A method for quantitative analysis of standard and high-throughput qPCR expression data based on input sample quantity.

Directory of Open Access Journals (Sweden)

Mateusz G Adamski

Full Text Available Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1 the achievement of absolute quantification and (2 a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.

Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR.

Science.gov (United States)

Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S

2018-01-01

The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

Real-time PCR analysis of carbon catabolite repression of cellobiose gene transcription in Trametes versicolor

Energy Technology Data Exchange (ETDEWEB)

Stapleton, P. C.; O' Mahoney, J.; Dobson, A. D. W. [National University of Ireland, Microbiology Department, Cork (Ireland)

2004-02-01

Previous reports indicate that in white rot fungi such as Trametes versicolor, the production of cellobiose dehydrogenase (CDH), an extracellular haemo-flavo-enzyme, is subject to carbon catabolite repression by both glucose and maltose, and that the repression is mediated at the transcriptional level. This paper describes the results of an investigation of CDH gene transcription in cellulolytic cultures of T. versicolor, in the presence of other additional carbon sources such as glucose, arabinose, and xylose. Using real time polymerase chain reaction (RT-PCR) assay methods in the presence of these other additional carbon sources, the levels of repression observed are quantitatively determined in an effort to obtain more accurate measurements of carbon catabolite repression of CDH production in this ligninolytic fungus. Ninety-six hours after addition, results of the analysis showed reduction in CDH transcript levels of 19-fold for galactose, 92-fold for arabinose and 114-fold for xylose. The greatest repressive effect was exhibited by glucose. In this case the reduction in CDH transcript levels was 3400-fold. CDH plays an important role in lignin degradation, and there is also substantial interest in the biotechnological applications of CDH, most particularly in the pulp and paper industry. 24 refs., 4 figs.

Propidium monoazide reverse transcription PCR and RT-qPCR for detecting infectious enterovirus and norovirus

Science.gov (United States)

Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...

Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

Directory of Open Access Journals (Sweden)

FIGUEIREDO Luiz Tadeu Moraes

1997-01-01

Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

Directory of Open Access Journals (Sweden)

U. Pagnini

2010-02-01

Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

A novel RT-qPCR assay for quantification of the MLL-MLLT3 fusion transcript in acute myeloid leukaemia

DEFF Research Database (Denmark)

Abildgaard, Lotte; Ommen, Hans Beier; Lausen, Birgitte Frederiksen

2013-01-01

OBJECTIVES: Patients with acute myeloid leukaemia (AML) of the monocytic lineage often lack molecular markers for minimal residual disease (MRD) monitoring. The MLL-MLLT3 fusion transcript found in patients with AML harbouring t(9;11) is amenable to RT-qPCR quantification but because...... of the heterogeneity of translocation break points, the MLL-MLLT3 fusion gene is a challenging target. We hypothesised that MRD monitoring using MLL-MLLT3 as a RT-qPCR marker is feasible in the majority of patients with t(9;11)-positive AML. METHODS: Using a locked nucleic acid probe, we developed a sensitive RT......-qPCR assay for quantification of the most common break point region of the MLL-MLLT3 fusion gene. Five paediatric patients with t(9;11)-positive AML were monitored using the MLL-MLLT3 assay. RESULTS: A total of 43 bone marrow (BM) and 52 Peripheral blood (PB) samples were collected from diagnosis until...

Outbreak of hepatitis E virus infection in Darfur, Sudan: effectiveness of real-time reverse transcription-PCR analysis of dried blood spots.

Science.gov (United States)

Mérens, Audrey; Guérin, Philippe Jean; Guthmann, Jean-Paul; Nicand, Elisabeth

2009-06-01

Biological samples collected in refugee camps during an outbreak of hepatitis E were used to compare the accuracy of hepatitis E virus RNA amplification by real-time reverse transcription-PCR (RT-PCR) for sera and dried blood spots (concordance of 90.6%). Biological profiles (RT-PCR and serology) of asymptomatic individuals were also analyzed.

A novel method of multiple nucleic acid detection: Real-time RT-PCR coupled with probe-melting curve analysis.

Science.gov (United States)

Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan

2017-11-15

A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

Differentiation among isolates of prunus necrotic ringspot virus by transcript conformation polymorphism.

Science.gov (United States)

Rosner, A; Maslenin, L; Spiegel, S

1998-09-01

A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.

Novel reference genes for quantifying transcriptional responses of Escherichia coli to protein overexpression by quantitative PCR

Directory of Open Access Journals (Sweden)

Zou Ruiyang

2011-04-01

Full Text Available Abstract Background Accurate interpretation of quantitative PCR (qPCR data requires normalization using constitutively expressed reference genes. Ribosomal RNA is often used as a reference gene for transcriptional studies in E. coli. However, the choice of reliable reference genes has not been systematically validated. The objective of this study is to identify a set of reliable reference genes for transcription analysis in recombinant protein over-expression studies in E. coli. Results In this study, the meta-analysis of 240 sets of single-channel Affymetrix microarray data representing over-expressions of 63 distinct recombinant proteins in various E. coli strains identified twenty candidate reference genes that were stably expressed across all conditions. The expression of these twenty genes and two commonly used reference genes, rrsA encoding ribosomal RNA 16S and ihfB, was quantified by qPCR in E. coli cells over-expressing four genes of the 1-Deoxy-D-Xylulose 5-Phosphate pathway. From these results, two independent statistical algorithms identified three novel reference genes cysG, hcaT, and idnT but not rrsA and ihfB as highly invariant in two E. coli strains, across different growth temperatures and induction conditions. Transcriptomic data normalized by the geometric average of these three genes demonstrated that genes of the lycopene synthetic pathway maintained steady expression upon enzyme overexpression. In contrast, the use of rrsA or ihfB as reference genes led to the mis-interpretation that lycopene pathway genes were regulated during enzyme over-expression. Conclusion This study identified cysG/hcaT/idnT to be reliable novel reference genes for transcription analysis in recombinant protein producing E. coli.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

Science.gov (United States)

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

The identification of point mutations in Duchenne muscular dystrophy patients by using reverse-transcription PCR and the protein truncation test

Energy Technology Data Exchange (ETDEWEB)

Gardner, R.J.; Bobrow, M.; Roberts, R.G. [St. Thomas`s Hospitals, London (United Kingdom)

1995-08-01

The protein truncation test (PTT) is a mutation-detection method that monitors the integrity of the open reading frame (ORF). More than 60% of cases of Duchenne muscular dystrophy (DMD) result from gross frameshifting deletions in the dystrophin gene that are detectable by multiplex PCR system. It has become apparent that virtually all of the remaining DMD mutations also disrupt the translational reading frame, making the PTT a logical next step toward a comprehensive strategy for the identification of all DMD mutations. We report here a pilot study involving 22 patients and describe the mutations characterized. These constitute 12 point mutations or small insertions/deletions and 4 gross rearrangements. We also have a remaining five patients in whom there does not appear to be mutation in the ORF. We believe that reverse-transcription-PCR/PTT is an efficient method by which to screen for small mutations in DMD patients with no deletion. 29 refs., 2 figs., 3 tabs.

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

Detection of Tumor Cell-Specific mRNA in the Peripheral Blood of Patients with Breast Cancer — Evaluation of Several Markers with Real-Time Reverse Transcription-PCR

Directory of Open Access Journals (Sweden)

Ulrich Andergassen

2013-01-01

Full Text Available It is widely known that cells from epithelial tumors, e.g., breast cancer, detach from their primary tissue and enter blood circulation. We show that the presence of circulating tumor cells (CTCs in samples of patients with primary and metastatic breast cancer can be detected with an array of selected tumor-marker-genes by reverse transcription real-time PCR. The focus of the presented work is on detecting differences in gene expression between healthy individuals and adjuvant and metastatic breast cancer patients, not an accurate quantification of these differences. Therefore, total RNA was isolated from blood samples of healthy donors and patients with primary or metastatic breast cancer after enrichment of mononuclear cells by density gradient centrifugation. After reverse transcription real-time PCR was carried out with a set of marker genes (BCSP, CK8, Her2, MGL, CK18, CK19. B2M and GAPDH were used as reference genes. Blood samples from patients with metastatic disease revealed increased cytokine gene levels in comparison to normal blood samples. Detection of a single gene was not sufficient to detect CTCs by reverse transcription real-time PCR. Markers used here were selected based on a recent study detecting cancer cells on different protein levels. The combination of such a marker array leads to higher and more specific discovery rates, predominantly in metastatic patients. Identification of CTCs by PCR methods may lead to better diagnosis and prognosis and could help to choose an adequate therapy.

Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

Energy Technology Data Exchange (ETDEWEB)

Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com

2009-07-01

The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

International Nuclear Information System (INIS)

Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.

2009-01-01

The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

Detection of hepatitis C virus RNA using reverse transcription PCR

International Nuclear Information System (INIS)

Yap, S.F.

1998-01-01

Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

A comparative study of microbial diversity and community structure in marine sediments using poly(A tailing and reverse transcription PCR

Directory of Open Access Journals (Sweden)

Tatsuhiko eHoshino

2013-06-01

Full Text Available To obtain a better understanding of metabolically active microbial communities, we tested a molecular ecological approach using poly(A tailing of environmental 16S rRNA, followed by full-length complementary DNA (cDNA synthesis and sequencing to eliminate potential biases caused by mismatching of PCR primer sequences. The RNA pool tested was extracted from marine sediments of the Yonaguni Knoll IV hydrothermal field in the southern Okinawa Trough. The sequences obtained using the ploy(A tailing method were compared statistically and phylogenetically with those obtained using conventional reverse transcription-polymerase chain reaction (RT-PCR with published domain-specific primers. Both methods indicated that Deltaproteobacteria are predominant in sediment (>85% of the total sequence read. The poly(A tailing method indicated that Desulfobacterales were the predominant deltaproteobacteria, while most of the sequences in libraries constructed using RT-PCR were derived from Desulfuromonadales. This discrepancy may have been due to low coverage of Desulfobacterales by the primers used. A comparison of library diversity indices indicated that the poly(A tailing method retrieves more phylogenetically diverse sequences from the environment. The four archaeal 16S rRNA sequences that were obtained using the poly(A tailing method formed deeply branching lineages that were related to Candidatus Parvarchaeum and the Ancient Archaeal Group. These results clearly demonstrate that poly(A tailing followed by cDNA sequencing is a powerful and less biased molecular ecological approach for the study of metabolically active microbial communities.

Relative quantification of mRNA: comparison of methods currently used for real-time PCR data analysis

Directory of Open Access Journals (Sweden)

Koppel Juraj

2007-12-01

Full Text Available Abstract Background Fluorescent data obtained from real-time PCR must be processed by some method of data analysis to obtain the relative quantity of target mRNA. The method chosen for data analysis can strongly influence results of the quantification. Results To compare the performance of six techniques which are currently used for analysing fluorescent data in real-time PCR relative quantification, we quantified four cytokine transcripts (IL-1β, IL-6 TNF-α, and GM-CSF in an in vivo model of colonic inflammation. Accuracy of the methods was tested by quantification on samples with known relative amounts of target mRNAs. Reproducibility of the methods was estimated by the determination of the intra-assay and inter-assay variability. Cytokine expression normalized to the expression of three reference genes (ACTB, HPRT, SDHA was then determined using the six methods for data analysis. The best results were obtained with the relative standard curve method, comparative Ct method and with DART-PCR, LinRegPCR and Liu & Saint exponential methods when average amplification efficiency was used. The use of individual amplification efficiencies in DART-PCR, LinRegPCR and Liu & Saint exponential methods significantly impaired the results. The sigmoid curve-fitting (SCF method produced medium performance; the results indicate that the use of appropriate type of fluorescence data and in some instances manual selection of the number of amplification cycles included in the analysis is necessary when the SCF method is applied. We also compared amplification efficiencies (E and found that although the E values determined by different methods of analysis were not identical, all the methods were capable to identify two genes whose E values significantly differed from other genes. Conclusion Our results show that all the tested methods can provide quantitative values reflecting the amounts of measured mRNA in samples, but they differ in their accuracy and

Assessing reference genes for accurate transcript normalization using quantitative real-time PCR in pearl millet [Pennisetum glaucum (L. R. Br].

Directory of Open Access Journals (Sweden)

Prasenjit Saha

Full Text Available Pearl millet [Pennisetum glaucum (L. R.Br.], a close relative of Panicoideae food crops and bioenergy grasses, offers an ideal system to perform functional genomics studies related to C4 photosynthesis and abiotic stress tolerance. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR provides a sensitive platform to conduct such gene expression analyses. However, the lack of suitable internal control reference genes for accurate transcript normalization during qRT-PCR analysis in pearl millet is the major limitation. Here, we conducted a comprehensive assessment of 18 reference genes on 234 samples which included an array of different developmental tissues, hormone treatments and abiotic stress conditions from three genotypes to determine appropriate reference genes for accurate normalization of qRT-PCR data. Analyses of Ct values using Stability Index, BestKeeper, ΔCt, Normfinder, geNorm and RefFinder programs ranked PP2A, TIP41, UBC2, UBQ5 and ACT as the most reliable reference genes for accurate transcript normalization under different experimental conditions. Furthermore, we validated the specificity of these genes for precise quantification of relative gene expression and provided evidence that a combination of the best reference genes are required to obtain optimal expression patterns for both endogeneous genes as well as transgenes in pearl millet.

Evaluation of a duplex reverse-transcription real-time PCR assay for the detection of encephalomyocarditis virus.

Science.gov (United States)

Qin, Shaomin; Underwood, Darren; Driver, Luke; Kistler, Carol; Diallo, Ibrahim; Kirkland, Peter D

2018-06-01

We evaluated a fluorogenic probe-based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21-4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.

Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

Science.gov (United States)

Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

2016-04-01

Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

Influence of DNA extraction methods, PCR inhibitors and quantification methods on real-time PCR assay of biotechnology-derived traits.

Science.gov (United States)

Demeke, Tigst; Jenkins, G Ronald

2010-03-01

Biotechnology-derived varieties of canola, cotton, corn and soybean are being grown in the USA, Canada and other predominantly grain exporting countries. Although the amount of farmland devoted to production of biotechnology-derived crops continues to increase, lingering concerns that unintended consequences may occur provide the EU and most grain-importing countries with justification to regulate these crops. Legislation in the EU requires traceability of grains/oilseeds, food and feed products, and labelling, when a threshold level of 0.9% w/w of genetically engineered trait is demonstrated to be present in an analytical sample. The GE content is routinely determined by quantitative PCR (qPCR) and plant genomic DNA provides the template for the initial steps in this process. A plethora of DNA extraction methods exist for qPCR applications. Implementing standardized methods for detection of genetically engineered traits is necessary to facilitate grain marketing. The International Organization for Standardization draft standard 21571 identifies detergent-based methods and commercially available kits that are widely used for DNA extraction, but also indicates that adaptations may be necessary depending upon the sample matrix. This review assesses advantages and disadvantages of various commercially available DNA extraction kits, as well as modifications to published cetyltrimethylammonium bromide methods. Inhibitors are a major obstacle for efficient amplification in qPCR. The types of PCR inhibitors and techniques to minimize inhibition are discussed. Finally, accurate quantification of DNA for applications in qPCR is not trivial. Many confounders contribute to differences in analytical measurements when a particular DNA quantification method is applied and different methods do not always provide concordant results on the same DNA sample. How these differences impact measurement uncertainty in qPCR is considered.

Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.

Science.gov (United States)

Smith, Cindy J; Osborn, A Mark

2009-01-01

Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.

Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription.

Science.gov (United States)

Johnston, Stephen; Gallaher, Zachary; Czaja, Krzysztof

2012-05-15

Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2(-∆∆Ct) normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

International Nuclear Information System (INIS)

Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

1995-01-01

Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

Establishment and in-house validation of stem-loop RT PCR method for MicroRNA398 expression analysis

Directory of Open Access Journals (Sweden)

Timotijević Gordana S.

2015-01-01

Full Text Available MicroRNAs (miRNAs belong to the class of small non-coding RNAs which have important roles throughout development as well as in plant response to diverse environmental stresses. Some of plant miRNAs are essential for regulation and maintenance of nutritive homeostasis when nutrients are in excess or shortage comparing to optimal concentration for certain plant species. Better understanding of miRNAs functions implies development of efficient technology for profiling their gene expression. We set out to establish validate the methodology for miRNA gene expression analysis in cucumber grown under suboptimal mineral nutrient regimes, including iron deficiency. Reverse transcription by “stem-loop” primers in combination with Real time PCR method is one of potential approaches for quantification of miRNA gene expression. In this paper we presented a method for “stem loop” primer design specific for miR398, as well as reaction optimization and determination of Real time PCR efficiency. Proving the accuracy of this method was imperative as “stem loop” RT which consider separate transcription of target and endogenous control. The method was verified by comparison of the obtained data with results of miR398 expression achieved using a commercial kit based on simultaneous conversion of all RNAs in cDNAs. [Projekat Ministarstva nauke Republike Srbije, br. 173005 i br. ON-173028

Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

International Nuclear Information System (INIS)

Rho, Hyun-Wook; Lee, Byoung-Chan; Choi, Eun-Seok; Choi, Il-Ju; Lee, Yeon-Su; Goh, Sung-Ho

2010-01-01

Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. We assessed the suitability of six possible reference genes, beta-actin (ACTB), glyceraldehydes-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyl transferase 1 (HPRT1), beta-2-microglobulin (B2M), ribosomal subunit L29 (RPL29) and 18S ribosomal RNA (18S rRNA) in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. This RT-qPCR study showed that there are statistically significant (p < 0.05) differences in the expression levels of HPRT1 and 18S rRNA in 'normal-' versus 'tumor stomach tissues'. The stability analyses by geNorm suggest B2M-GAPDH, as best reference gene combination for 'stomach cancer cell lines'; RPL29-HPRT1, for 'all stomach tissues'; and ACTB-18S rRNA, for 'all stomach cell lines and tissues'. NormFinder also identified B2M as the best reference gene for 'stomach cancer cell lines', RPL29-B2M for 'all stomach tissues', and 18S rRNA-ACTB for 'all stomach cell lines and tissues'. The comparisons of normalized expression of the target gene, GPNMB, showed different interpretation of target gene expression depend on best single reference gene or combination. This study validated RPL29 and RPL29-B2M as the best single reference

SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

Directory of Open Access Journals (Sweden)

Daijun Ling

Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Faggioli, F; Pasquini, G; Barba, M

1998-09-01

The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

External Quality Assessment for the Detection of Measles Virus by Reverse Transcription-PCR Using Armored RNA.

Directory of Open Access Journals (Sweden)

Dong Zhang

Full Text Available In recent years, nucleic acid tests for detection of measles virus RNA have been widely applied in laboratories belonging to the measles surveillance system of China. An external quality assessment program was established by the National Center for Clinical Laboratories to evaluate the performance of nucleic acid tests for measles virus. The external quality assessment panel, which consisted of 10 specimens, was prepared using armored RNAs, complex of noninfectious MS2 bacteriophage coat proteins encapsulated RNA of measles virus, as measles virus surrogate controls. Conserved sequences amplified from a circulating measles virus strain or from a vaccine strain were encapsulated into these armored RNAs. Forty-one participating laboratories from 15 provinces, municipalities, or autonomous regions that currently conduct molecular detection of measles virus enrolled in the external quality assessment program, including 40 measles surveillance system laboratories and one diagnostic reagent manufacturer. Forty laboratories used commercial reverse transcription-quantitative PCR kits, with only one laboratory applying a conventional PCR method developed in-house. The results indicated that most of the participants (38/41, 92.7% were able to accurately detect the panel with 100% sensitivity and 100% specificity. Although a wide range of commercially available kits for nucleic acid extraction and reverse transcription polymerase chain reaction were used by the participants, only two false-negative results and one false-positive result were generated; these were generated by three separate laboratories. Both false-negative results were obtained with tests performed on specimens with the lowest concentration (1.2 × 104 genomic equivalents/mL. In addition, all 18 participants from Beijing achieved 100% sensitivity and 100% specificity. Overall, we conclude that the majority of the laboratories evaluated have reliable diagnostic capacities for the detection

Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method

DEFF Research Database (Denmark)

Malorny, B.; Hoorfar, Jeffrey; Hugas, M.

2003-01-01

A collaborative study involving four European laboratories was conducted to investigate the diagnostic accuracy of a Salmonella specific PCR-based method, which was evaluated within the European FOOD-PCR project (http://www.pcr.dk). Each laboratory analysed by the PCR a set of independent obtained...... presumably naturally contaminated samples and compared the results with the microbiological culture method. The PCR-based method comprised a preenrichment step in buffered peptone water followed by a thermal cell lysis using a closed tube resin-based method. Artificially contaminated minced beef and whole......-based diagnostic methods and is currently proposed as international standard document....

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

Science.gov (United States)

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS

Directory of Open Access Journals (Sweden)

Tülin GÜVEN GÖKMEN

Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.

Frequency of BCR-ABL Transcript Types in Syrian CML Patients

Directory of Open Access Journals (Sweden)

Sulaf Farhat-Maghribi

2016-01-01

Full Text Available Background. In Syria, CML patients are started on tyrosine kinase inhibitors (TKIs and monitored until complete molecular response is achieved. BCR-ABL mRNA transcript type is not routinely identified, contrary to the recommendations. In this study we aimed to identify the frequency of different BCR-ABL transcripts in Syrian CML patients and highlight their significance on monitoring and treatment protocols. Methods. CML patients positive for BCR-ABL transcripts by quantitative RT-PCR were enrolled. BCR-ABL transcript types were investigated using a home-made PCR method that was adapted from published protocols and optimized. The transcript types were then confirmed using a commercially available research kit. Results. Twenty-four transcripts were found in 21 patients. The most common was b2a2, followed by b3a2, b3a3, and e1a3 present solely in 12 (57.1%, 3 (14.3%, 2 (9.5%, and 1 (4.8%, respectively. Three samples (14.3% contained dual transcripts. While b3a2 transcript was apparently associated with warning molecular response to imatinib treatment, b2a2, b3a3, and e1a3 transcripts collectively proved otherwise (P=0.047. Conclusion. It might be advisable to identify the BCR-ABL transcript type in CML patients at diagnosis, using an empirically verified method, in order to link the detected transcript with the clinical findings, possible resistance to treatment, and appropriate monitoring methods.

Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

Science.gov (United States)

Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

2017-04-01

Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

Method to determine transcriptional regulation pathways in organisms

Science.gov (United States)

Gardner, Timothy S.; Collins, James J.; Hayete, Boris; Faith, Jeremiah

2012-11-06

The invention relates to computer-implemented methods and systems for identifying regulatory relationships between expressed regulating polypeptides and targets of the regulatory activities of such regulating polypeptides. More specifically, the invention provides a new method for identifying regulatory dependencies between biochemical species in a cell. In particular embodiments, provided are computer-implemented methods for identifying a regulatory interaction between a transcription factor and a gene target of the transcription factor, or between a transcription factor and a set of gene targets of the transcription factor. Further provided are genome-scale methods for predicting regulatory interactions between a set of transcription factors and a corresponding set of transcriptional target substrates thereof.

Enteroviruses in blood of patients with type 1 diabetes detected by integrated cell culture and reverse transcription quantitative real-time PCR.

Science.gov (United States)

Alidjinou, Enagnon Kazali; Sane, Famara; Lefevre, Christine; Baras, Agathe; Moumna, Ilham; Engelmann, Ilka; Vantyghem, Marie-Christine; Hober, Didier

2017-11-01

Enteroviruses (EV) have been associated with type 1 diabetes (T1D), but EV RNA detection has been reported in only a small proportion of T1D patients. We studied whether integrated cell culture and reverse transcription real-time PCR could improve EV detection in blood samples from patients with T1D. Blood was collected from 13 patients with T1D. The presence of EV RNA in blood was investigated by using real-time RT-PCR. In addition, plasma and white blood cells (WBC) were inoculated to BGM and Vero cell line cultures. Culture supernatants and cells collected on day 7 and day 14 were tested for EV RNA by real-time RT-PCR. Enterovirus identification was performed through sequencing of the VP4/VP2 region. Enterovirus RNA was detected in blood by using real-time RT-PCR in only one out of 13 patients. The detection of EV RNA in cultures inoculated with clinical samples (plasma and/or WBC) gave positive results in five other patients. The viral loads were low, ranging from 45 to 4420 copies/ng of total RNA. One isolate was successfully identified as coxsackievirus B1. Integrated cell culture and reverse transcription real-time PCR can improve the detection rate of EV in blood samples of patients with T1D and can be useful to investigate further the relationship between EV and the disease.

The hsp 16 Gene of the Probiotic Lactobacillus acidophilus Is Differently Regulated by Salt, High Temperature and Acidic Stresses, as Revealed by Reverse Transcription Quantitative PCR (qRT-PCR Analysis

Directory of Open Access Journals (Sweden)

Daniela Fiocco

2011-08-01

Full Text Available Small heat shock proteins (sHsps are ubiquitous conserved chaperone-like proteins involved in cellular proteins protection under stressful conditions. In this study, a reverse transcription quantitative PCR (RT-qPCR procedure was developed and used to quantify the transcript level of a small heat shock gene (shs in the probiotic bacterium Lactobacillus acidophilus NCFM, under stress conditions such as heat (45 °C and 53 °C, bile (0.3% w/v, hyperosmosis (1 M and 2.5 M NaCl, and low pH value (pH 4. The shs gene of L. acidophilus NCFM was induced by salt, high temperature and acidic stress, while repression was observed upon bile stress. Analysis of the 5' noncoding region of the hsp16 gene reveals the presence of an inverted repeat (IR sequence (TTAGCACTC-N9-GAGTGCTAA homologue to the controlling IR of chaperone expression (CIRCE elements found in the upstream regulatory region of Gram-positive heat shock operons, suggesting that the hsp16 gene of L. acidophilus might be transcriptionally controlled by HrcA. In addition, the alignment of several small heat shock proteins identified so far in lactic acid bacteria, reveals that the Hsp16 of L. acidophilus exhibits a strong evolutionary relationship with members of the Lactobacillus acidophilus group.

Simultaneous detection of four garlic viruses by multiplex reverse transcription PCR and their distribution in Indian garlic accessions.

Science.gov (United States)

Majumder, S; Baranwal, V K

2014-06-01

Indian garlic is infected with Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV), Garlic common latent virus (GarCLV) and allexiviruses. Identity and distribution of garlic viruses in various garlic accessions from different geographical regions of India were investigated. OYDV and allexiviruses were observed in all the garlic accessions, while SLV and GarCLV were observed only in a few accessions. A multiplex reverse transcription (RT)-PCR method was developed for the simultaneous detection and identification of OYDV, SLV, GarCLV and Allexivirus infecting garlic accessions in India. This multiplex protocol standardized in this study will be useful in indexing of garlic viruses and production of virus free seed material. Copyright © 2014 Elsevier B.V. All rights reserved.

Evaluation of methods for oligonucleotide array data via quantitative real-time PCR.

Science.gov (United States)

Qin, Li-Xuan; Beyer, Richard P; Hudson, Francesca N; Linford, Nancy J; Morris, Daryl E; Kerr, Kathleen F

2006-01-17

There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch) and a sequence-based method of background adjustment (as in gcRMA) as the most important factors in methods' performances. However, we found poor reliability for methods using mismatch probes for low-intensity genes

Evaluation of methods for oligonucleotide array data via quantitative real-time PCR

Directory of Open Access Journals (Sweden)

Morris Daryl E

2006-01-01

Full Text Available Abstract Background There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. Results We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch and a sequence-based method of background adjustment (as in gcRMA as the most important factors in methods' performances. However, we found poor reliability for methods

Rapid and sensitive detection of Feline immunodeficiency virus using an insulated isothermal PCR-based assay with a point-of-need PCR detection platform.

Science.gov (United States)

Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2015-07-01

Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).

[Optimized application of nested PCR method for detection of malaria].

Science.gov (United States)

Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

2017-04-28

Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

Detection of live Salmonella enterica in fresh-cut vegetables by a TaqMan-based one-step reverse transcription real-time PCR.

Science.gov (United States)

Miao, Y J; Xiong, G T; Bai, M Y; Ge, Y; Wu, Z F

2018-05-01

Fresh-cut produce is at greater risk of Salmonella contamination. Detection and early warning systems play an important role in reducing the dissemination of contaminated products. One-step Reverse Transcription Polymerase Chain Reaction (RT-qPCR) targeting Salmonella tmRNA with or without a 6-h enrichment was evaluated for the detection of Salmonella in fresh-cut vegetables after 6-h storage. LOD of one-step RT-qPCR was 1·0 CFU per ml (about 100 copies tmRNA per ml) by assessed 10-fold serially diluted RNA from 10 6 CFU per ml bacteria culture. Then, one-step RT-qPCR assay was applied to detect viable Salmonella cells in 14 fresh-cut vegetables after 6-h storage. Without enrichment, this assay could detect 10 CFU per g for fresh-cut lettuce, cilantro, spinach, cabbage, Chinese cabbage and bell pepper, and 10 2 CFU per g for other vegetables. With a 6-h enrichment, this assay could detect 10 CFU per g for all fresh-cut vegetables used in this study. Moreover, this assay was able to discriminate viable cells from dead cells. This rapid detection assay may provide potential processing control and early warning method in fresh-cut vegetable processing to strengthen food safety assurance. Significance and Impact of the Study: Fresh-cut produce is at greater risk of Salmonella contamination. Rapid detection methods play an important role in reducing the dissemination of contaminated products. One-step RT-qPCR assay used in this study could detect 10 CFU per g Salmonella for 14 fresh-cut vegetables with a 6-h short enrichment. Moreover, this assay was able to discriminate viable cells from dead cells. This rapid detection assay may provide potential processing control and early warning method in fresh-cut vegetable processing to strengthen food safety assurance. © 2018 The Society for Applied Microbiology.

Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

Science.gov (United States)

Altınel, Ahmet

2017-01-01

Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

Improved Safety for Molecular Diagnosis of Classical Rabies Viruses by Use of a TaqMan Real-Time Reverse Transcription-PCR "Double Check" Strategy

DEFF Research Database (Denmark)

Hoffmann, B.; Freuling, C. M.; Wakeley, P. R.

2010-01-01

To improve the diagnosis of classical rabies virus with molecular methods, a validated, ready-to-use, real-time reverse transcription-PCR (RT-PCR) assay was developed. In a first step, primers and 6-carboxyfluorescien-labeled TaqMan probes specific for rabies virus were selected from the consensus...... sequence of the nucleoprotein gene of 203 different rabies virus sequences derived from GenBank. The selected primer-probe combination was highly specific and sensitive. During validation using a sample set of rabies virus strains from the virus archives of the Friedrich-Loeffler-Institut (FLI; Germany......), the Veterinary Laboratories Agency (VLA; United Kingdom), and the DTU National Veterinary Institute (Lindholm, Denmark), covering the global diversity of rabies virus lineages, it was shown that both the newly developed assay and a previously described one had some detection failures. This was overcome...

[A new method of processing quantitative PCR data].

Science.gov (United States)

Ke, Bing-Shen; Li, Guang-Yun; Chen, Shi-Min; Huang, Xiang-Yan; Chen, Ying-Jian; Xu, Jun

2003-05-01

Today standard PCR can't satisfy the need of biotechnique development and clinical research any more. After numerous dynamic research, PE company found there is a linear relation between initial template number and cycling time when the accumulating fluorescent product is detectable.Therefore,they developed a quantitative PCR technique to be used in PE7700 and PE5700. But the error of this technique is too great to satisfy the need of biotechnique development and clinical research. A better quantitative PCR technique is needed. The mathematical model submitted here is combined with the achievement of relative science,and based on the PCR principle and careful analysis of molecular relationship of main members in PCR reaction system. This model describes the function relation between product quantity or fluorescence intensity and initial template number and other reaction conditions, and can reflect the accumulating rule of PCR product molecule accurately. Accurate quantitative PCR analysis can be made use this function relation. Accumulated PCR product quantity can be obtained from initial template number. Using this model to do quantitative PCR analysis,result error is only related to the accuracy of fluorescence intensity or the instrument used. For an example, when the fluorescence intensity is accurate to 6 digits and the template size is between 100 to 1,000,000, the quantitative result accuracy will be more than 99%. The difference of result error is distinct using same condition,same instrument but different analysis method. Moreover,if the PCR quantitative analysis system is used to process data, it will get result 80 times of accuracy than using CT method.

Development of an in situ magnetic beads based RT-PCR method for electrochemiluminescent detection of rotavirus

Science.gov (United States)

Zhan, Fangfang; Zhou, Xiaoming

2012-12-01

Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.

DNA extraction method for PCR in mycorrhizal fungi.

Science.gov (United States)

Manian, S; Sreenivasaprasad, S; Mills, P R

2001-10-01

To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

Science.gov (United States)

Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

2016-09-01

Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

PCR IN TRAUMATOLOGY AND ORTHOPAEDICS: METHOD DESCRIPTION AND APPLICABILITY

Directory of Open Access Journals (Sweden)

E. M. Polyakova

2014-01-01

Full Text Available Review brief presents description of polymerase chain reaction method (PCR and its most common variants. Three PCR-based lines of research, carried out in the traumatology and orthopaedics, include identifying a causative agents of the implant-associated infection after orthopaedic surgery; detection of antibiotic resistance genes and biofilm forming genes. It was shown that PCR can be used as additional method for detection of genetic disorders, significant for traumatology and orthopaedics, and for investigation of cartilage and bone regeneration.

A novel method for detection of dioxins. Exonuclease protection mediated PCR assay

Energy Technology Data Exchange (ETDEWEB)

Xu, S.Q.; Sun, X.; Li, F.; Li, B.S. [Huazhong Univ. of Science and Technology, Wuhan, HB (China). Tongji Medical College

2004-09-15

The aromatic hydrocarbon receptor (AhR) is a ligand-actived transcription factor that mediates many of the biologic and toxicologic effects of dioxin-like chemicals (DLCs), such as 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD). Numerous AhR-based bioassays for identification and detection of DLCs have been developed in vitro. Such as the chemical-activated luciferase gene expression (CALUX), ethoxyresolufin-O-deethylase (EROD) activity are sometimes represented as the next best system when compared with whole body or in vivo systems. However, cell systems can be affected by the toxic chemical itself during the assay, thus confusing problems couldn't be avoided in the assay. Incorporation of metabolism in cell systems with uncertain consequences prolongs assay complexity and time. Thus these drawbacks limit the utility of cell systems for screening purposes. Most cell-free bioassays require radioactivity, such as the gel retardation of AhR binding (GRAB) assay, or antibody of AhR or ligand, which are unfeasible for some laboratories. Here a cell-free bioanalysis method, Exonuclease Protection Mediated PCR (EPM-PCR) bioassay, was established for detection of AhR ligands based on the binding of the dioxin:AhR complex to the specific DNA. EPM-PCR can provide indirect detection of ligands by quantification of the specific AhR-binding DNA, no necessary of any DNA labeling and sophisticated equipments. This new bioassay not only has the higher sensitivity and specificity, but it is rapid and easy to perform.

Field-Deployable Reverse Transcription-Insulated Isothermal PCR (RT-iiPCR) Assay for Rapid and Sensitive Detection of Foot-and-Mouth Disease Virus.

Science.gov (United States)

Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O

2017-10-01

Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT ™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco ™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.

Transcription-based prediction of response to IFNbeta using supervised computational methods.

Directory of Open Access Journals (Sweden)

Sergio E Baranzini

2005-01-01

Full Text Available Changes in cellular functions in response to drug therapy are mediated by specific transcriptional profiles resulting from the induction or repression in the activity of a number of genes, thereby modifying the preexisting gene activity pattern of the drug-targeted cell(s. Recombinant human interferon beta (rIFNbeta is routinely used to control exacerbations in multiple sclerosis patients with only partial success, mainly because of adverse effects and a relatively large proportion of nonresponders. We applied advanced data-mining and predictive modeling tools to a longitudinal 70-gene expression dataset generated by kinetic reverse-transcription PCR from 52 multiple sclerosis patients treated with rIFNbeta to discover higher-order predictive patterns associated with treatment outcome and to define the molecular footprint that rIFNbeta engraves on peripheral blood mononuclear cells. We identified nine sets of gene triplets whose expression, when tested before the initiation of therapy, can predict the response to interferon beta with up to 86% accuracy. In addition, time-series analysis revealed potential key players involved in a good or poor response to interferon beta. Statistical testing of a random outcome class and tolerance to noise was carried out to establish the robustness of the predictive models. Large-scale kinetic reverse-transcription PCR, coupled with advanced data-mining efforts, can effectively reveal preexisting and drug-induced gene expression signatures associated with therapeutic effects.

Automated PCR setup for forensic casework samples using the Normalization Wizard and PCR Setup robotic methods.

Science.gov (United States)

Greenspoon, S A; Sykes, K L V; Ban, J D; Pollard, A; Baisden, M; Farr, M; Graham, N; Collins, B L; Green, M M; Christenson, C C

2006-12-20

Human genome, pharmaceutical and research laboratories have long enjoyed the application of robotics to performing repetitive laboratory tasks. However, the utilization of robotics in forensic laboratories for processing casework samples is relatively new and poses particular challenges. Since the quantity and quality (a mixture versus a single source sample, the level of degradation, the presence of PCR inhibitors) of the DNA contained within a casework sample is unknown, particular attention must be paid to procedural susceptibility to contamination, as well as DNA yield, especially as it pertains to samples with little biological material. The Virginia Department of Forensic Science (VDFS) has successfully automated forensic casework DNA extraction utilizing the DNA IQ(trade mark) System in conjunction with the Biomek 2000 Automation Workstation. Human DNA quantitation is also performed in a near complete automated fashion utilizing the AluQuant Human DNA Quantitation System and the Biomek 2000 Automation Workstation. Recently, the PCR setup for casework samples has been automated, employing the Biomek 2000 Automation Workstation and Normalization Wizard, Genetic Identity version, which utilizes the quantitation data, imported into the software, to create a customized automated method for DNA dilution, unique to that plate of DNA samples. The PCR Setup software method, used in conjunction with the Normalization Wizard method and written for the Biomek 2000, functions to mix the diluted DNA samples, transfer the PCR master mix, and transfer the diluted DNA samples to PCR amplification tubes. Once the process is complete, the DNA extracts, still on the deck of the robot in PCR amplification strip tubes, are transferred to pre-labeled 1.5 mL tubes for long-term storage using an automated method. The automation of these steps in the process of forensic DNA casework analysis has been accomplished by performing extensive optimization, validation and testing of the

Quantification of organellar DNA and RNA using real-time PCR.

Science.gov (United States)

Weihe, Andreas

2014-01-01

Quantitative (real-time) polymerase chain reaction (PCR) allows the measurement of relative organellar gene copy numbers as well as transcript abundance of individual mitochondrial or plastidial genes. Requiring only minute amounts of total DNA or RNA, the described method can replace traditional analyses like Southern or Northern hybridization which require large amounts of organellar nucleic acids and usually provide only semiquantitative data. Here we describe prerequisites, reaction conditions, and data analysis principles, which should be applicable for a wide range of plant species and experimental situations where comparative and precise determination of gene copy numbers or transcript abundance is requested. Sequences of amplification primers for qPCR of organellar genes from Arabidopsis are provided.

Designing multiplex PCR system of Campylobacter jejuni for efficient typing by improving monoplex PCR binary typing method.

Science.gov (United States)

Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro

2015-01-01

Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Blood grouping based on PCR methods and agarose gel electrophoresis.

Science.gov (United States)

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Detection of Tilapia Lake Virus in Clinical Samples by Culturing and Nested Reverse Transcription-PCR.

Science.gov (United States)

Kembou Tsofack, Japhette Esther; Zamostiano, Rachel; Watted, Salsabeel; Berkowitz, Asaf; Rosenbluth, Ezra; Mishra, Nischay; Briese, Thomas; Lipkin, W Ian; Kabuusu, Richard M; Ferguson, Hugh; Del Pozo, Jorge; Eldar, Avi; Bacharach, Eran

2017-03-01

Tilapia are an important group of farmed fish that serve as a significant protein source worldwide. In recent years, substantial mortality of wild tilapia has been observed in the Sea of Galilee and in commercial ponds in Israel and Ecuador. We have identified the etiological agent of these mass die-offs as a novel orthomyxo-like virus and named it tilapia lake virus (TiLV). Here, we provide the conditions for efficient isolation, culturing, and quantification of the virus, including the use of susceptible fish cell lines. Moreover, we describe a sensitive nested reverse transcription-PCR (RT-PCR) assay allowing the rapid detection of TiLV in fish organs. This assay revealed, for the first time to our knowledge, the presence of TiLV in diseased Colombian tilapia, indicating a wider distribution of this emerging pathogen and stressing the risk that TiLV poses for the global tilapia industry. Overall, the described procedures should provide the tilapia aquaculture industry with important tools for the detection and containment of this pathogen. Copyright © 2017 American Society for Microbiology.

Detection of Tilapia Lake Virus in Clinical Samples by Culturing and Nested Reverse Transcription-PCR

Science.gov (United States)

Kembou Tsofack, Japhette Esther; Zamostiano, Rachel; Watted, Salsabeel; Berkowitz, Asaf; Rosenbluth, Ezra; Mishra, Nischay; Briese, Thomas; Lipkin, W. Ian; Kabuusu, Richard M.; Ferguson, Hugh; del Pozo, Jorge

2016-01-01

ABSTRACT Tilapia are an important group of farmed fish that serve as a significant protein source worldwide. In recent years, substantial mortality of wild tilapia has been observed in the Sea of Galilee and in commercial ponds in Israel and Ecuador. We have identified the etiological agent of these mass die-offs as a novel orthomyxo-like virus and named it tilapia lake virus (TiLV). Here, we provide the conditions for efficient isolation, culturing, and quantification of the virus, including the use of susceptible fish cell lines. Moreover, we describe a sensitive nested reverse transcription-PCR (RT-PCR) assay allowing the rapid detection of TiLV in fish organs. This assay revealed, for the first time to our knowledge, the presence of TiLV in diseased Colombian tilapia, indicating a wider distribution of this emerging pathogen and stressing the risk that TiLV poses for the global tilapia industry. Overall, the described procedures should provide the tilapia aquaculture industry with important tools for the detection and containment of this pathogen. PMID:27974544

Comparison of Nested-PCR technique and culture method in ...

African Journals Online (AJOL)

USER

2010-04-05

Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.

Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

Science.gov (United States)

Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

2004-03-01

Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

Virus isolation vs RT-PCR: which method is more successful in detecting VHSV and IHNV in fish tissue sampled under field conditions?

DEFF Research Database (Denmark)

Knüsel, R.; Bergmann, S. M.; Einer-Jensen, Katja

2007-01-01

in Switzerland. Compared to SPNT, the RT-PCR method detected, as with virus isolation, a much lower number of positive cases; reasons for this discrepancy are discussed. Our results indicate that RT-PCR can not only be successfully applied in field surveys, but may also be slightly more sensitive than virus......This study compared the results of reverse transcription-polymerase chain reaction (RT-PCR) and traditional virus isolation on cell culture in detection of viral haemorrhagic septicaemia virus (VHSV) and infectious haematopoietic necrosis virus (IHNV). RT-PCR was used for 172 tissue sample pools...... (total of 859 fish) originating from a field survey on the occurrence of VHSV and IHNV in farmed and wild salmonids in Switzerland. These samples represented all sites with fish that were either identified as virus-positive by means of virus isolation (three sites, four positive tissue sample pools) and...

Development of a PCR-RFLP method based on the transcription elongation factor 1-α gene to differentiate Fusarium graminearum from other species within the Fusarium graminearum species complex.

Science.gov (United States)

Garmendia, Gabriela; Umpierrez-Failache, Mariana; Ward, Todd J; Vero, Silvana

2018-04-01

Fusarium head blight (FHB) is a destructive disease of cereals crops worldwide and a major food safety concern due to grain contamination with trichothecenes and other mycotoxins. Fusarium graminearum, a member of the Fusarium graminearum species complex (FGSC) is the dominant FHB pathogen in many parts of the world. However, a number of other Fusarium species, including other members of the FGSC, may also be present for example in Argentina, New Zealand, Ethiopia, Nepal, Unites States in cereals such as wheat and barley. Proper species identification is critical to research aimed at improving disease and mycotoxin control programs. Identification of Fusarium species is are often unreliable by traditional, as many species are morphologically cryptic. DNA sequence-based methods offer a reliable means of species identification, but can be expensive when applied to the analyses of population samples. To facilitate identification of the major causative agent of FHB, this work describes an easy and inexpensive method to differentiate F. graminearum from the remaining species within the FGSC and from the other common Fusarium species causing FHB in cereals. The developed method is based on a PCR-RFLP of the transcription elongation factor (TEF 1-α) gene using the restriction enzyme BsaHI. Copyright © 2017 Elsevier Ltd. All rights reserved.

Normalization with Corresponding Naïve Tissue Minimizes Bias Caused by Commercial Reverse Transcription Kits on Quantitative Real-Time PCR Results.

Directory of Open Access Journals (Sweden)

Andreas Garcia-Bardon

Full Text Available Real-time reverse transcription polymerase chain reaction (PCR is the gold standard for expression analysis. Designed to improve reproducibility and sensitivity, commercial kits are commonly used for the critical step of cDNA synthesis. The present study was designed to determine the impact of these kits. mRNA from mouse brains were pooled to create serial dilutions ranging from 0.0625 μg to 2 μg, which were transcribed into cDNA using four different commercial reverse-transcription kits. Next, we transcribed mRNA from brain tissue after acute brain injury and naïve mice into cDNA for qPCR. Depending on tested genes, some kits failed to show linear results in dilution series and revealed strong variations in cDNA yield. Absolute expression data in naïve and trauma settings varied substantially between these kits. Normalization with a housekeeping gene failed to reduce kit-dependent variations, whereas normalization eliminated differences when naïve samples from the same region were used. The study shows strong evidence that choice of commercial cDNA synthesis kit has a major impact on PCR results and, consequently, on comparability between studies. Additionally, it provides a solution to overcome this limitation by normalization with data from naïve samples. This simple step helps to compare mRNA expression data between different studies and groups.

A comparative study of digital PCR and real-time qPCR for the detection and quantification of HPV mRNA in sentinel lymph nodes of cervical cancer patients.

Science.gov (United States)

Carow, Katrin; Read, Christina; Häfner, Norman; Runnebaum, Ingo B; Corner, Adam; Dürst, Matthias

2017-10-30

Qualitative analyses showed that the presence of HPV mRNA in sentinel lymph nodes of cervical cancer patients with pN0 status is associated with significantly decreased recurrence free survival. To further address the clinical potential of the strategy and to define prognostic threshold levels it is necessary to use a quantitative assay. Here, we compare two methods of quantification: digital PCR and standard quantitative PCR. Serial dilutions of 5 ng-5 pg RNA (≙ 500-0.5 cells) of the cervical cancer cell line SiHa were prepared in 5 µg RNA of the HPV-negative human keratinocyte cell line HaCaT. Clinical samples consisted of 10 sentinel lymph nodes with varying HPV transcript levels. Reverse transcription of total RNA (5 µg RNA each) was performed in 100 µl and cDNA aliquots were analyzed by qPCR and dPCR. Digital PCR was run in the RainDrop ® Digital PCR system (RainDance Technologies) using a probe-based detection of HPV E6/E7 cDNA PCR products with 11 µl template. qPCR was done using a Rotor Gene Q 5plex HRM (Qiagen) amplifying HPV E6/E7 cDNA in a SYBR Green format with 1 µl template. For the analysis of both, clinical samples and serial dilution samples, dPCR and qPCR showed comparable sensitivity. With regard to reproducibility, both methods differed considerably, especially for low template samples. Here, we found with qPCR a mean variation coefficient of 126% whereas dPCR enabled a significantly lower mean variation coefficient of 40% (p = 0.01). Generally, we saw with dPCR a substantial reduction of subsampling errors, which most likely reflects the large cDNA amounts available for analysis. Compared to real-time PCR, dPCR shows higher reliability. Thus, our HPV mRNA dPCR assay holds promise for the clinical evaluation of occult tumor cells in histologically tumor-free lymph nodes in future studies.

Development and validation of quantitative PCR assays to measure cytokine transcript levels in the Florida manatee (Trichechus manatus latirostris)

Science.gov (United States)

Ferrante, Jason; Hunter, Margaret; Wellehan, James F.X.

2018-01-01

Cytokines have important roles in the mammalian response to viral and bacterial infections, trauma, and wound healing. Because of early cytokine production after physiologic stresses, the regulation of messenger RNA (mRNA) transcripts can be used to assess immunologic responses before changes in protein production. To detect and assess early immune changes in endangered Florida manatees (Trichechus manatus latirostris), we developed and validated a panel of quantitative PCR assays to measure mRNA transcription levels for the cytokines interferon (IFN)-γ; interleukin (IL)-2, -6, and -10; tumor necrosis factor-α, and the housekeeping genes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (reference genes). Assays were successfully validated using blood samples from free-ranging, apparently healthy manatees from the east and west coasts of central Florida. No cytokine or housekeeping gene transcription levels were significantly different among age classes or sexes. However, the transcription levels for GAPDH, IL-2, IL-6, and IFN-γ were significantly higher (Puse as a reference gene in future studies. Our assays can aid in the investigation of manatee immune response to physical trauma and novel or ongoing environmental stressors.

Usefulness of in-house PCR methods for hepatitis B virus DNA detection.

Science.gov (United States)

Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo

2015-10-01

The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.

Detection of EML4-ALK in lung adenocarcinoma using pleural effusion with FISH, IHC, and RT-PCR methods.

Directory of Open Access Journals (Sweden)

Leilei Liu

Full Text Available Anaplastic lymphoma kinase (ALK and echinoderm microtubule-associated protein-like 4 (EML4 gene rearrangements occur in approximately 5% of non-small-cell lung cancers (NSCLC, leading to the overexpression of anaplastic lymphoma kinase and predicting a response to the targeted inhibitor, crizotinib. Malignant pleural effusion occurs in most patients with advanced lung cancer, especially adenocarcinoma, and tissue samples are not always available from these patients. We attempted to clarify the feasibility of detecting the EML4-ALK fusion gene in pleural effusion cells using different methods. We obtained 66 samples of pleural effusion from NSCLC patients. The pleural effusion fluid was centrifuged, and the cellular components obtained were formalin fixed and paraffin embedded. The EML4-ALK fusion gene status was determined with fluorescent in situ hybridization (FISH, reverse transcription-polymerase chain reaction (RT-PCR, and immunohistochemistry (IHC. EML4-ALK was detected in three of 66 patient samples (4.5% with RT-PCR. When the RT-PCR data were used as the standard, one false positive and one false negative samples were identified with IHC; and one false negative sample was identified with FISH. These results suggest that a block of pleural effusion cells can be used to detect the EML4-ALK fusion gene. IHC had good sensitivity, but low specificity. FISH had low sensitivity, but high specificity. RT-PCR is a good candidate method for detecting EML4-ALK in blocks of pleural effusion cells from lung cancer patients.

A field based detection method for Rose rosette virus using isothermal probe-based Reverse transcription-recombinase polymerase amplification assay.

Science.gov (United States)

Babu, Binoy; Washburn, Brian K; Ertek, Tülin Sarigül; Miller, Steven H; Riddle, Charles B; Knox, Gary W; Ochoa-Corona, Francisco M; Olson, Jennifer; Katırcıoğlu, Yakup Zekai; Paret, Mathews L

2017-09-01

Rose rosette disease, caused by Rose rosette virus (RRV; genus Emaravirus) is a major threat to the rose industry in the U.S. The only strategy currently available for disease management is early detection and eradication of the infected plants, thereby limiting its potential spread. Current RT-PCR based diagnostic methods for RRV are time consuming and are inconsistent in detecting the virus from symptomatic plants. Real-time RT-qPCR assay is highly sensitive for detection of RRV, but it is expensive and requires well-equipped laboratories. Both the RT-PCR and RT-qPCR cannot be used in a field-based testing for RRV. Hence a novel probe based, isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA) assay, using primer/probe designed based on the nucleocapsid gene of the RRV has been developed. The assay is highly specific and did not give a positive reaction to other viruses infecting roses belonging to both inclusive and exclusive genus. Dilution assays using the in vitro transcript showed that the primer/probe set is highly sensitive, with a detection limit of 1 fg/μl. In addition, a rapid technique for the extraction of viral RNA (rose varieties, collected from different states in the U.S. The entire process, including the extraction can be completed in 25min, with less sophisticated equipments. The developed assay can be used with high efficiency in large scale field testing for rapid detection of RRV in commercial nurseries and landscapes. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection of Canine Distemper Virus Nucleoprotein RNA by Reverse Transcription-PCR Using Serum, Whole Blood, and Cerebrospinal Fluid from Dogs with Distemper

Science.gov (United States)

Frisk, A. L.; König, M.; Moritz, A.; Baumgärtner, W.

1999-01-01

Reverse transcription-PCR (RT-PCR) was used to detect canine distemper virus (CDV) nucleoprotein (NP) RNA in serum, whole blood, and cerebrospinal fluid (CSF) samples from 38 dogs with clinically suspected distemper. Results were correlated to clinical findings, anti-CDV neutralizing antibody titers, postmortem findings, and demonstration of CDV NP antigen by immunohistochemistry. The specificity of the RT-PCR was ensured by amplification of RNA from various laboratory CDV strains, restriction enzyme digestion, and Southern blot hybridization. In 29 of 38 dogs, CDV infection was confirmed by postmortem examination and immunohistochemistry. The animals displayed the catarrhal, systemic, and nervous forms of distemper. Seventeen samples (serum, whole blood, or CSF) from dogs with distemper were tested with three sets of primers targeted to different regions of the NP gene of the CDV Onderstepoort strain. Expected amplicons were observed in 82, 53, and 41% of the 17 samples, depending upon the primer pair used. With the most sensitive primer pair (primer pair I), CDV NP RNA was detected in 25 of 29 (86%) serum samples and 14 of 16 (88%) whole blood and CSF samples from dogs with distemper but not in body fluids from immunohistochemically negative dogs. Nucleotide sequence analysis of five RT-PCR amplicons from isolates from the field revealed few silent point mutations. These isolates exhibited greater homology to the Rockborn (97 to 99%) than to the Onderstepoort (95 to 96%) CDV strain. In summary, although the sensitivity of the RT-PCR for detection of CDV is strongly influenced by the location of the selected primers, this nucleic acid detection system represents a highly specific and sensitive method for the antemortem diagnosis of distemper in dogs, regardless of the form of distemper, humoral immune response, and viral antigen distribution. PMID:10523566

Evaluation of NGS and RT-PCR Methods for ALK Rearrangement in European NSCLC Patients: Results from the European Thoracic Oncology Platform Lungscape Project.

Science.gov (United States)

Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota; Smyth, Paul; Soltermann, Alex; Bubendorf, Lukas; Speel, Ernst-Jan; Marchetti, Antonio; Nonaka, Daisuke; Monkhorst, Kim; Hager, Henrik; Martorell, Miguel; Sejda, Aleksandra; Cheney, Richard; Hernandez-Losa, Javier; Verbeken, Eric; Weder, Walter; Savic, Spasenija; Di Lorito, Alessia; Navarro, Atilio; Felip, Enriqueta; Warth, Arne; Baas, Paul; Meldgaard, Peter; Blackhall, Fiona; Dingemans, Anne-Marie; Dienemann, Hendrik; Dziadziuszko, Rafal; Vansteenkiste, Johan; O'Brien, Cathal; Geiger, Thomas; Sherlock, Jon; Schageman, Jeoffrey; Dafni, Urania; Kammler, Roswitha; Kerr, Keith; Thunnissen, Erik; Stahel, Rolf; Peters, Solange

2018-03-01

The reported prevalence of ALK receptor tyrosine kinase gene (ALK) rearrangement in NSCLC ranges from 2% to 7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proved to be a reproducible and sensitive technique. Reverse-transcriptase polymerase chain reaction (RT-PCR) has also been advocated, and most recently, the advent of targeted next-generation sequencing (NGS) for ALK and other fusions has become possible. This study compares anaplastic lymphoma kinase (ALK) evaluation with all four techniques in resected NSCLC from the large European Thoracic Oncology Platform Lungscape cohort. A total of 96 cases from the European Thoracic Oncology Platform Lungscape iBiobank, with any ALK immunoreactivity were examined by FISH, central RT-PCR, and NGS. An H-score higher than 120 defines IHC positivity. RNA was extracted from the same formalin-fixed, paraffin-embedded tissues. For RT-PCR, primers covered the most frequent ALK translocations. For NGS, the Oncomine Solid Tumour Fusion Transcript Kit (Thermo Fisher Scientific, Waltham, MA) was used. The concordance was assessed using the Cohen κ coefficient (two-sided α ≤ 5%). NGS provided results for 77 of the 95 cases tested (81.1%), whereas RT-PCR provided results for 77 of 96 (80.2%). Concordance occurred in 55 cases of the 60 cases tested with all four methods (43 ALK negative and 12 ALK positive). Using ALK copositivity for IHC and FISH as the criterion standard, we derived a sensitivity for RT-PCR/NGS of 70.0%/85.0%, with a specificity of 87.1%/79.0%. When either RT-PCR or NGS was combined with IHC, the sensitivity remained the same, whereas the specificity increased to 88.7% and 83.9% respectively. NGS evaluation with the Oncomine Solid Tumour Fusion transcript kit and RT-PCR proved to have high sensitivity and specificity, advocating their use in routine practice. For maximal sensitivity and specificity, ALK status should be

Identification and validation of quantitative real-time reverse transcription PCR reference genes for gene expression analysis in teak (Tectona grandis L.f.).

Science.gov (United States)

Galeano, Esteban; Vasconcelos, Tarcísio Sales; Ramiro, Daniel Alves; De Martin, Valentina de Fátima; Carrer, Helaine

2014-07-22

Teak (Tectona grandis L.f.) is currently the preferred choice of the timber trade for fabrication of woody products due to its extraordinary qualities and is widely grown around the world. Gene expression studies are essential to explore wood formation of vascular plants, and quantitative real-time reverse transcription PCR (qRT-PCR) is a sensitive technique employed for quantifying gene expression levels. One or more appropriate reference genes are crucial to accurately compare mRNA transcripts through different tissues/organs and experimental conditions. Despite being the focus of some genetic studies, a lack of molecular information has hindered genetic exploration of teak. To date, qRT-PCR reference genes have not been identified and validated for teak. Identification and cloning of nine commonly used qRT-PCR reference genes from teak, including ribosomal protein 60s (rp60s), clathrin adaptor complexes medium subunit family (Cac), actin (Act), histone 3 (His3), sand family (Sand), β-Tubulin (Β-Tub), ubiquitin (Ubq), elongation factor 1-α (Ef-1α), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Expression profiles of these genes were evaluated by qRT-PCR in six tissue and organ samples (leaf, flower, seedling, root, stem and branch secondary xylem) of teak. Appropriate gene cloning and sequencing, primer specificity and amplification efficiency was verified for each gene. Their stability as reference genes was validated by NormFinder, BestKeeper, geNorm and Delta Ct programs. Results obtained from all programs showed that TgUbq and TgEf-1α are the most stable genes to use as qRT-PCR reference genes and TgAct is the most unstable gene in teak. The relative expression of the teak cinnamyl alcohol dehydrogenase (TgCAD) gene in lignified tissues at different ages was assessed by qRT-PCR, using TgUbq and TgEf-1α as internal controls. These analyses exposed a consistent expression pattern with both reference genes. This study proposes a first broad

Numeric definition of the clinical performance of the nested reverse transcription-PCR for detection of hematogenous epithelial cells and correction for specific mRNA of non-target cell origin as evaluated for prostate cancer cells

NARCIS (Netherlands)

Schamhart, Denis; Swinnen, Johannes; Kurth, Karl-Heinz; Westerhof, Alex; Kusters, Ron; Borchers, Holger; Sternberg, Cora

2003-01-01

Background: Inappropriate quality management,of reverse transcription-PCR (RT-PCR) assays for the detection of blood-borne prostate cancer (PCa) cells hampers clinical conclusions. Improvement of the RT-PCR-methodology for prostate-specific, antigen (PSA) mRNA should focus on an appropriate numeric.

Reverse transcriptase real-time PCR for detection and quantification of viable Campylobacter jejuni directly from poultry faecal samples

DEFF Research Database (Denmark)

Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

2012-01-01

Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...

Development of a Rapid Detection Method for Potato virus X by Reverse Transcription Loop-Mediated Isothermal Amplification

Directory of Open Access Journals (Sweden)

Joojin Jeong

2015-09-01

Full Text Available The primary step for efficient control of viral diseases is the development of simple, rapid, and sensitive virus detection. Reverse transcription loop-mediated isothermal amplification (RT-LAMP has been used to detect viral RNA molecules because of its simplicity and high sensitivity for a number of viruses. RT-LAMP for the detection of Potato virus X (PVX was developed and compared with conventional reverse transcription polymerase chain reaction (RT-PCR to demonstrate its advantages over RT-PCR. RT-LAMP reactions were conducted with or without a set of loop primers since one out of six primers showed PVX specificity. Based on real-time monitoring, RT-LAMP detected PVX around 30 min, compared to 120 min for RT-PCR. By adding a fluorescent reagent during the reaction, the extra step of visualization by gel electrophoresis was not necessary. RT-LAMP was conducted using simple inexpensive instruments and a regular incubator to evaluate whether RNA could be amplified at a constant temperature instead of using an expensive thermal cycler. This study shows the potential of RT-LAMP for the diagnosis of viral diseases and PVX epidemiology because of its simplicity and rapidness compared to RT-PCR.

A standard curve based method for relative real time PCR data processing

Directory of Open Access Journals (Sweden)

Krause Andreas

2005-03-01

Full Text Available Abstract Background Currently real time PCR is the most precise method by which to measure gene expression. The method generates a large amount of raw numerical data and processing may notably influence final results. The data processing is based either on standard curves or on PCR efficiency assessment. At the moment, the PCR efficiency approach is preferred in relative PCR whilst the standard curve is often used for absolute PCR. However, there are no barriers to employ standard curves for relative PCR. This article provides an implementation of the standard curve method and discusses its advantages and limitations in relative real time PCR. Results We designed a procedure for data processing in relative real time PCR. The procedure completely avoids PCR efficiency assessment, minimizes operator involvement and provides a statistical assessment of intra-assay variation. The procedure includes the following steps. (I Noise is filtered from raw fluorescence readings by smoothing, baseline subtraction and amplitude normalization. (II The optimal threshold is selected automatically from regression parameters of the standard curve. (III Crossing points (CPs are derived directly from coordinates of points where the threshold line crosses fluorescence plots obtained after the noise filtering. (IV The means and their variances are calculated for CPs in PCR replicas. (V The final results are derived from the CPs' means. The CPs' variances are traced to results by the law of error propagation. A detailed description and analysis of this data processing is provided. The limitations associated with the use of parametric statistical methods and amplitude normalization are specifically analyzed and found fit to the routine laboratory practice. Different options are discussed for aggregation of data obtained from multiple reference genes. Conclusion A standard curve based procedure for PCR data processing has been compiled and validated. It illustrates that

Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

Science.gov (United States)

Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

2017-07-25

Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

Transcription-based model for the induction of chromosomal exchange events by ionising radiation

International Nuclear Information System (INIS)

Radford, I.A.

2003-01-01

The mechanistic basis for chromosomal aberration formation, following exposure of mammalian cells to ionising radiation, has long been debated. Although chromosomal aberrations are probably initiated by DNA double-strand breaks (DSB), little is understood about the mechanisms that generate and modulate DNA rearrangement. Based on results from our laboratory and data from the literature, a novel model of chromosomal aberration formation has been suggested (Radford 2002). The basic postulates of this model are that: (1) DSB, primarily those involving multiple individual damage sites (i.e. complex DSB), are the critical initiating lesion; (2) only those DSB occurring in transcription units that are associated with transcription 'factories' (complexes containing multiple transcription units) induce chromosomal exchange events; (3) such DSB are brought into contact with a DNA topoisomerase I molecule through RNA polymerase II catalysed transcription and give rise to trapped DNA-topo I cleavage complexes; and (4) trapped complexes interact with another topo I molecule on a temporarily inactive transcription unit at the same transcription factory leading to DNA cleavage and subsequent strand exchange between the cleavage complexes. We have developed a method using inverse PCR that allows the detection and sequencing of putative ionising radiation-induced DNA rearrangements involving different regions of the human genome (Forrester and Radford 1998). The sequences detected by inverse PCR can provide a test of the prediction of the transcription-based model that ionising radiation-induced DNA rearrangements occur between sequences in active transcription units. Accordingly, reverse transcriptase PCR was used to determine if sequences involved in rearrangements were transcribed in the test cells. Consistent with the transcription-based model, nearly all of the sequences examined gave a positive result to reverse transcriptase PCR (Forrester and Radford unpublished)

Application of anti-listerial bacteriocins: monitoring enterocin expression by multiplex relative reverse transcription-PCR.

Science.gov (United States)

Williams, D Ross; Chanos, Panagiotis

2012-12-01

Listeriosis is a deadly food-borne disease, and its incidence may be limited through the biotechnological exploitation of a number of anti-listerial biocontrol agents. The most widely used of these agents are bacteriocins and the Class II enterocins are characterized by their activity against Listeria. Enterocins are primarily produced by enterococci, particularly Enterococcus faecium and many strains have been described, often encoding multiple bacteriocins. The use of these strains in food will require that they are free of virulence functions and that they exhibit a high level expression of anti-listerial enterocins in fermentation conditions. Multiplex relative RT (reverse transcription)-PCR is a technique that is useful in the discovery of advantageous expression characteristics among enterocin-producing strains. It allows the levels of individual enterocin gene expression to be monitored and determination of how expression is altered under different growth conditions.

Comparison of PCR method with the culture method for identification of gonococci from endocervical swabs

Directory of Open Access Journals (Sweden)

Alam A

2002-01-01

Full Text Available Gonococcal infection remains still a major cause of morbidity among sexually active individuals. Diagnosis of the infection in a female case is more difficult than that in a male. This was a prospective study among 269 female commercial sex workers (CSWs to screen them for gonococcal infection, comparing the rapid method of identification of gonococci by polymerase chain reaction (PCR with the selective culture method. A total of 92 (34.2% CSWs were identified positive for Neisseria gonorrhoeae by combination of the two methods. The PCR method identified 87 of the specimens to harbour cppB gene of N. gonorrhoeae, whereas culture method identified 83 specimens showing colonies of gonococci. Taking into consideration of the total positive cases (92, the PCR method showed a sensitivity of 94.57%, whereas sensitivity of culture method was 90.22%. The selective culture method appears to be the most applicable in the identification of gonococci from clinical specimens, particularly in the less resourceful countries like Bangladesh.

Evaluation of Reference Genes for Reverse Transcription Quantitative PCR Studies of Physiological Responses in the Ghost Moth, Thitarodes armoricanus (Lepidoptera, Hepialidae.

Directory of Open Access Journals (Sweden)

Guiqing Liu

Full Text Available Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is the sensitive method to quantify the expression levels of target genes on the basis of endogenous control. An appropriate reference gene set for normalization is essential for reliable results. The ghost moth, Thitarodes armoricanus, a host species of a medicinal fungus, Ophiocordyceps sinensis, is an economically important member of the Lepidoptera. Recent studies have focused on the mechanism of adaptation of this species to its high-altitude environment and host immune response to O. sinensis infection and RT-qPCR is commonly used in these studies to decipher the genetic basis of physiological functions. However, a thorough assessment of candidate reference genes in the genus Thitarodes is lacking. Here, the expression levels of eight candidate reference genes (ACT, EF, EIF4A, GAPDH, G6PDH, RPL13A, TUB and 18S in T. armoricanus at different developmental stages and in different body parts of the seventh instar larvae were analyzed, along with larvae kept under low temperatures, larvae exposed to two fungal infections and larvae fed different diets. Three established software programs-Bestkeeper, geNorm and NormFinder-were employed to calculate variation among the treatments. The results revealed that the best-suited reference genes differed across the treatments, with EF, EIF4A and GAPDH found to be the best suited for the different developmental stages and larvae body parts; EF, EIF4A and RPL13A found to be the best suited for low-temperature challenge; and EF, EIF4A and TUB found to be the best suited for the fungal infections and dietary treatments. This study thus further contributes to the establishment of an accurate method for normalizing RT-qPCR results for T. armoricanus and serves as a reference for gene expression studies of related insect species.

Application of a Receptor-Binding Capture Quantitative Reverse Transcription-PCR Assay To Concentrate Human Norovirus from Sewage and To Study the Distribution and Stability of the Virus

Science.gov (United States)

Yang, David; Pan, Liangwen; Mandrell, Robert

2012-01-01

Water is an important route for human norovirus (HuNoV) transmission. Using magnetic beads conjugated with blood group-like antigens (HuNoV receptors), we developed a simple and rapid receptor-binding capture and magnetic sequestration (RBCMS) method and compared it to the existing negatively charged membrane absorption/elution (NCMAE) method for concentrating HuNoV from sewage effluent. RBCMS required 6-fold-less sample volume than the NCMAE method and also resulted in a significantly higher yield of HuNoV. The NCMAE and RBCMS concentrations of genogroup I (GI) HuNoV measured by quantitative reverse transcription-PCR (qRT-PCR) resulted in average threshold cycle (CT) values of 34.68 (8.68 copies, 252-fold concentration) versus 34.07 (13.05 copies, 477-fold concentration), respectively; the NCMAE and RBCMS concentrations of genogroup II (GII) HuNoV were measured as average CT values of 33.32 (24.7 copies, 239-fold concentration) versus 32.38 (46.9 copies, 333-fold concentration), respectively. The specificity of qRT-PCR was confirmed by traditional RT-PCR and an RNase I protection assay. The qRT-PCR signal from RBCMS-concentrated HuNoV treated with RNase I indicated that it was from encapsidated RNA and, probably, viable virus. In contrast, the qRT-PCR signal from NCMAE-concentrated HuNoV was not protected from RNase I and, likely, degradation. Both GI and GII HuNoV were detected from sewage effluent samples collected between April and July with average concentrations of 7.8 × 103 genomic copies per liter (gc/liter) and 4.3 × 104 gc/liter, respectively. No GI and sewage samples stored at room temperature for 4 weeks. We conclude that RBCMS requires less sample volume, has better recovery and sensitivity, and is faster than NCMAE for detection of HuNoV in sewage. PMID:22101044

Detection of hepatitis A virus in shellfish by nested reverse transcription-PCR

NARCIS (Netherlands)

Croci, L.; Medici, de D.; Morace, G.; Fiore, A.; Scalfaro, C.; Beneduce, F.; Toti, L.

1999-01-01

A method for the detection of HAV in shellfish, based on the use of guanidinium isothiocyanate-contg. soln. for RNA extn. and purifn. steps, followed by nested PCR, is hereby proposed. Tests were carried out on mollusc samples spiked with HAV strain FG. Results showed that in samples subjected only

Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis.

Science.gov (United States)

Chen, Derrick J; Procop, Gary W; Vogel, Sherilynn; Yen-Lieberman, Belinda; Richter, Sandra S

2015-11-01

The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Study the Three Extraction Methods for HBV DNA to Use in PCR

Directory of Open Access Journals (Sweden)

N. Sheikh

2004-07-01

Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.

Detection of hepatitis A virus by the nucleic acid sequence-based amplification technique and comparison with reverse transcription-PCR.

Science.gov (United States)

Jean, J; Blais, B; Darveau, A; Fliss, I

2001-12-01

A nucleic acid sequence-based amplification (NASBA) technique for the detection of hepatitis A virus (HAV) in foods was developed and compared to the traditional reverse transcription (RT)-PCR technique. Oligonucleotide primers targeting the VP1 and VP2 genes encoding the major HAV capsid proteins were used for the amplification of viral RNA in an isothermal process resulting in the accumulation of RNA amplicons. Amplicons were detected by hybridization with a digoxigenin-labeled oligonucleotide probe in a dot blot assay format. Using the NASBA, as little as 0.4 ng of target RNA/ml was detected per comparison to 4 ng/ml for RT-PCR. When crude HAV viral lysate was used, a detection limit of 2 PFU (4 x 10(2) PFU/ml) was obtained with NASBA, compared to 50 PFU (1 x 10(4) PFU/ml) obtained with RT-PCR. No interference was encountered in the amplification of HAV RNA in the presence of excess nontarget RNA or DNA. The NASBA system successfully detected HAV recovered from experimentally inoculated samples of waste water, lettuce, and blueberries. Compared to RT-PCR and other amplification techniques, the NASBA system offers several advantages in terms of sensitivity, rapidity, and simplicity. This technique should be readily adaptable for detection of other RNA viruses in both foods and clinical samples.

[Disappearance of residual disease confirmed by RT-PCR following induction chemotherapy in two hypoplastic leukemia patients with t(8;21)].

Science.gov (United States)

Sawada, M; Tsurumi, H; Yamada, T; Hara, T; Oyama, M; Moriwaki, H

1999-04-01

Reverse transcriptase-polymerase chain reaction (RT-PCR) methods often detect the AML1/MTG8 fusion transcript even in acute myelogenous leukemia (AML) patients with t(8;21) who have been in long-term remission. We encountered 2 hypoplastic leukemia patients with t(8;21) who achieved cytogenetic remission with short-term conventional chemotherapy. Patient 1 was a 42-year-old woman. Chromosomal analysis detected t(8;21) (q22;q22) and PCR analysis (35 cycles PCR amplification; detection limit 1 x 10(-5) cells) detected the AML1/MTG8 fusion transcript. Complete remission was obtained with 1 course of chemotherapy consisting of low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days). After 2 courses of consolidation chemotherapy consisting of conventional-dose cytarabine and mitoxantrone, the RT-PCR findings were negative for the AML1/MTG8 fusion transcript. Patient 2 was a 67-year-old man. Cytogenetic analysis detected t(8;21) (q22;q22), and was positive for the AML1/MTG8 fusion transcript. After 2 courses of induction chemotherapy comprising low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days), and 3 courses of conventional consolidation chemotherapy, RT-PCR analysis confirmed the disappearance of the AML1/MTG8 fusion transcript.

Promoter Boundaries for the luxCDABE and betIBA-proXWV Operons in Vibrio harveyi Defined by the Method Rapid Arbitrary PCR Insertion Libraries (RAIL).

Science.gov (United States)

Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C

2018-06-01

Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries

Selection and evaluation of potential reference genes for gene expression analysis in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae using reverse-transcription quantitative PCR.

Directory of Open Access Journals (Sweden)

Miao Yuan

Full Text Available The brown planthopper (BPH, Nilaparvata lugens (Hemiptera, Delphacidae, is one of the most important rice pests. Abundant genetic studies on BPH have been conducted using reverse-transcription quantitative real-time PCR (qRT-PCR. Using qRT-PCR, the expression levels of target genes are calculated on the basis of endogenous controls. These genes need to be appropriately selected by experimentally assessing whether they are stably expressed under different conditions. However, such studies on potential reference genes in N. lugens are lacking. In this paper, we presented a systematic exploration of eight candidate reference genes in N. lugens, namely, actin 1 (ACT, muscle actin (MACT, ribosomal protein S11 (RPS11, ribosomal protein S15e (RPS15, alpha 2-tubulin (TUB, elongation factor 1 delta (EF, 18S ribosomal RNA (18S, and arginine kinase (AK and used four alternative methods (BestKeeper, geNorm, NormFinder, and the delta Ct method to evaluate the suitability of these genes as endogenous controls. We examined their expression levels among different experimental factors (developmental stage, body part, geographic population, temperature variation, pesticide exposure, diet change, and starvation following the MIQE (Minimum Information for publication of Quantitative real time PCR Experiments guidelines. Based on the results of RefFinder, which integrates four currently available major software programs to compare and rank the tested candidate reference genes, RPS15, RPS11, and TUB were found to be the most suitable reference genes in different developmental stages, body parts, and geographic populations, respectively. RPS15 was the most suitable gene under different temperature and diet conditions, while RPS11 was the most suitable gene under different pesticide exposure and starvation conditions. This work sheds light on establishing a standardized qRT-PCR procedure in N. lugens, and serves as a starting point for screening for reference genes for

Comparison of RT-PCR-Dot blot hybridization based on radioisotope 32P with conventional RT-PCR and commercial ELISA Assays for blood screening of HIV-1

International Nuclear Information System (INIS)

Maria Lina R; Andi Yasmon

2011-01-01

There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)

Complementary techniques: validation of gene expression data by quantitative real time PCR.

Science.gov (United States)

Provenzano, Maurizio; Mocellin, Simone

2007-01-01

Microarray technology can be considered the most powerful tool for screening gene expression profiles of biological samples. After data mining, results need to be validated with highly reliable biotechniques allowing for precise quantitation of transcriptional abundance of identified genes. Quantitative real time PCR (qrt-PCR) technology has recently reached a level of sensitivity, accuracy and practical ease that support its use as a routine bioinstrumentation for gene level measurement. Currently, qrt-PCR is considered by most experts the most appropriate method to confirm or confute microarray-generated data. The knowledge of the biochemical principles underlying qrt-PCR as well as some related technical issues must be beard in mind when using this biotechnology.

A probe-based qRT-PCR method to profile immunological gene expression in blood of captive beluga whales (Delphinapterus leucas

Directory of Open Access Journals (Sweden)

Ming-An Tsai

2017-09-01

Full Text Available Cytokines are fundamental for a functioning immune system, and thus potentially serve as important indicators of animal health. Quantitation of mRNA using quantitative reverse transcription polymerase chain reaction (qRT-PCR is an established immunological technique. It is particularly suitable for detecting the expression of proteins against which monoclonal antibodies are not available. In this study, we developed a probe-based quantitative gene expression assay for immunological assessment of captive beluga whales (Delphinapterus leucas that is one of the most common cetacean species on display in aquariums worldwide. Six immunologically relevant genes (IL-2Rα, -4, -10, -12, TNFα, and IFNγ were selected for analysis, and two validated housekeeping genes (PGK1 and RPL4 with stable expression were used as reference genes. Sixteen blood samples were obtained from four animals with different health conditions and stored in RNAlater™ solution. These samples were used for RNA extraction followed by qRT-PCR analysis. Analysis of gene transcripts was performed by relative quantitation using the comparative Cq method with the integration of amplification efficiency and two reference genes. The expression levels of each gene in the samples from clinically healthy animals were normally distributed. Transcript outliers for IL-2Rα, IL-4, IL-12, TNFα, and IFNγ were noticed in four samples collected from two clinically unhealthy animals. This assay has the potential to identify immune system deviation from normal state, which is caused by health problems. Furthermore, knowing the immune status of captive cetaceans could help both trainers and veterinarians in implementing preventive approaches prior to disease onset.

Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

Directory of Open Access Journals (Sweden)

Wang Zhen

2011-11-01

Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

Direct recovery of infectious Pestivirus from a full-length RT-PCR amplicon

DEFF Research Database (Denmark)

Rasmussen, Thomas Bruun; Reimann, Ilona; Hoffmann, Bernd

2008-01-01

This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro, and the result......This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro......, and the resulting RNA transcripts were electroporated into ovine cells. Infectious virus was obtained after one cell culture passage. The rescued viruses had a phenotype similar to the parental Border Disease virus strain. Therefore, direct generation of infectious pestiviruses from full-length RT-PCR cDNA products...

A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

Science.gov (United States)

Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

2015-06-01

Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments.

Science.gov (United States)

Ganger, Michael T; Dietz, Geoffrey D; Ewing, Sarah J

2017-12-01

qPCR has established itself as the technique of choice for the quantification of gene expression. Procedures for conducting qPCR have received significant attention; however, more rigorous approaches to the statistical analysis of qPCR data are needed. Here we develop a mathematical model, termed the Common Base Method, for analysis of qPCR data based on threshold cycle values (C q ) and efficiencies of reactions (E). The Common Base Method keeps all calculations in the logscale as long as possible by working with log 10 (E) ∙ C q , which we call the efficiency-weighted C q value; subsequent statistical analyses are then applied in the logscale. We show how efficiency-weighted C q values may be analyzed using a simple paired or unpaired experimental design and develop blocking methods to help reduce unexplained variation. The Common Base Method has several advantages. It allows for the incorporation of well-specific efficiencies and multiple reference genes. The method does not necessitate the pairing of samples that must be performed using traditional analysis methods in order to calculate relative expression ratios. Our method is also simple enough to be implemented in any spreadsheet or statistical software without additional scripts or proprietary components.

Properties of the reverse transcription reaction in mRNA quantification

DEFF Research Database (Denmark)

Ståhlberg, Anders; Håkansson, Joakim; Xian, Xiaojie

2004-01-01

BACKGROUND: In most measurements of gene expression, mRNA is first reverse-transcribed into cDNA. We studied the reverse transcription reaction and its consequences for quantitative measurements of gene expression. METHODS: We used SYBR green I-based quantitative real-time PCR (QPCR) to measure...... the properties of reverse transcription reaction for the beta-tubulin, glyceraldehyde-3-phosphate dehydrogenase, Glut2, CaV1D, and insulin II genes, using random hexamers, oligo(dT), and gene-specific reverse transcription primers. RESULTS: Experimental variation in reverse transcription-QPCR (RT......-QPCR) was mainly attributable to the reverse transcription step. Reverse transcription efficiency depended on priming strategy, and the dependence was different for the five genes studied. Reverse transcription yields also depended on total RNA concentration. CONCLUSIONS: RT-QPCR gene expression measurements...

DNA decontamination methods for internal quality management in clinical PCR laboratories.

Science.gov (United States)

Wu, Yingping; Wu, Jianyong; Zhang, Zhihui; Cheng, Chen

2018-03-01

The polymerase chain reaction (PCR) technique, one of the most commonly applied methods in diagnostic and molecular biology, has a frustrating downside: the occurrence of false-positive signals due to contamination. In previous research, various DNA decontamination methods have been developed to overcome this limitation. Unfortunately, the use of random or poorly focused sampling methods for monitoring air and/or object surfaces leads to the incomplete elimination during decontamination procedures. We herein attempted to develop a novel DNA decontamination method (environmental surveillance, including surface and air sampling) and quality management program for clinical molecular diagnostic laboratories (or clinical PCR laboratories). Here, we performed a step-by-step evaluation of current DNA decontamination methods and developed an effective procedure for assessing the presence of decontaminating DNA via PCR analysis. Performing targeted environmental surveillance by sampling, which reached optimal performance over 2 weeks, and the decontamination process had been verified as reliable. Additionally, the process was validated to not affect PCR amplification efficiency based on a comparative study. In this study, effective guidelines for DNA decontamination were developed. The method employed ensured that surface DNA contamination could be effectively identified and eliminated. Furthermore, our study highlighted the importance of overall quality assurance and good clinical laboratory practices for preventing contamination, which are key factors for compliance with regulatory or accreditation requirements. Taken together, we provided the evidence that the presented scheme ranged from troubleshooting to the elimination of surface contamination, could serve as critical foundation for developing regular environmental surveillance guidelines for PCR laboratories. © 2017 Wiley Periodicals, Inc.

A sensitive, reproducible, and economic real-time reverse transcription PCR detecting avian metapneumovirus subtypes A and B.

Science.gov (United States)

Franzo, G; Drigo, M; Lupini, C; Catelli, E; Laconi, A; Listorti, V; Bonci, M; Naylor, C J; Martini, M; Cecchinato, M

2014-06-01

Use of real-time PCR is increasing in the diagnosis of infectious disease due to its sensitivity, specificity, and speed of detection. These characteristics make it particularly suited for the diagnosis of viral infections, like avian metapneumovirus (AMPV), for which effective control benefits from continuously updated knowledge of the epidemiological situation. Other real-time reverse transcription (RT)-PCRs have been published based on highly specific fluorescent dye-labeled probes, but they have high initial cost, complex validation, and a marked susceptibility to the genetic variability of their target sequence. With this in mind, we developed and validated a SYBR Green I-based quantitative RT-PCR for the detection of the two most prevalent AMPV subtypes (i.e., subtypes A and B). The assay demonstrated an analytical sensitivity comparable with that of a previously published real-time RT-PCR and the ability to detect RNA equivalent to approximately 0.5 infectious doses for both A and B subtypes. The high efficiency and linearity between viral titer and crossing point displayed for both subtypes make it suited for viral quantification. Optimization of reaction conditions and the implementation of melting curve analysis guaranteed the high specificity of the assay. The stable melting temperature difference between the two subtypes indicated the possibility of subtyping through melting temperature analysis. These characteristics make our assay a sensitive, specific, and rapid tool, enabling contemporaneous detection, quantification, and discrimination of AMPV subtype A and B.

Detection of Enterovirus 71 gene from clinical specimens by reverse-transcription loop-mediated isothermal amplification

Directory of Open Access Journals (Sweden)

D Wang

2014-01-01

Full Text Available Purpose : The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD for an early treatment by using loop-mediated isothermal amplification (LAMP technique. Materials and Methods : A reverse-transcription loop-mediated isothermal amplification (RT-LAMP for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conventional reverse-transcription polymerase chain reaction (RT-PCR and real-time PCR. Results : A total of 116 clinical specimens from the suspected HFMD individual were detected with the RT-LAMP. The detection rate for EV71 was 56.89% by RT-LAMP, 41.38% by real-time PCR and 34.48% by RT-PCR. The minimum detection limit of RT-LAMP was 0.01 PFU, both of RT-PCR and real-time PCR was 0.1PFU. Non-cross-reactive amplification with other enteroviruses was detected in the survey reports. Conclusions : The effectiveness of RT-LAMP is higher than RT-PCR and real-time PCR. The protocol is easy to operate and time saving. It was not an expensive instrument, which was needed; it is an applicable method for rapid diagnosis of the disease, especially in resource-poor countries or in developing countries.

Validation of chimerism in pediatric recipients of allogeneic hematopoietic stem cell transplantation (HSCT) a comparison between two methods: real-time PCR (qPCR) vs. variable number tandem repeats PCR (VNTR PCR).

Science.gov (United States)

Kletzel, Morris; Huang, Wei; Olszewski, Marie; Khan, Sana

2013-01-01

Post-hematopoietic stem cell transplantation (HSCT) chimerism monitoring is important to assess relapse and therapeutic intervention. The purpose of our study is to compare two methods variable number tandem repeats (VNTR) vs. quantitative real- time polymerase chain reaction (qPCR) in terms of determining chimerism. 127 (peripheral blood n=112, bone marrow n=15) samples were simultaneously tested by VNTR using APO-B, D1S80, D1S111, D17S30, gene loci SRY and ZP3 and qPCR using 34 assays (CA001-CA034) that are designed to a bi-allelic insertion/deletion (indel) polymorphism in the human genome. Samples were separated in three subsets: total WBC, T-cell and Myeloid cells. Extraction of DNA was performed then quantified. We analyzed column statistics, paired t-test and regression analysis for both methods. There was complete correlation between the two methods. The simplicity and rapidity of the test results from the qPCR method is more efficient and accurate to assess chimerism.

Comparison of PCR with Standard Method (MPN for detection of bacterial contamination in drinking water

Directory of Open Access Journals (Sweden)

Fatemeh Dehghan

2014-11-01

Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.

Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.

Science.gov (United States)

De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda

2018-04-01

Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.

Quantification of 16S rRNAs in complex bacterial communities by multiple competitive reverse transcription-PCR in temperature gradient gel electrophoresis fingerprints.

Science.gov (United States)

Felske, A; Akkermans, A D; De Vos, W M

1998-11-01

A novel approach was developed to quantify rRNA sequences in complex bacterial communities. The main bacterial 16S rRNAs in Drentse A grassland soils (The Netherlands) were amplified by reverse transcription (RT)-PCR with bacterium-specific primers and were separated by temperature gradient gel electrophoresis (TGGE). The primer pair used (primers U968-GC and L1401) was found to amplify with the same efficiency 16S rRNAs from bacterial cultures containing different taxa and cloned 16S ribosomal DNA amplicons from uncultured soil bacteria. The sequence-specific efficiency of amplification was determined by monitoring the amplification kinetics by kinetic PCR. The primer-specific amplification efficiency was assessed by competitive PCR and RT-PCR, and identical input amounts of different 16S rRNAs resulted in identical amplicon yields. The sequence-specific detection system used for competitive amplifications was TGGE, which also has been found to be suitable for simultaneous quantification of more than one sequence. We demonstrate that this approach can be applied to TGGE fingerprints of soil bacteria to estimate the ratios of the bacterial 16S rRNAs.

A Computational Re-Examination of Béla Bartók's Transcription Methods as Exemplified by his Sirató Transcriptions of 1937/1938 and their Relevance for Contemporary Methods of Computational Transcription of Qur'an Recitation

NARCIS (Netherlands)

Biró, D.P.; van Kranenburg, P.; Holzapfel, A.

2014-01-01

This is a study about furthering transcription methods via com- putational means. In particular we re-examine Bartók’s methods of transcription to see how his project of transcription might be continued incorporating 21st century technology. We then go on to apply our established analytical and

Accurate Gene Expression-Based Biodosimetry Using a Minimal Set of Human Gene Transcripts

Energy Technology Data Exchange (ETDEWEB)

Tucker, James D., E-mail: jtucker@biology.biosci.wayne.edu [Department of Biological Sciences, Wayne State University, Detroit, Michigan (United States); Joiner, Michael C. [Department of Radiation Oncology, Wayne State University, Detroit, Michigan (United States); Thomas, Robert A.; Grever, William E.; Bakhmutsky, Marina V. [Department of Biological Sciences, Wayne State University, Detroit, Michigan (United States); Chinkhota, Chantelle N.; Smolinski, Joseph M. [Department of Electrical and Computer Engineering, Wayne State University, Detroit, Michigan (United States); Divine, George W. [Department of Public Health Sciences, Henry Ford Hospital, Detroit, Michigan (United States); Auner, Gregory W. [Department of Electrical and Computer Engineering, Wayne State University, Detroit, Michigan (United States)

2014-03-15

Purpose: Rapid and reliable methods for conducting biological dosimetry are a necessity in the event of a large-scale nuclear event. Conventional biodosimetry methods lack the speed, portability, ease of use, and low cost required for triaging numerous victims. Here we address this need by showing that polymerase chain reaction (PCR) on a small number of gene transcripts can provide accurate and rapid dosimetry. The low cost and relative ease of PCR compared with existing dosimetry methods suggest that this approach may be useful in mass-casualty triage situations. Methods and Materials: Human peripheral blood from 60 adult donors was acutely exposed to cobalt-60 gamma rays at doses of 0 (control) to 10 Gy. mRNA expression levels of 121 selected genes were obtained 0.5, 1, and 2 days after exposure by reverse-transcriptase real-time PCR. Optimal dosimetry at each time point was obtained by stepwise regression of dose received against individual gene transcript expression levels. Results: Only 3 to 4 different gene transcripts, ASTN2, CDKN1A, GDF15, and ATM, are needed to explain ≥0.87 of the variance (R{sup 2}). Receiver-operator characteristics, a measure of sensitivity and specificity, of 0.98 for these statistical models were achieved at each time point. Conclusions: The actual and predicted radiation doses agree very closely up to 6 Gy. Dosimetry at 8 and 10 Gy shows some effect of saturation, thereby slightly diminishing the ability to quantify higher exposures. Analyses of these gene transcripts may be advantageous for use in a field-portable device designed to assess exposures in mass casualty situations or in clinical radiation emergencies.

Design and optimization of a novel reverse transcription linear-after-the-exponential PCR for the detection of foot-and-mouth disease virus.

Science.gov (United States)

Pierce, K E; Mistry, R; Reid, S M; Bharya, S; Dukes, J P; Hartshorn, C; King, D P; Wangh, L J

2010-07-01

A novel molecular assay for the detection of foot-and-mouth disease virus (FMDV) was developed using linear-after-the-exponential polymerase chain reaction (LATE-PCR). Pilot experiments using synthetic DNA targets demonstrated the ability of LATE-PCR to quantify initial target concentration through endpoint detection. A two-step protocol involving reverse transcription (RT) followed by LATE-PCR was then used to confirm the ability of the assay to detect FMDV RNA. Finally, RT and LATE-PCR were combined in a one-step duplex assay for co-amplification of an FMDV RNA segment and an internal control comprised of an Armored RNA. In that form, each of the excess primers in the reaction mixture hybridize to their respective RNA targets during a short pre-incubation, then generate cDNA strands during a 3-min RT step at 60°C, and the resulting cDNA is amplified by LATE-PCR without intervening sample processing. The RT-LATE-PCR assay generates fluorescent signals at endpoint that are proportional to the starting number of RNA targets and can detect a range of sequence variants using a single mismatch-tolerant probe. In addition to offering improvements over current laboratory-based molecular diagnostic assays for FMDV, this new assay is compatible with a novel portable ('point-of-care') device, the BioSeeq II, designed for the rapid diagnosis of FMD in the field. © 2009 The Authors. Journal compilation © 2009 The Society for Applied Microbiology.

Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

Science.gov (United States)

Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

2012-08-15

Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

Study of the Efficacy of Real Time-PCR Method for Amikacin Determination Using Microbial Assay

Directory of Open Access Journals (Sweden)

Farzaneh Lotfipour

2015-06-01

Full Text Available Purpose: Microbial assay is used to determine the potency of antibiotics and vitamins. In spite of its advantages like simplicity and easiness, and to reveal the slight changes in the molecules, the microbial assay suffers from significant limitations; these methods are of lower specificity, accuracy and sensitivity. The objective of the present study is to evaluate the efficacy of real time-PCR technique in comparison with turbidimetric method for microbial assay of amikacin. Methods: Microbial determination of amikacin by turbidimetric method was performed according to USP. Also amikacin concentrations were determined by microbial assay using taq-man quantitative PCR method. Standard curves in different concentration for both methods were plotted and method validation parameters of linearity, precision and accuracy were calculated using statistical procedures. Results: The RT-PCR method was linear in the wider concentration range (5.12 – 38.08 for RT-PCR versus 8.00 – 30.47 for turbidimetric method with a better correlation coefficient (0.976 for RT-PCR versus 0.958 for turbidimetric method. RT-PCR method with LOQ of 5.12 ng/ml was more sensitive than turbidimetric method with LOQ of 8.00 ng/ml and the former could detect and quantify low concentrations of amikacin. The results of accuracy and precision evaluation showed that the RT-PCR method was accurate and precise in all of the tested concentration. Conclusion: The RT-PCR method described here provided an accurate and precise technique for measurement of amikacin potency and it can be a candidate for microbial determination of the antibiotics with the same test organism.

Development of a reverse transcription loop-mediated isothermal amplification method for the rapid detection of avian influenza virus subtype H7.

Science.gov (United States)

Bao, Hongmei; Wang, Xiurong; Zhao, Yuhui; Sun, Xiaodong; Li, Yanbing; Xiong, Yongzhong; Chen, Hualan

2012-01-01

A rapid and sensitive reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for the detection of the H7 avian influenza virus (H7 AIV) isotype was developed. The minimum detection limit of the RT-LAMP assay was 0.1-0.01 PFU per reaction for H7 AIV RNA, making this assay 100-fold more sensitive than the conventional RT-PCR method. This RT-LAMP assay also has the capacity to detect both high- and low-pathogenic H7 AIV strains. Using a pool of RNAs extracted from influenza viruses corresponding to all 15 HA subtypes (in addition to other avian pathogenic viruses), the RT-LAMP system was confirmed to amplify only H7 AIV RNA. Furthermore, specific pathogen free (SPF) chickens were infected artificially with H7 AIV, throat and cloacal swabs were collected, and viral shedding was examined using viral isolation, RT-PCR and RT-LAMP. Shedding was detected following viral isolation and RT-LAMP one day after infection, whereas viral detection using RT-PCR was effective only on day 3 post-infection. These results indicate that the RT-LAMP method could facilitate epidemiological surveillance and the rapid diagnosis of the avian influenza subtype H7. Copyright © 2011 Elsevier B.V. All rights reserved.

Development and Evaluation of a PCR and Mass Spectroscopy-based (PCR-MS) Method for Quantitative, Type-specific Detection of Human Papillomavirus

Science.gov (United States)

Patel, Divya A.; Shih, Yang-Jen; Newton, Duane W.; Michael, Claire W.; Oeth, Paul A.; Kane, Michael D.; Opipari, Anthony W.; Ruffin, Mack T.; Kalikin, Linda M.; Kurnit, David M.

2010-01-01

Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay. PMID:19410602

Development and evaluation of a PCR and mass spectroscopy (PCR-MS)-based method for quantitative, type-specific detection of human papillomavirus.

Science.gov (United States)

Patel, Divya A; Shih, Yang-Jen; Newton, Duane W; Michael, Claire W; Oeth, Paul A; Kane, Michael D; Opipari, Anthony W; Ruffin, Mack T; Kalikin, Linda M; Kurnit, David M

2009-09-01

Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High-Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay.

Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

Science.gov (United States)

Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

2005-01-01

We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

Presence and transcriptional activity of anaerobic fungi in agricultural biogas plants.

Science.gov (United States)

Dollhofer, Veronika; Callaghan, Tony M; Griffith, Gareth W; Lebuhn, Michael; Bauer, Johann

2017-07-01

Bioaugmentation with anaerobic fungi (AF) is promising for improved biogas generation from lignocelluloses-rich substrates. However, before implementing AF into biogas processes it is necessary to investigate their natural occurrence, community structure and transcriptional activity in agricultural biogas plants. Thus, AF were detected with three specific PCR based methods: (i) Copies of their 18S genes were found in 7 of 10 biogas plants. (ii) Transcripts of a GH5 endoglucanase gene were present at low level in two digesters, indicating transcriptional cellulolytic activity of AF. (iii) Phylogeny of the AF-community was inferred with the 28S gene. A new Piromyces species was isolated from a PCR-positive digester. Evidence for AF was only found in biogas plants operated with high proportions of animal feces. Thus, AF were most likely transferred into digesters with animal derived substrates. Additionally, high process temperatures in combination with long retention times seemed to impede AF survival and activity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Molecular analysis of alternative transcripts of equine AXL receptor tyrosine kinase gene

Directory of Open Access Journals (Sweden)

Jeong-Woong Park

2017-10-01

Full Text Available Objective Since athletic performance is a most importance trait in horses, most research focused on physiological and physical studies of horse athletic abilities. In contrast, the molecular analysis as well as the regulatory pathway studies remain insufficient for evaluation and prediction of horse athletic abilities. In our previous study, we identified AXL receptor tyrosine kinase (AXL gene which was expressed as alternative spliced isoforms in skeletal muscle during exercise. In the present study, we validated two AXL alternative splicing transcripts (named as AXLa for long form and AXLb for short form in equine skeletal muscle to gain insight(s into the role of each alternative transcript during exercise. Methods We validated two isoforms of AXL transcripts in horse tissues by reverse transcriptase polymerase chain reaction (RT-PCR, and then cloned the transcripts to confirm the alternative locus and its sequences. Additionally, we examined the expression patterns of AXLa and AXLb transcripts in horse tissues by quantitative RT-PCR (qRT-PCR. Results Both of AXLa and AXLb transcripts were expressed in horse skeletal muscle and the expression levels were significantly increased after exercise. The sequencing analysis showed that there was an alternative splicing event at exon 11 between AXLa and AXLb transcripts. 3-dimentional (3D prediction of the alternative protein structures revealed that the structural distance of the connective region between fibronectin type 3 (FN3 and immunoglobin (Ig domain was different between two alternative isoforms. Conclusion It is assumed that the expression patterns of AXLa and AXLb transcripts would be involved in regulation of exercise-induced stress in horse muscle possibly through an NF-κB signaling pathway. Further study is necessary to uncover biological function(s and significance of the alternative splicing isoforms in race horse skeletal muscle.

A rapid method for screening arrayed plasmid cDNA library by PCR

International Nuclear Information System (INIS)

Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

1999-01-01

Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

Identification of circulating miRNA biomarkers based on global quantitative real-time PCR profiling

Directory of Open Access Journals (Sweden)

Kang Kang

2012-02-01

Full Text Available Abstract MicroRNAs (miRNAs are small noncoding RNAs (18-25 nucleotides that regulate gene expression at the post-transcriptional level. Recent studies have demonstrated the presence of miRNAs in the blood circulation. Deregulation of miRNAs in serum or plasma has been associated with many diseases including cancers and cardiovascular diseases, suggesting the possible use of miRNAs as diagnostic biomarkers. However, the detection of the small amount of miRNAs found in serum or plasma requires a method with high sensitivity and accuracy. Therefore, the current study describes polymerase chain reaction (PCR-based methods for measuring circulating miRNAs. Briefly, the procedure involves four major steps: (1 sample collection and preparation; (2 global miRNAs profiling using quantitative real-time PCR (qRT-PCR; (3 data normalization and analysis; and (4 selection and validation of miRNA biomarkers. In conclusion, qRT-PCR is a promising method for profiling of circulating miRNAs as biomarkers.

Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

DEFF Research Database (Denmark)

Munch, M.; Nielsen, L.P.; Handberg, Kurt

2001-01-01

A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR

Directory of Open Access Journals (Sweden)

Davis Thomas M

2010-03-01

Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.

Typing of Y chromosome SNPs with multiplex PCR methods

DEFF Research Database (Denmark)

Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels

2005-01-01

We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....

Design, Assembly, and Characterization of TALE-Based Transcriptional Activators and Repressors.

Science.gov (United States)

Thakore, Pratiksha I; Gersbach, Charles A

2016-01-01

Transcription activator-like effectors (TALEs) are modular DNA-binding proteins that can be fused to a variety of effector domains to regulate the epigenome. Nucleotide recognition by TALE monomers follows a simple cipher, making this a powerful and versatile method to activate or repress gene expression. Described here are methods to design, assemble, and test TALE transcription factors (TALE-TFs) for control of endogenous gene expression. In this protocol, TALE arrays are constructed by Golden Gate cloning and tested for activity by transfection and quantitative RT-PCR. These methods for engineering TALE-TFs are useful for studies in reverse genetics and genomics, synthetic biology, and gene therapy.

A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans

Science.gov (United States)

Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.

2000-01-01

Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130

Detection of enterovirus 71 gene from clinical specimens by reverse-transcription loop-mediated isothermal amplification.

Science.gov (United States)

Wang, D; Wang, X; Geng, Y; An, C

2014-01-01

The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD) for an early treatment by using loop-mediated isothermal amplification (LAMP) technique. A reverse-transcription loop-mediated isothermal amplification (RT-LAMP) for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conventional reverse-transcription polymerase chain reaction (RT-PCR) and real-time PCR. A total of 116 clinical specimens from the suspected HFMD individual were detected with the RT-LAMP. The detection rate for EV71 was 56.89% by RT-LAMP, 41.38% by real-time PCR and 34.48% by RT-PCR. The minimum detection limit of RT-LAMP was 0.01 PFU, both of RT-PCR and real-time PCR was 0.1PFU. Non-cross-reactive amplification with other enteroviruses was detected in the survey reports. The effectiveness of RT-LAMP is higher than RT-PCR and real-time PCR. The protocol is easy to operate and time saving. It was not an expensive instrument, which was needed; it is an applicable method for rapid diagnosis of the disease, especially in resource-poor countries or in developing countries.

Detection of negative and positive RNA strand of poliovirus Sabin 1 and echovirus E19 by a stem-loop reverse transcription PCR.

Science.gov (United States)

Fikatas, A; Dimitriou, T G; Kyriakopoulou, Z; Moschonas, G D; Amoutzias, G D; Mossialos, D; Gartzonika, C; Levidiotou-Stefanou, S; Markoulatos, P

2017-09-01

In this report a strand specific RT-PCR was established for the detection of the replicative negative RNA strand of poliovirus sabin 1 (Sabin1) and Echovirus 19 (E19) strains. The key for the successful conduction of the assay was the use of a specific reverse transcription primer targeting the 5'-UTR of enteroviruses that consisted of a stem-loop structure at the 5'-end and an enteroviral-specific sequence at the 3'-end. The stem loop RT-PCR was found to be an accurate and sensitive method, detecting even 10 -2 CCID 50 of poliovirus sabin 1 (Sabin1) and E19 strains 6 h postinfection (p.i.), while CPE appeared 3 days later. This assay was also validated in SiHa and Caski cell lines that are not used for the detection of enteroviruses. The negative RNA strand was detected 6 h and 12 h p.i. in SiHa and Caski cells, when these cell lines were inoculated with 10 5 and 1 CCID 50 respectively, whereas CPE was observed 5 days p.i for SiHa cells and 8 days p.i for Caski cells and that only at 10 5 CCID 50 . The results show that this approach may be used for replacing the time-consuming cell cultures in order to detect the active replication of enteroviruses. Enteroviruses are positive stranded RNA viruses that may cause severe diseases. The conventional method for detection of active viral replication involves virus isolation in sensitive cell cultures followed by titration and seroneutralization. In this report, we describe the use of a stem-loop secondary structured oligonucleotide in RT-PCR assay for the detection of the replicative negative strand of the positive-stranded RNA of poliovirus sabin 1 and E19 strains. This approach proved to be a useful tool that may be used for replacing the time-consuming cell culture assays in order to detect the active replication of enteroviruses. © 2017 The Society for Applied Microbiology.

Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples.

Science.gov (United States)

Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R

2011-09-01

In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.

Comparison of three human papillomavirus DNA detection methods: Next generation sequencing, multiplex-PCR and nested-PCR followed by Sanger based sequencing.

Science.gov (United States)

da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui

2016-05-01

To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.

Technical aspects and recommendations for single-cell qPCR.

Science.gov (United States)

Ståhlberg, Anders; Kubista, Mikael

2018-02-01

Single cells are basic physiological and biological units that can function individually as well as in groups in tissues and organs. It is central to identify, characterize and profile single cells at molecular level to be able to distinguish different kinds, to understand their functions and determine how they interact with each other. During the last decade several technologies for single-cell profiling have been developed and used in various applications, revealing many novel findings. Quantitative PCR (qPCR) is one of the most developed methods for single-cell profiling that can be used to interrogate several analytes, including DNA, RNA and protein. Single-cell qPCR has the potential to become routine methodology but the technique is still challenging, as it involves several experimental steps and few molecules are handled. Here, we discuss technical aspects and provide recommendation for single-cell qPCR analysis. The workflow includes experimental design, sample preparation, single-cell collection, direct lysis, reverse transcription, preamplification, qPCR and data analysis. Detailed reporting and sharing of experimental details and data will promote further development and make validation studies possible. Efforts aiming to standardize single-cell qPCR open up means to move single-cell analysis from specialized research settings to standard research laboratories. Copyright © 2017 Elsevier Ltd. All rights reserved.

RT-PCR Protocols - Methods in Molecular Biology

Directory of Open Access Journals (Sweden)

Manuela Monti

2011-03-01

Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

Transcriptional control in Alicyclobacillus acidocaldarius and associated genes, proteins, and methods

Science.gov (United States)

Lee, Brady Deneys; Thompson, David N; Apel, William A.; Thompson, Vicki Slavchev; Reed, David W; Lacey, Jeffrey A

2014-05-06

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius are provided. Further provided are methods of modulating transcription or transcription or transcriptional control using isolated and/or purified polypeptides and nucleic acid sequences from Alicyclobacillus acidocaldarius.

Transcriptional control in alicyclobacillus acidocaldarius and associated genes, proteins, and methods

Energy Technology Data Exchange (ETDEWEB)

Lee, Brady D; Thompson, David N; Apel, William A; Thompson, Vicki S; Reed, David W; Lacey, Jeffrey A

2016-11-22

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius are provided. Further provided are methods of modulating transcription or transcription or transcriptional control using isolated and/or purified polypeptides and nucleic acid sequences from Alicyclobacillus acidocaldarius.

Detection of ROS1 Gene Rearrangement in Lung Adenocarcinoma: Comparison of IHC, FISH and Real-Time RT-PCR

OpenAIRE

Shan, Ling; Lian, Fang; Guo, Lei; Qiu, Tian; Ling, Yun; Ying, Jianming; Lin, Dongmei

2015-01-01

Aims To compare fluorescence in situ hybridization (FISH), immunohistochemistry (IHC) and quantitative real-time reverse transcription-PCR (qRT-PCR) assays for detection of ROS1 fusion in a large number of ROS1-positive lung adenocatcinoma (ADC) patients. Methods Using IHC analysis, sixty lung ADCs including 16 cases with ROS1 protein expression and 44 cases without ROS1 expression were selected for this study. The ROS1 fusion status was examined by FISH and qRT-PCR assay. Results Among 60 ca...

Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori.

Science.gov (United States)

Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

2016-07-07

To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and

Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

Directory of Open Access Journals (Sweden)

Soares Fernando A

2009-03-01

Full Text Available Abstract Background HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC and fluorescence in situ hybridization (FISH. These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. Methods To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. Results The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4% and HER-2 transcript overexpression (20%. Moreover, 2+ immunostaining cases presented nonamplified status (50% by CISH and HER-2 downexpression (38.5% by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350. Conclusion Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene.

Design and Optimization of Reverse-Transcription Quantitative PCR Experiments

Czech Academy of Sciences Publication Activity Database

Tichopád, A.; Kitchen, R.; Riedmaier, I.; Becker, Ch.; Ståhlberg, A.; Kubista, Mikael

2009-01-01

Roč. 55, č. 10 (2009), s. 1816-1823 ISSN 0009-9147 Institutional research plan: CEZ:AV0Z50520701 Keywords : Design * optimization * RT qPCR Subject RIV: EG - Zoology Impact factor: 6.263, year: 2009

Intrinsic terminators in Mycoplasma hyopneumoniae transcription.

Science.gov (United States)

Fritsch, Tiago Ebert; Siqueira, Franciele Maboni; Schrank, Irene Silveira

2015-04-08

Mycoplasma hyopneumoniae, an important pathogen of swine, exhibits a low guanine and cytosine (GC) content genome. M. hyopneumoniae genome is organised in long transcriptional units and promoter sequences have been mapped upstream of all transcription units. These analysis provided insights into the gene organisation and transcription initiation at the genome scale. However, the presence of transcriptional terminator sequences in the M. hyopneumoniae genome is poorly understood. In silico analyses demonstrated the presence of putative terminators in 82% of the 33 monocistronic units (mCs) and in 74% of the 116 polycistronic units (pCs) considering different classes of terminators. The functional activity of 23 intrinsic terminators was confirmed by RT-PCR and qPCR. Analysis of all terminators found by three software algorithms, combined with experimental results, allowed us to propose a pattern of RNA hairpin formation during the termination process and to predict the location of terminators in the M. hyopneumoniae genome sequence. The stem-loop structures of intrinsic terminators of mycoplasma diverge from the pattern of terminators found in other bacteria due the low content of guanine and cytosine. In M. hyopneumoniae, transcription can end after a transcriptional unit and before its terminator sequence and can also continue past the terminator sequence with RNA polymerases gradually releasing the RNA.

DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.

Science.gov (United States)

Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P

2015-07-01

Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.

PCR-RFLP Method to Identify Salmonid Species of Economic Importance

Directory of Open Access Journals (Sweden)

Andreea Dudu

2011-05-01

Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

Directory of Open Access Journals (Sweden)

Georg Walch

2016-04-01

Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

Directory of Open Access Journals (Sweden)

Jeni Vuong

Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

[A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].

Science.gov (United States)

Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan

2015-04-01

To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.

The use of digital PCR to improve the application of quantitative molecular diagnostic methods for tuberculosis.

Science.gov (United States)

Devonshire, Alison S; O'Sullivan, Denise M; Honeyborne, Isobella; Jones, Gerwyn; Karczmarczyk, Maria; Pavšič, Jernej; Gutteridge, Alice; Milavec, Mojca; Mendoza, Pablo; Schimmel, Heinz; Van Heuverswyn, Fran; Gorton, Rebecca; Cirillo, Daniela Maria; Borroni, Emanuele; Harris, Kathryn; Barnard, Marinus; Heydenrych, Anthenette; Ndusilo, Norah; Wallis, Carole L; Pillay, Keshree; Barry, Thomas; Reddington, Kate; Richter, Elvira; Mozioğlu, Erkan; Akyürek, Sema; Yalçınkaya, Burhanettin; Akgoz, Muslum; Žel, Jana; Foy, Carole A; McHugh, Timothy D; Huggett, Jim F

2016-08-03

Real-time PCR (qPCR) based methods, such as the Xpert MTB/RIF, are increasingly being used to diagnose tuberculosis (TB). While qualitative methods are adequate for diagnosis, the therapeutic monitoring of TB patients requires quantitative methods currently performed using smear microscopy. The potential use of quantitative molecular measurements for therapeutic monitoring has been investigated but findings have been variable and inconclusive. The lack of an adequate reference method and reference materials is a barrier to understanding the source of such disagreement. Digital PCR (dPCR) offers the potential for an accurate method for quantification of specific DNA sequences in reference materials which can be used to evaluate quantitative molecular methods for TB treatment monitoring. To assess a novel approach for the development of quality assurance materials we used dPCR to quantify specific DNA sequences in a range of prototype reference materials and evaluated accuracy between different laboratories and instruments. The materials were then also used to evaluate the quantitative performance of qPCR and Xpert MTB/RIF in eight clinical testing laboratories. dPCR was found to provide results in good agreement with the other methods tested and to be highly reproducible between laboratories without calibration even when using different instruments. When the reference materials were analysed with qPCR and Xpert MTB/RIF by clinical laboratories, all laboratories were able to correctly rank the reference materials according to concentration, however there was a marked difference in the measured magnitude. TB is a disease where the quantification of the pathogen could lead to better patient management and qPCR methods offer the potential to rapidly perform such analysis. However, our findings suggest that when precisely characterised materials are used to evaluate qPCR methods, the measurement result variation is too high to determine whether molecular quantification

Overlapping transcription structure of human cytomegalovirus

Indian Academy of Sciences (India)

Transcription of human cytomegalovirus UL/b′ region has been studied extensively for some genes. In this study, transcripts of the UL140 and UL141, two of the UL/b′ genes, were identified in late RNAs of three HCMV isolates using Northern blot hybridization, cDNA library screening and RACE-PCR. At least three ...

Overlapping transcription structure of human cytomegalovirus ...

Indian Academy of Sciences (India)

2013-01-21

Jan 21, 2013 ... Transcription of human cytomegalovirus UL/b′ region has been studied extensively for some genes. In this study, transcripts of the UL140 and UL141, two of the UL/b′ genes, were identified in late RNAs of three HCMV isolates using Northern blot hybridization, cDNA library screening and RACE-PCR.

DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

DEFF Research Database (Denmark)

Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

2011-01-01

of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

Science.gov (United States)

Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

2013-12-01

Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

Polymerase chain reaction methods (PCR in agrobiotechnology

Directory of Open Access Journals (Sweden)

Taški-Ajduković Ksenija

2006-01-01

Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

Development and implementation of the quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network in mainland China

Directory of Open Access Journals (Sweden)

Wang Wei

2011-03-01

Full Text Available Abstract Background Reverse transcription PCR (RT-PCR and real time RT-PCR (rRT-PCR have been indispensable methods for influenza surveillance, especially for determination of avian influenza. The movement of testing beyond reference lab introduced the need of quality control, including the implementation of an evaluation system for validating personal training and sample proficiency testing. Methods We developed a panel with lysates of seasonal influenza virus (H1N1, H3N2 and B, serials of diluted H5N1 virus lysates, and in-vitro transcribed H5 hemaglutinin (HA and an artificial gene RNAs for RT-PCR and rRT-PCR quality control assessment. The validations of stability and reproducibility were performed on the panel. Additionally, the panel was implemented to assess the detection capability of Chinese human avian influenza networks. Results The panel has relatively high stability and good reproducibility demonstrated by kappa's tests. In the implementation of panel on Chinese human avian influenza networks, the results suggested that there were a relatively low number of discrepancies for both concise and reproducibility in Chinese avian influenza virus net works. Conclusions A quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network was developed. An availably statistical data, which are used to assess the detection capability of networks on avian influenza virus (H5N1, can be obtained relatively easily through implementation of the panel on networks.

Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in melon.

Directory of Open Access Journals (Sweden)

Qiusheng Kong

Full Text Available Melon (Cucumis melo. L is not only an economically important cucurbitaceous crop but also an attractive model for studying many biological characteristics. Screening appropriate reference genes is essential to reverse transcription quantitative real-time PCR (RT-qPCR, which is key to many studies involving gene expression analysis. In this study, 14 candidate reference genes were selected, and the variations in their expression in roots and leaves of plants subjected to biotic stress, abiotic stress, and plant growth regulator treatment were assessed by RT-qPCR. The stability of the expression of the selected genes was determined and ranked using geNorm and NormFinder. geNorm identified the two most stable genes for each set of conditions: CmADP and CmUBIep across all samples, CmUBIep and CmRPL in roots, CmRAN and CmACT in leaves, CmADP and CmRPL under abiotic stress conditions, CmTUA and CmACT under biotic stress conditions, and CmRAN and CmACT under plant growth regulator treatments. NormFinder determined CmRPL to be the best reference gene in roots and under biotic stress conditions and CmADP under the other experimental conditions. CmUBC2 and CmPP2A were not found to be suitable under many experimental conditions. The catalase family genes CmCAT1, CmCAT2, and CmCAT3 were identified in melon genome and used as target genes to validate the reliability of identified reference genes. The catalase family genes showed the most upregulation 3 days after inoculation with Fusarium wilt in roots, after which they were downregulated. Their levels of expression were significantly overestimated when the unsuitable reference gene was used for normalization. These results not only provide guidelines for the selection of reference genes for gene expression analyses in melons but may also provide valuable information for studying the functions of catalase family genes in stress responses.

A multiplex PCR method for detection of Aspergillus spp. and Mycobacterium tuberculosis in BAL specimens.

Science.gov (United States)

Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A

2015-06-01

The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Tendency for interlaboratory precision in the GMO analysis method based on real-time PCR.

Science.gov (United States)

Kodama, Takashi; Kurosawa, Yasunori; Kitta, Kazumi; Naito, Shigehiro

2010-01-01

The Horwitz curve estimates interlaboratory precision as a function only of concentration, and is frequently used as a method performance criterion in food analysis with chemical methods. The quantitative biochemical methods based on real-time PCR require an analogous criterion to progressively promote method validation. We analyzed the tendency of precision using a simplex real-time PCR technique in 53 collaborative studies of seven genetically modified (GM) crops. Reproducibility standard deviation (SR) and repeatability standard deviation (Sr) of the genetically modified organism (GMO) amount (%) was more or less independent of GM crops (i.e., maize, soybean, cotton, oilseed rape, potato, sugar beet, and rice) and evaluation procedure steps. Some studies evaluated whole steps consisting of DNA extraction and PCR quantitation, whereas others focused only on the PCR quantitation step by using DNA extraction solutions. Therefore, SR and Sr for GMO amount (%) are functions only of concentration similar to the Horwitz curve. We proposed S(R) = 0.1971C 0.8685 and S(r) = 0.1478C 0.8424, where C is the GMO amount (%). We also proposed a method performance index in GMO quantitative methods that is analogous to the Horwitz Ratio.

5' diversity of human hepatic PXR (NR1I2) transcripts and identification of the major transcription initiation site.

Science.gov (United States)

Kurose, Kouichi; Koyano, Satoru; Ikeda, Shinobu; Tohkin, Masahiro; Hasegawa, Ryuichi; Sawada, Jun-Ichi

2005-05-01

The human pregnane X receptor (PXR) is a crucial regulator of the genes encoding several major cytochrome P450 enzymes and transporters, such as CYP3A4 and MDR1, but its own transcriptional regulation remains unclear. To elucidate the transcriptional mechanisms of human PXR gene, we first endeavored to identify the transcription initiation site of human PXR using 5'-RACE. Five types of 5'-variable transcripts (a, b, c, d, and e) with common exon 2 sequence were found, and comparison of these sequences with the genomic sequence suggested that their 5' diversity is derived from initiation by alternative promoters and alternative splicing. None of the exons found in our study contain any new in-frame coding regions. Newly identified introns IVS-a and IVS-b were found to have CT-AC splice sites that do not follow the GT-AG rule of conventional donor and acceptor splice sites. Of the five types of 5' variable transcripts identified, RT-PCR showed that type-a was the major transcript type. Four transcription initiation sites (A-D) for type-a transcript were identified by 5'-RACE using GeneRacer RACE Ready cDNA (human liver) constructed by the oligo-capping method. Putative TATA boxes were located approximately 30 bp upstream from the transcriptional start sites of the major transcript (C) and the longest minor transcript (A) expressed in the human liver. These results indicate that the initiation of transcription of human PXR is more complex than previously reported.

Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

International Nuclear Information System (INIS)

Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

2008-01-01

Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

Science.gov (United States)

2014-01-01

Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

Establishment of a sensitive system for analysis of human vaginal microbiota on the basis of rRNA-targeted reverse transcription-quantitative PCR.

Science.gov (United States)

Kurakawa, Takashi; Ogata, Kiyohito; Tsuji, Hirokazu; Kado, Yukiko; Takahashi, Takuya; Kida, Yumi; Ito, Masahiro; Okada, Nobuhiko; Nomoto, Koji

2015-04-01

Ten specific primer sets, for Lactobacillus gasseri, Lactobacillus crispatus, Atopobium vaginae, Gardnerella vaginalis, Mobiluncus curtisii, Chlamydia trachomatis/muridarum, Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, Bifidobacterium adolescentis, and Bifidobacterium angulatum, were developed for quantitative analysis of vaginal microbiota. rRNA-targeted reverse transcription-quantitative PCR (RT-qPCR) analysis of the vaginal samples from 12 healthy Japanese volunteers using the new primer sets together with 25 existing primer sets revealed the diversity of their vaginal microbiota: Lactobacilli such as L. crispatus, L. gasseri, Lactobacillus jensenii, Lactobacillus iners, and Lactobacillus vaginalis, as the major populations at 10(7) cells/ml vaginal fluid, were followed by facultative anaerobes such as Streptococcus and strict anaerobes at lower population levels of 10(4) cells/ml or less. Certain bacterial vaginosis (BV)-related bacteria, such as G. vaginalis, A. vaginae, M. curtisii, and Prevotella, were also detected in some subjects. Especially in one subject, both G. vaginalis and A. vaginae were detected at high population levels of 10(8.8) and 10(8.9) cells/ml vaginal fluid, suggesting that she is an asymptomatic BV patient. These results suggest that the RT-qPCR system is effective for accurate analysis of major vaginal commensals and diagnosis of several vaginal infections. Copyright © 2015 Elsevier B.V. All rights reserved.

Immunocapture reverse transcription-polymerase chain reaction combined with nested PCR greatly increases the detection of Prunus necrotic ring spot virus in the peach.

Science.gov (United States)

Helguera, P R; Taborda, R; Docampo, D M; Ducasse, D A

2001-06-01

A detection system based on nested PCR after IC-RT-PCR (IC-RT-PCR-Nested PCR) was developed to improve indexing of Prunus necrotic ringspot virus in peach trees. Inhibitory effects and inconsistencies of the standard IC-RT-PCR were overcome by this approach. IC-RT-PCR-Nested PCR improved detection by three orders of magnitude compared with DAS-ELISA for the detection of PNRSV in leaves. Several different tissues were evaluated and equally consistent results were observed. The main advantages of the method are its consistency, high sensitivity and easy application in quarantine programs.

Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

Science.gov (United States)

Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

2017-11-01

Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

An external standard method for quantification of human cytomegalovirus by PCR

International Nuclear Information System (INIS)

Rongsen, Shen; Liren, Ma; Fengqi, Zhou; Qingliang, Luo

1997-01-01

An external standard method for PCR quantification of HCMV was reported. [α- 32 P]dATP was used as a tracer. 32 P-labelled specific amplification product was separated by agarose gel electrophoresis. A gel piece containing the specific product band was excised and counted in a plastic scintillation counter. Distribution of [α- 32 P]dATP in the electrophoretic gel plate and effect of separation between the 32 P-labelled specific product and free [α- 32 P]dATP were observed. A standard curve for quantification of HCMV by PCR was established and detective results of quality control templets were presented. The external standard method and the electrophoresis separation effect were appraised. The results showed that the method could be used for relative quantification of HCMV. (author)

Detection of Mycoplasma synoviae infection in broiler breeder farms of Tehran province using PCR and culture methods

Directory of Open Access Journals (Sweden)

Elhamnia, F.

2010-07-01

Full Text Available Mycoplasma synoviae (MS is an important avian pathogen that can cause both respiratory disease and joint inflammation synovitis in poultry, inducing economic losses to the Iranian chicken industry especially breeder farms. The aim of this study was to use the MS specific PCR and culture methods in order to detect of M. synoviae from breeder farms where located in Tehran province. A total of 475 samples including choanal cleft, trachea, ovary and /or joint cavities from 23 broiler breeder farms of Tehran area were collected. Samples were cultured in PPLO broth media supplemented for MS isolation. The bacteria DNAs were extracted by phenol/chloroform method. Specific published primers amplify a 207 bp region of the 16S rRNA gene of MS were used for PCR method. Out of 475 samples, 146 cultures were shown positive and typical Mycoplasma colonies, 85 samples were also identified MS based on agglutination test with specific MS antiserum and the PCR method. A total of 122 samples, a band with 207 bp was shown as MS specific PCR product in electrophoresis. In addition to these 85 samples that were positives in both culture and PCR, 37 samples that had not grown in Mycoplasma media were positive in MS specific PCR. A total of 292 samples were negatives in both culture and PCR methods. 122 positive samples out of 475 samples (25.7% were belonged to 7 breeder farms (30.4%. On conclusions, the MS infection of broiler breeder farms of Tehran area was confirmed truly. From the results, as the PCR method reduces the time consuming, an effectiveness and efficient for detection of M. synoviae infection of chicken breeder. It is then suggested that the PCR method could be an alternative method for culturing.

New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

Science.gov (United States)

Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

2015-01-01

We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

New multiplex PCR methods for rapid screening of genetically modified organisms in foods

Directory of Open Access Journals (Sweden)

Nelly eDatukishvili

2015-07-01

Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

Molecular analysis of the genera eremopyrum (ledeb). jaub. and spach and agropyron gaertner (poaceae) by pcr methods

International Nuclear Information System (INIS)

Yilmaz, R.; Cabi, E.; Dogan, M.

2014-01-01

RAPD-PCR (Random Amplified Polymorphic DNA Polymerase Chain Reaction) and Post PCR (Polymerase Chain Reaction) Melting Curve Analysis (MCA) have been used to investigate the pattern of genetic variation among some species in the genera Eremopyrum (Ledeb.) Jaub. and Spach and Agropyron Gaertner (Poaceae). Thirteen primers have been used in the study based on the RAPD-PCR and MCA analyses. Each species produced a distinct pattern of DNA fragments which have been used as a measure of the degree of relationship between species by means of using the RAPD-PCR results with three primers selected for identifying the genetic similarities. Polymorphic melting profiles have been obtained with Post PCR MCA method using three primers. Genetic similarities are calculated for all the species studied with RAPD-PCR and MCA methods, the dendrograms are obtained with the MVSP (Multi Variate Statistical Package) software using UPGMA (Unweighted Pair Group Method with Arithmetic Averages) and Jaccard's Coefficient. Polymorphism between 18 populations of Eremopyrum and 6 Agropyron populations and within the species are determined by using RAPD-PCR and Post PCR melting curve analysis (MCA) respectively. (author)

Evaluation of kDNA PCR hybridization and ITS1 nPCR methods in different clinical samples for visceral leishmaniasis diagnosis in dogs with and without clinical signs

International Nuclear Information System (INIS)

Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R.; Melo, Maria N.

2013-01-01

Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using 32 P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83% (25

Evaluation of kDNA PCR hybridization and ITS1 nPCR methods in different clinical samples for visceral leishmaniasis diagnosis in dogs with and without clinical signs

Energy Technology Data Exchange (ETDEWEB)

Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R., E-mail: alineleandra@hotmail.com, E-mail: streptos@hotmail.com, E-mail: rleite2005@gmail.com, E-mail: vidasnino@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia

2013-07-01

Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using {sup 32}P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83

Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

DEFF Research Database (Denmark)

Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte

2012-01-01

To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...

HAfTs are novel lncRNA transcripts from aflatoxin exposure.

Directory of Open Access Journals (Sweden)

B Alex Merrick

Full Text Available The transcriptome can reveal insights into precancer biology. We recently conducted RNA-Seq analysis on liver RNA from male rats exposed to the carcinogen, aflatoxin B1 (AFB1, for 90 days prior to liver tumor onset. Among >1,000 differentially expressed transcripts, several novel, unannotated Cufflinks-assembled transcripts, or HAfTs (Hepatic Aflatoxin Transcripts were found. We hypothesized PCR-cloning and RACE (rapid amplification of cDNA ends could further HAfT identification. Sanger data was obtained for 6 transcripts by PCR and 16 transcripts by 5'- and 3'-RACE. BLAST alignments showed, with two exceptions, HAfT transcripts were lncRNAs, >200nt without apparent long open reading frames. Six rat HAfT transcripts were classified as 'novel' without RefSeq annotation. Sequence alignment and genomic synteny showed each rat lncRNA had a homologous locus in the mouse genome and over half had homologous loci in the human genome, including at least two loci (and possibly three others that were previously unannotated. While HAfT functions are not yet clear, coregulatory roles may be possible from their adjacent orientation to known coding genes with altered expression that include 8 HAfT-gene pairs. For example, a unique rat HAfT, homologous to Pvt1, was adjacent to known genes controlling cell proliferation. Additionally, PCR and RACE Sanger sequencing showed many alternative splice variants and refinements of exon sequences compared to Cufflinks assembled transcripts and gene prediction algorithms. Presence of multiple splice variants and short tandem repeats found in some HAfTs may be consequential for secondary structure, transcriptional regulation, and function. In summary, we report novel, differentially expressed lncRNAs after exposure to the genotoxicant, AFB1, prior to neoplastic lesions. Complete cloning and sequencing of such transcripts could pave the way for a new set of sensitive and early prediction markers for chemical

Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

Science.gov (United States)

Kageyama, A; Benno, Y

2001-01-01

PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

Frequency of Chlamydia trachomatis in genital specimens: kerman city, PCR method

Directory of Open Access Journals (Sweden)

Khalili M

2008-06-01

Full Text Available Background: Chlamydia trachomatis (CT is an obligate intracellular bacterium that causes genital disease and the most common sexually transmitted infection in the world. The most frequent risk factors associated with chlamydial infection are related to sexual behavior, multiple partners, and inconsistent condom use. Presenting primarily as urtheritis in men and cervicitis in women, CT a major cause of chronic pelvic inflammatory disease and subsequent infertility in women, eye and lung infection in newborns and other manifestations. Identification of CT-infected patients may prevent its spread and thereby reduce the high morbidity associated with CT infections. Polymerase chain reaction (PCR is a sensitive and specific method for the detection of small quantity of bacterial DNA in clinical samples. The aim of this study was to determine the frequency of C. trachomatis by PCR in genital samples from patients in the city of Kerman.Methods: A total of 130 genital samples including 64 endocervical and 66 urethral swab samples were collected by physicians. Nucleic acid was extracted from each sample using a commercial DNA extraction kit. PCR primers specific for a conserved region of the C. trachomatis omp2 gene, encoding an outer membrane protein, were used for amplification.  Results: A total of 9.2% (6.25% of cervicitis and 12.1% of urethritis of the samples were found positive for CT using this PCR method. Conclusions:  The present study shows a high prevalence of CT infection, especially in men with urethritis. Such patients should be referred to genitourinary clinics for treatment and partner notification. Given its worldwide prevalence, further CT studies on more populations are needed to assess potential public health implications of these infections.

Reference gene selection for molecular studies of dormancy in wild oat (Avena fatua L. caryopses by RT-qPCR method.

Directory of Open Access Journals (Sweden)

Izabela Ruduś

Full Text Available Molecular studies of primary and secondary dormancy in Avena fatua L., a serious weed of cereal and other crops, are intended to reveal the species-specific details of underlying molecular mechanisms which in turn may be useable in weed management. Among others, quantitative real-time PCR (RT-qPCR data of comparative gene expression analysis may give some insight into the involvement of particular wild oat genes in dormancy release, maintenance or induction by unfavorable conditions. To assure obtaining biologically significant results using this method, the expression stability of selected candidate reference genes in different data subsets was evaluated using four statistical algorithms i.e. geNorm, NormFinder, Best Keeper and ΔCt method. Although some discrepancies in their ranking outputs were noticed, evidently two ubiquitin-conjugating enzyme homologs, AfUBC1 and AfUBC2, as well as one homolog of glyceraldehyde 3-phosphate dehydrogenase AfGAPDH1 and TATA-binding protein AfTBP2 appeared as more stably expressed than AfEF1a (translation elongation factor 1α, AfGAPDH2 or the least stable α-tubulin homolog AfTUA1 in caryopses and seedlings of A. fatua. Gene expression analysis of a dormancy-related wild oat transcription factor VIVIPAROUS1 (AfVP1 allowed for a validation of candidate reference genes performance. Based on the obtained results it can be recommended that the normalization factor calculated as a geometric mean of Cq values of AfUBC1, AfUBC2 and AfGAPDH1 would be optimal for RT-qPCR results normalization in the experiments comprising A. fatua caryopses of different dormancy status.

Reference gene selection for molecular studies of dormancy in wild oat (Avena fatua L.) caryopses by RT-qPCR method.

Science.gov (United States)

Ruduś, Izabela; Kępczyński, Jan

2018-01-01

Molecular studies of primary and secondary dormancy in Avena fatua L., a serious weed of cereal and other crops, are intended to reveal the species-specific details of underlying molecular mechanisms which in turn may be useable in weed management. Among others, quantitative real-time PCR (RT-qPCR) data of comparative gene expression analysis may give some insight into the involvement of particular wild oat genes in dormancy release, maintenance or induction by unfavorable conditions. To assure obtaining biologically significant results using this method, the expression stability of selected candidate reference genes in different data subsets was evaluated using four statistical algorithms i.e. geNorm, NormFinder, Best Keeper and ΔCt method. Although some discrepancies in their ranking outputs were noticed, evidently two ubiquitin-conjugating enzyme homologs, AfUBC1 and AfUBC2, as well as one homolog of glyceraldehyde 3-phosphate dehydrogenase AfGAPDH1 and TATA-binding protein AfTBP2 appeared as more stably expressed than AfEF1a (translation elongation factor 1α), AfGAPDH2 or the least stable α-tubulin homolog AfTUA1 in caryopses and seedlings of A. fatua. Gene expression analysis of a dormancy-related wild oat transcription factor VIVIPAROUS1 (AfVP1) allowed for a validation of candidate reference genes performance. Based on the obtained results it can be recommended that the normalization factor calculated as a geometric mean of Cq values of AfUBC1, AfUBC2 and AfGAPDH1 would be optimal for RT-qPCR results normalization in the experiments comprising A. fatua caryopses of different dormancy status.

Increased efficacy for in-house validation of real-time PCR GMO detection methods.

Science.gov (United States)

Scholtens, I M J; Kok, E J; Hougs, L; Molenaar, B; Thissen, J T N M; van der Voet, H

2010-03-01

To improve the efficacy of the in-house validation of GMO detection methods (DNA isolation and real-time PCR, polymerase chain reaction), a study was performed to gain insight in the contribution of the different steps of the GMO detection method to the repeatability and in-house reproducibility. In the present study, 19 methods for (GM) soy, maize canola and potato were validated in-house of which 14 on the basis of an 8-day validation scheme using eight different samples and five on the basis of a more concise validation protocol. In this way, data was obtained with respect to the detection limit, accuracy and precision. Also, decision limits were calculated for declaring non-conformance (>0.9%) with 95% reliability. In order to estimate the contribution of the different steps in the GMO analysis to the total variation variance components were estimated using REML (residual maximum likelihood method). From these components, relative standard deviations for repeatability and reproducibility (RSD(r) and RSD(R)) were calculated. The results showed that not only the PCR reaction but also the factors 'DNA isolation' and 'PCR day' are important factors for the total variance and should therefore be included in the in-house validation. It is proposed to use a statistical model to estimate these factors from a large dataset of initial validations so that for similar GMO methods in the future, only the PCR step needs to be validated. The resulting data are discussed in the light of agreed European criteria for qualified GMO detection methods.

A new detection method for the K variant of butyrylcholinesterase based on PCR primer introduced restriction analysis (PCR-PIRA).

Science.gov (United States)

Shibuta, K; Abe, M; Suzuki, T

1994-01-01

The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197

Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay

Directory of Open Access Journals (Sweden)

Khandaker Shadia

2012-01-01

Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11

Detection of Mycoplasma synoviae in clinical samples by VlhA-PCR method

Directory of Open Access Journals (Sweden)

H Ansari

2010-02-01

Full Text Available As one of the major pathogens of avian species, Mycoplasma Synoviae causes significant economic losses to the poultry industry. The main purpose of this study was to detect Mycoplasma Synoviae in clinical samples using the VlhA-PCR method. For serological screening test, 373 serum samples were collected from 25 breeder farms and rapid serum agglutination test conducted which revealed that 143 samples equivalent to 19 breeder farms were positive. For VlhA-PCR assay, 20 of the previously mentioned breeder farms were selected and sterile swab were collected from the palatine cleft, trachea, air sacs and lungs. Three swabs from 3 birds were placed in a test tube containing 1 ml of PBS and transferred to the laboratory for PCR test. Specific primers for VIhA gene were employed in this study. The PCR product from specific primers showed 350-400 bp for all field isolated on electrophoresis gel in 8 farms. VlhA-PCR with high sensitivity could be employed in definitive diagnosis of Mycoplasma Synoviae infection in the laboratory.

Comparison of phenotypic and PCR methods for detection of carbapenemases production by Enterobacteriaceae

Directory of Open Access Journals (Sweden)

Maryam AlTamimi

2017-01-01

Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.

Biomarker discovery for colon cancer using a 761 gene RT-PCR assay

Directory of Open Access Journals (Sweden)

Hackett James R

2007-08-01

Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of

Comparison of a PCR-Based Method with Culture and Direct Examination for Diagnosis of Acanthamoeba keratitis

Directory of Open Access Journals (Sweden)

S Farnia

2009-05-01

Full Text Available "nBackground: The aim was to compare three different methods (direct examination, culture and PCR meth­ods for the diagnosis of Acanthamoeba keratitis (AK in corneal scrapes."nMethods: Twenty eight corneal scrapes and contact lenses were collected from keratitis patients and re­ferred to the De­partment of Medical Parasitology and Mycology, School of Public Health, Tehran Univer­sity of Medical Sci­ences. Corneal scrapes were divided in three parts for direct examination, culture on non-nutrient agar and PCR analysis. PCR analysis was also performed using a 18S rRNA gene primer pair (DF3 region. DF3 (Diagnostic frag­ment 3 is a region of the nuclear small subunit ribosomal RNA gene which is specific for detecting Acan­thamoeba strains."nResults:  Acanthamoeba was the causative agent of keratitis in 50% of the patients. Direct smear of all pre­pared corneal scrapes in AK patients was negative and culture was positive in only 14.3% of the isolates. PCR analysis was positive in 71.4% of AK patients. These three methods were negative in corneal scrapes of non-AK patients. The sensitivity and specificity of PCR technique for the detection of Acanthamoeba sp. were calculated as 71.4% and 100%, respectively."nConclusion: According to high sensitivity and specificity of PCR-based method, this study confirmed that PCR using 18S rRNA gene primers (DF3 region is more useful for detecting AK cases compare to culture and direct microscopy methods.

PCR Expression Analysis Of the Estrogeninducible Gene Bcei in Gastrointestinal and Other Human Tumors

Directory of Open Access Journals (Sweden)

Iris Wundrack

1994-01-01

Full Text Available A polymerase chain reaction (PCR assay was developed to test for tumor cell specific expression of the BCEI gene. This new marker gene, reported at first for human breast cancer, was found specifically active in various gastrointestinal carcinomas by previously applying immunohistochemistry and RNA (Northern blot analysis. Presently, by using reverse transcription -PCR analysis, a series of primary tumor tissues and established tumor cell lines were testcd for BCEI transcription. This approach was compared to immunostaining achieved by an antibody directed against the BCEI gene’s product. The result demonstrate the superior sensitivity of PCR by indicating the gene’ s expression in cases where immunohistochemical testing remained negative.

A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.

Directory of Open Access Journals (Sweden)

Sandra J Laney

2008-06-01

Full Text Available Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript.Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes.This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.

Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms

Directory of Open Access Journals (Sweden)

Charlotte Nejad

2018-01-01

Full Text Available MicroRNA (miRNA detection by reverse transcription (RT quantitative real-time PCR (RT-qPCR is the most popular method currently used to measure miRNA expression. Although the majority of miRNA families are constituted of several 3′-end length variants (“isomiRs”, little attention has been paid to their differential detection by RT-qPCR. However, recent evidence indicates that 3′-end miRNA isoforms can exhibit 3′-length specific regulatory functions, underlining the need to develop strategies to differentiate 3′-isomiRs by RT-qPCR approaches. We demonstrate here that polyadenylation-based RT-qPCR strategies targeted to 20–21 nt isoforms amplify entire miRNA families, but that primers targeted to >22 nt isoforms were specific to >21 nt isoforms. Based on this observation, we developed a simple method to increase selectivity of polyadenylation-based RT-qPCR assays toward shorter isoforms, and demonstrate its capacity to help distinguish short RNAs from longer ones, using synthetic RNAs and biological samples with altered isomiR stoichiometry. Our approach can be adapted to many polyadenylation-based RT-qPCR technologies already exiting, providing a convenient way to distinguish long and short 3′-isomiRs.

No control genes required: Bayesian analysis of qRT-PCR data.

Directory of Open Access Journals (Sweden)

Mikhail V Matz

Full Text Available Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process.In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts. Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests.Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

No control genes required: Bayesian analysis of qRT-PCR data.

Science.gov (United States)

Matz, Mikhail V; Wright, Rachel M; Scott, James G

2013-01-01

Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR) is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process. In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC) algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts). Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization) but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests. Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

Comparison of reverse-transcription real-time PCR and immunohistochemistry for the detection of canine distemper virus infection in raccoons in Ontario, Canada.

Science.gov (United States)

Nemeth, Nicole M; Oesterle, Paul T; Campbell, G Douglas; Ojkic, Davor; Jardine, Claire M

2018-03-01

Canine distemper virus (CDV) is a widespread morbillivirus that causes subclinical to fatal infections in domestic and wild carnivores. Raccoons ( Procyon lotor) are CDV reservoirs and suffer from associated disease. Aspects of pathogenesis may lead to difficulty in the interpretation of commonly used testing modalities, such as reverse-transcription real-time (RT-rt)PCR and immunohistochemistry (IHC). The reliance upon such tests is greater for wildlife, which are often submitted as carcasses with no clinical history. We compared CDV RT-rtPCR results to immunohistochemistry (the gold standard) in tissues from 74 raccoons. These tests had high kappa agreement (lymph node: 0.9335; lung: 0.8671) and a negative correlation between IHC score and threshold cycle (Ct) value for lymph node and lung (Spearman rank correlation coefficient [ r s ] = -0.8555 and -0.8179, respectively; p < 0.00001). An RT-rtPCR Ct value of 30 in lung and lymph node with sensitivity and specificity of 92.3 and 92.6% and 86.8 and 96.4%, respectively, was suitable for determining CDV involvement. Conjunctival swabs provide an alternative for distemper diagnosis, as there was a strong correlation between Ct values of conjunctival swabs and tissues ( r s = -0.8498, p < 0.00001, n = 46). This information will aid in more efficient and accurate diagnoses in individuals, small-scale outbreaks, and epidemiologic investigations in wildlife.

A digital PCR method for identifying and quantifying adulteration of meat species in raw and processed food.

Directory of Open Access Journals (Sweden)

Junan Ren

Full Text Available Meat adulteration is a worldwide concern. In this paper, a new droplet digital PCR (ddPCR method was developed for the quantitative determination of the presence of chicken in sheep and goat meat products. Meanwhile, a constant (multiplication factor was introduced to transform the ratio of copy numbers to the proportion of meats. The presented ddPCR method was also proved to be more accurate (showing bias of less than 9% in the range from 5% to 80% than real-time PCR, which has been widely used in this determination. The method exhibited good repeatability and stability in different thermal treatments and at ultra-high pressure. The relative standard deviation (RSD values of 5% chicken content was less than 5.4% for ultra-high pressure or heat treatment. Moreover, we confirmed that different parts of meat had no effect on quantification accuracy of the ddPCR method. In contrast to real-time PCR, we examined the performance of ddPCR as a more precise, sensitive and stable analytical strategy to overcome potential problems of discrepancies in amplification efficiency discrepancy and to obtain the copy numbers directly without standard curves. The method and strategy developed in this study can be applied to quantify the presence and to confirm the absence of adulterants not only to sheep but also to other kinds of meat and meat products.

A Comparison of Molecular Typing Methods Applied to Enterobacter cloacae complex: hsp60 Sequencing, Rep-PCR, and MLST

Directory of Open Access Journals (Sweden)

Roberto Viau

2017-02-01

Full Text Available Molecular typing using repetitive sequenced-based PCR (rep-PCR and hsp60 sequencing were applied to a collection of diverse Enterobacter cloacae complex isolates. To determine the most practical method for reference laboratories, we analyzed 71 E. cloacae complex isolates from sporadic and outbreak occurrences originating from 4 geographic areas. While rep-PCR was more discriminating, hsp60 sequencing provided a broader and a more objective geographical tracking method similar to multilocus sequence typing (MLST. In addition, we suggest that MLST may have higher discriminative power compared to hsp60 sequencing, although rep-PCR remains the most discriminative method for local outbreak investigations. In addition, rep-PCR can be an effective and inexpensive method for local outbreak investigation.

A direct qPCR method for residual DNA quantification in monoclonal antibody drugs produced in CHO cells.

Science.gov (United States)

Hussain, Musaddeq

2015-11-10

Chinese hamster ovary (CHO) cells are the host cell of choice for manufacturing of monoclonal antibody (mAb) drugs in the biopharmaceutical industry. Host cell DNA is an impurity of such manufacturing process and must be controlled and monitored in order to ensure drug purity and safety. A conventional method for quantification of host residual DNA in drug requires extraction of DNA from the mAb drug substance with subsequent quantification of the extracted DNA using real-time PCR (qPCR). Here we report a method where the DNA extraction step is eliminated prior to qPCR. In this method, which we have named 'direct resDNA qPCR', the mAb drug substance is digested with a protease called KAPA in a 96-well PCR plate, the protease in the digest is then denatured at high temperature, qPCR reagents are added to the resultant reaction wells in the plate along with standards and controls in other wells of the same plate, and the plate subjected to qPCR for analysis of residual host DNA in the samples. This direct resDNA qPCR method for CHO is sensitive to 5.0fg of DNA with high precision and accuracy and has a wide linear range of determination. The method has been successfully tested with four mAbs drug, two IgG1 and two IgG4. Both the purified drug substance as well as a number of process intermediate samples, e.g., bioreactor harvest, Protein A column eluate and ion-exchange column eluates were tested. This method simplifies the residual DNA quantification protocol, reduces time of analysis and leads to increased assay sensitivity and development of automated high-throughput methods. Copyright © 2015 Elsevier B.V. All rights reserved.

Unequal distribution of RT-PCR artifacts along the E1-E2 region of Hepatitis C virus.

Science.gov (United States)

Domingo-Calap, Pilar; Sentandreu, Vicente; Bracho, Maria Alma; González-Candelas, Fernando; Moya, Andrés; Sanjuán, Rafael

2009-10-01

Although viral variability studies have focused traditionally on consensus sequences, the relevance of molecular clone sequences for studying viral evolution at the intra-host level is being increasingly recognized. However, for this approach to be reliable, RT-PCR artifacts do not have to contribute excessively to the observed variability. Molecular clone sequences were obtained from an in vitro transcript to estimate the maximum error rate associated to RT-PCR for the Hepatitis C virus (HCV) E1-E2 region. On average, the frequency of RT-PCR errors was one order of magnitude lower than the level of intra-host genetic variability observed in samples from an HCV outbreak. However, RT-PCR errors were not distributed evenly along the E1-E2 region and were concentrated heavily in the hypervariable region 2 (HVR 2). Although it is concluded that RT-PCR molecular clone sequences are reliable, these results warn against extrapolation of RT-PCR error rates to different genome regions. The data suggest that the RNA sequence context or secondary structure can determine the fidelity of in vitro transcription or reverse transcription. Potentially, these factors might also modify the fidelity of the viral polymerase.

Identification of some Fusarium species from selected crop seeds using traditional method and BIO-PCR

Directory of Open Access Journals (Sweden)

Tomasz Kulik

2012-12-01

Full Text Available We identified a species level of the fungal cultures isolated from selected crop seeds using traditional method and BIO-PCR. The use of BIO-PCR did not correspond completely to the morphological analyses. Both methods showed increased infection with F. poae in winter wheat seed sample originated from north Poland. Fungal culture No 40 (isolated from faba bean and identified with traditional method as mixed culture with F. culmorum and F. graminearum did not produce expected product after PCR reaction with species specific primers OPT18F470, OPT18R470. However, the use of additional primers Fc01F, Fc01R allowed for reliable identification of F. culmorum in the culture.

FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method

Directory of Open Access Journals (Sweden)

Lu Jia

2011-10-01

Full Text Available Abstract Background Although a variety of methods and expensive kits are available, molecular cloning can be a time-consuming and frustrating process. Results Here we report a highly simplified, reliable, and efficient PCR-based cloning technique to insert any DNA fragment into a plasmid vector or into a gene (cDNA in a vector at any desired position. With this method, the vector and insert are PCR amplified separately, with only 18 cycles, using a high fidelity DNA polymerase. The amplified insert has the ends with ~16-base overlapping with the ends of the amplified vector. After DpnI digestion of the mixture of the amplified vector and insert to eliminate the DNA templates used in PCR reactions, the mixture is directly transformed into competent E. coli cells to obtain the desired clones. This technique has many advantages over other cloning methods. First, it does not need gel purification of the PCR product or linearized vector. Second, there is no need of any cloning kit or specialized enzyme for cloning. Furthermore, with reduced number of PCR cycles, it also decreases the chance of random mutations. In addition, this method is highly effective and reproducible. Finally, since this cloning method is also sequence independent, we demonstrated that it can be used for chimera construction, insertion, and multiple mutations spanning a stretch of DNA up to 120 bp. Conclusion Our FastCloning technique provides a very simple, effective, reliable, and versatile tool for molecular cloning, chimera construction, insertion of any DNA sequences of interest and also for multiple mutations in a short stretch of a cDNA.

A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

Science.gov (United States)

Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

2013-03-11

Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

Evaluation of PCR methods for detection of Brucella strains from culture and tissues.

Science.gov (United States)

Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar

2017-04-01

The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.

Development of Nested PCR-Based Specific Markers for Detection of Peach Rosette Mosaic Virus in Plant Quarantine.

Science.gov (United States)

Lee, S; Kim, C S; Shin, Y G; Kim, J H; Kim, Y S; Jheong, W H

2016-03-01

The Peach rosette mosaic virus (PRMV) is a plant pathogen of the genus Nepovirus, and has been designated as a controlled quarantine virus in Korea. In this study, a specific reverse transcription (RT)-PCR marker set, nested PCR marker set, and modified-plasmid positive control were developed to promptly and accurately diagnose PRMV at plant-quarantine sites. The final selected PRMV-specific RT-PCR marker was PRMV-N10/C70 (967 bp), and the nested PCR product of 419 bp was finally amplified. The modified-plasmid positive control, in which the SalI restriction-enzyme region (GTCGAC) was inserted, verified PRMV contamination in a comparison with the control, enabling a more accurate diagnosis. It is expected that the developed method will continuously contribute to the plant-quarantine process in Korea.

A quantitative method to evaluate mesenchymal stem cell lipofection using real-time PCR.

Science.gov (United States)

Ribeiro, S C; Mendes, R; Madeira, C; Monteiro, G A; da Silva, C L; Cabral, J M S

2010-01-01

Genetic modification of human mesenchymal stem cells (MSC) is a powerful tool to improve the therapeutic utility of these cells and to increase the knowledge on their regulation mechanisms. In this context, strong efforts have been made recently to develop efficient nonviral gene delivery systems. Although several studies addressed this question most of them use the end product of a reporter gene instead of the DNA uptake quantification to test the transfection efficiency. In this study, we established a method based on quantitative real-time PCR (RT-PCR) to determine the intracellular plasmid DNA copy number in human MSC after lipofection. The procedure requires neither specific cell lysis nor DNA purification. The influence of cell number on the RT-PCR sensitivity was evaluated. The method showed good reproducibility, high sensitivity, and a wide linear range of 75-2.5 x 10⁶ plasmid DNA copies per cell. RT-PCR results were then compared with the percentage of transfected cells assessed by flow cytometry analysis, which showed that flow cytometry-based results are not always proportional to plasmid cellular uptake determined by RT-PCR. This work contributed for the establishment of a rapid quantitative assay to determine intracellular plasmid DNA in stem cells, which will be extremely beneficial for the optimization of gene delivery strategies. © 2010 American Institute of Chemical Engineers

Single-cell duplex RT-LATE-PCR reveals Oct4 and Xist RNA gradients in 8-cell embryos

Directory of Open Access Journals (Sweden)

Hartung Odelya

2007-12-01

Full Text Available Abstract Background The formation of two distinctive cell lineages in preimplantation mouse embryos is characterized by differential gene expression. The cells of the inner cell mass are pluripotent and express high levels of Oct4 mRNA, which is down-regulated in the surrounding trophectoderm. In contrast, the trophectoderm of female embryos contains Xist mRNA, which is absent from cells of the inner mass. Prior to blastocyst formation, all blastomeres of female embryos still express both of these RNAs. We, thus, postulated that simultaneous quantification of Oct4 and Xist transcripts in individual blastomeres at the 8-cell stage could be informative as to their subsequent fate. Testing this hypothesis, however, presented numerous technical challenges. We overcame these difficulties by combining PurAmp, a single-tube method for RNA preparation and quantification, with LATE-PCR, an advanced form of asymmetric PCR. Results We constructed a duplex RT-LATE-PCR assay for real-time measurement of Oct4 and Xist templates and confirmed its specificity and quantitative accuracy with different methods. We then undertook analysis of sets of blastomeres isolated from embryos at the 8-cell stage. At this stage, all cells in the embryo are still pluripotent and morphologically equivalent. Our results demonstrate, however, that both Oct4 and Xist RNA levels vary in individual blastomeres comprising the same embryo, with some cells having particularly elevated levels of either transcript. Analysis of multiple embryos also shows that Xist and Oct4 expression levels are not correlated at the 8-cell stage, although transcription of both genes is up-regulated at this time in development. In addition, comparison of data from males and females allowed us to determine that the efficiency of the Oct4/Xist assay is unaffected by sex-related differences in gene expression. Conclusion This paper describes the first example of multiplex RT-LATE-PCR and its utility, when

Detection of Legionella species in environmental water by the quantitative PCR method in combination with ethidium monoazide treatment.

Science.gov (United States)

Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio

2015-01-01

We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.

Molecular measurement of BCR-ABL transcript variations in chronic myeloid leukemia patients in cytogenetic remission

Directory of Open Access Journals (Sweden)

Costa Juliana

2010-11-01

Full Text Available Abstract Background The monitoring of BCR-ABL transcript levels by real-time quantitative polymerase chain reaction (RT-qPCR has become important to assess minimal residual disease (MRD and standard of care in the treatment of chronic myeloid leukemia (CML. In this study, we performed a prospective, sequential analysis using RT-qPCR monitoring of BCR-ABL gene rearrangements in blood samples from 91 CML patients in chronic phase (CP who achieved complete cytogenetic remission (CCyR and major molecular remission (MMR throughout imatinib treatment. Methods The absolute level of BCR-ABL transcript from peripheral blood was serially measured every 4 to 12 weeks by RT-qPCR. Only level variations > 0.5%, according to the international scale, was considered positive. Sequential cytogenetic analysis was also performed in bone marrow samples from all patients using standard protocols. Results Based on sequential analysis of BCR-ABL transcripts, the 91 patients were divided into three categories: (A 57 (62.6% had no variation on sequential analysis; (B 30 (32.9% had a single positive variation result obtained in a single sample; and (C 4 (4.39% had variations of BCR-ABL transcripts in at least two consecutive samples. Of the 34 patients who had elevated levels of transcripts (group B and C, 19 (55.8% had a BCR-ABL/BCR ratio, 13 (38.2% patients had a 1% to 10% increase and 2 patients had a >10% increase of RT-qPCR. The last two patients had lost a CCyR, and none of them showed mutations in the ABL gene. Transient cytogenetic alterations in Ph-negative cells were observed in five (5.5% patients, and none of whom lost CCyR. Conclusions Despite an increase levels of BCR-ABL/BCR ratio variations by RT-qPCR, the majority of CML patients with MMR remained in CCyR. Thus, such single variations should neither be considered predictive of subsequent failure and nor an indication for altering imatinib dose or switching to second generation therapy. Changing of

Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures.

Science.gov (United States)

McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D

2017-01-01

Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and

Simultaneous detection of three pome fruit tree viruses by one-step multiplex quantitative RT-PCR.

Science.gov (United States)

Malandraki, Ioanna; Beris, Despoina; Isaioglou, Ioannis; Olmos, Antonio; Varveri, Christina; Vassilakos, Nikon

2017-01-01

A one-step multiplex real-time reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan probes was developed for the simultaneous detection of Apple mosaic virus (ApMV), Apple stem pitting virus (ASPV) and Apple stem grooving virus (ASGV) in total RNA of pome trees extracted with a CTAB method. The sensitivity of the method was established using in vitro synthesized viral transcripts serially diluted in RNA from healthy, virus-tested (negative) pome trees. The three viruses were simultaneously detected up to a 10-4 dilution of total RNA from a naturally triple-infected apple tree prepared in total RNA of healthy apple tissue. The newly developed RT-qPCR assay was at least one hundred times more sensitive than conventional single RT-PCRs. The assay was validated with 36 field samples for which nine triple and 11 double infections were detected. All viruses were detected simultaneously in composite samples at least up to the ratio of 1:150 triple-infected to healthy pear tissue, suggesting the assay has the capacity to examine rapidly a large number of samples in pome tree certification programs and surveys for virus presence.

Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

Directory of Open Access Journals (Sweden)

Anita Chakravarti

2016-01-01

Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

Droplet digital PCR as a novel detection method for quantifying microRNAs in acute myocardial infarction.

Science.gov (United States)

Robinson, S; Follo, M; Haenel, D; Mauler, M; Stallmann, D; Tewari, M; Duerschmied, D; Peter, K; Bode, C; Ahrens, I; Hortmann, M

2018-04-15

micro-RNAs have shown promise as potential biomarkers for acute myocardial infarction and ischemia-reperfusion injury (I/R). Most recently droplet digital polymerase chain reaction (ddPCR) has been introduced as a more reliable and reproducible method for detecting micro-RNAs. We aimed to demonstrate the improved technical performance and diagnostic potential of ddPCR by measuring micro-RNAs in ST-elevation myocardial infarction (STEMI). A dilution series was performed in duplicate on synthetic Caenorrhabditis elegans-miR-39, comparing quantitative real-time PCR (qRT-PCR) and ddPCR. We used ddPCR and qRT-PCR to quantify the serum levels of miR-21, miR-208a and miR-499 between STEMI patients (n=24) and stable coronary artery disease (CAD) patients (n=20). In STEMI, I/R injury was assessed via measurement of ST-segment resolution. In the dilution series, ddPCR demonstrated superior coefficient of variation (12.1%vs.32.9%) and limit of detection (0.9325 vs.2.425copies/μl). In the patient cohort, ddPCR demonstrated greater differences in miR-21 levels (2190.5 vs. 484.7copies/μl; p=0.0004 for ddPCR and 136.4 vs. 122.8copies/μl; p=0.2273 for qRT-PCR) and in miR-208a (0 vs. 24.1copies/μl, p=0.0013 for ddPCR and 0 vs. 0copies/μl, p=0.0032 for qRT-PCR), with similar differences observed in miR-499 levels (9.4 vs. 81.5copies/μl, pPCR). ddPCR also more accurately defined STEMI for all miRNAs (area under the curve (AUC) of 0.8021/0.7740/0.9063 for miR-21/208a/499 with ddPCR vs. AUC of 0.6083/0.6917/0.8417 with qRT-PCR). However, there was no association between miR-21/208a/499 levels and ischemia-reperfusion injury. ddPCR demonstrates superiority in both technical performance and diagnostic potential compared to qRT-PCR. Ultimately, this supports its use as a diagnostic method for quantifying micro-RNAs, particularly in large multi-center trials. Copyright © 2017 Elsevier B.V. All rights reserved.

Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella

DEFF Research Database (Denmark)

Löfström, Charlotta; Krause, Michael; Josefsen, Mathilde Hartmann

2009-01-01

of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non....... Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially...... contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion: The real-time PCR method for detection of Salmonella in meat and carcass swabs was validated in comparative and collaborative trials according to NordVal recommendations. The PCR method...

Methods for microbial DNA extraction from soil for PCR amplification

Directory of Open Access Journals (Sweden)

Yeates C

1998-01-01

Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

Transcriptional profiling in human HaCaT keratinocytes in response to kaempferol and identification of potential transcription factors for regulating differential gene expression

Science.gov (United States)

Kang, Byung Young; Lee, Ki-Hwan; Lee, Yong Sung; Hong, Il; Lee, Mi-Ock; Min, Daejin; Chang, Ihseop; Hwang, Jae Sung; Park, Jun Seong; Kim, Duck Hee

2008-01-01

Kaempferol is the major flavonol in green tea and exhibits many biomedically useful properties such as antioxidative, cytoprotective and anti-apoptotic activities. To elucidate its effects on the skin, we investigated the transcriptional profiles of kaempferol-treated HaCaT cells using cDNA microarray analysis and identified 147 transcripts that exhibited significant changes in expression. Of these, 18 were up-regulated and 129 were down-regulated. These transcripts were then classified into 12 categories according to their functional roles: cell adhesion/cytoskeleton, cell cycle, redox homeostasis, immune/defense responses, metabolism, protein biosynthesis/modification, intracellular transport, RNA processing, DNA modification/ replication, regulation of transcription, signal transduction and transport. We then analyzed the promoter sequences of differentially-regulated genes and identified over-represented regulatory sites and candidate transcription factors (TFs) for gene regulation by kaempferol. These included c-REL, SAP-1, Ahr-ARNT, Nrf-2, Elk-1, SPI-B, NF-κB and p65. In addition, we validated the microarray results and promoter analyses using conventional methods such as real-time PCR and ELISA-based transcription factor assay. Our microarray analysis has provided useful information for determining the genetic regulatory network affected by kaempferol, and this approach will be useful for elucidating gene-phytochemical interactions. PMID:18446059

Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

Science.gov (United States)

Vojkovska, H; Kubikova, I; Kralik, P

2015-03-01

Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

Canine distemper virus detection by different methods of One-Step RT-qPCR

Directory of Open Access Journals (Sweden)

Claudia de Camargo Tozato

2016-01-01

Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

Science.gov (United States)

Lee, Seong-Hun

2014-11-01

There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

Science.gov (United States)

Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

1995-06-01

For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

Science.gov (United States)

Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

2013-10-01

A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

Mathematical analysis of the real time array PCR (RTA PCR) process

NARCIS (Netherlands)

Dijksman, Johan Frederik; Pierik, A.

2012-01-01

Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

Directory of Open Access Journals (Sweden)

Yong Huang

Full Text Available Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus and PCV2 (DNA virus from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29% and TGEV (11.7% preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

Science.gov (United States)

Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

2015-01-01

Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

Science.gov (United States)

Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

2015-01-01

Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

Energy Technology Data Exchange (ETDEWEB)

Tennyson, C.N.; Worton, R.G. [Univ. of Toronto and the Hospital for Sick Children, Ontario (Canada)

1994-09-01

The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

Arbitrarily primed PCR- A rapid and simple method for typing of leptospiral serovars

Directory of Open Access Journals (Sweden)

Ramadass P

2002-01-01

Full Text Available PURPOSE: To investigate the use of arbitrarily primed polymerase chain reaction (AP-PCR for typing of leptospiral serovars. METHODS: AP-PCR was adopted for identification of laboratory strains of leptospires and leptospiral cultures at serovar level. A primer of 12 bp was used for amplifying DNA of 13 laboratory strains of leptospires as well as culture pellets of leptospires. RESULTS: Each serovar produced distinct DNA fingerprint which was characteristic for each serovar. These patterns were used for typing of 81 serum culture samples obtained from human leptospiral cases. Of these samples, 39 could be typed based on AP-PCR fingerprints belonging to serovars autumnalis, pomona, canicola, javanica, icterohaemorrhagiae, patoc and pyrogenes. These results were confirmed by RAPD fingerprinting of the DNA samples of the respective leptospiral serovars after culturing -FNx01them in EMJH media. One of the important findings of this work was that straight culture sample could be used for AP-PCR assay, without purification of DNA. By having more number of AP-PCR reference fingerprints, more serovars could be typed. CONCLUSIONS: AP-PCR technique provides great potential for simple and rapid identification of leptospires at serovar level, which could be useful in molecular epidemiological studies of leptospirosis.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

Science.gov (United States)

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

Clinical evaluation of β-tubulin real-time PCR for rapid diagnosis of dermatophytosis, a comparison with mycological methods.

Science.gov (United States)

Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi

2017-10-01

Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.

Selection and Validation of Reference Genes for qRT-PCR Expression Analysis of Candidate Genes Involved in Olfactory Communication in the Butterfly Bicyclus anynana

OpenAIRE

Arun, Alok; Bauml?, V?ronique; Amelot, Ga?l; Nieberding, Caroline M.

2015-01-01

Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at ident...

PCR-RFLP diagnostic method for identifying Globodera species in Slovenia

Directory of Open Access Journals (Sweden)

Sasa ŠIRCA

2011-01-01

Full Text Available Species identification within the genus Globodera is based on the morphological and morphometrical characters of the cysts and second stage juveniles, and these are included in the majority of identification keys. Morphometrical methods are fast and can be applied to most of samples but they demand a trained and experienced specialist. Furthermore, some morphometrical characters may overlap between populations and beetwen species, leading to inaccurate identification. To confirm and complement the morphometrical identification of Globodera species molecular methods have been developed. Sequences of the internal transcribed spacer regions ITS1 and ITS2 of the rDNA gene cluster proved to be useful for identifying nematode species identification. A PCR-RFLP molecular method was used to identify Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae. Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae can be distinguished with PCR-RFLP analysis of the rDNA ITS fragment using five restriction enzymes. The RFLP patterns of G. rostochiensis, G. tabacum and G. achilleae were species-specific, while those of G. pallida varied. South American populations of G. pallida differed from other populations as their RFLP patterns were demonstrated to be distinct by in silico restriction of the ITS sequences deposited at NCBI.

Development and Evaluation of Event-Specific Quantitative PCR Method for Genetically Modified Soybean MON87701.

Science.gov (United States)

Tsukahara, Keita; Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Nishimaki-Mogami, Tomoko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

2016-01-01

A real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event, MON87701. First, a standard plasmid for MON87701 quantification was constructed. The conversion factor (C f ) required to calculate the amount of genetically modified organism (GMO) was experimentally determined for a real-time PCR instrument. The determined C f for the real-time PCR instrument was 1.24. For the evaluation of the developed method, a blind test was carried out in an inter-laboratory trial. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr), respectively. The determined biases and the RSDr values were less than 30 and 13%, respectively, at all evaluated concentrations. The limit of quantitation of the method was 0.5%, and the developed method would thus be applicable for practical analyses for the detection and quantification of MON87701.

PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato

Science.gov (United States)

Singh, Om P; Bali, Prerna; Hemingway, Janet; Subbarao, Sarala K; Dash, Aditya P; Adak, Tridibes

2009-01-01

Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr) is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F) in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F) in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR), an Amplification Refractory Mutation System (ARMS) and Primer Introduced Restriction Analysis-PCR (PIRA-PCR) were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method was refractory to non

PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato

Directory of Open Access Journals (Sweden)

Dash Aditya P

2009-07-01

Full Text Available Abstract Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR, an Amplification Refractory Mutation System (ARMS and Primer Introduced Restriction Analysis-PCR (PIRA-PCR were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method

Immunomagnetic separation combined with RT-qPCR for determining the efficacy of disinfectants against human noroviruses

Directory of Open Access Journals (Sweden)

Pengbo Liu

2015-03-01

Full Text Available Summary: Little is known about the effectiveness of disinfectants against human noroviruses (NoV partially because human NoV cannot be routinely cultured in laboratory. The objective of this study was to develop a NoV monoclonal antibody-conjugated immunomagnetic separation (IMS procedure combined with real-time reverse transcription polymerase chain reaction (RT-qPCR assays to study the in vitro efficacy of disinfectants against human NoV. Monoclonal antibodies against Norwalk virus (NV, GI.1 and NoV GII.4 were produced using unique NoV capsid proteins, and the antibodies were conjugated to magnetic Dynalbeads. The immunomagnetic beads were used to simultaneously capture intact NoV in samples and effectively remove PCR inhibitors. We examined the efficacy of ethanol, sodium hypochlorite, nine commercially available disinfectants, and one prototype disinfectant using the IMS/RT-qPCR. The sensitivity of this procedure was approximately 100 virus particles for both the NV and GII.4 viruses. The average log reductions in in vitro activities varied between disinfectants. The prototype disinfectant produced an average 3.19-log reduction in NV and a 1.38-log reduction in GII.4. The prototype disinfectant is promising of inactivating NoV. This method can be used to evaluate in vitro activity of disinfectants against human NoV. The IMS/RT-qPCR method is promising as an effective method to remove PCR inhibitors in disinfectants and enable the evaluation of the efficacy of disinfectants. Keywords: Disinfectant, Norovirus, Immunomagnetic separation, Real-time RT-PCR, PCR inhibition

Transcriptional responses in honey bee larvae infected with chalkbrood fungus.

Science.gov (United States)

Aronstein, Katherine A; Murray, Keith D; Saldivar, Eduardo

2010-06-21

Diseases and other stress factors working synergistically weaken honey bee health and may play a major role in the losses of bee populations in recent years. Among a large number of bee diseases, chalkbrood has been on the rise. We present here the experimental identification of honey bee genes that are differentially expressed in response to infection of honey bee larvae with the chalkbrood fungus, Ascosphaera apis. We used cDNA-AFLP Technology to profile transcripts in infected and uninfected bee larvae. From 64 primer combinations, over 7,400 transcriptionally-derived fragments were obtained A total of 98 reproducible polymorphic cDNA-AFLP fragments were excised and sequenced, followed by quantitative real-time RT-PCR (qRT-PCR) analysis of these and additional samples.We have identified a number of differentially-regulated transcripts that are implicated in general mechanisms of stress adaptation, including energy metabolism and protein transport. One of the most interesting differentially-regulated transcripts is for a chitinase-like enzyme that may be linked to anti-fungal activities in the honey bee larvae, similarly to gut and fat-body specific chitinases found in mosquitoes and the red flour beetle. Surprisingly, we did not find many components of the well-characterized NF-kappaB intracellular signaling pathways to be differentially-regulated using the cDNA-AFLP approach. Therefore, utilizing qRT-PCR, we probed some of the immune related genes to determine whether the lack of up-regulation of their transcripts in our analysis can be attributed to lack of immune activation or to limitations of the cDNA-AFLP approach. Using a combination of cDNA-AFLP and qRT-PCR analyses, we were able to determine several key transcriptional events that constitute the overall effort in the honey bee larvae to fight natural fungal infection. Honey bee transcripts identified in this study are involved in critical functions related to transcriptional regulation, apoptotic

[Development and validation of event-specific quantitative PCR method for genetically modified maize LY038].

Science.gov (United States)

Mano, Junichi; Masubuchi, Tomoko; Hatano, Shuko; Futo, Satoshi; Koiwa, Tomohiro; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Takabatake, Reona; Kitta, Kazumi

2013-01-01

In this article, we report a novel real-time PCR-based analytical method for quantitation of the GM maize event LY038. We designed LY038-specific and maize endogenous reference DNA-specific PCR amplifications. After confirming the specificity and linearity of the LY038-specific PCR amplification, we determined the conversion factor required to calculate the weight-based content of GM organism (GMO) in a multilaboratory evaluation. Finally, in order to validate the developed method, an interlaboratory collaborative trial according to the internationally harmonized guidelines was performed with blind DNA samples containing LY038 at the mixing levels of 0, 0.5, 1.0, 5.0 and 10.0%. The precision of the method was evaluated as the RSD of reproducibility (RSDR), and the values obtained were all less than 25%. The limit of quantitation of the method was judged to be 0.5% based on the definition of ISO 24276 guideline. The results from the collaborative trial suggested that the developed quantitative method would be suitable for practical testing of LY038 maize.

A novel PCR-based method to enumerate Salmonella in animal feed

DEFF Research Database (Denmark)

Löfström, Charlotta; Andersson, Gunnar; Häggblom, Per

2010-01-01

and pellets) only three gave results that differed between the PCR and MSRV methods. Ct values for naturally contaminated samples were higher compared to samples artificially contaminated with low numbers (approx. 2 CFU/25 g feed) of stressed Salmonella. To allow quantification of low numbers of Salmonella...

A transcript finishing initiative for closing gaps in the human transcriptome

DEFF Research Database (Denmark)

Sogayar, Mari Cleide; Camargo, Anamaria A; Bettoni, Fabiana

2004-01-01

We report the results of a transcript finishing initiative, undertaken for the purpose of identifying and characterizing novel human transcripts, in which RT-PCR was used to bridge gaps between paired EST clusters, mapped against the genomic sequence. Each pair of EST clusters selected...

Quantification of low-expressed mRNA using 5' LNA-containing real-time PCR primers

International Nuclear Information System (INIS)

Malgoyre, A.; Banzet, S.; Mouret, C.; Bigard, A.X.; Peinnequin, A.

2007-01-01

Real-time RT-PCR is the most sensitive and accurate method for mRNA quantification. Using specific recombinant DNA as a template, real-time PCR allows accurate quantification within a 7-log range and increased sensitivity below 10 copies. However, when using RT-PCR to quantify mRNA in biological samples, a stochastic off-targeted amplification can occur. Classical adjustments of assay parameters have minimal effects on such amplification. This undesirable amplification appears mostly to be dependent on specific to non-specific target ratio rather than on the absolute quantity of the specific target. This drawback, which decreases assay reliability, mostly appears when quantifying low-expressed transcript in a whole organ. An original primer design using properties of LNA allows to block off-target amplification. 5'-LNA substitution strengthens 5'-hybridization. Consequently on-target hybridization is stabilized and the probability for the off-target to lead to amplification is decreased

Entamoeba spp. diagnosis in patients with inflmmatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods

Directory of Open Access Journals (Sweden)

Zahra Gharibi

2017-10-01

Full Text Available Objective: To evaluate Entamoeba spp. diagnosis in patients with inflammatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods. Methods: In this descriptive cross-sectional survey, 200 stool samples were randomly collected during 2015–2016. The stool samples were evaluated microscopically for the presence of the parasite using direct and formalin-ether concentration and trichrome staining methods. Then, the stool samples were examined by copro-antigen ELISA (Biomerica Company and multiplex PCR methods. Results: Of 200 samples, 17, 29 and 23 cases were positive for Entamoeba species by the staining, copro-antigen ELISA and multiplex PCR methods, respectively. Of 23 positive samples in multiplex PCR test, 13 and 10 samples were positive for Entamoeba dispar (E. dispar and Entamoeba histolytica (E. histolytica, respectively. Conclusions: Our finding indicated a relatively high prevalence of Entamoeba species in patients with inflammatory diarrhea in Ahvaz city. Due to the complications of E. histolytica/ dispar infection, the health authorities of the city must pay more attention to control and prevent the transmission of E. histolytica/dispar to individuals.

Characterization of human mesothelin transcripts in ovarian and pancreatic cancer

International Nuclear Information System (INIS)

Muminova, Zhanat E; Strong, Theresa V; Shaw, Denise R

2004-01-01

Mesothelin is an attractive target for cancer immunotherapy due to its restricted expression in normal tissues and high level expression in several tumor types including ovarian and pancreatic adenocarcinomas. Three mesothelin transcript variants have been reported, but their relative expression in normal tissues and tumors has been poorly characterized. The goal of the present study was to clarify which mesothelin transcript variants are commonly expressed in human tumors. Human genomic and EST nucleotide sequences in the public databases were used to evaluate sequences reported for the three mesothelin transcript variants in silico. Subsequently, RNA samples from normal ovary, ovarian and pancreatic carcinoma cell lines, and primary ovarian tumors were analyzed by reverse transcription-polymerase chain reaction (RT-PCR) and nucleotide sequencing to directly identify expressed transcripts. In silico comparisons of genomic DNA sequences with available EST sequences supported expression of mesothelin transcript variants 1 and 3, but there were no sequence matches for transcript variant 2. Newly-derived nucleotide sequences of RT-PCR products from tissues and cell lines corresponded to mesothelin transcript variant 1. Mesothelin transcript variant 2 was not detected. Transcript variant 3 was observed as a small percentage of total mesothelin amplification products from all studied cell lines and tissues. Fractionation of nuclear and cytoplasmic RNA indicated that variant 3 was present primarily in the nuclear fraction. Thus, mesothelin transcript variant 3 may represent incompletely processed hnRNA. Mesothelin transcript variant 1 represents the predominant mature mRNA species expressed by both normal and tumor cells. This conclusion should be important for future development of cancer immunotherapies, diagnostic tests, and gene microarray studies targeting mesothelin

Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

International Nuclear Information System (INIS)

Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia GT; Bérgamo, Nádia A; Neto, Francisco A Moraes; Domingues, Maria AC; Soares, Fernando A; Caldeira, José RF; Rogatto, Silvia R

2009-01-01

HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4%) and HER-2 transcript overexpression (20%). Moreover, 2+ immunostaining cases presented nonamplified status (50%) by CISH and HER-2 downexpression (38.5%) by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350). Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene

Monitoring bottlenose dolphin leukocyte cytokine mRNA responsiveness by qPCR

Science.gov (United States)

Eberle, Kirsten C.; Venn-Watson, Stephanie K.; Jensen, Eric D.; Porter, Tracy J.; Waters, Theresa E.; Sacco, Randy E.

2017-01-01

Both veterinarians caring for dolphins in managed populations and researchers monitoring wild populations use blood-based diagnostics to monitor bottlenose dolphin (Tursiops truncatus) health. Quantitative PCR (qPCR) can be used to assess cytokine transcription patterns of peripheral blood mononuclear cells (PBMC). This can supplement currently available blood tests with information on immune status. Full realization of this potential requires establishment of normal ranges of cytokine gene transcription levels in bottlenose dolphins. We surveyed four dolphins over the span of seven months by serial bleeds. PBMC were stimulated with phytohaemagglutinin (1, 5, and 10 μg/mL) and concanavalin A (1 μg/mL) for 48 H in vitro. RNA from these cultures was probed by qPCR using Tursiops truncatus-specific primers (IL-1α, IL-1β, IL-1RA, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12p40, IL-13, IL-18, IFN-γ and TNF-α). Two blood samples from an additional bottlenose dolphin diagnosed with acute pulmonary disease add further perspective to the data. We observed that mitogen choice made a significant difference in the magnitude of gene transcription observed. On the other hand, most cytokines tested exhibited limited intra-animal variation. However, IL-6 and IL-12p40 differed between older and younger dolphins. Furthermore, the magnitude of mitogenic response clusters the tested cytokines into three groups. The data provide a reference for the selection of target cytokine mRNAs and their expected range of mitogen-stimulated cytokine gene transcription for future studies. PMID:29272269

Monitoring bottlenose dolphin leukocyte cytokine mRNA responsiveness by qPCR.

Directory of Open Access Journals (Sweden)

Amelia Ruth Hofstetter

Full Text Available Both veterinarians caring for dolphins in managed populations and researchers monitoring wild populations use blood-based diagnostics to monitor bottlenose dolphin (Tursiops truncatus health. Quantitative PCR (qPCR can be used to assess cytokine transcription patterns of peripheral blood mononuclear cells (PBMC. This can supplement currently available blood tests with information on immune status. Full realization of this potential requires establishment of normal ranges of cytokine gene transcription levels in bottlenose dolphins. We surveyed four dolphins over the span of seven months by serial bleeds. PBMC were stimulated with phytohaemagglutinin (1, 5, and 10 μg/mL and concanavalin A (1 μg/mL for 48 H in vitro. RNA from these cultures was probed by qPCR using Tursiops truncatus-specific primers (IL-1α, IL-1β, IL-1RA, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12p40, IL-13, IL-18, IFN-γ and TNF-α. Two blood samples from an additional bottlenose dolphin diagnosed with acute pulmonary disease add further perspective to the data. We observed that mitogen choice made a significant difference in the magnitude of gene transcription observed. On the other hand, most cytokines tested exhibited limited intra-animal variation. However, IL-6 and IL-12p40 differed between older and younger dolphins. Furthermore, the magnitude of mitogenic response clusters the tested cytokines into three groups. The data provide a reference for the selection of target cytokine mRNAs and their expected range of mitogen-stimulated cytokine gene transcription for future studies.

Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.

Science.gov (United States)

Jamjoom, Manal; Sultan, Amal H

2009-04-01

The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity

Quantitative RT-PCR for titration of replication-defective recombinant Semliki Forest virus.

Science.gov (United States)

Puglia, Ana L P; Rezende, Alexandre G; Jorge, Soraia A C; Wagner, Renaud; Pereira, Carlos A; Astray, Renato M

2013-11-01

Virus titration may constitute a drawback in the development and use of replication-defective viral vectors like Semliki Forest virus (SFV). The standardization and validation of a reverse transcription quantitative PCR (qRT-PCR) method for SFV titration is presented here. The qRT-PCR target is located within the nsp1 gene of the non-structural polyprotein SFV region (SFV RNA), which allows the strategy to be used for several different recombinant SFV constructs. Titer determinations were carried out by performing virus titration and infection assays with SFVs containing an RNA coding region for the rabies virus glycoprotein (RVGP) or green fluorescent protein (GFP). Results showed that the standardized qRT-PCR is applicable for different SFV constructs, and showed good reproducibility. To evaluate the correlation between the amount of functional SFV RNA in a virus lot and its infectivity in BHK-21 cell cultures, a temperature mediated titer decrease was performed and successfully quantitated by qRT-PCR. When used for cell infection at the same multiplicity of infection (MOI), the temperature treated SFV-RVGP samples induced the same levels of RVGP expression. Similarly, when different SFV-GFP lots with different virus titers, as accessed by qRT-PCR, were used for cell infection at the same MOI, the cultures showed comparable amounts of fluorescent cells. The data demonstrate a good correlation between the amount of virus used for infection, as measured by its SFV RNA, and the protein synthesis in the cells. In conclusion, the qRT-PCR method developed here is accurate and enables the titration of replication-defective SFV vectors, an essential aid for viral vector development as well as for establishment of production bioprocesses. Copyright © 2013 Elsevier B.V. All rights reserved.

Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

Science.gov (United States)

Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

2017-01-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

Is gene transcription involved in seed dry after-ripening?

Directory of Open Access Journals (Sweden)

Patrice Meimoun

Full Text Available Orthodox seeds are living organisms that survive anhydrobiosis and may display dormancy, an inability to germinate at harvest. Seed germination potential can be acquired during a prolonged period of dry storage called after-ripening. The aim of this work was to determine if gene transcription is an underlying regulatory mechanism for dormancy alleviation during after-ripening. To identify changes in gene transcription strictly associated with the acquisition of germination potential but not with storage, we used seed storage at low relative humidity that maintains dormancy as control. Transcriptome profiling was performed using DNA microarray to compare change in gene transcript abundance between dormant (D, after-ripened non-dormant (ND and after-ripened dormant seeds (control, C. Quantitative real-time polymerase chain reaction (qPCR was used to confirm gene expression. Comparison between D and ND showed the differential expression of 115 probesets at cut-off values of two-fold change (p<0.05. Comparisons between both D and C with ND in transcript abundance showed that only 13 transcripts, among 115, could be specific to dormancy alleviation. qPCR confirms the expression pattern of these transcripts but without significant variation between conditions. Here we show that sunflower seed dormancy alleviation in the dry state is not related to regulated changes in gene expression.

Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

Directory of Open Access Journals (Sweden)

Javad Mohammadi

2017-06-01

Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

OpenAIRE

Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

1999-01-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...

Correlation Coefficients Between Different Methods of Expressing Bacterial Quantification Using Real Time PCR

Directory of Open Access Journals (Sweden)

Bahman Navidshad

2012-02-01

Full Text Available The applications of conventional culture-dependent assays to quantify bacteria populations are limited by their dependence on the inconsistent success of the different culture-steps involved. In addition, some bacteria can be pathogenic or a source of endotoxins and pose a health risk to the researchers. Bacterial quantification based on the real-time PCR method can overcome the above-mentioned problems. However, the quantification of bacteria using this approach is commonly expressed as absolute quantities even though the composition of samples (like those of digesta can vary widely; thus, the final results may be affected if the samples are not properly homogenized, especially when multiple samples are to be pooled together before DNA extraction. The objective of this study was to determine the correlation coefficients between four different methods of expressing the output data of real-time PCR-based bacterial quantification. The four methods were: (i the common absolute method expressed as the cell number of specific bacteria per gram of digesta; (ii the Livak and Schmittgen, ΔΔCt method; (iii the Pfaffl equation; and (iv a simple relative method based on the ratio of cell number of specific bacteria to the total bacterial cells. Because of the effect on total bacteria population in the results obtained using ΔCt-based methods (ΔΔCt and Pfaffl, these methods lack the acceptable consistency to be used as valid and reliable methods in real-time PCR-based bacterial quantification studies. On the other hand, because of the variable compositions of digesta samples, a simple ratio of cell number of specific bacteria to the corresponding total bacterial cells of the same sample can be a more accurate method to quantify the population.

Arabidopsis R2R3-MYB transcription factor AtMYB60 functions as a transcriptional repressor of anthocyanin biosynthesis in lettuce (Lactuca sativa).

Science.gov (United States)

Park, Jong-Sug; Kim, Jung-Bong; Cho, Kang-Jin; Cheon, Choong-Ill; Sung, Mi-Kyung; Choung, Myoung-Gun; Roh, Kyung-Hee

2008-06-01

The MYB transcription factors play important roles in the regulation of many secondary metabolites at the transcriptional level. We evaluated the possible roles of the Arabidopsis R2R3-MYB transcription factors in flavonoid biosynthesis because they are induced by UV-B irradiation but their associated phenotypes are largely unexplored. We isolated their genes by RACE-PCR, and performed transgenic approach and metabolite analyses in lettuce (Lactuca sativa). We found that one member of this protein family, AtMYB60, inhibits anthocyanin biosynthesis in the lettuce plant. Wild-type lettuce normally accumulates anthocyanin, predominantly cyanidin and traces of delphinidin, and develops a red pigmentation. However, the production and accumulation of anthocyanin pigments in AtMYB60-overexpressing lettuce was inhibited. Using RT-PCR analysis, we also identified the complete absence or reduction of dihydroflavonol 4-reductase (DFR) transcripts in AtMYB60- overexpressing lettuce (AtMYB60-117 and AtMYB60-112 lines). The correlation between the overexpression of AtMYB60 and the inhibition of anthocyanin accumulation suggests that the transcription factorAtMYB60 controls anthocyanin biosynthesis in the lettuce leaf. Clarification of the roles of the AtMYB60 transcription factor will facilitate further studies and provide genetic tools to better understand the regulation in plants of the genes controlled by the MYB-type transcription factors. Furthermore, the characterization of AtMYB60 has implications for the development of new varieties of lettuce and other commercially important plants with metabolic engineering approaches.

Identification of appropriate reference genes for human mesenchymal stem cell analysis by quantitative real-time PCR.

Science.gov (United States)

Li, Xiuying; Yang, Qiwei; Bai, Jinping; Xuan, Yali; Wang, Yimin

2015-01-01

Normalization to a reference gene is the method of choice for quantitative reverse transcription-PCR (RT-qPCR) analysis. The stability of reference genes is critical for accurate experimental results and conclusions. We have evaluated the expression stability of eight commonly used reference genes found in four different human mesenchymal stem cells (MSC). Using geNorm, NormFinder and BestKeeper algorithms, we show that beta-2-microglobulin and peptidyl-prolylisomerase A were the optimal reference genes for normalizing RT-qPCR data obtained from MSC, whereas the TATA box binding protein was not suitable due to its extensive variability in expression. Our findings emphasize the significance of validating reference genes for qPCR analyses. We offer a short list of reference genes to use for normalization and recommend some commercially-available software programs as a rapid approach to validate reference genes. We also demonstrate that the two reference genes, β-actin and glyceraldehyde-3-phosphate dehydrogenase, are frequently used are not always successful in many cases.

European validation of Real-Time PCR method for detection of Salmonella spp. in pork meat.

Science.gov (United States)

Delibato, Elisabetta; Rodriguez-Lazaro, David; Gianfranceschi, Monica; De Cesare, Alessandra; Comin, Damiano; Gattuso, Antonietta; Hernandez, Marta; Sonnessa, Michele; Pasquali, Frédérique; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Prukner-Radovcic, Estella; Horvatek Tomic, Danijela; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John E; Chemaly, Marianne; Le Gall, Francoise; González-García, Patricia; Lettini, Antonia Anna; Lukac, Maja; Quesne, Segolénè; Zampieron, Claudia; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Proroga, Yolande T R; Capuano, Federico; Manfreda, Gerardo; De Medici, Dario

2014-08-01

The classical microbiological method for detection of Salmonella spp. requires more than five days for final confirmation, and consequently there is a need for an alternative methodology for detection of this pathogen particularly in those food categories with a short shelf-life. This study presents an international (at European level) ISO 16140-based validation study of a non-proprietary Real-Time PCR-based method that can generate final results the day following sample analysis. It is based on an ISO compatible enrichment coupled to an easy and inexpensive DNA extraction and a consolidated Real-Time PCR assay. Thirteen laboratories from seven European Countries participated to this trial, and pork meat was selected as food model. The limit of detection observed was down to 10 CFU per 25 g of sample, showing excellent concordance and accordance values between samples and laboratories (100%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (100%) when the results obtained for the Real-Time PCR-based methods were compared to those of the ISO 6579:2002 standard method. The results of this international trial demonstrate that the evaluated Real-Time PCR-based method represents an excellent alternative to the ISO standard. In fact, it shows an equal and solid performance as well as it reduces dramatically the extent of the analytical process, and can be easily implemented routinely by the Competent Authorities and Food Industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.

Comparison of culture-based, vital stain and PMA-qPCR methods for the quantitative detection of viable hookworm ova.

Science.gov (United States)

Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S

2017-06-01

Accurate quantitative measurement of viable hookworm ova from environmental samples is the key to controlling hookworm re-infections in the endemic regions. In this study, the accuracy of three quantitative detection methods [culture-based, vital stain and propidium monoazide-quantitative polymerase chain reaction (PMA-qPCR)] was evaluated by enumerating 1,000 ± 50 Ancylostoma caninum ova in the laboratory. The culture-based method was able to quantify an average of 397 ± 59 viable hookworm ova. Similarly, vital stain and PMA-qPCR methods quantified 644 ± 87 and 587 ± 91 viable ova, respectively. The numbers of viable ova estimated by the culture-based method were significantly (P methods. Therefore, both PMA-qPCR and vital stain methods appear to be suitable for the quantitative detection of viable hookworm ova. However, PMA-qPCR would be preferable over the vital stain method in scenarios where ova speciation is needed.

PCR melting profile (PCR MP - a new tool for differentiation of Candida albicans strains

Directory of Open Access Journals (Sweden)

Nowak Magdalena

2009-11-01

Full Text Available Abstract Background We have previously reported the use of PCR Melting Profile (PCR MP technique based on using low denaturation temperatures during ligation mediated PCR (LM PCR for bacterial strain differentiation. The aim of the current study was to evaluate this method for intra-species differentiation of Candida albicans strains. Methods In total 123 Candida albicans strains (including 7 reference, 11 clinical unrelated, and 105 isolates from patients of two hospitals in Poland were examined using three genotyping methods: PCR MP, macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE and RAPD techniques. Results The genotyping results of the PCR MP were compared with results from REA-PFGE and RAPD techniques giving 27, 26 and 25 unique types, respectively. The results showed that the PCR MP technique has at least the same discriminatory power as REA-PFGE and RAPD. Conclusion Data presented here show for the first time the evaluation of PCR MP technique for candidial strains differentiation and we propose that this can be used as a relatively simple and cheap technique for epidemiological studies in short period of time in hospital.

Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

OpenAIRE

Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

2009-01-01

Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

Molecular analysis of alternative transcripts of equine AXL receptor tyrosine kinase gene.

Science.gov (United States)

Park, Jeong-Woong; Song, Ki-Duk; Kim, Nam Young; Choi, Jae-Young; Hong, Seul A; Oh, Jin Hyeog; Kim, Si Won; Lee, Jeong Hyo; Park, Tae Sub; Kim, Jin-Kyoo; Kim, Jong Geun; Cho, Byung-Wook

2017-10-01

Since athletic performance is a most importance trait in horses, most research focused on physiological and physical studies of horse athletic abilities. In contrast, the molecular analysis as well as the regulatory pathway studies remain insufficient for evaluation and prediction of horse athletic abilities. In our previous study, we identified AXL receptor tyrosine kinase ( AXL ) gene which was expressed as alternative spliced isoforms in skeletal muscle during exercise. In the present study, we validated two AXL alternative splicing transcripts (named as AXLa for long form and AXLb for short form) in equine skeletal muscle to gain insight(s) into the role of each alternative transcript during exercise. We validated two isoforms of AXL transcripts in horse tissues by reverse transcriptase polymerase chain reaction (RT-PCR), and then cloned the transcripts to confirm the alternative locus and its sequences. Additionally, we examined the expression patterns of AXLa and AXLb transcripts in horse tissues by quantitative RT-PCR (qRT-PCR). Both of AXLa and AXLb transcripts were expressed in horse skeletal muscle and the expression levels were significantly increased after exercise. The sequencing analysis showed that there was an alternative splicing event at exon 11 between AXLa and AXLb transcripts. 3-dimentional (3D) prediction of the alternative protein structures revealed that the structural distance of the connective region between fibronectin type 3 (FN3) and immunoglobin (Ig) domain was different between two alternative isoforms. It is assumed that the expression patterns of AXLa and AXLb transcripts would be involved in regulation of exercise-induced stress in horse muscle possibly through an NF-κB signaling pathway. Further study is necessary to uncover biological function(s) and significance of the alternative splicing isoforms in race horse skeletal muscle.

Characterization of Betula platyphylla gene transcripts associated with early development of male inflorescence.

Science.gov (United States)

Xing, Lei; Liu, Xue-Mei

2012-02-01

Birch (Betula platyphylla), an eminent tree species in Northeast and Inner Mongolia of China, has been widely used in architecture, furniture, and paper making in recent years. In order to retrieve genes involved in early development of B. platyphylla male inflorescence, RNA populations extracted from early and late developmental stage were analyzed by cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) technique. Following amplification of 256 pairs of primer combinations, ~7000 fragments were generated, of which 350 transcripts expressing more in early stage than late. Of 350 specific transcripts, 198 clear and reproducible electrophoresis bands were retrieved and sequenced successfully, 74 of them (37%) showing significant homologies to known genes after GO annotation. Majority of the predicted gene products were involved in metabolism (24.56%), cellular process (27.19%), response to stimulus (11.4%) and cell growth (8.7%). Transcripts ME56, ME108, ME206 and ME310, representing metabolism, cellular process, response to stimulus and cell growth, respectively, were selected for further study to validate cDNA-AFLP expression patterns via RT-PCR and qRT-PCR analysis. RT-PCR and qRT-PCR expression pattern results were consistent with cDNA-AFLP analysis results.

European validation of a real-time PCR-based method for detection of Listeria monocytogenes in soft cheese.

Science.gov (United States)

Gianfranceschi, Monica Virginia; Rodriguez-Lazaro, David; Hernandez, Marta; González-García, Patricia; Comin, Damiano; Gattuso, Antonietta; Delibato, Elisabetta; Sonnessa, Michele; Pasquali, Frederique; Prencipe, Vincenza; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Kozačinski, Lidija; Tomic, Danijela Horvatek; Zdolec, Nevijo; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John Elmerdahl; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Paiusco, Antonella; De Cesare, Alessandra; Manfreda, Gerardo; De Medici, Dario

2014-08-01

The classical microbiological method for detection of Listeria monocytogenes requires around 7 days for final confirmation, and due to perishable nature of RTE food products, there is a clear need for an alternative methodology for detection of this pathogen. This study presents an international (at European level) ISO 16140-based validation trial of a non-proprietary real-time PCR-based methodology that can generate final results in the following day of the analysis. This methodology is based on an ISO compatible enrichment coupled to a bacterial DNA extraction and a consolidated real-time PCR assay. Twelve laboratories from six European countries participated in this trial, and soft cheese was selected as food model since it can represent a difficult matrix for the bacterial DNA extraction and real-time PCR amplification. The limit of detection observed was down to 10 CFU per 25 of sample, showing excellent concordance and accordance values between samples and laboratories (>75%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (82.75%, 96.70% and 97.62%, respectively) when the results obtained for the real-time PCR-based methods were compared to those of the ISO 11290-1 standard method. An interesting observation was that the L. monocytogenes detection by the real-time PCR method was less affected in the presence of Listeria innocua in the contaminated samples, proving therefore to be more reliable than the reference method. The results of this international trial demonstrate that the evaluated real-time PCR-based method represents an excellent alterative to the ISO standard since it shows a higher performance as well as reduce the extent of the analytical process, and can be easily implemented routinely by the competent authorities and food industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.

A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

Directory of Open Access Journals (Sweden)

M Heydarnezhadi

2011-09-01

Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

Transcriptional analysis of exopolysaccharides biosynthesis gene clusters in Lactobacillus plantarum.

Science.gov (United States)

Vastano, Valeria; Perrone, Filomena; Marasco, Rosangela; Sacco, Margherita; Muscariello, Lidia

2016-04-01

Exopolysaccharides (EPS) from lactic acid bacteria contribute to specific rheology and texture of fermented milk products and find applications also in non-dairy foods and in therapeutics. Recently, four clusters of genes (cps) associated with surface polysaccharide production have been identified in Lactobacillus plantarum WCFS1, a probiotic and food-associated lactobacillus. These clusters are involved in cell surface architecture and probably in release and/or exposure of immunomodulating bacterial molecules. Here we show a transcriptional analysis of these clusters. Indeed, RT-PCR experiments revealed that the cps loci are organized in five operons. Moreover, by reverse transcription-qPCR analysis performed on L. plantarum WCFS1 (wild type) and WCFS1-2 (ΔccpA), we demonstrated that expression of three cps clusters is under the control of the global regulator CcpA. These results, together with the identification of putative CcpA target sequences (catabolite responsive element CRE) in the regulatory region of four out of five transcriptional units, strongly suggest for the first time a role of the master regulator CcpA in EPS gene transcription among lactobacilli.

Estimation of Tissue Distribution of mRNA Transcripts for Desaturase and Elongase Enzymes in Channa striata (Bloch, 1793 Fingerlings using PCR Technique

Directory of Open Access Journals (Sweden)

M. Aliyu-Paiko

2013-06-01

Full Text Available Fish species are varied in their capacity to biosynthesize n-3 highlyunsaturated fatty acids (HUFA such as eicosapentaenoic and docosahexaenoic acids (EPA & DHA that are crucial to the health and well-being of all higher vertebrates. Experts report that HUFA metabolism involves enzyme-mediated fatty acyl desaturation (FAD and elongation (FAE processes. In previous studies, different workers cloned, characterized, identified and reported several genes for FAD and FAE enzymes in different fish species such as Atlantic salmon, gilthead seabream, rainbow trout and zebrafish, and also demonstrated the up- and down-regulation in the activity of these enzymes in response to fluctuations in dietary HUFA. In this paper, we report on the expression of genes (mRNA transcripts for FAD and FAE enzymes in different tissues of Channa striata (Bloch, 1793 fingerling, to evaluate the tissues of the fish in which activity of both enzymes are high. To achieve this objective, we used conventional polymerase chain reaction (PCR technique to isolate and quantify the absolute copy number for each gene transcripts from 8 different tissues of the fish (reared with a commercial feed. Our estimate show that the distribution of the 2 enzyme transcripts were significantly (P < 0.05 higher in the liver and brain of C. striata than detected in the 6 other tissues evaluated (muscle, ovary, testis, intestine, kidney and skin. Subsequently, we discuss here extensively, the implication of this observation with respect to the use of vegetable oils (VO as substitute to fish oil (FO in diets for freshwater fish species.

Sampling methods for rumen microbial counts by Real-Time PCR techniques

Directory of Open Access Journals (Sweden)

S. Puppo

2010-02-01

Full Text Available Fresh rumen samples were withdrawn from 4 cannulated buffalo females fed a fibrous diets in order to quantify bacteria concentration in the rumen by Real-Time PCR techniques. To obtain DNA of a good quality from whole rumen fluid, eight (M1-M8 different pre-filtration methods (cheese cloths, glass-fibre and nylon filter in combination with various centrifugation speeds (1000, 5000 and 14,000 rpm were tested. Genomic DNA extraction was performed either on fresh or frozen samples (-20°C. The quantitative bacteria analysis was realized according to Real-Time PCR procedure for Butyrivibrio fibrisolvens reported in literature. M5 resulted the best sampling procedure allowing to obtain a suitable genomic DNA. No differences were revealed between fresh and frozen samples.

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

Science.gov (United States)

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

A simple negative selection method to identify adenovirus recombinants using colony PCR

Directory of Open Access Journals (Sweden)

Yongliang Zhao

2014-01-01

Conclusions: The negative selection method to identify AdEasy adenovirus recombinants by colony PCR can identify the recombined colony within a short time-period, and maximally avoid damage to the recombinant plasmid by limiting recombination time, resulting in improved adenovirus packaging.

Enhancing the sensitivity of Dengue virus serotype detection by RT-PCR among infected children in India.

Science.gov (United States)

Ahamed, Syed Fazil; Vivek, Rosario; Kotabagi, Shalini; Nayak, Kaustuv; Chandele, Anmol; Kaja, Murali-Krishna; Shet, Anita

2017-06-01

Dengue surveillance relies on reverse transcription-polymerase chain reaction (RT-PCR), for confirmation of dengue virus (DENV) serotypes. We compared efficacies of published and modified primer sets targeting envelope (Env) and capsid-premembrane (C-prM) genes for detection of circulating DENV serotypes in southern India. Acute samples from children with clinically-diagnosed dengue were used for RT-PCR testing. All samples were also subjected to dengue serology (NS1 antigen and anti-dengue-IgM/IgG rapid immunochromatographic assay). Nested RT-PCR was performed on viral RNA using three methods targeting 654bp C-prM, 511bp C-prM and 641bp Env regions, respectively. RT-PCR-positive samples were validated by population sequencing. Among 171 children with suspected dengue, 121 were dengue serology-positive and 50 were dengue serology-negative. Among 121 serology-positives, RT-PCR detected 91 (75.2%) by CprM654, 72 (59.5%) by CprM511, and 74 (61.1%) by Env641. Among 50 serology-negatives, 10 (20.0%) were detected by CprM654, 12 (24.0%) by CprM511, and 11 (22.0%) by Env641. Overall detection rate using three methods sequentially was 82.6% (100/121) among serology-positive and 40.0% (20/50) among serology-negative samples; 6.6% (8/120) had co-infection with multiple DENV serotypes. We conclude that detection of acute dengue was enhanced by a modified RT-PCR method targeting the 654bp C-prM region, and further improved by using all three methods sequentially. Copyright © 2017 Elsevier B.V. All rights reserved.

A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.

Science.gov (United States)

Govan, V A; Brözel, V; Allsopp, M H; Davison, S

1998-05-01

Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.

Detection of mRNA by reverse transcription PCR as an indicator of viability in Phytophthora ramorum

Science.gov (United States)

Antonio Chimento; Santa Olga Cacciola; Matteo Garbelotto

2008-01-01

Real-Time PCR technologies offer increasing opportunities to detect and study phytopathogenic fungi. They combine the sensitivity of conventional PCR with the generation of a specific fluorescent signal providing both real-time analysis of the reaction kinetics and quantification of specific DNA targets. Before the development of Real-Time PCR and...

Detection of Yersinia Enterocolitica Species in Pig Tonsils and Raw Pork Meat by the Real-Time Pcr and Culture Methods.

Science.gov (United States)

Stachelska, M A

2017-09-26

The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.

Simplified Method for Predicting a Functional Class of Proteins in Transcription Factor Complexes

KAUST Repository

Piatek, Marek J.

2013-07-12

Background:Initiation of transcription is essential for most of the cellular responses to environmental conditions and for cell and tissue specificity. This process is regulated through numerous proteins, their ligands and mutual interactions, as well as interactions with DNA. The key such regulatory proteins are transcription factors (TFs) and transcription co-factors (TcoFs). TcoFs are important since they modulate the transcription initiation process through interaction with TFs. In eukaryotes, transcription requires that TFs form different protein complexes with various nuclear proteins. To better understand transcription regulation, it is important to know the functional class of proteins interacting with TFs during transcription initiation. Such information is not fully available, since not all proteins that act as TFs or TcoFs are yet annotated as such, due to generally partial functional annotation of proteins. In this study we have developed a method to predict, using only sequence composition of the interacting proteins, the functional class of human TF binding partners to be (i) TF, (ii) TcoF, or (iii) other nuclear protein. This allows for complementing the annotation of the currently known pool of nuclear proteins. Since only the knowledge of protein sequences is required in addition to protein interaction, the method should be easily applicable to many species.Results:Based on experimentally validated interactions between human TFs with different TFs, TcoFs and other nuclear proteins, our two classification systems (implemented as a web-based application) achieve high accuracies in distinguishing TFs and TcoFs from other nuclear proteins, and TFs from TcoFs respectively.Conclusion:As demonstrated, given the fact that two proteins are capable of forming direct physical interactions and using only information about their sequence composition, we have developed a completely new method for predicting a functional class of TF interacting protein partners

Selection of housekeeping genes for normalization by real-time RT-PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development.

Science.gov (United States)

González-Verdejo, C I; Die, J V; Nadal, S; Jiménez-Marín, A; Moreno, M T; Román, B

2008-08-15

Real-time PCR has become the method of choice for accurate and in-depth expression studies of candidate genes. To avoid bias, real-time PCR is referred to one or several internal control genes that should not fluctuate among treatments. A need for reference genes in the parasitic plant Orobanche ramosa has emerged, and the studies in this area have not yet been evaluated. In this study, the genes 18S rRNA, Or-act1, Or-tub1, and Or-ubq1 were compared in terms of expression stability using the BestKeeper software program. Among the four common endogenous control genes, Or-act1 and Or-ubq1 were the most stable in O. ramosa samples. In parallel, a study was carried out studying the expression of the transcription factor Or-MYB1 that seemed to be implicated during preinfection stages. The normalization strategy presented here is a prerequisite to accurate real-time PCR expression profiling that, among other things, opens up the possibility of studying messenger RNA levels of low-copy-number-like transcription factors.

Reference genes for reverse transcription quantitative PCR in canine brain tissue

NARCIS (Netherlands)

Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C

2015-01-01

BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and

Potassium hydroxide-ethylene diamine tetraacetic acid method for the rapid preparation of small-scale PCR template DNA from actinobacteria.

Science.gov (United States)

Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli

2014-01-01

Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.

Development and validation of a Q-PCR based TCID50 method for human herpesvirus 6

Directory of Open Access Journals (Sweden)

Gustafsson Rasmus K L

2012-12-01

Full Text Available Abstract Background For titer assessment of human herpesvirus 6 (HHV-6, IFA targeting viral proteins or a TCID50 method with ocular inspection for CPE can be used. These methods rely on the subjective decision of the assessor, obstructing the ability to obtain unanimous results. Findings We have developed and validated an alternative TCID50 read-out approach where infection in the titration culture plate is assessed by viral DNA load change by quantitative PCR. A ten time increase in viral DNA load was determined as cut point for infection since that yielded a maximum correlation with viral protein expression (93%. The average intra-assay CV was 9% for quantitative PCR read-out of TCID50 compared to 45% for ocular inspection read-out of TCID50, 14% for IFA read-out of TCID50, and 43% for an infectious units approach using IFA. The average inter-assay CV for quantitative PCR read-out of TCID50 was 73%, compared to 66%, 25% and 77% for the ocular inspection read-out for TCID50, IFA read-out of TCID50 and infectious unit approaches respectively. Conclusions The quantitative PCR based read-out of TCID50 proved to be more robust and easier to interpret than traditional TCID50 assessment approaches for HHV-6, and therefore it might be considered as an alternative method.

Efficacy of a novel PCR- and microarray-based method in diagnosis of a prosthetic joint infection

Science.gov (United States)

2014-01-01

Background and purpose Polymerase chain reaction (PCR) methods enable detection and species identification of many pathogens. We assessed the efficacy of a new PCR and microarray-based platform for detection of bacteria in prosthetic joint infections (PJIs). Methods This prospective study involved 61 suspected PJIs in hip and knee prostheses and 20 negative controls. 142 samples were analyzed by Prove-it Bone and Joint assay. The laboratory staff conducting the Prove-it analysis were not aware of the results of microbiological culture and clinical findings. The results of the analysis were compared with diagnosis of PJIs defined according to the Musculoskeletal Infection Society (MSIS) criteria and with the results of microbiological culture. Results 38 of 61 suspected PJIs met the definition of PJI according to the MSIS criteria. Of the 38 patients, the PCR detected bacteria in 31 whereas bacterial culture was positive in 28 patients. 15 of the PJI patients were undergoing antimicrobial treatment as the samples for analysis were obtained. When antimicrobial treatment had lasted 4 days or more, PCR detected bacteria in 6 of the 9 patients, but positive cultures were noted in only 2 of the 9 patients. All PCR results for the controls were negative. Of the 61 suspected PJIs, there were false-positive PCR results in 6 cases. Interpretation The Prove-it assay was helpful in PJI diagnostics during ongoing antimicrobial treatment. Without preceding treatment with antimicrobials, PCR and microarray-based assay did not appear to give any additional information over culture. PMID:24564748

[Comparison between conventional methods, ChromAgar Candida® and PCR method for the identification of Candida species in clinical isolates].

Science.gov (United States)

Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio

2011-01-01

The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

Detection of Brucella melitensis and Brucella abortus strains using a single-stage PCR method

Directory of Open Access Journals (Sweden)

Alamian, S.

2015-04-01

Full Text Available Brucella melitensis and Brucella abortus are of the most important causes of brucellosis, an infectious disease which is transmitted either directly or indirectly including consuming unpasteurized dairy products. Both strains are considered endemic in Iran. Common diagnostic methods such as bacteriologic cultures are difficult and time consuming regarding the bacteria. The aim of this study was to suggest a single-stage PCR method using a pair of primers to detect both B. melitensis and B. abortus. The primers were named UF1 and UR1 and the results showed that the final size of PCR products were 84 bp and 99 bp for B. melitensis and B. abortus, respectively. Therefore the method could be useful for rapid detection of B. melitensis and B. abortus simultaneously.

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Incidence of pulmonary aspergillosis and correlation of conventional diagnostic methods with nested PCR and real-time PCR assay using BAL fluid in intensive care unit patients.

Science.gov (United States)

Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein

2013-05-01

Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.

SNPs and real-time quantitative PCR method for constitutional allelic copy number determination, the VPREB1 marker case

Directory of Open Access Journals (Sweden)

Costa Elena

2011-05-01

Full Text Available Abstract Background 22q11.2 microdeletion is responsible for the DiGeorge Syndrome, characterized by heart defects, psychiatric disorders, endocrine and immune alterations and a 1 in 4000 live birth prevalence. Real-time quantitative PCR (qPCR approaches for allelic copy number determination have recently been investigated in 22q11.2 microdeletions detection. The qPCR method was performed for 22q11.2 microdeletions detection as a first-level screening approach in a genetically unknown series of patients with congenital heart defects. A technical issue related to the VPREB1 qPCR marker was pointed out. Methods A set of 100 unrelated Italian patients with congenital heart defects were tested for 22q11.2 microdeletions by a qPCR method using six different markers. Fluorescence In Situ Hybridization technique (FISH was used for confirmation. Results qPCR identified six patients harbouring the 22q11.2 microdeletion, confirmed by FISH. The VPREB1 gene marker presented with a pattern consistent with hemideletion in one 3 Mb deleted patient, suggestive for a long distal deletion, and in additional five non-deleted patients. The long distal 22q11.2 deletion was not confirmed by Comparative Genomic Hybridization. Indeed, the VPREB1 gene marker generated false positive results in association with the rs1320 G/A SNP, a polymorphism localized within the VPREB1 marker reverse primer sequence. Patients heterozygous for rs1320 SNP, showed a qPCR profile consistent with the presence of a hemideletion. Conclusions Though the qPCR technique showed advantages as a screening approach in terms of cost and time, the VPREB1 marker case revealed that single nucleotide polymorphisms can interfere with qPCR data generating erroneous allelic copy number interpretations.

Prevalence of periodontopathogenic bacteria in patients suffering from periodontitis using culture and PCR methods

Directory of Open Access Journals (Sweden)

Amir Aliramezani

2012-01-01

Full Text Available Background and Aims: Periodontitis is one of the most common oral diseases with the various incidence rates in different populations. A number of bacteria are considered as the major etiologic agents of periodontitis. The aim of the present study was to determine the prevalence of periodontopathogen bacteria in patients using both PCR and culture techniques.Materials and Methods: In this study, one-hundred patients (including 62 females and 38 males with an average age of 49±11.5 years with adult periodontitis referred to periodontics department of School of Dentistry/Tehran University of Medical Sciences were investigated. The samples were taken and sent immediately to the laboratory for culture and molecular evaluation. The PCR was performed using specific primers and the statistical analysis of data was performed using SPSS statistic software and McNemar test.Results: The results demonstrated that the total detection rate in culture method was 64%. The rate of Aggregatibacter actinomycetemcomitans (Aa was 28% which was significantly higher than that of Porphyromonas gingivalis (Pg (6% and Prevotella intermedia (Pi (3%. 27% of cases showed mixed bacterial growth. 65% of patients were positive using molecular method. The rate of Aa (30% was significantly higher than that of Pg (7% and Pi (5%. The mixed PCR positive rate containing of Aa, Pg and Pi was (23%.Conclusion: In this study, it was found that most of the bacteria isolated using culture and molecular methods were Aa, Pg and Pi, respectively. Although the detection frequencies of both techniques were similar, the specificity, sensitivity and bacterial detection speed of the PCR technique is obviously higher. Therefore, the use of molecular techniques is strongly recommended. However, both techniques seem to be suitable for microbiological diagnostics.

Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

Science.gov (United States)

Torriani, S; Zapparoli, G; Dellaglio, F

1999-10-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

Science.gov (United States)

Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

1999-01-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods

DEFF Research Database (Denmark)

Cowland, J B; Madsen, H O; Morling, N

1995-01-01

(ASA) method, which together recognise eight alleles. In 146 unrelated Danish individuals, the HLA-DQA1 alleles were in Hardy-Weinberg equilibrium. For identity testing, the power of discrimination (PD) of HLA-DQA1 was 0.932 with the RDB method and 0.942 with the PCR-RFLP/ASA method. For paternity...

Effect of low dose ionizing radiation on Bcl-2 transcription level of Peyer's patches in mouse

International Nuclear Information System (INIS)

Liu Jiamei; Chen Dong; Zheng Yongchen; Liu Shuzheng

2001-01-01

Objective: To study the effect of whole body irradiation (WBI) with different doses of X-rays on apoptosis in cells of mouse Peyer's patches and its molecular mechanism. Methods: RT-PCR was used to detect the changes of Bcl-2 transcription level. Agarose electrophoresis and flow cytometry were used to detect the changes of DNA and apoptotic bodies in Peyer's patches after WBI with different doses of X-rays. Results: The apoptotic was increased and Bcl-2 transcription level was decreased in Peyer's patches after 2 Gy X-rays. The apoptotic rate was decreased and Bcl-2 transcription level was increased in Peyer's patches after 75 mGy X-rays. Conclusion: Bcl-2 participates in the regulation of radiation-induced apoptosis in Peyer's patches

Comparison of the genexpert enterovirus assay (GXEA) with real-time one step RT-PCR for the detection of enteroviral RNA in the cerebrospinal fluid of patients with meningitis.

Science.gov (United States)

Hong, JiYoung; Kim, Ahyoun; Hwang, Seoyeon; Cheon, Doo-Sung; Kim, Jong-Hyen; Lee, June-Woo; Park, Jae-Hak; Kang, Byunghak

2015-02-13

Enteroviruses (EVs) are the leading cause of aseptic meningitis worldwide. Detection of enteroviral RNA in clinical specimens has been demonstrated to improve the management of patient care, especially that of neonates and young children. To establish a sensitive and reliable assay for routine laboratory diagnosis, we compared the sensitivity and specificity of the GeneXpert Enterovirus Assay (GXEA) with that of the reverse transcription polymerase chain reaction (RT-PCR) based assay referred to as real-time one step RT-PCR (RTo-PCR). The sensitivity/specificity produced by GXEA and RTo-PCR were 100%/100% and 65%/100%, respectively. Both methods evaluated in this article can be used for detection of enterovirus in clinical specimens and these nucleic acid amplification methods are useful assays for the diagnosis of enteroviral infection.

Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia persica in Animal Blood Samples.

Science.gov (United States)

Naddaf, S R; Kishdehi, M; Siavashi, Mr

2011-01-01

The mainstay of diagnosis of relapsing fever (RF) is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL) was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.

Comparison of a Commercially Available Repetitive-Element PCR System (DiversiLab) with PCR Ribotyping for Typing of Clostridium difficile Strains ▿

OpenAIRE

Eckert, C.; Van Broeck, J.; Spigaglia, P.; Burghoffer, B.; Delmée, M.; Mastrantonio, P.; Barbut, F.

2011-01-01

This study compared a repetitive-element PCR (rep-PCR) method (DiversiLab system) to PCR ribotyping. The discriminatory power of rep-PCR was 0.997. Among the PCR ribotype 027 isolates tested, different rep types could be distinguished. rep-PCR showed a higher discriminatory power than PCR ribotyping. Nevertheless, this method requires technical skill, and visual interpretation of rep-PCR fingerprint patterns may be difficult.

Evaluation of Appropriate Reference Genes for Reverse Transcription-Quantitative PCR Studies in Different Tissues of a Desert Poplar via Comparision of Different Algorithms

Directory of Open Access Journals (Sweden)

Hou-Ling Wang

2015-08-01

Full Text Available Despite the unshakable status of reverse transcription-quantitative PCR in gene expression analysis, it has certain disadvantages, including that the results are highly dependent on the reference genes selected for data normalization. Since inappropriate endogenous control genes will lead to inaccurate target gene expression profiles, the validation of suitable internal reference genes is essential. Given the increasing interest in functional genes and genomics of Populus euphratica, a desert poplar showing extraordinary adaptation to salt stress, we evaluated the expression stability of ten candidate reference genes in P. euphratica roots, stems, and leaves under salt stress conditions. We used five algorithms, namely, ΔCt, NormFinder, geNorm, GrayNorm, and a rank aggregation method (RankAggreg to identify suitable normalizers. To support the suitability of the identified reference genes and to compare the relative merits of these different algorithms, we analyzed and compared the relative expression levels of nine P. euphratica functional genes in different tissues. Our results indicate that a combination of multiple reference genes recommended by GrayNorm algorithm (e.g., a combination of Actin, EF1α, GAPDH, RP, UBQ in root should be used instead of a single reference gene. These results are valuable for research of gene identification in different P. euphratica tissues.

Transcriptome discovery in non-model wild fish species for the development of quantitative transcript abundance assays

Science.gov (United States)

Hahn, Cassidy M.; Iwanowicz, Luke R.; Cornman, Robert S.; Mazik, Patricia M.; Blazer, Vicki S.

2016-01-01

Environmental studies increasingly identify the presence of both contaminants of emerging concern (CECs) and legacy contaminants in aquatic environments; however, the biological effects of these compounds on resident fishes remain largely unknown. High throughput methodologies were employed to establish partial transcriptomes for three wild-caught, non-model fish species; smallmouth bass (Micropterus dolomieu), white sucker (Catostomus commersonii) and brown bullhead (Ameiurus nebulosus). Sequences from these transcriptome databases were utilized in the development of a custom nCounter CodeSet that allowed for direct multiplexed measurement of 50 transcript abundance endpoints in liver tissue. Sequence information was also utilized in the development of quantitative real-time PCR (qPCR) primers. Cross-species hybridization allowed the smallmouth bass nCounter CodeSet to be used for quantitative transcript abundance analysis of an additional non-model species, largemouth bass (Micropterus salmoides). We validated the nCounter analysis data system with qPCR for a subset of genes and confirmed concordant results. Changes in transcript abundance biomarkers between sexes and seasons were evaluated to provide baseline data on transcript modulation for each species of interest.

Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

Directory of Open Access Journals (Sweden)

Borges-Pérez Andrés

2008-12-01

Full Text Available Abstract Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC, SGN-U321250 (TIP41, SGN-U346908 ("Expressed" and SGN-U316474 (SAND genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real

Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella

Science.gov (United States)

2009-01-01

Background One of the major sources of human Salmonella infections is meat. Therefore, efficient and rapid monitoring of Salmonella in the meat production chain is necessary. Validation of alternative methods is needed to prove that the performance is equal to established methods. Very few of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non-commercial real-time PCR method for detection of Salmonella in meat and carcass swabs. Results The comparative trial was performed against a reference method (NMKL-71:5, 1999) using artificially and naturally contaminated samples (60 minced veal and pork meat samples, 60 poultry neck-skins, and 120 pig carcass swabs). The relative accuracy was 99%, relative detection level 100%, relative sensitivity 103% and relative specificity 100%. The collaborative trial included six laboratories testing minced meat, poultry neck-skins, and carcass swabs as un-inoculated samples and samples artificially contaminated with 1–10 CFU/25 g, and 10–100 CFU/25 g. Valid results were obtained from five of the laboratories and used for the statistical analysis. Apart from one of the non-inoculated samples being false positive with PCR for one of the laboratories, no false positive or false negative results were reported. Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion The real-time PCR method for detection of Salmonella in meat

A comparison of EGFR mutation testing methods in lung carcinoma: direct sequencing, real-time PCR and immunohistochemistry.

Directory of Open Access Journals (Sweden)

Bárbara Angulo

Full Text Available The objective of this study is to compare two EGFR testing methodologies (a commercial real-time PCR kit and a specific EGFR mutant immunohistochemistry, with direct sequencing and to investigate the limit of detection (LOD of both PCR-based methods. We identified EGFR mutations in 21 (16% of the 136 tumours analyzed by direct sequencing. Interestingly, the Therascreen EGFR Mutation Test kit was able to characterize as wild-type one tumour that could not be analyzed by direct sequencing of the PCR product. We then compared the LOD of the kit and that of direct sequencing using the available mutant tumours. The kit was able to detect the presence of a mutation in a 1% dilution of the total DNA in nine of the 18 tumours (50%, which tested positive with the real-time quantitative PCR method. In all cases, EGFR mutation was identified at a dilution of 5%. Where the mutant DNA represented 30% of the total DNA, sequencing was able to detect mutations in 12 out of 19 cases (63%. Additional experiments with genetically defined standards (EGFR ΔE746-A750/+ and EGFR L858R/+ yielded similar results. Immunohistochemistry (IHC staining with exon 19-specific antibody was seen in eight out of nine cases with E746-A750del detected by direct sequencing. Neither of the two tumours with complex deletions were positive. Of the five L858R-mutated tumours detected by the PCR methods, only two were positive for the exon 21-specific antibody. The specificity was 100% for both antibodies. The LOD of the real-time PCR method was lower than that of direct sequencing. The mutation specific IHC produced excellent specificity.

Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

Science.gov (United States)

Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.

Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

Directory of Open Access Journals (Sweden)

Alok Arun

Full Text Available Real-time quantitative reverse transcription PCR (qRT-PCR is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae, two developmental stages (pupal and adult and two sexes (male and female, all of which were subjected to two food treatments (food stress and control feeding ad libitum. The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the

Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

Science.gov (United States)

Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M

2015-01-01

Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression

Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

Science.gov (United States)

Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

2018-01-02

The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

Development of PCR-based detection methods for the quarantine phytopathogen Synchytrium endobioticum, causal agent of wart disease

NARCIS (Netherlands)

Boogert, van den P.H.J.F.; Gent-Pelzer, van M.P.E.; Bonants, P.J.M.; Boer, de S.H.; Wander, J.G.N.; Lévesque, C.A.; Leeuwen, van G.C.M.; Baayen, R.P.

2005-01-01

Abstract PCR-based methods were developed for the detection and quantification of the potato pathogen Synchytrium endobioticum in soil extracts and in planta. PCR primers, based on the internal transcribed spacer region of the multi-copy gene rDNA were tested for specificity, sensitivity and

Molecular typing of uropathogenic E. coli strains by the ERIC-PCR method.

Science.gov (United States)

Ardakani, Maryam Afkhami; Ranjbar, Reza

2016-04-01

Escherichia coli (E. coli) is the most common cause of urinary infections in hospitals. The aim of this study was to evaluate the ERIC-PCR method for molecular typing of uropathogenic E. coli strains isolated from hospitalized patients. In a cross sectional study, 98 E. coli samples were collected from urine samples taken from patients admitted to Baqiyatallah Hospital from June 2014 to January 2015. The disk agar diffusion method was used to determine antibiotic sensitivity. DNA proliferation based on repetitive intergenic consensus was used to classify the E. coli strains. The products of proliferation were electrophoresed on 1.5% agarose gel, and their dendrograms were drawn. The data were analyzed by online Insillico software. The method used in this research proliferated numerous bands (4-17 bands), ranging from 100 to 3000 base pairs. The detected strains were classified into six clusters (E1-E6) with 70% similarity between them. In this study, uropathogenic E. coli strains belonged to different genotypic clusters. It was found that ERIC-PCR had good differentiation power for molecular typing of uropathogenic E. coli strains isolated from the patients in the study.

Assessment of the real-time PCR and different digital PCR platforms for DNA quantification.

Science.gov (United States)

Pavšič, Jernej; Žel, Jana; Milavec, Mojca

2016-01-01

Digital PCR (dPCR) is beginning to supersede real-time PCR (qPCR) for quantification of nucleic acids in many different applications. Several analytical properties of the two most commonly used dPCR platforms, namely the QX100 system (Bio-Rad) and the 12.765 array of the Biomark system (Fluidigm), have already been evaluated and compared with those of qPCR. However, to the best of our knowledge, direct comparison between the three of these platforms using the same DNA material has not been done, and the 37 K array on the Biomark system has also not been evaluated in terms of linearity, analytical sensitivity and limit of quantification. Here, a first assessment of qPCR, the QX100 system and both arrays of the Biomark system was performed with plasmid and genomic DNA from human cytomegalovirus. With use of PCR components that alter the efficiency of qPCR, each dPCR platform demonstrated consistent copy-number estimations, which indicates the high resilience of dPCR. Two approaches, one considering the total reaction volume and the other considering the effective reaction size, were used to assess linearity, analytical sensitivity and variability. When the total reaction volume was considered, the best performance was observed with qPCR, followed by the QX100 system and the Biomark system. In contrast, when the effective reaction size was considered, all three platforms showed almost equal limits of detection and variability. Although dPCR might not always be more appropriate than qPCR for quantification of low copy numbers, dPCR is a suitable method for robust and reproducible quantification of viral DNA, and a promising technology for the higher-order reference measurement method.

Reverse transcription PCR-based detection of Crimean-Congo hemorrhagic fever virus isolated from ticks of domestic ruminants in Kurdistan province of Iran.

Science.gov (United States)

Fakoorziba, Mohammad Reza; Golmohammadi, Parvaneh; Moradzadeh, Rahmatollah; Moemenbellah-Fard, Mohammad Djaefar; Azizi, Kourosh; Davari, Behrooz; Alipour, Hamzeh; Ahmadnia, Sara; Chinikar, Sadegh

2012-09-01

Crimean-Congo hemorrhagic fever (CCHF) is a potentially fatal viral vector-borne zoonosis which has a mortality rate of up to 30% without treatment in humans. CCHF virus is transmitted to humans by ticks, predominantly from the Hyalomma genus. Following the report of two confirmed and one suspected death due to CCHF virus in Kurdistan province of Iran in 2007, this study was undertaken to determine the fauna of hard ticks on domestic ruminants (cattle, sheep, and goats) and their possible infection with CCHF virus using reverse transcription PCR technique. This is the first detection of CCHF virus in ticks from the Kurdistan province of Iran. Overall, 414 ixodid ticks were collected from two districts in this province. They represented four genera from which 10 separate species were identified. The Hyalomma genus was the most abundant tick genus (70%). It was the only genus shown to be infected with the CCHF virus using RT-PCR technique. The number of ticks positive for CCHF virus was 5 out of 90 (5.6%) adult ticks. The three remaining genera (Haemaphysalis, Rhipicephalus, and Dermacentor) were all negative following molecular survey. Four of the five virally-infected ticks were from cattle mainly in the Sanandaj district. We concluded that CCHF virus is present in the Hyalomma ticks on domestic ruminants (cattle) in Kurdistan province of Iran.

Reverse transcription-quantitative polymerase chain reaction: description of a RIN-based algorithm for accurate data normalization

Directory of Open Access Journals (Sweden)

Boissière-Michot Florence

2009-04-01

Full Text Available Abstract Background Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is the gold standard technique for mRNA quantification, but appropriate normalization is required to obtain reliable data. Normalization to accurately quantitated RNA has been proposed as the most reliable method for in vivo biopsies. However, this approach does not correct differences in RNA integrity. Results In this study, we evaluated the effect of RNA degradation on the quantification of the relative expression of nine genes (18S, ACTB, ATUB, B2M, GAPDH, HPRT, POLR2L, PSMB6 and RPLP0 that cover a wide expression spectrum. Our results show that RNA degradation could introduce up to 100% error in gene expression measurements when RT-qPCR data were normalized to total RNA. To achieve greater resolution of small differences in transcript levels in degraded samples, we improved this normalization method by developing a corrective algorithm that compensates for the loss of RNA integrity. This approach allowed us to achieve higher accuracy, since the average error for quantitative measurements was reduced to 8%. Finally, we applied our normalization strategy to the quantification of EGFR, HER2 and HER3 in 104 rectal cancer biopsies. Taken together, our data show that normalization of gene expression measurements by taking into account also RNA degradation allows much more reliable sample comparison. Conclusion We developed a new normalization method of RT-qPCR data that compensates for loss of RNA integrity and therefore allows accurate gene expression quantification in human biopsies.

A multiplex PCR method for rapid identification of Brachionus rotifers.

Science.gov (United States)

Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

2009-01-01

Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

Alliinase and cysteine synthase transcription in developing garlic (Allium sativum L.) over time.

Science.gov (United States)

Mitrová, Katarina; Svoboda, Pavel; Milella, Luigi; Ovesná, Jaroslava

2018-06-15

Garlic is a valuable source of healthy compounds, including secondary metabolites rich in sulphur such as cysteine sulphoxides (CSOs). Here, we present new qRT-PCR assays analysing the transcription of two genes encoding key enzymes in CSO biosynthetic pathways (cysteine synthase and alliinase) in developing garlic. We also identified a set of genes (ACT I, GAPDH, and TUB) to use as transcription normalisation controls. We showed that the (normalised) transcription of both enzymes was highest during sprouting and decreased significantly in fully developed leaves, which are the major CSO-producing organs. Transcriptional activity further declined at the end of the growing season. Different cultivars show similar sulphur metabolism gene expression when European garlics were compared to Chinese and American genotypes. The qRT-PCR assays presented are also suitable for investigating the effects of agricultural practices on CSO formation in garlic to satisfy consumer demands. Copyright © 2017. Published by Elsevier Ltd.

International study to evaluate PCR methods for detection of Trypanosoma cruzi DNA in blood samples from Chagas disease patients.

Directory of Open Access Journals (Sweden)

Alejandro G Schijman

Full Text Available BACKGROUND: A century after its discovery, Chagas disease still represents a major neglected tropical threat. Accurate diagnostics tools as well as surrogate markers of parasitological response to treatment are research priorities in the field. The purpose of this study was to evaluate the performance of PCR methods in detection of Trypanosoma cruzi DNA by an external quality evaluation. METHODOLOGY/FINDINGS: An international collaborative study was launched by expert PCR laboratories from 16 countries. Currently used strategies were challenged against serial dilutions of purified DNA from stocks representing T. cruzi discrete typing units (DTU I, IV and VI (set A, human blood spiked with parasite cells (set B and Guanidine Hidrochloride-EDTA blood samples from 32 seropositive and 10 seronegative patients from Southern Cone countries (set C. Forty eight PCR tests were reported for set A and 44 for sets B and C; 28 targeted minicircle DNA (kDNA, 13 satellite DNA (Sat-DNA and the remainder low copy number sequences. In set A, commercial master mixes and Sat-DNA Real Time PCR showed better specificity, but kDNA-PCR was more sensitive to detect DTU I DNA. In set B, commercial DNA extraction kits presented better specificity than solvent extraction protocols. Sat-DNA PCR tests had higher specificity, with sensitivities of 0.05-0.5 parasites/mL whereas specific kDNA tests detected 5.10(-3 par/mL. Sixteen specific and coherent methods had a Good Performance in both sets A and B (10 fg/µl of DNA from all stocks, 5 par/mL spiked blood. The median values of sensitivities, specificities and accuracies obtained in testing the Set C samples with the 16 tests determined to be good performing by analyzing Sets A and B samples varied considerably. Out of them, four methods depicted the best performing parameters in all three sets of samples, detecting at least 10 fg/µl for each DNA stock, 0.5 par/mL and a sensitivity between 83.3-94.4%, specificity of 85

Transcriptional Correlates of Memory Maintenance Following Long-Term Sensitization of "Aplysia Californica"

Science.gov (United States)

Conte, Catherine; Herdegen, Samantha; Kamal, Saman; Patel, Jency; Patel, Ushma; Perez, Leticia; Rivota, Marissa; Calin-Jageman, Robert J.; Calin-Jageman, Irina E.

2017-01-01

We characterized the transcriptional response accompanying maintenance of long-term sensitization (LTS) memory in the pleural ganglia of "Aplysia californica" using microarray (N = 8) and qPCR (N = 11 additional samples). We found that 24 h after memory induction there is strong regulation of 1198 transcripts (748 up and 450 down) in a…

Eliminating PCR contamination

International Nuclear Information System (INIS)

Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.

1991-01-01

The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs

Development and evaluation of event-specific quantitative PCR method for genetically modified soybean A2704-12.

Science.gov (United States)

Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2011-01-01

A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.

Molecular methods (digital PCR and real-time PCR) for the quantification of low copy DNA of Phytophthora nicotianae in environmental samples.

Science.gov (United States)

Blaya, Josefa; Lloret, Eva; Santísima-Trinidad, Ana B; Ros, Margarita; Pascual, Jose A

2016-04-01

Currently, real-time polymerase chain reaction (qPCR) is the technique most often used to quantify pathogen presence. Digital PCR (dPCR) is a new technique with the potential to have a substantial impact on plant pathology research owing to its reproducibility, sensitivity and low susceptibility to inhibitors. In this study, we evaluated the feasibility of using dPCR and qPCR to quantify Phytophthora nicotianae in several background matrices, including host tissues (stems and roots) and soil samples. In spite of the low dynamic range of dPCR (3 logs compared with 7 logs for qPCR), this technique proved to have very high precision applicable at very low copy numbers. The dPCR was able to detect accurately the pathogen in all type of samples in a broad concentration range. Moreover, dPCR seems to be less susceptible to inhibitors than qPCR in plant samples. Linear regression analysis showed a high correlation between the results obtained with the two techniques in soil, stem and root samples, with R(2) = 0.873, 0.999 and 0.995 respectively. These results suggest that dPCR is a promising alternative for quantifying soil-borne pathogens in environmental samples, even in early stages of the disease. © 2015 Society of Chemical Industry.

Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

Science.gov (United States)

Ogrean, Christy; Jackson, Ben; Covino, James

2010-01-01

The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213

Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia Persica in Animal Blood Samples

Directory of Open Access Journals (Sweden)

SR Naddaf

2011-06-01

Full Text Available Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by mi­cros­copy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spi­ro­chetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR tar­get­ing flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were per­formed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spi­ro­chete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentra­tion as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.

Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia persica in Animal Blood Samples

Directory of Open Access Journals (Sweden)

SR Naddaf

2011-06-01

Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by mi­cros­copy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spi­ro­chetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR tar­get­ing flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were per­formed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spi­ro­chete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentra­tion as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml.  Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.  

Ultra-fast DNA-based multiplex convection PCR method for meat species identification with possible on-site applications.

Science.gov (United States)

Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee

2017-08-15

The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

Polyuridylylation and processing of transcripts from multiple gene minicircles in chloroplasts of the dinoflagellate Amphidinium carterae

KAUST Repository

Barbrook, Adrian C.; Dorrell, Richard G.; Burrows, Jennifer; Plenderleith, Lindsey J.; Nisbet, R. Ellen R.; Howe, Christopher J.

2012-01-01

-PCR to study transcription and transcript processing in the chloroplasts of Amphidinium carterae, a model peridinin-containing dinoflagellate. These organisms have a highly unusual chloroplast genome, with genes located on multiple small 'minicircle' elements

Nucleic acid extraction, oligonucleotide probes and PCR methods

International Nuclear Information System (INIS)

Zhongtang Yu; Forster, R.J.

2005-01-01

Complex microbiomes of rumen and gastrointestinal tracts. Bacteria, fungi and protozoa, present in rumen and gastrointestinal (GI) tracts, interact with feed, with each other, and with their host animals, resulting in a complex symbiotic microbiota of distinctive composition and structure. Such microbiota is dynamic and highly responsive to a variety of biotic and abiotic factors, such as diet, feed additives, age, health and physiological status of the host animal, geographical locations, season and feeding regimen (reviewed in Ref. [39]). This symbiotic microbiota has been the focus of microbial research for over half a century in search for improved ruminant nutrition. Before the advent of molecular biology techniques, microorganisms in rumen and GI tracts, as in other habitats, were studied with cultivation-based techniques, which only allows for the isolation and characterization of a limited number of readily culturable species. As estimated, there are more than 400 species of bacteria and up to 100 species of protozoa and fungi inhabiting rumen and GI tracts. In human GI tracts, as much as 60% of these members cannot be isolated on agar plates and, thus, remain unknown. In ruminants, although it is not known, the culturable species of the microbiota are probably in the same range. Even among the culturable species, probably only some of them have been isolated and described. The application of cultivation-independent, more sensitive and accurate molecular techniques to the study of ruminal and GI microorganisms provided an alternative to directly examining the diversity and the community structure of ruminal and GI microbiota on the basis of genotypes, instead of phenotypes. Both polymerase chain reaction (PCR)-based methods, such as denaturing gradient gel electrophoresis (DGGE), ribosomal intergenic spacer analysis, terminal restriction fragment length polymorphism, cloning and sequencing of PCR amplicons and amplified 16S ribosomal DNA restriction

A PCR-based method for identification of bifidobacteria from the human alimentary tract at the species level

NARCIS (Netherlands)

Venema, K.; Maathuis, A.J.H.

2003-01-01

A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12

A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

Directory of Open Access Journals (Sweden)

Karolina Stojowska

Full Text Available We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s, while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR, whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR. The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

Science.gov (United States)

Stojowska, Karolina; Krawczyk, Beata

2014-01-01

We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

Science.gov (United States)

Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

A novel mean-centering method for normalizing microRNA expression from high-throughput RT-qPCR data

Directory of Open Access Journals (Sweden)

Wylie Dennis

2011-12-01

Full Text Available Abstract Background Normalization is critical for accurate gene expression analysis. A significant challenge in the quantitation of gene expression from biofluids samples is the inability to quantify RNA concentration prior to analysis, underscoring the need for robust normalization tools for this sample type. In this investigation, we evaluated various methods of normalization to determine the optimal approach for quantifying microRNA (miRNA expression from biofluids and tissue samples when using the TaqMan® Megaplex™ high-throughput RT-qPCR platform with low RNA inputs. Findings We compared seven normalization methods in the analysis of variation of miRNA expression from biofluid and tissue samples. We developed a novel variant of the common mean-centering normalization strategy, herein referred to as mean-centering restricted (MCR normalization, which is adapted to the TaqMan Megaplex RT-qPCR platform, but is likely applicable to other high-throughput RT-qPCR-based platforms. Our results indicate that MCR normalization performs comparable to or better than both standard mean-centering and other normalization methods. We also propose an extension of this method to be used when migrating biomarker signatures from Megaplex to singleplex RT-qPCR platforms, based on the identification of a small number of normalizer miRNAs that closely track the mean of expressed miRNAs. Conclusions We developed the MCR method for normalizing miRNA expression from biofluids samples when using the TaqMan Megaplex RT-qPCR platform. Our results suggest that normalization based on the mean of all fully observed (fully detected miRNAs minimizes technical variance in normalized expression values, and that a small number of normalizer miRNAs can be selected when migrating from Megaplex to singleplex assays. In our study, we find that normalization methods that focus on a restricted set of miRNAs tend to perform better than methods that focus on all miRNAs, including

A fast and highly sensitive blood culture PCR method for clinical detection of Salmonella enterica serovar Typhi

Directory of Open Access Journals (Sweden)

Zhou Liqing

2010-04-01

Full Text Available Abstract Background Salmonella Typhi causes an estimated 21 million new cases of typhoid fever and 216,000 deaths every year. Blood culture is currently the gold standard for diagnosis of typhoid fever, but it is time-consuming and takes several days for isolation and identification of causative organisms. It is then too late to initiate proper antibiotic therapy. Serological tests have very low sensitivity and specificity, and no practical value in endemic areas. As early diagnosis of the disease and prompt treatment are essential for optimal management, especially in children, a rapid sensitive detection method for typhoid fever is urgently needed. Although PCR is sensitive and rapid, initial research indicated similar sensitivity to blood culture and lower specificity. We developed a fast and highly sensitive blood culture PCR method for detection of Salmonella Typhi, allowing same-day initiation of treatment after accurate diagnosis of typhoid. Methods An ox bile tryptone soy broth was optimized for blood culture, which allows the complete lysis of blood cells to release intracellular bacteria without inhibiting the growth of Salmonella Typhi. Using the optimised broth Salmonella Typhi bacteria in artificial blood samples were enriched in blood culture and then detected by a PCR targeting the fliC-d gene of Salmonella Typhi. Results Tests demonstrated that 2.4% ox bile in blood culture not only lyzes blood cells completely within 1.5 hours so that the intracellular bacteria could be released, but also has no inhibiting effect on the growth of Salmonella Typhi. Three hour enrichment of Salmonella Typhi in tryptone soya broth containing 2.4% ox bile could increase the bacterial number from 0.75 CFU per millilitre of blood which is similar to clinical typhoid samples to the level which regular PCR can detect. The whole blood culture PCR assay takes less than 8 hours to complete rather than several days for conventional blood culture

Empirical evaluation of humpback whale telomere length estimates; quality control and factors causing variability in the singleplex and multiplex qPCR methods

DEFF Research Database (Denmark)

Olsen, Morten Tange; Bérubé, Martine; Robbins, Jooke

2012-01-01

BACKGROUND:Telomeres, the protective cap of chromosomes, have emerged as powerful markers of biological age and life history in model and non-model species. The qPCR method for telomere length estimation is one of the most common methods for telomere length estimation, but has received recent...... steps of qPCR. In order to evaluate the utility of the qPCR method for telomere length estimation in non-model species, we carried out four different qPCR assays directed at humpback whale telomeres, and subsequently performed a rigorous quality control to evaluate the performance of each assay. RESULTS...... to 40% depending on assay and quantification method, however this variation only affected telomere length estimates in the worst performing assays. CONCLUSION:Our results suggest that seemingly well performing qPCR assays may contain biases that will only be detected by extensive quality control...

Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods.

Science.gov (United States)

Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi

2015-10-19

We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

Current PCR Methods for the Detection, Identification and Quantification of Genetically Modified Organisms(GMOs: a Brief Review

Directory of Open Access Journals (Sweden)

Gadani F

2014-12-01

Full Text Available Analytical methods based on the polymerase chain reaction (PCR technology are increasingly used for the detection of deoxyribonucleic acid (DNA sequences associated with genetically modified organisms (GMOs. In the European Union and Switzerland, mandatory labeling of novel foods and food ingredients consisting of, or containing GMOs is required according to food regulations and is triggered by the presence of newly introduced foreign DNA sequences, or newly expressed proteins. In order to meet regulatory and consumer demand, numerous PCR-based methods have been developed which can detect, identify and quantify GMOs in agricultural crops, food and feed. Moreover, the determination of genetic identity allows for segregation and traceability (identity preservation throughout the supply chain of GM crops that have been enhanced with value-added quality traits. Prerequisites for GMO detection include a minimum amount of the target gene and prior knowledge of the type of genetic modification, such as virus or insect resistance traits, including controlling elements (promoters and terminators. Moreover, DNA extraction and purification is a critical step for the preparation of PCR-quality samples, particularly for processed agricultural crops such as tobacco. This paper reviews the state-of-the-art of PCR-based method development for the qualitative and quantitative determination and identification of GMOs, and includes a short summary of official and validated GMO detection methods.

Ensemble approach combining multiple methods improves human transcription start site prediction.

LENUS (Irish Health Repository)

Dineen, David G

2010-01-01

The computational prediction of transcription start sites is an important unsolved problem. Some recent progress has been made, but many promoters, particularly those not associated with CpG islands, are still difficult to locate using current methods. These methods use different features and training sets, along with a variety of machine learning techniques and result in different prediction sets.

Questioning Transcription: The Case for the Systematic and Reflexive Interviewing and Reporting (SRIR Method

Directory of Open Access Journals (Sweden)

Nicholas Loubere

2017-05-01

Full Text Available The recording and verbatim transcription of interviews is often considered to be one of the more tedious but necessary aspects of the in-depth qualitative research process. While transcription is undoubtedly a necessary methodological tool for researchers focusing specifically on discourse and language, it has also been widely adopted by researchers across the social sciences, and is sometimes advocated as a means of inherently improving the rigour of qualitative research. Based on recent experience from fieldwork in rural China, where I had initially expected to utilise the verbatim transcription method, in this article I critically assess the role of transcription in the design, implementation, and outcome of cross-cultural multilingual qualitative research. I argue that, in certain cases, verbatim transcription can limit the kind of information that may be considered valuable as data, and delay the processes of data reduction and analysis, thus separating the researcher from the fieldwork event. In response to these critiques, I propose an alternative approach to collecting, categorising, coding, and analysing qualitative data: the systematic and reflexive interviewing and reporting (SRIR method. The SRIR method utilises semi-structured and unstructured interviews conducted by two or more researchers. After completing an interview, researchers engage in reflexive dialogue, and jointly write interview and analysis reports. In this way, the SRIR method begins the process of coding and analysis in situ, thus facilitating critical engagement with emergent themes during fieldwork rather than afterwards. The method is, therefore, ideally suited to research projects that are designed to be open ended and flexible, in order to follow up on new information and potentially even change focus. URN: http://nbn-resolving.de/urn:nbn:de:0114-fqs1702152

Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

Directory of Open Access Journals (Sweden)

Tian-Min Qiao

2016-10-01

Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

Science.gov (United States)

Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

2016-01-01

Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

Science.gov (United States)

Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

2016-10-01

Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

Diagnosis of canine visceral leishmaniasis with radiolabelled probes: comparison of the kDNA PCR-hybridization with three molecular methods in different clinical samples

Energy Technology Data Exchange (ETDEWEB)

Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Departamento de Parasitologia. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)

2011-07-01

Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with {sup 32}P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)

Diagnosis of canine visceral leishmaniasis with radiolabelled probes: comparison of the kDNA PCR-hybridization with three molecular methods in different clinical samples

International Nuclear Information System (INIS)

Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R.

2011-01-01

Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with 32 P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)

An improved PCR method for direct identification of Porphyra (Bangiales, Rhodophyta) using conchocelis based on a RUBISCO intergenic spacer

Science.gov (United States)

Wang, Chao; Dong, Dong; Wang, Guangce; Zhang, Baoyu; Peng, Guang; Xu, Pu; Tang, Xiaorong

2009-09-01

An improved method of PCR in which the small segment of conchocelis is amplified directly without DNA extraction was used to amplify a RUBISCO intergenic spacer DNA fragment from nine species of red algal genus Porphyra (Bangiales, Rhodophyta), including Porphyra yezoensis (Jiangsu, China), P. haitanensis (Fujian, China), P. oligospermatangia (Qingdao, China), P. katadai (Qingdao, China), P. tenera (Qingdao, China), P. suborboculata (Fujian, China), P. pseudolinearis (Kogendo, Korea), P. linearis (Devon, England), and P. fallax (Seattle, USA). Standard PCR and the method developed here were both conducted using primers specific for the RUBISCO spacer region, after which the two PCR products were sequenced. The sequencing data of the amplicons obtained using both methods were identical, suggesting that the improved PCR method was functional. These findings indicate that the method developed here may be useful for the rapid identification of species of Porphyra in a germplasm bank. In addition, a phylogenetic tree was constructed using the RUBISCO spacer and partial rbcS sequence, and the results were in concordant with possible alternative phylogenies based on traditional morphological taxonomic characteristics, indicating that the RUBISCO spacer is a useful region for phylogenetic studies.

Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases

OpenAIRE

Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian; Aznar, Susana; Pakkenberg, Bente; Brudek, Tomasz

2016-01-01

Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results. This is especially important in relation to neurodegenerative diseases where disease-related structural changes may affect the most commonly used RGs. We analysed 15 candidate RGs in 98 brain sampl...

Transcriptome discovery in non-model wild fish species for the development of quantitative transcript abundance assays.

Science.gov (United States)

Hahn, Cassidy M; Iwanowicz, Luke R; Cornman, Robert S; Mazik, Patricia M; Blazer, Vicki S

2016-12-01

Environmental studies increasingly identify the presence of both contaminants of emerging concern (CECs) and legacy contaminants in aquatic environments; however, the biological effects of these compounds on resident fishes remain largely unknown. High throughput methodologies were employed to establish partial transcriptomes for three wild-caught, non-model fish species; smallmouth bass (Micropterus dolomieu), white sucker (Catostomus commersonii) and brown bullhead (Ameiurus nebulosus). Sequences from these transcriptome databases were utilized in the development of a custom nCounter CodeSet that allowed for direct multiplexed measurement of 50 transcript abundance endpoints in liver tissue. Sequence information was also utilized in the development of quantitative real-time PCR (qPCR) primers. Cross-species hybridization allowed the smallmouth bass nCounter CodeSet to be used for quantitative transcript abundance analysis of an additional non-model species, largemouth bass (Micropterus salmoides). We validated the nCounter analysis data system with qPCR for a subset of genes and confirmed concordant results. Changes in transcript abundance biomarkers between sexes and seasons were evaluated to provide baseline data on transcript modulation for each species of interest. Published by Elsevier Inc.

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Directory of Open Access Journals (Sweden)

Laurent Dacheux

2016-07-01

Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Science.gov (United States)

Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-07-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

Evaluation of the expression of internal control transcripts by real ...

African Journals Online (AJOL)

Evaluation of the expression of internal control transcripts by real-time RT-PCR analysis during tomato flower abscission. Song Gao, Tao Xu, Mingfang Qi, Yufeng Liu, Hong Li, Shuangshuang Lv, Jinhong Li, Tianlai Li ...

Real-time PCR-based method for the rapid detection of extended RAS mutations using bridged nucleic acids in colorectal cancer.

Science.gov (United States)

Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu

2017-10-27

Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

Sampling and Pooling Methods for Capturing Herd Level Antibiotic Resistance in Swine Feces using qPCR and CFU Approaches

DEFF Research Database (Denmark)

Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo

2015-01-01

The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... in the same swine fecal samples. The results showed that the qPCR assays were capable of detecting differences in antibiotic resistance levels in individual animals that the coliform bacteria colony forming units (CFU) could not. Also, the qPCR assays more accurately quantified antibiotic resistance genes...

Analytical Validation of Quantitative Real-Time PCR Methods for Quantification of Trypanosoma cruzi DNA in Blood Samples from Chagas Disease Patients.

Science.gov (United States)

Ramírez, Juan Carlos; Cura, Carolina Inés; da Cruz Moreira, Otacilio; Lages-Silva, Eliane; Juiz, Natalia; Velázquez, Elsa; Ramírez, Juan David; Alberti, Anahí; Pavia, Paula; Flores-Chávez, María Delmans; Muñoz-Calderón, Arturo; Pérez-Morales, Deyanira; Santalla, José; Marcos da Matta Guedes, Paulo; Peneau, Julie; Marcet, Paula; Padilla, Carlos; Cruz-Robles, David; Valencia, Edward; Crisante, Gladys Elena; Greif, Gonzalo; Zulantay, Inés; Costales, Jaime Alfredo; Alvarez-Martínez, Miriam; Martínez, Norma Edith; Villarroel, Rodrigo; Villarroel, Sandro; Sánchez, Zunilda; Bisio, Margarita; Parrado, Rudy; Maria da Cunha Galvão, Lúcia; Jácome da Câmara, Antonia Cláudia; Espinoza, Bertha; Alarcón de Noya, Belkisyole; Puerta, Concepción; Riarte, Adelina; Diosque, Patricio; Sosa-Estani, Sergio; Guhl, Felipe; Ribeiro, Isabela; Aznar, Christine; Britto, Constança; Yadón, Zaida Estela; Schijman, Alejandro G

2015-09-01

An international study was performed by 26 experienced PCR laboratories from 14 countries to assess the performance of duplex quantitative real-time PCR (qPCR) strategies on the basis of TaqMan probes for detection and quantification of parasitic loads in peripheral blood samples from Chagas disease patients. Two methods were studied: Satellite DNA (SatDNA) qPCR and kinetoplastid DNA (kDNA) qPCR. Both methods included an internal amplification control. Reportable range, analytical sensitivity, limits of detection and quantification, and precision were estimated according to international guidelines. In addition, inclusivity and exclusivity were estimated with DNA from stocks representing the different Trypanosoma cruzi discrete typing units and Trypanosoma rangeli and Leishmania spp. Both methods were challenged against 156 blood samples provided by the participant laboratories, including samples from acute and chronic patients with varied clinical findings, infected by oral route or vectorial transmission. kDNA qPCR showed better analytical sensitivity than SatDNA qPCR with limits of detection of 0.23 and 0.70 parasite equivalents/mL, respectively. Analyses of clinical samples revealed a high concordance in terms of sensitivity and parasitic loads determined by both SatDNA and kDNA qPCRs. This effort is a major step toward international validation of qPCR methods for the quantification of T. cruzi DNA in human blood samples, aiming to provide an accurate surrogate biomarker for diagnosis and treatment monitoring for patients with Chagas disease. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

Directory of Open Access Journals (Sweden)

André Moura

2016-07-01

Full Text Available ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evaluated when combined with two real time PCRs. The DNeasy Blood & Tissue Kit from QIAGEN showed better performance and sensitivity followed by the DNA Mini Kit RBC and FTA Elute Micro Card. Results suggested that, even when the analytical sensitivity of the qPCR is very high, the extraction method can influence the diagnostic sensitivity.

Validation of putative reference genes for normalization of Q-RT-PCR data from paraffin-embedded lymphoid tissue

DEFF Research Database (Denmark)

Green, Tina Marie; de Stricker, Karin; Møller, Michael Boe

2009-01-01

Normalization of quantitative reverse transcription-PCR (Q-RT-PCR) data to appropriate tissue-specific reference genes is an essential part of interpreting the results. This study aimed to determine the most appropriate reference genes for normalizing gene expressions in lymphatic tissue...... was 0.93 (Pnormalization with the appropriate reference genes. Thus, we show that formalin-fixed, paraffin-embedded lymphoid samples are suitable for Q-RT-PCR when using thoroughly validated reference genes....

Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

Science.gov (United States)

Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

2015-01-01

Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100

Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods

Directory of Open Access Journals (Sweden)

Akiko Edagawa

2015-10-01

Full Text Available We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR, and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%. Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%. In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8% compared with real-time qPCR alone (46/68, 67.6%. Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1% compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%. Legionella was not detected in the remaining six samples (6/68, 8.8%, irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

A multiplex PCR method for the identification of commercially important salmon and trout species (Oncorhynchus and Salmo) in North America.

Science.gov (United States)

Rasmussen Hellberg, Rosalee S; Morrissey, Michael T; Hanner, Robert H

2010-09-01

The purpose of this study was to develop a species-specific multiplex polymerase chain reaction (PCR) method that allows for the detection of salmon species substitution on the commercial market. Species-specific primers and TaqMan® probes were developed based on a comprehensive collection of mitochondrial 5' cytochrome c oxidase subunit I (COI) deoxyribonucleic acid (DNA) "barcode" sequences. Primers and probes were combined into multiplex assays and tested for specificity against 112 reference samples representing 25 species. Sensitivity and linearity tests were conducted using 10-fold serial dilutions of target DNA (single-species samples) and DNA admixtures containing the target species at levels of 10%, 1.0%, and 0.1% mixed with a secondary species. The specificity tests showed positive signals for the target DNA in both real-time and conventional PCR systems. Nonspecific amplification in both systems was minimal; however, false positives were detected at low levels (1.2% to 8.3%) in conventional PCR. Detection levels were similar for admixtures and single-species samples based on a 30 PCR cycle cut-off, with limits of 0.25 to 2.5 ng (1% to 10%) in conventional PCR and 0.05 to 5.0 ng (0.1% to 10%) in real-time PCR. A small-scale test with food samples showed promising results, with species identification possible even in heavily processed food items. Overall, this study presents a rapid, specific, and sensitive method for salmon species identification that can be applied to mixed-species and heavily processed samples in either conventional or real-time PCR formats. This study provides a newly developed method for salmon and trout species identification that will assist both industry and regulatory agencies in the detection and prevention of species substitution. This multiplex PCR method allows for rapid, high-throughput species identification even in heavily processed and mixed-species samples. An inter-laboratory study is currently being carried out to

Detection and Analysis of Circular RNAs by RT-PCR.

Science.gov (United States)

Panda, Amaresh C; Gorospe, Myriam

2018-03-20

Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

Directory of Open Access Journals (Sweden)

Marcos Lázaro Moreli

2004-10-01

Full Text Available We report a nested reverse transcription-polymerase chain reaction (RT-PCR assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity and in all 9 blood samples (100% positivity by nested-PCR. The eight amplicons obtained by RT-PCR (P1, P3-P9, including one obtained by nested-PCR (P-2 and not obtained by RT-PCR, were sequenced and showed high homology (94.8% to 99.1% with the N gene of Araraquara hantavirus. Although the serologic method ELISA is the most appropriate test for HCPS diagnosis, the use of nested RT-PCR for hantavirus in Brazil would contribute to the diagnosis of acute hantavirus disease detecting viral genomes in patient specimens as well as initial genomic characterization of circulating hantaviruses.

Novel degenerate PCR method for whole genome amplification applied to Peru Margin (ODP Leg 201 subsurface samples

Directory of Open Access Journals (Sweden)

Amanda eMartino

2012-01-01

Full Text Available A degenerate PCR-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. The method, which we have called Random Amplification Metagenomic PCR (RAMP, involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3’ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10X. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin, and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa show that community analysis can be sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low biomass samples.

Quantitation of TGF-beta1 mRNA in porcine mesangial cells by comparative kinetic RT/PCR: comparison with ribonuclease protection assay and in situ hybridization.

Science.gov (United States)

Ceol, M; Forino, M; Gambaro, G; Sauer, U; Schleicher, E D; D'Angelo, A; Anglani, F

2001-01-01

Gene expression can be examined with different techniques including ribonuclease protection assay (RPA), in situ hybridisation (ISH), and quantitative reverse transcription-polymerase chain reaction (RT/PCR). These methods differ considerably in their sensitivity and precision in detecting and quantifying low abundance mRNA. Although there is evidence that RT/PCR can be performed in a quantitative manner, the quantitative capacity of this method is generally underestimated. To demonstrate that the comparative kinetic RT/PCR strategy-which uses a housekeeping gene as internal standard-is a quantitative method to detect significant differences in mRNA levels between different samples, the inhibitory effect of heparin on phorbol 12-myristate 13-acetate (PMA)-induced-TGF-beta1 mRNA expression was evaluated by RT/PCR and RPA, the standard method of mRNA quantification, and the results were compared. The reproducibility of RT/PCR amplification was calculated by comparing the quantity of G3PDH and TGF-beta1 PCR products, generated during the exponential phases, estimated from two different RT/PCR (G3PDH, r = 0.968, P = 0.0000; TGF-beta1, r = 0.966, P = 0.0000). The quantitative capacity of comparative kinetic RT/PCR was demonstrated by comparing the results obtained from RPA and RT/PCR using linear regression analysis. Starting from the same RNA extraction, but using only 1% of the RNA for the RT/PCR compared to RPA, significant correlation was observed (r = 0.984, P = 0.0004). Moreover the morphometric analysis of ISH signal was applied for the semi-quantitative evaluation of the expression and localisation of TGF-beta1 mRNA in the entire cell population. Our results demonstrate the close similarity of the RT/PCR and RPA methods in giving quantitative information on mRNA expression and indicate the possibility to adopt the comparative kinetic RT/PCR as reliable quantitative method of mRNA analysis. Copyright 2001 Wiley-Liss, Inc.

Testing the sensitivity of Nested PCR method to detect Aspergillus fumigates in experimentally infected Sputum samples

International Nuclear Information System (INIS)

Ramadan, A.; Soukkaria, S.

2013-01-01

Fungal infections caused by Aspergillus species generally are occupying a second place among invasive fungal infections in the world, especially A. fumigatus, which is considered the main cause of invasive Aspergillosis (IA). Although IA rarely infects immunocompetent individuals, however, it can lead to death in immunocompromised patients. Therefore, it is necessary to diagnose the infection early in order to treat the disease efficiently. However, the conventional diagnostic tools, currently used to detect infections, has low sensitivity and reliability. Polymerase chain reaction (PCR) technology distribution as a molecular and high sensitive technology has allowed us to make comparative study between sensitivity of traditional currently used diagnostic method and Nested-PCR, the result of the study of sputum samples that experimentally infected with different concentrations of A.fumigatus spores ramping from 10 to10 6 spore/ml, have high sensitivity and specificity of Nested-PCR in detecting the lower concentrations, comparing with traditional diagnostic method (culture on Sabouraud media) that were negative in all concetrations. (author)

Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study

Science.gov (United States)

A number of PCR-based methods for detecting human fecal material in environmental waters have been developed over the past decade, but these methods have rarely received independent comparative testing. Here, we evaluated ten of these methods (BacH, BacHum-UCD, B. thetaiotaomic...

Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

DEFF Research Database (Denmark)

Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

2017-01-01

, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

A method for accurate detection of genomic microdeletions using real-time quantitative PCR

Directory of Open Access Journals (Sweden)

Bassett Anne S

2005-12-01

Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a well-established method for quantifying levels of gene expression, but has not been routinely applied to the detection of constitutional copy number alterations of human genomic DNA. Microdeletions or microduplications of the human genome are associated with a variety of genetic disorders. Although, clinical laboratories routinely use fluorescence in situ hybridization (FISH to identify such cryptic genomic alterations, there remains a significant number of individuals in which constitutional genomic imbalance is suspected, based on clinical parameters, but cannot be readily detected using current cytogenetic techniques. Results In this study, a novel application for real-time qPCR is presented that can be used to reproducibly detect chromosomal microdeletions and microduplications. This approach was applied to DNA from a series of patient samples and controls to validate genomic copy number alteration at cytoband 22q11. The study group comprised 12 patients with clinical symptoms of chromosome 22q11 deletion syndrome (22q11DS, 1 patient trisomic for 22q11 and 4 normal controls. 6 of the patients (group 1 had known hemizygous deletions, as detected by standard diagnostic FISH, whilst the remaining 6 patients (group 2 were classified as 22q11DS negative using the clinical FISH assay. Screening of the patients and controls with a set of 10 real time qPCR primers, spanning the 22q11.2-deleted region and flanking sequence, confirmed the FISH assay results for all patients with 100% concordance. Moreover, this qPCR enabled a refinement of the region of deletion at 22q11. Analysis of DNA from chromosome 22 trisomic sample demonstrated genomic duplication within 22q11. Conclusion In this paper we present a qPCR approach for the detection of chromosomal microdeletions and microduplications. The strategic use of in silico modelling for qPCR primer design to avoid regions of repetitive

Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method

Directory of Open Access Journals (Sweden)

Eva Renčová

2014-01-01

Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.

Identification and gene-silencing of a putative odorant receptor transcription factor in Varroa destructor: possible role in olfaction.

Science.gov (United States)

Singh, N K; Eliash, N; Stein, I; Kamer, Y; Ilia, Z; Rafaeli, A; Soroker, V

2016-04-01

The ectoparasitic mite Varroa destructor is one of the major threats to apiculture. Using a behavioural choice bioassay, we determined that phoretic mites were more successful in reaching a bee than reproductive mites, suggesting an energy trade-off between reproduction and host selection. We used both chemo-ecological and molecular strategies to identify the regulation of the olfactory machinery of Varroa and its association with reproduction. We focused on transcription regulation. Using primers designed to the conserved DNA binding region of transcription factors, we identified a gene transcript in V. destructor homologous to the pheromone receptor transcription factor (PRTF) gene of Pediculus humanus corporis. Quantitative PCR (qPCR) revealed that this PRTF-like gene transcript is expressed in the forelegs at higher levels than in the body devoid of forelegs. Subsequent comparative qPCR analysis showed that transcript expression was significantly higher in the phoretic as compared to the reproductive stage. Electrophysiological and behavioural studies revealed a reduction in the sensitivity of PRTF RNA interference-silenced mites to bee headspace, consistent with a reduction in the mites' ability to reach a host. In addition, vitellogenin expression was stimulated in PRTF-silenced mites to similar levels as found in reproductive mites. These data shed light upon the regulatory mechanism of host chemosensing in V. destructor. © 2016 The Royal Entomological Society.