood component can cause inflammation, though barely in the case of therapeutic plasma (in such a case, this is mainly restricted to allergy). Iron that may be freed by red blood cells but also processing and storage lesions such as the emission of microparticles can reveal themselves as pro-inflammatory. Platelets in platelet components represent the main source of inflammatory and/or allergic hazards in transfusion; this is linked with processing and storage lesions but also with the platelet physiology itself. It is of utmost importance to avoid inflammatory adverse events in patients that are fragile because of their primary condition and/or treatment; this stands for their safety, as inflammation can be extremely severe and even lethal, and also for their comfort; this increases efficacy of transfusion programs while reducing the overall costs. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  16. Best practices for transfusion for patients with sickle cell disease

    Directory of Open Access Journals (Sweden)

    Ted Wun

    2010-01-01

    Full Text Available The beta-globin gene mutation in sickle cell anemia results in anemia and repeated bouts of vascular occlusion. The cumulative effect of these vasocclusive events is progressive damage to many organs including the kidneys, lungs, and brain. The transfusion of red blood cells (RBC can ameliorate many of these complications, but can be associated with both acute and chronic complications, including iron overload. The objective of the Best Practices in Transfusion Medicine for Patients with Sickle Cell Disease (SCD Conference was to review the available published evidence and clinical experience surrounding the use of RBC transfusions for sickle cell disease by a panel of experts. The expert panel developed explicit clinical guidelines for the use of RBC in SCD patients. The panel also made recommendations for further research.  A set of guidelines were produced for dissemination to pertinent stakeholders. If implemented, these clinical pathways have the potential to optimize the use of red blood cell transfusions in SCD.

  17. The prevalence of transfusion-transmitted virus (TTV) infection in ...

    African Journals Online (AJOL)

    Transfusion-transmitted virus (TTV) is an unenveloped circular single-stranded DNA virus with a diameter of 30 to 32 nm that was first described in 1997 in Japan. TTV was detected in various populations without proven pathology, including blood donors and in patients with chronic hepatitis B virus (HBV) and hepatitis C ...

  18. Impact of Transfusion on Cancer Growth and Outcome

    Directory of Open Access Journals (Sweden)

    Hadi A. Goubran

    2016-01-01

    Full Text Available For many years, transfusion of allogeneic red blood cells, platelet concentrates, and plasma units has been part of the standard therapeutic arsenal used along the surgical and nonsurgical treatment of patients with malignancies. Although the benefits of these blood products are not a matter of debate in specific pathological conditions associated with life-threatening low blood cell counts or bleeding, increasing clinical evidence is nevertheless suggesting that deliberate transfusion of these blood components may actually lead to negative clinical outcomes by affecting patient's immune defense, stimulating tumor growth, tethering, and dissemination. Rigorous preclinical and clinical studies are needed to dimension the clinical relevance, benefits, and risks of transfusion of blood components in cancer patients and understand the amplitude of problems. There is also a need to consider validating preparation methods of blood components for so far ignored biological markers, such as microparticles and biological response modifiers. Meanwhile, blood component transfusions should be regarded as a personalized medicine, taking into careful consideration the status and specificities of the patient, rather than as a routine hospital procedure.

  19. Experience with predonated autologous blood transfusion in open ...

    African Journals Online (AJOL)

    Objectives: To find out the practicability, the acceptability, the effectiveness and the safety level of pre-donated, autologous blood transfusion (ABT) in patients who underwent open prostatectomy. Study design: Prospective. Patients and methods: It was a prospective study carried out in Nigeria over a 5-year period.

  20. Transfusion Related Hepatitis C Virus (HCV) Infection in Sickle Cell ...

    African Journals Online (AJOL)

    Rev Olaleye

    ABSTRACT: This study aimed to determine retrospectively, the prevalence of hepatitis C virus infection in relation to a background history of blood transfusion; through anti HCV antibody screening test, amongst adult sickle cell disease patients. Anti HCV antibody was tested for in the serum of 92 consecutively selected ...

  1. Review of autologous blood transfusion at the Kenyatta National ...

    African Journals Online (AJOL)

    Objective: This study was performed over a three- month period to establish the pattern of autologous blood transfusion with specific focus on age, sex, type of surgery, duration of hospital stay and religious beliefs. Design: Hospital based prospective study. Setting: The study was conducted at the Kenyatta National Hospital ...

  2. Cost effectiveness of autologous blood transfusion – A developing ...

    African Journals Online (AJOL)

    An autologous blood donation program was set up at National Orthopaedic Hospital, Igbobi Lagos in 1992 in response to the rising sero prevalence of HIV observed in our “relative replacement” donors. A retrospective batch analysis of patients who received autologous transfusion and those who received homologous ...

  3. Blood transfusion requirement during caesarean delivery: Risk factors

    African Journals Online (AJOL)

    Background: Group specific blood is often cross-matched ready for all patients scheduled for caesarean section in anticipation of haemorrhage during the surgery. This study was conducted to determine the risk factors for blood transfusion during anaesthesia for caesarean section. Methods: This was a prospective ...

  4. Predictors of post operative bleeding and blood transfusion in ...

    African Journals Online (AJOL)

    blood requirements. Objective: To evaluate the impact of some perioperative predictors of post-operative bleeding, and blood transfusion after heart surgery and offer suggestions on preventive measures. Design and Methods: A prospective analytical study. The perioperative factors studied were haemoglobin level, ...

  5. Seroprevalence of transfusion transmissible infections (TTI), in first ...

    African Journals Online (AJOL)

    Background: Transfusion transmissible infections, such as HIV, HBV, HCV and syphilis are on the rise and pose a threat to blood safety. Objective: To determine prevalence and demographic profiles of TTI's among first time blood donors in Abeokuta, Nigeria. Methods: The study was conducted between February to ...

  6. Appropriateness of Intra-Operative Blood Transfusion In Children at ...

    African Journals Online (AJOL)

    Background: The decision to transfuse intra-operatively is based on preoperative haemoglobin (Hb), estimated blood loss and physiological variables. The visual estimate of blood loss is notoriously unreliable especially with small volumes of blood losses in children. Objectives :We sought therefore to determine the ...

  7. Blood transfusion: risks and indications | Schoeman | Obstetrics and ...

    African Journals Online (AJOL)

    Blood transfusions are governed by the Human Tissue Act. Blood users and providers should be aware of their legal and clinical responsibility when using blood and blood products. The safety of blood products cannot be guaranteed and an inherent risk remains when using these products. All efforts should be made to ...

  8. Transfusion transmitted infections – A retrospective analysis from the ...

    African Journals Online (AJOL)

    Background: The emergence of transfusion transmitted infection (TTI) especially HIV/AIDS has created a huge obstacle in ensuring blood safety. To assess the situation in Eritrea, we carried out a retrospective study of 29,501 blood donors for the prevalence of TTI's i.e. HIV, HBV, HCV and Syphilis. Methods: The study ...

  9. Prediction of postpartum blood transfusion – risk factors and recurrence

    DEFF Research Database (Denmark)

    Wikkelsø, Anne J; Hjortøe, Sofie; Gerds, Thomas A

    2014-01-01

    OBJECTIVE: The aim was to find clinically useful risk factors for postpartum transfusion and to assess the joint predictive value in a population of women with a first and second delivery. METHODS: All Danish women with a first and second delivery from January 2001 to September 2009 who gave birt...

  10. Syphilis screening practices in blood transfusion facilities in Ghana

    DEFF Research Database (Denmark)

    Sarkodie, Francis; Hassall, Oliver; Owusu-Dabo, Ellis

    2016-01-01

    OBJECTIVES: The primary objective of this study was to compare laboratory practices for screening blood donors for syphilis at blood transfusion facilities in Ghana with the recommendations of the World Health Organization and the National Blood Service, Ghana (NBSG). The prevalence of syphilis a...

  11. Prevalence of Blood Pathogens among Transfused Patients in ...

    African Journals Online (AJOL)

    With the advent of 21st century technology that has resulted in the development of sophisticated equipments, blood supply is thought to be safer than ever. This study therefore, investigates the incidence and prevalence of transfusion transmitted infections in patients. The study was carried out on 55 hospitalized cohorts who ...

  12. The pattern of blood donation and transfusion transmissible ...

    African Journals Online (AJOL)

    Background: Blood for transfusion in Nigeria is largely collected from family members or commercial blood donors who would rather conceal information that could disqualify them from blood donation. The blood service is expected to transform blood sources to voluntary, guided by altruism and self-risk assessment and ...

  13. Twin-twin transfusion syndrome: etiology, severity and rational management

    NARCIS (Netherlands)

    van Gemert, M. J.; Umur, A.; Tijssen, J. G.; Ross, M. G.

    2001-01-01

    The twin-twin transfusion syndrome is a serious complication of monochorionic twin pregnancies. Partly as a result of an inadequate understanding of the pathophysiology of the syndrome, there is a lack of consensus in clinical management. We sought to review the available information on the etiology

  14. ABO, rhesus blood groups and transfusion-transmitted infections ...

    African Journals Online (AJOL)

    Background: Few studies focused on the study of blood groups in Gabon. This study aimed to determine the phenotypic frequency of ABO and Rhesus antigens in blood donors of Libreville and to assess the association between ABO blood groups and transfusion-transmitted infections. Materials and Methods: The study of ...

  15. Restrictive or Liberal Red-Cell Transfusion for Cardiac Surgery

    DEFF Research Database (Denmark)

    Mazer, C David; Whitlock, Richard P; Fergusson, Dean A

    2017-01-01

    BACKGROUND: The effect of a restrictive versus liberal red-cell transfusion strategy on clinical outcomes in patients undergoing cardiac surgery remains unclear. METHODS: In this multicenter, open-label, noninferiority trial, we randomly assigned 5243 adults undergoing cardiac surgery who had a E...

  16. Pattern and determinants of blood transfusion in a Nigerian neonatal ...

    African Journals Online (AJOL)

    2011-02-25

    Feb 25, 2011 ... Anemia of prematurity is a physiological phenomenon, which is related ... high, the procedure has become very rare in most parts of the developed ... with the clinical need to transfuse a large number of critically ill babies with ...

  17. Transfusion of the dangerous universal donor blood leading to ...

    African Journals Online (AJOL)

    Background: In a health-care setting in which group-identical donor blood is not always available for transfusion, group O whole blood, in the obsolete concept of its being a universal donor, is sometimes given to group A and B recipients without necessary precautions. Objectives: The objective is to draw attention to the ...

  18. Postnatal cranial ultrasonographic findings in feto-fetal transfusion syndrome.

    NARCIS (Netherlands)

    Breysem, L.; Naulaers, G.; Deprest, J.; Schoubroeck, D.V.; Daniels, H.; Lammens, M.M.Y.; Smet, M.H.

    2002-01-01

    Our objective was a retrospective evaluation of cranial US in survivors of twin pregnancy with feto-fetal transfusion syndrome (FFTS), with knowledge of prenatal treatment and neonatal/postnatal clinical data. In 18 pregnancies with FFTS (January 1996 to May 2000), pregnancy management and outcome,

  19. Genetically Determined Hazards of Blood Transfusion Within and ...

    African Journals Online (AJOL)

    1973-01-13

    Jan 13, 1973 ... may occur immediately, due to the presence in the serum of the recipient of naturally-occurring antibodies or of iso-antibodies, resulting from previous transfusion or pregnancy; or it may not be clinically perceptible and consist simply in the formation of antibodies against antigens present in the donor blood.

  20. Red Cell Alloantibodies in Multiple Transfused Thalassaemia Patients.

    Science.gov (United States)

    Chaudhari, C N

    2011-01-01

    Thalassaemia major patients require lifelong transfusion support due to which they are prone for alloimmunization to foreign RBCs. Alloimmunization can be prevented by extended phenotype match blood transfusion. The study was conducted to know the extent of problem of alloimmunization and to find important red cell antibodies in thalassaemia patients. A cross-sectional study was conducted. A total of 32 thalassaemia patients were enrolled. The specimen was subjected to red cell alloantibody and autoantibody by column gel agglutination technique. R 1 (w) R 1 , R 2 R 2 , rr (papaine and non papain) and 11 cell panel reagent cells were used in screening and identification of alloantibodies respectively. Six (18.8 %) subjects were alloimmunized. All alloimmunized subjects were recipient of more than 20 units of transfusion. Total seven clinically significant alloantibodies were identified. Anti E and anti c were commonest antibodies in four (12.5%) patients. Red cell alloimmunization is an important risk in thalassaemia patient. 71.4% of alloantibodies were anti E and anti c type. Extended phenotype match blood transfusion for Rh-c and Rh-E antigens or level 2 antigen matching stringency needs to be explored in preventing alloimmunization in thalassaemia patients.