WorldWideScience

Sample records for transcription pcr method

  1. Validated reverse transcription droplet digital PCR serves as a higher order method for absolute quantification of Potato virus Y strains.

    Science.gov (United States)

    Mehle, Nataša; Dobnik, David; Ravnikar, Maja; Pompe Novak, Maruša

    2018-05-03

    RNA viruses have a great potential for high genetic variability and rapid evolution that is generated by mutation and recombination under selection pressure. This is also the case of Potato virus Y (PVY), which comprises a high diversity of different recombinant and non-recombinant strains. Consequently, it is hard to develop reverse transcription real-time quantitative PCR (RT-qPCR) with the same amplification efficiencies for all PVY strains which would enable their equilibrate quantification; this is specially needed in mixed infections and other studies of pathogenesis. To achieve this, we initially transferred the PVY universal RT-qPCR assay to a reverse transcription droplet digital PCR (RT-ddPCR) format. RT-ddPCR is an absolute quantification method, where a calibration curve is not needed, and it is less prone to inhibitors. The RT-ddPCR developed and validated in this study achieved a dynamic range of quantification over five orders of magnitude, and in terms of its sensitivity, it was comparable to, or even better than, RT-qPCR. RT-ddPCR showed lower measurement variability. We have shown that RT-ddPCR can be used as a reference tool for the evaluation of different RT-qPCR assays. In addition, it can be used for quantification of RNA based on in-house reference materials that can then be used as calibrators in diagnostic laboratories.

  2. Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

    Science.gov (United States)

    Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

    2013-05-21

    Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

  3. Comparison of two methods for the detection of hepatitis A virus in clam samples (Tapes spp.) by reverse transcription-nested PCR.

    Science.gov (United States)

    Suñén, Ester; Casas, Nerea; Moreno, Belén; Zigorraga, Carmen

    2004-03-01

    The detection of hepatitis A virus in shellfish by reverse transcription-nested polymerase chain reaction (RT-nested PCR) is hampered mainly by low levels of virus contamination and PCR inhibitors in shellfish. In this study, we focused on getting a rapid and sensitive processing procedure for the detection of HAV by RT-nested PCR in clam samples (Tapes spp.). Two previously developed processing methods for virus concentration in shellfish have been improved upon and compared. The first method involves acid adsorption, elution, polyethylene glycol (PEG) precipitation, chloroform extraction and PEG precipitation. The second method is based on elution with a glycine buffer at pH 10, chloroform extraction and concentration by ultracentrifugation. Final clam concentrates were processed by RNA extraction or immunomagnetic capture of viruses (IMC) before the RT-nested PCR reaction. Both methods of sample processing combined with the RNA extraction from the concentrates were very efficient when they were assayed in seeded and naturally contaminated samples. The results show that the first method was more effective in removal inhibitors and the second was simpler and faster. The IMC of HAV from clam concentrates processed by method 1 was revealed to be a very effective method of simultaneously removing residual PCR inhibitors and of concentrating the virus.

  4. Comparative Evaluation of Three Homogenization Methods for Isolating Middle East Respiratory Syndrome Coronavirus Nucleic Acids From Sputum Samples for Real-Time Reverse Transcription PCR.

    Science.gov (United States)

    Sung, Heungsup; Yong, Dongeun; Ki, Chang Seok; Kim, Jae Seok; Seong, Moon Woo; Lee, Hyukmin; Kim, Mi Na

    2016-09-01

    Real-time reverse transcription PCR (rRT-PCR) of sputum samples is commonly used to diagnose Middle East respiratory syndrome coronavirus (MERS-CoV) infection. Owing to the difficulty of extracting RNA from sputum containing mucus, sputum homogenization is desirable prior to nucleic acid isolation. We determined optimal homogenization methods for isolating viral nucleic acids from sputum. We evaluated the following three sputum-homogenization methods: proteinase K and DNase I (PK-DNase) treatment, phosphate-buffered saline (PBS) treatment, and N-acetyl-L-cysteine and sodium citrate (NALC) treatment. Sputum samples were spiked with inactivated MERS-CoV culture isolates. RNA was extracted from pretreated, spiked samples using the easyMAG system (bioMérieux, France). Extracted RNAs were then subjected to rRT-PCR for MERS-CoV diagnosis (DiaPlex Q MERS-coronavirus, SolGent, Korea). While analyzing 15 spiked sputum samples prepared in technical duplicate, false-negative results were obtained with five (16.7%) and four samples (13.3%), respectively, by using the PBS and NALC methods. The range of threshold cycle (Ct) values observed when detecting upE in sputum samples was 31.1-35.4 with the PK-DNase method, 34.7-39.0 with the PBS method, and 33.9-38.6 with the NALC method. Compared with the control, which were prepared by adding a one-tenth volume of 1:1,000 diluted viral culture to PBS solution, the ranges of Ct values obtained by the PBS and NALC methods differed significantly from the mean control Ct of 33.2 (both Phomogenizing sputum samples prior to RNA extraction.

  5. Comparison of multiplex reverse transcription-PCR-enzyme ...

    African Journals Online (AJOL)

    Comparison of multiplex reverse transcription-PCR-enzyme hybridization assay with immunofluorescence techniques for the detection of four viral respiratory pathogens in pediatric community acquired pneumonia.

  6. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  7. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  8. Design and optimization of reverse-transcription quantitative PCR experiments.

    Science.gov (United States)

    Tichopad, Ales; Kitchen, Rob; Riedmaier, Irmgard; Becker, Christiane; Ståhlberg, Anders; Kubista, Mikael

    2009-10-01

    Quantitative PCR (qPCR) is a valuable technique for accurately and reliably profiling and quantifying gene expression. Typically, samples obtained from the organism of study have to be processed via several preparative steps before qPCR. We estimated the errors of sample withdrawal and extraction, reverse transcription (RT), and qPCR that are introduced into measurements of mRNA concentrations. We performed hierarchically arranged experiments with 3 animals, 3 samples, 3 RT reactions, and 3 qPCRs and quantified the expression of several genes in solid tissue, blood, cell culture, and single cells. A nested ANOVA design was used to model the experiments, and relative and absolute errors were calculated with this model for each processing level in the hierarchical design. We found that intersubject differences became easily confounded by sample heterogeneity for single cells and solid tissue. In cell cultures and blood, the noise from the RT and qPCR steps contributed substantially to the overall error because the sampling noise was less pronounced. We recommend the use of sample replicates preferentially to any other replicates when working with solid tissue, cell cultures, and single cells, and we recommend the use of RT replicates when working with blood. We show how an optimal sampling plan can be calculated for a limited budget. .

  9. Propidium monoazide reverse transcription PCR and RT-qPCR for detecting infectious enterovirus and norovirus

    Science.gov (United States)

    Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...

  10. Detection of hepatitis C virus RNA using reverse transcription PCR

    International Nuclear Information System (INIS)

    Yap, S.F.

    1998-01-01

    Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

  11. In situ reverse transcription-PCR for monitoring gene expression in individual Methanosarcina mazei S-6 cells

    DEFF Research Database (Denmark)

    Lange, Marianne; Tolker-Nielsen, Tim; Molin, Søren

    2000-01-01

    An in situ reverse transcription-PCR protocol for detecting specific mRNA in Methanosarcina mazei S-6 is described. This method allowed us to detect heat shock-induced increases in the intracellular levels of the transcript of the universal stress gene dnaK. The cell walls of paraformaldehyde...

  12. Multiplex, Quantitative, Reverse Transcription PCR Detection of Influenza Viruses Using Droplet Microfluidic Technology

    Directory of Open Access Journals (Sweden)

    Ravi Prakash

    2014-12-01

    Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.

  13. Development of a PCR-RFLP method based on the transcription elongation factor 1-α gene to differentiate Fusarium graminearum from other species within the Fusarium graminearum species complex.

    Science.gov (United States)

    Garmendia, Gabriela; Umpierrez-Failache, Mariana; Ward, Todd J; Vero, Silvana

    2018-04-01

    Fusarium head blight (FHB) is a destructive disease of cereals crops worldwide and a major food safety concern due to grain contamination with trichothecenes and other mycotoxins. Fusarium graminearum, a member of the Fusarium graminearum species complex (FGSC) is the dominant FHB pathogen in many parts of the world. However, a number of other Fusarium species, including other members of the FGSC, may also be present for example in Argentina, New Zealand, Ethiopia, Nepal, Unites States in cereals such as wheat and barley. Proper species identification is critical to research aimed at improving disease and mycotoxin control programs. Identification of Fusarium species is are often unreliable by traditional, as many species are morphologically cryptic. DNA sequence-based methods offer a reliable means of species identification, but can be expensive when applied to the analyses of population samples. To facilitate identification of the major causative agent of FHB, this work describes an easy and inexpensive method to differentiate F. graminearum from the remaining species within the FGSC and from the other common Fusarium species causing FHB in cereals. The developed method is based on a PCR-RFLP of the transcription elongation factor (TEF 1-α) gene using the restriction enzyme BsaHI. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Redman Julia C

    2008-07-01

    Full Text Available Abstract Background Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs, which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants. Results We established a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes. Conclusion High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.

  15. Normalization of Reverse Transcription Quantitative PCR Data During Ageing in Distinct Cerebral Structures.

    Science.gov (United States)

    Bruckert, G; Vivien, D; Docagne, F; Roussel, B D

    2016-04-01

    Reverse transcription quantitative-polymerase chain reaction (RT-qPCR) has become a routine method in many laboratories. Normalization of data from experimental conditions is critical for data processing and is usually achieved by the use of a single reference gene. Nevertheless, as pointed by the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines, several reference genes should be used for reliable normalization. Ageing is a physiological process that results in a decline of many expressed genes. Reliable normalization of RT-qPCR data becomes crucial when studying ageing. Here, we propose a RT-qPCR study from four mouse brain regions (cortex, hippocampus, striatum and cerebellum) at different ages (from 8 weeks to 22 months) in which we studied the expression of nine commonly used reference genes. With the use of two different algorithms, we found that all brain structures need at least two genes for a good normalization step. We propose specific pairs of gene for efficient data normalization in the four brain regions studied. These results underline the importance of reliable reference genes for specific brain regions in ageing.

  16. Improved Detection of Lassa Virus by Reverse Transcription-PCR Targeting the 5′ Region of S RNA▿

    OpenAIRE

    Ölschläger, Stephan; Lelke, Michaela; Emmerich, Petra; Panning, Marcus; Drosten, Christian; Hass, Meike; Asogun, Danny; Ehichioya, Deborah; Omilabu, Sunday; Günther, Stephan

    2010-01-01

    The method of choice for the detection of Lassa virus is reverse transcription (RT)-PCR. However, the high degree of genetic variability of the virus poses a problem with the design of RT-PCR assays that will reliably detect all strains. Recently, we encountered difficulties in detecting some strains from Liberia and Nigeria in a commonly used glycoprotein precursor (GPC) gene-specific RT-PCR assay (A. H. Demby, J. Chamberlain, D. W. Brown, and C. S. Clegg, J. Clin. Microbiol. 32:2898-2903, 1...

  17. Real-time PCR analysis of carbon catabolite repression of cellobiose gene transcription in Trametes versicolor

    Energy Technology Data Exchange (ETDEWEB)

    Stapleton, P. C.; O' Mahoney, J.; Dobson, A. D. W. [National University of Ireland, Microbiology Department, Cork (Ireland)

    2004-02-01

    Previous reports indicate that in white rot fungi such as Trametes versicolor, the production of cellobiose dehydrogenase (CDH), an extracellular haemo-flavo-enzyme, is subject to carbon catabolite repression by both glucose and maltose, and that the repression is mediated at the transcriptional level. This paper describes the results of an investigation of CDH gene transcription in cellulolytic cultures of T. versicolor, in the presence of other additional carbon sources such as glucose, arabinose, and xylose. Using real time polymerase chain reaction (RT-PCR) assay methods in the presence of these other additional carbon sources, the levels of repression observed are quantitatively determined in an effort to obtain more accurate measurements of carbon catabolite repression of CDH production in this ligninolytic fungus. Ninety-six hours after addition, results of the analysis showed reduction in CDH transcript levels of 19-fold for galactose, 92-fold for arabinose and 114-fold for xylose. The greatest repressive effect was exhibited by glucose. In this case the reduction in CDH transcript levels was 3400-fold. CDH plays an important role in lignin degradation, and there is also substantial interest in the biotechnological applications of CDH, most particularly in the pulp and paper industry. 24 refs., 4 figs.

  18. Design and Optimization of Reverse-Transcription Quantitative PCR Experiments

    Czech Academy of Sciences Publication Activity Database

    Tichopád, A.; Kitchen, R.; Riedmaier, I.; Becker, Ch.; Ståhlberg, A.; Kubista, Mikael

    2009-01-01

    Roč. 55, č. 10 (2009), s. 1816-1823 ISSN 0009-9147 Institutional research plan: CEZ:AV0Z50520701 Keywords : Design * optimization * RT qPCR Subject RIV: EG - Zoology Impact factor: 6.263, year: 2009

  19. Reliable gene expression analysis by reverse transcription-quantitative PCR: reporting and minimizing the uncertainty in data accuracy.

    Science.gov (United States)

    Remans, Tony; Keunen, Els; Bex, Geert Jan; Smeets, Karen; Vangronsveld, Jaco; Cuypers, Ann

    2014-10-01

    Reverse transcription-quantitative PCR (RT-qPCR) has been widely adopted to measure differences in mRNA levels; however, biological and technical variation strongly affects the accuracy of the reported differences. RT-qPCR specialists have warned that, unless researchers minimize this variability, they may report inaccurate differences and draw incorrect biological conclusions. The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines describe procedures for conducting and reporting RT-qPCR experiments. The MIQE guidelines enable others to judge the reliability of reported results; however, a recent literature survey found low adherence to these guidelines. Additionally, even experiments that use appropriate procedures remain subject to individual variation that statistical methods cannot correct. For example, since ideal reference genes do not exist, the widely used method of normalizing RT-qPCR data to reference genes generates background noise that affects the accuracy of measured changes in mRNA levels. However, current RT-qPCR data reporting styles ignore this source of variation. In this commentary, we direct researchers to appropriate procedures, outline a method to present the remaining uncertainty in data accuracy, and propose an intuitive way to select reference genes to minimize uncertainty. Reporting the uncertainty in data accuracy also serves for quality assessment, enabling researchers and peer reviewers to confidently evaluate the reliability of gene expression data. © 2014 American Society of Plant Biologists. All rights reserved.

  20. Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR.

    Science.gov (United States)

    Tatti, Enrico; McKew, Boyd A; Whitby, Corrine; Smith, Cindy J

    2016-06-11

    Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

  1. EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR

    Science.gov (United States)

    EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. The viral ribonucleic acid (RNA) from water sample concentrates is extracted and tested for enterovirus and norovirus RNA using reverse transcription-quantitative PCR (RT-qPCR). V...

  2. Simultaneous Detection of Four Foodborne Viruses in Food Samples Using a One-Step Multiplex Reverse Transcription PCR.

    Science.gov (United States)

    Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong

    2018-02-28

    A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.

  3. Polymerase chain reaction methods (PCR in agrobiotechnology

    Directory of Open Access Journals (Sweden)

    Taški-Ajduković Ksenija

    2006-01-01

    Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  4. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

    Directory of Open Access Journals (Sweden)

    Lee Yeon-Su

    2010-05-01

    Full Text Available Abstract Background Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. Methods We assessed the suitability of six possible reference genes, beta-actin (ACTB, glyceraldehydes-3-phosphate dehydrogenase (GAPDH, hypoxanthine phosphoribosyl transferase 1 (HPRT1, beta-2-microglobulin (B2M, ribosomal subunit L29 (RPL29 and 18S ribosomal RNA (18S rRNA in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. Results This RT-qPCR study showed that there are statistically significant (p Conclusion This study validated RPL29 and RPL29-B2M as the best single reference genes and combination, for RT-qPCR analysis of 'all stomach tissues', and B2M and B2M-GAPDH as the best single reference gene and combination, for 'stomach cancer cell lines'. Use of these validated reference genes should provide more exact interpretation of differential gene expressions at transcription level in stomach cancer.

  5. PCR

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  6. Novel reference genes for quantifying transcriptional responses of Escherichia coli to protein overexpression by quantitative PCR

    Directory of Open Access Journals (Sweden)

    Zou Ruiyang

    2011-04-01

    Full Text Available Abstract Background Accurate interpretation of quantitative PCR (qPCR data requires normalization using constitutively expressed reference genes. Ribosomal RNA is often used as a reference gene for transcriptional studies in E. coli. However, the choice of reliable reference genes has not been systematically validated. The objective of this study is to identify a set of reliable reference genes for transcription analysis in recombinant protein over-expression studies in E. coli. Results In this study, the meta-analysis of 240 sets of single-channel Affymetrix microarray data representing over-expressions of 63 distinct recombinant proteins in various E. coli strains identified twenty candidate reference genes that were stably expressed across all conditions. The expression of these twenty genes and two commonly used reference genes, rrsA encoding ribosomal RNA 16S and ihfB, was quantified by qPCR in E. coli cells over-expressing four genes of the 1-Deoxy-D-Xylulose 5-Phosphate pathway. From these results, two independent statistical algorithms identified three novel reference genes cysG, hcaT, and idnT but not rrsA and ihfB as highly invariant in two E. coli strains, across different growth temperatures and induction conditions. Transcriptomic data normalized by the geometric average of these three genes demonstrated that genes of the lycopene synthetic pathway maintained steady expression upon enzyme overexpression. In contrast, the use of rrsA or ihfB as reference genes led to the mis-interpretation that lycopene pathway genes were regulated during enzyme over-expression. Conclusion This study identified cysG/hcaT/idnT to be reliable novel reference genes for transcription analysis in recombinant protein producing E. coli.

  7. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  8. Laboratory evaluation of a quantitative real-time reverse transcription PCR assay for the detection and identification of the four subgroups of avian metapneumovirus.

    Science.gov (United States)

    Guionie, O; Toquin, D; Sellal, E; Bouley, S; Zwingelstein, F; Allée, C; Bougeard, S; Lemière, S; Eterradossi, N

    2007-02-01

    Avian metapneumovirus (AMPV) is an important pathogen causing respiratory diseases and egg drops in several avian species. Four AMPV subgroups have been identified. The laboratory diagnosis of AMPV infections relies on serological methods, on labour-intensive virus isolation procedures, and on recently developed subgroup specific reverse transcription PCR (RT-PCR) protocols. In the present study, both the specificity and sensitivity of a commercial real-time reverse transcription PCR (RRT-PCR) for the detection and identification of the four AMPV subgroups were evaluated. Fifteen non-AMPV avian viruses belonging to 7 genera and 32 AMPV belonging to the 4 subgroups were tested. No non-AMPV virus was detected, whereas all AMPV viruses were identified in agreement with their previous molecular and antigenic subgroup assignment. The sensitivity and quantitating ability of the RRT-PCR assay were determined using serial dilutions of RNA derived either from AMPV virus stocks or from runoff transcripts. In all cases, linear dose/responses were observed. The detection limits of the different subgroups ranged from 500 to 5000 RNA copies and from 0.03 to 3.16TCID50/ml. The results were reproducible under laboratory conditions, thus showing that quantitative RRT-PCR is a new and powerful tool for the rapid and sensitive detection, identification and quantitation of AMPVs.

  9. Comparison of Nested-PCR technique and culture method in ...

    African Journals Online (AJOL)

    USER

    2010-04-05

    Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.

  10. Blood grouping based on PCR methods and agarose gel electrophoresis.

    Science.gov (United States)

    Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2015-01-01

    The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

  11. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  12. Detection of hepatitis A virus in shellfish by nested reverse transcription-PCR

    NARCIS (Netherlands)

    Croci, L.; Medici, de D.; Morace, G.; Fiore, A.; Scalfaro, C.; Beneduce, F.; Toti, L.

    1999-01-01

    A method for the detection of HAV in shellfish, based on the use of guanidinium isothiocyanate-contg. soln. for RNA extn. and purifn. steps, followed by nested PCR, is hereby proposed. Tests were carried out on mollusc samples spiked with HAV strain FG. Results showed that in samples subjected only

  13. [Optimized application of nested PCR method for detection of malaria].

    Science.gov (United States)

    Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

    2017-04-28

    Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

  14. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

    International Nuclear Information System (INIS)

    Rho, Hyun-Wook; Lee, Byoung-Chan; Choi, Eun-Seok; Choi, Il-Ju; Lee, Yeon-Su; Goh, Sung-Ho

    2010-01-01

    Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. We assessed the suitability of six possible reference genes, beta-actin (ACTB), glyceraldehydes-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyl transferase 1 (HPRT1), beta-2-microglobulin (B2M), ribosomal subunit L29 (RPL29) and 18S ribosomal RNA (18S rRNA) in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. This RT-qPCR study showed that there are statistically significant (p < 0.05) differences in the expression levels of HPRT1 and 18S rRNA in 'normal-' versus 'tumor stomach tissues'. The stability analyses by geNorm suggest B2M-GAPDH, as best reference gene combination for 'stomach cancer cell lines'; RPL29-HPRT1, for 'all stomach tissues'; and ACTB-18S rRNA, for 'all stomach cell lines and tissues'. NormFinder also identified B2M as the best reference gene for 'stomach cancer cell lines', RPL29-B2M for 'all stomach tissues', and 18S rRNA-ACTB for 'all stomach cell lines and tissues'. The comparisons of normalized expression of the target gene, GPNMB, showed different interpretation of target gene expression depend on best single reference gene or combination. This study validated RPL29 and RPL29-B2M as the best single reference

  15. Application of anti-listerial bacteriocins: monitoring enterocin expression by multiplex relative reverse transcription-PCR.

    Science.gov (United States)

    Williams, D Ross; Chanos, Panagiotis

    2012-12-01

    Listeriosis is a deadly food-borne disease, and its incidence may be limited through the biotechnological exploitation of a number of anti-listerial biocontrol agents. The most widely used of these agents are bacteriocins and the Class II enterocins are characterized by their activity against Listeria. Enterocins are primarily produced by enterococci, particularly Enterococcus faecium and many strains have been described, often encoding multiple bacteriocins. The use of these strains in food will require that they are free of virulence functions and that they exhibit a high level expression of anti-listerial enterocins in fermentation conditions. Multiplex relative RT (reverse transcription)-PCR is a technique that is useful in the discovery of advantageous expression characteristics among enterocin-producing strains. It allows the levels of individual enterocin gene expression to be monitored and determination of how expression is altered under different growth conditions.

  16. Automated PCR setup for forensic casework samples using the Normalization Wizard and PCR Setup robotic methods.

    Science.gov (United States)

    Greenspoon, S A; Sykes, K L V; Ban, J D; Pollard, A; Baisden, M; Farr, M; Graham, N; Collins, B L; Green, M M; Christenson, C C

    2006-12-20

    Human genome, pharmaceutical and research laboratories have long enjoyed the application of robotics to performing repetitive laboratory tasks. However, the utilization of robotics in forensic laboratories for processing casework samples is relatively new and poses particular challenges. Since the quantity and quality (a mixture versus a single source sample, the level of degradation, the presence of PCR inhibitors) of the DNA contained within a casework sample is unknown, particular attention must be paid to procedural susceptibility to contamination, as well as DNA yield, especially as it pertains to samples with little biological material. The Virginia Department of Forensic Science (VDFS) has successfully automated forensic casework DNA extraction utilizing the DNA IQ(trade mark) System in conjunction with the Biomek 2000 Automation Workstation. Human DNA quantitation is also performed in a near complete automated fashion utilizing the AluQuant Human DNA Quantitation System and the Biomek 2000 Automation Workstation. Recently, the PCR setup for casework samples has been automated, employing the Biomek 2000 Automation Workstation and Normalization Wizard, Genetic Identity version, which utilizes the quantitation data, imported into the software, to create a customized automated method for DNA dilution, unique to that plate of DNA samples. The PCR Setup software method, used in conjunction with the Normalization Wizard method and written for the Biomek 2000, functions to mix the diluted DNA samples, transfer the PCR master mix, and transfer the diluted DNA samples to PCR amplification tubes. Once the process is complete, the DNA extracts, still on the deck of the robot in PCR amplification strip tubes, are transferred to pre-labeled 1.5 mL tubes for long-term storage using an automated method. The automation of these steps in the process of forensic DNA casework analysis has been accomplished by performing extensive optimization, validation and testing of the

  17. PCR IN TRAUMATOLOGY AND ORTHOPAEDICS: METHOD DESCRIPTION AND APPLICABILITY

    Directory of Open Access Journals (Sweden)

    E. M. Polyakova

    2014-01-01

    Full Text Available Review brief presents description of polymerase chain reaction method (PCR and its most common variants. Three PCR-based lines of research, carried out in the traumatology and orthopaedics, include identifying a causative agents of the implant-associated infection after orthopaedic surgery; detection of antibiotic resistance genes and biofilm forming genes. It was shown that PCR can be used as additional method for detection of genetic disorders, significant for traumatology and orthopaedics, and for investigation of cartilage and bone regeneration.

  18. Detection of Tilapia Lake Virus in Clinical Samples by Culturing and Nested Reverse Transcription-PCR.

    Science.gov (United States)

    Kembou Tsofack, Japhette Esther; Zamostiano, Rachel; Watted, Salsabeel; Berkowitz, Asaf; Rosenbluth, Ezra; Mishra, Nischay; Briese, Thomas; Lipkin, W Ian; Kabuusu, Richard M; Ferguson, Hugh; Del Pozo, Jorge; Eldar, Avi; Bacharach, Eran

    2017-03-01

    Tilapia are an important group of farmed fish that serve as a significant protein source worldwide. In recent years, substantial mortality of wild tilapia has been observed in the Sea of Galilee and in commercial ponds in Israel and Ecuador. We have identified the etiological agent of these mass die-offs as a novel orthomyxo-like virus and named it tilapia lake virus (TiLV). Here, we provide the conditions for efficient isolation, culturing, and quantification of the virus, including the use of susceptible fish cell lines. Moreover, we describe a sensitive nested reverse transcription-PCR (RT-PCR) assay allowing the rapid detection of TiLV in fish organs. This assay revealed, for the first time to our knowledge, the presence of TiLV in diseased Colombian tilapia, indicating a wider distribution of this emerging pathogen and stressing the risk that TiLV poses for the global tilapia industry. Overall, the described procedures should provide the tilapia aquaculture industry with important tools for the detection and containment of this pathogen. Copyright © 2017 American Society for Microbiology.

  19. Detection of Tilapia Lake Virus in Clinical Samples by Culturing and Nested Reverse Transcription-PCR

    Science.gov (United States)

    Kembou Tsofack, Japhette Esther; Zamostiano, Rachel; Watted, Salsabeel; Berkowitz, Asaf; Rosenbluth, Ezra; Mishra, Nischay; Briese, Thomas; Lipkin, W. Ian; Kabuusu, Richard M.; Ferguson, Hugh; del Pozo, Jorge

    2016-01-01

    ABSTRACT Tilapia are an important group of farmed fish that serve as a significant protein source worldwide. In recent years, substantial mortality of wild tilapia has been observed in the Sea of Galilee and in commercial ponds in Israel and Ecuador. We have identified the etiological agent of these mass die-offs as a novel orthomyxo-like virus and named it tilapia lake virus (TiLV). Here, we provide the conditions for efficient isolation, culturing, and quantification of the virus, including the use of susceptible fish cell lines. Moreover, we describe a sensitive nested reverse transcription-PCR (RT-PCR) assay allowing the rapid detection of TiLV in fish organs. This assay revealed, for the first time to our knowledge, the presence of TiLV in diseased Colombian tilapia, indicating a wider distribution of this emerging pathogen and stressing the risk that TiLV poses for the global tilapia industry. Overall, the described procedures should provide the tilapia aquaculture industry with important tools for the detection and containment of this pathogen. PMID:27974544

  20. Method 1615 RT-qPCR data

    Data.gov (United States)

    U.S. Environmental Protection Agency — EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. The viral ribonucleic acid (RNA) from water sample concentrates...

  1. [A new method of processing quantitative PCR data].

    Science.gov (United States)

    Ke, Bing-Shen; Li, Guang-Yun; Chen, Shi-Min; Huang, Xiang-Yan; Chen, Ying-Jian; Xu, Jun

    2003-05-01

    Today standard PCR can't satisfy the need of biotechnique development and clinical research any more. After numerous dynamic research, PE company found there is a linear relation between initial template number and cycling time when the accumulating fluorescent product is detectable.Therefore,they developed a quantitative PCR technique to be used in PE7700 and PE5700. But the error of this technique is too great to satisfy the need of biotechnique development and clinical research. A better quantitative PCR technique is needed. The mathematical model submitted here is combined with the achievement of relative science,and based on the PCR principle and careful analysis of molecular relationship of main members in PCR reaction system. This model describes the function relation between product quantity or fluorescence intensity and initial template number and other reaction conditions, and can reflect the accumulating rule of PCR product molecule accurately. Accurate quantitative PCR analysis can be made use this function relation. Accumulated PCR product quantity can be obtained from initial template number. Using this model to do quantitative PCR analysis,result error is only related to the accuracy of fluorescence intensity or the instrument used. For an example, when the fluorescence intensity is accurate to 6 digits and the template size is between 100 to 1,000,000, the quantitative result accuracy will be more than 99%. The difference of result error is distinct using same condition,same instrument but different analysis method. Moreover,if the PCR quantitative analysis system is used to process data, it will get result 80 times of accuracy than using CT method.

  2. Simultaneous detection of four garlic viruses by multiplex reverse transcription PCR and their distribution in Indian garlic accessions.

    Science.gov (United States)

    Majumder, S; Baranwal, V K

    2014-06-01

    Indian garlic is infected with Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV), Garlic common latent virus (GarCLV) and allexiviruses. Identity and distribution of garlic viruses in various garlic accessions from different geographical regions of India were investigated. OYDV and allexiviruses were observed in all the garlic accessions, while SLV and GarCLV were observed only in a few accessions. A multiplex reverse transcription (RT)-PCR method was developed for the simultaneous detection and identification of OYDV, SLV, GarCLV and Allexivirus infecting garlic accessions in India. This multiplex protocol standardized in this study will be useful in indexing of garlic viruses and production of virus free seed material. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. DNA extraction method for PCR in mycorrhizal fungi.

    Science.gov (United States)

    Manian, S; Sreenivasaprasad, S; Mills, P R

    2001-10-01

    To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

  4. Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR.

    Science.gov (United States)

    Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S

    2018-01-01

    The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. External Quality Assessment for the Detection of Measles Virus by Reverse Transcription-PCR Using Armored RNA.

    Directory of Open Access Journals (Sweden)

    Dong Zhang

    Full Text Available In recent years, nucleic acid tests for detection of measles virus RNA have been widely applied in laboratories belonging to the measles surveillance system of China. An external quality assessment program was established by the National Center for Clinical Laboratories to evaluate the performance of nucleic acid tests for measles virus. The external quality assessment panel, which consisted of 10 specimens, was prepared using armored RNAs, complex of noninfectious MS2 bacteriophage coat proteins encapsulated RNA of measles virus, as measles virus surrogate controls. Conserved sequences amplified from a circulating measles virus strain or from a vaccine strain were encapsulated into these armored RNAs. Forty-one participating laboratories from 15 provinces, municipalities, or autonomous regions that currently conduct molecular detection of measles virus enrolled in the external quality assessment program, including 40 measles surveillance system laboratories and one diagnostic reagent manufacturer. Forty laboratories used commercial reverse transcription-quantitative PCR kits, with only one laboratory applying a conventional PCR method developed in-house. The results indicated that most of the participants (38/41, 92.7% were able to accurately detect the panel with 100% sensitivity and 100% specificity. Although a wide range of commercially available kits for nucleic acid extraction and reverse transcription polymerase chain reaction were used by the participants, only two false-negative results and one false-positive result were generated; these were generated by three separate laboratories. Both false-negative results were obtained with tests performed on specimens with the lowest concentration (1.2 × 104 genomic equivalents/mL. In addition, all 18 participants from Beijing achieved 100% sensitivity and 100% specificity. Overall, we conclude that the majority of the laboratories evaluated have reliable diagnostic capacities for the detection

  6. Method to determine transcriptional regulation pathways in organisms

    Science.gov (United States)

    Gardner, Timothy S.; Collins, James J.; Hayete, Boris; Faith, Jeremiah

    2012-11-06

    The invention relates to computer-implemented methods and systems for identifying regulatory relationships between expressed regulating polypeptides and targets of the regulatory activities of such regulating polypeptides. More specifically, the invention provides a new method for identifying regulatory dependencies between biochemical species in a cell. In particular embodiments, provided are computer-implemented methods for identifying a regulatory interaction between a transcription factor and a gene target of the transcription factor, or between a transcription factor and a set of gene targets of the transcription factor. Further provided are genome-scale methods for predicting regulatory interactions between a set of transcription factors and a corresponding set of transcriptional target substrates thereof.

  7. Typing of Y chromosome SNPs with multiplex PCR methods

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels

    2005-01-01

    We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....

  8. Outbreak of hepatitis E virus infection in Darfur, Sudan: effectiveness of real-time reverse transcription-PCR analysis of dried blood spots.

    Science.gov (United States)

    Mérens, Audrey; Guérin, Philippe Jean; Guthmann, Jean-Paul; Nicand, Elisabeth

    2009-06-01

    Biological samples collected in refugee camps during an outbreak of hepatitis E were used to compare the accuracy of hepatitis E virus RNA amplification by real-time reverse transcription-PCR (RT-PCR) for sera and dried blood spots (concordance of 90.6%). Biological profiles (RT-PCR and serology) of asymptomatic individuals were also analyzed.

  9. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com

    2009-07-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  10. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    International Nuclear Information System (INIS)

    Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.

    2009-01-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  11. Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

    Science.gov (United States)

    Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

    2016-09-01

    Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Evaluation of a duplex reverse-transcription real-time PCR assay for the detection of encephalomyocarditis virus.

    Science.gov (United States)

    Qin, Shaomin; Underwood, Darren; Driver, Luke; Kistler, Carol; Diallo, Ibrahim; Kirkland, Peter D

    2018-06-01

    We evaluated a fluorogenic probe-based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21-4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.

  13. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  14. The identification of point mutations in Duchenne muscular dystrophy patients by using reverse-transcription PCR and the protein truncation test

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, R.J.; Bobrow, M.; Roberts, R.G. [St. Thomas`s Hospitals, London (United Kingdom)

    1995-08-01

    The protein truncation test (PTT) is a mutation-detection method that monitors the integrity of the open reading frame (ORF). More than 60% of cases of Duchenne muscular dystrophy (DMD) result from gross frameshifting deletions in the dystrophin gene that are detectable by multiplex PCR system. It has become apparent that virtually all of the remaining DMD mutations also disrupt the translational reading frame, making the PTT a logical next step toward a comprehensive strategy for the identification of all DMD mutations. We report here a pilot study involving 22 patients and describe the mutations characterized. These constitute 12 point mutations or small insertions/deletions and 4 gross rearrangements. We also have a remaining five patients in whom there does not appear to be mutation in the ORF. We believe that reverse-transcription-PCR/PTT is an efficient method by which to screen for small mutations in DMD patients with no deletion. 29 refs., 2 figs., 3 tabs.

  15. Methods for microbial DNA extraction from soil for PCR amplification

    Directory of Open Access Journals (Sweden)

    Yeates C

    1998-01-01

    Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

  16. Field-Deployable Reverse Transcription-Insulated Isothermal PCR (RT-iiPCR) Assay for Rapid and Sensitive Detection of Foot-and-Mouth Disease Virus.

    Science.gov (United States)

    Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O

    2017-10-01

    Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT ™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco ™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.

  17. Improved Safety for Molecular Diagnosis of Classical Rabies Viruses by Use of a TaqMan Real-Time Reverse Transcription-PCR "Double Check" Strategy

    DEFF Research Database (Denmark)

    Hoffmann, B.; Freuling, C. M.; Wakeley, P. R.

    2010-01-01

    To improve the diagnosis of classical rabies virus with molecular methods, a validated, ready-to-use, real-time reverse transcription-PCR (RT-PCR) assay was developed. In a first step, primers and 6-carboxyfluorescien-labeled TaqMan probes specific for rabies virus were selected from the consensus...... sequence of the nucleoprotein gene of 203 different rabies virus sequences derived from GenBank. The selected primer-probe combination was highly specific and sensitive. During validation using a sample set of rabies virus strains from the virus archives of the Friedrich-Loeffler-Institut (FLI; Germany......), the Veterinary Laboratories Agency (VLA; United Kingdom), and the DTU National Veterinary Institute (Lindholm, Denmark), covering the global diversity of rabies virus lineages, it was shown that both the newly developed assay and a previously described one had some detection failures. This was overcome...

  18. COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS

    Directory of Open Access Journals (Sweden)

    Tülin GÜVEN GÖKMEN

    Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.

  19. Reference genes for reverse transcription quantitative PCR in canine brain tissue

    NARCIS (Netherlands)

    Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C

    2015-01-01

    BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and

  20. Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

    Science.gov (United States)

    Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

    2013-12-01

    Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Development and validation of quantitative PCR assays to measure cytokine transcript levels in the Florida manatee (Trichechus manatus latirostris)

    Science.gov (United States)

    Ferrante, Jason; Hunter, Margaret; Wellehan, James F.X.

    2018-01-01

    Cytokines have important roles in the mammalian response to viral and bacterial infections, trauma, and wound healing. Because of early cytokine production after physiologic stresses, the regulation of messenger RNA (mRNA) transcripts can be used to assess immunologic responses before changes in protein production. To detect and assess early immune changes in endangered Florida manatees (Trichechus manatus latirostris), we developed and validated a panel of quantitative PCR assays to measure mRNA transcription levels for the cytokines interferon (IFN)-γ; interleukin (IL)-2, -6, and -10; tumor necrosis factor-α, and the housekeeping genes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (reference genes). Assays were successfully validated using blood samples from free-ranging, apparently healthy manatees from the east and west coasts of central Florida. No cytokine or housekeeping gene transcription levels were significantly different among age classes or sexes. However, the transcription levels for GAPDH, IL-2, IL-6, and IFN-γ were significantly higher (Puse as a reference gene in future studies. Our assays can aid in the investigation of manatee immune response to physical trauma and novel or ongoing environmental stressors.

  2. A multiplex PCR method for rapid identification of Brachionus rotifers.

    Science.gov (United States)

    Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

    2009-01-01

    Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

  3. Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

    International Nuclear Information System (INIS)

    Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

    1995-01-01

    Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

  4. Selection and evaluation of potential reference genes for gene expression analysis in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae using reverse-transcription quantitative PCR.

    Directory of Open Access Journals (Sweden)

    Miao Yuan

    Full Text Available The brown planthopper (BPH, Nilaparvata lugens (Hemiptera, Delphacidae, is one of the most important rice pests. Abundant genetic studies on BPH have been conducted using reverse-transcription quantitative real-time PCR (qRT-PCR. Using qRT-PCR, the expression levels of target genes are calculated on the basis of endogenous controls. These genes need to be appropriately selected by experimentally assessing whether they are stably expressed under different conditions. However, such studies on potential reference genes in N. lugens are lacking. In this paper, we presented a systematic exploration of eight candidate reference genes in N. lugens, namely, actin 1 (ACT, muscle actin (MACT, ribosomal protein S11 (RPS11, ribosomal protein S15e (RPS15, alpha 2-tubulin (TUB, elongation factor 1 delta (EF, 18S ribosomal RNA (18S, and arginine kinase (AK and used four alternative methods (BestKeeper, geNorm, NormFinder, and the delta Ct method to evaluate the suitability of these genes as endogenous controls. We examined their expression levels among different experimental factors (developmental stage, body part, geographic population, temperature variation, pesticide exposure, diet change, and starvation following the MIQE (Minimum Information for publication of Quantitative real time PCR Experiments guidelines. Based on the results of RefFinder, which integrates four currently available major software programs to compare and rank the tested candidate reference genes, RPS15, RPS11, and TUB were found to be the most suitable reference genes in different developmental stages, body parts, and geographic populations, respectively. RPS15 was the most suitable gene under different temperature and diet conditions, while RPS11 was the most suitable gene under different pesticide exposure and starvation conditions. This work sheds light on establishing a standardized qRT-PCR procedure in N. lugens, and serves as a starting point for screening for reference genes for

  5. A Novel PCR Assay for Listeria welshimeri Targeting Transcriptional Regulator Gene lwe1801

    Science.gov (United States)

    Transcriptional regulator genes encode a group of specialized molecules that play essential roles in microbial responses to changing external conditions. These genes have been shown to possess species or group specificity and are useful as detection targets for diagnostic application. The present st...

  6. Detection of Canine Distemper Virus Nucleoprotein RNA by Reverse Transcription-PCR Using Serum, Whole Blood, and Cerebrospinal Fluid from Dogs with Distemper

    Science.gov (United States)

    Frisk, A. L.; König, M.; Moritz, A.; Baumgärtner, W.

    1999-01-01

    Reverse transcription-PCR (RT-PCR) was used to detect canine distemper virus (CDV) nucleoprotein (NP) RNA in serum, whole blood, and cerebrospinal fluid (CSF) samples from 38 dogs with clinically suspected distemper. Results were correlated to clinical findings, anti-CDV neutralizing antibody titers, postmortem findings, and demonstration of CDV NP antigen by immunohistochemistry. The specificity of the RT-PCR was ensured by amplification of RNA from various laboratory CDV strains, restriction enzyme digestion, and Southern blot hybridization. In 29 of 38 dogs, CDV infection was confirmed by postmortem examination and immunohistochemistry. The animals displayed the catarrhal, systemic, and nervous forms of distemper. Seventeen samples (serum, whole blood, or CSF) from dogs with distemper were tested with three sets of primers targeted to different regions of the NP gene of the CDV Onderstepoort strain. Expected amplicons were observed in 82, 53, and 41% of the 17 samples, depending upon the primer pair used. With the most sensitive primer pair (primer pair I), CDV NP RNA was detected in 25 of 29 (86%) serum samples and 14 of 16 (88%) whole blood and CSF samples from dogs with distemper but not in body fluids from immunohistochemically negative dogs. Nucleotide sequence analysis of five RT-PCR amplicons from isolates from the field revealed few silent point mutations. These isolates exhibited greater homology to the Rockborn (97 to 99%) than to the Onderstepoort (95 to 96%) CDV strain. In summary, although the sensitivity of the RT-PCR for detection of CDV is strongly influenced by the location of the selected primers, this nucleic acid detection system represents a highly specific and sensitive method for the antemortem diagnosis of distemper in dogs, regardless of the form of distemper, humoral immune response, and viral antigen distribution. PMID:10523566

  7. A sensitive, reproducible, and economic real-time reverse transcription PCR detecting avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Franzo, G; Drigo, M; Lupini, C; Catelli, E; Laconi, A; Listorti, V; Bonci, M; Naylor, C J; Martini, M; Cecchinato, M

    2014-06-01

    Use of real-time PCR is increasing in the diagnosis of infectious disease due to its sensitivity, specificity, and speed of detection. These characteristics make it particularly suited for the diagnosis of viral infections, like avian metapneumovirus (AMPV), for which effective control benefits from continuously updated knowledge of the epidemiological situation. Other real-time reverse transcription (RT)-PCRs have been published based on highly specific fluorescent dye-labeled probes, but they have high initial cost, complex validation, and a marked susceptibility to the genetic variability of their target sequence. With this in mind, we developed and validated a SYBR Green I-based quantitative RT-PCR for the detection of the two most prevalent AMPV subtypes (i.e., subtypes A and B). The assay demonstrated an analytical sensitivity comparable with that of a previously published real-time RT-PCR and the ability to detect RNA equivalent to approximately 0.5 infectious doses for both A and B subtypes. The high efficiency and linearity between viral titer and crossing point displayed for both subtypes make it suited for viral quantification. Optimization of reaction conditions and the implementation of melting curve analysis guaranteed the high specificity of the assay. The stable melting temperature difference between the two subtypes indicated the possibility of subtyping through melting temperature analysis. These characteristics make our assay a sensitive, specific, and rapid tool, enabling contemporaneous detection, quantification, and discrimination of AMPV subtype A and B.

  8. Detection of live Salmonella enterica in fresh-cut vegetables by a TaqMan-based one-step reverse transcription real-time PCR.

    Science.gov (United States)

    Miao, Y J; Xiong, G T; Bai, M Y; Ge, Y; Wu, Z F

    2018-05-01

    Fresh-cut produce is at greater risk of Salmonella contamination. Detection and early warning systems play an important role in reducing the dissemination of contaminated products. One-step Reverse Transcription Polymerase Chain Reaction (RT-qPCR) targeting Salmonella tmRNA with or without a 6-h enrichment was evaluated for the detection of Salmonella in fresh-cut vegetables after 6-h storage. LOD of one-step RT-qPCR was 1·0 CFU per ml (about 100 copies tmRNA per ml) by assessed 10-fold serially diluted RNA from 10 6 CFU per ml bacteria culture. Then, one-step RT-qPCR assay was applied to detect viable Salmonella cells in 14 fresh-cut vegetables after 6-h storage. Without enrichment, this assay could detect 10 CFU per g for fresh-cut lettuce, cilantro, spinach, cabbage, Chinese cabbage and bell pepper, and 10 2 CFU per g for other vegetables. With a 6-h enrichment, this assay could detect 10 CFU per g for all fresh-cut vegetables used in this study. Moreover, this assay was able to discriminate viable cells from dead cells. This rapid detection assay may provide potential processing control and early warning method in fresh-cut vegetable processing to strengthen food safety assurance. Significance and Impact of the Study: Fresh-cut produce is at greater risk of Salmonella contamination. Rapid detection methods play an important role in reducing the dissemination of contaminated products. One-step RT-qPCR assay used in this study could detect 10 CFU per g Salmonella for 14 fresh-cut vegetables with a 6-h short enrichment. Moreover, this assay was able to discriminate viable cells from dead cells. This rapid detection assay may provide potential processing control and early warning method in fresh-cut vegetable processing to strengthen food safety assurance. © 2018 The Society for Applied Microbiology.

  9. A novel RT-qPCR assay for quantification of the MLL-MLLT3 fusion transcript in acute myeloid leukaemia

    DEFF Research Database (Denmark)

    Abildgaard, Lotte; Ommen, Hans Beier; Lausen, Birgitte Frederiksen

    2013-01-01

    OBJECTIVES: Patients with acute myeloid leukaemia (AML) of the monocytic lineage often lack molecular markers for minimal residual disease (MRD) monitoring. The MLL-MLLT3 fusion transcript found in patients with AML harbouring t(9;11) is amenable to RT-qPCR quantification but because...... of the heterogeneity of translocation break points, the MLL-MLLT3 fusion gene is a challenging target. We hypothesised that MRD monitoring using MLL-MLLT3 as a RT-qPCR marker is feasible in the majority of patients with t(9;11)-positive AML. METHODS: Using a locked nucleic acid probe, we developed a sensitive RT......-qPCR assay for quantification of the most common break point region of the MLL-MLLT3 fusion gene. Five paediatric patients with t(9;11)-positive AML were monitored using the MLL-MLLT3 assay. RESULTS: A total of 43 bone marrow (BM) and 52 Peripheral blood (PB) samples were collected from diagnosis until...

  10. Immunocapture reverse transcription-polymerase chain reaction combined with nested PCR greatly increases the detection of Prunus necrotic ring spot virus in the peach.

    Science.gov (United States)

    Helguera, P R; Taborda, R; Docampo, D M; Ducasse, D A

    2001-06-01

    A detection system based on nested PCR after IC-RT-PCR (IC-RT-PCR-Nested PCR) was developed to improve indexing of Prunus necrotic ringspot virus in peach trees. Inhibitory effects and inconsistencies of the standard IC-RT-PCR were overcome by this approach. IC-RT-PCR-Nested PCR improved detection by three orders of magnitude compared with DAS-ELISA for the detection of PNRSV in leaves. Several different tissues were evaluated and equally consistent results were observed. The main advantages of the method are its consistency, high sensitivity and easy application in quarantine programs.

  11. Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method

    DEFF Research Database (Denmark)

    Malorny, B.; Hoorfar, Jeffrey; Hugas, M.

    2003-01-01

    A collaborative study involving four European laboratories was conducted to investigate the diagnostic accuracy of a Salmonella specific PCR-based method, which was evaluated within the European FOOD-PCR project (http://www.pcr.dk). Each laboratory analysed by the PCR a set of independent obtained...... presumably naturally contaminated samples and compared the results with the microbiological culture method. The PCR-based method comprised a preenrichment step in buffered peptone water followed by a thermal cell lysis using a closed tube resin-based method. Artificially contaminated minced beef and whole......-based diagnostic methods and is currently proposed as international standard document....

  12. Designing multiplex PCR system of Campylobacter jejuni for efficient typing by improving monoplex PCR binary typing method.

    Science.gov (United States)

    Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro

    2015-01-01

    Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  13. Nucleic acid extraction, oligonucleotide probes and PCR methods

    International Nuclear Information System (INIS)

    Zhongtang Yu; Forster, R.J.

    2005-01-01

    Complex microbiomes of rumen and gastrointestinal tracts. Bacteria, fungi and protozoa, present in rumen and gastrointestinal (GI) tracts, interact with feed, with each other, and with their host animals, resulting in a complex symbiotic microbiota of distinctive composition and structure. Such microbiota is dynamic and highly responsive to a variety of biotic and abiotic factors, such as diet, feed additives, age, health and physiological status of the host animal, geographical locations, season and feeding regimen (reviewed in Ref. [39]). This symbiotic microbiota has been the focus of microbial research for over half a century in search for improved ruminant nutrition. Before the advent of molecular biology techniques, microorganisms in rumen and GI tracts, as in other habitats, were studied with cultivation-based techniques, which only allows for the isolation and characterization of a limited number of readily culturable species. As estimated, there are more than 400 species of bacteria and up to 100 species of protozoa and fungi inhabiting rumen and GI tracts. In human GI tracts, as much as 60% of these members cannot be isolated on agar plates and, thus, remain unknown. In ruminants, although it is not known, the culturable species of the microbiota are probably in the same range. Even among the culturable species, probably only some of them have been isolated and described. The application of cultivation-independent, more sensitive and accurate molecular techniques to the study of ruminal and GI microorganisms provided an alternative to directly examining the diversity and the community structure of ruminal and GI microbiota on the basis of genotypes, instead of phenotypes. Both polymerase chain reaction (PCR)-based methods, such as denaturing gradient gel electrophoresis (DGGE), ribosomal intergenic spacer analysis, terminal restriction fragment length polymorphism, cloning and sequencing of PCR amplicons and amplified 16S ribosomal DNA restriction

  14. A comparative study of microbial diversity and community structure in marine sediments using poly(A tailing and reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Tatsuhiko eHoshino

    2013-06-01

    Full Text Available To obtain a better understanding of metabolically active microbial communities, we tested a molecular ecological approach using poly(A tailing of environmental 16S rRNA, followed by full-length complementary DNA (cDNA synthesis and sequencing to eliminate potential biases caused by mismatching of PCR primer sequences. The RNA pool tested was extracted from marine sediments of the Yonaguni Knoll IV hydrothermal field in the southern Okinawa Trough. The sequences obtained using the ploy(A tailing method were compared statistically and phylogenetically with those obtained using conventional reverse transcription-polymerase chain reaction (RT-PCR with published domain-specific primers. Both methods indicated that Deltaproteobacteria are predominant in sediment (>85% of the total sequence read. The poly(A tailing method indicated that Desulfobacterales were the predominant deltaproteobacteria, while most of the sequences in libraries constructed using RT-PCR were derived from Desulfuromonadales. This discrepancy may have been due to low coverage of Desulfobacterales by the primers used. A comparison of library diversity indices indicated that the poly(A tailing method retrieves more phylogenetically diverse sequences from the environment. The four archaeal 16S rRNA sequences that were obtained using the poly(A tailing method formed deeply branching lineages that were related to Candidatus Parvarchaeum and the Ancient Archaeal Group. These results clearly demonstrate that poly(A tailing followed by cDNA sequencing is a powerful and less biased molecular ecological approach for the study of metabolically active microbial communities.

  15. RT-PCR Protocols - Methods in Molecular Biology

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2011-03-01

    Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

  16. Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

    DEFF Research Database (Denmark)

    Munch, M.; Nielsen, L.P.; Handberg, Kurt

    2001-01-01

    A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

  17. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  18. Evaluation of methods for oligonucleotide array data via quantitative real-time PCR.

    Science.gov (United States)

    Qin, Li-Xuan; Beyer, Richard P; Hudson, Francesca N; Linford, Nancy J; Morris, Daryl E; Kerr, Kathleen F

    2006-01-17

    There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch) and a sequence-based method of background adjustment (as in gcRMA) as the most important factors in methods' performances. However, we found poor reliability for methods using mismatch probes for low-intensity genes

  19. Evaluation of methods for oligonucleotide array data via quantitative real-time PCR

    Directory of Open Access Journals (Sweden)

    Morris Daryl E

    2006-01-01

    Full Text Available Abstract Background There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. Results We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch and a sequence-based method of background adjustment (as in gcRMA as the most important factors in methods' performances. However, we found poor reliability for methods

  20. Detection of Tumor Cell-Specific mRNA in the Peripheral Blood of Patients with Breast Cancer — Evaluation of Several Markers with Real-Time Reverse Transcription-PCR

    Directory of Open Access Journals (Sweden)

    Ulrich Andergassen

    2013-01-01

    Full Text Available It is widely known that cells from epithelial tumors, e.g., breast cancer, detach from their primary tissue and enter blood circulation. We show that the presence of circulating tumor cells (CTCs in samples of patients with primary and metastatic breast cancer can be detected with an array of selected tumor-marker-genes by reverse transcription real-time PCR. The focus of the presented work is on detecting differences in gene expression between healthy individuals and adjuvant and metastatic breast cancer patients, not an accurate quantification of these differences. Therefore, total RNA was isolated from blood samples of healthy donors and patients with primary or metastatic breast cancer after enrichment of mononuclear cells by density gradient centrifugation. After reverse transcription real-time PCR was carried out with a set of marker genes (BCSP, CK8, Her2, MGL, CK18, CK19. B2M and GAPDH were used as reference genes. Blood samples from patients with metastatic disease revealed increased cytokine gene levels in comparison to normal blood samples. Detection of a single gene was not sufficient to detect CTCs by reverse transcription real-time PCR. Markers used here were selected based on a recent study detecting cancer cells on different protein levels. The combination of such a marker array leads to higher and more specific discovery rates, predominantly in metastatic patients. Identification of CTCs by PCR methods may lead to better diagnosis and prognosis and could help to choose an adequate therapy.

  1. Evaluation of Reference Genes for Reverse Transcription Quantitative PCR Studies of Physiological Responses in the Ghost Moth, Thitarodes armoricanus (Lepidoptera, Hepialidae.

    Directory of Open Access Journals (Sweden)

    Guiqing Liu

    Full Text Available Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is the sensitive method to quantify the expression levels of target genes on the basis of endogenous control. An appropriate reference gene set for normalization is essential for reliable results. The ghost moth, Thitarodes armoricanus, a host species of a medicinal fungus, Ophiocordyceps sinensis, is an economically important member of the Lepidoptera. Recent studies have focused on the mechanism of adaptation of this species to its high-altitude environment and host immune response to O. sinensis infection and RT-qPCR is commonly used in these studies to decipher the genetic basis of physiological functions. However, a thorough assessment of candidate reference genes in the genus Thitarodes is lacking. Here, the expression levels of eight candidate reference genes (ACT, EF, EIF4A, GAPDH, G6PDH, RPL13A, TUB and 18S in T. armoricanus at different developmental stages and in different body parts of the seventh instar larvae were analyzed, along with larvae kept under low temperatures, larvae exposed to two fungal infections and larvae fed different diets. Three established software programs-Bestkeeper, geNorm and NormFinder-were employed to calculate variation among the treatments. The results revealed that the best-suited reference genes differed across the treatments, with EF, EIF4A and GAPDH found to be the best suited for the different developmental stages and larvae body parts; EF, EIF4A and RPL13A found to be the best suited for low-temperature challenge; and EF, EIF4A and TUB found to be the best suited for the fungal infections and dietary treatments. This study thus further contributes to the establishment of an accurate method for normalizing RT-qPCR results for T. armoricanus and serves as a reference for gene expression studies of related insect species.

  2. Fecal specimens preparation methods for PCR diagnosis of human taeniosis

    Directory of Open Access Journals (Sweden)

    Nunes Cáris Maroni

    2006-01-01

    Full Text Available Sample preparation and DNA extraction protocols for DNA amplification by PCR, which can be applied in human fecal samples for taeniasis diagnosis, are described. DNA extracted from fecal specimens with phenol/chloroform/isoamilic alcohol and DNAzol® reagent had to be first purified to generate fragments of 170 pb and 600 pb by HDP2-PCR. This purification step was not necessary with the use of QIAmp DNA stool mini kit®. Best DNA extraction results were achieved after eggs disruption with glass beads, either with phenol/chloroform/isoamilic alcohol, DNAzol® reagent or QIAmp DNA stool mini kit®.

  3. A novel method for detection of dioxins. Exonuclease protection mediated PCR assay

    Energy Technology Data Exchange (ETDEWEB)

    Xu, S.Q.; Sun, X.; Li, F.; Li, B.S. [Huazhong Univ. of Science and Technology, Wuhan, HB (China). Tongji Medical College

    2004-09-15

    The aromatic hydrocarbon receptor (AhR) is a ligand-actived transcription factor that mediates many of the biologic and toxicologic effects of dioxin-like chemicals (DLCs), such as 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD). Numerous AhR-based bioassays for identification and detection of DLCs have been developed in vitro. Such as the chemical-activated luciferase gene expression (CALUX), ethoxyresolufin-O-deethylase (EROD) activity are sometimes represented as the next best system when compared with whole body or in vivo systems. However, cell systems can be affected by the toxic chemical itself during the assay, thus confusing problems couldn't be avoided in the assay. Incorporation of metabolism in cell systems with uncertain consequences prolongs assay complexity and time. Thus these drawbacks limit the utility of cell systems for screening purposes. Most cell-free bioassays require radioactivity, such as the gel retardation of AhR binding (GRAB) assay, or antibody of AhR or ligand, which are unfeasible for some laboratories. Here a cell-free bioanalysis method, Exonuclease Protection Mediated PCR (EPM-PCR) bioassay, was established for detection of AhR ligands based on the binding of the dioxin:AhR complex to the specific DNA. EPM-PCR can provide indirect detection of ligands by quantification of the specific AhR-binding DNA, no necessary of any DNA labeling and sophisticated equipments. This new bioassay not only has the higher sensitivity and specificity, but it is rapid and easy to perform.

  4. Comparison of PCR method with the culture method for identification of gonococci from endocervical swabs

    Directory of Open Access Journals (Sweden)

    Alam A

    2002-01-01

    Full Text Available Gonococcal infection remains still a major cause of morbidity among sexually active individuals. Diagnosis of the infection in a female case is more difficult than that in a male. This was a prospective study among 269 female commercial sex workers (CSWs to screen them for gonococcal infection, comparing the rapid method of identification of gonococci by polymerase chain reaction (PCR with the selective culture method. A total of 92 (34.2% CSWs were identified positive for Neisseria gonorrhoeae by combination of the two methods. The PCR method identified 87 of the specimens to harbour cppB gene of N. gonorrhoeae, whereas culture method identified 83 specimens showing colonies of gonococci. Taking into consideration of the total positive cases (92, the PCR method showed a sensitivity of 94.57%, whereas sensitivity of culture method was 90.22%. The selective culture method appears to be the most applicable in the identification of gonococci from clinical specimens, particularly in the less resourceful countries like Bangladesh.

  5. A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

    Science.gov (United States)

    Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

    2015-06-01

    Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

  6. A new detection method for the K variant of butyrylcholinesterase based on PCR primer introduced restriction analysis (PCR-PIRA).

    Science.gov (United States)

    Shibuta, K; Abe, M; Suzuki, T

    1994-01-01

    The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197

  7. Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in melon.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Melon (Cucumis melo. L is not only an economically important cucurbitaceous crop but also an attractive model for studying many biological characteristics. Screening appropriate reference genes is essential to reverse transcription quantitative real-time PCR (RT-qPCR, which is key to many studies involving gene expression analysis. In this study, 14 candidate reference genes were selected, and the variations in their expression in roots and leaves of plants subjected to biotic stress, abiotic stress, and plant growth regulator treatment were assessed by RT-qPCR. The stability of the expression of the selected genes was determined and ranked using geNorm and NormFinder. geNorm identified the two most stable genes for each set of conditions: CmADP and CmUBIep across all samples, CmUBIep and CmRPL in roots, CmRAN and CmACT in leaves, CmADP and CmRPL under abiotic stress conditions, CmTUA and CmACT under biotic stress conditions, and CmRAN and CmACT under plant growth regulator treatments. NormFinder determined CmRPL to be the best reference gene in roots and under biotic stress conditions and CmADP under the other experimental conditions. CmUBC2 and CmPP2A were not found to be suitable under many experimental conditions. The catalase family genes CmCAT1, CmCAT2, and CmCAT3 were identified in melon genome and used as target genes to validate the reliability of identified reference genes. The catalase family genes showed the most upregulation 3 days after inoculation with Fusarium wilt in roots, after which they were downregulated. Their levels of expression were significantly overestimated when the unsuitable reference gene was used for normalization. These results not only provide guidelines for the selection of reference genes for gene expression analyses in melons but may also provide valuable information for studying the functions of catalase family genes in stress responses.

  8. A standard curve based method for relative real time PCR data processing

    Directory of Open Access Journals (Sweden)

    Krause Andreas

    2005-03-01

    Full Text Available Abstract Background Currently real time PCR is the most precise method by which to measure gene expression. The method generates a large amount of raw numerical data and processing may notably influence final results. The data processing is based either on standard curves or on PCR efficiency assessment. At the moment, the PCR efficiency approach is preferred in relative PCR whilst the standard curve is often used for absolute PCR. However, there are no barriers to employ standard curves for relative PCR. This article provides an implementation of the standard curve method and discusses its advantages and limitations in relative real time PCR. Results We designed a procedure for data processing in relative real time PCR. The procedure completely avoids PCR efficiency assessment, minimizes operator involvement and provides a statistical assessment of intra-assay variation. The procedure includes the following steps. (I Noise is filtered from raw fluorescence readings by smoothing, baseline subtraction and amplitude normalization. (II The optimal threshold is selected automatically from regression parameters of the standard curve. (III Crossing points (CPs are derived directly from coordinates of points where the threshold line crosses fluorescence plots obtained after the noise filtering. (IV The means and their variances are calculated for CPs in PCR replicas. (V The final results are derived from the CPs' means. The CPs' variances are traced to results by the law of error propagation. A detailed description and analysis of this data processing is provided. The limitations associated with the use of parametric statistical methods and amplitude normalization are specifically analyzed and found fit to the routine laboratory practice. Different options are discussed for aggregation of data obtained from multiple reference genes. Conclusion A standard curve based procedure for PCR data processing has been compiled and validated. It illustrates that

  9. Relative quantification of mRNA: comparison of methods currently used for real-time PCR data analysis

    Directory of Open Access Journals (Sweden)

    Koppel Juraj

    2007-12-01

    Full Text Available Abstract Background Fluorescent data obtained from real-time PCR must be processed by some method of data analysis to obtain the relative quantity of target mRNA. The method chosen for data analysis can strongly influence results of the quantification. Results To compare the performance of six techniques which are currently used for analysing fluorescent data in real-time PCR relative quantification, we quantified four cytokine transcripts (IL-1β, IL-6 TNF-α, and GM-CSF in an in vivo model of colonic inflammation. Accuracy of the methods was tested by quantification on samples with known relative amounts of target mRNAs. Reproducibility of the methods was estimated by the determination of the intra-assay and inter-assay variability. Cytokine expression normalized to the expression of three reference genes (ACTB, HPRT, SDHA was then determined using the six methods for data analysis. The best results were obtained with the relative standard curve method, comparative Ct method and with DART-PCR, LinRegPCR and Liu & Saint exponential methods when average amplification efficiency was used. The use of individual amplification efficiencies in DART-PCR, LinRegPCR and Liu & Saint exponential methods significantly impaired the results. The sigmoid curve-fitting (SCF method produced medium performance; the results indicate that the use of appropriate type of fluorescence data and in some instances manual selection of the number of amplification cycles included in the analysis is necessary when the SCF method is applied. We also compared amplification efficiencies (E and found that although the E values determined by different methods of analysis were not identical, all the methods were capable to identify two genes whose E values significantly differed from other genes. Conclusion Our results show that all the tested methods can provide quantitative values reflecting the amounts of measured mRNA in samples, but they differ in their accuracy and

  10. [A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].

    Science.gov (United States)

    Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan

    2015-04-01

    To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.

  11. Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Faggioli, F; Pasquini, G; Barba, M

    1998-09-01

    The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

  12. Detection of EML4-ALK in lung adenocarcinoma using pleural effusion with FISH, IHC, and RT-PCR methods.

    Directory of Open Access Journals (Sweden)

    Leilei Liu

    Full Text Available Anaplastic lymphoma kinase (ALK and echinoderm microtubule-associated protein-like 4 (EML4 gene rearrangements occur in approximately 5% of non-small-cell lung cancers (NSCLC, leading to the overexpression of anaplastic lymphoma kinase and predicting a response to the targeted inhibitor, crizotinib. Malignant pleural effusion occurs in most patients with advanced lung cancer, especially adenocarcinoma, and tissue samples are not always available from these patients. We attempted to clarify the feasibility of detecting the EML4-ALK fusion gene in pleural effusion cells using different methods. We obtained 66 samples of pleural effusion from NSCLC patients. The pleural effusion fluid was centrifuged, and the cellular components obtained were formalin fixed and paraffin embedded. The EML4-ALK fusion gene status was determined with fluorescent in situ hybridization (FISH, reverse transcription-polymerase chain reaction (RT-PCR, and immunohistochemistry (IHC. EML4-ALK was detected in three of 66 patient samples (4.5% with RT-PCR. When the RT-PCR data were used as the standard, one false positive and one false negative samples were identified with IHC; and one false negative sample was identified with FISH. These results suggest that a block of pleural effusion cells can be used to detect the EML4-ALK fusion gene. IHC had good sensitivity, but low specificity. FISH had low sensitivity, but high specificity. RT-PCR is a good candidate method for detecting EML4-ALK in blocks of pleural effusion cells from lung cancer patients.

  13. Influence of DNA extraction methods, PCR inhibitors and quantification methods on real-time PCR assay of biotechnology-derived traits.

    Science.gov (United States)

    Demeke, Tigst; Jenkins, G Ronald

    2010-03-01

    Biotechnology-derived varieties of canola, cotton, corn and soybean are being grown in the USA, Canada and other predominantly grain exporting countries. Although the amount of farmland devoted to production of biotechnology-derived crops continues to increase, lingering concerns that unintended consequences may occur provide the EU and most grain-importing countries with justification to regulate these crops. Legislation in the EU requires traceability of grains/oilseeds, food and feed products, and labelling, when a threshold level of 0.9% w/w of genetically engineered trait is demonstrated to be present in an analytical sample. The GE content is routinely determined by quantitative PCR (qPCR) and plant genomic DNA provides the template for the initial steps in this process. A plethora of DNA extraction methods exist for qPCR applications. Implementing standardized methods for detection of genetically engineered traits is necessary to facilitate grain marketing. The International Organization for Standardization draft standard 21571 identifies detergent-based methods and commercially available kits that are widely used for DNA extraction, but also indicates that adaptations may be necessary depending upon the sample matrix. This review assesses advantages and disadvantages of various commercially available DNA extraction kits, as well as modifications to published cetyltrimethylammonium bromide methods. Inhibitors are a major obstacle for efficient amplification in qPCR. The types of PCR inhibitors and techniques to minimize inhibition are discussed. Finally, accurate quantification of DNA for applications in qPCR is not trivial. Many confounders contribute to differences in analytical measurements when a particular DNA quantification method is applied and different methods do not always provide concordant results on the same DNA sample. How these differences impact measurement uncertainty in qPCR is considered.

  14. Establishment and in-house validation of stem-loop RT PCR method for MicroRNA398 expression analysis

    Directory of Open Access Journals (Sweden)

    Timotijević Gordana S.

    2015-01-01

    Full Text Available MicroRNAs (miRNAs belong to the class of small non-coding RNAs which have important roles throughout development as well as in plant response to diverse environmental stresses. Some of plant miRNAs are essential for regulation and maintenance of nutritive homeostasis when nutrients are in excess or shortage comparing to optimal concentration for certain plant species. Better understanding of miRNAs functions implies development of efficient technology for profiling their gene expression. We set out to establish validate the methodology for miRNA gene expression analysis in cucumber grown under suboptimal mineral nutrient regimes, including iron deficiency. Reverse transcription by “stem-loop” primers in combination with Real time PCR method is one of potential approaches for quantification of miRNA gene expression. In this paper we presented a method for “stem loop” primer design specific for miR398, as well as reaction optimization and determination of Real time PCR efficiency. Proving the accuracy of this method was imperative as “stem loop” RT which consider separate transcription of target and endogenous control. The method was verified by comparison of the obtained data with results of miR398 expression achieved using a commercial kit based on simultaneous conversion of all RNAs in cDNAs. [Projekat Ministarstva nauke Republike Srbije, br. 173005 i br. ON-173028

  15. Comparison of PCR with Standard Method (MPN for detection of bacterial contamination in drinking water

    Directory of Open Access Journals (Sweden)

    Fatemeh Dehghan

    2014-11-01

    Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.

  16. A multiplex reverse transcription PCR and automated electronic microarray assay for detection and differentiation of seven viruses affecting swine.

    Science.gov (United States)

    Erickson, A; Fisher, M; Furukawa-Stoffer, T; Ambagala, A; Hodko, D; Pasick, J; King, D P; Nfon, C; Ortega Polo, R; Lung, O

    2018-04-01

    Microarray technology can be useful for pathogen detection as it allows simultaneous interrogation of the presence or absence of a large number of genetic signatures. However, most microarray assays are labour-intensive and time-consuming to perform. This study describes the development and initial evaluation of a multiplex reverse transcription (RT)-PCR and novel accompanying automated electronic microarray assay for simultaneous detection and differentiation of seven important viruses that affect swine (foot-and-mouth disease virus [FMDV], swine vesicular disease virus [SVDV], vesicular exanthema of swine virus [VESV], African swine fever virus [ASFV], classical swine fever virus [CSFV], porcine respiratory and reproductive syndrome virus [PRRSV] and porcine circovirus type 2 [PCV2]). The novel electronic microarray assay utilizes a single, user-friendly instrument that integrates and automates capture probe printing, hybridization, washing and reporting on a disposable electronic microarray cartridge with 400 features. This assay accurately detected and identified a total of 68 isolates of the seven targeted virus species including 23 samples of FMDV, representing all seven serotypes, and 10 CSFV strains, representing all three genotypes. The assay successfully detected viruses in clinical samples from the field, experimentally infected animals (as early as 1 day post-infection (dpi) for FMDV and SVDV, 4 dpi for ASFV, 5 dpi for CSFV), as well as in biological material that were spiked with target viruses. The limit of detection was 10 copies/μl for ASFV, PCV2 and PRRSV, 100 copies/μl for SVDV, CSFV, VESV and 1,000 copies/μl for FMDV. The electronic microarray component had reduced analytical sensitivity for several of the target viruses when compared with the multiplex RT-PCR. The integration of capture probe printing allows custom onsite array printing as needed, while electrophoretically driven hybridization generates results faster than conventional

  17. Detection of mRNA by reverse transcription PCR as an indicator of viability in Phytophthora ramorum

    Science.gov (United States)

    Antonio Chimento; Santa Olga Cacciola; Matteo Garbelotto

    2008-01-01

    Real-Time PCR technologies offer increasing opportunities to detect and study phytopathogenic fungi. They combine the sensitivity of conventional PCR with the generation of a specific fluorescent signal providing both real-time analysis of the reaction kinetics and quantification of specific DNA targets. Before the development of Real-Time PCR and...

  18. Enteroviruses in blood of patients with type 1 diabetes detected by integrated cell culture and reverse transcription quantitative real-time PCR.

    Science.gov (United States)

    Alidjinou, Enagnon Kazali; Sane, Famara; Lefevre, Christine; Baras, Agathe; Moumna, Ilham; Engelmann, Ilka; Vantyghem, Marie-Christine; Hober, Didier

    2017-11-01

    Enteroviruses (EV) have been associated with type 1 diabetes (T1D), but EV RNA detection has been reported in only a small proportion of T1D patients. We studied whether integrated cell culture and reverse transcription real-time PCR could improve EV detection in blood samples from patients with T1D. Blood was collected from 13 patients with T1D. The presence of EV RNA in blood was investigated by using real-time RT-PCR. In addition, plasma and white blood cells (WBC) were inoculated to BGM and Vero cell line cultures. Culture supernatants and cells collected on day 7 and day 14 were tested for EV RNA by real-time RT-PCR. Enterovirus identification was performed through sequencing of the VP4/VP2 region. Enterovirus RNA was detected in blood by using real-time RT-PCR in only one out of 13 patients. The detection of EV RNA in cultures inoculated with clinical samples (plasma and/or WBC) gave positive results in five other patients. The viral loads were low, ranging from 45 to 4420 copies/ng of total RNA. One isolate was successfully identified as coxsackievirus B1. Integrated cell culture and reverse transcription real-time PCR can improve the detection rate of EV in blood samples of patients with T1D and can be useful to investigate further the relationship between EV and the disease.

  19. Internal quality control of PCR-based genotyping methods

    DEFF Research Database (Denmark)

    Bladbjerg, Else-Marie; Gram, Jørgen; Jespersen, Jørgen

    2002-01-01

    Internal quality control programmes for genetic analyses are needed. We have focused on quality control aspects of selected polymorphism analyses used in thrombosis research. DNA was isolated from EDTA-blood (n = 500) and analysed for 18 polymorphisms by polymerase chain reaction (PCR), i...... because of positive reagent blanks (controls (Control of data handling revealed 0.1% reading mistakes and 0.5% entry mistakes. Based on our experiences, we propose an internal quality control programme......, electrophoresis (analytical factors), result reading and entry into a database (post-analytical factors). Furthermore, we evaluated a procedure for result confirmation. Isolated DNA was of good quality (42 micrograms/ml blood, A260/A280 ratio > 1.75, negative DNAsis tests). Occasionally, results were reanalysed...

  20. Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

    Science.gov (United States)

    Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

    2016-04-01

    Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

  1. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    Directory of Open Access Journals (Sweden)

    Leterrier Christine

    2010-07-01

    Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

  2. Numeric definition of the clinical performance of the nested reverse transcription-PCR for detection of hematogenous epithelial cells and correction for specific mRNA of non-target cell origin as evaluated for prostate cancer cells

    NARCIS (Netherlands)

    Schamhart, Denis; Swinnen, Johannes; Kurth, Karl-Heinz; Westerhof, Alex; Kusters, Ron; Borchers, Holger; Sternberg, Cora

    2003-01-01

    Background: Inappropriate quality management,of reverse transcription-PCR (RT-PCR) assays for the detection of blood-borne prostate cancer (PCa) cells hampers clinical conclusions. Improvement of the RT-PCR-methodology for prostate-specific, antigen (PSA) mRNA should focus on an appropriate numeric.

  3. A novel method of multiple nucleic acid detection: Real-time RT-PCR coupled with probe-melting curve analysis.

    Science.gov (United States)

    Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan

    2017-11-15

    A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  5. A method for quantitative analysis of standard and high-throughput qPCR expression data based on input sample quantity.

    Directory of Open Access Journals (Sweden)

    Mateusz G Adamski

    Full Text Available Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1 the achievement of absolute quantification and (2 a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.

  6. Study of the Efficacy of Real Time-PCR Method for Amikacin Determination Using Microbial Assay

    Directory of Open Access Journals (Sweden)

    Farzaneh Lotfipour

    2015-06-01

    Full Text Available Purpose: Microbial assay is used to determine the potency of antibiotics and vitamins. In spite of its advantages like simplicity and easiness, and to reveal the slight changes in the molecules, the microbial assay suffers from significant limitations; these methods are of lower specificity, accuracy and sensitivity. The objective of the present study is to evaluate the efficacy of real time-PCR technique in comparison with turbidimetric method for microbial assay of amikacin. Methods: Microbial determination of amikacin by turbidimetric method was performed according to USP. Also amikacin concentrations were determined by microbial assay using taq-man quantitative PCR method. Standard curves in different concentration for both methods were plotted and method validation parameters of linearity, precision and accuracy were calculated using statistical procedures. Results: The RT-PCR method was linear in the wider concentration range (5.12 – 38.08 for RT-PCR versus 8.00 – 30.47 for turbidimetric method with a better correlation coefficient (0.976 for RT-PCR versus 0.958 for turbidimetric method. RT-PCR method with LOQ of 5.12 ng/ml was more sensitive than turbidimetric method with LOQ of 8.00 ng/ml and the former could detect and quantify low concentrations of amikacin. The results of accuracy and precision evaluation showed that the RT-PCR method was accurate and precise in all of the tested concentration. Conclusion: The RT-PCR method described here provided an accurate and precise technique for measurement of amikacin potency and it can be a candidate for microbial determination of the antibiotics with the same test organism.

  7. Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

    Science.gov (United States)

    Altınel, Ahmet

    2017-01-01

    Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

  8. Detection of negative and positive RNA strand of poliovirus Sabin 1 and echovirus E19 by a stem-loop reverse transcription PCR.

    Science.gov (United States)

    Fikatas, A; Dimitriou, T G; Kyriakopoulou, Z; Moschonas, G D; Amoutzias, G D; Mossialos, D; Gartzonika, C; Levidiotou-Stefanou, S; Markoulatos, P

    2017-09-01

    In this report a strand specific RT-PCR was established for the detection of the replicative negative RNA strand of poliovirus sabin 1 (Sabin1) and Echovirus 19 (E19) strains. The key for the successful conduction of the assay was the use of a specific reverse transcription primer targeting the 5'-UTR of enteroviruses that consisted of a stem-loop structure at the 5'-end and an enteroviral-specific sequence at the 3'-end. The stem loop RT-PCR was found to be an accurate and sensitive method, detecting even 10 -2 CCID 50 of poliovirus sabin 1 (Sabin1) and E19 strains 6 h postinfection (p.i.), while CPE appeared 3 days later. This assay was also validated in SiHa and Caski cell lines that are not used for the detection of enteroviruses. The negative RNA strand was detected 6 h and 12 h p.i. in SiHa and Caski cells, when these cell lines were inoculated with 10 5 and 1 CCID 50 respectively, whereas CPE was observed 5 days p.i for SiHa cells and 8 days p.i for Caski cells and that only at 10 5 CCID 50 . The results show that this approach may be used for replacing the time-consuming cell cultures in order to detect the active replication of enteroviruses. Enteroviruses are positive stranded RNA viruses that may cause severe diseases. The conventional method for detection of active viral replication involves virus isolation in sensitive cell cultures followed by titration and seroneutralization. In this report, we describe the use of a stem-loop secondary structured oligonucleotide in RT-PCR assay for the detection of the replicative negative strand of the positive-stranded RNA of poliovirus sabin 1 and E19 strains. This approach proved to be a useful tool that may be used for replacing the time-consuming cell culture assays in order to detect the active replication of enteroviruses. © 2017 The Society for Applied Microbiology.

  9. Usefulness of in-house PCR methods for hepatitis B virus DNA detection.

    Science.gov (United States)

    Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo

    2015-10-01

    The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Assessing reference genes for accurate transcript normalization using quantitative real-time PCR in pearl millet [Pennisetum glaucum (L. R. Br].

    Directory of Open Access Journals (Sweden)

    Prasenjit Saha

    Full Text Available Pearl millet [Pennisetum glaucum (L. R.Br.], a close relative of Panicoideae food crops and bioenergy grasses, offers an ideal system to perform functional genomics studies related to C4 photosynthesis and abiotic stress tolerance. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR provides a sensitive platform to conduct such gene expression analyses. However, the lack of suitable internal control reference genes for accurate transcript normalization during qRT-PCR analysis in pearl millet is the major limitation. Here, we conducted a comprehensive assessment of 18 reference genes on 234 samples which included an array of different developmental tissues, hormone treatments and abiotic stress conditions from three genotypes to determine appropriate reference genes for accurate normalization of qRT-PCR data. Analyses of Ct values using Stability Index, BestKeeper, ΔCt, Normfinder, geNorm and RefFinder programs ranked PP2A, TIP41, UBC2, UBQ5 and ACT as the most reliable reference genes for accurate transcript normalization under different experimental conditions. Furthermore, we validated the specificity of these genes for precise quantification of relative gene expression and provided evidence that a combination of the best reference genes are required to obtain optimal expression patterns for both endogeneous genes as well as transgenes in pearl millet.

  11. Virus isolation vs RT-PCR: which method is more successful in detecting VHSV and IHNV in fish tissue sampled under field conditions?

    DEFF Research Database (Denmark)

    Knüsel, R.; Bergmann, S. M.; Einer-Jensen, Katja

    2007-01-01

    in Switzerland. Compared to SPNT, the RT-PCR method detected, as with virus isolation, a much lower number of positive cases; reasons for this discrepancy are discussed. Our results indicate that RT-PCR can not only be successfully applied in field surveys, but may also be slightly more sensitive than virus......This study compared the results of reverse transcription-polymerase chain reaction (RT-PCR) and traditional virus isolation on cell culture in detection of viral haemorrhagic septicaemia virus (VHSV) and infectious haematopoietic necrosis virus (IHNV). RT-PCR was used for 172 tissue sample pools...... (total of 859 fish) originating from a field survey on the occurrence of VHSV and IHNV in farmed and wild salmonids in Switzerland. These samples represented all sites with fish that were either identified as virus-positive by means of virus isolation (three sites, four positive tissue sample pools) and...

  12. Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori.

    Science.gov (United States)

    Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

    2016-07-07

    To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and

  13. Evaluation of Appropriate Reference Genes for Reverse Transcription-Quantitative PCR Studies in Different Tissues of a Desert Poplar via Comparision of Different Algorithms

    Directory of Open Access Journals (Sweden)

    Hou-Ling Wang

    2015-08-01

    Full Text Available Despite the unshakable status of reverse transcription-quantitative PCR in gene expression analysis, it has certain disadvantages, including that the results are highly dependent on the reference genes selected for data normalization. Since inappropriate endogenous control genes will lead to inaccurate target gene expression profiles, the validation of suitable internal reference genes is essential. Given the increasing interest in functional genes and genomics of Populus euphratica, a desert poplar showing extraordinary adaptation to salt stress, we evaluated the expression stability of ten candidate reference genes in P. euphratica roots, stems, and leaves under salt stress conditions. We used five algorithms, namely, ΔCt, NormFinder, geNorm, GrayNorm, and a rank aggregation method (RankAggreg to identify suitable normalizers. To support the suitability of the identified reference genes and to compare the relative merits of these different algorithms, we analyzed and compared the relative expression levels of nine P. euphratica functional genes in different tissues. Our results indicate that a combination of multiple reference genes recommended by GrayNorm algorithm (e.g., a combination of Actin, EF1α, GAPDH, RP, UBQ in root should be used instead of a single reference gene. These results are valuable for research of gene identification in different P. euphratica tissues.

  14. The hsp 16 Gene of the Probiotic Lactobacillus acidophilus Is Differently Regulated by Salt, High Temperature and Acidic Stresses, as Revealed by Reverse Transcription Quantitative PCR (qRT-PCR Analysis

    Directory of Open Access Journals (Sweden)

    Daniela Fiocco

    2011-08-01

    Full Text Available Small heat shock proteins (sHsps are ubiquitous conserved chaperone-like proteins involved in cellular proteins protection under stressful conditions. In this study, a reverse transcription quantitative PCR (RT-qPCR procedure was developed and used to quantify the transcript level of a small heat shock gene (shs in the probiotic bacterium Lactobacillus acidophilus NCFM, under stress conditions such as heat (45 °C and 53 °C, bile (0.3% w/v, hyperosmosis (1 M and 2.5 M NaCl, and low pH value (pH 4. The shs gene of L. acidophilus NCFM was induced by salt, high temperature and acidic stress, while repression was observed upon bile stress. Analysis of the 5' noncoding region of the hsp16 gene reveals the presence of an inverted repeat (IR sequence (TTAGCACTC-N9-GAGTGCTAA homologue to the controlling IR of chaperone expression (CIRCE elements found in the upstream regulatory region of Gram-positive heat shock operons, suggesting that the hsp16 gene of L. acidophilus might be transcriptionally controlled by HrcA. In addition, the alignment of several small heat shock proteins identified so far in lactic acid bacteria, reveals that the Hsp16 of L. acidophilus exhibits a strong evolutionary relationship with members of the Lactobacillus acidophilus group.

  15. Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis.

    Science.gov (United States)

    Chen, Derrick J; Procop, Gary W; Vogel, Sherilynn; Yen-Lieberman, Belinda; Richter, Sandra S

    2015-11-01

    The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. Development of an in situ magnetic beads based RT-PCR method for electrochemiluminescent detection of rotavirus

    Science.gov (United States)

    Zhan, Fangfang; Zhou, Xiaoming

    2012-12-01

    Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.

  17. Validation of chimerism in pediatric recipients of allogeneic hematopoietic stem cell transplantation (HSCT) a comparison between two methods: real-time PCR (qPCR) vs. variable number tandem repeats PCR (VNTR PCR).

    Science.gov (United States)

    Kletzel, Morris; Huang, Wei; Olszewski, Marie; Khan, Sana

    2013-01-01

    Post-hematopoietic stem cell transplantation (HSCT) chimerism monitoring is important to assess relapse and therapeutic intervention. The purpose of our study is to compare two methods variable number tandem repeats (VNTR) vs. quantitative real- time polymerase chain reaction (qPCR) in terms of determining chimerism. 127 (peripheral blood n=112, bone marrow n=15) samples were simultaneously tested by VNTR using APO-B, D1S80, D1S111, D17S30, gene loci SRY and ZP3 and qPCR using 34 assays (CA001-CA034) that are designed to a bi-allelic insertion/deletion (indel) polymorphism in the human genome. Samples were separated in three subsets: total WBC, T-cell and Myeloid cells. Extraction of DNA was performed then quantified. We analyzed column statistics, paired t-test and regression analysis for both methods. There was complete correlation between the two methods. The simplicity and rapidity of the test results from the qPCR method is more efficient and accurate to assess chimerism.

  18. The use of digital PCR to improve the application of quantitative molecular diagnostic methods for tuberculosis.

    Science.gov (United States)

    Devonshire, Alison S; O'Sullivan, Denise M; Honeyborne, Isobella; Jones, Gerwyn; Karczmarczyk, Maria; Pavšič, Jernej; Gutteridge, Alice; Milavec, Mojca; Mendoza, Pablo; Schimmel, Heinz; Van Heuverswyn, Fran; Gorton, Rebecca; Cirillo, Daniela Maria; Borroni, Emanuele; Harris, Kathryn; Barnard, Marinus; Heydenrych, Anthenette; Ndusilo, Norah; Wallis, Carole L; Pillay, Keshree; Barry, Thomas; Reddington, Kate; Richter, Elvira; Mozioğlu, Erkan; Akyürek, Sema; Yalçınkaya, Burhanettin; Akgoz, Muslum; Žel, Jana; Foy, Carole A; McHugh, Timothy D; Huggett, Jim F

    2016-08-03

    Real-time PCR (qPCR) based methods, such as the Xpert MTB/RIF, are increasingly being used to diagnose tuberculosis (TB). While qualitative methods are adequate for diagnosis, the therapeutic monitoring of TB patients requires quantitative methods currently performed using smear microscopy. The potential use of quantitative molecular measurements for therapeutic monitoring has been investigated but findings have been variable and inconclusive. The lack of an adequate reference method and reference materials is a barrier to understanding the source of such disagreement. Digital PCR (dPCR) offers the potential for an accurate method for quantification of specific DNA sequences in reference materials which can be used to evaluate quantitative molecular methods for TB treatment monitoring. To assess a novel approach for the development of quality assurance materials we used dPCR to quantify specific DNA sequences in a range of prototype reference materials and evaluated accuracy between different laboratories and instruments. The materials were then also used to evaluate the quantitative performance of qPCR and Xpert MTB/RIF in eight clinical testing laboratories. dPCR was found to provide results in good agreement with the other methods tested and to be highly reproducible between laboratories without calibration even when using different instruments. When the reference materials were analysed with qPCR and Xpert MTB/RIF by clinical laboratories, all laboratories were able to correctly rank the reference materials according to concentration, however there was a marked difference in the measured magnitude. TB is a disease where the quantification of the pathogen could lead to better patient management and qPCR methods offer the potential to rapidly perform such analysis. However, our findings suggest that when precisely characterised materials are used to evaluate qPCR methods, the measurement result variation is too high to determine whether molecular quantification

  19. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  20. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Directory of Open Access Journals (Sweden)

    Claudia de Camargo Tozato

    2016-01-01

    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  1. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  2. Identification and validation of quantitative real-time reverse transcription PCR reference genes for gene expression analysis in teak (Tectona grandis L.f.).

    Science.gov (United States)

    Galeano, Esteban; Vasconcelos, Tarcísio Sales; Ramiro, Daniel Alves; De Martin, Valentina de Fátima; Carrer, Helaine

    2014-07-22

    Teak (Tectona grandis L.f.) is currently the preferred choice of the timber trade for fabrication of woody products due to its extraordinary qualities and is widely grown around the world. Gene expression studies are essential to explore wood formation of vascular plants, and quantitative real-time reverse transcription PCR (qRT-PCR) is a sensitive technique employed for quantifying gene expression levels. One or more appropriate reference genes are crucial to accurately compare mRNA transcripts through different tissues/organs and experimental conditions. Despite being the focus of some genetic studies, a lack of molecular information has hindered genetic exploration of teak. To date, qRT-PCR reference genes have not been identified and validated for teak. Identification and cloning of nine commonly used qRT-PCR reference genes from teak, including ribosomal protein 60s (rp60s), clathrin adaptor complexes medium subunit family (Cac), actin (Act), histone 3 (His3), sand family (Sand), β-Tubulin (Β-Tub), ubiquitin (Ubq), elongation factor 1-α (Ef-1α), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Expression profiles of these genes were evaluated by qRT-PCR in six tissue and organ samples (leaf, flower, seedling, root, stem and branch secondary xylem) of teak. Appropriate gene cloning and sequencing, primer specificity and amplification efficiency was verified for each gene. Their stability as reference genes was validated by NormFinder, BestKeeper, geNorm and Delta Ct programs. Results obtained from all programs showed that TgUbq and TgEf-1α are the most stable genes to use as qRT-PCR reference genes and TgAct is the most unstable gene in teak. The relative expression of the teak cinnamyl alcohol dehydrogenase (TgCAD) gene in lignified tissues at different ages was assessed by qRT-PCR, using TgUbq and TgEf-1α as internal controls. These analyses exposed a consistent expression pattern with both reference genes. This study proposes a first broad

  3. Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

    OpenAIRE

    Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

    1999-01-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...

  4. Study the Three Extraction Methods for HBV DNA to Use in PCR

    Directory of Open Access Journals (Sweden)

    N. Sheikh

    2004-07-01

    Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.

  5. Normalization with Corresponding Naïve Tissue Minimizes Bias Caused by Commercial Reverse Transcription Kits on Quantitative Real-Time PCR Results.

    Directory of Open Access Journals (Sweden)

    Andreas Garcia-Bardon

    Full Text Available Real-time reverse transcription polymerase chain reaction (PCR is the gold standard for expression analysis. Designed to improve reproducibility and sensitivity, commercial kits are commonly used for the critical step of cDNA synthesis. The present study was designed to determine the impact of these kits. mRNA from mouse brains were pooled to create serial dilutions ranging from 0.0625 μg to 2 μg, which were transcribed into cDNA using four different commercial reverse-transcription kits. Next, we transcribed mRNA from brain tissue after acute brain injury and naïve mice into cDNA for qPCR. Depending on tested genes, some kits failed to show linear results in dilution series and revealed strong variations in cDNA yield. Absolute expression data in naïve and trauma settings varied substantially between these kits. Normalization with a housekeeping gene failed to reduce kit-dependent variations, whereas normalization eliminated differences when naïve samples from the same region were used. The study shows strong evidence that choice of commercial cDNA synthesis kit has a major impact on PCR results and, consequently, on comparability between studies. Additionally, it provides a solution to overcome this limitation by normalization with data from naïve samples. This simple step helps to compare mRNA expression data between different studies and groups.

  6. Optimization of Quantitative PCR Methods for Enteropathogen Detection

    Science.gov (United States)

    Liu, Jie; Gratz, Jean; Amour, Caroline; Nshama, Rosemary; Walongo, Thomas; Maro, Athanasia; Mduma, Esto; Platts-Mills, James; Boisen, Nadia; Nataro, James; Haverstick, Doris M.; Kabir, Furqan; Lertsethtakarn, Paphavee; Silapong, Sasikorn; Jeamwattanalert, Pimmada; Bodhidatta, Ladaporn; Mason, Carl; Begum, Sharmin; Haque, Rashidul; Praharaj, Ira; Kang, Gagandeep; Houpt, Eric R.

    2016-01-01

    Detection and quantification of enteropathogens in stool specimens is useful for diagnosing the cause of diarrhea but is technically challenging. Here we evaluate several important determinants of quantification: specimen collection, nucleic acid extraction, and extraction and amplification efficiency. First, we evaluate the molecular detection and quantification of pathogens in rectal swabs versus stool, using paired flocked rectal swabs and whole stool collected from 129 children hospitalized with diarrhea in Tanzania. Swabs generally yielded a higher quantification cycle (Cq) (average 29.7, standard deviation 3.5 vs. 25.3 ± 2.9 from stool, P<0.001) but were still able to detect 80% of pathogens with a Cq < 30 in stool. Second, a simplified total nucleic acid (TNA) extraction procedure was compared to separate DNA and RNA extractions and showed 92% (318/344) sensitivity and 98% (951/968) specificity, with no difference in Cq value for the positive results (ΔCq(DNA+RNA-TNA) = -0.01 ± 1.17, P = 0.972, N = 318). Third, we devised a quantification scheme that adjusts pathogen quantity to the specimen’s extraction and amplification efficiency, and show that this better estimates the quantity of spiked specimens than the raw target Cq. In sum, these methods for enteropathogen quantification, stool sample collection, and nucleic acid extraction will be useful for laboratories studying enteric disease. PMID:27336160

  7. Development and Evaluation of a PCR and Mass Spectroscopy-based (PCR-MS) Method for Quantitative, Type-specific Detection of Human Papillomavirus

    Science.gov (United States)

    Patel, Divya A.; Shih, Yang-Jen; Newton, Duane W.; Michael, Claire W.; Oeth, Paul A.; Kane, Michael D.; Opipari, Anthony W.; Ruffin, Mack T.; Kalikin, Linda M.; Kurnit, David M.

    2010-01-01

    Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay. PMID:19410602

  8. Development and evaluation of a PCR and mass spectroscopy (PCR-MS)-based method for quantitative, type-specific detection of human papillomavirus.

    Science.gov (United States)

    Patel, Divya A; Shih, Yang-Jen; Newton, Duane W; Michael, Claire W; Oeth, Paul A; Kane, Michael D; Opipari, Anthony W; Ruffin, Mack T; Kalikin, Linda M; Kurnit, David M

    2009-09-01

    Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High-Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay.

  9. HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods

    DEFF Research Database (Denmark)

    Cowland, J B; Madsen, H O; Morling, N

    1995-01-01

    (ASA) method, which together recognise eight alleles. In 146 unrelated Danish individuals, the HLA-DQA1 alleles were in Hardy-Weinberg equilibrium. For identity testing, the power of discrimination (PD) of HLA-DQA1 was 0.932 with the RDB method and 0.942 with the PCR-RFLP/ASA method. For paternity...

  10. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. A multiplex PCR method for detection of Aspergillus spp. and Mycobacterium tuberculosis in BAL specimens.

    Science.gov (United States)

    Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A

    2015-06-01

    The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  12. A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

    Science.gov (United States)

    Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

    2013-03-11

    Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

  13. Evaluation of PCR methods for detection of Brucella strains from culture and tissues.

    Science.gov (United States)

    Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar

    2017-04-01

    The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.

  14. Design and optimization of a novel reverse transcription linear-after-the-exponential PCR for the detection of foot-and-mouth disease virus.

    Science.gov (United States)

    Pierce, K E; Mistry, R; Reid, S M; Bharya, S; Dukes, J P; Hartshorn, C; King, D P; Wangh, L J

    2010-07-01

    A novel molecular assay for the detection of foot-and-mouth disease virus (FMDV) was developed using linear-after-the-exponential polymerase chain reaction (LATE-PCR). Pilot experiments using synthetic DNA targets demonstrated the ability of LATE-PCR to quantify initial target concentration through endpoint detection. A two-step protocol involving reverse transcription (RT) followed by LATE-PCR was then used to confirm the ability of the assay to detect FMDV RNA. Finally, RT and LATE-PCR were combined in a one-step duplex assay for co-amplification of an FMDV RNA segment and an internal control comprised of an Armored RNA. In that form, each of the excess primers in the reaction mixture hybridize to their respective RNA targets during a short pre-incubation, then generate cDNA strands during a 3-min RT step at 60°C, and the resulting cDNA is amplified by LATE-PCR without intervening sample processing. The RT-LATE-PCR assay generates fluorescent signals at endpoint that are proportional to the starting number of RNA targets and can detect a range of sequence variants using a single mismatch-tolerant probe. In addition to offering improvements over current laboratory-based molecular diagnostic assays for FMDV, this new assay is compatible with a novel portable ('point-of-care') device, the BioSeeq II, designed for the rapid diagnosis of FMD in the field. © 2009 The Authors. Journal compilation © 2009 The Society for Applied Microbiology.

  15. An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR

    Directory of Open Access Journals (Sweden)

    Davis Thomas M

    2010-03-01

    Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.

  16. Detection of Legionella species in environmental water by the quantitative PCR method in combination with ethidium monoazide treatment.

    Science.gov (United States)

    Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio

    2015-01-01

    We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.

  17. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  18. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  19. Comparison of phenotypic and PCR methods for detection of carbapenemases production by Enterobacteriaceae

    Directory of Open Access Journals (Sweden)

    Maryam AlTamimi

    2017-01-01

    Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.

  20. Development and Evaluation of Event-Specific Quantitative PCR Method for Genetically Modified Soybean MON87701.

    Science.gov (United States)

    Tsukahara, Keita; Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Nishimaki-Mogami, Tomoko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2016-01-01

    A real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event, MON87701. First, a standard plasmid for MON87701 quantification was constructed. The conversion factor (C f ) required to calculate the amount of genetically modified organism (GMO) was experimentally determined for a real-time PCR instrument. The determined C f for the real-time PCR instrument was 1.24. For the evaluation of the developed method, a blind test was carried out in an inter-laboratory trial. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr), respectively. The determined biases and the RSDr values were less than 30 and 13%, respectively, at all evaluated concentrations. The limit of quantitation of the method was 0.5%, and the developed method would thus be applicable for practical analyses for the detection and quantification of MON87701.

  1. Quantification of 16S rRNAs in complex bacterial communities by multiple competitive reverse transcription-PCR in temperature gradient gel electrophoresis fingerprints.

    Science.gov (United States)

    Felske, A; Akkermans, A D; De Vos, W M

    1998-11-01

    A novel approach was developed to quantify rRNA sequences in complex bacterial communities. The main bacterial 16S rRNAs in Drentse A grassland soils (The Netherlands) were amplified by reverse transcription (RT)-PCR with bacterium-specific primers and were separated by temperature gradient gel electrophoresis (TGGE). The primer pair used (primers U968-GC and L1401) was found to amplify with the same efficiency 16S rRNAs from bacterial cultures containing different taxa and cloned 16S ribosomal DNA amplicons from uncultured soil bacteria. The sequence-specific efficiency of amplification was determined by monitoring the amplification kinetics by kinetic PCR. The primer-specific amplification efficiency was assessed by competitive PCR and RT-PCR, and identical input amounts of different 16S rRNAs resulted in identical amplicon yields. The sequence-specific detection system used for competitive amplifications was TGGE, which also has been found to be suitable for simultaneous quantification of more than one sequence. We demonstrate that this approach can be applied to TGGE fingerprints of soil bacteria to estimate the ratios of the bacterial 16S rRNAs.

  2. Detection of hepatitis A virus by the nucleic acid sequence-based amplification technique and comparison with reverse transcription-PCR.

    Science.gov (United States)

    Jean, J; Blais, B; Darveau, A; Fliss, I

    2001-12-01

    A nucleic acid sequence-based amplification (NASBA) technique for the detection of hepatitis A virus (HAV) in foods was developed and compared to the traditional reverse transcription (RT)-PCR technique. Oligonucleotide primers targeting the VP1 and VP2 genes encoding the major HAV capsid proteins were used for the amplification of viral RNA in an isothermal process resulting in the accumulation of RNA amplicons. Amplicons were detected by hybridization with a digoxigenin-labeled oligonucleotide probe in a dot blot assay format. Using the NASBA, as little as 0.4 ng of target RNA/ml was detected per comparison to 4 ng/ml for RT-PCR. When crude HAV viral lysate was used, a detection limit of 2 PFU (4 x 10(2) PFU/ml) was obtained with NASBA, compared to 50 PFU (1 x 10(4) PFU/ml) obtained with RT-PCR. No interference was encountered in the amplification of HAV RNA in the presence of excess nontarget RNA or DNA. The NASBA system successfully detected HAV recovered from experimentally inoculated samples of waste water, lettuce, and blueberries. Compared to RT-PCR and other amplification techniques, the NASBA system offers several advantages in terms of sensitivity, rapidity, and simplicity. This technique should be readily adaptable for detection of other RNA viruses in both foods and clinical samples.

  3. Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples.

    Science.gov (United States)

    Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R

    2011-09-01

    In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.

  4. Identification of some Fusarium species from selected crop seeds using traditional method and BIO-PCR

    Directory of Open Access Journals (Sweden)

    Tomasz Kulik

    2012-12-01

    Full Text Available We identified a species level of the fungal cultures isolated from selected crop seeds using traditional method and BIO-PCR. The use of BIO-PCR did not correspond completely to the morphological analyses. Both methods showed increased infection with F. poae in winter wheat seed sample originated from north Poland. Fungal culture No 40 (isolated from faba bean and identified with traditional method as mixed culture with F. culmorum and F. graminearum did not produce expected product after PCR reaction with species specific primers OPT18F470, OPT18R470. However, the use of additional primers Fc01F, Fc01R allowed for reliable identification of F. culmorum in the culture.

  5. Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

    Science.gov (United States)

    Kageyama, A; Benno, Y

    2001-01-01

    PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

  6. Arbitrarily primed PCR- A rapid and simple method for typing of leptospiral serovars

    Directory of Open Access Journals (Sweden)

    Ramadass P

    2002-01-01

    Full Text Available PURPOSE: To investigate the use of arbitrarily primed polymerase chain reaction (AP-PCR for typing of leptospiral serovars. METHODS: AP-PCR was adopted for identification of laboratory strains of leptospires and leptospiral cultures at serovar level. A primer of 12 bp was used for amplifying DNA of 13 laboratory strains of leptospires as well as culture pellets of leptospires. RESULTS: Each serovar produced distinct DNA fingerprint which was characteristic for each serovar. These patterns were used for typing of 81 serum culture samples obtained from human leptospiral cases. Of these samples, 39 could be typed based on AP-PCR fingerprints belonging to serovars autumnalis, pomona, canicola, javanica, icterohaemorrhagiae, patoc and pyrogenes. These results were confirmed by RAPD fingerprinting of the DNA samples of the respective leptospiral serovars after culturing -FNx01them in EMJH media. One of the important findings of this work was that straight culture sample could be used for AP-PCR assay, without purification of DNA. By having more number of AP-PCR reference fingerprints, more serovars could be typed. CONCLUSIONS: AP-PCR technique provides great potential for simple and rapid identification of leptospires at serovar level, which could be useful in molecular epidemiological studies of leptospirosis.

  7. A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1 Strain

    Directory of Open Access Journals (Sweden)

    Theo P. Sloots

    2009-12-01

    Full Text Available Timely implementation of antiviral treatment and other public health based responses are dependent on accurate and rapid diagnosis of the novel pandemic influenza A(H1N1 strain. In this study we developed a duplex real-time PCR (RT-PCR (dFLU-TM assay for the simultaneous detection of a broad range of influenza A subtypes and specific detection of the novel H1N1 2009 pandemic strain. The assay was compared to the combined results of two previously described monoplex RT-PCR assays using 183 clinical samples and 10 seasonal influenza A isolates. Overall, the results showed that the dFLU-TM RT-PCR method is suitable for detection of influenza A, including the novel H1N1 pandemic strain, in clinical samples.

  8. Incidence of pulmonary aspergillosis and correlation of conventional diagnostic methods with nested PCR and real-time PCR assay using BAL fluid in intensive care unit patients.

    Science.gov (United States)

    Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein

    2013-05-01

    Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.

  9. Tendency for interlaboratory precision in the GMO analysis method based on real-time PCR.

    Science.gov (United States)

    Kodama, Takashi; Kurosawa, Yasunori; Kitta, Kazumi; Naito, Shigehiro

    2010-01-01

    The Horwitz curve estimates interlaboratory precision as a function only of concentration, and is frequently used as a method performance criterion in food analysis with chemical methods. The quantitative biochemical methods based on real-time PCR require an analogous criterion to progressively promote method validation. We analyzed the tendency of precision using a simplex real-time PCR technique in 53 collaborative studies of seven genetically modified (GM) crops. Reproducibility standard deviation (SR) and repeatability standard deviation (Sr) of the genetically modified organism (GMO) amount (%) was more or less independent of GM crops (i.e., maize, soybean, cotton, oilseed rape, potato, sugar beet, and rice) and evaluation procedure steps. Some studies evaluated whole steps consisting of DNA extraction and PCR quantitation, whereas others focused only on the PCR quantitation step by using DNA extraction solutions. Therefore, SR and Sr for GMO amount (%) are functions only of concentration similar to the Horwitz curve. We proposed S(R) = 0.1971C 0.8685 and S(r) = 0.1478C 0.8424, where C is the GMO amount (%). We also proposed a method performance index in GMO quantitative methods that is analogous to the Horwitz Ratio.

  10. A quantitative method to evaluate mesenchymal stem cell lipofection using real-time PCR.

    Science.gov (United States)

    Ribeiro, S C; Mendes, R; Madeira, C; Monteiro, G A; da Silva, C L; Cabral, J M S

    2010-01-01

    Genetic modification of human mesenchymal stem cells (MSC) is a powerful tool to improve the therapeutic utility of these cells and to increase the knowledge on their regulation mechanisms. In this context, strong efforts have been made recently to develop efficient nonviral gene delivery systems. Although several studies addressed this question most of them use the end product of a reporter gene instead of the DNA uptake quantification to test the transfection efficiency. In this study, we established a method based on quantitative real-time PCR (RT-PCR) to determine the intracellular plasmid DNA copy number in human MSC after lipofection. The procedure requires neither specific cell lysis nor DNA purification. The influence of cell number on the RT-PCR sensitivity was evaluated. The method showed good reproducibility, high sensitivity, and a wide linear range of 75-2.5 x 10⁶ plasmid DNA copies per cell. RT-PCR results were then compared with the percentage of transfected cells assessed by flow cytometry analysis, which showed that flow cytometry-based results are not always proportional to plasmid cellular uptake determined by RT-PCR. This work contributed for the establishment of a rapid quantitative assay to determine intracellular plasmid DNA in stem cells, which will be extremely beneficial for the optimization of gene delivery strategies. © 2010 American Institute of Chemical Engineers

  11. European validation of Real-Time PCR method for detection of Salmonella spp. in pork meat.

    Science.gov (United States)

    Delibato, Elisabetta; Rodriguez-Lazaro, David; Gianfranceschi, Monica; De Cesare, Alessandra; Comin, Damiano; Gattuso, Antonietta; Hernandez, Marta; Sonnessa, Michele; Pasquali, Frédérique; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Prukner-Radovcic, Estella; Horvatek Tomic, Danijela; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John E; Chemaly, Marianne; Le Gall, Francoise; González-García, Patricia; Lettini, Antonia Anna; Lukac, Maja; Quesne, Segolénè; Zampieron, Claudia; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Proroga, Yolande T R; Capuano, Federico; Manfreda, Gerardo; De Medici, Dario

    2014-08-01

    The classical microbiological method for detection of Salmonella spp. requires more than five days for final confirmation, and consequently there is a need for an alternative methodology for detection of this pathogen particularly in those food categories with a short shelf-life. This study presents an international (at European level) ISO 16140-based validation study of a non-proprietary Real-Time PCR-based method that can generate final results the day following sample analysis. It is based on an ISO compatible enrichment coupled to an easy and inexpensive DNA extraction and a consolidated Real-Time PCR assay. Thirteen laboratories from seven European Countries participated to this trial, and pork meat was selected as food model. The limit of detection observed was down to 10 CFU per 25 g of sample, showing excellent concordance and accordance values between samples and laboratories (100%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (100%) when the results obtained for the Real-Time PCR-based methods were compared to those of the ISO 6579:2002 standard method. The results of this international trial demonstrate that the evaluated Real-Time PCR-based method represents an excellent alternative to the ISO standard. In fact, it shows an equal and solid performance as well as it reduces dramatically the extent of the analytical process, and can be easily implemented routinely by the Competent Authorities and Food Industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Transcriptional control in Alicyclobacillus acidocaldarius and associated genes, proteins, and methods

    Science.gov (United States)

    Lee, Brady Deneys; Thompson, David N; Apel, William A.; Thompson, Vicki Slavchev; Reed, David W; Lacey, Jeffrey A

    2014-05-06

    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius are provided. Further provided are methods of modulating transcription or transcription or transcriptional control using isolated and/or purified polypeptides and nucleic acid sequences from Alicyclobacillus acidocaldarius.

  13. Transcriptional control in alicyclobacillus acidocaldarius and associated genes, proteins, and methods

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Brady D; Thompson, David N; Apel, William A; Thompson, Vicki S; Reed, David W; Lacey, Jeffrey A

    2016-11-22

    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius are provided. Further provided are methods of modulating transcription or transcription or transcriptional control using isolated and/or purified polypeptides and nucleic acid sequences from Alicyclobacillus acidocaldarius.

  14. Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay

    Directory of Open Access Journals (Sweden)

    Khandaker Shadia

    2012-01-01

    Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11

  15. Establishment of a sensitive system for analysis of human vaginal microbiota on the basis of rRNA-targeted reverse transcription-quantitative PCR.

    Science.gov (United States)

    Kurakawa, Takashi; Ogata, Kiyohito; Tsuji, Hirokazu; Kado, Yukiko; Takahashi, Takuya; Kida, Yumi; Ito, Masahiro; Okada, Nobuhiko; Nomoto, Koji

    2015-04-01

    Ten specific primer sets, for Lactobacillus gasseri, Lactobacillus crispatus, Atopobium vaginae, Gardnerella vaginalis, Mobiluncus curtisii, Chlamydia trachomatis/muridarum, Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, Bifidobacterium adolescentis, and Bifidobacterium angulatum, were developed for quantitative analysis of vaginal microbiota. rRNA-targeted reverse transcription-quantitative PCR (RT-qPCR) analysis of the vaginal samples from 12 healthy Japanese volunteers using the new primer sets together with 25 existing primer sets revealed the diversity of their vaginal microbiota: Lactobacilli such as L. crispatus, L. gasseri, Lactobacillus jensenii, Lactobacillus iners, and Lactobacillus vaginalis, as the major populations at 10(7) cells/ml vaginal fluid, were followed by facultative anaerobes such as Streptococcus and strict anaerobes at lower population levels of 10(4) cells/ml or less. Certain bacterial vaginosis (BV)-related bacteria, such as G. vaginalis, A. vaginae, M. curtisii, and Prevotella, were also detected in some subjects. Especially in one subject, both G. vaginalis and A. vaginae were detected at high population levels of 10(8.8) and 10(8.9) cells/ml vaginal fluid, suggesting that she is an asymptomatic BV patient. These results suggest that the RT-qPCR system is effective for accurate analysis of major vaginal commensals and diagnosis of several vaginal infections. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Comparison of reverse-transcription real-time PCR and immunohistochemistry for the detection of canine distemper virus infection in raccoons in Ontario, Canada.

    Science.gov (United States)

    Nemeth, Nicole M; Oesterle, Paul T; Campbell, G Douglas; Ojkic, Davor; Jardine, Claire M

    2018-03-01

    Canine distemper virus (CDV) is a widespread morbillivirus that causes subclinical to fatal infections in domestic and wild carnivores. Raccoons ( Procyon lotor) are CDV reservoirs and suffer from associated disease. Aspects of pathogenesis may lead to difficulty in the interpretation of commonly used testing modalities, such as reverse-transcription real-time (RT-rt)PCR and immunohistochemistry (IHC). The reliance upon such tests is greater for wildlife, which are often submitted as carcasses with no clinical history. We compared CDV RT-rtPCR results to immunohistochemistry (the gold standard) in tissues from 74 raccoons. These tests had high kappa agreement (lymph node: 0.9335; lung: 0.8671) and a negative correlation between IHC score and threshold cycle (Ct) value for lymph node and lung (Spearman rank correlation coefficient [ r s ] = -0.8555 and -0.8179, respectively; p < 0.00001). An RT-rtPCR Ct value of 30 in lung and lymph node with sensitivity and specificity of 92.3 and 92.6% and 86.8 and 96.4%, respectively, was suitable for determining CDV involvement. Conjunctival swabs provide an alternative for distemper diagnosis, as there was a strong correlation between Ct values of conjunctival swabs and tissues ( r s = -0.8498, p < 0.00001, n = 46). This information will aid in more efficient and accurate diagnoses in individuals, small-scale outbreaks, and epidemiologic investigations in wildlife.

  17. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    OpenAIRE

    Moura, André; Hodon, Mikael Arrais; Soares Filho, Paulo Martins; Issa, Marina de Azevedo; Oliveira, Ana Paula Ferreira de; Fonseca Júnior, Antônio Augusto

    2016-01-01

    ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evalua...

  18. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  19. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  20. A simple negative selection method to identify adenovirus recombinants using colony PCR

    Directory of Open Access Journals (Sweden)

    Yongliang Zhao

    2014-01-01

    Conclusions: The negative selection method to identify AdEasy adenovirus recombinants by colony PCR can identify the recombined colony within a short time-period, and maximally avoid damage to the recombinant plasmid by limiting recombination time, resulting in improved adenovirus packaging.

  1. A novel PCR-based method to enumerate Salmonella in animal feed

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Andersson, Gunnar; Häggblom, Per

    2010-01-01

    and pellets) only three gave results that differed between the PCR and MSRV methods. Ct values for naturally contaminated samples were higher compared to samples artificially contaminated with low numbers (approx. 2 CFU/25 g feed) of stressed Salmonella. To allow quantification of low numbers of Salmonella...

  2. DNA decontamination methods for internal quality management in clinical PCR laboratories.

    Science.gov (United States)

    Wu, Yingping; Wu, Jianyong; Zhang, Zhihui; Cheng, Chen

    2018-03-01

    The polymerase chain reaction (PCR) technique, one of the most commonly applied methods in diagnostic and molecular biology, has a frustrating downside: the occurrence of false-positive signals due to contamination. In previous research, various DNA decontamination methods have been developed to overcome this limitation. Unfortunately, the use of random or poorly focused sampling methods for monitoring air and/or object surfaces leads to the incomplete elimination during decontamination procedures. We herein attempted to develop a novel DNA decontamination method (environmental surveillance, including surface and air sampling) and quality management program for clinical molecular diagnostic laboratories (or clinical PCR laboratories). Here, we performed a step-by-step evaluation of current DNA decontamination methods and developed an effective procedure for assessing the presence of decontaminating DNA via PCR analysis. Performing targeted environmental surveillance by sampling, which reached optimal performance over 2 weeks, and the decontamination process had been verified as reliable. Additionally, the process was validated to not affect PCR amplification efficiency based on a comparative study. In this study, effective guidelines for DNA decontamination were developed. The method employed ensured that surface DNA contamination could be effectively identified and eliminated. Furthermore, our study highlighted the importance of overall quality assurance and good clinical laboratory practices for preventing contamination, which are key factors for compliance with regulatory or accreditation requirements. Taken together, we provided the evidence that the presented scheme ranged from troubleshooting to the elimination of surface contamination, could serve as critical foundation for developing regular environmental surveillance guidelines for PCR laboratories. © 2017 Wiley Periodicals, Inc.

  3. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    Directory of Open Access Journals (Sweden)

    Soares Fernando A

    2009-03-01

    Full Text Available Abstract Background HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC and fluorescence in situ hybridization (FISH. These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. Methods To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. Results The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4% and HER-2 transcript overexpression (20%. Moreover, 2+ immunostaining cases presented nonamplified status (50% by CISH and HER-2 downexpression (38.5% by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350. Conclusion Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene.

  4. Detection of Mycoplasma synoviae in clinical samples by VlhA-PCR method

    Directory of Open Access Journals (Sweden)

    H Ansari

    2010-02-01

    Full Text Available As one of the major pathogens of avian species, Mycoplasma Synoviae causes significant economic losses to the poultry industry. The main purpose of this study was to detect Mycoplasma Synoviae in clinical samples using the VlhA-PCR method. For serological screening test, 373 serum samples were collected from 25 breeder farms and rapid serum agglutination test conducted which revealed that 143 samples equivalent to 19 breeder farms were positive. For VlhA-PCR assay, 20 of the previously mentioned breeder farms were selected and sterile swab were collected from the palatine cleft, trachea, air sacs and lungs. Three swabs from 3 birds were placed in a test tube containing 1 ml of PBS and transferred to the laboratory for PCR test. Specific primers for VIhA gene were employed in this study. The PCR product from specific primers showed 350-400 bp for all field isolated on electrophoresis gel in 8 farms. VlhA-PCR with high sensitivity could be employed in definitive diagnosis of Mycoplasma Synoviae infection in the laboratory.

  5. Probe-based real-time PCR method for multilocus melt typing of Xylella fastidiosa strains.

    Science.gov (United States)

    Brady, Jeff A; Faske, Jennifer B; Ator, Rebecca A; Castañeda-Gill, Jessica M; Mitchell, Forrest L

    2012-04-01

    Epidemiological studies of Pierce's disease (PD) can be confounded by a lack of taxonomic detail on the bacterial causative agent, Xylella fastidiosa (Xf). PD in grape is caused by strains of Xylella fastidiosa subsp. fastidiosa, but is not caused by other subspecies of Xf that typically colonize plants other than grape. Detection assays using ELISA and qPCR are effective at detecting and quantifying Xf presence or absence, but offer no information on Xf subspecies or strain identity. Surveying insects or host plants for Xf by current ELISA or qPCR methods provides only presence/absence and quantity information for any and all Xf subspecies, potentially leading to false assessments of disease threat. This study uses a series of adjacent-hybridizing DNA melt analysis probes that are capable of efficiently discriminating Xf subspecies and strain relationships in rapid real-time PCR reactions. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.

    Science.gov (United States)

    Govan, V A; Brözel, V; Allsopp, M H; Davison, S

    1998-05-01

    Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.

  7. Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

    Science.gov (United States)

    Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

    1999-01-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

  8. Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

    Science.gov (United States)

    Torriani, S; Zapparoli, G; Dellaglio, F

    1999-10-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

  9. Identification of Suitable Reference Genes for Investigating Gene Expression in Anterior Cruciate Ligament Injury by Using Reverse Transcription-Quantitative PCR.

    Directory of Open Access Journals (Sweden)

    Mariana Ferreira Leal

    Full Text Available The anterior cruciate ligament (ACL is one of the most frequently injured structures during high-impact sporting activities. Gene expression analysis may be a useful tool for understanding ACL tears and healing failure. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR has emerged as an effective method for such studies. However, this technique requires the use of suitable reference genes for data normalization. Here, we evaluated the suitability of six reference genes (18S, ACTB, B2M, GAPDH, HPRT1, and TBP by using ACL samples of 39 individuals with ACL tears (20 with isolated ACL tears and 19 with ACL tear and combined meniscal injury and of 13 controls. The stability of the candidate reference genes was determined by using the NormFinder, geNorm, BestKeeper DataAssist, and RefFinder software packages and the comparative ΔCt method. ACTB was the best single reference gene and ACTB+TBP was the best gene pair. The GenEx software showed that the accumulated standard deviation is reduced when a larger number of reference genes is used for gene expression normalization. However, the use of a single reference gene may not be suitable. To identify the optimal combination of reference genes, we evaluated the expression of FN1 and PLOD1. We observed that at least 3 reference genes should be used. ACTB+HPRT1+18S is the best trio for the analyses involving isolated ACL tears and controls. Conversely, ACTB+TBP+18S is the best trio for the analyses involving (1 injured ACL tears and controls, and (2 ACL tears of patients with meniscal tears and controls. Therefore, if the gene expression study aims to compare non-injured ACL, isolated ACL tears and ACL tears from patients with meniscal tear as three independent groups ACTB+TBP+18S+HPRT1 should be used. In conclusion, 3 or more genes should be used as reference genes for analysis of ACL samples of individuals with and without ACL tears.

  10. A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans

    Science.gov (United States)

    Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.

    2000-01-01

    Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130

  11. Development and validation of a Q-PCR based TCID50 method for human herpesvirus 6

    Directory of Open Access Journals (Sweden)

    Gustafsson Rasmus K L

    2012-12-01

    Full Text Available Abstract Background For titer assessment of human herpesvirus 6 (HHV-6, IFA targeting viral proteins or a TCID50 method with ocular inspection for CPE can be used. These methods rely on the subjective decision of the assessor, obstructing the ability to obtain unanimous results. Findings We have developed and validated an alternative TCID50 read-out approach where infection in the titration culture plate is assessed by viral DNA load change by quantitative PCR. A ten time increase in viral DNA load was determined as cut point for infection since that yielded a maximum correlation with viral protein expression (93%. The average intra-assay CV was 9% for quantitative PCR read-out of TCID50 compared to 45% for ocular inspection read-out of TCID50, 14% for IFA read-out of TCID50, and 43% for an infectious units approach using IFA. The average inter-assay CV for quantitative PCR read-out of TCID50 was 73%, compared to 66%, 25% and 77% for the ocular inspection read-out for TCID50, IFA read-out of TCID50 and infectious unit approaches respectively. Conclusions The quantitative PCR based read-out of TCID50 proved to be more robust and easier to interpret than traditional TCID50 assessment approaches for HHV-6, and therefore it might be considered as an alternative method.

  12. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    Directory of Open Access Journals (Sweden)

    André Moura

    2016-07-01

    Full Text Available ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evaluated when combined with two real time PCRs. The DNeasy Blood & Tissue Kit from QIAGEN showed better performance and sensitivity followed by the DNA Mini Kit RBC and FTA Elute Micro Card. Results suggested that, even when the analytical sensitivity of the qPCR is very high, the extraction method can influence the diagnostic sensitivity.

  13. DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.

    Science.gov (United States)

    Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P

    2015-07-01

    Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.

  14. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  15. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments.

    Science.gov (United States)

    Ganger, Michael T; Dietz, Geoffrey D; Ewing, Sarah J

    2017-12-01

    qPCR has established itself as the technique of choice for the quantification of gene expression. Procedures for conducting qPCR have received significant attention; however, more rigorous approaches to the statistical analysis of qPCR data are needed. Here we develop a mathematical model, termed the Common Base Method, for analysis of qPCR data based on threshold cycle values (C q ) and efficiencies of reactions (E). The Common Base Method keeps all calculations in the logscale as long as possible by working with log 10 (E) ∙ C q , which we call the efficiency-weighted C q value; subsequent statistical analyses are then applied in the logscale. We show how efficiency-weighted C q values may be analyzed using a simple paired or unpaired experimental design and develop blocking methods to help reduce unexplained variation. The Common Base Method has several advantages. It allows for the incorporation of well-specific efficiencies and multiple reference genes. The method does not necessitate the pairing of samples that must be performed using traditional analysis methods in order to calculate relative expression ratios. Our method is also simple enough to be implemented in any spreadsheet or statistical software without additional scripts or proprietary components.

  16. Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

    Science.gov (United States)

    Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

    2012-08-15

    Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Application of a Receptor-Binding Capture Quantitative Reverse Transcription-PCR Assay To Concentrate Human Norovirus from Sewage and To Study the Distribution and Stability of the Virus

    Science.gov (United States)

    Yang, David; Pan, Liangwen; Mandrell, Robert

    2012-01-01

    Water is an important route for human norovirus (HuNoV) transmission. Using magnetic beads conjugated with blood group-like antigens (HuNoV receptors), we developed a simple and rapid receptor-binding capture and magnetic sequestration (RBCMS) method and compared it to the existing negatively charged membrane absorption/elution (NCMAE) method for concentrating HuNoV from sewage effluent. RBCMS required 6-fold-less sample volume than the NCMAE method and also resulted in a significantly higher yield of HuNoV. The NCMAE and RBCMS concentrations of genogroup I (GI) HuNoV measured by quantitative reverse transcription-PCR (qRT-PCR) resulted in average threshold cycle (CT) values of 34.68 (8.68 copies, 252-fold concentration) versus 34.07 (13.05 copies, 477-fold concentration), respectively; the NCMAE and RBCMS concentrations of genogroup II (GII) HuNoV were measured as average CT values of 33.32 (24.7 copies, 239-fold concentration) versus 32.38 (46.9 copies, 333-fold concentration), respectively. The specificity of qRT-PCR was confirmed by traditional RT-PCR and an RNase I protection assay. The qRT-PCR signal from RBCMS-concentrated HuNoV treated with RNase I indicated that it was from encapsidated RNA and, probably, viable virus. In contrast, the qRT-PCR signal from NCMAE-concentrated HuNoV was not protected from RNase I and, likely, degradation. Both GI and GII HuNoV were detected from sewage effluent samples collected between April and July with average concentrations of 7.8 × 103 genomic copies per liter (gc/liter) and 4.3 × 104 gc/liter, respectively. No GI and sewage samples stored at room temperature for 4 weeks. We conclude that RBCMS requires less sample volume, has better recovery and sensitivity, and is faster than NCMAE for detection of HuNoV in sewage. PMID:22101044

  18. Detection of Brucella melitensis and Brucella abortus strains using a single-stage PCR method

    Directory of Open Access Journals (Sweden)

    Alamian, S.

    2015-04-01

    Full Text Available Brucella melitensis and Brucella abortus are of the most important causes of brucellosis, an infectious disease which is transmitted either directly or indirectly including consuming unpasteurized dairy products. Both strains are considered endemic in Iran. Common diagnostic methods such as bacteriologic cultures are difficult and time consuming regarding the bacteria. The aim of this study was to suggest a single-stage PCR method using a pair of primers to detect both B. melitensis and B. abortus. The primers were named UF1 and UR1 and the results showed that the final size of PCR products were 84 bp and 99 bp for B. melitensis and B. abortus, respectively. Therefore the method could be useful for rapid detection of B. melitensis and B. abortus simultaneously.

  19. An external standard method for quantification of human cytomegalovirus by PCR

    International Nuclear Information System (INIS)

    Rongsen, Shen; Liren, Ma; Fengqi, Zhou; Qingliang, Luo

    1997-01-01

    An external standard method for PCR quantification of HCMV was reported. [α- 32 P]dATP was used as a tracer. 32 P-labelled specific amplification product was separated by agarose gel electrophoresis. A gel piece containing the specific product band was excised and counted in a plastic scintillation counter. Distribution of [α- 32 P]dATP in the electrophoretic gel plate and effect of separation between the 32 P-labelled specific product and free [α- 32 P]dATP were observed. A standard curve for quantification of HCMV by PCR was established and detective results of quality control templets were presented. The external standard method and the electrophoresis separation effect were appraised. The results showed that the method could be used for relative quantification of HCMV. (author)

  20. Comparison of three human papillomavirus DNA detection methods: Next generation sequencing, multiplex-PCR and nested-PCR followed by Sanger based sequencing.

    Science.gov (United States)

    da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui

    2016-05-01

    To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.

  1. Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.

    Science.gov (United States)

    Jamjoom, Manal; Sultan, Amal H

    2009-04-01

    The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity

  2. [Development and validation of event-specific quantitative PCR method for genetically modified maize LY038].

    Science.gov (United States)

    Mano, Junichi; Masubuchi, Tomoko; Hatano, Shuko; Futo, Satoshi; Koiwa, Tomohiro; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Takabatake, Reona; Kitta, Kazumi

    2013-01-01

    In this article, we report a novel real-time PCR-based analytical method for quantitation of the GM maize event LY038. We designed LY038-specific and maize endogenous reference DNA-specific PCR amplifications. After confirming the specificity and linearity of the LY038-specific PCR amplification, we determined the conversion factor required to calculate the weight-based content of GM organism (GMO) in a multilaboratory evaluation. Finally, in order to validate the developed method, an interlaboratory collaborative trial according to the internationally harmonized guidelines was performed with blind DNA samples containing LY038 at the mixing levels of 0, 0.5, 1.0, 5.0 and 10.0%. The precision of the method was evaluated as the RSD of reproducibility (RSDR), and the values obtained were all less than 25%. The limit of quantitation of the method was judged to be 0.5% based on the definition of ISO 24276 guideline. The results from the collaborative trial suggested that the developed quantitative method would be suitable for practical testing of LY038 maize.

  3. Increased efficacy for in-house validation of real-time PCR GMO detection methods.

    Science.gov (United States)

    Scholtens, I M J; Kok, E J; Hougs, L; Molenaar, B; Thissen, J T N M; van der Voet, H

    2010-03-01

    To improve the efficacy of the in-house validation of GMO detection methods (DNA isolation and real-time PCR, polymerase chain reaction), a study was performed to gain insight in the contribution of the different steps of the GMO detection method to the repeatability and in-house reproducibility. In the present study, 19 methods for (GM) soy, maize canola and potato were validated in-house of which 14 on the basis of an 8-day validation scheme using eight different samples and five on the basis of a more concise validation protocol. In this way, data was obtained with respect to the detection limit, accuracy and precision. Also, decision limits were calculated for declaring non-conformance (>0.9%) with 95% reliability. In order to estimate the contribution of the different steps in the GMO analysis to the total variation variance components were estimated using REML (residual maximum likelihood method). From these components, relative standard deviations for repeatability and reproducibility (RSD(r) and RSD(R)) were calculated. The results showed that not only the PCR reaction but also the factors 'DNA isolation' and 'PCR day' are important factors for the total variance and should therefore be included in the in-house validation. It is proposed to use a statistical model to estimate these factors from a large dataset of initial validations so that for similar GMO methods in the future, only the PCR step needs to be validated. The resulting data are discussed in the light of agreed European criteria for qualified GMO detection methods.

  4. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  5. Correlation Coefficients Between Different Methods of Expressing Bacterial Quantification Using Real Time PCR

    Directory of Open Access Journals (Sweden)

    Bahman Navidshad

    2012-02-01

    Full Text Available The applications of conventional culture-dependent assays to quantify bacteria populations are limited by their dependence on the inconsistent success of the different culture-steps involved. In addition, some bacteria can be pathogenic or a source of endotoxins and pose a health risk to the researchers. Bacterial quantification based on the real-time PCR method can overcome the above-mentioned problems. However, the quantification of bacteria using this approach is commonly expressed as absolute quantities even though the composition of samples (like those of digesta can vary widely; thus, the final results may be affected if the samples are not properly homogenized, especially when multiple samples are to be pooled together before DNA extraction. The objective of this study was to determine the correlation coefficients between four different methods of expressing the output data of real-time PCR-based bacterial quantification. The four methods were: (i the common absolute method expressed as the cell number of specific bacteria per gram of digesta; (ii the Livak and Schmittgen, ΔΔCt method; (iii the Pfaffl equation; and (iv a simple relative method based on the ratio of cell number of specific bacteria to the total bacterial cells. Because of the effect on total bacteria population in the results obtained using ΔCt-based methods (ΔΔCt and Pfaffl, these methods lack the acceptable consistency to be used as valid and reliable methods in real-time PCR-based bacterial quantification studies. On the other hand, because of the variable compositions of digesta samples, a simple ratio of cell number of specific bacteria to the corresponding total bacterial cells of the same sample can be a more accurate method to quantify the population.

  6. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Science.gov (United States)

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  7. Reverse transcription PCR-based detection of Crimean-Congo hemorrhagic fever virus isolated from ticks of domestic ruminants in Kurdistan province of Iran.

    Science.gov (United States)

    Fakoorziba, Mohammad Reza; Golmohammadi, Parvaneh; Moradzadeh, Rahmatollah; Moemenbellah-Fard, Mohammad Djaefar; Azizi, Kourosh; Davari, Behrooz; Alipour, Hamzeh; Ahmadnia, Sara; Chinikar, Sadegh

    2012-09-01

    Crimean-Congo hemorrhagic fever (CCHF) is a potentially fatal viral vector-borne zoonosis which has a mortality rate of up to 30% without treatment in humans. CCHF virus is transmitted to humans by ticks, predominantly from the Hyalomma genus. Following the report of two confirmed and one suspected death due to CCHF virus in Kurdistan province of Iran in 2007, this study was undertaken to determine the fauna of hard ticks on domestic ruminants (cattle, sheep, and goats) and their possible infection with CCHF virus using reverse transcription PCR technique. This is the first detection of CCHF virus in ticks from the Kurdistan province of Iran. Overall, 414 ixodid ticks were collected from two districts in this province. They represented four genera from which 10 separate species were identified. The Hyalomma genus was the most abundant tick genus (70%). It was the only genus shown to be infected with the CCHF virus using RT-PCR technique. The number of ticks positive for CCHF virus was 5 out of 90 (5.6%) adult ticks. The three remaining genera (Haemaphysalis, Rhipicephalus, and Dermacentor) were all negative following molecular survey. Four of the five virally-infected ticks were from cattle mainly in the Sanandaj district. We concluded that CCHF virus is present in the Hyalomma ticks on domestic ruminants (cattle) in Kurdistan province of Iran.

  8. Prevalence of periodontopathogenic bacteria in patients suffering from periodontitis using culture and PCR methods

    Directory of Open Access Journals (Sweden)

    Amir Aliramezani

    2012-01-01

    Full Text Available Background and Aims: Periodontitis is one of the most common oral diseases with the various incidence rates in different populations. A number of bacteria are considered as the major etiologic agents of periodontitis. The aim of the present study was to determine the prevalence of periodontopathogen bacteria in patients using both PCR and culture techniques.Materials and Methods: In this study, one-hundred patients (including 62 females and 38 males with an average age of 49±11.5 years with adult periodontitis referred to periodontics department of School of Dentistry/Tehran University of Medical Sciences were investigated. The samples were taken and sent immediately to the laboratory for culture and molecular evaluation. The PCR was performed using specific primers and the statistical analysis of data was performed using SPSS statistic software and McNemar test.Results: The results demonstrated that the total detection rate in culture method was 64%. The rate of Aggregatibacter actinomycetemcomitans (Aa was 28% which was significantly higher than that of Porphyromonas gingivalis (Pg (6% and Prevotella intermedia (Pi (3%. 27% of cases showed mixed bacterial growth. 65% of patients were positive using molecular method. The rate of Aa (30% was significantly higher than that of Pg (7% and Pi (5%. The mixed PCR positive rate containing of Aa, Pg and Pi was (23%.Conclusion: In this study, it was found that most of the bacteria isolated using culture and molecular methods were Aa, Pg and Pi, respectively. Although the detection frequencies of both techniques were similar, the specificity, sensitivity and bacterial detection speed of the PCR technique is obviously higher. Therefore, the use of molecular techniques is strongly recommended. However, both techniques seem to be suitable for microbiological diagnostics.

  9. Application of PCR-DGGE method for identification of nematode communities in pepper growing soil

    OpenAIRE

    Nguyen, Thi Phuong; Ha, Duy Ngo; Nguyen, Huu Hung; Duong, Duc Hieu

    2017-01-01

    Soil nematodes play an important role in indication for assessing soil environments and ecosystems. Previous studies of nematode community analyses based on molecular identification have shown to be useful for assessing soil environments. Here we applied PCR-DGGE method for molecular analysis of five soil nematode communities (designed as S1 to S5) collected from four provinces in Southeastern Vietnam (Binh Duong, Ba Ria Vung Tau, Binh Phuoc and Dong Nai) based on SSU gene. By sequencing DNA ...

  10. Detection and Identification of Free-living Amoeba from Environmental Water in Taiwan by PCR Method

    Science.gov (United States)

    Tsai, H. F.; Hsu, B. M.; Huang, K. H.; She, C. Y.; Kao, P. M.; Shen, S. M.; Tseng, S. F.; Chen, J. S.

    2012-04-01

    Acanthamoeba, Naegleria, Balamuthia and Hartmannella all belong to free-living amoebae that are present ubiquitously in the environment including water, soil, and air. Free-living amoebae are parasites which can infect humans and can lead to serious illness and even death. The aim of this study is to investigate the presence of free-living amoebae in aquatic environment in Taiwan, and to compare the differences between Acanthamoeba and Naegleria in diverse cultivation methods and conditions. In this study, we used molecular method by PCR amplification with specific primers to analyze the occurrence of free-living amoebae. We collected 176 samples from environmental water including drinking water treatment plants, stream water, and hot spring recreational areas in Taiwan. Based on the results of PCR, 43 water samples (24.4%) were detected positive for free-living amoebae. The most common Acanthamoeba genotype isolated from samples including T2, T4, T5, T12, and T15. N. australiensis and N. lovaniensis were also identified by molecular biology techniques. Furthermore, we found that both Acanthamoeba and Naegleria can be cultured by PYG in 30° C, but not all free-living amoebae can be isolated and enriched by using storage-cultivation method. Because of the widespread presence of Acanthamoeba and Naegleria in aquatic environments, the water quality and safety of aquatic environments should be more conscious in Taiwan and worldwide. Keywords: free-living amoebae; Acanthamoeba; Naegleria; Balamuthia; Hartmannella; PCR

  11. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  12. Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

    Directory of Open Access Journals (Sweden)

    Javad Mohammadi

    2017-06-01

    Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

  13. A method for accurate detection of genomic microdeletions using real-time quantitative PCR

    Directory of Open Access Journals (Sweden)

    Bassett Anne S

    2005-12-01

    Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a well-established method for quantifying levels of gene expression, but has not been routinely applied to the detection of constitutional copy number alterations of human genomic DNA. Microdeletions or microduplications of the human genome are associated with a variety of genetic disorders. Although, clinical laboratories routinely use fluorescence in situ hybridization (FISH to identify such cryptic genomic alterations, there remains a significant number of individuals in which constitutional genomic imbalance is suspected, based on clinical parameters, but cannot be readily detected using current cytogenetic techniques. Results In this study, a novel application for real-time qPCR is presented that can be used to reproducibly detect chromosomal microdeletions and microduplications. This approach was applied to DNA from a series of patient samples and controls to validate genomic copy number alteration at cytoband 22q11. The study group comprised 12 patients with clinical symptoms of chromosome 22q11 deletion syndrome (22q11DS, 1 patient trisomic for 22q11 and 4 normal controls. 6 of the patients (group 1 had known hemizygous deletions, as detected by standard diagnostic FISH, whilst the remaining 6 patients (group 2 were classified as 22q11DS negative using the clinical FISH assay. Screening of the patients and controls with a set of 10 real time qPCR primers, spanning the 22q11.2-deleted region and flanking sequence, confirmed the FISH assay results for all patients with 100% concordance. Moreover, this qPCR enabled a refinement of the region of deletion at 22q11. Analysis of DNA from chromosome 22 trisomic sample demonstrated genomic duplication within 22q11. Conclusion In this paper we present a qPCR approach for the detection of chromosomal microdeletions and microduplications. The strategic use of in silico modelling for qPCR primer design to avoid regions of repetitive

  14. Estimation of Tissue Distribution of mRNA Transcripts for Desaturase and Elongase Enzymes in Channa striata (Bloch, 1793 Fingerlings using PCR Technique

    Directory of Open Access Journals (Sweden)

    M. Aliyu-Paiko

    2013-06-01

    Full Text Available Fish species are varied in their capacity to biosynthesize n-3 highlyunsaturated fatty acids (HUFA such as eicosapentaenoic and docosahexaenoic acids (EPA & DHA that are crucial to the health and well-being of all higher vertebrates. Experts report that HUFA metabolism involves enzyme-mediated fatty acyl desaturation (FAD and elongation (FAE processes. In previous studies, different workers cloned, characterized, identified and reported several genes for FAD and FAE enzymes in different fish species such as Atlantic salmon, gilthead seabream, rainbow trout and zebrafish, and also demonstrated the up- and down-regulation in the activity of these enzymes in response to fluctuations in dietary HUFA. In this paper, we report on the expression of genes (mRNA transcripts for FAD and FAE enzymes in different tissues of Channa striata (Bloch, 1793 fingerling, to evaluate the tissues of the fish in which activity of both enzymes are high. To achieve this objective, we used conventional polymerase chain reaction (PCR technique to isolate and quantify the absolute copy number for each gene transcripts from 8 different tissues of the fish (reared with a commercial feed. Our estimate show that the distribution of the 2 enzyme transcripts were significantly (P < 0.05 higher in the liver and brain of C. striata than detected in the 6 other tissues evaluated (muscle, ovary, testis, intestine, kidney and skin. Subsequently, we discuss here extensively, the implication of this observation with respect to the use of vegetable oils (VO as substitute to fish oil (FO in diets for freshwater fish species.

  15. Droplet digital PCR as a novel detection method for quantifying microRNAs in acute myocardial infarction.

    Science.gov (United States)

    Robinson, S; Follo, M; Haenel, D; Mauler, M; Stallmann, D; Tewari, M; Duerschmied, D; Peter, K; Bode, C; Ahrens, I; Hortmann, M

    2018-04-15

    micro-RNAs have shown promise as potential biomarkers for acute myocardial infarction and ischemia-reperfusion injury (I/R). Most recently droplet digital polymerase chain reaction (ddPCR) has been introduced as a more reliable and reproducible method for detecting micro-RNAs. We aimed to demonstrate the improved technical performance and diagnostic potential of ddPCR by measuring micro-RNAs in ST-elevation myocardial infarction (STEMI). A dilution series was performed in duplicate on synthetic Caenorrhabditis elegans-miR-39, comparing quantitative real-time PCR (qRT-PCR) and ddPCR. We used ddPCR and qRT-PCR to quantify the serum levels of miR-21, miR-208a and miR-499 between STEMI patients (n=24) and stable coronary artery disease (CAD) patients (n=20). In STEMI, I/R injury was assessed via measurement of ST-segment resolution. In the dilution series, ddPCR demonstrated superior coefficient of variation (12.1%vs.32.9%) and limit of detection (0.9325 vs.2.425copies/μl). In the patient cohort, ddPCR demonstrated greater differences in miR-21 levels (2190.5 vs. 484.7copies/μl; p=0.0004 for ddPCR and 136.4 vs. 122.8copies/μl; p=0.2273 for qRT-PCR) and in miR-208a (0 vs. 24.1copies/μl, p=0.0013 for ddPCR and 0 vs. 0copies/μl, p=0.0032 for qRT-PCR), with similar differences observed in miR-499 levels (9.4 vs. 81.5copies/μl, pPCR). ddPCR also more accurately defined STEMI for all miRNAs (area under the curve (AUC) of 0.8021/0.7740/0.9063 for miR-21/208a/499 with ddPCR vs. AUC of 0.6083/0.6917/0.8417 with qRT-PCR). However, there was no association between miR-21/208a/499 levels and ischemia-reperfusion injury. ddPCR demonstrates superiority in both technical performance and diagnostic potential compared to qRT-PCR. Ultimately, this supports its use as a diagnostic method for quantifying micro-RNAs, particularly in large multi-center trials. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Frequency of Chlamydia trachomatis in genital specimens: kerman city, PCR method

    Directory of Open Access Journals (Sweden)

    Khalili M

    2008-06-01

    Full Text Available Background: Chlamydia trachomatis (CT is an obligate intracellular bacterium that causes genital disease and the most common sexually transmitted infection in the world. The most frequent risk factors associated with chlamydial infection are related to sexual behavior, multiple partners, and inconsistent condom use. Presenting primarily as urtheritis in men and cervicitis in women, CT a major cause of chronic pelvic inflammatory disease and subsequent infertility in women, eye and lung infection in newborns and other manifestations. Identification of CT-infected patients may prevent its spread and thereby reduce the high morbidity associated with CT infections. Polymerase chain reaction (PCR is a sensitive and specific method for the detection of small quantity of bacterial DNA in clinical samples. The aim of this study was to determine the frequency of C. trachomatis by PCR in genital samples from patients in the city of Kerman.Methods: A total of 130 genital samples including 64 endocervical and 66 urethral swab samples were collected by physicians. Nucleic acid was extracted from each sample using a commercial DNA extraction kit. PCR primers specific for a conserved region of the C. trachomatis omp2 gene, encoding an outer membrane protein, were used for amplification.  Results: A total of 9.2% (6.25% of cervicitis and 12.1% of urethritis of the samples were found positive for CT using this PCR method. Conclusions:  The present study shows a high prevalence of CT infection, especially in men with urethritis. Such patients should be referred to genitourinary clinics for treatment and partner notification. Given its worldwide prevalence, further CT studies on more populations are needed to assess potential public health implications of these infections.

  17. Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method

    Directory of Open Access Journals (Sweden)

    Eva Renčová

    2014-01-01

    Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.

  18. Testing the sensitivity of Nested PCR method to detect Aspergillus fumigates in experimentally infected Sputum samples

    International Nuclear Information System (INIS)

    Ramadan, A.; Soukkaria, S.

    2013-01-01

    Fungal infections caused by Aspergillus species generally are occupying a second place among invasive fungal infections in the world, especially A. fumigatus, which is considered the main cause of invasive Aspergillosis (IA). Although IA rarely infects immunocompetent individuals, however, it can lead to death in immunocompromised patients. Therefore, it is necessary to diagnose the infection early in order to treat the disease efficiently. However, the conventional diagnostic tools, currently used to detect infections, has low sensitivity and reliability. Polymerase chain reaction (PCR) technology distribution as a molecular and high sensitive technology has allowed us to make comparative study between sensitivity of traditional currently used diagnostic method and Nested-PCR, the result of the study of sputum samples that experimentally infected with different concentrations of A.fumigatus spores ramping from 10 to10 6 spore/ml, have high sensitivity and specificity of Nested-PCR in detecting the lower concentrations, comparing with traditional diagnostic method (culture on Sabouraud media) that were negative in all concetrations. (author)

  19. Evaluation of NGS and RT-PCR Methods for ALK Rearrangement in European NSCLC Patients: Results from the European Thoracic Oncology Platform Lungscape Project.

    Science.gov (United States)

    Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota; Smyth, Paul; Soltermann, Alex; Bubendorf, Lukas; Speel, Ernst-Jan; Marchetti, Antonio; Nonaka, Daisuke; Monkhorst, Kim; Hager, Henrik; Martorell, Miguel; Sejda, Aleksandra; Cheney, Richard; Hernandez-Losa, Javier; Verbeken, Eric; Weder, Walter; Savic, Spasenija; Di Lorito, Alessia; Navarro, Atilio; Felip, Enriqueta; Warth, Arne; Baas, Paul; Meldgaard, Peter; Blackhall, Fiona; Dingemans, Anne-Marie; Dienemann, Hendrik; Dziadziuszko, Rafal; Vansteenkiste, Johan; O'Brien, Cathal; Geiger, Thomas; Sherlock, Jon; Schageman, Jeoffrey; Dafni, Urania; Kammler, Roswitha; Kerr, Keith; Thunnissen, Erik; Stahel, Rolf; Peters, Solange

    2018-03-01

    The reported prevalence of ALK receptor tyrosine kinase gene (ALK) rearrangement in NSCLC ranges from 2% to 7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proved to be a reproducible and sensitive technique. Reverse-transcriptase polymerase chain reaction (RT-PCR) has also been advocated, and most recently, the advent of targeted next-generation sequencing (NGS) for ALK and other fusions has become possible. This study compares anaplastic lymphoma kinase (ALK) evaluation with all four techniques in resected NSCLC from the large European Thoracic Oncology Platform Lungscape cohort. A total of 96 cases from the European Thoracic Oncology Platform Lungscape iBiobank, with any ALK immunoreactivity were examined by FISH, central RT-PCR, and NGS. An H-score higher than 120 defines IHC positivity. RNA was extracted from the same formalin-fixed, paraffin-embedded tissues. For RT-PCR, primers covered the most frequent ALK translocations. For NGS, the Oncomine Solid Tumour Fusion Transcript Kit (Thermo Fisher Scientific, Waltham, MA) was used. The concordance was assessed using the Cohen κ coefficient (two-sided α ≤ 5%). NGS provided results for 77 of the 95 cases tested (81.1%), whereas RT-PCR provided results for 77 of 96 (80.2%). Concordance occurred in 55 cases of the 60 cases tested with all four methods (43 ALK negative and 12 ALK positive). Using ALK copositivity for IHC and FISH as the criterion standard, we derived a sensitivity for RT-PCR/NGS of 70.0%/85.0%, with a specificity of 87.1%/79.0%. When either RT-PCR or NGS was combined with IHC, the sensitivity remained the same, whereas the specificity increased to 88.7% and 83.9% respectively. NGS evaluation with the Oncomine Solid Tumour Fusion transcript kit and RT-PCR proved to have high sensitivity and specificity, advocating their use in routine practice. For maximal sensitivity and specificity, ALK status should be

  20. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

    2000-01-01

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  1. Sampling methods for rumen microbial counts by Real-Time PCR techniques

    Directory of Open Access Journals (Sweden)

    S. Puppo

    2010-02-01

    Full Text Available Fresh rumen samples were withdrawn from 4 cannulated buffalo females fed a fibrous diets in order to quantify bacteria concentration in the rumen by Real-Time PCR techniques. To obtain DNA of a good quality from whole rumen fluid, eight (M1-M8 different pre-filtration methods (cheese cloths, glass-fibre and nylon filter in combination with various centrifugation speeds (1000, 5000 and 14,000 rpm were tested. Genomic DNA extraction was performed either on fresh or frozen samples (-20°C. The quantitative bacteria analysis was realized according to Real-Time PCR procedure for Butyrivibrio fibrisolvens reported in literature. M5 resulted the best sampling procedure allowing to obtain a suitable genomic DNA. No differences were revealed between fresh and frozen samples.

  2. A Comparison of Molecular Typing Methods Applied to Enterobacter cloacae complex: hsp60 Sequencing, Rep-PCR, and MLST

    Directory of Open Access Journals (Sweden)

    Roberto Viau

    2017-02-01

    Full Text Available Molecular typing using repetitive sequenced-based PCR (rep-PCR and hsp60 sequencing were applied to a collection of diverse Enterobacter cloacae complex isolates. To determine the most practical method for reference laboratories, we analyzed 71 E. cloacae complex isolates from sporadic and outbreak occurrences originating from 4 geographic areas. While rep-PCR was more discriminating, hsp60 sequencing provided a broader and a more objective geographical tracking method similar to multilocus sequence typing (MLST. In addition, we suggest that MLST may have higher discriminative power compared to hsp60 sequencing, although rep-PCR remains the most discriminative method for local outbreak investigations. In addition, rep-PCR can be an effective and inexpensive method for local outbreak investigation.

  3. Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

    DEFF Research Database (Denmark)

    Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina

    2013-01-01

    in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...

  4. Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Krause, Michael; Josefsen, Mathilde Hartmann

    2009-01-01

    of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non....... Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially...... contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion: The real-time PCR method for detection of Salmonella in meat and carcass swabs was validated in comparative and collaborative trials according to NordVal recommendations. The PCR method...

  5. A PCR-based method for identification of bifidobacteria from the human alimentary tract at the species level

    NARCIS (Netherlands)

    Venema, K.; Maathuis, A.J.H.

    2003-01-01

    A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12

  6. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  7. Development of PCR-based detection methods for the quarantine phytopathogen Synchytrium endobioticum, causal agent of wart disease

    NARCIS (Netherlands)

    Boogert, van den P.H.J.F.; Gent-Pelzer, van M.P.E.; Bonants, P.J.M.; Boer, de S.H.; Wander, J.G.N.; Lévesque, C.A.; Leeuwen, van G.C.M.; Baayen, R.P.

    2005-01-01

    Abstract PCR-based methods were developed for the detection and quantification of the potato pathogen Synchytrium endobioticum in soil extracts and in planta. PCR primers, based on the internal transcribed spacer region of the multi-copy gene rDNA were tested for specificity, sensitivity and

  8. Investigations on the frequency of norovirus contamination of ready-to-eat food items in Istanbul, Turkey, by using real-time reverse transcription PCR.

    Science.gov (United States)

    Yilmaz, Aysun; Bostan, Kamil; Altan, Eda; Muratoglu, Karlo; Turan, Nuri; Tan, Derya; Helps, Christopher; Yilmaz, Huseyin

    2011-05-01

    Investigation of norovirus (NoV) contamination of food items is important because many outbreaks occur after consumption of contaminated shellfish, vegetables, fruits, and water. The frequency of NoV contamination in food items has not previously been investigated in Turkey. The aim of this study was to investigate the frequency of human NoV genogroups (G) I and II in ready-to-eat tomatoes, parsley, green onion, lettuce, mixed salads, and cracked wheat balls. RNA was extracted with the RNeasy Mini Kit, and a real-time reverse transcription (RT) PCR assay was performed using primers specific for NoV GI and GII. Among the 525 samples analyzed, NoV GII was detected in 1 green onion sample and 1 tomato sample by both SYBR Green and TaqMan real-time RT-PCR assays; no GI virus was detected. The Enterobactericaeae and Escherichia coli levels in the NoV-positive green onion were 6.56 and 1.28 log CFU/g, and those in the tomato were 5.55 and 1.30 log CFU/g, respectively. No significant difference in the bacterial levels was found between the NoV-positive and NoV-negative samples. This study is the first in which NoV GII was found in ready-to-eat food collected from Istanbul, Turkey; thus, these foods may be considered a risk to human health. Epidemiological studies and measures to prevent NoV infection should be considered.

  9. Comparison of Resistant and Susceptible Strains of Trichomons vaginalis to Metronidazole Using PCR Method

    Directory of Open Access Journals (Sweden)

    M Fallah

    2012-09-01

    Full Text Available Background: Metronidazole is drug of choice recommended by WHO for treatment of trichomoniasis, however, some reports claims drug resistance in Trichomonas vaginalis isolates recently. The objective of this study was to determine the minimum lethal concentration (MLC of metronidazole in resistant and sensitive strains, as well as genetic patterns of these stains by PCR method. Methods: From February 2006 to March 2007, in a cross sectional study, clinical and wet mount examination of vaginal smear along with culture were performed on 683 women attending to public and private outpatient clinics in Hamadan. Trichomoniasis marked based on major clinical symptoms. Diagnosis confirmed using wet mount microscopically and culture in Diamond medium. A serial concentration of metronidazole was provided and all isolated Trichomonas strains (resistant and sensitive tested by standard method. Finally, all sensitive and resistant strains examined by PCR technique. Results: Only 15/683, (2.2% of patients clinically diagnosed trichomonal vaginitis were positive for T. vaginalis by wet smear and culture. The minimum lethal concentration (MLC for clinically sensitive isolates was 25 µg/ml; however, this concentration for resistant isolates was 200 µg/ml after 24 h and 100 µg/ml after 50 h. The results of PCR examination of DNA from sensitive and resistant isolates had same pattern. The lanes appeared by two primers were 98 bp and 261 bp for both clinically sensitive and resistant strains. Conclusion: Resistance to metronidazole in T. vaginalis has not relation to genetic variations and might be related to some physiologic pathways of organism.

  10. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures.

    Science.gov (United States)

    McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and

  11. Clinical evaluation of β-tubulin real-time PCR for rapid diagnosis of dermatophytosis, a comparison with mycological methods.

    Science.gov (United States)

    Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi

    2017-10-01

    Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.

  12. Molecular analysis of the genera eremopyrum (ledeb). jaub. and spach and agropyron gaertner (poaceae) by pcr methods

    International Nuclear Information System (INIS)

    Yilmaz, R.; Cabi, E.; Dogan, M.

    2014-01-01

    RAPD-PCR (Random Amplified Polymorphic DNA Polymerase Chain Reaction) and Post PCR (Polymerase Chain Reaction) Melting Curve Analysis (MCA) have been used to investigate the pattern of genetic variation among some species in the genera Eremopyrum (Ledeb.) Jaub. and Spach and Agropyron Gaertner (Poaceae). Thirteen primers have been used in the study based on the RAPD-PCR and MCA analyses. Each species produced a distinct pattern of DNA fragments which have been used as a measure of the degree of relationship between species by means of using the RAPD-PCR results with three primers selected for identifying the genetic similarities. Polymorphic melting profiles have been obtained with Post PCR MCA method using three primers. Genetic similarities are calculated for all the species studied with RAPD-PCR and MCA methods, the dendrograms are obtained with the MVSP (Multi Variate Statistical Package) software using UPGMA (Unweighted Pair Group Method with Arithmetic Averages) and Jaccard's Coefficient. Polymorphism between 18 populations of Eremopyrum and 6 Agropyron populations and within the species are determined by using RAPD-PCR and Post PCR melting curve analysis (MCA) respectively. (author)

  13. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures

    OpenAIRE

    McMahon, Tanis C.; Blais, Burton W.; Wong, Alex; Carrillo, Catherine D.

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin (stx) and intimin (eae)]. However, false positives arise when complex food matrices, such as beef, contain mixtu...

  14. Detection of Mycoplasma synoviae infection in broiler breeder farms of Tehran province using PCR and culture methods

    Directory of Open Access Journals (Sweden)

    Elhamnia, F.

    2010-07-01

    Full Text Available Mycoplasma synoviae (MS is an important avian pathogen that can cause both respiratory disease and joint inflammation synovitis in poultry, inducing economic losses to the Iranian chicken industry especially breeder farms. The aim of this study was to use the MS specific PCR and culture methods in order to detect of M. synoviae from breeder farms where located in Tehran province. A total of 475 samples including choanal cleft, trachea, ovary and /or joint cavities from 23 broiler breeder farms of Tehran area were collected. Samples were cultured in PPLO broth media supplemented for MS isolation. The bacteria DNAs were extracted by phenol/chloroform method. Specific published primers amplify a 207 bp region of the 16S rRNA gene of MS were used for PCR method. Out of 475 samples, 146 cultures were shown positive and typical Mycoplasma colonies, 85 samples were also identified MS based on agglutination test with specific MS antiserum and the PCR method. A total of 122 samples, a band with 207 bp was shown as MS specific PCR product in electrophoresis. In addition to these 85 samples that were positives in both culture and PCR, 37 samples that had not grown in Mycoplasma media were positive in MS specific PCR. A total of 292 samples were negatives in both culture and PCR methods. 122 positive samples out of 475 samples (25.7% were belonged to 7 breeder farms (30.4%. On conclusions, the MS infection of broiler breeder farms of Tehran area was confirmed truly. From the results, as the PCR method reduces the time consuming, an effectiveness and efficient for detection of M. synoviae infection of chicken breeder. It is then suggested that the PCR method could be an alternative method for culturing.

  15. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  16. Verification of animal species in ham and salami by dna microarray and real time pcr methods

    Directory of Open Access Journals (Sweden)

    Zuzana Drdolová

    2017-01-01

    Full Text Available Consumer protection and detecting of adulteration is very important and has a wide societal impact in the economic sphere. Detection of animal species in meat products and the use of combining different methods is one of the means to achieve relevant product status. The aim of this study was to reveal whether or not the products label clearly meets the content declared by producer. In our study, 29 samples of meat products such as salami and ham obtained from stores and supermarkets in Slovakia were analyzed to detect the existing animal species according to the product label the use of Chipron LCD Array Analysis System, Meat 5.0. Products in which the presence of non-declared animal species has been detected were subjected to testing by the innuDETECT PCR Real-Time Kit, repeatedly. The results showed that 20 (68.96% samples were improperly labeled. From in total 14 tested ham samples 11 (78.57% products exhibited non-conformity with declared composition. Tested salami samples (15 revealed 9 (60% incorrectly labelled products. The results obtained by DNA Microarray and Real Time PCR methods were identical, and both methods should be extensively promoted for the detection of animal species in the meat and meat products. Normal 0 21 false false false EN-GB X-NONE X-NONE

  17. PCR-RFLP diagnostic method for identifying Globodera species in Slovenia

    Directory of Open Access Journals (Sweden)

    Sasa ŠIRCA

    2011-01-01

    Full Text Available Species identification within the genus Globodera is based on the morphological and morphometrical characters of the cysts and second stage juveniles, and these are included in the majority of identification keys. Morphometrical methods are fast and can be applied to most of samples but they demand a trained and experienced specialist. Furthermore, some morphometrical characters may overlap between populations and beetwen species, leading to inaccurate identification. To confirm and complement the morphometrical identification of Globodera species molecular methods have been developed. Sequences of the internal transcribed spacer regions ITS1 and ITS2 of the rDNA gene cluster proved to be useful for identifying nematode species identification. A PCR-RFLP molecular method was used to identify Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae. Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae can be distinguished with PCR-RFLP analysis of the rDNA ITS fragment using five restriction enzymes. The RFLP patterns of G. rostochiensis, G. tabacum and G. achilleae were species-specific, while those of G. pallida varied. South American populations of G. pallida differed from other populations as their RFLP patterns were demonstrated to be distinct by in silico restriction of the ITS sequences deposited at NCBI.

  18. Novel methods of cytokine detection: Real-time PCR, ELISPOT, and intracellular cytokine staining

    Directory of Open Access Journals (Sweden)

    Eliza Turlej

    2009-05-01

    Full Text Available Cytokines are small hormone-like proteins that play important roles in immune system control. Cytokines regulate the proliferation and differentiation of cells and hematopoiesis and act as mediators in the inflammatory reaction. Changes in cytokine levels are found in many diseases, such as sepsis, bowel inflammatory disease, autoimmune diseases, as well as graft-versus-host disease. Cytokines levels can be detected using in vivo, in vitro, and ex vivo techniques. The level of cytokine produced can be measured by immunoenzymatic test (ELISA in supernatant after cell culture with the addition of stimulant and in plasma by techniques that measure the level of cytokine secretion in cells (e.g. immunohistochemical staining, ELISPOT, and intracellular cytokine staining, and by molecular biological methods (RPA, real-time PCR, in situ hybridization, and Northern blot. Detection of cytokine mRNA in tissues is useful in the direct determination of heterogenic populations of cytokine-producing cells. Nowadays the most frequently used methods for measuring cytokine level are ELISPOT, intracellular cytokine staining with flow cytometry detection, and real-time PCR. These methods have an important clinical role in vaccine efficacy, in viral, bacterial, and verminous diagnostics, and in determining the efficacy of cancer treatment.

  19. Molecular typing of uropathogenic E. coli strains by the ERIC-PCR method.

    Science.gov (United States)

    Ardakani, Maryam Afkhami; Ranjbar, Reza

    2016-04-01

    Escherichia coli (E. coli) is the most common cause of urinary infections in hospitals. The aim of this study was to evaluate the ERIC-PCR method for molecular typing of uropathogenic E. coli strains isolated from hospitalized patients. In a cross sectional study, 98 E. coli samples were collected from urine samples taken from patients admitted to Baqiyatallah Hospital from June 2014 to January 2015. The disk agar diffusion method was used to determine antibiotic sensitivity. DNA proliferation based on repetitive intergenic consensus was used to classify the E. coli strains. The products of proliferation were electrophoresed on 1.5% agarose gel, and their dendrograms were drawn. The data were analyzed by online Insillico software. The method used in this research proliferated numerous bands (4-17 bands), ranging from 100 to 3000 base pairs. The detected strains were classified into six clusters (E1-E6) with 70% similarity between them. In this study, uropathogenic E. coli strains belonged to different genotypic clusters. It was found that ERIC-PCR had good differentiation power for molecular typing of uropathogenic E. coli strains isolated from the patients in the study.

  20. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Directory of Open Access Journals (Sweden)

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  1. Transcription-based prediction of response to IFNbeta using supervised computational methods.

    Directory of Open Access Journals (Sweden)

    Sergio E Baranzini

    2005-01-01

    Full Text Available Changes in cellular functions in response to drug therapy are mediated by specific transcriptional profiles resulting from the induction or repression in the activity of a number of genes, thereby modifying the preexisting gene activity pattern of the drug-targeted cell(s. Recombinant human interferon beta (rIFNbeta is routinely used to control exacerbations in multiple sclerosis patients with only partial success, mainly because of adverse effects and a relatively large proportion of nonresponders. We applied advanced data-mining and predictive modeling tools to a longitudinal 70-gene expression dataset generated by kinetic reverse-transcription PCR from 52 multiple sclerosis patients treated with rIFNbeta to discover higher-order predictive patterns associated with treatment outcome and to define the molecular footprint that rIFNbeta engraves on peripheral blood mononuclear cells. We identified nine sets of gene triplets whose expression, when tested before the initiation of therapy, can predict the response to interferon beta with up to 86% accuracy. In addition, time-series analysis revealed potential key players involved in a good or poor response to interferon beta. Statistical testing of a random outcome class and tolerance to noise was carried out to establish the robustness of the predictive models. Large-scale kinetic reverse-transcription PCR, coupled with advanced data-mining efforts, can effectively reveal preexisting and drug-induced gene expression signatures associated with therapeutic effects.

  2. A digital PCR method for identifying and quantifying adulteration of meat species in raw and processed food.

    Directory of Open Access Journals (Sweden)

    Junan Ren

    Full Text Available Meat adulteration is a worldwide concern. In this paper, a new droplet digital PCR (ddPCR method was developed for the quantitative determination of the presence of chicken in sheep and goat meat products. Meanwhile, a constant (multiplication factor was introduced to transform the ratio of copy numbers to the proportion of meats. The presented ddPCR method was also proved to be more accurate (showing bias of less than 9% in the range from 5% to 80% than real-time PCR, which has been widely used in this determination. The method exhibited good repeatability and stability in different thermal treatments and at ultra-high pressure. The relative standard deviation (RSD values of 5% chicken content was less than 5.4% for ultra-high pressure or heat treatment. Moreover, we confirmed that different parts of meat had no effect on quantification accuracy of the ddPCR method. In contrast to real-time PCR, we examined the performance of ddPCR as a more precise, sensitive and stable analytical strategy to overcome potential problems of discrepancies in amplification efficiency discrepancy and to obtain the copy numbers directly without standard curves. The method and strategy developed in this study can be applied to quantify the presence and to confirm the absence of adulterants not only to sheep but also to other kinds of meat and meat products.

  3. A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

    Directory of Open Access Journals (Sweden)

    M Heydarnezhadi

    2011-09-01

    Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

  4. Comparison of PCR and quantitative real-time PCR methods for the characterization of ruminant and cattle fecal pollution sources

    Science.gov (United States)

    The state of California has mandated the preparation of a guidance document on the application of fecal source identification methods for recreational water quality management. California contains the fifth highest population of cattle in the United States, making the inclusio...

  5. Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique

    Directory of Open Access Journals (Sweden)

    Hyoung Rai Ko

    2017-09-01

    Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.

  6. Development of a qPCR method to rapidly assess the function of NKT cells.

    Science.gov (United States)

    Sohn, Silke; Tiper, Irina; Japp, Emily; Sun, Wenji; Tkaczuk, Katherine; Webb, Tonya J

    2014-05-01

    NKT cells comprise a rare, but important subset of T cells which account for ~0.2% of the total circulating T cell population. NKT cells are known to have anti-tumor functions and rapidly produce high levels of cytokines following activation. Several clinical trials have sought to exploit the effector functions of NKT cells. While some studies have shown promise, NKT cells are approximately 50% lower in cancer patients compared to healthy donors of the same age and gender, thus limiting their therapeutic efficacy. These studies indicate that baseline levels of activation should be assessed before initiating an NKT cell based immunotherapeutic strategy. The goal of this study was to develop a sensitive method to rapidly assess NKT cell function. We utilized artificial antigen presenting cells in combination with qPCR in order to determine NKT cell function in peripheral blood mononuclear cells from healthy donors and breast cancer patients. We found that NKT cell activation can be detected by qPCR, but not by ELISA, in healthy donors as well as in breast cancer patients following four hour stimulation. This method utilizing CD1d-expressing aAPCs will enhance our knowledge of NKT cell biology and could potentially be used as a novel tool in adoptive immunotherapeutic strategies. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Bovine Papillomavirus in Brazil: Detection of Coinfection of Unusual Types by a PCR-RFLP Method

    Directory of Open Access Journals (Sweden)

    R. F. Carvalho

    2013-01-01

    Full Text Available Bovine papillomavirus (BPV is recognized as a causal agent of benign and malignant tumors in cattle. Thirteen types of BPV are currently characterized and classified into three distinct genera, associated with different pathological outcomes. The described BPV types as well as other putative ones have been demonstrated by molecular biology methods, mainly by the employment of degenerated PCR primers. Specifically, divergences in the nucleotide sequence of the L1 gene are useful for the identification and classification of new papillomavirus types. On the present work, a method based on the PCR-RFLP technique and DNA sequencing was evaluated as a screening tool, allowing for the detection of two relatively rare types of BPV in lesions samples from a six-year-old Holstein dairy cow, chronically affected with cutaneous papillomatosis. These findings point to the dissemination of BPVs with unclear pathogenic potential, since two relatively rare, new described BPV types, which were first characterized in Japan, were also detected in Brazil.

  8. Use of real-time PCR to evaluate two DNA extraction methods from food

    Directory of Open Access Journals (Sweden)

    Maria Regina Branquinho

    2012-03-01

    Full Text Available The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R² demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.

  9. Detection of Candida species by nested PCR method in one-humped camels (Camelus dromedarius).

    Science.gov (United States)

    Parin, Ugur; Erbas, Goksel; Kirkan, Sukru; Savasan, Serap; Tugba Yuksel, H; Balat, Gamze

    2018-02-01

    Systemic fungal diseases are the infections caused by false treatment protocols and generally are not taken into consideration especially in the veterinary field. One-humped camels are found in the western side of the Aegean region of our country and bred for wrestling. The aim of this study is the application of diagnosing systemic fungi infection from camel blood samples by the PCR method. In this study, specific primers for DNA topoisomerase II gene sequences were used. As a result, a systemic fungal infection was detected by the nested PCR method from 10 (20%) out of 50 DNA samples taken from camels located on the western side of the Aegean region. In this study, 3 (30%) samples were identified as Candida albicans, 3 (30%) samples were identified as C. glabrata, and 4 (40%) samples were identified as C. parapsilosis. In conclusion, the 20% positive systemic fungal infection rate in one-humped camels observed in the present study showed that the systemic fungal infections are not taken into considerations in veterinary medicine. Further studies are suggested in order to obtain and to maintain extensive data for systemic fungal diseases in our country for one-humped camels.

  10. A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.

    Science.gov (United States)

    Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping

    2018-01-24

    Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of

  11. Apparatus, System and Method for Fast Detection of Genetic Information by PCR in an Interchangeable Chip

    KAUST Repository

    Wen, Weijia; Wu, Jinbo; Kodzius, Rimantas

    2011-01-01

    A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable

  12. Multicenter validation of PCR-based method for detection of Salmonella in chicken and pig samples

    DEFF Research Database (Denmark)

    Malorny, B.; Cook, N.; D'Agostino, M.

    2004-01-01

    As part of a standardization project, an interlaboratory trial including 15 laboratories from 13 European countries was conducted to evaluate the performance of a noproprietary polymerase chain reaction (PCR)-based method for the detection of Salmonella on artificially contaminated chicken rinse...... or positive. Outlier results caused, for example, by gross departures from the experimental protocol, were omitted from the analysis. For both the chicken rinse and the pig swab samples, the diagnostic sensitivity was 100%, with 100% accordance (repeatability) and concordance (reproducibility). The diagnostic...... specificity was 80.1% (with 85.7% accordance and 67.5% concordance) for chicken rinse, and 91.7% (with 100% accordance and 83.3% concordance) for pig swab. Thus, the interlaboratory variation due to personnel, reagents, thermal cyclers, etc., did not affect the performance of the method, which...

  13. A direct qPCR method for residual DNA quantification in monoclonal antibody drugs produced in CHO cells.

    Science.gov (United States)

    Hussain, Musaddeq

    2015-11-10

    Chinese hamster ovary (CHO) cells are the host cell of choice for manufacturing of monoclonal antibody (mAb) drugs in the biopharmaceutical industry. Host cell DNA is an impurity of such manufacturing process and must be controlled and monitored in order to ensure drug purity and safety. A conventional method for quantification of host residual DNA in drug requires extraction of DNA from the mAb drug substance with subsequent quantification of the extracted DNA using real-time PCR (qPCR). Here we report a method where the DNA extraction step is eliminated prior to qPCR. In this method, which we have named 'direct resDNA qPCR', the mAb drug substance is digested with a protease called KAPA in a 96-well PCR plate, the protease in the digest is then denatured at high temperature, qPCR reagents are added to the resultant reaction wells in the plate along with standards and controls in other wells of the same plate, and the plate subjected to qPCR for analysis of residual host DNA in the samples. This direct resDNA qPCR method for CHO is sensitive to 5.0fg of DNA with high precision and accuracy and has a wide linear range of determination. The method has been successfully tested with four mAbs drug, two IgG1 and two IgG4. Both the purified drug substance as well as a number of process intermediate samples, e.g., bioreactor harvest, Protein A column eluate and ion-exchange column eluates were tested. This method simplifies the residual DNA quantification protocol, reduces time of analysis and leads to increased assay sensitivity and development of automated high-throughput methods. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Differentiation between spore-forming and asporogenic bacteria using a PCR and southern hybridization based method

    Energy Technology Data Exchange (ETDEWEB)

    Brill, J.A.; Wiegel, J. [Univ. of Georgia, Athens, GA (United States)

    1997-12-31

    A set of molecular probes was devised to develop a method for screening for the presence of sequences homologous to three representative genes exclusively involved in endosporulation. Based on known gene sequences, degenerate PCR primers were designed against spo0A and ssp. Experimental conditions were devised under which homologs of both genes were consistently detected in endospore-forming bacteria, but not in asporogenic bacteria. The PCR amplification products and dpaA/B from Bacillus subtilis were used as hybridization probes for Southern blots. Identical conditions were used with the genomic DNA from endospore-forming and asporogenic bacteria. We therefore concluded that the probes specifically detect the targeted sporulation genes and we obtained no indication that genes homologous to ssp, spo0A and dpaA/B are present in asporogenic bacteria. Thus, this assay can potentially be used to detect spore-forming bacteria in various kinds of samples and to distinguish between bacteria containing sporulation genes and those who do not regardless of whether sporulation is observed or not. 43 refs., 3 figs., 1 tab.

  15. Validation of qPCR Methods for the Detection of Mycobacterium in New World Animal Reservoirs.

    Directory of Open Access Journals (Sweden)

    Genevieve Housman

    2015-11-01

    Full Text Available Zoonotic pathogens that cause leprosy (Mycobacterium leprae and tuberculosis (Mycobacterium tuberculosis complex, MTBC continue to impact modern human populations. Therefore, methods able to survey mycobacterial infection in potential animal hosts are necessary for proper evaluation of human exposure threats. Here we tested for mycobacterial-specific single- and multi-copy loci using qPCR. In a trial study in which armadillos were artificially infected with M. leprae, these techniques were specific and sensitive to pathogen detection, while more traditional ELISAs were only specific. These assays were then employed in a case study to detect M. leprae as well as MTBC in wild marmosets. All marmosets were negative for M. leprae DNA, but 14 were positive for the mycobacterial rpoB gene assay. Targeted capture and sequencing of rpoB and other MTBC genes validated the presence of mycobacterial DNA in these samples and revealed that qPCR is useful for identifying mycobacterial-infected animal hosts.

  16. A comparative expression analysis of gene transcripts in brain tissue of non-transgenic and GH-transgenic zebrafish (Danio rerio using a DDRT-PCR approach

    Directory of Open Access Journals (Sweden)

    Fernanda A. Alves-Costa

    2012-06-01

    Full Text Available The presence of higher level of exogenous growth hormone (GH in transgenic animals could lead to several physiological alterations. A GH transgenic zebrafish (Danio rerio line was compared to nontransgenic (NT samples of the species through a DDRT-PCR approach, with the goal of identifying candidate differentially expressed transcripts in brain tissues that could be involved in GH overexpression. Densitometric analyses of two selected amplification products, p300 and ADCY2, pointed to a significant lower gene expression in the transgenic zebrafish (104.02 ± 57.71; 224.10 ± 91.73 when compared to NT samples (249.75 ± 30.08; 342.95 ± 65.19. The present data indicate that p300 and ADCY2 are involved in a regulation system for GH when high circulating levels of this hormone are found in zebrafishes.A presença de níveis mais elevados do hormônio de crescimento (GH em animais transgênicos poderia levar a várias alterações fisiológicas. Uma linhagem transgênica de paulistinha (Danio rerio para o GH foi comparada com amostras não transgênicas (NT desta espécie, através de uma abordagem de DDRT-PCR, com o objetivo de identificar transcritos candidatos diferencialmente expressos em tecido cerebral que poderiam estar envolvidos na superexpressão de GH. Análises densitométricas de dois produtos de amplificação selecionados, p300 e ADCY2, apontaram uma expressão gênica significativamente menor nas amostras transgênicas de paulistinha (104.02 ± 57.71; 224.10 ± 91.73, quando comparadas com as amostras NT (249.75 ± 30.08; 342.95±65.19. Os presentes dados indicam que p300 e ADCY2 estão envolvidos em um sistema de regulação do GH, quando altos níveis circulantes desse hormônio são encontrados em paulistinha.

  17. SNPs and real-time quantitative PCR method for constitutional allelic copy number determination, the VPREB1 marker case

    Directory of Open Access Journals (Sweden)

    Costa Elena

    2011-05-01

    Full Text Available Abstract Background 22q11.2 microdeletion is responsible for the DiGeorge Syndrome, characterized by heart defects, psychiatric disorders, endocrine and immune alterations and a 1 in 4000 live birth prevalence. Real-time quantitative PCR (qPCR approaches for allelic copy number determination have recently been investigated in 22q11.2 microdeletions detection. The qPCR method was performed for 22q11.2 microdeletions detection as a first-level screening approach in a genetically unknown series of patients with congenital heart defects. A technical issue related to the VPREB1 qPCR marker was pointed out. Methods A set of 100 unrelated Italian patients with congenital heart defects were tested for 22q11.2 microdeletions by a qPCR method using six different markers. Fluorescence In Situ Hybridization technique (FISH was used for confirmation. Results qPCR identified six patients harbouring the 22q11.2 microdeletion, confirmed by FISH. The VPREB1 gene marker presented with a pattern consistent with hemideletion in one 3 Mb deleted patient, suggestive for a long distal deletion, and in additional five non-deleted patients. The long distal 22q11.2 deletion was not confirmed by Comparative Genomic Hybridization. Indeed, the VPREB1 gene marker generated false positive results in association with the rs1320 G/A SNP, a polymorphism localized within the VPREB1 marker reverse primer sequence. Patients heterozygous for rs1320 SNP, showed a qPCR profile consistent with the presence of a hemideletion. Conclusions Though the qPCR technique showed advantages as a screening approach in terms of cost and time, the VPREB1 marker case revealed that single nucleotide polymorphisms can interfere with qPCR data generating erroneous allelic copy number interpretations.

  18. Efficacy of a novel PCR- and microarray-based method in diagnosis of a prosthetic joint infection

    Science.gov (United States)

    2014-01-01

    Background and purpose Polymerase chain reaction (PCR) methods enable detection and species identification of many pathogens. We assessed the efficacy of a new PCR and microarray-based platform for detection of bacteria in prosthetic joint infections (PJIs). Methods This prospective study involved 61 suspected PJIs in hip and knee prostheses and 20 negative controls. 142 samples were analyzed by Prove-it Bone and Joint assay. The laboratory staff conducting the Prove-it analysis were not aware of the results of microbiological culture and clinical findings. The results of the analysis were compared with diagnosis of PJIs defined according to the Musculoskeletal Infection Society (MSIS) criteria and with the results of microbiological culture. Results 38 of 61 suspected PJIs met the definition of PJI according to the MSIS criteria. Of the 38 patients, the PCR detected bacteria in 31 whereas bacterial culture was positive in 28 patients. 15 of the PJI patients were undergoing antimicrobial treatment as the samples for analysis were obtained. When antimicrobial treatment had lasted 4 days or more, PCR detected bacteria in 6 of the 9 patients, but positive cultures were noted in only 2 of the 9 patients. All PCR results for the controls were negative. Of the 61 suspected PJIs, there were false-positive PCR results in 6 cases. Interpretation The Prove-it assay was helpful in PJI diagnostics during ongoing antimicrobial treatment. Without preceding treatment with antimicrobials, PCR and microarray-based assay did not appear to give any additional information over culture. PMID:24564748

  19. Sampling and Pooling Methods for Capturing Herd Level Antibiotic Resistance in Swine Feces using qPCR and CFU Approaches

    DEFF Research Database (Denmark)

    Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo

    2015-01-01

    The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... in the same swine fecal samples. The results showed that the qPCR assays were capable of detecting differences in antibiotic resistance levels in individual animals that the coliform bacteria colony forming units (CFU) could not. Also, the qPCR assays more accurately quantified antibiotic resistance genes...

  20. Chitinase mRNA levels by quantitative PCR using the single standard DNA: acidic mammalian chitinase is a major transcript in the mouse stomach.

    Directory of Open Access Journals (Sweden)

    Misa Ohno

    Full Text Available Chitinases hydrolyze the β-1-4 glycosidic bonds of chitin, a major structural component of fungi, crustaceans and insects. Although mammals do not produce chitin or its synthase, they express two active chitinases, chitotriosidase (Chit1 and acidic mammalian chitinase (AMCase. These mammalian chitinases have attracted considerable attention due to their increased expression in individuals with a number of pathological conditions, including Gaucher disease, Alzheimer's disease and asthma. However, the contribution of these enzymes to the pathophysiology of these diseases remains to be determined. The quantification of the Chit1 and AMCase mRNA levels and the comparison of those levels with the levels of well-known reference genes can generate useful and biomedically relevant information. In the beginning, we established a quantitative real-time PCR system that uses standard DNA produced by ligating the cDNA fragments of the target genes. This system enabled us to quantify and compare the expression levels of the chitinases and the reference genes on the same scale. We found that AMCase mRNA is synthesized at extraordinarily high levels in the mouse stomach. The level of this mRNA in the mouse stomach was 7- to 10-fold higher than the levels of the housekeeping genes and was comparable to that the level of the mRNA for pepsinogen C (progastricsin, a major component of the gastric mucosa. Thus, AMCase mRNA is a major transcript in mouse stomach, suggesting that AMCase functions as a digestive enzyme that breaks down polymeric chitin and as part of the host defense against chitin-containing pathogens in the gastric contents. Our methodology is applicable to the quantification of mRNAs for multiple genes across multiple specimens using the same scale.

  1. Preliminary results on ghrelin mRNA quantification in buffalo calves during fasting and refeeding by real-time reverse transcription PCR assay

    Directory of Open Access Journals (Sweden)

    G. Neglia

    2010-02-01

    Full Text Available The aim of this trial was to evaluate ghrelin response to milk administration in 20 days old buffalo calves. The trial was carried out on 5 female buffalo calves with a mean age of 21.2±2.8 days. Five blood samples were collected from each animal into EDTA tubes, starting at 07.00 until 15.00, at 2-h intervals. At 09.00, after the second blood sample, replaced milk was administered to the calves. Blood samples were immediately placed at 4°C until processing, which was performed on the same day. We used real-time reverse transcription PCR system to detect the expression of ghrelin mRNA levels in blood of buffalo calves. Two calves showed a low ghrelin concentration at the start of the trial (Group A = low ghrelin concentration and three calves a high ghrelin concentration (Group B = high ghrelin concentration. Ghrelin expression was significantly higher either two hours (P<0.01 and just before feeding (P<0.05 in Group B vs. Group A. However, in both cases, a significant (P<0.05 difference was observed within each group between -2 and 6 hours after feeding. Therefore, ghrelin concentration tended to increase in animals that showed low levels and, similarly, it lowered in animals that showed high concentration. If these results will be confirmed, may represent the evidence that also in buffalo calves the ghrelin system may affect feed intake. Further studies are needed in order to better evaluate the ghrelin system in buffalo calves.

  2. Promoter Boundaries for the luxCDABE and betIBA-proXWV Operons in Vibrio harveyi Defined by the Method Rapid Arbitrary PCR Insertion Libraries (RAIL).

    Science.gov (United States)

    Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C

    2018-06-01

    Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries

  3. A probe-based qRT-PCR method to profile immunological gene expression in blood of captive beluga whales (Delphinapterus leucas

    Directory of Open Access Journals (Sweden)

    Ming-An Tsai

    2017-09-01

    Full Text Available Cytokines are fundamental for a functioning immune system, and thus potentially serve as important indicators of animal health. Quantitation of mRNA using quantitative reverse transcription polymerase chain reaction (qRT-PCR is an established immunological technique. It is particularly suitable for detecting the expression of proteins against which monoclonal antibodies are not available. In this study, we developed a probe-based quantitative gene expression assay for immunological assessment of captive beluga whales (Delphinapterus leucas that is one of the most common cetacean species on display in aquariums worldwide. Six immunologically relevant genes (IL-2Rα, -4, -10, -12, TNFα, and IFNγ were selected for analysis, and two validated housekeeping genes (PGK1 and RPL4 with stable expression were used as reference genes. Sixteen blood samples were obtained from four animals with different health conditions and stored in RNAlater™ solution. These samples were used for RNA extraction followed by qRT-PCR analysis. Analysis of gene transcripts was performed by relative quantitation using the comparative Cq method with the integration of amplification efficiency and two reference genes. The expression levels of each gene in the samples from clinically healthy animals were normally distributed. Transcript outliers for IL-2Rα, IL-4, IL-12, TNFα, and IFNγ were noticed in four samples collected from two clinically unhealthy animals. This assay has the potential to identify immune system deviation from normal state, which is caused by health problems. Furthermore, knowing the immune status of captive cetaceans could help both trainers and veterinarians in implementing preventive approaches prior to disease onset.

  4. Apparatus, System and Method for Fast Detection of Genetic Information by PCR in an Interchangeable Chip

    KAUST Repository

    Wen, Weijia

    2011-03-03

    A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable chip with volumes as small as 1.25 µl, while the heating and cooling rate may be as fast as 12.7 °C/second ensuring that the total time needed of only 25 minutes to complete the 35 cycle PCR amplification. The PCR may be performed according to a two-temperature approach for denaturing and annealing (Td and Ta) of DNA with the PCR chip, with which the amplification of male-specific SRY gene marker by utilizing raw saliva may be achieved. The genetic identification may be in-situ detected after PCR by the optical detection system.

  5. Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study

    Science.gov (United States)

    A number of PCR-based methods for detecting human fecal material in environmental waters have been developed over the past decade, but these methods have rarely received independent comparative testing. Here, we evaluated ten of these methods (BacH, BacHum-UCD, B. thetaiotaomic...

  6. Determination of CMV infection in CSF of children with meningoencephalitis: PCR method

    Directory of Open Access Journals (Sweden)

    Noorbakhsh S

    2009-01-01

    Full Text Available "nBackground: In recent years, many ill cases with cytomegalovirus reactivation in non-immuno compromised persons reported. Goal of study: to determine the CMV infection in cerebrospinal fluid of aseptic meningoencephalitis children hospitalized in Rasul & Mofid hospital (2005-2007. "nMethods: In a cross sectional study 132 cases selected with simple sampling. CMV-DNA in their Cerebro spinal fluids searched by qualitative PCR. "nResults: The age range of the study patients was 5 month- 13 years, median age= 2±3.7 years; 87(65.9% male and 45(34.1% was female. The presenting signs and symptoms were convulsion 77(69.4%; meningitis 25(18.8%, loss of consciousness 47(37%; neurologic defects 15.9%. DNA extrated in 11 cases. Mycoplasma- DNA in 2cases; DNA-CMV detected 2(1.5%. Positive DNA HSV found in 7(15.3% of patients. DNA- HSV type- 15.3% (7/132 cases. An infant 5 month age with developmental delay, microcephaly and recurrent convulsions. A 1 year girl with brain atrophy and progressive hydrocephaly with intracranial shunt "nConclusions: Differentiation between herpes meningoencephalitis and other encephalopathy based on clinical signs in children is too difficult. CMV (1.5% has lower rate than herpes simplex type-1 (5.7%. In addition to CMV and HSV1 all of herpes family viruses (varicella, herpes 6, 7, Epstein barr virus could have role in  children with meningoencephalitis. In recent years a sensitive, rapid, simple diagnostic  test "Single tube Multiplex PCR" in cerebro spinal fluid recommend. Rapid diagnosis and faster treatment is necessary for decreasing mortality and morbidity in all of herpes meningoencephalitis cases

  7. Technical note: development of a quantitative PCR method for monitoring strain dynamics during yogurt manufacture.

    Science.gov (United States)

    Miller, D M; Dudley, E G; Roberts, R F

    2012-09-01

    Yogurt starter cultures may consist of multiple strains of Lactobacillus delbrueckii ssp. bulgaricus (LB) and Streptococcus thermophilus (ST). Conventional plating methods for monitoring LB and ST levels during yogurt manufacture do not allow for quantification of individual strains. The objective of the present work was to develop a quantitative PCR method for quantification of individual strains in a commercial yogurt starter culture. Strain-specific primers were designed for 2 ST strains (ST DGCC7796 and ST DGCC7710), 1 LB strain (DGCC4078), and 1 Lactobacillus delbrueckii ssp. lactis strain (LL; DGCC4550). Primers for the individual ST and LB strains were designed to target unique DNA sequences in clustered regularly interspersed short palindromic repeats. Primers for LL were designed to target a putative mannitol-specific IIbC component of the phosphotransferase system. Following evaluation of primer specificity, standard curves relating cell number to cycle threshold were prepared for each strain individually and in combination in yogurt mix, and no significant differences in the slopes were observed. Strain balance data was collected for yogurt prepared at 41 and 43°C to demonstrate the potential application of this method. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  8. Inverse PCR-based method for isolating novel SINEs from genome.

    Science.gov (United States)

    Han, Yawei; Chen, Liping; Guan, Lihong; He, Shunping

    2014-04-01

    Short interspersed elements (SINEs) are moderately repetitive DNA sequences in eukaryotic genomes. Although eukaryotic genomes contain numerous SINEs copy, it is very difficult and laborious to isolate and identify them by the reported methods. In this study, the inverse PCR was successfully applied to isolate SINEs from Opsariichthys bidens genome in Eastern Asian Cyprinid. A group of SINEs derived from tRNA(Ala) molecular had been identified, which were named Opsar according to Opsariichthys. SINEs characteristics were exhibited in Opsar, which contained a tRNA(Ala)-derived region at the 5' end, a tRNA-unrelated region, and AT-rich region at the 3' end. The tRNA-derived region of Opsar shared 76 % sequence similarity with tRNA(Ala) gene. This result indicated that Opsar could derive from the inactive or pseudogene of tRNA(Ala). The reliability of method was tested by obtaining C-SINE, Ct-SINE, and M-SINEs from Ctenopharyngodon idellus, Megalobrama amblycephala, and Cyprinus carpio genomes. This method is simpler than the previously reported, which successfully omitted many steps, such as preparation of probes, construction of genomic libraries, and hybridization.

  9. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  10. Comparison of a PCR-Based Method with Culture and Direct Examination for Diagnosis of Acanthamoeba keratitis

    Directory of Open Access Journals (Sweden)

    S Farnia

    2009-05-01

    Full Text Available "nBackground: The aim was to compare three different methods (direct examination, culture and PCR meth­ods for the diagnosis of Acanthamoeba keratitis (AK in corneal scrapes."nMethods: Twenty eight corneal scrapes and contact lenses were collected from keratitis patients and re­ferred to the De­partment of Medical Parasitology and Mycology, School of Public Health, Tehran Univer­sity of Medical Sci­ences. Corneal scrapes were divided in three parts for direct examination, culture on non-nutrient agar and PCR analysis. PCR analysis was also performed using a 18S rRNA gene primer pair (DF3 region. DF3 (Diagnostic frag­ment 3 is a region of the nuclear small subunit ribosomal RNA gene which is specific for detecting Acan­thamoeba strains."nResults:  Acanthamoeba was the causative agent of keratitis in 50% of the patients. Direct smear of all pre­pared corneal scrapes in AK patients was negative and culture was positive in only 14.3% of the isolates. PCR analysis was positive in 71.4% of AK patients. These three methods were negative in corneal scrapes of non-AK patients. The sensitivity and specificity of PCR technique for the detection of Acanthamoeba sp. were calculated as 71.4% and 100%, respectively."nConclusion: According to high sensitivity and specificity of PCR-based method, this study confirmed that PCR using 18S rRNA gene primers (DF3 region is more useful for detecting AK cases compare to culture and direct microscopy methods.

  11. A rapid and direct real time PCR-based method for identification of Salmonella spp

    DEFF Research Database (Denmark)

    Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.

    2003-01-01

    The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated ...

  12. Ensemble approach combining multiple methods improves human transcription start site prediction.

    LENUS (Irish Health Repository)

    Dineen, David G

    2010-01-01

    The computational prediction of transcription start sites is an important unsolved problem. Some recent progress has been made, but many promoters, particularly those not associated with CpG islands, are still difficult to locate using current methods. These methods use different features and training sets, along with a variety of machine learning techniques and result in different prediction sets.

  13. A PCR-aided transcript titration assay revealing very low expression of a gene at band 3p21 in 33 cells lines derived from all types of lung cancer

    NARCIS (Netherlands)

    Kok, K; Buchhagen, D L; Carritt, B; Buys, C H; van den Berg, Anke

    1993-01-01

    We have developed a general PCR-based method to quantify the amount of a specific mRNA present in a given cell line or tissue. We applied this quantitative PCR to analyse the expression of D8, a human gene which we recently identified in the chromosomal region 3p21, the common deletion region of

  14. Diagnosis of Giardia infections by PCR-based methods in children of an endemic area

    Directory of Open Access Journals (Sweden)

    EB David

    2011-01-01

    Full Text Available The present study was designed to estimate the prevalence of Giardia infection in preschool- and school-aged children living in an endemic area. Fecal samples from 573 children were processed by zinc sulfate centrifugal flotation, centrifugal sedimentation (using a commercial device for fecal concentration - TF-Test kit® and polymerase chain reaction (PCR-based methods. Of the stool samples assessed, 277 (48.3% were positive for intestinal parasites and/or commensal protozoa. Centrifugal flotation presented the highest diagnostic sensitivity for Giardia infections. The kappa index revealed that both coproparasitological techniques closely agreed on the Giardia diagnosis (86% versus satisfactory (72% and poor (35% concordances for commensal protozoan and helminth infections, respectively. Concerning Giardia molecular diagnosis, from the 71 microscopy-positive samples, specific amplification of gdh and tpi fragments was noted in 68 (95.7% and 64 (90% samples, respectively. Amplification of gdh and tpi genes was observed, respectively, in 95.7% and 90% of microscopy-positive Giardia samples. For 144 microscopy-negative samples, gdh and tpi gene amplification products were obtained from 8.3% and 35.9% samples, respectively. The agreement between these genes was about 40%. The centrifuge-flotation based method was the most suitable means of Giardia diagnosis assessed in the present study by combining accuracy and low cost.

  15. PCR-RFLP method to distinguish Frankliniella occidentalis, Frankliniella intonsa, Frankliniella pallida and Frankliniella tenuicornis

    Directory of Open Access Journals (Sweden)

    Przybylska Arnika

    2016-01-01

    Full Text Available Thrips from the genus Frankliniella (Thysanoptera, Thripidae are phytophagous on crops and wild plants. Some of them cause slight economic damage, however, others including F. occidentalis and F. intonsa are responsible for considerable losses in crop production. Moreover, they constitute a double threat for host plants by not only feeding on them but also vectoring viruses, some of which are on the quarantined list of the European Plant Protection Organization. The rapid detection and differentiation between more and less harmful Frankliniella species is, therefore, important in order to combat the pests at the time of their appearance. In this study, we have undertaken to develop a method of detecting F. occidentalis, F. intonsa, F. pallida, and F. tenuicornis. The protocol is based on PCR amplification of ITS1 rDNA fragments of these insects using universal primers pair giving products of slightly distinct length for studied insects. Restriction enzymes digestion which is easy to interpret, allows for visible differentiation of all these Frankliniella species. The method was shown to be species-specific and sensitive. Even single specimens in either the larvae or adult stage could be distinguished.

  16. Simplified Method for Predicting a Functional Class of Proteins in Transcription Factor Complexes

    KAUST Repository

    Piatek, Marek J.

    2013-07-12

    Background:Initiation of transcription is essential for most of the cellular responses to environmental conditions and for cell and tissue specificity. This process is regulated through numerous proteins, their ligands and mutual interactions, as well as interactions with DNA. The key such regulatory proteins are transcription factors (TFs) and transcription co-factors (TcoFs). TcoFs are important since they modulate the transcription initiation process through interaction with TFs. In eukaryotes, transcription requires that TFs form different protein complexes with various nuclear proteins. To better understand transcription regulation, it is important to know the functional class of proteins interacting with TFs during transcription initiation. Such information is not fully available, since not all proteins that act as TFs or TcoFs are yet annotated as such, due to generally partial functional annotation of proteins. In this study we have developed a method to predict, using only sequence composition of the interacting proteins, the functional class of human TF binding partners to be (i) TF, (ii) TcoF, or (iii) other nuclear protein. This allows for complementing the annotation of the currently known pool of nuclear proteins. Since only the knowledge of protein sequences is required in addition to protein interaction, the method should be easily applicable to many species.Results:Based on experimentally validated interactions between human TFs with different TFs, TcoFs and other nuclear proteins, our two classification systems (implemented as a web-based application) achieve high accuracies in distinguishing TFs and TcoFs from other nuclear proteins, and TFs from TcoFs respectively.Conclusion:As demonstrated, given the fact that two proteins are capable of forming direct physical interactions and using only information about their sequence composition, we have developed a completely new method for predicting a functional class of TF interacting protein partners

  17. Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis in Stevia rebaudiana Bertoni by Real-Time Polymerase Chain Reaction (RT-PCR).

    Science.gov (United States)

    Modi, Arpan; Kumar, Nitish; Narayanan, Subhash

    2016-01-01

    Stevia (Stevia rebaudiana Bertoni) is a medicinal plant having sweet, diterpenoid glycosides known as steviol glycosides which are 200-300 times sweeter than sucrose (0.4 % solution). They are synthesized mainly in the leaves via plastid localized 2-C-methyl-D-erythrose-4-phosphate pathway (MEP pathway). Fifteen genes are involved in the formation of these glycosides. In the present protocol, a method for the quantification of transcripts of these genes is shown. The work involves RNA extraction and cDNA preparation, and therefore, procedures for the confirmation of DNA-free cDNA preparation have also been illustrated. Moreover, details of plant treatments are not mentioned as this protocol may apply to relative gene expression profile in any medicinal plant with any treatment. The treatments are numbered as T0 (Control), T1, T2, T3, and T4.

  18. In Situ CaptureRT-qPCR: A new simple and sensitive method to detect human norovirus in oysters

    Science.gov (United States)

    Human noroviruses (HuNoVs) are the major cause for the non-bacterial acute gastroenteritis worldwide. RT-qPCR is a widely used method to detect HuNoVs. However, the method is unable to discriminate between infectious and non-infectious viruses. Previously, we reported that the receptor mediated in s...

  19. Validation of a 20-h real-time PCR method for screening of Salmonella in poultry faecal samples

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Hansen, Flemming; Hoorfar, Jeffrey

    2010-01-01

    (NordVal). The comparative trial was performed against a reference method from the Nordic Committee on Food Analysis (NMKL187, 2007) using 132 artificially and naturally contaminated samples. The limit of detection (LOD50) was found to be 24 and 33 CFU/sample for the PCR and NMKL187 methods...

  20. Molecular methods (digital PCR and real-time PCR) for the quantification of low copy DNA of Phytophthora nicotianae in environmental samples.

    Science.gov (United States)

    Blaya, Josefa; Lloret, Eva; Santísima-Trinidad, Ana B; Ros, Margarita; Pascual, Jose A

    2016-04-01

    Currently, real-time polymerase chain reaction (qPCR) is the technique most often used to quantify pathogen presence. Digital PCR (dPCR) is a new technique with the potential to have a substantial impact on plant pathology research owing to its reproducibility, sensitivity and low susceptibility to inhibitors. In this study, we evaluated the feasibility of using dPCR and qPCR to quantify Phytophthora nicotianae in several background matrices, including host tissues (stems and roots) and soil samples. In spite of the low dynamic range of dPCR (3 logs compared with 7 logs for qPCR), this technique proved to have very high precision applicable at very low copy numbers. The dPCR was able to detect accurately the pathogen in all type of samples in a broad concentration range. Moreover, dPCR seems to be less susceptible to inhibitors than qPCR in plant samples. Linear regression analysis showed a high correlation between the results obtained with the two techniques in soil, stem and root samples, with R(2) = 0.873, 0.999 and 0.995 respectively. These results suggest that dPCR is a promising alternative for quantifying soil-borne pathogens in environmental samples, even in early stages of the disease. © 2015 Society of Chemical Industry.

  1. Sampling and Pooling Methods for Capturing Herd Level Antibiotic Resistance in Swine Feces using qPCR and CFU Approaches

    DEFF Research Database (Denmark)

    Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo

    2015-01-01

    The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... when comparing individual sampling and pooling methods. qPCR on pooled samples was found to be a good representative for the general resistance level in a pig herd compared to the coliform CFU counts. It had significantly reduced relative standard deviations compared to coliform CFU counts in the same...

  2. A combined HM-PCR/SNuPE method for high sensitive detection of rare DNA methylation

    Directory of Open Access Journals (Sweden)

    Tierling Sascha

    2010-06-01

    Full Text Available Abstract Background DNA methylation changes are widely used as early molecular markers in cancer detection. Sensitive detection and classification of rare methylation changes in DNA extracted from circulating body fluids or complex tissue samples is crucial for the understanding of tumor etiology, clinical diagnosis and treatment. In this paper, we describe a combined method to monitor the presence of methylated tumor DNA in an excess of unmethylated background DNA of non-tumorous cells. The method combines heavy methyl-PCR, which favors preferential amplification of methylated marker sequence from bisulfite-treated DNA with a methylation-specific single nucleotide primer extension monitored by ion-pair, reversed-phase, high-performance liquid chromatography separation. Results This combined method allows detection of 14 pg (that is, four to five genomic copies of methylated chromosomal DNA in a 2000-fold excess (that is, 50 ng of unmethylated chromosomal background, with an analytical sensitivity of > 90%. We outline a detailed protocol for the combined assay on two examples of known cancer markers (SEPT9 and TMEFF2 and discuss general aspects of assay design and data interpretation. Finally, we provide an application example for rapid testing on tumor methylation in plasma DNA derived from a small cohort of patients with colorectal cancer. Conclusion The method allows unambiguous detection of rare DNA methylation, for example in body fluid or DNA isolates from cells or tissues, with very high sensitivity and accuracy. The application combines standard technologies and can easily be adapted to any target region of interest. It does not require costly reagents and can be used for routine screening of many samples.

  3. European validation of a real-time PCR-based method for detection of Listeria monocytogenes in soft cheese.

    Science.gov (United States)

    Gianfranceschi, Monica Virginia; Rodriguez-Lazaro, David; Hernandez, Marta; González-García, Patricia; Comin, Damiano; Gattuso, Antonietta; Delibato, Elisabetta; Sonnessa, Michele; Pasquali, Frederique; Prencipe, Vincenza; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Kozačinski, Lidija; Tomic, Danijela Horvatek; Zdolec, Nevijo; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John Elmerdahl; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Paiusco, Antonella; De Cesare, Alessandra; Manfreda, Gerardo; De Medici, Dario

    2014-08-01

    The classical microbiological method for detection of Listeria monocytogenes requires around 7 days for final confirmation, and due to perishable nature of RTE food products, there is a clear need for an alternative methodology for detection of this pathogen. This study presents an international (at European level) ISO 16140-based validation trial of a non-proprietary real-time PCR-based methodology that can generate final results in the following day of the analysis. This methodology is based on an ISO compatible enrichment coupled to a bacterial DNA extraction and a consolidated real-time PCR assay. Twelve laboratories from six European countries participated in this trial, and soft cheese was selected as food model since it can represent a difficult matrix for the bacterial DNA extraction and real-time PCR amplification. The limit of detection observed was down to 10 CFU per 25 of sample, showing excellent concordance and accordance values between samples and laboratories (>75%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (82.75%, 96.70% and 97.62%, respectively) when the results obtained for the real-time PCR-based methods were compared to those of the ISO 11290-1 standard method. An interesting observation was that the L. monocytogenes detection by the real-time PCR method was less affected in the presence of Listeria innocua in the contaminated samples, proving therefore to be more reliable than the reference method. The results of this international trial demonstrate that the evaluated real-time PCR-based method represents an excellent alterative to the ISO standard since it shows a higher performance as well as reduce the extent of the analytical process, and can be easily implemented routinely by the competent authorities and food industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Optimization of a 12-hour TaqMan PCR-based method for detection of Salmonella bacteria in meat

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Krause, Michael; Hansen, F.

    2007-01-01

    no positive effects and resulted in decreased reproducibility. Increasing the amount of PCR template DNA from 5 to 20 mu l improved the threshold cycle value by approximately 2. The improved 12-h PCR method was successfully compared to a reference culture method with 100 minced meat and poultry samples...... the highest number of salmonellae. When analyzing minced meat samples, positive effects of increasing the initial sampling volume from 1 to 5 ml and increasing the amount of paramagnetic particles to 90 mu l were observed. However, washing the pellet and eluting the DNA in reduced volumes (25 and 50 mu l) had...

  5. Molecular characterization of Aspergillus infections in an Iranian educational hospital using RAPD-PCR method

    Directory of Open Access Journals (Sweden)

    Kambiz Diba

    2014-09-01

    Conclusion: The hospital sources for the Aspergillus clinical isolates included air condition and walls. RAPD-PCR analysis can play a trivial role to find the hospital sources of Aspergillus clinical isolates.

  6. Development of PCR method for diagnosing of honey bee American Foulbrood disease

    Directory of Open Access Journals (Sweden)

    Modirrousta, H.

    2012-06-01

    Full Text Available American foulbrood (AFB disease is caused by the sporeforming bacterium Paenibacillus larvae larvae. Traditional diagnosis is based on culture technique is time and laboratory work consuming. In this study with standard strain, PCR was developed by specific primers and PCR products were electrophoresed on 0.8 % agarose gel. The PCR primers were selected on the basis of the 16S rRNA gene and amplify a 700-bp amplicon. Detection limits were determined for suspensions of bacteria and spores and also honey and larvae experimentally contaminated. The lowest number of bacteria and spores that were able to detect were respectively 28, 33, 330 and 243 cfu /ml. This PCR technique can be used to identification of the presence of Paenibacillus larvae larvae spores in honey samples, brood samples or on the colonies that grow on medium.

  7. International study to evaluate PCR methods for detection of Trypanosoma cruzi DNA in blood samples from Chagas disease patients.

    Directory of Open Access Journals (Sweden)

    Alejandro G Schijman

    Full Text Available BACKGROUND: A century after its discovery, Chagas disease still represents a major neglected tropical threat. Accurate diagnostics tools as well as surrogate markers of parasitological response to treatment are research priorities in the field. The purpose of this study was to evaluate the performance of PCR methods in detection of Trypanosoma cruzi DNA by an external quality evaluation. METHODOLOGY/FINDINGS: An international collaborative study was launched by expert PCR laboratories from 16 countries. Currently used strategies were challenged against serial dilutions of purified DNA from stocks representing T. cruzi discrete typing units (DTU I, IV and VI (set A, human blood spiked with parasite cells (set B and Guanidine Hidrochloride-EDTA blood samples from 32 seropositive and 10 seronegative patients from Southern Cone countries (set C. Forty eight PCR tests were reported for set A and 44 for sets B and C; 28 targeted minicircle DNA (kDNA, 13 satellite DNA (Sat-DNA and the remainder low copy number sequences. In set A, commercial master mixes and Sat-DNA Real Time PCR showed better specificity, but kDNA-PCR was more sensitive to detect DTU I DNA. In set B, commercial DNA extraction kits presented better specificity than solvent extraction protocols. Sat-DNA PCR tests had higher specificity, with sensitivities of 0.05-0.5 parasites/mL whereas specific kDNA tests detected 5.10(-3 par/mL. Sixteen specific and coherent methods had a Good Performance in both sets A and B (10 fg/µl of DNA from all stocks, 5 par/mL spiked blood. The median values of sensitivities, specificities and accuracies obtained in testing the Set C samples with the 16 tests determined to be good performing by analyzing Sets A and B samples varied considerably. Out of them, four methods depicted the best performing parameters in all three sets of samples, detecting at least 10 fg/µl for each DNA stock, 0.5 par/mL and a sensitivity between 83.3-94.4%, specificity of 85

  8. A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

    Directory of Open Access Journals (Sweden)

    Karolina Stojowska

    Full Text Available We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s, while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR, whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR. The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

  9. A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

    Science.gov (United States)

    Stojowska, Karolina; Krawczyk, Beata

    2014-01-01

    We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

  10. A comparison of EGFR mutation testing methods in lung carcinoma: direct sequencing, real-time PCR and immunohistochemistry.

    Directory of Open Access Journals (Sweden)

    Bárbara Angulo

    Full Text Available The objective of this study is to compare two EGFR testing methodologies (a commercial real-time PCR kit and a specific EGFR mutant immunohistochemistry, with direct sequencing and to investigate the limit of detection (LOD of both PCR-based methods. We identified EGFR mutations in 21 (16% of the 136 tumours analyzed by direct sequencing. Interestingly, the Therascreen EGFR Mutation Test kit was able to characterize as wild-type one tumour that could not be analyzed by direct sequencing of the PCR product. We then compared the LOD of the kit and that of direct sequencing using the available mutant tumours. The kit was able to detect the presence of a mutation in a 1% dilution of the total DNA in nine of the 18 tumours (50%, which tested positive with the real-time quantitative PCR method. In all cases, EGFR mutation was identified at a dilution of 5%. Where the mutant DNA represented 30% of the total DNA, sequencing was able to detect mutations in 12 out of 19 cases (63%. Additional experiments with genetically defined standards (EGFR ΔE746-A750/+ and EGFR L858R/+ yielded similar results. Immunohistochemistry (IHC staining with exon 19-specific antibody was seen in eight out of nine cases with E746-A750del detected by direct sequencing. Neither of the two tumours with complex deletions were positive. Of the five L858R-mutated tumours detected by the PCR methods, only two were positive for the exon 21-specific antibody. The specificity was 100% for both antibodies. The LOD of the real-time PCR method was lower than that of direct sequencing. The mutation specific IHC produced excellent specificity.

  11. Reference gene selection for molecular studies of dormancy in wild oat (Avena fatua L. caryopses by RT-qPCR method.

    Directory of Open Access Journals (Sweden)

    Izabela Ruduś

    Full Text Available Molecular studies of primary and secondary dormancy in Avena fatua L., a serious weed of cereal and other crops, are intended to reveal the species-specific details of underlying molecular mechanisms which in turn may be useable in weed management. Among others, quantitative real-time PCR (RT-qPCR data of comparative gene expression analysis may give some insight into the involvement of particular wild oat genes in dormancy release, maintenance or induction by unfavorable conditions. To assure obtaining biologically significant results using this method, the expression stability of selected candidate reference genes in different data subsets was evaluated using four statistical algorithms i.e. geNorm, NormFinder, Best Keeper and ΔCt method. Although some discrepancies in their ranking outputs were noticed, evidently two ubiquitin-conjugating enzyme homologs, AfUBC1 and AfUBC2, as well as one homolog of glyceraldehyde 3-phosphate dehydrogenase AfGAPDH1 and TATA-binding protein AfTBP2 appeared as more stably expressed than AfEF1a (translation elongation factor 1α, AfGAPDH2 or the least stable α-tubulin homolog AfTUA1 in caryopses and seedlings of A. fatua. Gene expression analysis of a dormancy-related wild oat transcription factor VIVIPAROUS1 (AfVP1 allowed for a validation of candidate reference genes performance. Based on the obtained results it can be recommended that the normalization factor calculated as a geometric mean of Cq values of AfUBC1, AfUBC2 and AfGAPDH1 would be optimal for RT-qPCR results normalization in the experiments comprising A. fatua caryopses of different dormancy status.

  12. Reference gene selection for molecular studies of dormancy in wild oat (Avena fatua L.) caryopses by RT-qPCR method.

    Science.gov (United States)

    Ruduś, Izabela; Kępczyński, Jan

    2018-01-01

    Molecular studies of primary and secondary dormancy in Avena fatua L., a serious weed of cereal and other crops, are intended to reveal the species-specific details of underlying molecular mechanisms which in turn may be useable in weed management. Among others, quantitative real-time PCR (RT-qPCR) data of comparative gene expression analysis may give some insight into the involvement of particular wild oat genes in dormancy release, maintenance or induction by unfavorable conditions. To assure obtaining biologically significant results using this method, the expression stability of selected candidate reference genes in different data subsets was evaluated using four statistical algorithms i.e. geNorm, NormFinder, Best Keeper and ΔCt method. Although some discrepancies in their ranking outputs were noticed, evidently two ubiquitin-conjugating enzyme homologs, AfUBC1 and AfUBC2, as well as one homolog of glyceraldehyde 3-phosphate dehydrogenase AfGAPDH1 and TATA-binding protein AfTBP2 appeared as more stably expressed than AfEF1a (translation elongation factor 1α), AfGAPDH2 or the least stable α-tubulin homolog AfTUA1 in caryopses and seedlings of A. fatua. Gene expression analysis of a dormancy-related wild oat transcription factor VIVIPAROUS1 (AfVP1) allowed for a validation of candidate reference genes performance. Based on the obtained results it can be recommended that the normalization factor calculated as a geometric mean of Cq values of AfUBC1, AfUBC2 and AfGAPDH1 would be optimal for RT-qPCR results normalization in the experiments comprising A. fatua caryopses of different dormancy status.

  13. Modeling and experimental methods to probe the link between global transcription and spatial organization of chromosomes.

    Directory of Open Access Journals (Sweden)

    K Venkatesan Iyer

    Full Text Available Genomes are spatially assembled into chromosome territories (CT within the nucleus of living cells. Recent evidences have suggested associations between three-dimensional organization of CTs and the active gene clusters within neighboring CTs. These gene clusters are part of signaling networks sharing similar transcription factor or other downstream transcription machineries. Hence, presence of such gene clusters of active signaling networks in a cell type may regulate the spatial organization of chromosomes in the nucleus. However, given the probabilistic nature of chromosome positions and complex transcription factor networks (TFNs, quantitative methods to establish their correlation is lacking. In this paper, we use chromosome positions and gene expression profiles in interphase fibroblasts and describe methods to capture the correspondence between their spatial position and expression. In addition, numerical simulations designed to incorporate the interacting TFNs, reveal that the chromosome positions are also optimized for the activity of these networks. These methods were validated for specific chromosome pairs mapped in two distinct transcriptional states of T-Cells (naïve and activated. Taken together, our methods highlight the functional coupling between topology of chromosomes and their respective gene expression patterns.

  14. Entamoeba spp. diagnosis in patients with inflmmatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods

    Directory of Open Access Journals (Sweden)

    Zahra Gharibi

    2017-10-01

    Full Text Available Objective: To evaluate Entamoeba spp. diagnosis in patients with inflammatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods. Methods: In this descriptive cross-sectional survey, 200 stool samples were randomly collected during 2015–2016. The stool samples were evaluated microscopically for the presence of the parasite using direct and formalin-ether concentration and trichrome staining methods. Then, the stool samples were examined by copro-antigen ELISA (Biomerica Company and multiplex PCR methods. Results: Of 200 samples, 17, 29 and 23 cases were positive for Entamoeba species by the staining, copro-antigen ELISA and multiplex PCR methods, respectively. Of 23 positive samples in multiplex PCR test, 13 and 10 samples were positive for Entamoeba dispar (E. dispar and Entamoeba histolytica (E. histolytica, respectively. Conclusions: Our finding indicated a relatively high prevalence of Entamoeba species in patients with inflammatory diarrhea in Ahvaz city. Due to the complications of E. histolytica/ dispar infection, the health authorities of the city must pay more attention to control and prevent the transmission of E. histolytica/dispar to individuals.

  15. An improved PCR method for direct identification of Porphyra (Bangiales, Rhodophyta) using conchocelis based on a RUBISCO intergenic spacer

    Science.gov (United States)

    Wang, Chao; Dong, Dong; Wang, Guangce; Zhang, Baoyu; Peng, Guang; Xu, Pu; Tang, Xiaorong

    2009-09-01

    An improved method of PCR in which the small segment of conchocelis is amplified directly without DNA extraction was used to amplify a RUBISCO intergenic spacer DNA fragment from nine species of red algal genus Porphyra (Bangiales, Rhodophyta), including Porphyra yezoensis (Jiangsu, China), P. haitanensis (Fujian, China), P. oligospermatangia (Qingdao, China), P. katadai (Qingdao, China), P. tenera (Qingdao, China), P. suborboculata (Fujian, China), P. pseudolinearis (Kogendo, Korea), P. linearis (Devon, England), and P. fallax (Seattle, USA). Standard PCR and the method developed here were both conducted using primers specific for the RUBISCO spacer region, after which the two PCR products were sequenced. The sequencing data of the amplicons obtained using both methods were identical, suggesting that the improved PCR method was functional. These findings indicate that the method developed here may be useful for the rapid identification of species of Porphyra in a germplasm bank. In addition, a phylogenetic tree was constructed using the RUBISCO spacer and partial rbcS sequence, and the results were in concordant with possible alternative phylogenies based on traditional morphological taxonomic characteristics, indicating that the RUBISCO spacer is a useful region for phylogenetic studies.

  16. Comparison of DNA probe, PCR amplification, ELISA and culture methods for the rapid detection of Salmonella in poultry

    International Nuclear Information System (INIS)

    Qasem, J.A.; Al-Mouqati, S.; Rajkumar, G.

    2005-01-01

    The identification of Salmonella spp. from poultry meat was studied by comparing bacterial detection using the Gene-Trak colorimetric hybridization method, a PCR amplification kit and an Enzyme Linked Immunosorbent Assay (ELISA), and these methods were compared with the conventional methodology proposed by the United States Food and Drug Administration (US FDA) for detection of Salmonella in food samples. Forty positive and negative samples were studied. The three methods yielded similar results with levels of Salmonella greater than 10 CFU per sample, even when the samples were highly contaminated with competing bacteria. In contrast, 20 CFU of seed inoculum per sample was the lowest level of Salmonella detectable with all three methods and the standard culture method. The detection limits of the PCR and ELISA assays were 5 CFU/g after enrichment at 37 deg. C for 6 and 9 hours, respectively. Compared with conventional bacteriology, all three methods here demonstrated high sensitivity and specificity for Salmonella. (author)

  17. PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato

    Science.gov (United States)

    Singh, Om P; Bali, Prerna; Hemingway, Janet; Subbarao, Sarala K; Dash, Aditya P; Adak, Tridibes

    2009-01-01

    Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr) is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F) in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F) in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR), an Amplification Refractory Mutation System (ARMS) and Primer Introduced Restriction Analysis-PCR (PIRA-PCR) were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method was refractory to non

  18. A multiplex PCR method for the identification of commercially important salmon and trout species (Oncorhynchus and Salmo) in North America.

    Science.gov (United States)

    Rasmussen Hellberg, Rosalee S; Morrissey, Michael T; Hanner, Robert H

    2010-09-01

    The purpose of this study was to develop a species-specific multiplex polymerase chain reaction (PCR) method that allows for the detection of salmon species substitution on the commercial market. Species-specific primers and TaqMan® probes were developed based on a comprehensive collection of mitochondrial 5' cytochrome c oxidase subunit I (COI) deoxyribonucleic acid (DNA) "barcode" sequences. Primers and probes were combined into multiplex assays and tested for specificity against 112 reference samples representing 25 species. Sensitivity and linearity tests were conducted using 10-fold serial dilutions of target DNA (single-species samples) and DNA admixtures containing the target species at levels of 10%, 1.0%, and 0.1% mixed with a secondary species. The specificity tests showed positive signals for the target DNA in both real-time and conventional PCR systems. Nonspecific amplification in both systems was minimal; however, false positives were detected at low levels (1.2% to 8.3%) in conventional PCR. Detection levels were similar for admixtures and single-species samples based on a 30 PCR cycle cut-off, with limits of 0.25 to 2.5 ng (1% to 10%) in conventional PCR and 0.05 to 5.0 ng (0.1% to 10%) in real-time PCR. A small-scale test with food samples showed promising results, with species identification possible even in heavily processed food items. Overall, this study presents a rapid, specific, and sensitive method for salmon species identification that can be applied to mixed-species and heavily processed samples in either conventional or real-time PCR formats. This study provides a newly developed method for salmon and trout species identification that will assist both industry and regulatory agencies in the detection and prevention of species substitution. This multiplex PCR method allows for rapid, high-throughput species identification even in heavily processed and mixed-species samples. An inter-laboratory study is currently being carried out to

  19. PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato

    Directory of Open Access Journals (Sweden)

    Dash Aditya P

    2009-07-01

    Full Text Available Abstract Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR, an Amplification Refractory Mutation System (ARMS and Primer Introduced Restriction Analysis-PCR (PIRA-PCR were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method

  20. Questioning Transcription: The Case for the Systematic and Reflexive Interviewing and Reporting (SRIR Method

    Directory of Open Access Journals (Sweden)

    Nicholas Loubere

    2017-05-01

    Full Text Available The recording and verbatim transcription of interviews is often considered to be one of the more tedious but necessary aspects of the in-depth qualitative research process. While transcription is undoubtedly a necessary methodological tool for researchers focusing specifically on discourse and language, it has also been widely adopted by researchers across the social sciences, and is sometimes advocated as a means of inherently improving the rigour of qualitative research. Based on recent experience from fieldwork in rural China, where I had initially expected to utilise the verbatim transcription method, in this article I critically assess the role of transcription in the design, implementation, and outcome of cross-cultural multilingual qualitative research. I argue that, in certain cases, verbatim transcription can limit the kind of information that may be considered valuable as data, and delay the processes of data reduction and analysis, thus separating the researcher from the fieldwork event. In response to these critiques, I propose an alternative approach to collecting, categorising, coding, and analysing qualitative data: the systematic and reflexive interviewing and reporting (SRIR method. The SRIR method utilises semi-structured and unstructured interviews conducted by two or more researchers. After completing an interview, researchers engage in reflexive dialogue, and jointly write interview and analysis reports. In this way, the SRIR method begins the process of coding and analysis in situ, thus facilitating critical engagement with emergent themes during fieldwork rather than afterwards. The method is, therefore, ideally suited to research projects that are designed to be open ended and flexible, in order to follow up on new information and potentially even change focus. URN: http://nbn-resolving.de/urn:nbn:de:0114-fqs1702152

  1. A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method

    OpenAIRE

    Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao

    2015-01-01

    Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

  2. Current PCR Methods for the Detection, Identification and Quantification of Genetically Modified Organisms(GMOs: a Brief Review

    Directory of Open Access Journals (Sweden)

    Gadani F

    2014-12-01

    Full Text Available Analytical methods based on the polymerase chain reaction (PCR technology are increasingly used for the detection of deoxyribonucleic acid (DNA sequences associated with genetically modified organisms (GMOs. In the European Union and Switzerland, mandatory labeling of novel foods and food ingredients consisting of, or containing GMOs is required according to food regulations and is triggered by the presence of newly introduced foreign DNA sequences, or newly expressed proteins. In order to meet regulatory and consumer demand, numerous PCR-based methods have been developed which can detect, identify and quantify GMOs in agricultural crops, food and feed. Moreover, the determination of genetic identity allows for segregation and traceability (identity preservation throughout the supply chain of GM crops that have been enhanced with value-added quality traits. Prerequisites for GMO detection include a minimum amount of the target gene and prior knowledge of the type of genetic modification, such as virus or insect resistance traits, including controlling elements (promoters and terminators. Moreover, DNA extraction and purification is a critical step for the preparation of PCR-quality samples, particularly for processed agricultural crops such as tobacco. This paper reviews the state-of-the-art of PCR-based method development for the qualitative and quantitative determination and identification of GMOs, and includes a short summary of official and validated GMO detection methods.

  3. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

    Directory of Open Access Journals (Sweden)

    Kwang-Pyo Kim

    2015-09-01

    Full Text Available The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634 encoding alcohol acetaldehyde dehydrogenase (Aad, previously designated as Listeria adhesion protein (LAP, and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology. PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL.

  4. Detection of fungi by conventional methods and semi-nested PCR in patients with presumed fungal keratitis.

    Science.gov (United States)

    Haghani, I; Amirinia, F; Nowroozpoor-Dailami, K; Shokohi, T

    2015-06-01

    Fungal keratitis is a suppurative, ulcerative, and sight-threatening infection of the cornea that sometimes leads to blindness. The aims of this study were: recuperating facilities for laboratory diagnosis, determining the causative microorganisms, and comparing conventional laboratory diagnostic tools and semi-nested PCR. Sampling was conducted in patients with suspected fungal keratitis. Two corneal scrapings specimens, one for direct smear and culture and the other for semi- nested PCR were obtained. Of the 40 expected cases of mycotic keratitis, calcofluor white staining showed positivity in 25%, culture in 17.5%, KOH in 10%, and semi-nested PCR in 27.5%. The sensitivities of semi-nested PCR, KOH, and CFW were 57.1%, 28.5%, and 42% while the specificities were 78.7%, 94%, and 78.7%, respectively. The time taken for PCR assay was 4 to 8 hours, whereas positive fungal cultures took at least 5 to 7 days. Due to the increasing incidence of fungal infections in people with weakened immune systems, uninformed using of topical corticosteroids and improper use of contact lens, fast diagnosis and accurate treatment of keratomycosis seems to be essential . Therefore, according to the current study, molecular methods can detect mycotic keratitis early and correctly leading to appropriate treatment.

  5. A rapid cycleave PCR method for distinguishing the vaccine strain Brucella abortus A19 in China.

    Science.gov (United States)

    Nan, Wenlong; Zhang, Yueyong; Tan, Pengfei; Xu, Zouliang; Chen, Yuqi; Mao, Kairong; Chen, Yiping

    2016-05-01

    Brucellosis is a widespread zoonotic disease caused by Brucella spp. Immunization with attenuated vaccines has proved to be an effective method of prevention; however, it may also interfere with diagnosis. Brucella abortus strain A19, which is homologous to B. abortus strain S19, is widely used for the prevention of bovine brucellosis in China. For effective monitoring of the control of brucellosis, it is essential to distinguish A19 from field strains. Single-nucleotide polymorphism-based assays offer a new approach to such discrimination studies. In the current study, we developed a cycleave PCR assay that successfully distinguished attenuated vaccine strains A19 and S19 from 22 strains of B. abortus and 57 strains of 5 other Brucella species. The assay gave a negative reaction with 4 non-Brucella species. The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 7.6 fg for the A19 strain and 220 fg for the single non-A19/non-S19 Brucella strain tested (B. abortus 104M). The assay was also reproducible (intra- and interassay coefficients of variation: 0.003-0.01 and 0.004-0.025, respectively). The cycleave assay gave an A19/S19-specific reaction in 3 out of 125 field serum samples, with the same 3 samples being positive in an alternative A19/S19-specific molecular assay. The cycleave assay gave a total of 102 Brucella-specific reactions (3 being the A19/S19-specific reactions), whereas an alternative Brucella-specific assay gave 92 positive reactions (all also positive in the cycleave assay). Therefore, this assay represents a simple, rapid, sensitive, and specific tool for use in brucellosis control. © 2016 The Author(s).

  6. PCR-based methods for identification of potentially zoonotic ascaridoid parasites of the dog, fox and cat.

    Science.gov (United States)

    Jacobs, D E; Zhu, X; Gasser, R B; Chilton, N B

    1997-11-01

    Genomic DNA was extracted from ascaridoid nematodes collected from dogs, foxes and cats. A region spanning the second internal transcribed spacer (ITS-2) of the ribosomal DNA of each sample was amplified by PCR. Representative ITS-2 products for each nematode species (Toxocara canis, Toxocara cati and Toxascaris leonina) were sequenced. Restriction sites were identified for use as genetic markers in a PCR-linked RFLP assay. The three species could be differentiated from each other and from other ascaridoids that may be found in human tissues by use of two endonucleases, HinfI and RsaI. Primers were designed to unique regions of the ITS-2 sequences of the three species for use in diagnostic PCR procedures and primer sets evaluated against panels of homologous and heterologous DNA samples. Results suggest that both methods are good candidates for further development for the detection and/or identification of ascaridoid larvae in human tissues.

  7. Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella

    Science.gov (United States)

    2009-01-01

    Background One of the major sources of human Salmonella infections is meat. Therefore, efficient and rapid monitoring of Salmonella in the meat production chain is necessary. Validation of alternative methods is needed to prove that the performance is equal to established methods. Very few of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non-commercial real-time PCR method for detection of Salmonella in meat and carcass swabs. Results The comparative trial was performed against a reference method (NMKL-71:5, 1999) using artificially and naturally contaminated samples (60 minced veal and pork meat samples, 60 poultry neck-skins, and 120 pig carcass swabs). The relative accuracy was 99%, relative detection level 100%, relative sensitivity 103% and relative specificity 100%. The collaborative trial included six laboratories testing minced meat, poultry neck-skins, and carcass swabs as un-inoculated samples and samples artificially contaminated with 1–10 CFU/25 g, and 10–100 CFU/25 g. Valid results were obtained from five of the laboratories and used for the statistical analysis. Apart from one of the non-inoculated samples being false positive with PCR for one of the laboratories, no false positive or false negative results were reported. Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion The real-time PCR method for detection of Salmonella in meat

  8. ReadqPCR and NormqPCR: R packages for the reading, quality checking and normalisation of RT-qPCR quantification cycle (Cq data

    Directory of Open Access Journals (Sweden)

    Perkins James R

    2012-07-01

    Full Text Available Abstract Background Measuring gene transcription using real-time reverse transcription polymerase chain reaction (RT-qPCR technology is a mainstay of molecular biology. Technologies now exist to measure the abundance of many transcripts in parallel. The selection of the optimal reference gene for the normalisation of this data is a recurring problem, and several algorithms have been developed in order to solve it. So far nothing in R exists to unite these methods, together with other functions to read in and normalise the data using the chosen reference gene(s. Results We have developed two R/Bioconductor packages, ReadqPCR and NormqPCR, intended for a user with some experience with high-throughput data analysis using R, who wishes to use R to analyse RT-qPCR data. We illustrate their potential use in a workflow analysing a generic RT-qPCR experiment, and apply this to a real dataset. Packages are available from http://www.bioconductor.org/packages/release/bioc/html/ReadqPCR.htmland http://www.bioconductor.org/packages/release/bioc/html/NormqPCR.html Conclusions These packages increase the repetoire of RT-qPCR analysis tools available to the R user and allow them to (amongst other things read their data into R, hold it in an ExpressionSet compatible R object, choose appropriate reference genes, normalise the data and look for differential expression between samples.

  9. FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method

    Directory of Open Access Journals (Sweden)

    Lu Jia

    2011-10-01

    Full Text Available Abstract Background Although a variety of methods and expensive kits are available, molecular cloning can be a time-consuming and frustrating process. Results Here we report a highly simplified, reliable, and efficient PCR-based cloning technique to insert any DNA fragment into a plasmid vector or into a gene (cDNA in a vector at any desired position. With this method, the vector and insert are PCR amplified separately, with only 18 cycles, using a high fidelity DNA polymerase. The amplified insert has the ends with ~16-base overlapping with the ends of the amplified vector. After DpnI digestion of the mixture of the amplified vector and insert to eliminate the DNA templates used in PCR reactions, the mixture is directly transformed into competent E. coli cells to obtain the desired clones. This technique has many advantages over other cloning methods. First, it does not need gel purification of the PCR product or linearized vector. Second, there is no need of any cloning kit or specialized enzyme for cloning. Furthermore, with reduced number of PCR cycles, it also decreases the chance of random mutations. In addition, this method is highly effective and reproducible. Finally, since this cloning method is also sequence independent, we demonstrated that it can be used for chimera construction, insertion, and multiple mutations spanning a stretch of DNA up to 120 bp. Conclusion Our FastCloning technique provides a very simple, effective, reliable, and versatile tool for molecular cloning, chimera construction, insertion of any DNA sequences of interest and also for multiple mutations in a short stretch of a cDNA.

  10. A field based detection method for Rose rosette virus using isothermal probe-based Reverse transcription-recombinase polymerase amplification assay.

    Science.gov (United States)

    Babu, Binoy; Washburn, Brian K; Ertek, Tülin Sarigül; Miller, Steven H; Riddle, Charles B; Knox, Gary W; Ochoa-Corona, Francisco M; Olson, Jennifer; Katırcıoğlu, Yakup Zekai; Paret, Mathews L

    2017-09-01

    Rose rosette disease, caused by Rose rosette virus (RRV; genus Emaravirus) is a major threat to the rose industry in the U.S. The only strategy currently available for disease management is early detection and eradication of the infected plants, thereby limiting its potential spread. Current RT-PCR based diagnostic methods for RRV are time consuming and are inconsistent in detecting the virus from symptomatic plants. Real-time RT-qPCR assay is highly sensitive for detection of RRV, but it is expensive and requires well-equipped laboratories. Both the RT-PCR and RT-qPCR cannot be used in a field-based testing for RRV. Hence a novel probe based, isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA) assay, using primer/probe designed based on the nucleocapsid gene of the RRV has been developed. The assay is highly specific and did not give a positive reaction to other viruses infecting roses belonging to both inclusive and exclusive genus. Dilution assays using the in vitro transcript showed that the primer/probe set is highly sensitive, with a detection limit of 1 fg/μl. In addition, a rapid technique for the extraction of viral RNA (rose varieties, collected from different states in the U.S. The entire process, including the extraction can be completed in 25min, with less sophisticated equipments. The developed assay can be used with high efficiency in large scale field testing for rapid detection of RRV in commercial nurseries and landscapes. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Rapid detection of Salmonella in pet food: design and evaluation of integrated methods based on real-time PCR detection.

    Science.gov (United States)

    Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane

    2012-02-01

    Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.

  12. ITPI: Initial Transcription Process-Based Identification Method of Bioactive Components in Traditional Chinese Medicine Formula

    Directory of Open Access Journals (Sweden)

    Baixia Zhang

    2016-01-01

    Full Text Available Identification of bioactive components is an important area of research in traditional Chinese medicine (TCM formula. The reported identification methods only consider the interaction between the components and the target proteins, which is not sufficient to explain the influence of TCM on the gene expression. Here, we propose the Initial Transcription Process-based Identification (ITPI method for the discovery of bioactive components that influence transcription factors (TFs. In this method, genome-wide chip detection technology was used to identify differentially expressed genes (DEGs. The TFs of DEGs were derived from GeneCards. The components influencing the TFs were derived from STITCH. The bioactive components in the formula were identified by evaluating the molecular similarity between the components in formula and the components that influence the TF of DEGs. Using the formula of Tian-Zhu-San (TZS as an example, the reliability and limitation of ITPI were examined and 16 bioactive components that influence TFs were identified.

  13. Application of a PCR method for the diagnosis of ulcerative enteritis: preliminary results

    Directory of Open Access Journals (Sweden)

    Fabrizio Agnoletti

    2010-01-01

    Full Text Available Ulcerative enteritis or “quail disease” is an acute clostridial infection of young birds reported in many avian species, chicken and turkey included. Clostridium colinum is the causative agent of ulcerative enteritis and because of the difficulties bound to the isolation and identification of this bacterium by means of classic bacteriological techniques, its detection appears very hard and the prevalence of this disease could be underestimated. To investigate the diffusion of C. colinum in enteric disease of birds, a recently developed PCR protocol was applied to 42 cultural broths previously inoculated with organs and intestinal samples collected from diseased subjects. PCR-positive broths were cultivated to attempt the isolation of C. colinum. Samples collected from positive birds were subjected to histological examinations. 4 birds (3 broilers chickens and 1 pigeon resulted PCR-positive and, in one case, C. colinum was isolated. Gross and histological lesions of positive birds were compatible with those described in other ulcerative enteritis outbreaks. These preliminary results demonstrates that C. colinum is sporadically implicated in enteric diseases of broiler chickens (14.2%. In addition, the PCR assay proved to be an useful and reliable instrument to support the diagnosis of ulcerative enteritis and to facilitate the isolation of C. colinum.

  14. Study Unveils New Method for Universal Extraction and PCR Amplification of Fungal DNA

    Science.gov (United States)

    2014-06-12

    ubiquitous human fungal pathogen. It is the most commonly seen Aspergillus infection, and it responds to the usual antifungal treatment, amphotericin...600. Besides the tough exterior, some fungi also have melanin in their cell walls, and may contain carbohydrates and other substances that inhibit PCR

  15. DETECTION OF GIARDIA IN ENVIRONMENTAL WATERS BY IMMUNO-PCR AMPLIFICATION METHODS

    Science.gov (United States)

    Genomic DNA was extracted either directly from Giardia muris cysts seeded into environmental surface waters or from cysts isolated by immunomagnetic beads (IMB}. A 0.171-kbp segment of the giardin gene was PCR-amplified following "direct extraction" of Giardia DNA from seeded Cah...

  16. Validation of a PCR-based method for detection of food-borne thermotolerant Campylobacters in a multicenter collaborative trial

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Cook, N.; D'Agostino, M.

    2004-01-01

    A PCR-based method for rapid detection of food-borne thermotolerant campylobacters was evaluated through a collaborative trial with 12 laboratories testing spiked carcass rinse samples. The method showed an interlaboratory diagnostic sensitivity of 96.7% and a diagnostic specificity of 100% for c......% for chicken samples, while these values were 94.2 and 83.3%, respectively, for pig samples....

  17. Incidence of Listeria species in bovine, ovine, caprine, camel and water buffalo milk using cultural method and the PCR assay

    OpenAIRE

    Rahimi, Ebrahim; Momtaz, Hassan; Behzadnia, Asma; Baghbadorani, Zeinab Torki

    2014-01-01

    Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. R...

  18. Development of a reverse transcription loop-mediated isothermal amplification method for the rapid detection of avian influenza virus subtype H7.

    Science.gov (United States)

    Bao, Hongmei; Wang, Xiurong; Zhao, Yuhui; Sun, Xiaodong; Li, Yanbing; Xiong, Yongzhong; Chen, Hualan

    2012-01-01

    A rapid and sensitive reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for the detection of the H7 avian influenza virus (H7 AIV) isotype was developed. The minimum detection limit of the RT-LAMP assay was 0.1-0.01 PFU per reaction for H7 AIV RNA, making this assay 100-fold more sensitive than the conventional RT-PCR method. This RT-LAMP assay also has the capacity to detect both high- and low-pathogenic H7 AIV strains. Using a pool of RNAs extracted from influenza viruses corresponding to all 15 HA subtypes (in addition to other avian pathogenic viruses), the RT-LAMP system was confirmed to amplify only H7 AIV RNA. Furthermore, specific pathogen free (SPF) chickens were infected artificially with H7 AIV, throat and cloacal swabs were collected, and viral shedding was examined using viral isolation, RT-PCR and RT-LAMP. Shedding was detected following viral isolation and RT-LAMP one day after infection, whereas viral detection using RT-PCR was effective only on day 3 post-infection. These results indicate that the RT-LAMP method could facilitate epidemiological surveillance and the rapid diagnosis of the avian influenza subtype H7. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. A fast and highly sensitive blood culture PCR method for clinical detection of Salmonella enterica serovar Typhi

    Directory of Open Access Journals (Sweden)

    Zhou Liqing

    2010-04-01

    Full Text Available Abstract Background Salmonella Typhi causes an estimated 21 million new cases of typhoid fever and 216,000 deaths every year. Blood culture is currently the gold standard for diagnosis of typhoid fever, but it is time-consuming and takes several days for isolation and identification of causative organisms. It is then too late to initiate proper antibiotic therapy. Serological tests have very low sensitivity and specificity, and no practical value in endemic areas. As early diagnosis of the disease and prompt treatment are essential for optimal management, especially in children, a rapid sensitive detection method for typhoid fever is urgently needed. Although PCR is sensitive and rapid, initial research indicated similar sensitivity to blood culture and lower specificity. We developed a fast and highly sensitive blood culture PCR method for detection of Salmonella Typhi, allowing same-day initiation of treatment after accurate diagnosis of typhoid. Methods An ox bile tryptone soy broth was optimized for blood culture, which allows the complete lysis of blood cells to release intracellular bacteria without inhibiting the growth of Salmonella Typhi. Using the optimised broth Salmonella Typhi bacteria in artificial blood samples were enriched in blood culture and then detected by a PCR targeting the fliC-d gene of Salmonella Typhi. Results Tests demonstrated that 2.4% ox bile in blood culture not only lyzes blood cells completely within 1.5 hours so that the intracellular bacteria could be released, but also has no inhibiting effect on the growth of Salmonella Typhi. Three hour enrichment of Salmonella Typhi in tryptone soya broth containing 2.4% ox bile could increase the bacterial number from 0.75 CFU per millilitre of blood which is similar to clinical typhoid samples to the level which regular PCR can detect. The whole blood culture PCR assay takes less than 8 hours to complete rather than several days for conventional blood culture

  20. RAPD-PCR – still a suitable Method for Genetically Underexplored Species?

    Directory of Open Access Journals (Sweden)

    Konstanze Ursula Behrmann

    2015-11-01

    Full Text Available Saithe (Pollachius virens is a commercially important fish species; the annual catch quota in the Northeast Atlantic exceeds 100.000 t. Despite that saithe is underexplored from a fish population genetically view. Because saithe is a highly migratory species, which undergoes a long larval drift, the population structure of saithe within the Northeast Atlantic is not fully understood. Models used as a basis for the management plan are based on tagging studies, which have been carried out in the 1960th. But still there are doubts regarding the numbers of stocks living in the Northeast Atlantic. Migration routes are affected by salmon farming, growing steadily from the 1990th. In the last years a hyperstability of the saithe stock in the North Sea had been detected underlining the need to have a closer look on the saithe stocks in the Northeast Atlantic. Random amplified polymorphic DNA (RAPD - PCR is a DNA fingerprinting technique often used in species identification and population genetic research for species, whose genome has not been sequenced very extensive as being the case for most of the food fishes. We applied RAPD-PCR in a study of saithe populations from the North Atlantic. The suitability of RAPD-PCR was improved by optimisations for enhanced reproducibility. The “classical” protocol for RAPD-PCR was modified by increasing the annealing temperature and shortening the time of annealing, providing a much better reproducibility. Thus, RAPD-PCR was found to be a straightforward and low-cost way, compared to other population genetic tools, to get a first insight into the population structure of less sequenced fish species within a very short time, being useful for preliminary studies or laboratories without large capacities for DNA sequencing.

  1. Ultra-fast DNA-based multiplex convection PCR method for meat species identification with possible on-site applications.

    Science.gov (United States)

    Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee

    2017-08-15

    The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Droplet Digital PCR for BCR/ABL(P210) Detecting of CML: A High Sensitive Method of the Minimal Residual Disease& Disease Progression.

    Science.gov (United States)

    Wang, Wen-Jun; Zheng, Chao-Feng; Liu, Zhuang; Tan, Yan-Hong; Chen, Xiu-Hua; Zhao, Bin-Liang; Li, Guo-Xia; Xu, Zhi-Fang; Ren, Fang-Gang; Zhang, Yao-Fang; Chang, Jian-Mei; Wang, Hong-Wei

    2018-04-25

    The present study intended to establish a droplet digital PCR (dd-PCR) for monitoring minimal residual disease (MRD) in patients with BCR/ABL (P210)-positive CML, thereby achieving deep-level monitoring of tumor load and determining the efficacy for guided clinically individualized treatment. Using dd-PCR and RT-qPCR, two cell suspensions were obtained from K562 cells and normal peripheral blood mononuclear cells by gradient dilution and were measured at the cellular level. At peripheral blood(PB) level, 61 cases with CML-chronic phase (CML-CP) were obtained after tyrosine kinase inhibitors (TKIs) treatment and regular follow-ups. By RT-qPCR, BCR/ABL (P210) fusion gene was undetectable in PB after three successive analyses, which were performed once every three months. At the same time, dd-PCR was performed simultaneously with the last equal amount of cDNA. Ten CML patients with MR4.5 were followed up by the two methods. At the cellular level, consistency of results of dd-PCR and RT-qPCR reached R 2 ≥0.99, with conversion equation of Y=33.148X 1.222 (Y: dd-PCR results; X: RT-qPCR results). In the dd-PCR test, 11 of the 61 CML patients (18.03%) tested positive and showed statistically significant difference (PPCR 3 months earlier than by RT-qPCR. In contrast with RT-qPCR, dd-PCR is more sensitive, thus enabling accurate conversion of dd-PCR results into internationally standard RT-qPCR results by conversion equation, to achieve a deeper molecular biology-based stratification of BCR/ABL(P210) MRD. It has some reference value to monitor disease progression in clinic. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  3. A Computational Re-Examination of Béla Bartók's Transcription Methods as Exemplified by his Sirató Transcriptions of 1937/1938 and their Relevance for Contemporary Methods of Computational Transcription of Qur'an Recitation

    NARCIS (Netherlands)

    Biró, D.P.; van Kranenburg, P.; Holzapfel, A.

    2014-01-01

    This is a study about furthering transcription methods via com- putational means. In particular we re-examine Bartók’s methods of transcription to see how his project of transcription might be continued incorporating 21st century technology. We then go on to apply our established analytical and

  4. A novel method of selective removal of human DNA improves PCR sensitivity for detection of Salmonella Typhi in blood samples.

    Science.gov (United States)

    Zhou, Liqing; Pollard, Andrew J

    2012-07-27

    Enteric fever is a major public health problem, causing an estimated 21million new cases and 216,000 or more deaths every year. Current diagnosis of the disease is inadequate. Blood culture only identifies 45 to 70% of the cases and is time-consuming. Serological tests have very low sensitivity and specificity. Clinical samples obtained for diagnosis of enteric fever in the field generally have blood, so that even PCR-based methods, widely used for detection of other infectious diseases, are not a straightforward option in typhoid diagnosis. We developed a novel method to enrich target bacterial DNA by selective removal of human DNA from blood samples, enhancing the sensitivity of PCR tests. This method offers the possibility of improving PCR assays directly using clinical specimens for diagnosis of this globally important infectious disease. Blood samples were mixed with ox bile for selective lysis of human blood cells and the released human DNA was then digested with addition of bile resistant micrococcal nuclease. The intact Salmonella Typhi bacteria were collected from the specimen by centrifugation and the DNA extracted with QIAamp DNA mini kit. The presence of Salmonella Typhi bacteria in blood samples was detected by PCR with the fliC-d gene of Salmonella Typhi as the target. Micrococcal nuclease retained activity against human blood DNA in the presence of up to 9% ox bile. Background human DNA was dramatically removed from blood samples through the use of ox bile lysis and micrococcal nuclease for removal of mammalian DNA. Consequently target Salmonella Typhi DNA was enriched in DNA preparations and the PCR sensitivity for detection of Salmonella Typhi in spiked blood samples was enhanced by 1,000 fold. Use of a combination of selective ox-bile blood cell lysis and removal of human DNA with micrococcal nuclease significantly improves PCR sensitivity and offers a better option for improved typhoid PCR assays directly using clinical specimens in diagnosis of

  5. Differentiation among isolates of prunus necrotic ringspot virus by transcript conformation polymorphism.

    Science.gov (United States)

    Rosner, A; Maslenin, L; Spiegel, S

    1998-09-01

    A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.

  6. Development of a Rapid Detection Method for Potato virus X by Reverse Transcription Loop-Mediated Isothermal Amplification

    Directory of Open Access Journals (Sweden)

    Joojin Jeong

    2015-09-01

    Full Text Available The primary step for efficient control of viral diseases is the development of simple, rapid, and sensitive virus detection. Reverse transcription loop-mediated isothermal amplification (RT-LAMP has been used to detect viral RNA molecules because of its simplicity and high sensitivity for a number of viruses. RT-LAMP for the detection of Potato virus X (PVX was developed and compared with conventional reverse transcription polymerase chain reaction (RT-PCR to demonstrate its advantages over RT-PCR. RT-LAMP reactions were conducted with or without a set of loop primers since one out of six primers showed PVX specificity. Based on real-time monitoring, RT-LAMP detected PVX around 30 min, compared to 120 min for RT-PCR. By adding a fluorescent reagent during the reaction, the extra step of visualization by gel electrophoresis was not necessary. RT-LAMP was conducted using simple inexpensive instruments and a regular incubator to evaluate whether RNA could be amplified at a constant temperature instead of using an expensive thermal cycler. This study shows the potential of RT-LAMP for the diagnosis of viral diseases and PVX epidemiology because of its simplicity and rapidness compared to RT-PCR.

  7. A simple method for encapsulating single cells in alginate microspheres allows for direct PCR and whole genome amplification.

    Directory of Open Access Journals (Sweden)

    Saharnaz Bigdeli

    Full Text Available Microdroplets are an effective platform for segregating individual cells and amplifying DNA. However, a key challenge is to recover the contents of individual droplets for downstream analysis. This paper offers a method for embedding cells in alginate microspheres and performing multiple serial operations on the isolated cells. Rhodobacter sphaeroides cells were diluted in alginate polymer and sprayed into microdroplets using a fingertip aerosol sprayer. The encapsulated cells were lysed and subjected either to conventional PCR, or whole genome amplification using either multiple displacement amplification (MDA or a two-step PCR protocol. Microscopic examination after PCR showed that the lumen of the occupied microspheres contained fluorescently stained DNA product, but multiple displacement amplification with phi29 produced only a small number of polymerase colonies. The 2-step WGA protocol was successful in generating fluorescent material, and quantitative PCR from DNA extracted from aliquots of microspheres suggested that the copy number inside the microspheres was amplified up to 3 orders of magnitude. Microspheres containing fluorescent material were sorted by a dilution series and screened with a fluorescent plate reader to identify single microspheres. The DNA was extracted from individual isolates, re-amplified with full-length sequencing adapters, and then a single isolate was sequenced using the Illumina MiSeq platform. After filtering the reads, the only sequences that collectively matched a genome in the NCBI nucleotide database belonged to R. sphaeroides. This demonstrated that sequencing-ready DNA could be generated from the contents of a single microsphere without culturing. However, the 2-step WGA strategy showed limitations in terms of low genome coverage and an uneven frequency distribution of reads across the genome. This paper offers a simple method for embedding cells in alginate microspheres and performing PCR on isolated

  8. Multiway real-time PCR gene expression profiling in yeast. Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli

    Czech Academy of Sciences Publication Activity Database

    Stahlberg, A.; Elbing, K.; Andrade-Garda, J.M.; Sjögreen, B.; Forootan, A.; Kubista, Mikael

    2008-01-01

    Roč. 9, č. 170 (2008), s. 1-41 ISSN 1471-2164 Institutional research plan: CEZ:AV0Z50520701 Keywords : Expression Profiling * Real-time PCR * Yeast Subject RIV: EI - Biotechnology ; Bionics Impact factor: 3.926, year: 2008

  9. Detection of human papillomavirus by hybrid capture and real time PCR methods in patients with chronic cervicitis and cervical intraepithelial

    Directory of Open Access Journals (Sweden)

    Elisha Khandker

    2016-07-01

    Full Text Available Background and objectives:Cervical cancer due to Human papillomavirus (HPV is one of the leading causes of morbidity and mortality in women. Testing of HPV can identify women who are at risk of cervical cancer. Nowadays, molecular methods like real time polymerase chain reaction (PCR and hybrid capture technique are applied for detecting HPV in cervical specimens. The objective of the present study was to determine the rate of HPV infection in women with chronic cervicitis and cervical intraepithelial neoplasia (CIN by a commercial real time polymerase chain reaction test kit and by a hybrid capture HPV DNA test. Methods:Women aged between 20 to 55 years with chronic cervicitis and CIN were enrolled in the study after obtaining informed consent. Cervical specimen was collected by using cervical brush and stored in transport medium until used. HPV was detected by High Risk Screen Real-TM Quant 2x (Sacace, Biotechnologies SrI, Italy real time PCR kit (HR RT-PCR and by Hybrid Capture-2 High-Risk HPV DNA (Hc-2; Digene Corporation, USA test. Results: Total 72 women with chronic cervicitis and CIN of different grades were included in the study. Out of this, HPV infection detected by HR RT-PCR was 31 (43% and by Hc-2 was 14 (19.4%. Both the tests were able to detect HPV infection in all the CIN 3 cases and in most of the CIN 2 cases. However, HR RT-PCR detected higher number of HPV in chronic cervicitis and CIN1 cases. Conclusion:The study has shown that HR RT-PCR and Hc-2 tests are equally effective in detecting HPV infection in patients with CIN 2 and CIN 3 lesions. However, HR RT-PCR is more sensitive test for detecting HPV in chronic cervicitis and early CIN lesions and, therefore can be used in epidemiological study to detect presence of HPV in general population. IMC J Med Sci 2016; 10(2: 45-48

  10. Development and evaluation of event-specific quantitative PCR method for genetically modified soybean A2704-12.

    Science.gov (United States)

    Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.

  11. Novel degenerate PCR method for whole genome amplification applied to Peru Margin (ODP Leg 201 subsurface samples

    Directory of Open Access Journals (Sweden)

    Amanda eMartino

    2012-01-01

    Full Text Available A degenerate PCR-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. The method, which we have called Random Amplification Metagenomic PCR (RAMP, involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3’ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10X. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin, and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa show that community analysis can be sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low biomass samples.

  12. Novel Degenerate PCR Method for Whole-Genome Amplification Applied to Peru Margin (ODP Leg 201) Subsurface Samples

    Science.gov (United States)

    Martino, Amanda J.; Rhodes, Matthew E.; Biddle, Jennifer F.; Brandt, Leah D.; Tomsho, Lynn P.; House, Christopher H.

    2011-01-01

    A degenerate polymerase chain reaction (PCR)-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. While optimized here for use with Roche 454 technology, the general framework presented may be applicable to other next generation sequencing systems as well (e.g., Illumina, Ion Torrent). The method, which we have called random amplification metagenomic PCR (RAMP), involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3′ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10×. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin), and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa identified illustrates well the generally accepted view that community analysis is sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low-biomass samples. PMID:22319519

  13. Optimization of a Real Time PCR based method for the detection of Listeria monocytogenes in pork meat.

    Science.gov (United States)

    Gattuso, Antonietta; Gianfranceschi, Monica Virginia; Sonnessa, Michele; Delibato, Elisabetta; Marchesan, Massimo; Hernandez, Marta; De Medici, Dario; Rodriguez-Lazaro, David

    2014-08-01

    The aim of this study was to optimize a Real-Time PCR protocol for a rapid detection of Listeria monocytogenes in pork meat, using reduced volumes of primary selective enrichment broth and times of incubation to decrease the cost and time for analysis. Forty-five samples of pork meat were artificially contaminated with two different levels of L. monocytogenes (1-10 CFU per sample and 10-100 CFU per sample), homogenized in three different volumes of Half Fraser Broth (1:3; 1:5 and 1:10) and incubated at 30°C ± 1°C for 5h, 8h and 24h. The detection was conducted in parallel by Real-Time PCR and the ISO standard 11290-1 methods. L. monocytogenes was detected in all the samples after 24h by Real-Time PCR method, also using reduced volumes of Half Fraser Broth. This represents a clear advantage as the time to final detection and the inherent costs were significantly reduced compared to the ISO reference method. All samples artificially contaminated were correctly detected also after 8 of incubation at 30°C ± 1°C in Half Fraser Broth and 24h in Fraser Broth at 37°C ± 1°C using cultural method. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. One-step multiplex PCR method for the determination of pecan and Brazil nut allergens in food products.

    Science.gov (United States)

    Hubalkova, Zora; Rencova, Eva

    2011-10-01

    A one-step polymerase chain reaction (PCR) method for the simultaneous detection of the major allergens of pecan and Brazil nuts was developed. Primer pairs for the amplification of partial sequences of genes encoding the allergens were designed and tested for their specificity on a range of food components. The targeted amplicon size was 173 bp of Ber e 1 gene of Brazil nuts and 72 bp of vicilin-like seed storage protein gene in pecan nuts. The primer pair detecting the noncoding region of the chloroplast DNA was used as the internal control of amplification. The intrinsic detection limit of the PCR method was 100 pg mL(-1) pecan or Brazil nuts DNA. The practical detection limit was 0.1% w/w (1 g kg(-1)). The method was applied for the investigation of 63 samples with the declaration of pecans, Brazil nuts, other different nut species or nuts generally. In 15 food samples pecans and Brazil nuts allergens were identified in the conformity with the food declaration. The presented multiplex PCR method is specific enough and can be used as a fast approach for the detection of major allergens of pecan or Brazil nuts in food. Copyright © 2011 Society of Chemical Industry.

  15. Evaluation and Comparison of Multiple Test Methods, Including Real-time PCR, for Legionella Detection in Clinical Specimens

    Science.gov (United States)

    Peci, Adriana; Winter, Anne-Luise; Gubbay, Jonathan B.

    2016-01-01

    Legionella is a Gram-negative bacterium that can cause Pontiac fever, a mild upper respiratory infection and Legionnaire’s disease, a more severe illness. We aimed to compare the performance of urine antigen, culture, and polymerase chain reaction (PCR) test methods and to determine if sputum is an acceptable alternative to the use of more invasive bronchoalveolar lavage (BAL). Data for this study included specimens tested for Legionella at Public Health Ontario Laboratories from 1st January, 2010 to 30th April, 2014, as part of routine clinical testing. We found sensitivity of urinary antigen test (UAT) compared to culture to be 87%, specificity 94.7%, positive predictive value (PPV) 63.8%, and negative predictive value (NPV) 98.5%. Sensitivity of UAT compared to PCR was 74.7%, specificity 98.3%, PPV 77.7%, and NPV 98.1%. Out of 146 patients who had a Legionella-positive result by PCR, only 66 (45.2%) also had a positive result by culture. Sensitivity for culture was the same using either sputum or BAL (13.6%); sensitivity for PCR was 10.3% for sputum and 12.8% for BAL. Both sputum and BAL yield similar results regardless testing methods (Fisher Exact p-values = 1.0, for each test). In summary, all test methods have inherent weaknesses in identifying Legionella; therefore, more than one testing method should be used. Obtaining a single specimen type from patients with pneumonia limits the ability to diagnose Legionella, particularly when urine is the specimen type submitted. Given ease of collection and similar sensitivity to BAL, clinicians are encouraged to submit sputum in addition to urine when BAL submission is not practical from patients being tested for Legionella. PMID:27630979

  16. Evaluation and comparison of multiple test methods, including real-time PCR, for Legionella detection in clinical specimens.

    Directory of Open Access Journals (Sweden)

    Adriana Peci

    2016-08-01

    Full Text Available Legionella is a gram-negative bacterium that can cause Pontiac fever, a mild upper respiratory infection and Legionnaire’s disease, a more severe illness. We aimed to compare the performance of urine antigen, culture and PCR test methods and to determine if sputum is an alternative to the use of more invasive bronchoalveolar lavage (BAL. Data for this study included specimens tested for Legionella at PHOL from January 1, 2010 to April 30, 2014, as part of routine clinical testing. We found sensitivity of UAT compared to culture to be 87%, specificity 94.7%, positive predictive value (PPV 63.8% and negative predictive value (NPV 98.5%. Sensitivity of UAT compared to PCR was 74.7%, specificity 98.3%, PPV 77.7% and NPV 98.1%. Of 146 patients who had a Legionella positive result by PCR, only 66(45.2% also had a positive result by culture. Sensitivity for culture was the same using either sputum or BAL (13.6%; sensitivity for PCR was 10.3% for sputum and 12.8% for BAL. Both sputum and BAL yield similar results despite testing methods (Fisher Exact p-values=1.0, for each test. In summary, all test methods have inherent weaknesses in identifying Legionella; thereforemore than one testing method should be used. Obtaining a single specimen type from patients with pneumonia limits the ability to diagnose Legionella, particularly when urine is the specimen type submitted. Given ease of collection, and similar sensitivity to BAL, clinicians are encouraged to submit sputum in addition to urine when BAL submission is not practical, from patients being tested for Legionella.

  17. In vitro adhesion assay of lactic acid bacteria, Escherichia coli and Salmonella sp. by microbiological and PCR methods

    Directory of Open Access Journals (Sweden)

    Didier Montet

    2006-03-01

    Full Text Available In vitro adhesion assay using Lactobacillus reuteri KUB-AC5 as a test strain has been studied by applying simple PCR reaction together with image analysis and plate count techniques. Critical factor affecting the PCR method was quality and quantity of DNA. The cell lysis technique was modified to optimize this method. Thus, lysozyme and proteinase K were added to lyse the cells, followed by SDS solution to obtain a complete cell lysis. Only PCR products from total cells (TC were obtained, with low consistency, but none from cells bound to mucus (BC at either 0.1 or 0.5 mg/mL concentration. It was hypothesized that the attached cells might not be extracted into the cell suspension. Therefore, 1% SDS solution and 0.1M NaOH were used directly in the extraction. As expected, PCR products were observed when both TC and BC were used as a DNA template. Adhesion appeared at a wide range of 0-45%, with low consistency. Therefore, a simple microbiological method (plate count was used. The extraction of bound cells into cell suspension was critical in this method. Extraction times of 20, 60, 120 and 150 min were tried. Results showed that maximum cell number was obtained with 120 min extraction. L. reuteri KUB-AC5, L. reuteri KUB-AC16, L. reuteri KUB-AC20, L. salivarius KUB-AC21, L. acidophilus KV-1, Escherichia coli E010, Salmonella sp. S003, E. coli ATCC8739, and S. typhimurium ATCC 13311 exhibited adhesion activity of 21.6%, 0.8%, 5.7%, 1.1%, 23.1%, 10.7%, 10.3%, 4.4% and 3.2%, respectively. Among the 9 types of microorganisms tested L. acidophilus KV-1 and L. reuteri KUB-AC5 showed higher adhesion activity than the others.

  18. Assessment of Clinically Suspected Tubercular Lymphadenopathy by Real-Time PCR Compared to Non-Molecular Methods on Lymph Node Aspirates.

    Science.gov (United States)

    Gupta, Vivek; Bhake, Arvind

    2018-01-01

    The diagnosis of tubercular lymphadenitis (TBLN) is challenging. This study assesses the role of diagnostic intervention with real-time PCR in clinically suspected tubercular lymphadenopathy in relation to cytology and microbiological methods. The cross-sectional study involved 214 patients, and PCR, cytology, and Ziehl-Neelsen (ZN) staining was performed on aspirates. The findings were compared with culture on Lowenstein-Jensen medium. The overall concordance of cytology and PCR, both individually and combined, was calculated. χ2 and Phi values were assessed between cytology, PCR, and culture. A cytological diagnosis of tuberculosis (TB), reactive lymphoid hyperplasia, and suppurative lymphadenitis was made in 71, 112, and 6 patients, respectively. PCR and culture were positive in 40% of the cases. Among the TBLN patients, PCR showed higher positivity in necrosis and culture showed higher positivity in necrotizing granuloma. Positive ZN staining was observed in 29.6% of the TBLN cases, with an overall positivity of 11%. PCR could additionally detect 82 cases missed by ZN staining. The overall concordance rate for either diagnostic modality, i.e., PCR or cytology, was highest (75%), and for PCR alone was 74%. Phi values were observed to be 0.47 between PCR and culture. Real-time PCR for Mycobacterium tuberculosis complex on aspirates offers a definitive and comparable diagnosis of TBLN. Including this approach as the primary investigation in the work-up of TBLN could reduce the burden of TB. © 2017 S. Karger AG, Basel.

  19. Novel One-Step Multiplex PCR-Based Method for HLA Typing and Preimplantational Genetic Diagnosis of -Thalassemia

    Directory of Open Access Journals (Sweden)

    Raquel M. Fernández

    2013-01-01

    Full Text Available Preimplantation genetic diagnosis (PGD of single gene disorders, combined with HLA matching (PGD-HLA, has emerged as a tool for couples at risk of transmitting a genetic disease to select unaffected embryos of an HLA tissue type compatible with that of an existing affected child. Here, we present a novel one-step multiplex PCR to genotype a spectrum of STRs to simultaneously perform HLA typing and PGD for -thalassemia. This method is being routinely used for PGD-HLA cycles in our department, with a genotyping success rate of 100%. As an example, we present the first successful PGD-HLA typing in Spain, which resulted in the birth of a boy and subsequent successful HSC transplantation to his affected brother, who is doing well 4 years following transplantation. The advantage of our method is that it involves only a round of single PCR for multiple markers amplification (up to 10 markers within the HLA and 6 markers at the -globin loci. This strategy has allowed us to considerably reduce the optimization of the PCR method for each specific PGD-HLA family as well as the time to obtain molecular results in each cycle.

  20. Performance of two quantitative PCR methods for microbial source tracking of human sewage and implications for microbial risk assessment in recreational waters

    Science.gov (United States)

    Before new, rapid quantitative PCR (qPCR) methods for recreational water quality assessment and microbial source tracking (MST) can be useful in a regulatory context, an understanding of the ability of the method to detect a DNA target (marker) when the contaminant soure has been...

  1. Evaluation of reference genes for reverse transcription quantitative real-time PCR (RT-qPCR) studies in Silene vulgaris considering the method of cDNA preparation

    Czech Academy of Sciences Publication Activity Database

    Koloušková, Pavla; Stone, James D.; Štorchová, Helena

    2017-01-01

    Roč. 12, č. 8 (2017), č. článku e0183470. E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) LH15075; GA ČR(CZ) GA16-09220S Institutional support: RVO:61389030 Keywords : CYTOPLASMIC MALE -STERILITY * SUITABLE REFERENCE GENES * INTERNAL CONTROL GENES Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  2. SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

    Directory of Open Access Journals (Sweden)

    Daijun Ling

    Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

  3. An insulated isothermal PCR method on a field-deployable device for rapid and sensitive detection of canine parvovirus type 2 at points of need.

    Science.gov (United States)

    Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T

    2015-08-01

    Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Evaluation of kDNA PCR hybridization and ITS1 nPCR methods in different clinical samples for visceral leishmaniasis diagnosis in dogs with and without clinical signs

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R., E-mail: alineleandra@hotmail.com, E-mail: streptos@hotmail.com, E-mail: rleite2005@gmail.com, E-mail: vidasnino@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia

    2013-07-01

    Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using {sup 32}P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83

  5. Evaluation of kDNA PCR hybridization and ITS1 nPCR methods in different clinical samples for visceral leishmaniasis diagnosis in dogs with and without clinical signs

    International Nuclear Information System (INIS)

    Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R.; Melo, Maria N.

    2013-01-01

    Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using 32 P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83% (25

  6. Quantitative RT-PCR based platform for rapid quantification of the transcripts of highly homologous multigene families and their members during grain development

    DEFF Research Database (Denmark)

    Kaczmarczyk, Agnieszka Ewa; Bowra, Steve; Elek, Zoltan

    2012-01-01

    expression combined with genetic variation in large multigene families with high homology among the alleles is very challenging. Results We designed a rapid qRT-PCR system with the aim of characterising the variation in the expression of hordein genes families. All the known D-, C-, B-, and gamma......-hordein sequences coding full length open reading frames were collected from commonly available databases. Phylogenetic analysis was performed and the members of the different hordein families were classified into subfamilies. Primer sets were designed to discriminate the gene expression level of whole families...... and its subgroups. More over the results indicate the genotypic specific gene expression. Conclusions Quantitative RT-PCR with SYBR Green labelling can be a useful technique to follow gene expression levels of large gene families with highly homologues members. We showed variation in the temporal...

  7. Diagnosis of canine visceral leishmaniasis with radiolabelled probes: comparison of the kDNA PCR-hybridization with three molecular methods in different clinical samples

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Departamento de Parasitologia. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)

    2011-07-01

    Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with {sup 32}P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)

  8. Diagnosis of canine visceral leishmaniasis with radiolabelled probes: comparison of the kDNA PCR-hybridization with three molecular methods in different clinical samples

    International Nuclear Information System (INIS)

    Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R.

    2011-01-01

    Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with 32 P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)

  9. A highly sensitive and specific method for the screening detection of genetically modified organisms based on digital PCR without pretreatment.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang

    2015-08-04

    Digital PCR has developed rapidly since it was first reported in the 1990 s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products.

  10. A method for the analysis of 32 X chromosome insertion deletion polymorphisms in a single PCR

    DEFF Research Database (Denmark)

    Pereira, Rui; Pereira, Vania; Gomes, Iva

    2012-01-01

    population samples and revealed high forensic efficiency, as measured by the accumulated power of discrimination (0.9999990 was the lowest value in males and 0.999999999998 was the highest in females) and mean exclusion chance varied between 0.998 and 0.9996 in duos and between 0.99997 and 0.999998 in trios......-Indel multiplex system amplifying 32 biallelic markers in one single PCR. The multiplex includes X-Indels shown to be polymorphic in the major human population groups and follows a short amplicon strategy. The set was applied in the genetic characterization of sub-Saharan African, European and East Asian...

  11. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number

    Directory of Open Access Journals (Sweden)

    Dehghan fatemeh

    2014-05-01

    Conclusions: Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  12. Standardization of enterococci density estimates by EPA qPCR methods and comparison of beach action value exceedances in river waters with culture methods

    Science.gov (United States)

    The U.S.EPA has published recommendations for calibrator cell equivalent (CCE) densities of enterococci in recreational waters determined by a qPCR method in its 2012 Recreational Water Quality Criteria (RWQC). The CCE quantification unit stems from the calibration model used to ...

  13. A simple method for extracting DNA from rhododendron plants infected with Phytophthora spp. for use in PCR

    Directory of Open Access Journals (Sweden)

    Trzewik Aleksandra

    2016-01-01

    Full Text Available Among the numerous protocols that describe the extraction of DNA, those relating to the isolation of DNA from infected plants, are rare. This study describes a rapid and reliable method of extracting a high quality and quantity of DNA from rhododendron leaves artificially infected with Phytophthora cactorum, P. cambivora, P. cinnamomi, P. citrophthora, and P. plurivora. The use of the modified Doyle and Doyle protocol (1987 allowed us to obtain high quantity and quality DNA (18.26 μg from 100 mg of the fresh weight of infected leaves at the ratios of A260/280 and A260/230 - 1.83 and 1.72, respectively, suitable for conventional polymerase chain reaction (PCR and real-time PCR amplifications.

  14. Effects of measurement method and transcript availability on inexperienced raters' stuttering frequency scores.

    Science.gov (United States)

    Chakraborty, Nalanda; Logan, Kenneth J

    To examine the effects of measurement method and transcript availability on the accuracy, reliability, and efficiency of inexperienced raters' stuttering frequency measurements. 44 adults, all inexperienced at evaluating stuttered speech, underwent 20 min of preliminary training in stuttering measurement and then analyzed a series of sentences, with and without access to transcripts of sentence stimuli, using either a syllable-based analysis (SBA) or an utterance-based analysis (UBA). Participants' analyses were compared between groups and to a composite analysis from two experienced evaluators. Stuttering frequency scores from the SBA and UBA groups differed significantly from the experienced evaluators' scores; however, UBA scores were significantly closer to the experienced evaluators' scores and were completed significantly faster than the SBA scores. Transcript availability facilitated scoring accuracy and efficiency in both groups. The internal reliability of stuttering frequency scores was acceptable for the SBA and UBA groups; however, the SBA group demonstrated only modest point-by-point agreement with ratings from the experienced evaluators. Given its accuracy and efficiency advantages over syllable-based analysis, utterance-based fluency analysis appears to be an appropriate context for introducing stuttering frequency measurement to raters who have limited experience in stuttering measurement. To address accuracy gaps between experienced and inexperienced raters, however, use of either analysis must be supplemented with training activities that expose inexperienced raters to the decision-making processes used by experienced raters when identifying stuttered syllables. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR)

    NARCIS (Netherlands)

    Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.

    2002-01-01

    A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or

  16. Molecular beacon-based real-time PCR method for detection of porcine DNA in gelatin and gelatin capsules.

    Science.gov (United States)

    Mohamad, Nurhidayatul Asma; Mustafa, Shuhaimi; Khairil Mokhtar, Nur Fadhilah; El Sheikha, Aly Farag

    2018-03-05

    The pharmaceutical industry has boosted gelatin consumption worldwide. This is supported by the availability of cost-effective gelatin production from porcine by-products. However, cross-contamination of gelatin materials, where porcine gelatin was unintentionally included in the other animal sources of gelatin, has caused significant concerns about halal authenticity. The real-time polymerase chain reaction (PCR) has enabled a highly specific and sensitive animal species detection method in various food products. Hence, such a technique was employed in the present study to detect and quantify porcine DNA in gelatin using a molecular beacon probe, with differences in performance between mitochondrial (cytochrome b gene) and chromosomal DNA-(MPRE42 repetitive element) based porcine-specific PCR assays being compared. A higher sensitivity was observed in chromosomal DNA (MPRE-PCR assay), where this assay allows the detection of gelatin DNA at amounts as as low as 1 pg, whereas mitochondrial DNA (CBH-PCR assay) can only detect at levels down to 10 pg of gelatin DNA. When an analysis with commercial gelatin and gelatin capsule samples was conducted, the same result was observed, with a significantly more sensitive detection being provided by the repetitive element of chromosomal DNA. The present study has established highly sensitive DNA-based porcine detection systems derived from chromosomal DNA that are feasible for highly processed products such as gelatin and gelatin capsules containing a minute amount of DNA. This sensitive detection method can also be implemented to assist the halal authentication process of various food products available on the market. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  17. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  18. Empirical evaluation of humpback whale telomere length estimates; quality control and factors causing variability in the singleplex and multiplex qPCR methods

    DEFF Research Database (Denmark)

    Olsen, Morten Tange; Bérubé, Martine; Robbins, Jooke

    2012-01-01

    BACKGROUND:Telomeres, the protective cap of chromosomes, have emerged as powerful markers of biological age and life history in model and non-model species. The qPCR method for telomere length estimation is one of the most common methods for telomere length estimation, but has received recent...... steps of qPCR. In order to evaluate the utility of the qPCR method for telomere length estimation in non-model species, we carried out four different qPCR assays directed at humpback whale telomeres, and subsequently performed a rigorous quality control to evaluate the performance of each assay. RESULTS...... to 40% depending on assay and quantification method, however this variation only affected telomere length estimates in the worst performing assays. CONCLUSION:Our results suggest that seemingly well performing qPCR assays may contain biases that will only be detected by extensive quality control...

  19. A high-throughput splinkerette-PCR method for the isolation and sequencing of retroviral insertion sites

    DEFF Research Database (Denmark)

    Uren, Anthony G; Mikkers, Harald; Kool, Jaap

    2009-01-01

    sites has been a major limitation to performing screens on this scale. Here we present a method for the high-throughput isolation of insertion sites using a highly efficient splinkerette-PCR method coupled with capillary or 454 sequencing. This protocol includes a description of the procedure for DNA......Insertional mutagens such as viruses and transposons are a useful tool for performing forward genetic screens in mice to discover cancer genes. These screens are most effective when performed using hundreds of mice; however, until recently, the cost-effective isolation and sequencing of insertion...

  20. New Methods for Prosodic Transcription: Capturing Variability as a Source of Information

    Directory of Open Access Journals (Sweden)

    Jennifer Cole

    2016-06-01

    Full Text Available Understanding the role of prosody in encoding linguistic meaning and in shaping phonetic form requires the analysis of prosodically annotated speech drawn from a wide variety of speech materials. Yet obtaining accurate and reliable prosodic annotations for even small datasets is challenging due to the time and expertise required. We discuss several factors that make prosodic annotation difficult and impact its reliability, all of which relate to 'variability': in the patterning of prosodic elements (features and structures as they relate to the linguistic and discourse context, in the acoustic cues for those prosodic elements, and in the parameter values of the cues. We propose two novel methods for prosodic transcription that capture variability as a source of information relevant to the linguistic analysis of prosody. The first is 'Rapid Prosody Transcription '(RPT, which can be performed by non-experts using a simple set of unary labels to mark prominence and boundaries based on immediate auditory impression. Inter-transcriber variability is used to calculate continuous-valued prosody ‘scores’ that are assigned to each word and represent the perceptual salience of its prosodic features or structure. RPT can be used to model the relative influence of top-down factors and acoustic cues in prosody perception, and to model prosodic variation across many dimensions, including language variety,speech style, or speaker’s affect. The second proposed method is the identification of individual cues to the contrastive prosodic elements of an utterance. Cue specification provides a link between the contrastive symbolic categories of prosodic structures and the continuous-valued parameters in the acoustic signal, and offers a framework for investigating how factors related to the grammatical and situational context influence the phonetic form of spoken words and phrases. While cue specification as a transcription tool has not yet been explored as

  1. Determination of Baylisascaris schroederi infection in wild giant pandas by an accurate and sensitive PCR/CE-SSCP method.

    Directory of Open Access Journals (Sweden)

    Wenping Zhang

    Full Text Available It has been recognized that other than habitat loss, degradation and fragmentation, the infection of the roundworm Baylisascaris schroederi (B. schroederi is one of the major causes of death in wild giant pandas. However, the prevalence and intensity of the parasite infection has been inconsistently reported through a method that uses sedimentation-floatation followed by a microscope examination. This method fails to accurately determine infection because there are many bamboo residues and/or few B. schroederi eggs in the examined fecal samples. In the present study, we adopted a method that uses PCR and capillary electrophoresis combined with a single-strand conformation polymorphism analysis (PCR/CE-SSCP to detect B. schroederi infection in wild giant pandas at a nature reserve, and compared it to the traditional microscope approach. The PCR specifically amplified a single band of 279-bp from both fecal samples and positive controls, which was confirmed by sequence analysis to correspond to the mitochondrial COII gene of B. schroederi. Moreover, it was demonstrated that the amount of genomic DNA was linearly correlated with the peak area of the CE-SSCP analysis. Thus, our adopted method can reliably detect the infectious prevalence and intensity of B. schroederi in wild giant pandas. The prevalence of B. schroederi was found to be 54% in the 91 fecal samples examined, and 48% in the fecal samples of 31 identified individual giant pandas. Infectious intensities of the 91 fecal samples were detected to range from 2.8 to 959.2 units/gram, and from 4.8 to 959.2 units/gram in the fecal samples of the 31 identified giant pandas. For comparison, by using the traditional microscope method, the prevalence of B. schroederi was found to be only 33% in the 91 fecal samples, 32% in the fecal samples of the 31 identified giant pandas, and no reliable infectious intensity was observed.

  2. Internal quality control of PCR-based genotyping methods in research studies and patient diagnostics

    DEFF Research Database (Denmark)

    Bladbjerg, Else-Marie; Gram, Jørgen; Jespersen, Jørgen

    2002-01-01

    Genetic analyses are increasingly integrated in the clinical laboratory, and internal quality control programmes are needed. We have focused on quality control aspects of selected polymorphism analyses used in thrombosis research. DNA was isolated from EDTA-blood (n = 500) by ammonium acetate....... Control of data handling revealed 0.1% reading mistakes and 0.5% entry mistakes. Based on our experiences we propose an internal quality control programme for widely used PCR-based haemostasis polymorphism analyses.......-isolation (pre-analytical factors), DNA-amplification, digestion with restriction enzymes, electrophoresis (analytical factors), result reading and entry into a database (post-analytical factors). Furthermore, we evaluated a procedure for result confirmation. Isolated DNA was of good quality (42 microg/ml blood...

  3. Real-time PCR-based method for rapid detection of Aspergillus niger and Aspergillus welwitschiae isolated from coffee.

    Science.gov (United States)

    von Hertwig, Aline Morgan; Sant'Ana, Anderson S; Sartori, Daniele; da Silva, Josué José; Nascimento, Maristela S; Iamanaka, Beatriz Thie; Pelegrinelli Fungaro, Maria Helena; Taniwaki, Marta Hiromi

    2018-05-01

    Some species from Aspergillus section Nigri are morphologically very similar and altogether have been called A. niger aggregate. Although the species included in this group are morphologically very similar, they differ in their ability to produce mycotoxins and other metabolites and their taxonomical status has evolved continuously. Among them, A. niger and A. welwitschiae are ochratoxin A and fumonisin B 2 producers and their detection and/or identification is of crucial importance for food safety. The aim of this study was the development of a real-time PCR-based method for simultaneous discrimination of A. niger and A. welwitschiae from other species of the A. niger aggregate isolated from coffee beans. One primer pair and a hybridization probe specific for detection of A. niger and A. welwitschiae strains were designed based on the BenA gene sequences, and used in a Real-time PCR assay for the rapid discrimination between both these species from all others of the A. niger aggregate. The Real-time PCR assay was shown to be 100% efficient in discriminating the 73 isolates of A. niger/A. welwitschiae from the other A. niger aggregate species analyzed as a negative control. This result testifies to the use of this technique as a good tool in the rapid detection of these important toxigenic species. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. A multiplex PCR-based method for the detection and early identification of wood rotting fungi in standing trees.

    Science.gov (United States)

    Guglielmo, F; Bergemann, S E; Gonthier, P; Nicolotti, G; Garbelotto, M

    2007-11-01

    The goal of this research was the development of a PCR-based assay to identify important decay fungi from wood of hardwood tree species in northern temperate regions. Eleven taxon-specific primers were designed for PCR amplification of either nuclear or mitochondrial ribosomal DNA regions of Armillaria spp., Ganoderma spp., Hericium spp., Hypoxylon thouarsianum var. thouarsianum, Inonotus/Phellinus-group, Laetiporus spp., Perenniporia fraxinea, Pleurotus spp., Schizophyllum spp., Stereum spp. and Trametes spp. Multiplex PCR reactions were developed and optimized to detect fungal DNA and identify each taxon with a sensitivity of at least 1 pg of target DNA in the template. This assay correctly identified the agents of decay in 82% of tested wood samples. The development and optimization of multiplex PCRs allowed for reliable identification of wood rotting fungi directly from wood. Early detection of wood decay fungi is crucial for assessment of tree stability in urban landscapes. Furthermore, this method may prove useful for prediction of the severity and the evolution of decay in standing trees.

  5. A rapid real-time PCR method to differentiate between mottled skate (Beringraja pulchra) and other skate and ray species.

    Science.gov (United States)

    Kim, Mi-Ra; Kwon, Kisung; Jung, Yoo-Kyung; Kang, Tae Sun

    2018-07-30

    Skates and rays are commercially important fish in South Korea, and among them, Beringraja pulchra has the highest economic value. However, the similar morphological traits among skates and rays are often exploited for seafood fraud. Here, we designed both Beringraja pulchra-specific and skate-universal primer sets, capable of detecting short sequences in the cytochrome oxidase subunit I gene, and developed highly sensitive and reliable quantitative real-time PCR (qPCR) assays to differentiate between Beringraja pulchra and other skate and ray species. AΔCq method based on differences in the amplification efficiency was developed, validated, and then used to confirm the presence of Beringraja pulchra in twenty-six commercial skate products. The averageΔCq value obtained for other skate species (18.94 ± 3.46) was significantly higher than that of Beringraja pulchra (1.18 ± 0.15). For on-site applications, we developed an ultra-fast qPCR assay, allowing for completion of the entire analytical procedure within 30 min. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Bloodmeal Identification in Field-Collected Sand Flies From Casa Branca, Brazil, Using the Cytochrome b PCR Method.

    Science.gov (United States)

    Carvalho, G M L; Rêgo, F D; Tanure, A; Silva, A C P; Dias, T A; Paz, G F; Andrade Filho, J D

    2017-07-01

    PCR-based identification of vertebrate host bloodmeals has been performed on several vectors species with success. In the present study, we used a previously published PCR protocol followed by DNA sequencing based on primers designed from multiple alignments of the mitochondrial cytochrome b gene used to identify avian and mammalian hosts of various hematophagous vectors. The amplification of a fragment encoding a 359 bp sequence of the Cyt b gene yielded recognized amplification products in 192 female sand flies (53%), from a total of 362 females analyzed. In the study area of Casa Branca, Brazil, blood-engorged female sand flies such as Lutzomyia longipalpis (Lutz & Neiva, 1912), Migonemyia migonei (França, 1924), and Nyssomyia whitmani (Antunes & Coutinho, 1939) were analyzed for bloodmeal sources. The PCR-based method identified human, dog, chicken, and domestic rat blood sources. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. Recovery methods for detection and quantification of Campylobacter depend on meat matrices and bacteriological or PCR tools.

    Science.gov (United States)

    Fosse, J; Laroche, M; Rossero, A; Fédérighi, M; Seegers, H; Magras, C

    2006-09-01

    Campylobacter is one of the main causes of human foodborne bacterial disease associated with meat consumption in developed countries. Therefore, the most effective approach for recovery and detection of Campylobacter from meat should be determined. Two hundred ninety pork skin and chine samples were inoculated with Campylobacter jejuni NCTC 11168 and two strains of Campylobacter coli. Campylobacter cells were then recovered from suspensions and enumerated by direct plating. Campylobacter recovery was evaluated by comparing results for two methods of sample collection (swabbing and mechanical pummeling) and three recovery fluids (peptone water, 5% glucose serum, and demineralized water). End-point multiplex PCR was performed to evaluate the compatibility of the recovery fluids with direct PCR detection techniques. Mean recovery ratios differed significantly between pork skin and chine samples. Ratios were higher for mechanical pummeling (0.53 for pork skin and 0.49 for chine) than for swabbing (0.31 and 0.13, respectively). For pork skin, ratios obtained with peptone water (0.50) and with glucose serum (0.55) were higher than those obtained with demineralized water (0.16). Significant differences were not observed for chine samples. Direct multiplex PCR detection of Campylobacter was possible with pork skin samples. The tools for Campylobacter recovery must be appropriate for the meat matrix to be evaluated. In this study, less than 66% of inoculated Campylobacter was recovered from meat. This underestimation must be taken into account for quantitative risk analysis of Campylobacter infection.

  8. Multiway real-time PCR gene expression profiling in yeast Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli.

    Science.gov (United States)

    Ståhlberg, Anders; Elbing, Karin; Andrade-Garda, José Manuel; Sjögreen, Björn; Forootan, Amin; Kubista, Mikael

    2008-04-16

    The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.

  9. Multiway real-time PCR gene expression profiling in yeast Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli

    Directory of Open Access Journals (Sweden)

    Andrade-Garda José

    2008-04-01

    Full Text Available Abstract Background The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. Results We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Conclusion Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.

  10. A novel method for improved accuracy of transcription factor binding site prediction

    KAUST Repository

    Khamis, Abdullah M.; Motwalli, Olaa Amin; Oliva, Romina; Jankovic, Boris R.; Medvedeva, Yulia; Ashoor, Haitham; Essack, Magbubah; Gao, Xin; Bajic, Vladimir B.

    2018-01-01

    Identifying transcription factor (TF) binding sites (TFBSs) is important in the computational inference of gene regulation. Widely used computational methods of TFBS prediction based on position weight matrices (PWMs) usually have high false positive rates. Moreover, computational studies of transcription regulation in eukaryotes frequently require numerous PWM models of TFBSs due to a large number of TFs involved. To overcome these problems we developed DRAF, a novel method for TFBS prediction that requires only 14 prediction models for 232 human TFs, while at the same time significantly improves prediction accuracy. DRAF models use more features than PWM models, as they combine information from TFBS sequences and physicochemical properties of TF DNA-binding domains into machine learning models. Evaluation of DRAF on 98 human ChIP-seq datasets shows on average 1.54-, 1.96- and 5.19-fold reduction of false positives at the same sensitivities compared to models from HOCOMOCO, TRANSFAC and DeepBind, respectively. This observation suggests that one can efficiently replace the PWM models for TFBS prediction by a small number of DRAF models that significantly improve prediction accuracy. The DRAF method is implemented in a web tool and in a stand-alone software freely available at http://cbrc.kaust.edu.sa/DRAF.

  11. A novel method for improved accuracy of transcription factor binding site prediction

    KAUST Repository

    Khamis, Abdullah M.

    2018-03-20

    Identifying transcription factor (TF) binding sites (TFBSs) is important in the computational inference of gene regulation. Widely used computational methods of TFBS prediction based on position weight matrices (PWMs) usually have high false positive rates. Moreover, computational studies of transcription regulation in eukaryotes frequently require numerous PWM models of TFBSs due to a large number of TFs involved. To overcome these problems we developed DRAF, a novel method for TFBS prediction that requires only 14 prediction models for 232 human TFs, while at the same time significantly improves prediction accuracy. DRAF models use more features than PWM models, as they combine information from TFBS sequences and physicochemical properties of TF DNA-binding domains into machine learning models. Evaluation of DRAF on 98 human ChIP-seq datasets shows on average 1.54-, 1.96- and 5.19-fold reduction of false positives at the same sensitivities compared to models from HOCOMOCO, TRANSFAC and DeepBind, respectively. This observation suggests that one can efficiently replace the PWM models for TFBS prediction by a small number of DRAF models that significantly improve prediction accuracy. The DRAF method is implemented in a web tool and in a stand-alone software freely available at http://cbrc.kaust.edu.sa/DRAF.

  12. [Comparison between conventional methods, ChromAgar Candida® and PCR method for the identification of Candida species in clinical isolates].

    Science.gov (United States)

    Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio

    2011-01-01

    The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  13. Comparison of Enzymatic Method Rapid Yeast Plus System with RFLP-PCR for Identification of Isolated Yeast from Vulvovaginal Candidiasis.

    Science.gov (United States)

    Hossein, Moallaei; Mirhendi, Seied Hossein; Brandão, João; Mirdashti, Reza; Rosado, Laura

    2011-09-01

    To compare two identification methods, i.e., restriction fragment length polymorphism (RFLP)-PCR analysis and enzymatic method Rapid TM Yeast Plus System to identify different species causing vulvovaginal candidiasis (VVC). Vaginal discharges of women who had attended the gynecology outpatient clinic of Mobini Hospital in Sabzevar, Iran were collected using cotton swabs and were cultured on Sabouraud dextrose agar. Isolated yeasts were identified by germ-tube testing and Rapid TM Yeast Plus System (Remel USA). For molecular identification, the isolated DNA was amplified with ITS1 and ITS4 universal primers and PCR products digested with the enzyme HpaІІ followed by agarose gel electrophoresis. Epidemiological and clinical features of women with respect to identified species were also evaluated. Out of 231 subjects enrolled, 62 VVC cases were detected. The isolated species were identified as follows: Candida albicans, 24 (38.7%), C. glabrata, 15 (24.2%), C. kefyr, 13 (21.0%) C. krusei, 9 (14.5%), and Saccharomyces cerevisiae, 1 (1.6%) by RFLP-PCR method; whereas findings by Rapid TM Yeast Plus System were C. albicans, 24 (38.7%), C. glabrata, 5 (8%), C. kefyr, 11 (17.7%) C. krusei, 2 (3.2%), S. cerevisiae, 9 (14.5%), and C. tropicalis, 6 (9.6%) as well as other nonpathogenic yeasts, 4 (6.9%). Statistical comparison showed that there is no significant difference in identification of C. albicans by the two methods; although, in this study, it was not true about other species of yeasts. A correlation between clinical and laboratory findings is important as it enables us to administer an appropriate treatment on time.

  14. Comparison of culture-based, vital stain and PMA-qPCR methods for the quantitative detection of viable hookworm ova.

    Science.gov (United States)

    Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S

    2017-06-01

    Accurate quantitative measurement of viable hookworm ova from environmental samples is the key to controlling hookworm re-infections in the endemic regions. In this study, the accuracy of three quantitative detection methods [culture-based, vital stain and propidium monoazide-quantitative polymerase chain reaction (PMA-qPCR)] was evaluated by enumerating 1,000 ± 50 Ancylostoma caninum ova in the laboratory. The culture-based method was able to quantify an average of 397 ± 59 viable hookworm ova. Similarly, vital stain and PMA-qPCR methods quantified 644 ± 87 and 587 ± 91 viable ova, respectively. The numbers of viable ova estimated by the culture-based method were significantly (P methods. Therefore, both PMA-qPCR and vital stain methods appear to be suitable for the quantitative detection of viable hookworm ova. However, PMA-qPCR would be preferable over the vital stain method in scenarios where ova speciation is needed.

  15. Comparative, Collaborative, and On-Site Validation of a TaqMan PCR Method as a Tool for Certified Production of Fresh, Campylobacter-Free Chickens

    DEFF Research Database (Denmark)

    Krause, Michael; Josefsen, Mathilde Hartmann; Lund, Marianne

    2006-01-01

    , a faster, real-time PCR approach was validated in comparative and collaborative trials, based on recommendations from the Nordic system for validation of alternative microbiological methods (NordVal). The comparative real-time PCR trial was performed in comparison to two reference culture protocols...... fulfilled the NordVal validation criteria and has since been implemented at a major abattoir....

  16. Development and validation of an event-specific quantitative PCR method for genetically modified maize MIR162.

    Science.gov (United States)

    Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2014-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize event, MIR162. We first prepared a standard plasmid for MIR162 quantification. The conversion factor (Cf) required to calculate the genetically modified organism (GMO) amount was empirically determined for two real-time PCR instruments, the Applied Biosystems 7900HT (ABI7900) and the Applied Biosystems 7500 (ABI7500) for which the determined Cf values were 0.697 and 0.635, respectively. To validate the developed method, a blind test was carried out in an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr). The determined biases were less than 25% and the RSDr values were less than 20% at all evaluated concentrations. These results suggested that the limit of quantitation of the method was 0.5%, and that the developed method would thus be suitable for practical analyses for the detection and quantification of MIR162.

  17. Incidence of Listeria species in bovine, ovine, caprine, camel and water buffalo milk using cultural method and the PCR assay

    Directory of Open Access Journals (Sweden)

    Ebrahim Rahimi

    2014-02-01

    Full Text Available Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. Results: Using cultural method, 19 samples (7.3% were positive for Listeria spp. The highest prevalence of Listeria was found in raw water buffalo milk (11.8%, followed by raw bovine milk (10.6%, raw ovine milk (7.1%, and raw caprine milk (4.2% samples. All 37 camel milk samples from 20 camel breeding farms were negative for Listeria spp. The overall prevalence of Listeria was 7.3%, in which Listeria innocua was the most recovered species (4.2%; the remaining isolates were Listeria monocytogenes (1.9%, Listeria ivanovii (0.08% and Listeria seeligari (0.04%. The PCR assay could identify 8 Listeria-contaminated milk samples that were negative using the cultural method. Conclusions: The results presented in this study indicate the potential risk of infection with Listeria in people consuming raw and unpasteurized milk.

  18. Ensemble approach combining multiple methods improves human transcription start site prediction

    LENUS (Irish Health Repository)

    Dineen, David G

    2010-11-30

    Abstract Background The computational prediction of transcription start sites is an important unsolved problem. Some recent progress has been made, but many promoters, particularly those not associated with CpG islands, are still difficult to locate using current methods. These methods use different features and training sets, along with a variety of machine learning techniques and result in different prediction sets. Results We demonstrate the heterogeneity of current prediction sets, and take advantage of this heterogeneity to construct a two-level classifier (\\'Profisi Ensemble\\') using predictions from 7 programs, along with 2 other data sources. Support vector machines using \\'full\\' and \\'reduced\\' data sets are combined in an either\\/or approach. We achieve a 14% increase in performance over the current state-of-the-art, as benchmarked by a third-party tool. Conclusions Supervised learning methods are a useful way to combine predictions from diverse sources.

  19. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    International Nuclear Information System (INIS)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia GT; Bérgamo, Nádia A; Neto, Francisco A Moraes; Domingues, Maria AC; Soares, Fernando A; Caldeira, José RF; Rogatto, Silvia R

    2009-01-01

    HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4%) and HER-2 transcript overexpression (20%). Moreover, 2+ immunostaining cases presented nonamplified status (50%) by CISH and HER-2 downexpression (38.5%) by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350). Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene

  20. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  1. Molecular identification of Indian crocodile species: PCR-RFLP method for forensic authentication*.

    Science.gov (United States)

    Meganathan, P R; Dubey, Bhawna; Haque, Ikramul

    2009-09-01

    South East Asian countries are known for illegal poaching and trade of crocodiles clandestinely, to be used in skin, medicinal, and cosmetic industries. Besides crocodiles being listed in the Convention on International Trade in Endangered Species of Wild Fauna and Flora, India has its Wildlife Protection Act, 1972 for conservation of crocodile species. Hitherto, lack of any rapid and reliable technique for examinations of crocodile-based crime exhibits such as skin, bones, etc. has been a major problem for an effective promulgation of law on illegal trade. DNA-based identification of species using PCR-RFLP technique for an apt identification of all the three Indian crocodile species namely, Crocodylus porosus, Crocodylus palustris and Gavialis gangeticus is presented here. A 628 bp segment of cytochrome b gene was amplified using novel primers followed by restriction digestion with three enzymes i.e., HaeIII, MboI, and MwoI, separately and in combination. The technique has produced a species-specific pattern for identifying the three crocodile species individually, which fulfills the requirement for its forensic application. It is expected that the technique will prove handy in identification of all the three Indian crocodile species and strengthen conservation efforts.

  2. Reverse transcription-polymerase chain reaction (RT-PCR based detection and economic impact of foot-and-mouth disease in District Faisalabad, Pakistan during the year 2015

    Directory of Open Access Journals (Sweden)

    W. Ali

    2017-06-01

    Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.

  3. Simplified method to predict mutual interactions of human transcription factors based on their primary structure

    KAUST Repository

    Schmeier, Sebastian

    2011-07-05

    Background: Physical interactions between transcription factors (TFs) are necessary for forming regulatory protein complexes and thus play a crucial role in gene regulation. Currently, knowledge about the mechanisms of these TF interactions is incomplete and the number of known TF interactions is limited. Computational prediction of such interactions can help identify potential new TF interactions as well as contribute to better understanding the complex machinery involved in gene regulation. Methodology: We propose here such a method for the prediction of TF interactions. The method uses only the primary sequence information of the interacting TFs, resulting in a much greater simplicity of the prediction algorithm. Through an advanced feature selection process, we determined a subset of 97 model features that constitute the optimized model in the subset we considered. The model, based on quadratic discriminant analysis, achieves a prediction accuracy of 85.39% on a blind set of interactions. This result is achieved despite the selection for the negative data set of only those TF from the same type of proteins, i.e. TFs that function in the same cellular compartment (nucleus) and in the same type of molecular process (transcription initiation). Such selection poses significant challenges for developing models with high specificity, but at the same time better reflects real-world problems. Conclusions: The performance of our predictor compares well to those of much more complex approaches for predicting TF and general protein-protein interactions, particularly when taking the reduced complexity of model utilisation into account. © 2011 Schmeier et al.

  4. Simplified method to predict mutual interactions of human transcription factors based on their primary structure.

    Directory of Open Access Journals (Sweden)

    Sebastian Schmeier

    Full Text Available BACKGROUND: Physical interactions between transcription factors (TFs are necessary for forming regulatory protein complexes and thus play a crucial role in gene regulation. Currently, knowledge about the mechanisms of these TF interactions is incomplete and the number of known TF interactions is limited. Computational prediction of such interactions can help identify potential new TF interactions as well as contribute to better understanding the complex machinery involved in gene regulation. METHODOLOGY: We propose here such a method for the prediction of TF interactions. The method uses only the primary sequence information of the interacting TFs, resulting in a much greater simplicity of the prediction algorithm. Through an advanced feature selection process, we determined a subset of 97 model features that constitute the optimized model in the subset we considered. The model, based on quadratic discriminant analysis, achieves a prediction accuracy of 85.39% on a blind set of interactions. This result is achieved despite the selection for the negative data set of only those TF from the same type of proteins, i.e. TFs that function in the same cellular compartment (nucleus and in the same type of molecular process (transcription initiation. Such selection poses significant challenges for developing models with high specificity, but at the same time better reflects real-world problems. CONCLUSIONS: The performance of our predictor compares well to those of much more complex approaches for predicting TF and general protein-protein interactions, particularly when taking the reduced complexity of model utilisation into account.

  5. A semi-nested real-time PCR method to detect low chimerism percentage in small quantity of hematopoietic stem cell transplant DNA samples.

    Science.gov (United States)

    Aloisio, Michelangelo; Bortot, Barbara; Gandin, Ilaria; Severini, Giovanni Maria; Athanasakis, Emmanouil

    2017-02-01

    Chimerism status evaluation of post-allogeneic hematopoietic stem cell transplantation samples is essential to predict post-transplant relapse. The most commonly used technique capable of detecting small increments of chimerism is quantitative real-time PCR. Although this method is already used in several laboratories, previously described protocols often lack sensitivity and the amount of the DNA required for each chimerism analysis is too high. In the present study, we compared a novel semi-nested allele-specific real-time PCR (sNAS-qPCR) protocol with our in-house standard allele-specific real-time PCR (gAS-qPCR) protocol. We selected two genetic markers and analyzed technical parameters (slope, y-intercept, R2, and standard deviation) useful to determine the performances of the two protocols. The sNAS-qPCR protocol showed better sensitivity and precision. Moreover, the sNAS-qPCR protocol requires, as input, only 10 ng of DNA, which is at least 10-fold less than the gAS-qPCR protocols described in the literature. Finally, the proposed sNAS-qPCR protocol could prove very useful for performing chimerism analysis with a small amount of DNA, as in the case of blood cell subsets.

  6. Rapid detection of food-borne Salmonella contamination using IMBs-qPCR method based on pagC gene

    Directory of Open Access Journals (Sweden)

    Jiashun Wang

    Full Text Available Abstract Detection of Salmonella is very important to minimize the food safety risk. In this study, the recombinant PagC protein and PagC antibody were prepared and coupled with immunomagnetic beads (IMBs to capture Salmonella cells from pork and milk samples. And then the SYBR Green qualitative PCR was developed to detect the pathogenic Salmonella. The results showed that the PagC polyclonal antiserum is of good specificity and the capture rate of 0.1 mg IMBs for Salmonella tended to be stable at the range of 70-74% corresponding to the concentrations between 101 and 104 CFU/mL. The method developed demonstrated high specificity for the positive Salmonella samples when compared to non-specific DNA samples, such as Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The limit of detection of this assay was 18 CFU/mL. Detection and quantitative enumeration of Salmonella in samples of pork or milk shows good recoveries of 54.34% and 52.07%. In conclusion, the polyclonal antibody of recombinant PagC protein is effective to capture Salmonella from detected samples. The developed pagC antibody IMBs-qPCR method showed efficiency, sensitivity and specificity for 30 Salmonella detection, enabling detection within 10 h, which is a promising rapid method to detect Salmonella in emergency.

  7. Interlaboratory validation of quantitative duplex real-time PCR method for screening analysis of genetically modified maize.

    Science.gov (United States)

    Takabatake, Reona; Koiwa, Tomohiro; Kasahara, Masaki; Takashima, Kaori; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Oguchi, Taichi; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    To reduce the cost and time required to routinely perform the genetically modified organism (GMO) test, we developed a duplex quantitative real-time PCR method for a screening analysis simultaneously targeting an event-specific segment for GA21 and Cauliflower Mosaic Virus 35S promoter (P35S) segment [Oguchi et al., J. Food Hyg. Soc. Japan, 50, 117-125 (2009)]. To confirm the validity of the method, an interlaboratory collaborative study was conducted. In the collaborative study, conversion factors (Cfs), which are required to calculate the GMO amount (%), were first determined for two real-time PCR instruments, the ABI PRISM 7900HT and the ABI PRISM 7500. A blind test was then conducted. The limit of quantitation for both GA21 and P35S was estimated to be 0.5% or less. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSD(R)). The determined bias and RSD(R) were each less than 25%. We believe the developed method would be useful for the practical screening analysis of GM maize.

  8. A PCR based method to detect Russula spp. in soil samples and Limodorum abortivum roots in Mediterranean environments

    Directory of Open Access Journals (Sweden)

    Eduardo Larriba

    2015-04-01

    Full Text Available Aim of study: Orchidaceaehas the largest number of species of any family in the plant kingdom. This family is subject to a high risk of extinction in natural environments, such as natural parks and protected areas. Recent studies have shown the prevalence of many species of orchids to be linked to fungal soil diversity, due to their myco-heterotrophic behaviour. Plant communities determine fungal soil diversity, and both generate optimal conditions for orchid development. Area of study: The work was carried out in n the two most important natural parks in Alicante (Font Roja and Sierra Mariola, in South-eastern of Spain. Material and Methods: We designed a molecular tool to monitor the presence of Russula spp. in soil and orchids roots, combined with phytosociological methods. Main results: Using a PCR-based method, we detected the presence in the soil and Limodorum abortivum orchid roots of the mycorrhizal fungi Russula spp. The species with highest coverage was Quercus rotundifolia in areas where the orchid was present. Research highlights: We present a useful tool based on PCR to detect the presence of Russula spp. in a natural environment. These results are consistent with those obtained in different studies that linked the presence of the mycorrhizal fungi Russula spp. in roots of the species Limodorum and the interaction between these fungal species and Quercus ilex trees in Mediterranean forest environments.

  9. Diagnosis of Neisseria gonorrhoeae among pregnant women by culture method and PCR on cppB gene

    Directory of Open Access Journals (Sweden)

    Jalal Mardaneh

    2013-11-01

    Full Text Available Background: Neisseria gonorrhoeae is a human obligate pathogen and the etiological agent of gonorrhea. Health irreparable complications resulting from gonorrhea disease occur mainly in pregnant women and neonates. Aim of this study was diagnosis of Neisseria gonorrhoeae among pregnant women with using culture and molecular method by amplification of cppB gene with PCR. Material and Methods: In this cross-sectional study, two endocervical swab specimens were obtained from 1100 pregnant women who referred to Shiraz Hospitals. Culture on nonselective and selective media and nucleic acid amplification test (NAAT were performed for detection of Neisseria gonorrhoeae cppB gene. Results: All endocervical swabs cultures on selective and nonselective media were negative for Neisseria gonorrhoeae. Among examined endocervical swabs, 13samples (1.18% were positive by nucleic acid amplification of Neisseria gonorrgoeae cppB gene. Conclusion: Negative results of culture and positive results of PCR in this study indicate that however culture is gold standard method for detection of Neisseria gonorrhoeae but due to bacterial autolysis, poor sampling techniques and improper specimen storage and transport, its value decline as compared with Nucleic acid amplification test (NAAT.

  10. Comparison of indoor air sampling and dust collection methods for fungal exposure assessment using quantitative PCR

    Science.gov (United States)

    Evaluating fungal contamination indoors is complicated because of the many different sampling methods utilized. In this study, fungal contamination was evaluated using five sampling methods and four matrices for results. The five sampling methods were a 48 hour indoor air sample ...

  11. Culture Method and PCR for the Detection of Helicobacter pylori in Drinking Water in Basrah Governorate Iraq

    Directory of Open Access Journals (Sweden)

    A. A. Al-Sulami

    2012-01-01

    Full Text Available Helicobacter pylori is recognized by the World Health Organization to be the primary cause of peptic ulcers, chronic gastritis, and stomach cancer, though the source of human infection is not well understood. One of the problems in understanding the source of human contamination is the difficulty in isolating the organism from the environment. However, the combination of PCR results with those of culturing of 471 drinking water samples can provide a more accurate picture of H. pylori detection. In this method 78 presumptive H. pylori colonies out of 266 tap water samples were obtained in the preliminary detection on modified Columbia agar (MCUA slant relying on urease positivity with a rate of 29.3%. However, only 11 out of them were confirmed by Gram staining and biochemical tests reducing the rate to 4.13% whereas only 3 (1.46% from 205 reverse osmosis (RO water samples. Furthermore, only 6 (54.5% out of the 11 isolates from tap water and 1 (33.3% of the 3 RO isolates were confirmed by 16SrRNA PCR. Thus PCR confirmation reduced the rate to 2.2%. In addition, only 4 (4% of 100 tap water samples negative for H. pylori by culture method were H. pylori positive by 16SrRNA. Water samples were collected from 24 districts of Basrah Governorate from February–December 2009. The direct recovery of H. pylori from drinking water is both alarming and scientifically exciting in terms of the investigation of its epidemiology.

  12. Ultra-sensitive "turn-on" detection method for Hg(2+) based on mispairing biosensor and emulsion PCR.

    Science.gov (United States)

    Zhu, Pengyu; Tian, Wenying; Cheng, Nan; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2016-08-01

    Sensor-based detection methods have inspired the idea that chemical or physical signals could be converted to nucleic acid signals to be quantitatively detected using a combination of appropriate detection tools. To achieve ultra-sensitive and absolute quantitative detection of mercury ion (Hg(2+)), we have combined a mispairing biosensor for Hg(2+) and emulsion PCR. The parameters that might influence the biosensor step, such as the duration of isothermal amplification and the concentration of the sensor oligonucleotide, have been firstly optimized in our study to achieve the most efficient biosensor detection. The evaluation results of secondary structures between the biosensors with different number of T-Hg-T structures achieved by Circular Dichroism have indicated that the secondary hairpin structure would be varied according to the change of number of T-Hg-T structures, which could influence the quantitative detection results. Further optimization of number of T-Hg-T within the biosensor sequences showed that 5 T-Hg-T structures could generate the most efficient amplification. After the above optimizations, the emulsion PCR has been employed to achieve the absolute quantitation of nucleic acid signals. The final results have shown that the limit of quantitation (LOQ) in our study was as low as 40fmol, and the limit of detection (LOD) was 10fmol. The practical detection tests showed that the quantitative results were stable and accurate for all substrates. In conclusion, by combining a mispairing biosensor with emulsion PCR, we developed a flexible and stable quantitative "turn-on" detection method with ultra-sensitivity that can detect trace amounts Hg(2+) within different substrates. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Real-Time PCR-Based Quantitation Method for the Genetically Modified Soybean Line GTS 40-3-2.

    Science.gov (United States)

    Kitta, Kazumi; Takabatake, Reona; Mano, Junichi

    2016-01-01

    This chapter describes a real-time PCR-based method for quantitation of the relative amount of genetically modified (GM) soybean line GTS 40-3-2 [Roundup Ready(®) soybean (RRS)] contained in a batch. The method targets a taxon-specific soybean gene (lectin gene, Le1) and the specific DNA construct junction region between the Petunia hybrida chloroplast transit peptide sequence and the Agrobacterium 5-enolpyruvylshikimate-3-phosphate synthase gene (epsps) sequence present in GTS 40-3-2. The method employs plasmid pMulSL2 as a reference material in order to quantify the relative amount of GTS 40-3-2 in soybean samples using a conversion factor (Cf) equal to the ratio of the RRS-specific DNA to the taxon-specific DNA in representative genuine GTS 40-3-2 seeds.

  14. Development of a qualitative real-time PCR method to detect 19 targets for identification of genetically modified organisms.

    Science.gov (United States)

    Peng, Cheng; Wang, Pengfei; Xu, Xiaoli; Wang, Xiaofu; Wei, Wei; Chen, Xiaoyun; Xu, Junfeng

    2016-01-01

    As the amount of commercially available genetically modified organisms (GMOs) grows recent years, the diversity of target sequences for molecular detection techniques are eagerly needed. Considered as the gold standard for GMO analysis, the real-time PCR technology was optimized to produce a high-throughput GMO screening method. With this method we can detect 19 transgenic targets. The specificity of the assays was demonstrated to be 100 % by the specific amplification of DNA derived from reference material from 20 genetically modified crops and 4 non modified crops. Furthermore, most assays showed a very sensitive detection, reaching the limit of ten copies. The 19 assays are the most frequently used genetic elements present in GM crops and theoretically enable the screening of the known GMO described in Chinese markets. Easy to use, fast and cost efficient, this method approach fits the purpose of GMO testing laboratories.

  15. Genotyping of friesian horses to detect a hydrocephalus-associated c.1423C>T mutation in B3GALNT2 using PCR-RFLP and PCR-PIRA methods: Frequency in stallion horses in México.

    Science.gov (United States)

    Ayala-Valdovinos, Miguel Angel; Galindo-García, Jorge; Sánchez-Chiprés, David; Duifhuis-Rivera, Theodor

    2017-04-01

    Hydrocephalus in Friesian horses is an autosomal recessive hereditary disease that can result in an abortion, a stillbirth, or euthanization of a newborn foal. Here, the hydrocephalus-associated c.1423C > T mutation in B3GALNT2 gene was detected with PCR-RFLP and PCR-PIRA methods for horse genotyping. A preliminary genotyping survey was performed on 83 randomly selected Friesian stallion horses to determine the current allele frequency in Mexico. The frequency of the mutant T allele was 9.6%. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. PCR-free quantitative detection of genetically modified organism from raw materials. An electrochemiluminescence-based bio bar code method.

    Science.gov (United States)

    Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R

    2008-05-15

    A bio bar code assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio bar code assay requires lengthy experimental procedures including the preparation and release of bar code DNA probes from the target-nanoparticle complex and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio bar code assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2,2'-bipyridyl) ruthenium (TBR)-labeled bar code DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products.

  17. Sika deer (Cervus nippon)-specific real-time PCR method to detect fraudulent labelling of meat and meat products.

    Science.gov (United States)

    Kaltenbrunner, Maria; Hochegger, Rupert; Cichna-Markl, Margit

    2018-05-08

    Since game meat is more valuable and expensive than meat from domesticated animal species it is a potential target for adulteration. Analytical methods must allow the identification and quantification of meat species to be applicable for the detection of fraudulent labelling. We developed a real-time PCR assay for the authentication of sika deer (Cervus nippon) and products thereof. The primer/probe system amplifies a 71 bp fragment of the kappa-casein precursor gene. Since the target sequence contained only one sika deer-specific base, we introduced a deliberate base mismatch in the forward primer. The real-time PCR assay did not show cross-reactivity with 19 animal and 49 plant species tested. Low cross-reactivity was observed with red deer, fallow deer, reindeer and moose. However, with a ΔCt value of ≥11.79 between sika deer and the cross-reacting species, cross-reactivity will not affect the accuracy of the method. LOD and LOQ, determined by analysing serial dilutions of a DNA extract containing 1% (w/w) sika deer DNA in pig DNA, were 0.3% and 0.5%, respectively. The accuracy was evaluated by analysing DNA mixtures and DNA isolates from meat extract mixtures and meat mixtures. In general, recoveries were in the range from 70 to 130%.

  18. Real-Time PCR Typing of Escherichia coli Based on Multiple Single Nucleotide Polymorphisms--a Convenient and Rapid Method.

    Science.gov (United States)

    Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan

    2016-01-01

    Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.

  19. Analysis of Single Nucleotide Polymorphism (SNP rs22114085 Associated with Canine Atopic Dermatitis by PCR-RFLP Method

    Directory of Open Access Journals (Sweden)

    Martina Miluchová

    2012-05-01

    Full Text Available Canine atopic dermatitis (cAD is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema. The aim of the paper was to identify of the SNP rs22114085 in different dog breeds. The material involved 52 dogs from 5 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA carrier and from blood by using commercial kit NucleospinBlood and used in order to estimate rs22114085 SNP genotypes by PCR-RFLP method. The PCR products were digested with DdeI restriction enzyme. The C allele was distributed in Czech Pointer, Chihuahua, German Wirehaired Pointer with an allele frequency ranging from 0.4545 to 1.00. In the population of Czech Pointer we detected all genotypes CC, CT and TT with frequency in male 0.25, 0.5833 and 0.1667, and in female 0.2728, 0.3636 and 0.3636, subsequently. In German Wirehaired Pointer was detected homozygote genotype CC in male and heterozygote genotype CT in female with frequency 1 and 1. In Chihuahua was observed homozygote genotype CC and heterozygote genotype CT with frequency 0.3333 and 0.6667, subsequently. In Golden retriever and Pincher we detected genotype TT with frequency 1.

  20. Multi response optimization of internal grinding process parameters for outer ring using Taguchi method and PCR-TOPSIS

    Science.gov (United States)

    Wisnuadi, Alief Regyan; Damayanti, Retno Wulan; Pujiyanto, Eko

    2018-02-01

    Bearing is one of the most widely used parts in automotive industry. One of the leading bearing manufacturing companies in the world is SKF Indonesia. This company must produce bearing with international standard. SKF Indonesia must do continuous improvement in order to face competition. During this time, SKF Indonesia is only performing quality control at its Quality Assurance department. In other words, quality improvement at SKF Indonesia has not been done thoroughly. The purpose of this research is to improve quality of outer ring product at SKF Indonesia by conducting an internal grinding process experiment about setting speed ratio, fine position, and spark out grinding time. The specific purpose of this experiment is to optimize some quality responses such as roughness, roundness, and cycle time. All of the response in this experiment were smaller the better. Taguchi method and PCR-TOPSIS are used for the optimization process. The result of this research shows that by using Taguchi method and PCR-TOPSIS, the optimum condition occurs on speed ratio 36, fine position 18 µm/s and spark out 0.5 s. The optimum conditions result were roughness 0.398 µm, roundness 1.78 µm and cycle time 8.1 s. This results have been better than the previous results and meet the standards. The roughness of 0.523 µm decrease to 0.398 µm and the average cycle time of 8.5 s decrease to 8.1 s.

  1. Analysis of single nucleotide polymorphism (SNP RS23472497 associated with canine atopic dermatitis by ACRS-PCR method

    Directory of Open Access Journals (Sweden)

    Martina Miluchová

    2014-05-01

    Full Text Available The aim of the paper was to identify of the SNP rs23472497 associated with canine atopic dermatitis (cAD. cAD is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema. The material involved 60 dogs from 6 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA carrier and from blood by using commercial kit NucleospinBlood and used in order to estimate rs23472497 SNP genotypes by ACRS-PCR method. The PCR products were digested with NlaIII restriction enzyme. In the population of Czech Pointer and Slovak Wirehaired Pointer we detected all genotypes AA, AG and GG with frequency 0.0732, 0.5122 and 0.4146 for Czech Pointer and 0.1818, 0.5455 and 0.2727 for Slovak Wirehaired Pointer. In Border Collie was observed heterozygote genotype AG and homozygote genotype GG with frequency 0.6667 and 0.3333, subsequently. In German Wirehaired Pointer, Australian Shepherd dog and American Staffordshire terrier we detected only genotype AG with frequency 1. The A allele was distributed with an allele frequency ranging from 0.3293 to 0.5. The G allele was distributed with an allele frequency ranging from 0.5 to 0.6707.

  2. Identification of Lactobacillus delbrueckii and Streptococcus thermophilus Strains Present in Artisanal Raw Cow Milk Cheese Using Real-time PCR and Classic Plate Count Methods.

    Science.gov (United States)

    Stachelska, Milena A

    2017-12-04

    The aim of this paper was to detect Lactobacillus delbrueckii and Streptococcus thermophilus using real-time quantitative PCR assay in 7-day ripening cheese produced from unpasteurised milk. Real-time quantitative PCR assays were designed to identify and enumerate the chosen species of lactic acid bacteria (LAB) in ripened cheese. The results of molecular quantification and classic bacterial enumeration showed a high level of similarity proving that DNA extraction was carried out in a proper way and that genomic DNA solutions were free of PCR inhibitors. These methods revealed the presence of L. delbrueckii and S. thermophilus. The real-time PCR enabled quantification with a detection of 101-103 CFU/g of product. qPCR-standard curves were linear over seven log units down to 101 copies per reaction; efficiencies ranged from 77.9% to 93.6%. Cheese samples were analysed with plate count method and qPCR in parallel. Compared with the classic plate count method, the newly developed qPCR method provided faster and species specific identification of two dairy LAB and yielded comparable quantitative results.

  3. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium.

    Science.gov (United States)

    Die, Jose V; Baldwin, Ransom L; Rowland, Lisa J; Li, Robert; Oh, Sunghee; Li, Congjun; Connor, Erin E; Ranilla, Maria-Jose

    2017-01-01

    The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following introduction of solid feed to the weaning neonate as well as affecting the metabolism of other nutrients and absorption of nutrients in in vitro experiments. The objective of the present study was to validate expression stability of eight putative reference genes bovine rumen, considering the intrinsic heterogeneity of bovine rumen with regard to different luminal characteristics due to direct infusion of butyrate to double the intra-ruminal content of the rumen liquor. Our focus was on identifying stable reference genes which are suitable to normalize real-time RT-qPCR experiments from rumen samples collected from clinical assays, irrespective of localization within the organ and the across physiological state. The most stably expressed genes included: ACTB, UXT, DBNDD2, RPS9, DDX54 and HMBS. Their high stability values suggest these reference genes will facilitate better evaluation of variation of across an array of conditions including: localization within the rumen, differences among cattle fed an array of rations, as well as response to development in the weaning animal. Moreover, we anticipate these reference genes may be useful for expression studies in other ruminants.

  4. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR analysis in the rumen epithelium.

    Directory of Open Access Journals (Sweden)

    Jose V Die

    Full Text Available The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following introduction of solid feed to the weaning neonate as well as affecting the metabolism of other nutrients and absorption of nutrients in in vitro experiments. The objective of the present study was to validate expression stability of eight putative reference genes bovine rumen, considering the intrinsic heterogeneity of bovine rumen with regard to different luminal characteristics due to direct infusion of butyrate to double the intra-ruminal content of the rumen liquor. Our focus was on identifying stable reference genes which are suitable to normalize real-time RT-qPCR experiments from rumen samples collected from clinical assays, irrespective of localization within the organ and the across physiological state. The most stably expressed genes included: ACTB, UXT, DBNDD2, RPS9, DDX54 and HMBS. Their high stability values suggest these reference genes will facilitate better evaluation of variation of across an array of conditions including: localization within the rumen, differences among cattle fed an array of rations, as well as response to development in the weaning animal. Moreover, we anticipate these reference genes may be useful for expression studies in other ruminants.

  5. Oxidative stress provokes distinct transcriptional responses in the stress-tolerant atr7 and stress-sensitive loh2 Arabidopsis thaliana mutants as revealed by multi-parallel quantitative real-time PCR analysis of ROS marker and antioxidant genes.

    Science.gov (United States)

    Mehterov, Nikolay; Balazadeh, Salma; Hille, Jacques; Toneva, Valentina; Mueller-Roeber, Bernd; Gechev, Tsanko

    2012-10-01

    The Arabidopsis thaliana atr7 mutant is tolerant to oxidative stress induced by paraquat (PQ) or the catalase inhibitor aminotriazole (AT), while its original background loh2 and wild-type plants are sensitive. Both, AT and PQ, which stimulate the intracellular formation of H₂O₂ or superoxide anions, respectively, trigger cell death in loh2 but do not lead to visible damage in atr7. To study gene expression during oxidative stress and ROS-induced programmed cell death, two platforms for multi-parallel quantitative real-time PCR (qRT-PCR) analysis of 217 antioxidant and 180 ROS marker genes were employed. The qRT-PCR analyses revealed AT- and PQ-induced expression of many ROS-responsive genes mainly in loh2, confirming that an oxidative burst plays a role in the activation of the cell death in this mutant. Some of the genes were specifically regulated by either AT or PQ, serving as markers for particular types of ROS. Genes significantly induced by both AT and PQ in loh2 included transcription factors (ANAC042/JUB1, ANAC102, DREB19, HSFA2, RRTF1, ZAT10, ZAT12, ethylene-responsive factors), signaling compounds, ferritins, alternative oxidases, and antioxidant enzymes. Many of these genes were upregulated in atr7 compared to loh2 under non-stress conditions at the first time point, indicating that higher basal levels of ROS and higher antioxidant capacity in atr7 are responsible for the enhanced tolerance to oxidative stress and suggesting a possible tolerance against multiple stresses of this mutant. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  6. Potassium hydroxide-ethylene diamine tetraacetic acid method for the rapid preparation of small-scale PCR template DNA from actinobacteria.

    Science.gov (United States)

    Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli

    2014-01-01

    Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.

  7. Comparison of methods of DNA extraction for real-time PCR in a model of pleural tuberculosis.

    Science.gov (United States)

    Santos, Ana; Cremades, Rosa; Rodríguez, Juan Carlos; García-Pachón, Eduardo; Ruiz, Montserrat; Royo, Gloria

    2010-01-01

    Molecular methods have been reported to have different sensitivities in the diagnosis of pleural tuberculosis and this may in part be caused by the use of different methods of DNA extraction. Our study compares nine DNA extraction systems in an experimental model of pleural tuberculosis. An inoculum of Mycobacterium tuberculosis was added to 23 pleural liquid samples with different characteristics. DNA was subsequently extracted using nine different methods (seven manual and two automatic) for analysis with real-time PCR. Only two methods were able to detect the presence of M. tuberculosis DNA in all the samples: extraction using columns (Qiagen) and automated extraction with the TNAI system (Roche). The automatic method is more expensive, but requires less time. Almost all the false negatives were because of the difficulty involved in extracting M. tuberculosis DNA, as in general, all the methods studied are capable of eliminating inhibitory substances that block the amplification reaction. The method of M. tuberculosis DNA extraction used affects the results of the diagnosis of pleural tuberculosis by molecular methods. DNA extraction systems that have been shown to be effective in pleural liquid should be used.

  8. A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

    steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

  9. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

    2013-01-01

    steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

  10. Development of real-time PCR and hybridization methods for detection and identification of thermophilic Campylobacter spp. in pig faecal samples

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Andersen, M. T.; Dalsgaard, Anders

    2005-01-01

    species-specific detection of Campylobacter spp. in naturally infected pig faecal samples after an enrichment step, whereas the hybridization approach enhanced the specific isolation of C. jejuni (present in minority to C. coli) from pigs. Conclusions: The rt-PCR was specific for Campylobacter jejuni, C...... by phenotypic methods and the developed rt-PCR provides an easy and fast method for such differentiation. Detection of C. jejuni by colony hybridization may increase the isolation rate of this species from pig faeces....

  11. Evaluation of NGS and RT-PCR methods for ALK rearrangement in European NSCLC patients

    DEFF Research Database (Denmark)

    Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota

    2018-01-01

    INTRODUCTION: The reported prevalence of ALK rearrangement in NSCLC ranges from 2%-7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proven to be a reproducible and sensitive technique. Reverse transcriptase...

  12. AN INTEGRATED CELL CULTURE/RT-PCR METHOD FOR DETECTING ENTEROVIRUS IN WATER

    Science.gov (United States)

    Echovirus and coxsackievirus can cause mild to severe disease following consumption of contaminated drinking water. However, comprehensive occurrence studies of enteroviruses in drinking water matrices are limited, in part because of the lack of available methods that are rapid, ...

  13. Rapid-Viability PCR Method for Detection of Live, Virulent Bacillus anthracis in Environmental Samples ▿

    OpenAIRE

    Létant, Sonia E.; Murphy, Gloria A.; Alfaro, Teneile M.; Avila, Julie R.; Kane, Staci R.; Raber, Ellen; Bunt, Thomas M.; Shah, Sanjiv R.

    2011-01-01

    In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real...

  14. Real-time PCR-based method for the rapid detection of extended RAS mutations using bridged nucleic acids in colorectal cancer.

    Science.gov (United States)

    Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu

    2017-10-27

    Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Role of PCR method using IS6110 primer in detecting Mycobacterium tuberculosis among the clinically diagnosed childhood tuberculosis patients at an urban hospital in Dhaka, Bangladesh.

    Science.gov (United States)

    Kabir, Senjuti; Uddin, Mohammad Khaja Mafij; Chisti, Mohammod Jobayer; Fannana, Tilka; Haque, Mohammad Enamul; Uddin, Muhammad Reaj; Banu, Sayera; Ahmed, Tahmeed

    2018-03-01

    Better methods are needed for the accurate detection of child tuberculosis (TB). This study compared different laboratory tests and evaluated IS6110 PCR for the detection of Mycobacterium tuberculosis (MTB) among clinically diagnosed child TB patients. A total of 102 paediatric patients (PCR testing. The sensitivity, specificity, and positive and negative predictive values (PPV, NPV) of smear microscopy and PCR were compared to the two culture methods. Three patients were positive on smear microscopy (2.9%). MTB was detected by conventional culture in 15.7% (16/102), liquid culture in 14% (14/100), and IS6110 PCR in 61.8% (63/102). PCR detected an additional 45 patients who were undetected with the three other tests. Compared to conventional and liquid culture, respectively, smear microscopy showed sensitivity of 18.8% and 21.4%, specificity of 100% individually, PPV of 100% individually, and NPV of 86.9% and 88.7%, whereas PCR had sensitivity of 87.5% and 92.9%, specificity of 43% individually, PPV of 22.2% and 21%, and NPV of 94.9% and 97.4%. PCR can be useful compared to smear microscopy and culture methods and is applicable as a rapid screening test for child TB. A larger scale study is required to determine its diagnostic efficacy in improving the detection of child TB in the presence and absence of severe malnutrition. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Detection of Yersinia Enterocolitica Species in Pig Tonsils and Raw Pork Meat by the Real-Time Pcr and Culture Methods.

    Science.gov (United States)

    Stachelska, M A

    2017-09-26

    The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.

  17. Development of FQ-PCR method to determine the level of ADD1 expression in fatty and lean pigs.

    Science.gov (United States)

    Cui, J X; Chen, W; Zeng, Y Q

    2015-10-30

    To determine how adipocyte determination and differentiation factor 1 (ADD1), a gene involved in the determination of pork quality, is regulated in Laiwu and Large pigs, we used TaqMan fluorescence quantitative real-time polymerase chain reaction (FQ-PCR) to detect differential expression in the longissimus muscle of Laiwu (fatty) and Large White (lean) pigs. In this study, the ADD1 and GAPDH cDNA sequences were cloned using a T-A cloning assay, and the clone sequences were consistent with those deposited in GenBank. Thus, the target fragment was successfully recombined into the vector, and its integrity was maintained. The standard curve and regression equation were established through the optimized FQ-PCR protocol. The standard curve of porcine ADD1 and GAPDH cDNA was determined, and its linear range extension could reach seven orders of magnitudes. The results showed that this method was used to quantify ADD1 expression in the longissimus muscle of two breeds of pig, and was found to be accurate, sensitive, and convenient. These results provide information regarding porcine ADD1 mRNA expression and the mechanism of adipocyte differentiation, and this study could help in the effort to meet the demands of consumers interested in the maintenance of health and prevention of obesity. Furthermore, it could lead to new approaches in the prevention and clinical treatment of this disease.

  18. Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

    Science.gov (United States)

    Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

    2017-01-01

    Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  19. Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia persica in Animal Blood Samples.

    Science.gov (United States)

    Naddaf, S R; Kishdehi, M; Siavashi, Mr

    2011-01-01

    The mainstay of diagnosis of relapsing fever (RF) is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL) was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.

  20. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  1. Quantification of miRNAs by a simple and specific qPCR method

    DEFF Research Database (Denmark)

    Cirera Salicio, Susanna; Busk, Peter K.

    2014-01-01

    MicroRNAs (miRNAs) are powerful regulators of gene expression at posttranscriptional level and play important roles in many biological processes and in disease. The rapid pace of the emerging field of miRNAs has opened new avenues for development of techniques to quantitatively determine mi...... in miRNA quantification. Furthermore, the method is easy to perform with common laboratory reagents, which allows miRNA quantification at low cost....

  2. Eliminating PCR contamination

    International Nuclear Information System (INIS)

    Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.

    1991-01-01

    The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs

  3. Selection of Suitable DNA Extraction Methods for Genetically Modified Maize 3272, and Development and Evaluation of an Event-Specific Quantitative PCR Method for 3272.

    Science.gov (United States)

    Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2016-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize, 3272. We first attempted to obtain genome DNA from this maize using a DNeasy Plant Maxi kit and a DNeasy Plant Mini kit, which have been widely utilized in our previous studies, but DNA extraction yields from 3272 were markedly lower than those from non-GM maize seeds. However, lowering of DNA extraction yields was not observed with GM quicker or Genomic-tip 20/G. We chose GM quicker for evaluation of the quantitative method. We prepared a standard plasmid for 3272 quantification. The conversion factor (Cf), which is required to calculate the amount of a genetically modified organism (GMO), was experimentally determined for two real-time PCR instruments, the Applied Biosystems 7900HT (the ABI 7900) and the Applied Biosystems 7500 (the ABI7500). The determined Cf values were 0.60 and 0.59 for the ABI 7900 and the ABI 7500, respectively. To evaluate the developed method, a blind test was conducted as part of an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSDr). The determined values were similar to those in our previous validation studies. The limit of quantitation for the method was estimated to be 0.5% or less, and we concluded that the developed method would be suitable and practical for detection and quantification of 3272.

  4. A flotation/sieving method to detect Echinococcus multilocularis and Toxocara spp. eggs in soil by real-time PCR

    Science.gov (United States)

    Umhang, Gérald; Bastien, Matthieu; Renault, Camille; Faisse, Marine; Caillot, Christophe; Boucher, Jean-Marc; Hormaz, Vanessa; Poulle, Marie-Lazarine; Boué, Franck

    2017-01-01

    Soil can be a source of human infection by many zoonotic helminth species including Echinococcus multilocularis and Toxocara spp. The prevention of alveolar echinococcosis could be greatly improved through the identification of at-risk areas. Yet very few data are available about the detection of E. multilocularis in soil, while more studies have been reported for Toxocara spp. Identification of soil contamination by E. multilocularis eggs requires the use of specific methods. This study describes the development of a method for the detection of E. multilocularis in soil samples with the concentration of eggs using a flotation/sieving method and detection by duplex real-time polymerase chain reaction (PCR). Toxocara spp. egg detection was also undertaken due to the widespread presence of this parasite in soil, despite it being considered less pathogenic. Method sensitivity of 100% was reached for the detection of 10 E. multilocularis eggs spiked in 10 g of soil. Concerning Toxocara spp., method sensitivity was lower but assumed to be due to the reduced effectiveness of the DNA extraction protocol. The parasitological status for E. multilocularis and Toxocara spp. of 63 carnivore fecal samples collected in highly endemic rural areas of France and of soil samples collected under and near these fecal samples was compared. The contamination of soil samples collected under positive fecal samples for E. multilocularis (n = 3) or Toxocara spp. (n = 19) confirmed the transfer of eggs from the definitive host to the environment. PMID:28737135

  5. A PCR-Based Method to Construct Lentiviral Vector Expressing Double Tough Decoy for miRNA Inhibition.

    Directory of Open Access Journals (Sweden)

    Huiling Qiu

    Full Text Available DNA vector-encoded Tough Decoy (TuD miRNA inhibitor is attracting increased attention due to its high efficiency in miRNA suppression. The current methods used to construct TuD vectors are based on synthesizing long oligonucleotides (~90 mer, which have been costly and problematic because of mutations during synthesis. In this study, we report a PCR-based method for the generation of double Tough Decoy (dTuD vector in which only two sets of shorter oligonucleotides (< 60 mer were used. Different approaches were employed to test the inhibitory potency of dTuDs. We demonstrated that dTuD is the most efficient method in miRNA inhibition in vitro and in vivo. Using this method, a mini dTuD library against 88 human miRNAs was constructed and used for a high-throughput screening (HTS of AP-1 pathway-related miRNAs. Seven miRNAs (miR-18b-5p, -101-3p, -148b-3p, -130b-3p, -186-3p, -187-3p and -1324 were identified as candidates involved in AP-1 pathway regulation. This novel method allows for an accurate and cost-effective generation of dTuD miRNA inhibitor, providing a powerful tool for efficient miRNA suppression in vitro and in vivo.

  6. Quantification of Listeria monocytogenes in minimally processed leafy vegetables using a combined method based on enrichment and 16S rRNA real-time PCR.

    Science.gov (United States)

    Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina

    2010-02-01

    Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.

  7. Comparison of Pulsed-Gel Electrophoresis and a Commercial Repetitive-Element PCR Method for Assessment of Methicillin-Resistant Staphylococcus aureus Clustering in Different Health Care Facilities

    Science.gov (United States)

    Duster, Megan; Warrack, Simone; Maki, Dennis; Safdar, Nasia

    2014-01-01

    Pulsed-field gel electrophoresis (PFGE) is a common method used to type methicillin-resistant Staphylococcus aureus (MRSA) in nosocomial investigations and epidemiological studies but is time-consuming and methodologically challenging. We compared typing results obtained using a commercial repetitive-element PCR (rep-PCR) system with PFGE in a sample of 86 unique MRSA isolates recovered from subjects in an academic referral hospital and two nursing homes in the same geographic region. Both methods reliably assigned isolates to the same Centers for Disease Control and Prevention (CDC) pulsotype. PFGE was significantly more discriminatory (Simpson's index of diversity, 0.92 at the 95% strain similarity threshold) than the commercial rep-PCR system (Simpson's index of diversity, 0.58). The global (adjusted Rand coefficient, 0.10) and directional congruence (adjusted Wallace coefficientrepPCR→PFGE = 0.06; adjusted Wallace coefficientPFGE→repPCR = 0.52) between the two methods was low. MRSA strains recovered from study nursing homes that were clonal when typed by the commercial rep-PCR method were frequently noted to be genetically distinct when typed using PFGE. These data suggest that the commercial rep-PCR has less utility than PFGE in small-scale epidemiological assessments of MRSA in health care settings. PMID:24671801

  8. The utility of optical detection system (qPCR) and bioinformatics methods in reference gene expression analysis

    Science.gov (United States)

    Skarzyńska, Agnieszka; Pawełkowicz, Magdalena; PlÄ der, Wojciech; Przybecki, Zbigniew

    2016-09-01

    Real-time quantitative polymerase chain reaction is consider as the most reliable method for gene expression studies. However, the expression of target gene could be misinterpreted due to improper normalization. Therefore, the crucial step for analysing of qPCR data is selection of suitable reference genes, which should be validated experimentally. In order to choice the gene with stable expression in the designed experiment, we performed reference gene expression analysis. In this study genes described in the literature and novel genes predicted as control genes, based on the in silico analysis of transcriptome data were used. Analysis with geNorm and NormFinder algorithms allow to create the ranking of candidate genes and indicate the best reference for flower morphogenesis study. According to the results, genes CACS and CYCL were characterised the most stable expression, but the least suitable genes were TUA and EF.

  9. A rapid and simple method of detection of Blepharisma japonicum using PCR and immobilisation on FTA paper

    Science.gov (United States)

    Hide, Geoff; Hughes, Jacqueline M; McNuff, Robert

    2003-01-01

    Background The rapid expansion in the availability of genome and DNA sequence information has opened up new possibilities for the development of methods for detecting free-living protozoa in environmental samples. The protozoan Blepharisma japonicum was used to investigate a rapid and simple detection system based on polymerase chain reaction amplification (PCR) from organisms immobilised on FTA paper. Results Using primers designed from the α-tubulin genes of Blepharisma, specific and sensitive detection to the equivalent of a single Blepharisma cell could be achieved. Similar detection levels were found using water samples, containing Blepharisma, which were dried onto Whatman FTA paper. Conclusion This system has potential as a sensitive convenient detection system for Blepharisma and could be applied to other protozoan organisms. PMID:14516472

  10. A PCR-DGGE method for detection and identification of Campylobacter, Helicobacter, Arcobacter and related Epsilobacteria and its application to saliva samples from humans and domestic pets

    DEFF Research Database (Denmark)

    Petersen, Randi Føns; Harrington, C. S.; Kortegaard, H. E.

    2007-01-01

    Results: A semi-nested PCR was developed to allow sensitive detection of all Epsilobacteria, with species separation undertaken by DGGE. A database was constructed in BioNumerics using 145 strains covering 51 Campylobacter, Arcobacter and Helicobacter taxa; Nineteen distinct DGGE profile-groups were......Aims: To develop a PCR-denaturing gradient gel electrophoresis (PCR-DGGE) method for the detection and identification of Campylobacter, Helicobacter and Arcobacter species (Epsilobacteria) in clinical samples and evaluate its efficacy on saliva samples from humans and domestic pets. Methods ans...... distinguished. This approach detected Epsilobacteria in all saliva samples collected from humans, cats and dogs, and identified Campylobacter concisus and/or Campylobacter gracilis in the human samples. The pet animal samples were taken from individuals with oral/dental diseases; PCR-DGGE identified up to four...

  11. Distribution and differential diagnosis of Entamoeba Histolytica from Entamoeba Dispar by the PCR-RFLP method in central Iran

    International Nuclear Information System (INIS)

    Hooshyar, Hossein; Rezian, Mostafa; Kazemi, Bahram

    2003-01-01

    Entamoeba histolytica and Entamoeba dispar are two morphologically indistinguishable human protozoan parasites that are genetically distinct species. The potential invasive pathogenic Entamoeba histolytica and non-invasive parasites Entamoeba dispar can be differentiated by molecular and other methods. We used Polymer Chain Reaction (PCR) to determine the ratio of two species in a population in central Iran.Human stool samples(n=12 148) were randomly collected in Tehran and Karaj and examined for E.histolytica/E.dispar cysts with direct and formalin-ether methods.Eighty -seven (0.7%) cases were positive, of which 49 (62.8%) isolates were successfully cultured in Robison's medium. A pair of oligonucleotide primers designed from sequence data for genomic DNA coding the 30-KD surface antigen of E.histolytica/E.dipar was used to amplify a 374 base-pair (bp) fragment. The restriction fragment length polymorphism (RFLP) pattern obtained from a standard E.histolytica isolate had had two fragments (219 bp and 155bp), but the standard isolate of E. disparshowed three fragments (155, 152 and 67bp ). Differential diagonosis of 49 isolates of E. histolytica/ E. dispar from Tehran and Karaj using PCR-RFLP revealed that 46(93.9%) were E. were E. dispar while only 2(4.1%) were E. histolytica .One person (2%) had a mixed infection and showed both patterns The differential diagonosis of the potentially pathogenic parasite E.histolytica from the non-pathogenic E. dispar is of clinical and epidemiological importance. This study demonstrated E. dispar is much more prevalent than E.histolytica among the c yst passersin Tehran and Kraj in Central Iran. (author)

  12. Reverse transcriptase real-time PCR for detection and quantification of viable Campylobacter jejuni directly from poultry faecal samples

    DEFF Research Database (Denmark)

    Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

    2012-01-01

    Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...

  13. Role of PCR method using IS6110 primer in detecting Mycobacterium tuberculosis among the clinically diagnosed childhood tuberculosis patients at an urban hospital in Dhaka, Bangladesh

    Directory of Open Access Journals (Sweden)

    Senjuti Kabir

    2018-03-01

    Full Text Available Objective: Better methods are needed for the accurate detection of child tuberculosis (TB. This study compared different laboratory tests and evaluated IS6110 PCR for the detection of Mycobacterium tuberculosis (MTB among clinically diagnosed child TB patients. Methods: A total of 102 paediatric patients (<15 years old with clinically diagnosed TB were enrolled in this study. The patients were admitted to the icddr,b hospital in Dhaka between 2003 and 2005. Sputum/gastric lavage samples were collected for smear microscopy, culture (solid/Lowenstein–Jensen medium and liquid/MGIT, and IS6110 PCR testing. The sensitivity, specificity, and positive and negative predictive values (PPV, NPV of smear microscopy and PCR were compared to the two culture methods. Results: Three patients were positive on smear microscopy (2.9%. MTB was detected by conventional culture in 15.7% (16/102, liquid culture in 14% (14/100, and IS6110 PCR in 61.8% (63/102. PCR detected an additional 45 patients who were undetected with the three other tests. Compared to conventional and liquid culture, respectively, smear microscopy showed sensitivity of 18.8% and 21.4%, specificity of 100% individually, PPV of 100% individually, and NPV of 86.9% and 88.7%, whereas PCR had sensitivity of 87.5% and 92.9%, specificity of 43% individually, PPV of 22.2% and 21%, and NPV of 94.9% and 97.4%. Conclusions: PCR can be useful compared to smear microscopy and culture methods and is applicable as a rapid screening test for child TB. A larger scale study is required to determine its diagnostic efficacy in improving the detection of child TB in the presence and absence of severe malnutrition. Keywords: Child tuberculosis, Mycobacterium tuberculosis, IS6110 PCR

  14. Analytical Validation of Quantitative Real-Time PCR Methods for Quantification of Trypanosoma cruzi DNA in Blood Samples from Chagas Disease Patients.

    Science.gov (United States)

    Ramírez, Juan Carlos; Cura, Carolina Inés; da Cruz Moreira, Otacilio; Lages-Silva, Eliane; Juiz, Natalia; Velázquez, Elsa; Ramírez, Juan David; Alberti, Anahí; Pavia, Paula; Flores-Chávez, María Delmans; Muñoz-Calderón, Arturo; Pérez-Morales, Deyanira; Santalla, José; Marcos da Matta Guedes, Paulo; Peneau, Julie; Marcet, Paula; Padilla, Carlos; Cruz-Robles, David; Valencia, Edward; Crisante, Gladys Elena; Greif, Gonzalo; Zulantay, Inés; Costales, Jaime Alfredo; Alvarez-Martínez, Miriam; Martínez, Norma Edith; Villarroel, Rodrigo; Villarroel, Sandro; Sánchez, Zunilda; Bisio, Margarita; Parrado, Rudy; Maria da Cunha Galvão, Lúcia; Jácome da Câmara, Antonia Cláudia; Espinoza, Bertha; Alarcón de Noya, Belkisyole; Puerta, Concepción; Riarte, Adelina; Diosque, Patricio; Sosa-Estani, Sergio; Guhl, Felipe; Ribeiro, Isabela; Aznar, Christine; Britto, Constança; Yadón, Zaida Estela; Schijman, Alejandro G

    2015-09-01

    An international study was performed by 26 experienced PCR laboratories from 14 countries to assess the performance of duplex quantitative real-time PCR (qPCR) strategies on the basis of TaqMan probes for detection and quantification of parasitic loads in peripheral blood samples from Chagas disease patients. Two methods were studied: Satellite DNA (SatDNA) qPCR and kinetoplastid DNA (kDNA) qPCR. Both methods included an internal amplification control. Reportable range, analytical sensitivity, limits of detection and quantification, and precision were estimated according to international guidelines. In addition, inclusivity and exclusivity were estimated with DNA from stocks representing the different Trypanosoma cruzi discrete typing units and Trypanosoma rangeli and Leishmania spp. Both methods were challenged against 156 blood samples provided by the participant laboratories, including samples from acute and chronic patients with varied clinical findings, infected by oral route or vectorial transmission. kDNA qPCR showed better analytical sensitivity than SatDNA qPCR with limits of detection of 0.23 and 0.70 parasite equivalents/mL, respectively. Analyses of clinical samples revealed a high concordance in terms of sensitivity and parasitic loads determined by both SatDNA and kDNA qPCRs. This effort is a major step toward international validation of qPCR methods for the quantification of T. cruzi DNA in human blood samples, aiming to provide an accurate surrogate biomarker for diagnosis and treatment monitoring for patients with Chagas disease. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  15. Optimization of conditions to extract high quality DNA for PCR analysis from whole blood using SDS-proteinase K method

    Directory of Open Access Journals (Sweden)

    Wajhul Qamar

    2017-11-01

    Full Text Available In case of studies associated with human genetics, genomics, and pharmacogenetics the genomic DNA is extracted from the buccal cells, whole blood etc. Several methods are exploited by the researchers to extract DNA from the whole blood. One of these methods, which utilizes cell lysis and proteolytic properties of sodium dodecyl sulfate (SDS and proteinase K respectively, might also be called SDS-PK method. It does not include any hazardous chemicals such as phenol or chloroform and is inexpensive. However, several researchers report the same method with different formulas and conditions. During our experiments with whole blood DNA extraction we experienced problems such as protein contamination, DNA purity and yield when followed some SDS-PK protocols reported elsewhere. A260/A280 and A260/A230 ratios along with PCR amplification give a clear idea about the procedure that was followed to extract the DNA. In an effort to increase the DNA purity from human whole blood, we pointed out some steps of the protocol that play a crucial role in determining the extraction of high quality DNA.

  16. A versatile method to design stem-loop primer-based quantitative PCR assays for detecting small regulatory RNA molecules.

    Directory of Open Access Journals (Sweden)

    Zsolt Czimmerer

    Full Text Available Short regulatory RNA-s have been identified as key regulators of gene expression in eukaryotes. They have been involved in the regulation of both physiological and pathological processes such as embryonal development, immunoregulation and cancer. One of their relevant characteristics is their high stability, which makes them excellent candidates for use as biomarkers. Their number is constantly increasing as next generation sequencing methods reveal more and more details of their synthesis. These novel findings aim for new detection methods for the individual short regulatory RNA-s in order to be able to confirm the primary data and characterize newly identified subtypes in different biological conditions. We have developed a flexible method to design RT-qPCR assays that are very sensitive and robust. The newly designed assays were tested extensively in samples from plant, mouse and even human formalin fixed paraffin embedded tissues. Moreover, we have shown that these assays are able to quantify endogenously generated shRNA molecules. The assay design method is freely available for anyone who wishes to use a robust and flexible system for the quantitative analysis of matured regulatory RNA-s.

  17. A human fecal contamination score for ranking recreational sites using the HF183/BacR287 quantitative real-time PCR method.

    Science.gov (United States)

    Cao, Yiping; Sivaganesan, Mano; Kelty, Catherine A; Wang, Dan; Boehm, Alexandria B; Griffith, John F; Weisberg, Stephen B; Shanks, Orin C

    2018-01-01

    Human fecal pollution of recreational waters remains a public health concern worldwide. As a result, there is a growing interest in the application of human-associated fecal source identification quantitative real-time PCR (qPCR) technologies for water quality research and management. However, there are currently no standardized approaches for field implementation and interpretation of qPCR data. In this study, a standardized HF183/BacR287 qPCR method was combined with a water sampling strategy and a novel Bayesian weighted average approach to establish a human fecal contamination score (HFS) that can be used to prioritize sampling sites for remediation based on measured human waste levels. The HFS was then used to investigate 975 study design scenarios utilizing different combinations of sites with varying sampling intensities (daily to once per week) and number of qPCR replicates per sample (2-14 replicates). Findings demonstrate that site prioritization with HFS is feasible and that both sampling intensity and number of qPCR replicates influence reliability of HFS estimates. The novel data analysis strategy presented here provides a prescribed approach for the implementation and interpretation of human-associated HF183/BacR287 qPCR data with the goal of site prioritization based on human fecal pollution levels. In addition, information is provided for future users to customize study designs for optimal HFS performance. Published by Elsevier Ltd.

  18. Validation of an open-formula, diagnostic real-time PCR method for 20-hr detection of Salmonella in animal feeds

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Hoorfar, Jeffrey

    2012-01-01

    A comparative study of a 20-hr, non-commercial, open-formula PCR method and the standard culture-based method NMKL 187, for detection of Salmonella, was performed according to the validation protocol from the Nordic organization for validation of alternative microbiological methods (NordVal) on 81...

  19. PCR-based method for the rapid identification of astaxanthin-accumulating yeasts (Phaffia spp.).

    Science.gov (United States)

    Colabella, Fernando; Libkind, Diego

    2016-01-01

    It has been recently found that the natural distribution, habitat, and genetic diversity of astaxanthin-producing yeasts (i.e. Phaffia rhodozyma, synonym Xanthophyllomyces dendrorhous) is much greater than previously thought. P. rhodozyma is biotechnologically exploited due to its ability to produce the carotenoid pigment astaxanthin and thus, it is used as a natural source of this pigment for aquaculture. P. rhodozyma was also capable of synthesizing the potent UVB sunscreen mycosporine-glutaminol-glucoside (MGG). Therefore, further environmental studies are needed to elucidate its ecological aspects and detect new potential strains for the production of astaxanthin and MGG. However, obtaining new isolates of P. rhodozyma and related species is not always easy due to its low abundance and the presence of other sympatric and pigmented yeasts. In this work we report a successful development of a species-specific primer which has the ability to quickly and accurately detecting isolates representing all known lineages of the genus Phaffia (including novel species of the genus) and excluding closely related taxa. For this purpose, a primer of 20 nucleotides (called PhR) was designed to be used in combination with universal primers ITS3 and NL4 in a multiplex amplification. The proposed method has the sensitivity and specificity required for the precise detection of new isolates, and therefore represents an important tool for the environmental search for novel astaxanthin-producing yeasts. Copyright © 2015 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  20. Rapid Identification and Quantification of Aureococcus anophagefferens by qPCR Method (Taqman) in the Qinhuangdao Coastal Area: A Region for Recurrent Brown Tide Breakout in China.

    Science.gov (United States)

    Wang, Li-Ping; Lei, Kun

    2016-12-01

    Since 2009, Aureococcus anophagefferens has caused brown tide to occur recurrently in Qinhuangdao coastal area, China. Because the algal cells of A. anophagefferens are so tiny (~3 µm) that it is very hard to identify exactly under a microscope for natural water samples, it is very urgent to develop a method for efficient and continuous monitoring. Here specific primers and Taqman probe are designed to develop a real-time quantitative PCR (qPCR) method for identification and quantification continually. The algal community and cell abundance of A. anophagefferens in the study area (E 119°20'-119°50' and N 39°30'-39°50') from April to October in 2013 are detected by pyrosequencing, and are used to validate the specification and precision of qPCR method for natural samples. Both pyrosequencing and qPCR shows that the targeted cells are present only in May, June and July, and the cell abundance are July > June > May. Although there are various algal species including dinoflagellata, diatom, Cryptomonadales, Chrysophyceae and Chlorophyta living in the natural seawater simultaneously, no disturbance happens to qPCR method. This qPCR method could detect as few as 10 targeted cells, indicating it is able to detect the algal cells at pre-bloom levels. Therefore, qPCR with Taqman probe provides a powerful and sensitive method to monitor the brown tide continually in Qinhuangdao coastal area, China. The results provide a necessary technology support for forecasting the brown tide initiation, in China.

  1. Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods.

    Science.gov (United States)

    Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi

    2015-10-19

    We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

  2. Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods

    Directory of Open Access Journals (Sweden)

    Akiko Edagawa

    2015-10-01

    Full Text Available We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR, and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%. Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%. In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8% compared with real-time qPCR alone (46/68, 67.6%. Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1% compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%. Legionella was not detected in the remaining six samples (6/68, 8.8%, irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

  3. Verification of Frequency in Species of Nontuberculous Mycobacteria in Kermanshah Drinking Water Supplies Using the PCR-Sequencing Method.

    Science.gov (United States)

    Mohajeri, Parviz; Yazdani, Laya; Shahraki, Abdolrazagh Hashemi; Alvandi, Amirhoshang; Atashi, Sara; Farahani, Abbas; Almasi, Ali; Rezaei, Mansour

    2017-04-01

    Nontuberculous mycobacteria are habitants of environment, especially in aquatic systems. Some of them cause problems in immunodeficient patients. Over the last decade, 16S rRNA gene sequencing was established in 45 novel species of nontuberculous mycobacteria. Experiences revealed that this method underestimates the diversity, but does not distinguish between some of mycobacterium subsp. To recognize emerging rapidly growing mycobacteria and identify their subsp, rpoB gene sequencing has been developed. To better understand the transmission of nontuberculous mycobacterial species from drinking water and preventing the spread of illness with these bacteria, the aim of this study was to detect the presence of bacteria by PCR-sequencing techniques. Drinking water samples were collected from different areas of Kermanshah city in west of IRAN. After decontamination with cetylpyridinium chloride, samples were filtered with 0.45-micron filters, the filter transferred directly on growth medium waiting to appear in colonies, then DNA extraction and PCR were performed, and products were sent to sequencing. We found 35/110 (32%) nontuberculous mycobacterial species in drinking water samples, isolates included Mycobacterium goodii, Mycobacterium aurum, and Mycobacterium gastri with the most abundance (11.5%), followed by Mycobacterium smegmatis, Mycobacterium porcinum, Mycobacterium peregrinum, Mycobacterium mucogenicum, and Mycobacterium chelonae (8%). In this study, we recognized the evidence of contamination by nontuberculous mycobacteria in corroded water pipes. As a result of the high prevalence of these bacteria in drinking water in Kermanshah, this is important evidence of transmission through drinking water. This finding can also help public health policy makers control these isolates in drinking water supplies in Kermanshah.

  4. Lactobacillus genus identification isolated from gastrointestinal tract of chickens after bee products application using FISH and RTQ PCR methods

    Directory of Open Access Journals (Sweden)

    Miroslava Kačániová

    2013-05-01

    Full Text Available The general objective of this study was to examine the effect of bee products on the lactobacilli colonization of chickens. Bee products were administered to both feed mixtures in various amounts in addition to the control group. First experimental group was with propolis in feed mixture with the addition of 400 mg propolis per 1 kg of compound and second group was with pollen in feed mixture with the addition of 450 mg pollen per 1 kg of compound. In this experiment, quantitative counts of lactobacilli in ceca of 49-day-old chicken (Ross 308 using classical and FISH method were investigated. Counts of lactobacilli on MRS agar were monitored. To check the reliability of traditional methods of cultivation samples were evaluated by fluorescence in situ hybridization (FISH. Lactobacillus cells, isolated from gastrointestinal tract, were detected after hybridization of fluorescently labeled probe with bacterial cells. Counts of CFU of lactobacilli were compared in experimental and control treatments, respectively. The lowest count was detected in the control experimental group. The highest count was detected in the third experimental group where was 450 mg of pollen added to 1 kg of feed mixture. Using Real-time PCR method, we identified the species range of the genera Lactobacillus in the intestinal tract of broiler. Detected species from the genus Lactobacillus were L. crispatus, L. salivarius and L. acidophilus.

  5. Novel subtractive transcription-based amplification of mRNA (STAR method and its application in search of rare and differentially expressed genes in AD brains

    Directory of Open Access Journals (Sweden)

    Walker P Roy

    2006-11-01

    Full Text Available Abstract Background Alzheimer's disease (AD is a complex disorder that involves multiple biological processes. Many genes implicated in these processes may be present in low abundance in the human brain. DNA microarray analysis identifies changed genes that are expressed at high or moderate levels. Complementary to this approach, we described here a novel technology designed specifically to isolate rare and novel genes previously undetectable by other methods. We have used this method to identify differentially expressed genes in brains affected by AD. Our method, termed Subtractive Transcription-based Amplification of mRNA (STAR, is a combination of subtractive RNA/DNA hybridization and RNA amplification, which allows the removal of non-differentially expressed transcripts and the linear amplification of the differentially expressed genes. Results Using the STAR technology we have identified over 800 differentially expressed sequences in AD brains, both up- and down- regulated, compared to age-matched controls. Over 55% of the sequences represent genes of unknown function and roughly half of them were novel and rare discoveries in the human brain. The expression changes of nearly 80 unique genes were further confirmed by qRT-PCR and the association of additional genes with AD and/or neurodegeneration was established using an in-house literature mining tool (LitMiner. Conclusion The STAR process significantly amplifies unique and rare sequences relative to abundant housekeeping genes and, as a consequence, identifies genes not previously linked to AD. This method also offers new opportunities to study the subtle changes in gene expression that potentially contribute to the development and/or progression of AD.

  6. A human fecal contamination index for ranking impaired recreational watersusing the HF183 quantitative real-time PCR method

    Science.gov (United States)

    Human fecal pollution of surface water remains a public health concern worldwide. As a result, there is a growing interest in the application of human-associated fecal source identification quantitative real-time PCR (qPCR) technologies for recreational water quality risk managem...

  7. Data Acceptance Criteria for Standardized Human-Associated Fecal Source Identification Quantitative Real-Time PCR Methods

    Science.gov (United States)

    There is a growing interest in the application of human-associated fecal sourceidentification quantitative real-time PCR (qPCR) technologies for water quality management. The transition from a research tool to a standardized protocol requires a high degree of confidence in data q...

  8. An easy 'one tube' method to estimate viability of Cryptosporidium oocysts using real-time qPCR

    NARCIS (Netherlands)

    Paziewska-Harris, A.; Schoone, G.; Schallig, H. D. F. H.

    2016-01-01

    Viability estimation of the highly resistant oocysts of Cryptosporidium remains a key issue for the monitoring and control of this pathogen. We present here a simple 'one tube' quantitative PCR (qPCR) protocol for viability estimation using a DNA extraction protocol which preferentially solubilizes

  9. EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

    Science.gov (United States)

    Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

  10. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    Directory of Open Access Journals (Sweden)

    Žel Jana

    2006-08-01

    Full Text Available Abstract Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was

  11. Critical points of DNA quantification by real-time PCR--effects of DNA extraction method and sample matrix on quantification of genetically modified organisms.

    Science.gov (United States)

    Cankar, Katarina; Stebih, Dejan; Dreo, Tanja; Zel, Jana; Gruden, Kristina

    2006-08-14

    Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to

  12. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    Science.gov (United States)

    Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina

    2006-01-01

    Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary

  13. Evaluation of an Improved U.S. Food and Drug Administration Method for the Detection of Cyclospora cayetanensis in Produce Using Real-Time PCR.

    Science.gov (United States)

    Murphy, Helen R; Lee, Seulgi; da Silva, Alexandre J

    2017-07-01

    Cyclospora cayetanensis is a protozoan parasite that causes human diarrheal disease associated with the consumption of fresh produce or water contaminated with C. cayetanensis oocysts. In the United States, foodborne outbreaks of cyclosporiasis have been linked to various types of imported fresh produce, including cilantro and raspberries. An improved method was developed for identification of C. cayetanensis in produce at the U.S. Food and Drug Administration. The method relies on a 0.1% Alconox produce wash solution for efficient recovery of oocysts, a commercial kit for DNA template preparation, and an optimized TaqMan real-time PCR assay with an internal amplification control for molecular detection of the parasite. A single laboratory validation study was performed to assess the method's performance and compare the optimized TaqMan real-time PCR assay and a reference nested PCR assay by examining 128 samples. The samples consisted of 25 g of cilantro or 50 g of raspberries seeded with 0, 5, 10, or 200 C. cayetanensis oocysts. Detection rates for cilantro seeded with 5 and 10 oocysts were 50.0 and 87.5%, respectively, with the real-time PCR assay and 43.7 and 94.8%, respectively, with the nested PCR assay. Detection rates for raspberries seeded with 5 and 10 oocysts were 25.0 and 75.0%, respectively, with the real-time PCR assay and 18.8 and 68.8%, respectively, with the nested PCR assay. All unseeded samples were negative, and all samples seeded with 200 oocysts were positive. Detection rates using the two PCR methods were statistically similar, but the real-time PCR assay is less laborious and less prone to amplicon contamination and allows monitoring of amplification and analysis of results, making it more attractive to diagnostic testing laboratories. The improved sample preparation steps and the TaqMan real-time PCR assay provide a robust, streamlined, and rapid analytical procedure for surveillance, outbreak response, and regulatory testing of foods for

  14. Evaluation and In-House Validation of Five DNA Extraction Methods for PCR-based STR Analysis of Bloodstained Denims

    Directory of Open Access Journals (Sweden)

    Henry Perdigon

    2004-06-01

    Full Text Available One type of crime scene evidence commonly submitted for analysis is bloodstain on denim. However, chemicals (e.g., indigo used to produce denim materials may co-purify with DNA and hence, affect subsequent DNA analysis. The present study compared five methods (e.g., standard organic, organic with hydrogen peroxide (H2O2, modified FTA™, organic/Chelex®-Centricon®, and QIAamp® DNA Mini Kit-based procedures for the isolation of blood DNA from denim. A Short Tandem Repeat (STR-based analysis across two to nine STR markers, namely, HUMvWA, HUMTH01, D8S306, HUMFES/FPS, HUMDHFRP2, HUMF13A01, HUMFGA, HUMTPOX, and HUMCSF1PO, was used to evaluate successful amplification of blood DNA extracted from light indigo, dark indigo, indigo-sulfur, pure indigo, sulfur-top, and sulfur-bottom denim materials. The results of the present study support the utility of organic/Chelex®-Centricon® and QIAamp® Kit procedures in extracting PCR-amplifiable DNA from five different types of denim materials for STR analysis. Furthermore, a solid-based method using FTA™ classic cards was modified to provide a simple, rapid, safe, and cost-effective procedure for extracting blood DNA from light, dark indigo and pure indigo denim materials. However, DNA eluted from bloodstained sulfur-dyed denims (e.g., sulfur-top and sulfur-bottom using FTA™ procedure was not readily amplifiable.

  15. Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods.

    Science.gov (United States)

    Seo, K H; Valentin-Bon, I E; Brackett, R E

    2006-03-01

    Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.

  16. Inter-laboratory evaluation of three flagellin PCR/RFLP methods for typing Campylobacter jejuni and C-coli: the CAMPYNET experience

    DEFF Research Database (Denmark)

    Harrington, Clare S.; Moran, L.; Ridley, A.M.

    2003-01-01

    Aims: To compare typeability, discriminatory ability, and inter-laboratory reproducibility of three flagellin PCR/RFLP(fla typing) methods previously described for Campylobacter. Methods and Results: The sample set(n = 100) was diverse, including both C. jejuni (n = 85) and C. coli (n = 15). Two ...

  17. Development of a Rapid Real-Time PCR Method as a Tool To Quantify Viable Photobacterium phosphoreum Bacteria in Salmon (Salmo salar) Steaks

    DEFF Research Database (Denmark)

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka

    2013-01-01

    A specific real-time PCR quantification method combined with a propidium monoazide sample treatment step was developed to determine quantitatively the viable population of the Photobacterium phosphoreum species group in raw modified-atmosphere-packed salmon. Primers were designed to amplify a 350......-bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When these primers were used for real-time PCR in pure culture, a good correlation (R2 of 0.99) was obtained...... between this method and conventional enumeration on marine agar (MA). Quantification was linear over 5 log units as confirmed by using inoculated salmon samples. On naturally contaminated fresh salmon, the new real-time PCR method performed successfully with a quantification limit of 3 log CFU...

  18. Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

    Science.gov (United States)

    Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

    2017-08-01

    The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Development of real-time PCR method for the detection and the quantification of a new endogenous reference gene in sugar beet "Beta vulgaris L.": GMO application.

    Science.gov (United States)

    Chaouachi, Maher; Alaya, Akram; Ali, Imen Ben Haj; Hafsa, Ahmed Ben; Nabi, Nesrine; Bérard, Aurélie; Romaniuk, Marcel; Skhiri, Fethia; Saïd, Khaled

    2013-01-01

    KEY MESSAGE : Here, we describe a new developed quantitative real-time PCR method for the detection and quantification of a new specific endogenous reference gene used in GMO analysis. The key requirement of this study was the identification of a new reference gene used for the differentiation of the four genomic sections of the sugar beet (Beta vulgaris L.) (Beta, Corrollinae, Nanae and Procumbentes) suitable for quantification of genetically modified sugar beet. A specific qualitative polymerase chain reaction (PCR) assay was designed to detect the sugar beet amplifying a region of the adenylate transporter (ant) gene only from the species of the genomic section I of the genus Beta (cultivated and wild relatives) and showing negative PCR results for 7 species of the 3 other sections, 8 related species and 20 non-sugar beet plants. The sensitivity of the assay was 15 haploid genome copies (HGC). A quantitative real-time polymerase chain reaction (QRT-PCR) assay was also performed, having high linearity (R (2) > 0.994) over sugar beet standard concentrations ranging from 20,000 to 10 HGC of the sugar beet DNA per PCR. The QRT-PCR assay described in this study was specific and more sensitive for sugar beet quantification compared to the validated test previously reported in the European Reference Laboratory. This assay is suitable for GMO quantification in routine analysis from a wide variety of matrices.

  20. Development of an In-House Multiplex Nested RT-PCR Method for Detecting Acute HIV-1 Infection in High Risk Populations.

    Science.gov (United States)

    Liu, Zhiying; Li, Wei; Xu, Meng; Sheng, Bo; Yang, Zixuan; Jiao, Yanmei; Zhang, Tong; Mou, Danlei; Chen, Dexi; Wu, Hao

    2015-01-01

    The detection of acute HIV infection (AHI) among high risk populations can help reduce secondary transmission of HIV. The nucleic acid testing (NAT) can shorten the test window period by up to 7-12 days. In this study, we describe an in-house NAT based on the multiplex nested RT-PCR method to detect the HIV RNA. We also evaluated it in a high risk cohort in Beijing. Four primer pairs were designed and evaluated for the detection of different HIV-1 subtypes in group M. Multiplex RT-PCR and nested PCR were performed. The sensitivity, specialty, primers compatibility among HIV subtypes were evaluated simultaneously. In an MSM cohort in Beijing during a 3-year period, a total of 11,808 blood samples that were negative by ELISA or indeterminate by Western blot were analyzed by this multiplex nested RT-PCR with pooling strategy. The multiplex nested RT-PCR was successfully applied for the detection of at least six HIV-1 subtypes. The sensitivity was 40 copies/ml and the specificity was 100%. A total of 29 people were tested HIV-1 positive with acute infection in a MSM cohort of Beijing during a 3 years period. This multiplex nested RT-PCR provides a useful tool for the rapid detection of acute HIV-1 infection. When used in combination with the 3(rd) generation ELISA, it can improve the detection rate of HIV infection, especially in the source limited regions.

  1. Inverse fusion PCR cloning.

    Directory of Open Access Journals (Sweden)

    Markus Spiliotis

    Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.

  2. Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia Persica in Animal Blood Samples

    Directory of Open Access Journals (Sweden)

    SR Naddaf

    2011-06-01

    Full Text Available Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by mi­cros­copy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spi­ro­chetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR tar­get­ing flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were per­formed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spi­ro­chete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentra­tion as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.

  3. Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia persica in Animal Blood Samples

    Directory of Open Access Journals (Sweden)

    SR Naddaf

    2011-06-01

    Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by mi­cros­copy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spi­ro­chetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR tar­get­ing flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were per­formed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spi­ro­chete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentra­tion as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml.  Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.  

  4. Comparative analysis of methods for gene transcription profiling data derived from different microarray technologies in rat and mouse models of diabetes

    Directory of Open Access Journals (Sweden)

    Bihoreau Marie-Thérèse

    2009-02-01

    Full Text Available Abstract Background Microarray technologies are widely used to quantify the abundance of transcripts corresponding to thousands of genes. To maximise the robustness of transcriptome results, we have tested the performance and reproducibility of rat and mouse gene expression data obtained with Affymetrix, Illumina and Operon platforms. Results We present a thorough analysis of the degree of reproducibility provided by analysing the transcriptomic profile of the same animals of several experimental groups under different popular microarray technologies in different tissues. Concordant results from inter- and intra-platform comparisons were maximised by testing many popular computational methods for generating fold changes and significances and by only considering oligonucleotides giving high expression levels. The choice of Affymetrix signal extraction technique was shown to have the greatest effect on the concordance across platforms. In both species, when choosing optimal methods, the agreement between data generated on the Affymetrix and Illumina was excellent; this was verified using qRT-PCR on a selection of genes present on all platforms. Conclusion This study provides an extensive assessment of analytical methods best suited for processing data from different microarray technologies and can assist integration of technologically different gene expression datasets in biological systems.

  5. Development of a Reverse Transcription Loop-Mediated Isothermal Amplification Method for the Rapid Detection of Subtype H7N9 Avian Influenza Virus

    Directory of Open Access Journals (Sweden)

    Hongmei Bao

    2014-01-01

    Full Text Available A novel influenza A (H7N9 virus has emerged in China. To rapidly detect this virus from clinical samples, we developed a reverse transcription loop-mediated isothermal amplification (RT-LAMP method for the detection of the H7N9 virus. The minimum detection limit of the RT-LAMP assay was 0.01 PFU H7N9 virus, making this method 100-fold more sensitive to the detection of the H7N9 virus than conventional RT-PCR. The H7N9 virus RT-LAMP assays can efficiently detect different sources of H7N9 influenza virus RNA (from chickens, pigeons, the environment, and humans. No cross-reactive amplification with the RNA of other subtype influenza viruses or of other avian respiratory viruses was observed. The assays can effectively detect H7N9 influenza virus RNA in drinking water, soil, cloacal swab, and tracheal swab samples that were collected from live poultry markets, as well as human H7N9 virus, in less than 30 min. These results suggest that the H7N9 virus RT-LAMP assays were efficient, practical, and rapid diagnostic methods for the epidemiological surveillance and diagnosis of influenza A (H7N9 virus from different resource samples.

  6. DPI-ELISA: a fast and versatile method to specify the binding of plant transcription factors to DNA in vitro

    Directory of Open Access Journals (Sweden)

    Chaban Christina

    2010-11-01

    Full Text Available Abstract Background About 10% of all genes in eukaryote genomes are predicted to encode transcription factors. The specific binding of transcription factors to short DNA-motifs influences the expression of neighbouring genes. However, little is known about the DNA-protein interaction itself. To date there are only a few suitable methods to characterise DNA-protein-interactions, among which the EMSA is the method most frequently used in laboratories. Besides EMSA, several protocols describe the effective use of an ELISA-based transcription factor binding assay e.g. for the analysis of human NFκB binding to specific DNA sequences. Results We provide a unified protocol for this type of ELISA analysis, termed DNA-Protein-Interaction (DPI-ELISA. Qualitative analyses with His-epitope tagged plant transcription factors expressed in E. coli revealed that EMSA and DPI-ELISA result in comparable and reproducible data. The binding of AtbZIP63 to the C-box and AtWRKY11 to the W2-box could be reproduced and validated by both methods. We next examined the physical binding of the C-terminal DNA-binding domains of AtWRKY33, AtWRKY50 and AtWRKY75 to the W2-box. Although the DNA-binding domain is highly conserved among the WRKY proteins tested, the use of the DPI-ELISA discloses differences in W2-box binding properties between these proteins. In addition to these well-studied transcription factor families, we applied our protocol to AtBPC2, a member of the so far uncharacterised plant specific Basic Pentacysteine transcription factor family. We could demonstrate binding to GA/TC-dinucleotide repeat motifs by our DPI-ELISA protocol. Different buffers and reaction conditions were examined. Conclusions We successfully applied our DPI-ELISA protocol to investigate the DNA-binding specificities of three different classes of transcription factors from Arabidopsis thaliana. However, the analysis of the binding affinity of any DNA-binding protein to any given DNA

  7. Methods for Real-Time PCR-Based Diagnosis of Chlamydia pneumoniae, Chlamydia psittaci, and Chlamydia abortus Infections in an Opened Molecular Diagnostic Platform.

    Science.gov (United States)

    Opota, Onya; Brouillet, René; Greub, Gilbert; Jaton, Katia

    2017-01-01

    The advances in molecular biology of the last decades have dramatically improved the field of diagnostic bacteriology. In particular, PCR-based technologies have impacted the diagnosis of infections caused by obligate intracellular bacteria such as pathogens from the Chlamydiacae family. Here, we describe a real-time PCR-based method using the Taqman technology for the diagnosis of Chlamydia pneumoniae, Chlamydia psittaci, and Chlamydia abortus infection. The method presented here can be applied to various clinical samples and can be adapted on opened molecular diagnostic platforms.

  8. Using NOAA/AVHRR based remote sensing data and PCR method for estimation of Aus rice yield in Bangladesh

    Science.gov (United States)

    Nizamuddin, Mohammad; Akhand, Kawsar; Roytman, Leonid; Kogan, Felix; Goldberg, Mitch

    2015-06-01

    Rice is a dominant food crop of Bangladesh accounting about 75 percent of agricultural land use for rice cultivation and currently Bangladesh is the world's fourth largest rice producing country. Rice provides about two-third of total calorie supply and about one-half of the agricultural GDP and one-sixth of the national income in Bangladesh. Aus is one of the main rice varieties in Bangladesh. Crop production, especially rice, the main food staple, is the most susceptible to climate change and variability. Any change in climate will, thus, increase uncertainty regarding rice production as climate is major cause year-to-year variability in rice productivity. This paper shows the application of remote sensing data for estimating Aus rice yield in Bangladesh using official statistics of rice yield with real time acquired satellite data from Advanced Very High Resolution Radiometer (AVHRR) sensor and Principal Component Regression (PCR) method was used to construct a model. The simulated result was compared with official agricultural statistics showing that the error of estimation of Aus rice yield was less than 10%. Remote sensing, therefore, is a valuable tool for estimating crop yields well in advance of harvest, and at a low cost.

  9. A new PCR-based method shows that blue crabs (Callinectes sapidus (Rathbun)) consume winter flounder (Pseudopleuronectes americanus (Walbaum)).

    Science.gov (United States)

    Collier, Jackie L; Fitzgerald, Sean P; Hice, Lyndie A; Frisk, Michael G; McElroy, Anne E

    2014-01-01

    Winter flounder (Pseudopleuronectes americanus) once supported robust commercial and recreational fisheries in the New York (USA) region, but since the 1990s populations have been in decline. Available data show that settlement of young-of-the-year winter flounder has not declined as sharply as adult abundance, suggesting that juveniles are experiencing higher mortality following settlement. The recent increase of blue crab (Callinectes sapidus) abundance in the New York region raises the possibility that new sources of predation may be contributing to juvenile winter flounder mortality. To investigate this possibility we developed and validated a method to specifically detect winter flounder mitochondrial control region DNA sequences in the gut contents of blue crabs. A survey of 55 crabs collected from Shinnecock Bay (along the south shore of Long Island, New York) in July, August, and September of 2011 showed that 12 of 42 blue crabs (28.6%) from which PCR-amplifiable DNA was recovered had consumed winter flounder in the wild, empirically supporting the trophic link between these species that has been widely speculated to exist. This technique overcomes difficulties with visual identification of the often unrecognizable gut contents of decapod crustaceans, and modifications of this approach offer valuable tools to more broadly address their feeding habits on a wide variety of species.

  10. Multiplex PCR with minisequencing as an effective high-throughput SNP typing method for formalin-fixed tissue

    DEFF Research Database (Denmark)

    Gilbert, Marcus T P; Sanchez, Juan J; Haselkorn, Tamara

    2007-01-01

    , multiplex PCR with minisequencing (MPMS), on 92 DNA extractions performed on six archival FFPE samples of variable DNA quality, which date between 9 and 25 years old. On the three extracts with highest quality, we found the assay efficiency to be near 100%. However, the efficiency of the lowest quality...... extracts varied significantly. In this study, we demonstrate that although direct measures of DNA concentration in the extracts provide no useful information with regard to subsequent MPMS success, the success of the assay can be determined to some degree a priori, through initial screening of the DNA...... quality using a simple quantitative real-time PCR (qPCR) assay for nuclear DNA, and/or an assay of the maximum PCR amplifiable size of nuclear DNA. MPMS promises to be of significant use in future genetic studies on FFPE material. It provides a streamlined approach for retrieving a large amount of genetic...

  11. Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

    DEFF Research Database (Denmark)

    Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte

    2012-01-01

    To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...

  12. Detecting Pathogens of Verticillium Wilt in Winter Oilseed Rape Using ELISA and PCR – Comparison of the Two Methods and With Visual Stand Evaluation

    Directory of Open Access Journals (Sweden)

    Tomáš Spitzer

    2017-01-01

    Full Text Available During 2013–2015, oilseed rape samples from various locations in the Czech Republic were analysed for the presence of Verticillium wilt. Samples were evaluated in the lab using ELISA and PCR as well as by visual evaluation during the samples collection. A comparison of detection match in individual methods also was made. ELISA and PCR matched in detecting Verticillium wilt in 60 % of cases. For practical use, a higher match rate would be necessary in cases where samples were to be analysed in various laboratories using only one of these techniques. The possibility was demonstrated to use kits as well as primers not targeted specifically to just Verticillium longisporum but recording both main species on oilseed rape (V. longisporum and V. dahliae. The match rates of lab analyses with visual evaluation of stand infection were surprisingly high at 62 % for ELISA and 77 % for PCR. All three stand evaluation methods matched in 56 % of cases.

  13. Identification of genus Acinetobacter: Standardization of in-house PCR and its comparison with conventional phenotypic methods.

    Science.gov (United States)

    Kulkarni, Sughosh S; Madalgi, Radhika; Ajantha, Ganavalli S; Kulkarni, Raghavendra D

    2017-01-01

    Acinetobacter is grouped under nonfermenting Gram-negative bacilli. It is increasingly isolated from pathological samples. The ability of this genus to acquire drug resistance and spread in the hospital settings is posing a grave problem in healthcare. Specific treatment protocols are advocated for Acinetobacter infections. Hence, rapid identification and drug susceptibility profiling are critical in the management of these infections. To standardize an in-house polymerase chain reaction (PCR) for identification of genus Acinetobacter and to compare PCR with two protocols for its phenotypic identification. A total of 96 clinical isolates of Acinetobacter were included in the study. An in-house PCR for genus level identification of Acinetobacter was standardized. All the isolates were phenotypically identified by two protocols. The results of PCR and phenotypic identification protocols were compared. The in-house PCR standardized was highly sensitive and specific for the genus Acinetobacter . There was 100% agreement between the phenotypic and molecular identification of the genus. The preliminary identification tests routinely used in clinical laboratories were also in complete agreement with phenotypic and molecular identification. The in-house PCR for genus level identification is specific and sensitive. However, it may not be essential for routine identification as the preliminary phenotypic identification tests used in the clinical laboratory reliably identify the genus Acinetobacter .

  14. Development of simple and rapid PCR-fingerprinting methods for Vibrio cholerae on the basis of genetic diversity of the superintegron.

    Science.gov (United States)

    Chowdhury, N; Asakura, M; Neogi, S B; Hinenoya, A; Haldar, S; Ramamurthy, T; Sarkar, B L; Faruque, S M; Yamasaki, S

    2010-07-01

    To develop simple and rapid PCR-fingerprinting methods for Vibrio cholerae O1 (El Tor and classical biotypes) and O139 serogroup strains which cause major cholera epidemics, on the basis of the diversity of superintegron (SI) carried by these strains. PCR-restriction fragment length polymorphism (PCR-RFLP) assay was developed targeting region between integrase gene in the SI and its nearby ORF, followed by BglI digestion. Besides, a V. cholerae repeat-amplified fragment length polymorphism (VCR-AFLP) assay was also developed. In the PCR-RFLP, 94 El Tor, 29 classical and 54 O139 strains produced nine, three and six different DNA fingerprints, respectively. On the other hand, VCR-AFLP distinguished these El Tor, classical and O139 strains into five, nine and two DNA fingerprints, respectively. Combining both assays the El Tor, classical and O139 strains could be differentiated into 11, 10 and seven different types, respectively. In a comparative study, pulsed-field gel electrophoresis (PFGE) showed similar differentiation for El Tor (11 types), but lower discrimination for O139 (two types) and classical strains (five types). The PCR assays based on SI diversity can be used as a useful typing tool for epidemiological studies of V. cholerae. This newly developed method is more discriminatory, simple, rapid and cost-effective in comparison with PFGE, and thus can be widely applicable. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

  15. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    Science.gov (United States)

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. False Negative Rates of a Macrofoam-Swab Sampling Method with Low Surface Concentrations of Two Bacillus anthracis Surrogates via Real-Time PCR

    Energy Technology Data Exchange (ETDEWEB)

    Hutchison, Janine R. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Piepel, Gregory F. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Amidan, Brett G. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sydor, Michael A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Kaiser, Brooke L.D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2016-06-01

    Surface sampling for Bacillus anthracis spores has traditionally relied on detection via bacterial cultivation methods. Although effective, this approach does not provide the level of organism specificity that can be gained through molecular techniques. False negative rates (FNR) and limits of detection (LOD) were determined for two B. anthracis surrogates with modified rapid viability-polymerase chain reaction (mRV-PCR) following macrofoam-swab sampling. This study was conducted in parallel with a previously reported study that analyzed spores using a plate-culture method. B. anthracis Sterne (BAS) or B. atrophaeus Nakamura (BG) spores were deposited onto four surface materials (glass, stainless steel, vinyl tile, and plastic) at nine target concentrations (2 to 500 spores/coupon; 0.078 to 19.375 colony-forming units [CFU] per cm2). Mean FNR values for mRV-PCR analysis ranged from 0 to 0.917 for BAS and 0 to 0.875 for BG and increased as spore concentration decreased (over the concentrations investigated) for each surface material. FNRs based on mRV-PCR data were not statistically different for BAS and BG, but were significantly lower for glass than for vinyl tile. FNRs also tended to be lower for the mRV-PCR method compared to the culture method. The mRV-PCR LOD95 was lowest for glass (0.429 CFU/cm2 with BAS and 0.341 CFU/cm2 with BG) and highest for vinyl tile (0.919 CFU/cm2 with BAS and 0.917 CFU/cm2 with BG). These mRV-PCR LOD95 values were lower than the culture values (BAS: 0.678 to 1.023 CFU/cm2 and BG: 0.820 to 1.489 CFU/cm2). The FNR and LOD95 values reported in this work provide guidance for environmental sampling of Bacillus spores at low concentrations.

  17. Linear and exponential TAIL-PCR: a method for efficient and quick amplification of flanking sequences adjacent to Tn5 transposon insertion sites.

    Science.gov (United States)

    Jia, Xianbo; Lin, Xinjian; Chen, Jichen

    2017-11-02

    Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.

  18. Highly sensitive detection of the PIK3CAH1047R mutation in colorectal cancer using a novel PCR-RFLP method

    International Nuclear Information System (INIS)

    Li, Wan-Ming; Hu, Ting-Ting; Zhou, Lin-Lin; Feng, Yi-Ming; Wang, Yun-Yi; Fang, Jin

    2016-01-01

    The PIK3CA H1047R mutation is considered to be a potential predictive biomarker for EGFR-targeted therapies. In this study, we developed a novel PCR-PFLP approach to detect the PIK3CA H1047R mutation in high effectiveness. A 126-bp fragment of PIK3CA exon-20 was