WorldWideScience

Sample records for transcription factors sequence

  1. Using TESS to predict transcription factor binding sites in DNA sequence.

    Science.gov (United States)

    Schug, Jonathan

    2008-03-01

    This unit describes how to use the Transcription Element Search System (TESS). This Web site predicts transcription factor binding sites (TFBS) in DNA sequence using two different kinds of models of sites, strings and positional weight matrices. The binding of transcription factors to DNA is a major part of the control of gene expression. Transcription factors exhibit sequence-specific binding; they form stronger bonds to some DNA sequences than to others. Identification of a good binding site in the promoter for a gene suggests the possibility that the corresponding factor may play a role in the regulation of that gene. However, the sequences transcription factors recognize are typically short and allow for some amount of mismatch. Because of this, binding sites for a factor can typically be found at random every few hundred to a thousand base pairs. TESS has features to help sort through and evaluate the significance of predicted sites.

  2. Sequence motifs in MADS transcription factors responsible for specificity and diversification of protein-protein interaction.

    Directory of Open Access Journals (Sweden)

    Aalt D J van Dijk

    Full Text Available Protein sequences encompass tertiary structures and contain information about specific molecular interactions, which in turn determine biological functions of proteins. Knowledge about how protein sequences define interaction specificity is largely missing, in particular for paralogous protein families with high sequence similarity, such as the plant MADS domain transcription factor family. In comparison to the situation in mammalian species, this important family of transcription regulators has expanded enormously in plant species and contains over 100 members in the model plant species Arabidopsis thaliana. Here, we provide insight into the mechanisms that determine protein-protein interaction specificity for the Arabidopsis MADS domain transcription factor family, using an integrated computational and experimental approach. Plant MADS proteins have highly similar amino acid sequences, but their dimerization patterns vary substantially. Our computational analysis uncovered small sequence regions that explain observed differences in dimerization patterns with reasonable accuracy. Furthermore, we show the usefulness of the method for prediction of MADS domain transcription factor interaction networks in other plant species. Introduction of mutations in the predicted interaction motifs demonstrated that single amino acid mutations can have a large effect and lead to loss or gain of specific interactions. In addition, various performed bioinformatics analyses shed light on the way evolution has shaped MADS domain transcription factor interaction specificity. Identified protein-protein interaction motifs appeared to be strongly conserved among orthologs, indicating their evolutionary importance. We also provide evidence that mutations in these motifs can be a source for sub- or neo-functionalization. The analyses presented here take us a step forward in understanding protein-protein interactions and the interplay between protein sequences and

  3. A ChIP-Seq benchmark shows that sequence conservation mainly improves detection of strong transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Tony Håndstad

    Full Text Available BACKGROUND: Transcription factors are important controllers of gene expression and mapping transcription factor binding sites (TFBS is key to inferring transcription factor regulatory networks. Several methods for predicting TFBS exist, but there are no standard genome-wide datasets on which to assess the performance of these prediction methods. Also, it is believed that information about sequence conservation across different genomes can generally improve accuracy of motif-based predictors, but it is not clear under what circumstances use of conservation is most beneficial. RESULTS: Here we use published ChIP-seq data and an improved peak detection method to create comprehensive benchmark datasets for prediction methods which use known descriptors or binding motifs to detect TFBS in genomic sequences. We use this benchmark to assess the performance of five different prediction methods and find that the methods that use information about sequence conservation generally perform better than simpler motif-scanning methods. The difference is greater on high-affinity peaks and when using short and information-poor motifs. However, if the motifs are specific and information-rich, we find that simple motif-scanning methods can perform better than conservation-based methods. CONCLUSIONS: Our benchmark provides a comprehensive test that can be used to rank the relative performance of transcription factor binding site prediction methods. Moreover, our results show that, contrary to previous reports, sequence conservation is better suited for predicting strong than weak transcription factor binding sites.

  4. Sequence2Vec: A novel embedding approach for modeling transcription factor binding affinity landscape

    KAUST Repository

    Dai, Hanjun

    2017-07-26

    Motivation: An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have brought the opportunity for building binding affinity prediction methods, the accurate characterization of TF-DNA binding affinity landscape still remains a challenging problem. Results: Here we propose a novel sequence embedding approach for modeling the transcription factor binding affinity landscape. Our method represents DNA binding sequences as a hidden Markov model (HMM) which captures both position specific information and long-range dependency in the sequence. A cornerstone of our method is a novel message passing-like embedding algorithm, called Sequence2Vec, which maps these HMMs into a common nonlinear feature space and uses these embedded features to build a predictive model. Our method is a novel combination of the strength of probabilistic graphical models, feature space embedding and deep learning. We conducted comprehensive experiments on over 90 large-scale TF-DNA data sets which were measured by different high-throughput experimental technologies. Sequence2Vec outperforms alternative machine learning methods as well as the state-of-the-art binding affinity prediction methods.

  5. SoyDB: a knowledge database of soybean transcription factors

    Directory of Open Access Journals (Sweden)

    Valliyodan Babu

    2010-01-01

    Full Text Available Abstract Background Transcription factors play the crucial rule of regulating gene expression and influence almost all biological processes. Systematically identifying and annotating transcription factors can greatly aid further understanding their functions and mechanisms. In this article, we present SoyDB, a user friendly database containing comprehensive knowledge of soybean transcription factors. Description The soybean genome was recently sequenced by the Department of Energy-Joint Genome Institute (DOE-JGI and is publicly available. Mining of this sequence identified 5,671 soybean genes as putative transcription factors. These genes were comprehensively annotated as an aid to the soybean research community. We developed SoyDB - a knowledge database for all the transcription factors in the soybean genome. The database contains protein sequences, predicted tertiary structures, putative DNA binding sites, domains, homologous templates in the Protein Data Bank (PDB, protein family classifications, multiple sequence alignments, consensus protein sequence motifs, web logo of each family, and web links to the soybean transcription factor database PlantTFDB, known EST sequences, and other general protein databases including Swiss-Prot, Gene Ontology, KEGG, EMBL, TAIR, InterPro, SMART, PROSITE, NCBI, and Pfam. The database can be accessed via an interactive and convenient web server, which supports full-text search, PSI-BLAST sequence search, database browsing by protein family, and automatic classification of a new protein sequence into one of 64 annotated transcription factor families by hidden Markov models. Conclusions A comprehensive soybean transcription factor database was constructed and made publicly accessible at http://casp.rnet.missouri.edu/soydb/.

  6. Real sequence effects on the search dynamics of transcription factors on DNA

    DEFF Research Database (Denmark)

    Bauer, Maximilian; Rasmussen, Emil S.; Lomholt, Michael A.

    2015-01-01

    Recent experiments show that transcription factors (TFs) indeed use the facilitated diffusion mechanism to locate their target sequences on DNA in living bacteria cells: TFs alternate between sliding motion along DNA and relocation events through the cytoplasm. From simulations and theoretical...... analysis we study the TF-sliding motion for a large section of the DNA-sequence of a common E. coli strain, based on the two-state TF-model with a fast-sliding search state and a recognition state enabling target detection. For the probability to detect the target before dissociating from DNA the TF...... on the underlying nucleotide sequence is varied. A moderate dependence maximises the capability to distinguish between the main operator and similar sequences. Moreover, these auxiliary operators serve as starting points for DNA looping with the main operator, yielding a spectrum of target detection times spanning...

  7. Comparison of Transcription Factor Binding Site Models

    KAUST Repository

    Bhuyan, Sharifulislam

    2012-05-01

    Modeling of transcription factor binding sites (TFBSs) and TFBS prediction on genomic sequences are important steps to elucidate transcription regulatory mechanism. Dependency of transcription regulation on a great number of factors such as chemical specificity, molecular structure, genomic and epigenetic characteristics, long distance interaction, makes this a challenging problem. Different experimental procedures generate evidence that DNA-binding domains of transcription factors show considerable DNA sequence specificity. Probabilistic modeling of TFBSs has been moderately successful in identifying patterns from a family of sequences. In this study, we compare performances of different probabilistic models and try to estimate their efficacy over experimental TFBSs data. We build a pipeline to calculate sensitivity and specificity from aligned TFBS sequences for several probabilistic models, such as Markov chains, hidden Markov models, Bayesian networks. Our work, containing relevant statistics and evaluation for the models, can help researchers to choose the most appropriate model for the problem at hand.

  8. De novo transcriptome sequence assembly and identification of AP2/ERF transcription factor related to abiotic stress in parsley (Petroselinum crispum.

    Directory of Open Access Journals (Sweden)

    Meng-Yao Li

    Full Text Available Parsley is an important biennial Apiaceae species that is widely cultivated as herb, spice, and vegetable. Previous studies on parsley principally focused on its physiological and biochemical properties, including phenolic compound and volatile oil contents. However, little is known about the molecular and genetic properties of parsley. In this study, 23,686,707 high-quality reads were obtained and assembled into 81,852 transcripts and 50,161 unigenes for the first time. Functional annotation showed that 30,516 unigenes had sequence similarity to known genes. In addition, 3,244 putative simple sequence repeats were detected in curly parsley. Finally, 1,569 of the identified unigenes belonged to 58 transcription factor families. Various abiotic stresses have a strong detrimental effect on the yield and quality of parsley. AP2/ERF transcription factors have important functions in plant development, hormonal regulation, and abiotic response. A total of 88 putative AP2/ERF factors were identified from the transcriptome sequence of parsley. Seven AP2/ERF transcription factors were selected in this study to analyze the expression profiles of parsley under different abiotic stresses. Our data provide a potentially valuable resource that can be used for intensive parsley research.

  9. De novo transcriptome sequence assembly and identification of AP2/ERF transcription factor related to abiotic stress in parsley (Petroselinum crispum).

    Science.gov (United States)

    Li, Meng-Yao; Tan, Hua-Wei; Wang, Feng; Jiang, Qian; Xu, Zhi-Sheng; Tian, Chang; Xiong, Ai-Sheng

    2014-01-01

    Parsley is an important biennial Apiaceae species that is widely cultivated as herb, spice, and vegetable. Previous studies on parsley principally focused on its physiological and biochemical properties, including phenolic compound and volatile oil contents. However, little is known about the molecular and genetic properties of parsley. In this study, 23,686,707 high-quality reads were obtained and assembled into 81,852 transcripts and 50,161 unigenes for the first time. Functional annotation showed that 30,516 unigenes had sequence similarity to known genes. In addition, 3,244 putative simple sequence repeats were detected in curly parsley. Finally, 1,569 of the identified unigenes belonged to 58 transcription factor families. Various abiotic stresses have a strong detrimental effect on the yield and quality of parsley. AP2/ERF transcription factors have important functions in plant development, hormonal regulation, and abiotic response. A total of 88 putative AP2/ERF factors were identified from the transcriptome sequence of parsley. Seven AP2/ERF transcription factors were selected in this study to analyze the expression profiles of parsley under different abiotic stresses. Our data provide a potentially valuable resource that can be used for intensive parsley research.

  10. TFpredict and SABINE: sequence-based prediction of structural and functional characteristics of transcription factors.

    Directory of Open Access Journals (Sweden)

    Johannes Eichner

    Full Text Available One of the key mechanisms of transcriptional control are the specific connections between transcription factors (TF and cis-regulatory elements in gene promoters. The elucidation of these specific protein-DNA interactions is crucial to gain insights into the complex regulatory mechanisms and networks underlying the adaptation of organisms to dynamically changing environmental conditions. As experimental techniques for determining TF binding sites are expensive and mostly performed for selected TFs only, accurate computational approaches are needed to analyze transcriptional regulation in eukaryotes on a genome-wide level. We implemented a four-step classification workflow which for a given protein sequence (1 discriminates TFs from other proteins, (2 determines the structural superclass of TFs, (3 identifies the DNA-binding domains of TFs and (4 predicts their cis-acting DNA motif. While existing tools were extended and adapted for performing the latter two prediction steps, the first two steps are based on a novel numeric sequence representation which allows for combining existing knowledge from a BLAST scan with robust machine learning-based classification. By evaluation on a set of experimentally confirmed TFs and non-TFs, we demonstrate that our new protein sequence representation facilitates more reliable identification and structural classification of TFs than previously proposed sequence-derived features. The algorithms underlying our proposed methodology are implemented in the two complementary tools TFpredict and SABINE. The online and stand-alone versions of TFpredict and SABINE are freely available to academics at http://www.cogsys.cs.uni-tuebingen.de/software/TFpredict/ and http://www.cogsys.cs.uni-tuebingen.de/software/SABINE/.

  11. Demonstrating Interactions of Transcription Factors with DNA by Electrophoretic Mobility Shift Assay.

    Science.gov (United States)

    Yousaf, Nasim; Gould, David

    2017-01-01

    Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.

  12. Structural Fingerprints of Transcription Factor Binding Site Regions

    Directory of Open Access Journals (Sweden)

    Peter Willett

    2009-03-01

    Full Text Available Fourier transforms are a powerful tool in the prediction of DNA sequence properties, such as the presence/absence of codons. We have previously compiled a database of the structural properties of all 32,896 unique DNA octamers. In this work we apply Fourier techniques to the analysis of the structural properties of human chromosomes 21 and 22 and also to three sets of transcription factor binding sites within these chromosomes. We find that, for a given structural property, the structural property power spectra of chromosomes 21 and 22 are strikingly similar. We find common peaks in their power spectra for both Sp1 and p53 transcription factor binding sites. We use the power spectra as a structural fingerprint and perform similarity searching in order to find transcription factor binding site regions. This approach provides a new strategy for searching the genome data for information. Although it is difficult to understand the relationship between specific functional properties and the set of structural parameters in our database, our structural fingerprints nevertheless provide a useful tool for searching for function information in sequence data. The power spectrum fingerprints provide a simple, fast method for comparing a set of functional sequences, in this case transcription factor binding site regions, with the sequences of whole chromosomes. On its own, the power spectrum fingerprint does not find all transcription factor binding sites in a chromosome, but the results presented here show that in combination with other approaches, this technique will improve the chances of identifying functional sequences hidden in genomic data.

  13. Thermodynamics-based models of transcriptional regulation with gene sequence.

    Science.gov (United States)

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  14. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  15. Next-Generation Sequencing of Genomic DNA Fragments Bound to a Transcription Factor in Vitro Reveals Its Regulatory Potential

    Directory of Open Access Journals (Sweden)

    Yukio Kurihara

    2014-12-01

    Full Text Available Several transcription factors (TFs coordinate to regulate expression of specific genes at the transcriptional level. In Arabidopsis thaliana it is estimated that approximately 10% of all genes encode TFs or TF-like proteins. It is important to identify target genes that are directly regulated by TFs in order to understand the complete picture of a plant’s transcriptome profile. Here, we investigate the role of the LONG HYPOCOTYL5 (HY5 transcription factor that acts as a regulator of photomorphogenesis. We used an in vitro genomic DNA binding assay coupled with immunoprecipitation and next-generation sequencing (gDB-seq instead of the in vivo chromatin immunoprecipitation (ChIP-based methods. The results demonstrate that the HY5-binding motif predicted here was similar to the motif reported previously and that in vitro HY5-binding loci largely overlapped with the HY5-targeted candidate genes identified in previous ChIP-chip analysis. By combining these results with microarray analysis, we identified hundreds of HY5-binding genes that were differentially expressed in hy5. We also observed delayed induction of some transcripts of HY5-binding genes in hy5 mutants in response to blue-light exposure after dark treatment. Thus, an in vitro gDNA-binding assay coupled with sequencing is a convenient and powerful method to bridge the gap between identifying TF binding potential and establishing function.

  16. A transcription factor active on the epidermal growth factor receptor gene

    International Nuclear Information System (INIS)

    Kageyama, R.; Merlino, G.T.; Pastan, I.

    1988-01-01

    The authors have developed an in vitro transcription system for the epidermal growth factor receptor (EGFR) oncogene by using nuclear extracts of A431 human epidermoid carcinoma cells, which overproduce EGFR. They found that a nuclear factor, termed EGFR-specific transcription factor (ETF), specifically stimulated EGFR transcription by 5- to 10-fold. In this report, ETF, purified by using sequence-specific oligonucleotide affinity chromatography, is shown by renaturing material eluted from a NaDodSO 4 /polyacrylamide gel to be a protein with a molecular mass of 120 kDa. ETF binds to the promoter region, as measured by DNase I footprinting and gel-mobility-shift assays, and specifically stimulates the transcription of the EGFR gene in a reconstituted in vitro transcription system. These results suggest that ETF could play a role in the overexpression of the cellular oncogene EGFR

  17. DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.

    Science.gov (United States)

    Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford

    2017-10-01

    Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  18. Transcription factor IID in the Archaea: sequences in the Thermococcus celer genome would encode a product closely related to the TATA-binding protein of eukaryotes

    Science.gov (United States)

    Marsh, T. L.; Reich, C. I.; Whitelock, R. B.; Olsen, G. J.; Woese, C. R. (Principal Investigator)

    1994-01-01

    The first step in transcription initiation in eukaryotes is mediated by the TATA-binding protein, a subunit of the transcription factor IID complex. We have cloned and sequenced the gene for a presumptive homolog of this eukaryotic protein from Thermococcus celer, a member of the Archaea (formerly archaebacteria). The protein encoded by the archaeal gene is a tandem repeat of a conserved domain, corresponding to the repeated domain in its eukaryotic counterparts. Molecular phylogenetic analyses of the two halves of the repeat are consistent with the duplication occurring before the divergence of the archael and eukaryotic domains. In conjunction with previous observations of similarity in RNA polymerase subunit composition and sequences and the finding of a transcription factor IIB-like sequence in Pyrococcus woesei (a relative of T. celer) it appears that major features of the eukaryotic transcription apparatus were well-established before the origin of eukaryotic cellular organization. The divergence between the two halves of the archael protein is less than that between the halves of the individual eukaryotic sequences, indicating that the average rate of sequence change in the archael protein has been less than in its eukaryotic counterparts. To the extent that this lower rate applies to the genome as a whole, a clearer picture of the early genes (and gene families) that gave rise to present-day genomes is more apt to emerge from the study of sequences from the Archaea than from the corresponding sequences from eukaryotes.

  19. Chromatin immunoprecipitation (ChIP) of plant transcription factors followed by sequencing (ChIP-SEQ) or hybridization to whole genome arrays (ChIP-CHIP)

    NARCIS (Netherlands)

    Kaufmann, K.; Muiño, J.M.; Østerås, M.; Farinelli, L.; Krajewski, P.; Angenent, G.C.

    2010-01-01

    Chromatin immunoprecipitation (ChIP) is a powerful technique to study interactions between transcription factors (TFs) and DNA in vivo. For genome-wide de novo discovery of TF-binding sites, the DNA that is obtained in ChIP experiments needs to be processed for sequence identification. The sequences

  20. In silico detection of sequence variations modifying transcriptional regulation.

    Directory of Open Access Journals (Sweden)

    Malin C Andersen

    2008-01-01

    Full Text Available Identification of functional genetic variation associated with increased susceptibility to complex diseases can elucidate genes and underlying biochemical mechanisms linked to disease onset and progression. For genes linked to genetic diseases, most identified causal mutations alter an encoded protein sequence. Technological advances for measuring RNA abundance suggest that a significant number of undiscovered causal mutations may alter the regulation of gene transcription. However, it remains a challenge to separate causal genetic variations from linked neutral variations. Here we present an in silico driven approach to identify possible genetic variation in regulatory sequences. The approach combines phylogenetic footprinting and transcription factor binding site prediction to identify variation in candidate cis-regulatory elements. The bioinformatics approach has been tested on a set of SNPs that are reported to have a regulatory function, as well as background SNPs. In the absence of additional information about an analyzed gene, the poor specificity of binding site prediction is prohibitive to its application. However, when additional data is available that can give guidance on which transcription factor is involved in the regulation of the gene, the in silico binding site prediction improves the selection of candidate regulatory polymorphisms for further analyses. The bioinformatics software generated for the analysis has been implemented as a Web-based application system entitled RAVEN (regulatory analysis of variation in enhancers. The RAVEN system is available at http://www.cisreg.ca for all researchers interested in the detection and characterization of regulatory sequence variation.

  1. In Silico Detection of Sequence Variations Modifying Transcriptional Regulation

    Science.gov (United States)

    Andersen, Malin C; Engström, Pär G; Lithwick, Stuart; Arenillas, David; Eriksson, Per; Lenhard, Boris; Wasserman, Wyeth W; Odeberg, Jacob

    2008-01-01

    Identification of functional genetic variation associated with increased susceptibility to complex diseases can elucidate genes and underlying biochemical mechanisms linked to disease onset and progression. For genes linked to genetic diseases, most identified causal mutations alter an encoded protein sequence. Technological advances for measuring RNA abundance suggest that a significant number of undiscovered causal mutations may alter the regulation of gene transcription. However, it remains a challenge to separate causal genetic variations from linked neutral variations. Here we present an in silico driven approach to identify possible genetic variation in regulatory sequences. The approach combines phylogenetic footprinting and transcription factor binding site prediction to identify variation in candidate cis-regulatory elements. The bioinformatics approach has been tested on a set of SNPs that are reported to have a regulatory function, as well as background SNPs. In the absence of additional information about an analyzed gene, the poor specificity of binding site prediction is prohibitive to its application. However, when additional data is available that can give guidance on which transcription factor is involved in the regulation of the gene, the in silico binding site prediction improves the selection of candidate regulatory polymorphisms for further analyses. The bioinformatics software generated for the analysis has been implemented as a Web-based application system entitled RAVEN (regulatory analysis of variation in enhancers). The RAVEN system is available at http://www.cisreg.ca for all researchers interested in the detection and characterization of regulatory sequence variation. PMID:18208319

  2. The WRKY transcription factor family in Brachypodium distachyon.

    Science.gov (United States)

    Tripathi, Prateek; Rabara, Roel C; Langum, Tanner J; Boken, Ashley K; Rushton, Deena L; Boomsma, Darius D; Rinerson, Charles I; Rabara, Jennifer; Reese, R Neil; Chen, Xianfeng; Rohila, Jai S; Rushton, Paul J

    2012-06-22

    A complete assembled genome sequence of wheat is not yet available. Therefore, model plant systems for wheat are very valuable. Brachypodium distachyon (Brachypodium) is such a system. The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating important agronomic traits. Studies of WRKY transcription factors in Brachypodium and wheat therefore promise to lead to new strategies for wheat improvement. We have identified and manually curated the WRKY transcription factor family from Brachypodium using a pipeline designed to identify all potential WRKY genes. 86 WRKY transcription factors were found, a total higher than all other current databases. We therefore propose that our numbering system (BdWRKY1-BdWRKY86) becomes the standard nomenclature. In the JGI v1.0 assembly of Brachypodium with the MIPS/JGI v1.0 annotation, nine of the transcription factors have no gene model and eleven gene models are probably incorrectly predicted. In total, twenty WRKY transcription factors (23.3%) do not appear to have accurate gene models. To facilitate use of our data, we have produced The Database of Brachypodium distachyon WRKY Transcription Factors. Each WRKY transcription factor has a gene page that includes predicted protein domains from MEME analyses. These conserved protein domains reflect possible input and output domains in signaling. The database also contains a BLAST search function where a large dataset of WRKY transcription factors, published genes, and an extensive set of wheat ESTs can be searched. We also produced a phylogram containing the WRKY transcription factor families from Brachypodium, rice, Arabidopsis, soybean, and Physcomitrella patens, together with published WRKY transcription factors from wheat. This phylogenetic tree provides evidence for orthologues, co-orthologues, and paralogues of Brachypodium WRKY transcription factors. The description of the WRKY transcription factor

  3. Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes.

    Science.gov (United States)

    Riechmann, J L; Heard, J; Martin, G; Reuber, L; Jiang, C; Keddie, J; Adam, L; Pineda, O; Ratcliffe, O J; Samaha, R R; Creelman, R; Pilgrim, M; Broun, P; Zhang, J Z; Ghandehari, D; Sherman, B K; Yu, G

    2000-12-15

    The completion of the Arabidopsis thaliana genome sequence allows a comparative analysis of transcriptional regulators across the three eukaryotic kingdoms. Arabidopsis dedicates over 5% of its genome to code for more than 1500 transcription factors, about 45% of which are from families specific to plants. Arabidopsis transcription factors that belong to families common to all eukaryotes do not share significant similarity with those of the other kingdoms beyond the conserved DNA binding domains, many of which have been arranged in combinations specific to each lineage. The genome-wide comparison reveals the evolutionary generation of diversity in the regulation of transcription.

  4. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    Science.gov (United States)

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  5. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  6. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  7. Alterations in transcription factor binding in radioresistant human melanoma cells after ionizing radiation

    International Nuclear Information System (INIS)

    Sahijdak, W.M.; Yang, Chin-Rang; Zuckerman, J.S.; Meyers, M.; Boothman, D.A.

    1994-01-01

    We analyzed alterations in transcription factor binding to specific, known promoter DNA consensus sequences between irradiated and unirradiated radioresistant human melanoma (U1-Mel) cells. The goal of this study was to begin to investigate which transcription factors and DNA-binding sites are responsible for the induction of specific transcripts and proteins after ionizing radiation. Transcription factor binding was observed using DNA band-shift assays and oligonucleotide competition analyses. Confluence-arrested U1-Mel cells were irradiated (4.5 Gy) and harvested at 4 h. Double-stranded oligonucleotides containing known DNA-binding consensus sites for specific transcription factors were used. Increased DNA binding activity after ionizing radiation was noted with oligonucleotides containing the CREB, NF-kB and Sp1 consensus sites. No changes in protein binding to AP-1, AP-2, AP-3, or CTF/NF1, GRE or Oct-1 consensus sequences were noted. X-ray activation of select transcription factors, which bind certain consensus sites in promoters, may cause specific induction or repression of gene transcription. 22 refs., 2 figs

  8. Determination of specificity influencing residues for key transcription factor families

    DEFF Research Database (Denmark)

    Patel, Ronak Y.; Garde, Christian; Stormo, Gary D.

    2015-01-01

    Transcription factors (TFs) are major modulators of transcription and subsequent cellular processes. The binding of TFs to specific regulatory elements is governed by their specificity. Considering the gap between known TFs sequence and specificity, specificity prediction frameworks are highly de...

  9. DNA residence time is a regulatory factor of transcription repression

    Science.gov (United States)

    Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette

    2017-01-01

    Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492

  10. The evolution of WRKY transcription factors.

    Science.gov (United States)

    Rinerson, Charles I; Rabara, Roel C; Tripathi, Prateek; Shen, Qingxi J; Rushton, Paul J

    2015-02-27

    The availability of increasing numbers of sequenced genomes has necessitated a re-evaluation of the evolution of the WRKY transcription factor family. Modern day plants descended from a charophyte green alga that colonized the land between 430 and 470 million years ago. The first charophyte genome sequence from Klebsormidium flaccidum filled a gap in the available genome sequences in the plant kingdom between unicellular green algae that typically have 1-3 WRKY genes and mosses that contain 30-40. WRKY genes have been previously found in non-plant species but their occurrence has been difficult to explain. Only two WRKY genes are present in the Klebsormidium flaccidum genome and the presence of a Group IIb gene was unexpected because it had previously been thought that Group IIb WRKY genes first appeared in mosses. We found WRKY transcription factor genes outside of the plant lineage in some diplomonads, social amoebae, fungi incertae sedis, and amoebozoa. This patchy distribution suggests that lateral gene transfer is responsible. These lateral gene transfer events appear to pre-date the formation of the WRKY groups in flowering plants. Flowering plants contain proteins with domains typical for both resistance (R) proteins and WRKY transcription factors. R protein-WRKY genes have evolved numerous times in flowering plants, each type being restricted to specific flowering plant lineages. These chimeric proteins contain not only novel combinations of protein domains but also novel combinations and numbers of WRKY domains. Once formed, R protein WRKY genes may combine different components of signalling pathways that may either create new diversity in signalling or accelerate signalling by short circuiting signalling pathways. We propose that the evolution of WRKY transcription factors includes early lateral gene transfers to non-plant organisms and the occurrence of algal WRKY genes that have no counterparts in flowering plants. We propose two alternative hypotheses

  11. Microarray and cDNA sequence analysis of transcription during nerve-dependent limb regeneration

    Directory of Open Access Journals (Sweden)

    Bryant Susan V

    2009-01-01

    Full Text Available Abstract Background Microarray analysis and 454 cDNA sequencing were used to investigate a centuries-old problem in regenerative biology: the basis of nerve-dependent limb regeneration in salamanders. Innervated (NR and denervated (DL forelimbs of Mexican axolotls were amputated and transcripts were sampled after 0, 5, and 14 days of regeneration. Results Considerable similarity was observed between NR and DL transcriptional programs at 5 and 14 days post amputation (dpa. Genes with extracellular functions that are critical to wound healing were upregulated while muscle-specific genes were downregulated. Thus, many processes that are regulated during early limb regeneration do not depend upon nerve-derived factors. The majority of the transcriptional differences between NR and DL limbs were correlated with blastema formation; cell numbers increased in NR limbs after 5 dpa and this yielded distinct transcriptional signatures of cell proliferation in NR limbs at 14 dpa. These transcriptional signatures were not observed in DL limbs. Instead, gene expression changes within DL limbs suggest more diverse and protracted wound-healing responses. 454 cDNA sequencing complemented the microarray analysis by providing deeper sampling of transcriptional programs and associated biological processes. Assembly of new 454 cDNA sequences with existing expressed sequence tag (EST contigs from the Ambystoma EST database more than doubled (3935 to 9411 the number of non-redundant human-A. mexicanum orthologous sequences. Conclusion Many new candidate gene sequences were discovered for the first time and these will greatly enable future studies of wound healing, epigenetics, genome stability, and nerve-dependent blastema formation and outgrowth using the axolotl model.

  12. The cellular transcription factor CREB corresponds to activating transcription factor 47 (ATF-47) and forms complexes with a group of polypeptides related to ATF-43.

    OpenAIRE

    Hurst, H C; Masson, N; Jones, N C; Lee, K A

    1990-01-01

    Promoter elements containing the sequence motif CGTCA are important for a variety of inducible responses at the transcriptional level. Multiple cellular factors specifically bind to these elements and are encoded by a multigene family. Among these factors, polypeptides termed activating transcription factor 43 (ATF-43) and ATF-47 have been purified from HeLa cells and a factor referred to as cyclic AMP response element-binding protein (CREB) has been isolated from PC12 cells and rat brain. We...

  13. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    Science.gov (United States)

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  14. Cell type-specific termination of transcription by transposable element sequences.

    Science.gov (United States)

    Conley, Andrew B; Jordan, I King

    2012-09-30

    Transposable elements (TEs) encode sequences necessary for their own transposition, including signals required for the termination of transcription. TE sequences within the introns of human genes show an antisense orientation bias, which has been proposed to reflect selection against TE sequences in the sense orientation owing to their ability to terminate the transcription of host gene transcripts. While there is evidence in support of this model for some elements, the extent to which TE sequences actually terminate transcription of human gene across the genome remains an open question. Using high-throughput sequencing data, we have characterized over 9,000 distinct TE-derived sequences that provide transcription termination sites for 5,747 human genes across eight different cell types. Rarefaction curve analysis suggests that there may be twice as many TE-derived termination sites (TE-TTS) genome-wide among all human cell types. The local chromatin environment for these TE-TTS is similar to that seen for 3' UTR canonical TTS and distinct from the chromatin environment of other intragenic TE sequences. However, those TE-TTS located within the introns of human genes were found to be far more cell type-specific than the canonical TTS. TE-TTS were much more likely to be found in the sense orientation than other intragenic TE sequences of the same TE family and TE-TTS in the sense orientation terminate transcription more efficiently than those found in the antisense orientation. Alu sequences were found to provide a large number of relatively weak TTS, whereas LTR elements provided a smaller number of much stronger TTS. TE sequences provide numerous termination sites to human genes, and TE-derived TTS are particularly cell type-specific. Thus, TE sequences provide a powerful mechanism for the diversification of transcriptional profiles between cell types and among evolutionary lineages, since most TE-TTS are evolutionarily young. The extent of transcription

  15. In vitro fluorescence studies of transcription factor IIB-DNA interaction.

    Science.gov (United States)

    Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta

    2015-01-01

    General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.

  16. Transcription factor binding sites prediction based on modified nucleosomes.

    Directory of Open Access Journals (Sweden)

    Mohammad Talebzadeh

    Full Text Available In computational methods, position weight matrices (PWMs are commonly applied for transcription factor binding site (TFBS prediction. Although these matrices are more accurate than simple consensus sequences to predict actual binding sites, they usually produce a large number of false positive (FP predictions and so are impoverished sources of information. Several studies have employed additional sources of information such as sequence conservation or the vicinity to transcription start sites to distinguish true binding regions from random ones. Recently, the spatial distribution of modified nucleosomes has been shown to be associated with different promoter architectures. These aligned patterns can facilitate DNA accessibility for transcription factors. We hypothesize that using data from these aligned and periodic patterns can improve the performance of binding region prediction. In this study, we propose two effective features, "modified nucleosomes neighboring" and "modified nucleosomes occupancy", to decrease FP in binding site discovery. Based on these features, we designed a logistic regression classifier which estimates the probability of a region as a TFBS. Our model learned each feature based on Sp1 binding sites on Chromosome 1 and was tested on the other chromosomes in human CD4+T cells. In this work, we investigated 21 histone modifications and found that only 8 out of 21 marks are strongly correlated with transcription factor binding regions. To prove that these features are not specific to Sp1, we combined the logistic regression classifier with the PWM, and created a new model to search TFBSs on the genome. We tested the model using transcription factors MAZ, PU.1 and ELF1 and compared the results to those using only the PWM. The results show that our model can predict Transcription factor binding regions more successfully. The relative simplicity of the model and capability of integrating other features make it a superior method

  17. WRKY transcription factor superfamily: Structure, origin and functions

    African Journals Online (AJOL)

    terminal ends contain the WRKYGQR amino acid sequence and a zinc-finger motif. WRKY transcription factors can regulate the expression of target genes that contain the W-box elements (C/T)TGAC(C/T) in the promoter regions by specifically ...

  18. Cell type-specific termination of transcription by transposable element sequences

    Directory of Open Access Journals (Sweden)

    Conley Andrew B

    2012-09-01

    Full Text Available Abstract Background Transposable elements (TEs encode sequences necessary for their own transposition, including signals required for the termination of transcription. TE sequences within the introns of human genes show an antisense orientation bias, which has been proposed to reflect selection against TE sequences in the sense orientation owing to their ability to terminate the transcription of host gene transcripts. While there is evidence in support of this model for some elements, the extent to which TE sequences actually terminate transcription of human gene across the genome remains an open question. Results Using high-throughput sequencing data, we have characterized over 9,000 distinct TE-derived sequences that provide transcription termination sites for 5,747 human genes across eight different cell types. Rarefaction curve analysis suggests that there may be twice as many TE-derived termination sites (TE-TTS genome-wide among all human cell types. The local chromatin environment for these TE-TTS is similar to that seen for 3′ UTR canonical TTS and distinct from the chromatin environment of other intragenic TE sequences. However, those TE-TTS located within the introns of human genes were found to be far more cell type-specific than the canonical TTS. TE-TTS were much more likely to be found in the sense orientation than other intragenic TE sequences of the same TE family and TE-TTS in the sense orientation terminate transcription more efficiently than those found in the antisense orientation. Alu sequences were found to provide a large number of relatively weak TTS, whereas LTR elements provided a smaller number of much stronger TTS. Conclusions TE sequences provide numerous termination sites to human genes, and TE-derived TTS are particularly cell type-specific. Thus, TE sequences provide a powerful mechanism for the diversification of transcriptional profiles between cell types and among evolutionary lineages, since most TE-TTS are

  19. Mitochondrial transcription factor A (Tfam) gene sequencing and mitochondrial evaluation in inherited retinal dysplasia in miniature schnauzer dogs.

    Science.gov (United States)

    Bauer, Bianca S; Forsyth, George W; Sandmeyer, Lynne S; Grahn, Bruce H

    2011-04-01

    Mitochondrial transcription factor A (Tfam) has been implicated in the pathogenesis of retinal dysplasia in miniature schnauzer dogs and it has been proposed that affected dogs have altered mitochondrial numbers, size, and morphology. To test these hypotheses the Tfam gene of affected and normal miniature schnauzer dogs with retinal dysplasia was sequenced and lymphocyte mitochondria were quantified, measured, and the morphology was compared in normal and affected dogs using transmission electron microscopy. For Tfam sequencing, retina, retinal pigment epithelium (RPE), and whole blood samples were collected. Total RNA was isolated from the retina and RPE and reverse transcribed to make cDNA. Genomic DNA was extracted from white blood cell pellets obtained from the whole blood samples. The Tfam coding sequence, 5' promoter region, intron1 and the 3' non-coding sequence of normal and affected dogs were amplified using polymerase chain reaction (PCR), cloned and sequenced. For electron microscopy, lymphocytes from affected and normal dogs were photographed and the mitochondria within each cross-section were identified, quantified, and the mitochondrial area (μm²) per lymphocyte cross-section was calculated. Lastly, using a masked technique, mitochondrial morphology was compared between the 2 groups. Sequencing of the miniature schnauzer Tfam gene revealed no functional sequence variation between affected and normal dogs. Lymphocyte and mitochondrial area, mitochondrial quantification, and morphology assessment also revealed no significant difference between the 2 groups. Further investigation into other candidate genes or factors causing retinal dysplasia in the miniature schnauzer is warranted.

  20. Transcription Factor Functional Protein-Protein Interactions in Plant Defense Responses

    Directory of Open Access Journals (Sweden)

    Murilo S. Alves

    2014-03-01

    Full Text Available Responses to biotic stress in plants lead to dramatic reprogramming of gene expression, favoring stress responses at the expense of normal cellular functions. Transcription factors are master regulators of gene expression at the transcriptional level, and controlling the activity of these factors alters the transcriptome of the plant, leading to metabolic and phenotypic changes in response to stress. The functional analysis of interactions between transcription factors and other proteins is very important for elucidating the role of these transcriptional regulators in different signaling cascades. In this review, we present an overview of protein-protein interactions for the six major families of transcription factors involved in plant defense: basic leucine zipper containing domain proteins (bZIP, amino-acid sequence WRKYGQK (WRKY, myelocytomatosis related proteins (MYC, myeloblastosis related proteins (MYB, APETALA2/ ETHYLENE-RESPONSIVE ELEMENT BINDING FACTORS (AP2/EREBP and no apical meristem (NAM, Arabidopsis transcription activation factor (ATAF, and cup-shaped cotyledon (CUC (NAC. We describe the interaction partners of these transcription factors as molecular responses during pathogen attack and the key components of signal transduction pathways that take place during plant defense responses. These interactions determine the activation or repression of response pathways and are crucial to understanding the regulatory networks that modulate plant defense responses.

  1. Protein-protein interactions in the regulation of WRKY transcription factors.

    Science.gov (United States)

    Chi, Yingjun; Yang, Yan; Zhou, Yuan; Zhou, Jie; Fan, Baofang; Yu, Jing-Quan; Chen, Zhixiang

    2013-03-01

    It has been almost 20 years since the first report of a WRKY transcription factor, SPF1, from sweet potato. Great progress has been made since then in establishing the diverse biological roles of WRKY transcription factors in plant growth, development, and responses to biotic and abiotic stress. Despite the functional diversity, almost all analyzed WRKY proteins recognize the TTGACC/T W-box sequences and, therefore, mechanisms other than mere recognition of the core W-box promoter elements are necessary to achieve the regulatory specificity of WRKY transcription factors. Research over the past several years has revealed that WRKY transcription factors physically interact with a wide range of proteins with roles in signaling, transcription, and chromatin remodeling. Studies of WRKY-interacting proteins have provided important insights into the regulation and mode of action of members of the important family of transcription factors. It has also emerged that the slightly varied WRKY domains and other protein motifs conserved within each of the seven WRKY subfamilies participate in protein-protein interactions and mediate complex functional interactions between WRKY proteins and between WRKY and other regulatory proteins in the modulation of important biological processes. In this review, we summarize studies of protein-protein interactions for WRKY transcription factors and discuss how the interacting partners contribute, at different levels, to the establishment of the complex regulatory and functional network of WRKY transcription factors.

  2. Proteopedia: 3D Visualization and Annotation of Transcription Factor-DNA Readout Modes

    Science.gov (United States)

    Dantas Machado, Ana Carolina; Saleebyan, Skyler B.; Holmes, Bailey T.; Karelina, Maria; Tam, Julia; Kim, Sharon Y.; Kim, Keziah H.; Dror, Iris; Hodis, Eran; Martz, Eric; Compeau, Patricia A.; Rohs, Remo

    2012-01-01

    3D visualization assists in identifying diverse mechanisms of protein-DNA recognition that can be observed for transcription factors and other DNA binding proteins. We used Proteopedia to illustrate transcription factor-DNA readout modes with a focus on DNA shape, which can be a function of either nucleotide sequence (Hox proteins) or base pairing…

  3. Transcription Factors Bind Thousands of Active and InactiveRegions in the Drosophila Blastoderm

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Yong; MacArthur, Stewart; Bourgon, Richard; Nix, David; Pollard, Daniel A.; Iyer, Venky N.; Hechmer, Aaron; Simirenko, Lisa; Stapleton, Mark; Luengo Hendriks, Cris L.; Chu, Hou Cheng; Ogawa, Nobuo; Inwood, William; Sementchenko, Victor; Beaton, Amy; Weiszmann, Richard; Celniker, Susan E.; Knowles, David W.; Gingeras, Tom; Speed, Terence P.; Eisen, Michael B.; Biggin, Mark D.

    2008-01-10

    Identifying the genomic regions bound by sequence-specific regulatory factors is central both to deciphering the complex DNA cis-regulatory code that controls transcription in metazoans and to determining the range of genes that shape animal morphogenesis. Here, we use whole-genome tiling arrays to map sequences bound in Drosophila melanogaster embryos by the six maternal and gap transcription factors that initiate anterior-posterior patterning. We find that these sequence-specific DNA binding proteins bind with quantitatively different specificities to highly overlapping sets of several thousand genomic regions in blastoderm embryos. Specific high- and moderate-affinity in vitro recognition sequences for each factor are enriched in bound regions. This enrichment, however, is not sufficient to explain the pattern of binding in vivo and varies in a context-dependent manner, demonstrating that higher-order rules must govern targeting of transcription factors. The more highly bound regions include all of the over forty well-characterized enhancers known to respond to these factors as well as several hundred putative new cis-regulatory modules clustered near developmental regulators and other genes with patterned expression at this stage of embryogenesis. The new targets include most of the microRNAs (miRNAs) transcribed in the blastoderm, as well as all major zygotically transcribed dorsal-ventral patterning genes, whose expression we show to be quantitatively modulated by anterior-posterior factors. In addition to these highly bound regions, there are several thousand regions that are reproducibly bound at lower levels. However, these poorly bound regions are, collectively, far more distant from genes transcribed in the blastoderm than highly bound regions; are preferentially found in protein-coding sequences; and are less conserved than highly bound regions. Together these observations suggest that many of these poorly-bound regions are not involved in early

  4. Transcription blockage by homopurine DNA sequences: role of sequence composition and single-strand breaks

    Science.gov (United States)

    Belotserkovskii, Boris P.; Neil, Alexander J.; Saleh, Syed Shayon; Shin, Jane Hae Soo; Mirkin, Sergei M.; Hanawalt, Philip C.

    2013-01-01

    The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816–12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation. PMID:23275544

  5. Pleiotropy constrains the evolution of protein but not regulatory sequences in a transcription regulatory network influencing complex social behaviours

    Directory of Open Access Journals (Sweden)

    Daria eMolodtsova

    2014-12-01

    Full Text Available It is increasingly apparent that genes and networks that influence complex behaviour are evolutionary conserved, which is paradoxical considering that behaviour is labile over evolutionary timescales. How does adaptive change in behaviour arise if behaviour is controlled by conserved, pleiotropic, and likely evolutionary constrained genes? Pleiotropy and connectedness are known to constrain the general rate of protein evolution, prompting some to suggest that the evolution of complex traits, including behaviour, is fuelled by regulatory sequence evolution. However, we seldom have data on the strength of selection on mutations in coding and regulatory sequences, and this hinders our ability to study how pleiotropy influences coding and regulatory sequence evolution. Here we use population genomics to estimate the strength of selection on coding and regulatory mutations for a transcriptional regulatory network that influences complex behaviour of honey bees. We found that replacement mutations in highly connected transcription factors and target genes experience significantly stronger negative selection relative to weakly connected transcription factors and targets. Adaptively evolving proteins were significantly more likely to reside at the periphery of the regulatory network, while proteins with signs of negative selection were near the core of the network. Interestingly, connectedness and network structure had minimal influence on the strength of selection on putative regulatory sequences for both transcription factors and their targets. Our study indicates that adaptive evolution of complex behaviour can arise because of positive selection on protein-coding mutations in peripheral genes, and on regulatory sequence mutations in both transcription factors and their targets throughout the network.

  6. Using sequence-specific chemical and structural properties of DNA to predict transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Amy L Bauer

    2010-11-01

    Full Text Available An important step in understanding gene regulation is to identify the DNA binding sites recognized by each transcription factor (TF. Conventional approaches to prediction of TF binding sites involve the definition of consensus sequences or position-specific weight matrices and rely on statistical analysis of DNA sequences of known binding sites. Here, we present a method called SiteSleuth in which DNA structure prediction, computational chemistry, and machine learning are applied to develop models for TF binding sites. In this approach, binary classifiers are trained to discriminate between true and false binding sites based on the sequence-specific chemical and structural features of DNA. These features are determined via molecular dynamics calculations in which we consider each base in different local neighborhoods. For each of 54 TFs in Escherichia coli, for which at least five DNA binding sites are documented in RegulonDB, the TF binding sites and portions of the non-coding genome sequence are mapped to feature vectors and used in training. According to cross-validation analysis and a comparison of computational predictions against ChIP-chip data available for the TF Fis, SiteSleuth outperforms three conventional approaches: Match, MATRIX SEARCH, and the method of Berg and von Hippel. SiteSleuth also outperforms QPMEME, a method similar to SiteSleuth in that it involves a learning algorithm. The main advantage of SiteSleuth is a lower false positive rate.

  7. CONREAL web server: identification and visualization of conserved transcription factor binding sites

    NARCIS (Netherlands)

    Berezikov, E.; Guryev, V.; Cuppen, E.

    2005-01-01

    The use of orthologous sequences and phylogenetic footprinting approaches have become popular for the recognition of conserved and potentially functional sequences. Several algorithms have been developed for the identification of conserved transcription factor binding sites (TFBSs), which are

  8. Eukaryotic transcription factors

    DEFF Research Database (Denmark)

    Staby, Lasse; O'Shea, Charlotte; Willemoës, Martin

    2017-01-01

    Gene-specific transcription factors (TFs) are key regulatory components of signaling pathways, controlling, for example, cell growth, development, and stress responses. Their biological functions are determined by their molecular structures, as exemplified by their structured DNA-binding domains...... regions with function-related, short sequence motifs and molecular recognition features with structural propensities. This review focuses on molecular aspects of TFs, which represent paradigms of ID-related features. Through specific examples, we review how the ID-associated flexibility of TFs enables....... It is furthermore emphasized how classic biochemical concepts like allostery, conformational selection, induced fit, and feedback regulation are undergoing a revival with the appreciation of ID. The review also describes the most recent advances based on computational simulations of ID-based interaction mechanisms...

  9. Novel splice mutation in microthalmia-associated transcription factor in Waardenburg Syndrome.

    Science.gov (United States)

    Brenner, Laura; Burke, Kelly; Leduc, Charles A; Guha, Saurav; Guo, Jiancheng; Chung, Wendy K

    2011-01-01

    Waardenburg Syndrome (WS) is a syndromic form of hearing loss associated with mutations in six different genes. We identified a large family with WS that had previously undergone clinical testing, with no reported pathogenic mutation. Using linkage analysis, a region on 3p14.1 with an LOD score of 6.6 was identified. Microthalmia-Associated Transcription Factor, a gene known to cause WS, is located within this region of linkage. Sequencing of Microthalmia-Associated Transcription Factor demonstrated a c.1212 G>A synonymous variant that segregated with the WS in the family and was predicted to cause a novel splicing site that was confirmed with expression analysis of the mRNA. This case illustrates the need to computationally analyze novel synonymous sequence variants for possible effects on splicing to maximize the clinical sensitivity of sequence-based genetic testing.

  10. WRKY transcription factors

    Science.gov (United States)

    Bakshi, Madhunita; Oelmüller, Ralf

    2014-01-01

    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  11. A DNA-binding-site landscape and regulatory network analysis for NAC transcription factors in Arabidopsis thaliana

    DEFF Research Database (Denmark)

    Lindemose, Søren; Jensen, Michael Krogh; de Velde, Jan Van

    2014-01-01

    regulatory networks of 12 NAC transcription factors. Our data offer specific single-base resolution fingerprints for most TFs studied and indicate that NAC DNA-binding specificities might be predicted from their DNA-binding domain's sequence. The developed methodology, including the application......Target gene identification for transcription factors is a prerequisite for the systems wide understanding of organismal behaviour. NAM-ATAF1/2-CUC2 (NAC) transcription factors are amongst the largest transcription factor families in plants, yet limited data exist from unbiased approaches to resolve...... the DNA-binding preferences of individual members. Here, we present a TF-target gene identification workflow based on the integration of novel protein binding microarray data with gene expression and multi-species promoter sequence conservation to identify the DNA-binding specificities and the gene...

  12. Analysis of functional redundancies within the Arabidopsis TCP transcription factor family

    NARCIS (Netherlands)

    Danisman, S.; Dijk, van A.D.J.; Bimbo, A.; Wal, van der F.; Hennig, L.; Folter, de S.; Angenent, G.C.; Immink, R.G.H.

    2013-01-01

    Analyses of the functions of TEOSINTE-LIKE1, CYCLOIDEA, and ROLIFERATING CELL FACTOR1 (TCP) transcription factors have been hampered by functional redundancy between its individual members. In general, putative functionally redundant genes are predicted based on sequence similarity and confirmed by

  13. Development of DNA affinity techniques for the functional characterization of purified RNA polymerase II transcription factors

    International Nuclear Information System (INIS)

    Garfinkel, S.; Thompson, J.A.; Cohen, R.B.; Brendler, T.; Safer, B.

    1987-01-01

    Affinity adsorption, precipitation, and partitioning techniques have been developed to purify and characterize RNA Pol II transcription components from whole cell extracts (WCE) (HeLa) and nuclear extracts (K562). The titration of these extracts with multicopy constructs of the Ad2 MLP but not pUC8, inhibits transcriptional activity. DNA-binding factors precipitated by this technique are greatly enriched by centrifugation. Using this approach, factors binding to the upstream promoter sequence (UPS) of the Ad2 MLP have been rapidly isolated by Mono Q, Mono S, and DNA affinity chromatography. By U.V. crosslinking to nucleotides containing specific 32 P-phosphodiester bonds within the recognition sequence, this factor is identified as a M/sub r/ = 45,000 polypeptide. To generate an assay system for the functional evaluation of single transcription components, a similar approach using synthetic oligonucleotide sequences spanning single promoter binding sites has been developed. The addition of a synthetic 63-mer containing the UPS element of the Ad2 MLP to HeLa WCE inhibited transcription by 60%. The addition of partially purified UPS binding protein, but not RNA Pol II, restored transcriptional activity. The addition of synthetic oligonucleotides containing other regulatory sequences not present in the Ad2 MLP was without effect

  14. Low nucleosome occupancy is encoded around functional human transcription factor binding sites

    Directory of Open Access Journals (Sweden)

    Daenen Floris

    2008-07-01

    Full Text Available Abstract Background Transcriptional regulation of genes in eukaryotes is achieved by the interactions of multiple transcription factors with arrays of transcription factor binding sites (TFBSs on DNA and with each other. Identification of these TFBSs is an essential step in our understanding of gene regulatory networks, but computational prediction of TFBSs with either consensus or commonly used stochastic models such as Position-Specific Scoring Matrices (PSSMs results in an unacceptably high number of hits consisting of a few true functional binding sites and numerous false non-functional binding sites. This is due to the inability of the models to incorporate higher order properties of sequences including sequences surrounding TFBSs and influencing the positioning of nucleosomes and/or the interactions that might occur between transcription factors. Results Significant improvement can be expected through the development of a new framework for the modeling and prediction of TFBSs that considers explicitly these higher order sequence properties. It would be particularly interesting to include in the new modeling framework the information present in the nucleosome positioning sequences (NPSs surrounding TFBSs, as it can be hypothesized that genomes use this information to encode the formation of stable nucleosomes over non-functional sites, while functional sites have a more open chromatin configuration. In this report we evaluate the usefulness of the latter feature by comparing the nucleosome occupancy probabilities around experimentally verified human TFBSs with the nucleosome occupancy probabilities around false positive TFBSs and in random sequences. Conclusion We present evidence that nucleosome occupancy is remarkably lower around true functional human TFBSs as compared to non-functional human TFBSs, which supports the use of this feature to improve current TFBS prediction approaches in higher eukaryotes.

  15. The transcription fidelity factor GreA impedes DNA break repair.

    Science.gov (United States)

    Sivaramakrishnan, Priya; Sepúlveda, Leonardo A; Halliday, Jennifer A; Liu, Jingjing; Núñez, María Angélica Bravo; Golding, Ido; Rosenberg, Susan M; Herman, Christophe

    2017-10-12

    Homologous recombination repairs DNA double-strand breaks and must function even on actively transcribed DNA. Because break repair prevents chromosome loss, the completion of repair is expected to outweigh the transcription of broken templates. However, the interplay between DNA break repair and transcription processivity is unclear. Here we show that the transcription factor GreA inhibits break repair in Escherichia coli. GreA restarts backtracked RNA polymerase and hence promotes transcription fidelity. We report that removal of GreA results in markedly enhanced break repair via the classic RecBCD-RecA pathway. Using a deep-sequencing method to measure chromosomal exonucleolytic degradation, we demonstrate that the absence of GreA limits RecBCD-mediated resection. Our findings suggest that increased RNA polymerase backtracking promotes break repair by instigating RecA loading by RecBCD, without the influence of canonical Chi signals. The idea that backtracked RNA polymerase can stimulate recombination presents a DNA transaction conundrum: a transcription fidelity factor that compromises genomic integrity.

  16. Prediction of nucleosome positioning based on transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Xianfu Yi

    Full Text Available BACKGROUND: The DNA of all eukaryotic organisms is packaged into nucleosomes, the basic repeating units of chromatin. The nucleosome consists of a histone octamer around which a DNA core is wrapped and the linker histone H1, which is associated with linker DNA. By altering the accessibility of DNA sequences, the nucleosome has profound effects on all DNA-dependent processes. Understanding the factors that influence nucleosome positioning is of great importance for the study of genomic control mechanisms. Transcription factors (TFs have been suggested to play a role in nucleosome positioning in vivo. PRINCIPAL FINDINGS: Here, the minimum redundancy maximum relevance (mRMR feature selection algorithm, the nearest neighbor algorithm (NNA, and the incremental feature selection (IFS method were used to identify the most important TFs that either favor or inhibit nucleosome positioning by analyzing the numbers of transcription factor binding sites (TFBSs in 53,021 nucleosomal DNA sequences and 50,299 linker DNA sequences. A total of nine important families of TFs were extracted from 35 families, and the overall prediction accuracy was 87.4% as evaluated by the jackknife cross-validation test. CONCLUSIONS: Our results are consistent with the notion that TFs are more likely to bind linker DNA sequences than the sequences in the nucleosomes. In addition, our results imply that there may be some TFs that are important for nucleosome positioning but that play an insignificant role in discriminating nucleosome-forming DNA sequences from nucleosome-inhibiting DNA sequences. The hypothesis that TFs play a role in nucleosome positioning is, thus, confirmed by the results of this study.

  17. Nucleocytoplasmic shuttling of transcription factors

    DEFF Research Database (Denmark)

    Cartwright, P; Helin, K

    2000-01-01

    To elicit the transcriptional response following intra- or extracellular stimuli, the signals need to be transmitted to their site of action within the nucleus. The nucleocytoplasmic shuttling of transcription factors is a mechanism mediating this process. The activation and inactivation...... of the transcriptional response is essential for cells to progress through the cell cycle in a normal manner. The involvement of cytoplasmic and nuclear accessory molecules, and the general nuclear membrane transport components, are essential for this process. Although nuclear import and export for different...... transcription factor families are regulated by similar mechanisms, there are several differences that allow for the specific activation of each transcription factor. This review discusses the general import and export pathways found to be common amongst many different transcription factors, and highlights...

  18. Transcriptional regulation by competing transcription factor modules.

    Directory of Open Access Journals (Sweden)

    Rutger Hermsen

    2006-12-01

    Full Text Available Gene regulatory networks lie at the heart of cellular computation. In these networks, intracellular and extracellular signals are integrated by transcription factors, which control the expression of transcription units by binding to cis-regulatory regions on the DNA. The designs of both eukaryotic and prokaryotic cis-regulatory regions are usually highly complex. They frequently consist of both repetitive and overlapping transcription factor binding sites. To unravel the design principles of these promoter architectures, we have designed in silico prokaryotic transcriptional logic gates with predefined input-output relations using an evolutionary algorithm. The resulting cis-regulatory designs are often composed of modules that consist of tandem arrays of binding sites to which the transcription factors bind cooperatively. Moreover, these modules often overlap with each other, leading to competition between them. Our analysis thus identifies a new signal integration motif that is based upon the interplay between intramodular cooperativity and intermodular competition. We show that this signal integration mechanism drastically enhances the capacity of cis-regulatory domains to integrate signals. Our results provide a possible explanation for the complexity of promoter architectures and could be used for the rational design of synthetic gene circuits.

  19. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    International Nuclear Information System (INIS)

    Ghazal, P.; Lubon, H.; Hennighausen, L.

    1988-01-01

    Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene

  20. Adaptive evolution of transcription factor binding sites

    Directory of Open Access Journals (Sweden)

    Berg Johannes

    2004-10-01

    Full Text Available Abstract Background The regulation of a gene depends on the binding of transcription factors to specific sites located in the regulatory region of the gene. The generation of these binding sites and of cooperativity between them are essential building blocks in the evolution of complex regulatory networks. We study a theoretical model for the sequence evolution of binding sites by point mutations. The approach is based on biophysical models for the binding of transcription factors to DNA. Hence we derive empirically grounded fitness landscapes, which enter a population genetics model including mutations, genetic drift, and selection. Results We show that the selection for factor binding generically leads to specific correlations between nucleotide frequencies at different positions of a binding site. We demonstrate the possibility of rapid adaptive evolution generating a new binding site for a given transcription factor by point mutations. The evolutionary time required is estimated in terms of the neutral (background mutation rate, the selection coefficient, and the effective population size. Conclusions The efficiency of binding site formation is seen to depend on two joint conditions: the binding site motif must be short enough and the promoter region must be long enough. These constraints on promoter architecture are indeed seen in eukaryotic systems. Furthermore, we analyse the adaptive evolution of genetic switches and of signal integration through binding cooperativity between different sites. Experimental tests of this picture involving the statistics of polymorphisms and phylogenies of sites are discussed.

  1. Conifer R2R3-MYB transcription factors: sequence analyses and gene expression in wood-forming tissues of white spruce (Picea glauca

    Directory of Open Access Journals (Sweden)

    Grima-Pettenati Jacqueline

    2007-03-01

    Full Text Available Abstract Background Several members of the R2R3-MYB family of transcription factors act as regulators of lignin and phenylpropanoid metabolism during wood formation in angiosperm and gymnosperm plants. The angiosperm Arabidopsis has over one hundred R2R3-MYBs genes; however, only a few members of this family have been discovered in gymnosperms. Results We isolated and characterised full-length cDNAs encoding R2R3-MYB genes from the gymnosperms white spruce, Picea glauca (13 sequences, and loblolly pine, Pinus taeda L. (five sequences. Sequence similarities and phylogenetic analyses placed the spruce and pine sequences in diverse subgroups of the large R2R3-MYB family, although several of the sequences clustered closely together. We searched the highly variable C-terminal region of diverse plant MYBs for conserved amino acid sequences and identified 20 motifs in the spruce MYBs, nine of which have not previously been reported and three of which are specific to conifers. The number and length of the introns in spruce MYB genes varied significantly, but their positions were well conserved relative to angiosperm MYB genes. Quantitative RTPCR of MYB genes transcript abundance in root and stem tissues revealed diverse expression patterns; three MYB genes were preferentially expressed in secondary xylem, whereas others were preferentially expressed in phloem or were ubiquitous. The MYB genes expressed in xylem, and three others, were up-regulated in the compression wood of leaning trees within 76 hours of induction. Conclusion Our survey of 18 conifer R2R3-MYB genes clearly showed a gene family structure similar to that of Arabidopsis. Three of the sequences are likely to play a role in lignin metabolism and/or wood formation in gymnosperm trees, including a close homolog of the loblolly pine PtMYB4, shown to regulate lignin biosynthesis in transgenic tobacco.

  2. Triple helix-forming oligonucleotide corresponding to the polypyrimidine sequence in the rat alpha 1(I) collagen promoter specifically inhibits factor binding and transcription.

    Science.gov (United States)

    Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V

    1996-01-19

    Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.

  3. A deeper look into transcription regulatory code by preferred pair distance templates for transcription factor binding sites

    KAUST Repository

    Kulakovskiy, Ivan V.

    2011-08-18

    Motivation: Modern experimental methods provide substantial information on protein-DNA recognition. Studying arrangements of transcription factor binding sites (TFBSs) of interacting transcription factors (TFs) advances understanding of the transcription regulatory code. Results: We constructed binding motifs for TFs forming a complex with HIF-1α at the erythropoietin 3\\'-enhancer. Corresponding TFBSs were predicted in the segments around transcription start sites (TSSs) of all human genes. Using the genome-wide set of regulatory regions, we observed several strongly preferred distances between hypoxia-responsive element (HRE) and binding sites of a particular cofactor protein. The set of preferred distances was called as a preferred pair distance template (PPDT). PPDT dramatically depended on the TF and orientation of its binding sites relative to HRE. PPDT evaluated from the genome-wide set of regulatory sequences was used to detect significant PPDT-consistent binding site pairs in regulatory regions of hypoxia-responsive genes. We believe PPDT can help to reveal the layout of eukaryotic regulatory segments. © The Author 2011. Published by Oxford University Press. All rights reserved.

  4. The Journey of a Transcription Factor

    DEFF Research Database (Denmark)

    Pireyre, Marie

    Plants have developed astonishing networks regulating their metabolism to adapt to their environment. The complexity of these networks is illustrated by the expansion of families of regulators such as transcription factors in the plant kingdom. Transcription factors specifically impact...... transcriptional networks by integrating exogenous and endogenous stimuli and regulating gene expression accordingly. Regulation of transcription factors and their activation is thus highly important to modulate the transcriptional programs and increase fitness of the plant in a given environment. Plant metabolism....... The biosynthetic machinery of GLS is governed by interplay of six MYB and three bHLH transcription factors. MYB28, MYB29 and MYB76 regulate methionine-derived GLS, and MYB51, MYB34 and MYB122 regulate tryptophan-derived GLS. The three bHLH transcription factors MYC2, MYC3 and MYC4 physically interact with all six...

  5. Transcription factor trapping by RNA in gene regulatory elements.

    Science.gov (United States)

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  6. G =  MAT: linking transcription factor expression and DNA binding data.

    Science.gov (United States)

    Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak

    2011-01-31

    Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/.

  7. G = MAT: Linking Transcription Factor Expression and DNA Binding Data

    Science.gov (United States)

    Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak

    2011-01-01

    Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/. PMID:21297945

  8. Genome-wide profiling of H3K56 acetylation and transcription factor binding sites in human adipocytes.

    Directory of Open Access Journals (Sweden)

    Kinyui Alice Lo

    Full Text Available The growing epidemic of obesity and metabolic diseases calls for a better understanding of adipocyte biology. The regulation of transcription in adipocytes is particularly important, as it is a target for several therapeutic approaches. Transcriptional outcomes are influenced by both histone modifications and transcription factor binding. Although the epigenetic states and binding sites of several important transcription factors have been profiled in the mouse 3T3-L1 cell line, such data are lacking in human adipocytes. In this study, we identified H3K56 acetylation sites in human adipocytes derived from mesenchymal stem cells. H3K56 is acetylated by CBP and p300, and deacetylated by SIRT1, all are proteins with important roles in diabetes and insulin signaling. We found that while almost half of the genome shows signs of H3K56 acetylation, the highest level of H3K56 acetylation is associated with transcription factors and proteins in the adipokine signaling and Type II Diabetes pathways. In order to discover the transcription factors that recruit acetyltransferases and deacetylases to sites of H3K56 acetylation, we analyzed DNA sequences near H3K56 acetylated regions and found that the E2F recognition sequence was enriched. Using chromatin immunoprecipitation followed by high-throughput sequencing, we confirmed that genes bound by E2F4, as well as those by HSF-1 and C/EBPα, have higher than expected levels of H3K56 acetylation, and that the transcription factor binding sites and acetylation sites are often adjacent but rarely overlap. We also discovered a significant difference between bound targets of C/EBPα in 3T3-L1 and human adipocytes, highlighting the need to construct species-specific epigenetic and transcription factor binding site maps. This is the first genome-wide profile of H3K56 acetylation, E2F4, C/EBPα and HSF-1 binding in human adipocytes, and will serve as an important resource for better understanding adipocyte

  9. Simplified Method for Predicting a Functional Class of Proteins in Transcription Factor Complexes

    KAUST Repository

    Piatek, Marek J.

    2013-07-12

    Background:Initiation of transcription is essential for most of the cellular responses to environmental conditions and for cell and tissue specificity. This process is regulated through numerous proteins, their ligands and mutual interactions, as well as interactions with DNA. The key such regulatory proteins are transcription factors (TFs) and transcription co-factors (TcoFs). TcoFs are important since they modulate the transcription initiation process through interaction with TFs. In eukaryotes, transcription requires that TFs form different protein complexes with various nuclear proteins. To better understand transcription regulation, it is important to know the functional class of proteins interacting with TFs during transcription initiation. Such information is not fully available, since not all proteins that act as TFs or TcoFs are yet annotated as such, due to generally partial functional annotation of proteins. In this study we have developed a method to predict, using only sequence composition of the interacting proteins, the functional class of human TF binding partners to be (i) TF, (ii) TcoF, or (iii) other nuclear protein. This allows for complementing the annotation of the currently known pool of nuclear proteins. Since only the knowledge of protein sequences is required in addition to protein interaction, the method should be easily applicable to many species.Results:Based on experimentally validated interactions between human TFs with different TFs, TcoFs and other nuclear proteins, our two classification systems (implemented as a web-based application) achieve high accuracies in distinguishing TFs and TcoFs from other nuclear proteins, and TFs from TcoFs respectively.Conclusion:As demonstrated, given the fact that two proteins are capable of forming direct physical interactions and using only information about their sequence composition, we have developed a completely new method for predicting a functional class of TF interacting protein partners

  10. Sequence2Vec: A novel embedding approach for modeling transcription factor binding affinity landscape

    KAUST Repository

    Dai, Hanjun; Umarov, Ramzan; Kuwahara, Hiroyuki; Li, Yu; Song, Le; Gao, Xin

    2017-01-01

    Motivation: An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have

  11. Transcriptional Slippage and RNA Editing Increase the Diversity of Transcripts in Chloroplasts: Insight from Deep Sequencing of Vigna radiata Genome and Transcriptome.

    Directory of Open Access Journals (Sweden)

    Ching-Ping Lin

    Full Text Available We performed deep sequencing of the nuclear and organellar genomes of three mungbean genotypes: Vigna radiata ssp. sublobata TC1966, V. radiata var. radiata NM92 and the recombinant inbred line RIL59 derived from a cross between TC1966 and NM92. Moreover, we performed deep sequencing of the RIL59 transcriptome to investigate transcript variability. The mungbean chloroplast genome has a quadripartite structure including a pair of inverted repeats separated by two single copy regions. A total of 213 simple sequence repeats were identified in the chloroplast genomes of NM92 and RIL59; 78 single nucleotide variants and nine indels were discovered in comparing the chloroplast genomes of TC1966 and NM92. Analysis of the mungbean chloroplast transcriptome revealed mRNAs that were affected by transcriptional slippage and RNA editing. Transcriptional slippage frequency was positively correlated with the length of simple sequence repeats of the mungbean chloroplast genome (R2=0.9911. In total, 41 C-to-U editing sites were found in 23 chloroplast genes and in one intergenic spacer. No editing site that swapped U to C was found. A combination of bioinformatics and experimental methods revealed that the plastid-encoded RNA polymerase-transcribed genes psbF and ndhA are affected by transcriptional slippage in mungbean and in main lineages of land plants, including three dicots (Glycine max, Brassica rapa, and Nicotiana tabacum, two monocots (Oryza sativa and Zea mays, two gymnosperms (Pinus taeda and Ginkgo biloba and one moss (Physcomitrella patens. Transcript analysis of the rps2 gene showed that transcriptional slippage could affect transcripts at single sequence repeat regions with poly-A runs. It showed that transcriptional slippage together with incomplete RNA editing may cause sequence diversity of transcripts in chloroplasts of land plants.

  12. Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.

    Science.gov (United States)

    Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F

    2014-10-17

    The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.

  13. Transcriptional blockages in a cell-free system by sequence-selective DNA alkylating agents.

    Science.gov (United States)

    Ferguson, L R; Liu, A P; Denny, W A; Cullinane, C; Talarico, T; Phillips, D R

    2000-04-14

    There is considerable interest in DNA sequence-selective DNA-binding drugs as potential inhibitors of gene expression. Five compounds with distinctly different base pair specificities were compared in their effects on the formation and elongation of the transcription complex from the lac UV5 promoter in a cell-free system. All were tested at drug levels which killed 90% of cells in a clonogenic survival assay. Cisplatin, a selective alkylator at purine residues, inhibited transcription, decreasing the full-length transcript, and causing blockage at a number of GG or AG sequences, making it probable that intrastrand crosslinks are the blocking lesions. A cyclopropylindoline known to be an A-specific alkylator also inhibited transcription, with blocks at adenines. The aniline mustard chlorambucil, that targets primarily G but also A sequences, was also effective in blocking the formation of full-length transcripts. It produced transcription blocks either at, or one base prior to, AA or GG sequences, suggesting that intrastrand crosslinks could again be involved. The non-alkylating DNA minor groove binder Hoechst 33342 (a bisbenzimidazole) blocked formation of the full-length transcript, but without creating specific blockage sites. A bisbenzimidazole-linked aniline mustard analogue was a more effective transcription inhibitor than either chlorambucil or Hoechst 33342, with different blockage sites occurring immediately as compared with 2 h after incubation. The blockages were either immediately prior to AA or GG residues, or four to five base pairs prior to such sites, a pattern not predicted from in vitro DNA-binding studies. Minor groove DNA-binding ligands are of particular interest as inhibitors of gene expression, since they have the potential ability to bind selectively to long sequences of DNA. The results suggest that the bisbenzimidazole-linked mustard does cause alkylation and transcription blockage at novel DNA sites. in addition to sites characteristic of

  14. G =  MAT: linking transcription factor expression and DNA binding data.

    Directory of Open Access Journals (Sweden)

    Konstantin Tretyakov

    Full Text Available Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/.

  15. Genome wide analysis of stress responsive WRKY transcription factors in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Shaiq Sultan

    2016-04-01

    Full Text Available WRKY transcription factors are a class of DNA-binding proteins that bind with a specific sequence C/TTGACT/C known as W-Box found in promoters of genes which are regulated by these WRKYs. From previous studies, 43 different stress responsive WRKY transcription factors in Arabidopsis thaliana, identified and then categorized in three groups viz., abiotic, biotic and both of these stresses. A comprehensive genome wide analysis including chromosomal localization, gene structure analysis, multiple sequence alignment, phylogenetic analysis and promoter analysis of these WRKY genes was carried out in this study to determine the functional homology in Arabidopsis. This analysis led to the classification of these WRKY family members into 3 major groups and subgroups and showed evolutionary relationship among these groups on the base of their functional WRKY domain, chromosomal localization and intron/exon structure. The proposed groups of these stress responsive WRKY genes and annotation based on their position on chromosomes can also be explored to determine their functional homology in other plant species in relation to different stresses. The result of the present study provides indispensable genomic information for the stress responsive WRKY transcription factors in Arabidopsis and will pave the way to explain the precise role of various AtWRKYs in plant growth and development under stressed conditions.

  16. Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells

    International Nuclear Information System (INIS)

    Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada

    1988-01-01

    HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription

  17. HOCOMOCO: expansion and enhancement of the collection of transcription factor binding sites models

    KAUST Repository

    Kulakovskiy, Ivan V.

    2015-11-19

    Models of transcription factor (TF) binding sites provide a basis for a wide spectrum of studies in regulatory genomics, from reconstruction of regulatory networks to functional annotation of transcripts and sequence variants. While TFs may recognize different sequence patterns in different conditions, it is pragmatic to have a single generic model for each particular TF as a baseline for practical applications. Here we present the expanded and enhanced version of HOCOMOCO (http://hocomoco.autosome.ru and http://www.cbrc.kaust.edu.sa/hocomoco10), the collection of models of DNA patterns, recognized by transcription factors. HOCOMOCO now provides position weight matrix (PWM) models for binding sites of 601 human TFs and, in addition, PWMs for 396 mouse TFs. Furthermore, we introduce the largest up to date collection of dinucleotide PWM models for 86 (52) human (mouse) TFs. The update is based on the analysis of massive ChIP-Seq and HT-SELEX datasets, with the validation of the resulting models on in vivo data. To facilitate a practical application, all HOCOMOCO models are linked to gene and protein databases (Entrez Gene, HGNC, UniProt) and accompanied by precomputed score thresholds. Finally, we provide command-line tools for PWM and diPWM threshold estimation and motif finding in nucleotide sequences.

  18. Determining physical constraints in transcriptional initiationcomplexes using DNA sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Shultzaberger, Ryan K.; Chiang, Derek Y.; Moses, Alan M.; Eisen,Michael B.

    2007-07-01

    Eukaryotic gene expression is often under the control ofcooperatively acting transcription factors whose binding is limited bystructural constraints. By determining these structural constraints, wecan understand the "rules" that define functional cooperativity.Conversely, by understanding the rules of binding, we can inferstructural characteristics. We have developed an information theory basedmethod for approximating the physical limitations of cooperativeinteractions by comparing sequence analysis to microarray expressiondata. When applied to the coordinated binding of the sulfur amino acidregulatory protein Met4 by Cbf1 and Met31, we were able to create acombinatorial model that can correctly identify Met4 regulatedgenes.

  19. Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

    Science.gov (United States)

    Kageyama, R; Merlino, G T; Pastan, I

    1989-09-15

    Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

  20. The WRKY Transcription Factor Genes in Lotus japonicus

    OpenAIRE

    Song, Hui; Wang, Pengfei; Nan, Zhibiao; Wang, Xingjun

    2014-01-01

    WRKY transcription factor genes play critical roles in plant growth and development, as well as stress responses. WRKY genes have been examined in various higher plants, but they have not been characterized in Lotus japonicus. The recent release of the L. japonicus whole genome sequence provides an opportunity for a genome wide analysis of WRKY genes in this species. In this study, we identified 61 WRKY genes in the L. japonicus genome. Based on the WRKY protein structure, L. japonicus WRKY (...

  1. Directing traffic on DNA-How transcription factors relieve or induce transcriptional interference.

    Science.gov (United States)

    Hao, Nan; Palmer, Adam C; Dodd, Ian B; Shearwin, Keith E

    2017-03-15

    Transcriptional interference (TI) is increasingly recognized as a widespread mechanism of gene control, particularly given the pervasive nature of transcription, both sense and antisense, across all kingdoms of life. Here, we discuss how transcription factor binding kinetics strongly influence the ability of a transcription factor to relieve or induce TI.

  2. TcoF-DB: dragon database for human transcription co-factors and transcription factor interacting proteins

    KAUST Repository

    Schaefer, Ulf; Schmeier, Sebastian; Bajic, Vladimir B.

    2010-01-01

    The initiation and regulation of transcription in eukaryotes is complex and involves a large number of transcription factors (TFs), which are known to bind to the regulatory regions of eukaryotic DNA. Apart from TF-DNA binding, protein-protein interaction involving TFs is an essential component of the machinery facilitating transcriptional regulation. Proteins that interact with TFs in the context of transcription regulation but do not bind to the DNA themselves, we consider transcription co-factors (TcoFs). The influence of TcoFs on transcriptional regulation and initiation, although indirect, has been shown to be significant with the functionality of TFs strongly influenced by the presence of TcoFs. While the role of TFs and their interaction with regulatory DNA regions has been well-studied, the association between TFs and TcoFs has so far been given less attention. Here, we present a resource that is comprised of a collection of human TFs and the TcoFs with which they interact. Other proteins that have a proven interaction with a TF, but are not considered TcoFs are also included. Our database contains 157 high-confidence TcoFs and additionally 379 hypothetical TcoFs. These have been identified and classified according to the type of available evidence for their involvement in transcriptional regulation and their presence in the cell nucleus. We have divided TcoFs into four groups, one of which contains high-confidence TcoFs and three others contain TcoFs which are hypothetical to different extents. We have developed the Dragon Database for Human Transcription Co-Factors and Transcription Factor Interacting Proteins (TcoF-DB). A web-based interface for this resource can be freely accessed at http://cbrc.kaust.edu.sa/tcof/ and http://apps.sanbi.ac.za/tcof/. © The Author(s) 2010.

  3. TcoF-DB: dragon database for human transcription co-factors and transcription factor interacting proteins

    KAUST Repository

    Schaefer, Ulf

    2010-10-21

    The initiation and regulation of transcription in eukaryotes is complex and involves a large number of transcription factors (TFs), which are known to bind to the regulatory regions of eukaryotic DNA. Apart from TF-DNA binding, protein-protein interaction involving TFs is an essential component of the machinery facilitating transcriptional regulation. Proteins that interact with TFs in the context of transcription regulation but do not bind to the DNA themselves, we consider transcription co-factors (TcoFs). The influence of TcoFs on transcriptional regulation and initiation, although indirect, has been shown to be significant with the functionality of TFs strongly influenced by the presence of TcoFs. While the role of TFs and their interaction with regulatory DNA regions has been well-studied, the association between TFs and TcoFs has so far been given less attention. Here, we present a resource that is comprised of a collection of human TFs and the TcoFs with which they interact. Other proteins that have a proven interaction with a TF, but are not considered TcoFs are also included. Our database contains 157 high-confidence TcoFs and additionally 379 hypothetical TcoFs. These have been identified and classified according to the type of available evidence for their involvement in transcriptional regulation and their presence in the cell nucleus. We have divided TcoFs into four groups, one of which contains high-confidence TcoFs and three others contain TcoFs which are hypothetical to different extents. We have developed the Dragon Database for Human Transcription Co-Factors and Transcription Factor Interacting Proteins (TcoF-DB). A web-based interface for this resource can be freely accessed at http://cbrc.kaust.edu.sa/tcof/ and http://apps.sanbi.ac.za/tcof/. © The Author(s) 2010.

  4. The chemical structure of DNA sequence signals for RNA transcription

    Science.gov (United States)

    George, D. G.; Dayhoff, M. O.

    1982-01-01

    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  5. A single, specific thymine mutation in the ComK-Binding site severely decreases binding and transcription activation by the competence transcription factor ComK of Bacillus subtilis

    NARCIS (Netherlands)

    Susanna, Kim A.; Mironczuk, Aleksandra M.; Smits, Wiep Klaas; Hamoen, Leendert W.; Kuipers, Oscar P.

    The competence transcription factor ComK plays a central role in competence development in Bacillus subtilis by activating the transcription of the K regulon. ComK-activated genes are characterized by the presence of a specific sequence to which ComK binds, a K-box, in their upstream DNA region.

  6. Reconstruction of the core and extended regulons of global transcription factors.

    Directory of Open Access Journals (Sweden)

    Yann S Dufour

    2010-07-01

    Full Text Available The processes underlying the evolution of regulatory networks are unclear. To address this question, we used a comparative genomics approach that takes advantage of the large number of sequenced bacterial genomes to predict conserved and variable members of transcriptional regulatory networks across phylogenetically related organisms. Specifically, we developed a computational method to predict the conserved regulons of transcription factors across alpha-proteobacteria. We focused on the CRP/FNR super-family of transcription factors because it contains several well-characterized members, such as FNR, FixK, and DNR. While FNR, FixK, and DNR are each proposed to regulate different aspects of anaerobic metabolism, they are predicted to recognize very similar DNA target sequences, and they occur in various combinations among individual alpha-proteobacterial species. In this study, the composition of the respective FNR, FixK, or DNR conserved regulons across 87 alpha-proteobacterial species was predicted by comparing the phylogenetic profiles of the regulators with the profiles of putative target genes. The utility of our predictions was evaluated by experimentally characterizing the FnrL regulon (a FNR-type regulator in the alpha-proteobacterium Rhodobacter sphaeroides. Our results show that this approach correctly predicted many regulon members, provided new insights into the biological functions of the respective regulons for these regulators, and suggested models for the evolution of the corresponding transcriptional networks. Our findings also predict that, at least for the FNR-type regulators, there is a core set of target genes conserved across many species. In addition, the members of the so-called extended regulons for the FNR-type regulators vary even among closely related species, possibly reflecting species-specific adaptation to environmental and other factors. The comparative genomics approach we developed is readily applicable to other

  7. An ABRE promoter sequence is involved in osmotic stress-responsive expression of the DREB2A gene, which encodes a transcription factor regulating drought-inducible genes in Arabidopsis.

    Science.gov (United States)

    Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2011-12-01

    In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.

  8. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  9. Environmental contaminants and microRNA regulation: Transcription factors as regulators of toxicant-altered microRNA expression

    Energy Technology Data Exchange (ETDEWEB)

    Sollome, James; Martin, Elizabeth [Department of Environmental Science & Engineering, Gillings School of Global Public Health, University of North Carolina, Chapel Hill (United States); Sethupathy, Praveen [Department of Genetics, School of Medicine, University of North Carolina, Chapel Hill, NC (United States); Fry, Rebecca C., E-mail: rfry@unc.edu [Department of Environmental Science & Engineering, Gillings School of Global Public Health, University of North Carolina, Chapel Hill (United States); Curriculum in Toxicology, School of Medicine, University of North Carolina, Chapel Hill, NC (United States)

    2016-12-01

    MicroRNAs (miRNAs) regulate gene expression by binding mRNA and inhibiting translation and/or inducing degradation of the associated transcripts. Expression levels of miRNAs have been shown to be altered in response to environmental toxicants, thus impacting cellular function and influencing disease risk. Transcription factors (TFs) are known to be altered in response to environmental toxicants and play a critical role in the regulation of miRNA expression. To date, environmentally-responsive TFs that are important for regulating miRNAs remain understudied. In a state-of-the-art analysis, we utilized an in silico bioinformatic approach to characterize potential transcriptional regulators of environmentally-responsive miRNAs. Using the miRStart database, genomic sequences of promoter regions for all available human miRNAs (n = 847) were identified and promoter regions were defined as − 1000/+500 base pairs from the transcription start site. Subsequently, the promoter region sequences of environmentally-responsive miRNAs (n = 128) were analyzed using enrichment analysis to determine overrepresented TF binding sites (TFBS). While most (56/73) TFs differed across environmental contaminants, a set of 17 TFs was enriched for promoter binding among miRNAs responsive to numerous environmental contaminants. Of these, one TF was common to miRNAs altered by the majority of environmental contaminants, namely SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 3 (SMARCA3). These identified TFs represent candidate common transcriptional regulators of miRNAs perturbed by environmental toxicants. - Highlights: • Transcription factors that regulate environmentally-modulated miRNA expression are understudied • Transcription factor binding sites (TFBS) located within DNA promoter regions of miRNAs were identified. • Specific transcription factors may serve as master regulators of environmentally-mediated microRNA expression.

  10. Environmental contaminants and microRNA regulation: Transcription factors as regulators of toxicant-altered microRNA expression

    International Nuclear Information System (INIS)

    Sollome, James; Martin, Elizabeth; Sethupathy, Praveen; Fry, Rebecca C.

    2016-01-01

    MicroRNAs (miRNAs) regulate gene expression by binding mRNA and inhibiting translation and/or inducing degradation of the associated transcripts. Expression levels of miRNAs have been shown to be altered in response to environmental toxicants, thus impacting cellular function and influencing disease risk. Transcription factors (TFs) are known to be altered in response to environmental toxicants and play a critical role in the regulation of miRNA expression. To date, environmentally-responsive TFs that are important for regulating miRNAs remain understudied. In a state-of-the-art analysis, we utilized an in silico bioinformatic approach to characterize potential transcriptional regulators of environmentally-responsive miRNAs. Using the miRStart database, genomic sequences of promoter regions for all available human miRNAs (n = 847) were identified and promoter regions were defined as − 1000/+500 base pairs from the transcription start site. Subsequently, the promoter region sequences of environmentally-responsive miRNAs (n = 128) were analyzed using enrichment analysis to determine overrepresented TF binding sites (TFBS). While most (56/73) TFs differed across environmental contaminants, a set of 17 TFs was enriched for promoter binding among miRNAs responsive to numerous environmental contaminants. Of these, one TF was common to miRNAs altered by the majority of environmental contaminants, namely SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 3 (SMARCA3). These identified TFs represent candidate common transcriptional regulators of miRNAs perturbed by environmental toxicants. - Highlights: • Transcription factors that regulate environmentally-modulated miRNA expression are understudied • Transcription factor binding sites (TFBS) located within DNA promoter regions of miRNAs were identified. • Specific transcription factors may serve as master regulators of environmentally-mediated microRNA expression

  11. Fatty Acid–Regulated Transcription Factors in the Liver

    Science.gov (United States)

    Jump, Donald B.; Tripathy, Sasmita; Depner, Christopher M.

    2014-01-01

    Fatty acid regulation of hepatic gene transcription was first reported in the early 1990s. Several transcription factors have been identified as targets of fatty acid regulation. This regulation is achieved by direct fatty acid binding to the transcription factor or by indirect mechanisms where fatty acids regulate signaling pathways controlling the expression of transcription factors or the phosphorylation, ubiquitination, or proteolytic cleavage of the transcription factor. Although dietary fatty acids are well-established regulators of hepatic transcription factors, emerging evidence indicates that endogenously generated fatty acids are equally important in controlling transcription factors in the context of glucose and lipid homeostasis. Our first goal in this review is to provide an up-to-date examination of the molecular and metabolic bases of fatty acid regulation of key transcription factors controlling hepatic metabolism. Our second goal is to link these mechanisms to nonalcoholic fatty liver disease (NAFLD), a growing health concern in the obese population. PMID:23528177

  12. A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

    DEFF Research Database (Denmark)

    Dossani, Zain Y.; Apel, Amanda Reider; Szmidt-Middleton, Heather

    2018-01-01

    regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein....... Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes...... levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain....

  13. Genome-Wide Identification of the Target Genes of AP2-O, a Plasmodium AP2-Family Transcription Factor.

    Directory of Open Access Journals (Sweden)

    Izumi Kaneko

    2015-05-01

    Full Text Available Stage-specific transcription is a fundamental biological process in the life cycle of the Plasmodium parasite. Proteins containing the AP2 DNA-binding domain are responsible for stage-specific transcriptional regulation and belong to the only known family of transcription factors in Plasmodium parasites. Comprehensive identification of their target genes will advance our understanding of the molecular basis of stage-specific transcriptional regulation and stage-specific parasite development. AP2-O is an AP2 family transcription factor that is expressed in the mosquito midgut-invading stage, called the ookinete, and is essential for normal morphogenesis of this stage. In this study, we identified the genome-wide target genes of AP2-O by chromatin immunoprecipitation-sequencing and elucidate how this AP2 family transcription factor contributes to the formation of this motile stage. The analysis revealed that AP2-O binds specifically to the upstream genomic regions of more than 500 genes, suggesting that approximately 10% of the parasite genome is directly regulated by AP2-O. These genes are involved in distinct biological processes such as morphogenesis, locomotion, midgut penetration, protection against mosquito immunity and preparation for subsequent oocyst development. This direct and global regulation by AP2-O provides a model for gene regulation in Plasmodium parasites and may explain how these parasites manage to control their complex life cycle using a small number of sequence-specific AP2 transcription factors.

  14. A Classification of Basic Helix-Loop-Helix Transcription Factors of Soybean

    Directory of Open Access Journals (Sweden)

    Karen A. Hudson

    2015-01-01

    Full Text Available The complete genome sequence of soybean allows an unprecedented opportunity for the discovery of the genes controlling important traits. In particular, the potential functions of regulatory genes are a priority for analysis. The basic helix-loop-helix (bHLH family of transcription factors is known to be involved in controlling a wide range of systems critical for crop adaptation and quality, including photosynthesis, light signalling, pigment biosynthesis, and seed pod development. Using a hidden Markov model search algorithm, 319 genes with basic helix-loop-helix transcription factor domains were identified within the soybean genome sequence. These were classified with respect to their predicted DNA binding potential, intron/exon structure, and the phylogeny of the bHLH domain. Evidence is presented that the vast majority (281 of these 319 soybean bHLH genes are expressed at the mRNA level. Of these soybean bHLH genes, 67% were found to exist in two or more homeologous copies. This dataset provides a framework for future studies on bHLH gene function in soybean. The challenge for future research remains to define functions for the bHLH factors encoded in the soybean genome, which may allow greater flexibility for genetic selection of growth and environmental adaptation in this widely grown crop.

  15. The Transcription Factor Encyclopedia

    DEFF Research Database (Denmark)

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I

    2012-01-01

    mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written......ABSTRACT: Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130...

  16. Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL.

    Science.gov (United States)

    Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin

    2014-05-01

    Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

  17. De-novo discovery of differentially abundant transcription factor binding sites including their positional preference.

    Science.gov (United States)

    Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo

    2011-02-10

    Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open

  18. Sequencing and transcriptional analysis of the Streptococcus thermophilus histamine biosynthesis gene cluster: factors that affect differential hdcA expression

    DEFF Research Database (Denmark)

    Calles-Enríquez, Marina; Hjort, Benjamin Benn; Andersen, Pia Skov

    2010-01-01

    to produce histamine. The hdc clusters of S. thermophilus CHCC1524 and CHCC6483 were sequenced, and the factors that affect histamine biosynthesis and histidine-decarboxylating gene (hdcA) expression were studied. The hdc cluster began with the hdcA gene, was followed by a transporter (hdcP), and ended...... with the hdcB gene, which is of unknown function. The three genes were orientated in the same direction. The genetic organization of the hdc cluster showed a unique organization among the lactic acid bacterial group and resembled those of Staphylococcus and Clostridium species, thus indicating possible...... acquisition through a horizontal transfer mechanism. Transcriptional analysis of the hdc cluster revealed the existence of a polycistronic mRNA covering the three genes. The histidine-decarboxylating gene (hdcA) of S. thermophilus demonstrated maximum expression during the stationary growth phase, with high...

  19. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    International Nuclear Information System (INIS)

    Xiao, Xiao; Gang, Yi; Wang, Honghong; Wang, Jiayin; Zhao, Lina; Xu, Li; Liu, Zhiguo

    2015-01-01

    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity

  20. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Xiao [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Gang, Yi [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province (China); Wang, Honghong [No. 518 Hospital of Chinese People’s Liberation Army, Xi’an 710043, Shaanxi Province (China); Wang, Jiayin [The Genome Institute, Washington University in St. Louis, St. Louis, MO 63108 (United States); Zhao, Lina [Department of Radiation Oncology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Xu, Li, E-mail: lxuhelen@163.com [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Liu, Zhiguo, E-mail: liuzhiguo@fmmu.edu.cn [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China)

    2015-02-06

    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.

  1. Comparative analysis of function and interaction of transcription factors in nematodes: Extensive conservation of orthology coupled to rapid sequence evolution

    Directory of Open Access Journals (Sweden)

    Singh Rama S

    2008-08-01

    Full Text Available Abstract Background Much of the morphological diversity in eukaryotes results from differential regulation of gene expression in which transcription factors (TFs play a central role. The nematode Caenorhabditis elegans is an established model organism for the study of the roles of TFs in controlling the spatiotemporal pattern of gene expression. Using the fully sequenced genomes of three Caenorhabditid nematode species as well as genome information from additional more distantly related organisms (fruit fly, mouse, and human we sought to identify orthologous TFs and characterized their patterns of evolution. Results We identified 988 TF genes in C. elegans, and inferred corresponding sets in C. briggsae and C. remanei, containing 995 and 1093 TF genes, respectively. Analysis of the three gene sets revealed 652 3-way reciprocal 'best hit' orthologs (nematode TF set, approximately half of which are zinc finger (ZF-C2H2 and ZF-C4/NHR types and HOX family members. Examination of the TF genes in C. elegans and C. briggsae identified the presence of significant tandem clustering on chromosome V, the majority of which belong to ZF-C4/NHR family. We also found evidence for lineage-specific duplications and rapid evolution of many of the TF genes in the two species. A search of the TFs conserved among nematodes in Drosophila melanogaster, Mus musculus and Homo sapiens revealed 150 reciprocal orthologs, many of which are associated with important biological processes and human diseases. Finally, a comparison of the sequence, gene interactions and function indicates that nematode TFs conserved across phyla exhibit significantly more interactions and are enriched in genes with annotated mutant phenotypes compared to those that lack orthologs in other species. Conclusion Our study represents the first comprehensive genome-wide analysis of TFs across three nematode species and other organisms. The findings indicate substantial conservation of transcription

  2. A transcriptome resource for the koala (Phascolarctos cinereus): insights into koala retrovirus transcription and sequence diversity.

    Science.gov (United States)

    Hobbs, Matthew; Pavasovic, Ana; King, Andrew G; Prentis, Peter J; Eldridge, Mark D B; Chen, Zhiliang; Colgan, Donald J; Polkinghorne, Adam; Wilkins, Marc R; Flanagan, Cheyne; Gillett, Amber; Hanger, Jon; Johnson, Rebecca N; Timms, Peter

    2014-09-11

    The koala, Phascolarctos cinereus, is a biologically unique and evolutionarily distinct Australian arboreal marsupial. The goal of this study was to sequence the transcriptome from several tissues of two geographically separate koalas, and to create the first comprehensive catalog of annotated transcripts for this species, enabling detailed analysis of the unique attributes of this threatened native marsupial, including infection by the koala retrovirus. RNA-Seq data was generated from a range of tissues from one male and one female koala and assembled de novo into transcripts using Velvet-Oases. Transcript abundance in each tissue was estimated. Transcripts were searched for likely protein-coding regions and a non-redundant set of 117,563 putative protein sequences was produced. In similarity searches there were 84,907 (72%) sequences that aligned to at least one sequence in the NCBI nr protein database. The best alignments were to sequences from other marsupials. After applying a reciprocal best hit requirement of koala sequences to those from tammar wallaby, Tasmanian devil and the gray short-tailed opossum, we estimate that our transcriptome dataset represents approximately 15,000 koala genes. The marsupial alignment information was used to look for potential gene duplications and we report evidence for copy number expansion of the alpha amylase gene, and of an aldehyde reductase gene.Koala retrovirus (KoRV) transcripts were detected in the transcriptomes. These were analysed in detail and the structure of the spliced envelope gene transcript was determined. There was appreciable sequence diversity within KoRV, with 233 sites in the KoRV genome showing small insertions/deletions or single nucleotide polymorphisms. Both koalas had sequences from the KoRV-A subtype, but the male koala transcriptome has, in addition, sequences more closely related to the KoRV-B subtype. This is the first report of a KoRV-B-like sequence in a wild population. This transcriptomic

  3. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    Science.gov (United States)

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  4. Anthocyanin biosynthesis in pears is regulated by a R2R3-MYB transcription factor PyMYB10.

    Science.gov (United States)

    Feng, Shouqian; Wang, Yanling; Yang, Song; Xu, Yuting; Chen, Xuesen

    2010-06-01

    Skin color is an important factor in pear breeding programs. The degree of red coloration is determined by the content and composition of anthocyanins. In plants, many MYB transcriptional factors are involved in regulating anthocyanin biosynthesis. In this study, a R2R3-MYB transcription factor gene, PyMYB10, was isolated from Asian pear (Pyrus pyrifolia) cv. 'Aoguan'. Sequence analysis suggested that the PyMYB10 gene was an ortholog of MdMYB10 gene, which regulates anthocyanin biosynthesis in red fleshed apple (Malus x domestica) cv. 'Red Field'. PyMYB10 was identified at the genomic level and had three exons, with its upstream sequence containing core sequences of cis-acting regulatory elements involved in light responsiveness. Fruit bagging showed that light could induce expression of PyMYB10 and anthocyanin biosynthesis. Quantitative real-time PCR revealed that PyMYB10 was predominantly expressed in pear skins, buds, and young leaves, and the level of transcription in buds was higher than in skin and young leaves. In ripening fruits, the transcription of PyMYB10 in the skin was positively correlated with genes in the anthocyanin pathway and with anthocyanin biosynthesis. In addition, the transcription of PyMYB10 and genes of anthocyanin biosynthesis were more abundant in red-skinned pear cultivars compared to blushed cultivars. Transgenic Arabidopsis plants overexpressing PyMYB10 exhibited ectopic pigmentation in immature seeds. The study suggested that PyMYB10 plays a role in regulating anthocyanin biosynthesis and the overexpression of PyMYB10 was sufficient to induce anthocyanin accumulation.

  5. RNA binding specificity of Ebola virus transcription factor VP30.

    Science.gov (United States)

    Schlereth, Julia; Grünweller, Arnold; Biedenkopf, Nadine; Becker, Stephan; Hartmann, Roland K

    2016-09-01

    The transcription factor VP30 of the non-segmented RNA negative strand Ebola virus balances viral transcription and replication. Here, we comprehensively studied RNA binding by VP30. Using a novel VP30:RNA electrophoretic mobility shift assay, we tested truncated variants of 2 potential natural RNA substrates of VP30 - the genomic Ebola viral 3'-leader region and its complementary antigenomic counterpart (each ∼155 nt in length) - and a series of other non-viral RNAs. Based on oligonucleotide interference, the major VP30 binding region on the genomic 3'-leader substrate was assigned to the internal expanded single-stranded region (∼ nt 125-80). Best binding to VP30 was obtained with ssRNAs of optimally ∼ 40 nt and mixed base composition; underrepresentation of purines or pyrimidines was tolerated, but homopolymeric sequences impaired binding. A stem-loop structure, particularly at the 3'-end or positioned internally, supports stable binding to VP30. In contrast, dsRNA or RNAs exposing large internal loops flanked by entirely helical arms on both sides are not bound. Introduction of a 5´-Cap(0) structure impaired VP30 binding. Also, ssDNAs bind substantially weaker than isosequential ssRNAs and heparin competes with RNA for binding to VP30, indicating that ribose 2'-hydroxyls and electrostatic contacts of the phosphate groups contribute to the formation of VP30:RNA complexes. Our results indicate a rather relaxed RNA binding specificity of filoviral VP30, which largely differs from that of the functionally related transcription factor of the Paramyxoviridae which binds to ssRNAs as short as 13 nt with a preference for oligo(A) sequences.

  6. Gene discovery and transcript analyses in the corn smut pathogen Ustilago maydis: expressed sequence tag and genome sequence comparison

    Directory of Open Access Journals (Sweden)

    Saville Barry J

    2007-09-01

    Full Text Available Abstract Background Ustilago maydis is the basidiomycete fungus responsible for common smut of corn and is a model organism for the study of fungal phytopathogenesis. To aid in the annotation of the genome sequence of this organism, several expressed sequence tag (EST libraries were generated from a variety of U. maydis cell types. In addition to utility in the context of gene identification and structure annotation, the ESTs were analyzed to identify differentially abundant transcripts and to detect evidence of alternative splicing and anti-sense transcription. Results Four cDNA libraries were constructed using RNA isolated from U. maydis diploid teliospores (U. maydis strains 518 × 521 and haploid cells of strain 521 grown under nutrient rich, carbon starved, and nitrogen starved conditions. Using the genome sequence as a scaffold, the 15,901 ESTs were assembled into 6,101 contiguous expressed sequences (contigs; among these, 5,482 corresponded to predicted genes in the MUMDB (MIPS Ustilago maydis database, while 619 aligned to regions of the genome not yet designated as genes in MUMDB. A comparison of EST abundance identified numerous genes that may be regulated in a cell type or starvation-specific manner. The transcriptional response to nitrogen starvation was assessed using RT-qPCR. The results of this suggest that there may be cross-talk between the nitrogen and carbon signalling pathways in U. maydis. Bioinformatic analysis identified numerous examples of alternative splicing and anti-sense transcription. While intron retention was the predominant form of alternative splicing in U. maydis, other varieties were also evident (e.g. exon skipping. Selected instances of both alternative splicing and anti-sense transcription were independently confirmed using RT-PCR. Conclusion Through this work: 1 substantial sequence information has been provided for U. maydis genome annotation; 2 new genes were identified through the discovery of 619

  7. Synthetic Promoters and Transcription Factors for Heterologous Protein Expression in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Fabian Machens

    2017-10-01

    Full Text Available Orthogonal systems for heterologous protein expression as well as for the engineering of synthetic gene regulatory circuits in hosts like Saccharomyces cerevisiae depend on synthetic transcription factors (synTFs and corresponding cis-regulatory binding sites. We have constructed and characterized a set of synTFs based on either transcription activator-like effectors or CRISPR/Cas9, and corresponding small synthetic promoters (synPs with minimal sequence identity to the host’s endogenous promoters. The resulting collection of functional synTF/synP pairs confers very low background expression under uninduced conditions, while expression output upon induction of the various synTFs covers a wide range and reaches induction factors of up to 400. The broad spectrum of expression strengths that is achieved will be useful for various experimental setups, e.g., the transcriptional balancing of expression levels within heterologous pathways or the construction of artificial regulatory networks. Furthermore, our analyses reveal simple rules that enable the tuning of synTF expression output, thereby allowing easy modification of a given synTF/synP pair. This will make it easier for researchers to construct tailored transcriptional control systems.

  8. Functionally significant, rare transcription factor variants in tetralogy of Fallot.

    Directory of Open Access Journals (Sweden)

    Ana Töpf

    Full Text Available Rare variants in certain transcription factors involved in cardiac development cause Mendelian forms of congenital heart disease. The purpose of this study was to systematically assess the frequency of rare transcription factor variants in sporadic patients with the cardiac outflow tract malformation tetralogy of Fallot (TOF.We sequenced the coding, 5'UTR, and 3'UTR regions of twelve transcription factor genes implicated in cardiac outflow tract development (NKX2.5, GATA4, ISL1, TBX20, MEF2C, BOP/SMYD1, HAND2, FOXC1, FOXC2, FOXH, FOXA2 and TBX1 in 93 non-syndromic, non-Mendelian TOF cases. We also analysed Illumina Human 660W-Quad SNP Array data for copy number variants in these genes; none were detected. Four of the rare variants detected have previously been shown to affect transactivation in in vitro reporter assays: FOXC1 p.P297S, FOXC2 p.Q444R, FOXH1 p.S113T and TBX1 p.P43_G61del PPPPRYDPCAAAAPGAPGP. Two further rare variants, HAND2 p.A25_A26insAA and FOXC1 p.G378_G380delGGG, A488_491delAAAA, affected transactivation in in vitro reporter assays. Each of these six functionally significant variants was present in a single patient in the heterozygous state; each of the four for which parental samples were available were maternally inherited. Thus in the 93 TOF cases we identified six functionally significant mutations in the secondary heart field transcriptional network.This study indicates that rare genetic variants in the secondary heart field transcriptional network with functional effects on protein function occur in 3-13% of patients with TOF. This is the first report of a functionally significant HAND2 mutation in a patient with congenital heart disease.

  9. Principal component analysis for predicting transcription-factor binding motifs from array-derived data

    Directory of Open Access Journals (Sweden)

    Vincenti Matthew P

    2005-11-01

    Full Text Available Abstract Background The responses to interleukin 1 (IL-1 in human chondrocytes constitute a complex regulatory mechanism, where multiple transcription factors interact combinatorially to transcription-factor binding motifs (TFBMs. In order to select a critical set of TFBMs from genomic DNA information and an array-derived data, an efficient algorithm to solve a combinatorial optimization problem is required. Although computational approaches based on evolutionary algorithms are commonly employed, an analytical algorithm would be useful to predict TFBMs at nearly no computational cost and evaluate varying modelling conditions. Singular value decomposition (SVD is a powerful method to derive primary components of a given matrix. Applying SVD to a promoter matrix defined from regulatory DNA sequences, we derived a novel method to predict the critical set of TFBMs. Results The promoter matrix was defined to establish a quantitative relationship between the IL-1-driven mRNA alteration and genomic DNA sequences of the IL-1 responsive genes. The matrix was decomposed with SVD, and the effects of 8 potential TFBMs (5'-CAGGC-3', 5'-CGCCC-3', 5'-CCGCC-3', 5'-ATGGG-3', 5'-GGGAA-3', 5'-CGTCC-3', 5'-AAAGG-3', and 5'-ACCCA-3' were predicted from a pool of 512 random DNA sequences. The prediction included matches to the core binding motifs of biologically known TFBMs such as AP2, SP1, EGR1, KROX, GC-BOX, ABI4, ETF, E2F, SRF, STAT, IK-1, PPARγ, STAF, ROAZ, and NFκB, and their significance was evaluated numerically using Monte Carlo simulation and genetic algorithm. Conclusion The described SVD-based prediction is an analytical method to provide a set of potential TFBMs involved in transcriptional regulation. The results would be useful to evaluate analytically a contribution of individual DNA sequences.

  10. Sequence organization and control of transcription in the bacteriophage T4 tRNA region.

    Science.gov (United States)

    Broida, J; Abelson, J

    1985-10-05

    Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.

  11. Enriching Genomic Resources and Marker Development from Transcript Sequences of Jatropha curcas for Microgravity Studies

    Science.gov (United States)

    Tian, Wenlan; Paudel, Dev

    2017-01-01

    Jatropha (Jatropha curcas L.) is an economically important species with a great potential for biodiesel production. To enrich the jatropha genomic databases and resources for microgravity studies, we sequenced and annotated the transcriptome of jatropha and developed SSR and SNP markers from the transcriptome sequences. In total 1,714,433 raw reads with an average length of 441.2 nucleotides were generated. De novo assembling and clustering resulted in 115,611 uniquely assembled sequences (UASs) including 21,418 full-length cDNAs and 23,264 new jatropha transcript sequences. The whole set of UASs were fully annotated, out of which 59,903 (51.81%) were assigned with gene ontology (GO) term, 12,584 (10.88%) had orthologs in Eukaryotic Orthologous Groups (KOG), and 8,822 (7.63%) were mapped to 317 pathways in six different categories in Kyoto Encyclopedia of Genes and Genome (KEGG) database, and it contained 3,588 putative transcription factors. From the UASs, 9,798 SSRs were discovered with AG/CT as the most frequent (45.8%) SSR motif type. Further 38,693 SNPs were detected and 7,584 remained after filtering. This UAS set has enriched the current jatropha genomic databases and provided a large number of genetic markers, which can facilitate jatropha genetic improvement and many other genetic and biological studies. PMID:28154822

  12. Evidence for site-specific occupancy of the mitochondrial genome by nuclear transcription factors.

    Directory of Open Access Journals (Sweden)

    Georgi K Marinov

    Full Text Available Mitochondria contain their own circular genome, with mitochondria-specific transcription and replication systems and corresponding regulatory proteins. All of these proteins are encoded in the nuclear genome and are post-translationally imported into mitochondria. In addition, several nuclear transcription factors have been reported to act in mitochondria, but there has been no comprehensive mapping of their occupancy patterns and it is not clear how many other factors may also be found in mitochondria. Here we address these questions by using ChIP-seq data from the ENCODE, mouseENCODE and modENCODE consortia for 151 human, 31 mouse and 35 C. elegans factors. We identified 8 human and 3 mouse transcription factors with strong localized enrichment over the mitochondrial genome that was usually associated with the corresponding recognition sequence motif. Notably, these sites of occupancy are often the sites with highest ChIP-seq signal intensity within both the nuclear and mitochondrial genomes and are thus best explained as true binding events to mitochondrial DNA, which exist in high copy number in each cell. We corroborated these findings by immunocytochemical staining evidence for mitochondrial localization. However, we were unable to find clear evidence for mitochondrial binding in ENCODE and other publicly available ChIP-seq data for most factors previously reported to localize there. As the first global analysis of nuclear transcription factors binding in mitochondria, this work opens the door to future studies that probe the functional significance of the phenomenon.

  13. Negative transcriptional regulation of mitochondrial transcription factor A (TFAM) by nuclear TFAM

    International Nuclear Information System (INIS)

    Lee, Eun Jin; Kang, Young Cheol; Park, Wook-Ha; Jeong, Jae Hoon; Pak, Youngmi Kim

    2014-01-01

    Highlights: • TFAM localizes in nuclei and mitochondria of neuronal cells. • Nuclear TFAM does not bind the Tfam promoter. • Nuclear TFAM reduced the Tfam promoter activity via suppressing NRF-1 activity. • A novel self-negative feedback regulation of Tfam gene expression is explored. • FAM may play different roles depending on its subcellular localizations. - Abstract: The nuclear DNA-encoded mitochondrial transcription factor A (TFAM) is synthesized in cytoplasm and transported into mitochondria. TFAM enhances both transcription and replication of mitochondrial DNA. It is unclear, however, whether TFAM plays a role in regulating nuclear gene expression. Here, we demonstrated that TFAM was localized to the nucleus and mitochondria by immunostaining, subcellular fractionation, and TFAM-green fluorescent protein hybrid protein studies. In HT22 hippocampal neuronal cells, human TFAM (hTFAM) overexpression suppressed human Tfam promoter-mediated luciferase activity in a dose-dependent manner. The mitochondria targeting sequence-deficient hTFAM also repressed Tfam promoter activity to the same degree as hTFAM. It indicated that nuclear hTFAM suppressed Tfam expression without modulating mitochondrial activity. The repression required for nuclear respiratory factor-1 (NRF-1), but hTFAM did not bind to the NRF-1 binding site of its promoter. TFAM was co-immunoprecipitated with NRF-1. Taken together, we suggest that nuclear TFAM down-regulate its own gene expression as a NRF-1 repressor, showing that TFAM may play different roles depending on its subcellular localizations

  14. Occupancy classification of position weight matrix-inferred transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Hollis Wright

    Full Text Available BACKGROUND: Computational prediction of Transcription Factor Binding Sites (TFBS from sequence data alone is difficult and error-prone. Machine learning techniques utilizing additional environmental information about a predicted binding site (such as distances from the site to particular chromatin features to determine its occupancy/functionality class show promise as methods to achieve more accurate prediction of true TFBS in silico. We evaluate the Bayesian Network (BN and Support Vector Machine (SVM machine learning techniques on four distinct TFBS data sets and analyze their performance. We describe the features that are most useful for classification and contrast and compare these feature sets between the factors. RESULTS: Our results demonstrate good performance of classifiers both on TFBS for transcription factors used for initial training and for TFBS for other factors in cross-classification experiments. We find that distances to chromatin modifications (specifically, histone modification islands as well as distances between such modifications to be effective predictors of TFBS occupancy, though the impact of individual predictors is largely TF specific. In our experiments, Bayesian network classifiers outperform SVM classifiers. CONCLUSIONS: Our results demonstrate good performance of machine learning techniques on the problem of occupancy classification, and demonstrate that effective classification can be achieved using distances to chromatin features. We additionally demonstrate that cross-classification of TFBS is possible, suggesting the possibility of constructing a generalizable occupancy classifier capable of handling TFBS for many different transcription factors.

  15. Transcriptional profiling in human HaCaT keratinocytes in response to kaempferol and identification of potential transcription factors for regulating differential gene expression

    Science.gov (United States)

    Kang, Byung Young; Lee, Ki-Hwan; Lee, Yong Sung; Hong, Il; Lee, Mi-Ock; Min, Daejin; Chang, Ihseop; Hwang, Jae Sung; Park, Jun Seong; Kim, Duck Hee

    2008-01-01

    Kaempferol is the major flavonol in green tea and exhibits many biomedically useful properties such as antioxidative, cytoprotective and anti-apoptotic activities. To elucidate its effects on the skin, we investigated the transcriptional profiles of kaempferol-treated HaCaT cells using cDNA microarray analysis and identified 147 transcripts that exhibited significant changes in expression. Of these, 18 were up-regulated and 129 were down-regulated. These transcripts were then classified into 12 categories according to their functional roles: cell adhesion/cytoskeleton, cell cycle, redox homeostasis, immune/defense responses, metabolism, protein biosynthesis/modification, intracellular transport, RNA processing, DNA modification/ replication, regulation of transcription, signal transduction and transport. We then analyzed the promoter sequences of differentially-regulated genes and identified over-represented regulatory sites and candidate transcription factors (TFs) for gene regulation by kaempferol. These included c-REL, SAP-1, Ahr-ARNT, Nrf-2, Elk-1, SPI-B, NF-κB and p65. In addition, we validated the microarray results and promoter analyses using conventional methods such as real-time PCR and ELISA-based transcription factor assay. Our microarray analysis has provided useful information for determining the genetic regulatory network affected by kaempferol, and this approach will be useful for elucidating gene-phytochemical interactions. PMID:18446059

  16. NAC transcription factors: structurally distinct, functionally diverse

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Ernst, Heidi A; Leggio, Leila Lo

    2005-01-01

    level and localization, and to the first indications of NAC participation in transcription factor networks. The recent determination of the DNA and protein binding NAC domain structure offers insight into the molecular functions of the protein family. Research into NAC transcription factors has......NAC proteins constitute one of the largest families of plant-specific transcription factors, and the family is present in a wide range of land plants. Here, we summarize the biological and molecular functions of the NAC family, paying particular attention to the intricate regulation of NAC protein...

  17. Full-length mRNA sequencing uncovers a widespread coupling between transcription initiation and mRNA processing.

    Science.gov (United States)

    Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C

    2018-03-29

    The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.

  18. A comprehensive set of transcript sequences of the heavy metal hyperaccumulator Noccaea caerulescens

    Directory of Open Access Journals (Sweden)

    YA-FEN eLIN

    2014-06-01

    Full Text Available Noccaea caerulescens is an extremophile plant species belonging to the Brassicaceae family. It has adapted to grow on soils containing high, normally toxic, concentrations of metals such as nickel, zinc and cadmium. Next to being extremely tolerant to these metals, it is one of the few species known to hyperaccumulate these metals to extremely high concentrations in their aboveground biomass. In order to provide additional molecular resources for this model metal hyperaccumulator species to study and understand the mechanism of heavy metal exposure adaptation, we aimed to provide a comprehensive database of transcript sequences for N. caerulescens. In this study, 23830 transcript sequences (isotigs with an average length of 1025 bps were determined for roots, shoots and inflorescences of N. caerulescens accession ‘Ganges’ by Roche GS-FLEX 454 pyrosequencing. These isotigs were grouped into 20,378 isogroups, representing potential genes. This is a large expansion of the existing N. caerulescens transcriptome set consisting of 3705 unigenes. When compared to a Brassicaceae proteome set, 22,232 (93.2% of the N. caerulescens isotigs (corresponding to 19191 isogroups had a significant match and could be annotated accordingly. Of the remaining sequences, 98 isotigs resembled non-plant sequences and 1386 had no significant similarity to any sequence in the GenBank database. Among the annotated set there were many isotigs with similarity to metal homeostasis genes or genes for glucosinolate biosynthesis. Only for transcripts similar to Metallothionein3 (MT3, clear evidence for an additional copy was found. This comprehensive set of transcripts is expected to further contribute to the discovery of mechanisms used by N. caerulescens to adapt to heavy metal exposure.

  19. Analysis of mutations in the entire coding sequence of the factor VIII gene

    Energy Technology Data Exchange (ETDEWEB)

    Bidichadani, S.I.; Lanyon, W.G.; Connor, J.M. [Glascow Univ. (United Kingdom)] [and others

    1994-09-01

    Hemophilia A is a common X-linked recessive disorder of bleeding caused by deleterious mutations in the gene for clotting factor VIII. The large size of the factor VIII gene, the high frequency of de novo mutations and its tissue-specific expression complicate the detection of mutations. We have used a combination of RT-PCR of ectopic factor VIII transcripts and genomic DNA-PCRs to amplify the entire essential sequence of the factor VIII gene. This is followed by chemical mismatch cleavage analysis and direct sequencing in order to facilitate a comprehensive search for mutations. We describe the characterization of nine potentially pathogenic mutations, six of which are novel. In each case, a correlation of the genotype with the observed phenotype is presented. In order to evaluate the pathogenicity of the five missense mutations detected, we have analyzed them for evolutionary sequence conservation and for their involvement of sequence motifs catalogued in the PROSITE database of protein sites and patterns.

  20. Exploring the sequence-function relationship in transcriptional regulation by the lac O1 operator.

    Science.gov (United States)

    Maity, Tuhin S; Jha, Ramesh K; Strauss, Charlie E M; Dunbar, John

    2012-07-01

    Understanding how binding of a transcription factor to an operator is influenced by the operator sequence is an ongoing quest. It facilitates discovery of alternative binding sites as well as tuning of transcriptional regulation. We investigated the behavior of the Escherichia coli Lac repressor (LacI) protein with a large set of lac O(1) operator variants. The 114 variants examined contained a mean of 2.9 (range 0-4) mutations at positions -4, -2, +2 and +4 in the minimally required 17 bp operator. The relative affinity of LacI for the operators was examined by quantifying expression of a GFP reporter gene and Rosetta structural modeling. The combinations of mutations in the operator sequence created a wide range of regulatory behaviors. We observed variations in the GFP fluorescent signal among the operator variants of more than an order of magnitude under both uninduced and induced conditions. We found that a single nucleotide change may result in changes of up to six- and 12-fold in uninduced and induced GFP signals, respectively. Among the four positions mutated, we found that nucleotide G at position -4 is strongly correlated with strong repression. By Rosetta modeling, we found a significant correlation between the calculated binding energy and the experimentally observed transcriptional repression strength for many operators. However, exceptions were also observed, underscoring the necessity for further improvement in biophysical models of protein-DNA interactions. © 2012 The Authors Journal compilation © 2012 FEBS.

  1. A Next-Generation Sequencing Approach Uncovers Viral Transcripts Incorporated in Poxvirus Virions

    Directory of Open Access Journals (Sweden)

    Marica Grossegesse

    2017-10-01

    Full Text Available Transcripts are known to be incorporated in particles of DNA viruses belonging to the families of Herpesviridae and Mimiviridae, but the presence of transcripts in other DNA viruses, such as poxviruses, has not been analyzed yet. Therefore, we first established a next-generation-sequencing (NGS-based protocol, enabling the unbiased identification of transcripts in virus particles. Subsequently, we applied our protocol to analyze RNA in an emerging zoonotic member of the Poxviridae family, namely Cowpox virus. Our results revealed the incorporation of 19 viral transcripts, while host identifications were restricted to ribosomal and mitochondrial RNA. Most viral transcripts had an unknown and immunomodulatory function, suggesting that transcript incorporation may be beneficial for poxvirus immune evasion. Notably, the most abundant transcript originated from the D5L/I1R gene that encodes a viral inhibitor of the host cytoplasmic DNA sensing machinery.

  2. Identification of cis-regulatory sequences that activate transcription in the suspensor of plant embryos.

    Science.gov (United States)

    Kawashima, Tomokazu; Wang, Xingjun; Henry, Kelli F; Bi, Yuping; Weterings, Koen; Goldberg, Robert B

    2009-03-03

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the scarlet runner bean (Phaseolus coccineus) G564 gene to understand how genes are activated specifically within the suspensor during early embryo development. Previously, we showed that the G564 upstream region has a block of tandem repeats, which contain a conserved 10-bp motif (GAAAAG(C)/(T)GAA), and that deletion of these repeats results in a loss of suspensor transcription. Here, we use gain-of-function (GOF) experiments with transgenic globular-stage tobacco embryos to show that only 1 of the 5 tandem repeats is required to drive suspensor-specific transcription. Fine-scale deletion and scanning mutagenesis experiments with 1 tandem repeat uncovered a 54-bp region that contains all of the sequences required to activate transcription in the suspensor, including the 10-bp motif (GAAAAGCGAA) and a similar 10-bp-like motif (GAAAAACGAA). Site-directed mutagenesis and GOF experiments indicated that both the 10-bp and 10-bp-like motifs are necessary, but not sufficient to activate transcription in the suspensor, and that a sequence (TTGGT) between the 10-bp and the 10-bp-like motifs is also necessary for suspensor transcription. Together, these data identify sequences that are required to activate transcription in the suspensor of a plant embryo after fertilization.

  3. Endoplasmic reticulum stress-responsive transcription factor ATF6α directs recruitment of the Mediator of RNA polymerase II transcription and multiple histone acetyltransferase complexes.

    Science.gov (United States)

    Sela, Dotan; Chen, Lu; Martin-Brown, Skylar; Washburn, Michael P; Florens, Laurence; Conaway, Joan Weliky; Conaway, Ronald C

    2012-06-29

    The basic leucine zipper transcription factor ATF6α functions as a master regulator of endoplasmic reticulum (ER) stress response genes. Previous studies have established that, in response to ER stress, ATF6α translocates to the nucleus and activates transcription of ER stress response genes upon binding sequence specifically to ER stress response enhancer elements in their promoters. In this study, we investigate the biochemical mechanism by which ATF6α activates transcription. By exploiting a combination of biochemical and multidimensional protein identification technology-based mass spectrometry approaches, we have obtained evidence that ATF6α functions at least in part by recruiting to the ER stress response enhancer elements of ER stress response genes a collection of RNA polymerase II coregulatory complexes, including the Mediator and multiple histone acetyltransferase complexes, among which are the Spt-Ada-Gcn5 acetyltransferase (SAGA) and Ada-Two-A-containing (ATAC) complexes. Our findings shed new light on the mechanism of action of ATF6α, and they outline a straightforward strategy for applying multidimensional protein identification technology mass spectrometry to determine which RNA polymerase II transcription factors and coregulators are recruited to promoters and other regulatory elements to control transcription.

  4. Regulation of the human ADAMTS-4 promoter by transcription factors and cytokines

    International Nuclear Information System (INIS)

    Thirunavukkarasu, Kannan; Pei, Yong; Moore, Terry L.; Wang, He; Yu, Xiao-peng; Geiser, Andrew G.; Chandrasekhar, Srinivasan

    2006-01-01

    ADAMTS-4 (aggrecanase-1) is a metalloprotease that plays a role in aggrecan degradation in the cartilage extracellular matrix. In order to understand the regulation of ADAMTS-4 gene expression we have cloned and characterized a functional 4.5 kb human ADAMTS-4 promoter. Sequence analysis of the promoter revealed the presence of putative binding sites for nuclear factor of activated T cells (NFAT) and Runx family of transcription factors that are known to regulate chondrocyte maturation and differentiation. Using promoter-reporter assays and mRNA analysis we have analyzed the role of chondrocyte-expressed transcription factors NFATp and Runx2 and have shown that ADAMTS-4 is a potential downstream target of these two factors. Our results suggest that inhibition of the expression/function of NFATp and/or Runx2 may enable us to modulate aggrecan degradation in normal physiology and/or in degenerative joint diseases. The ADAMTS-4 promoter would serve as a valuable mechanistic tool to better understand the regulation of ADAMTS-4 expression by signaling pathways that modulate cartilage matrix breakdown

  5. Extended region of nodulation genes in Rhizobium meliloti 1021. II. Nucleotide sequence, transcription start sites and protein products

    International Nuclear Information System (INIS)

    Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.

    1987-01-01

    The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site

  6. Relaxed selection against accidental binding of transcription factors with conserved chromatin contexts.

    Science.gov (United States)

    Babbitt, G A

    2010-10-15

    The spurious (or nonfunctional) binding of transcription factors (TF) to the wrong locations on DNA presents a formidable challenge to genomes given the relatively low ceiling for sequence complexity within the short lengths of most binding motifs. The high potential for the occurrence of random motifs and subsequent nonfunctional binding of many transcription factors should theoretically lead to natural selection against the occurrence of spurious motif throughout the genome. However, because of the active role that chromatin can influence over eukaryotic gene regulation, it may also be expected that many supposed spurious binding sites could escape purifying selection if (A) they simply occur in regions of high nucleosome occupancy or (B) their surrounding chromatin was dynamically involved in their identity and function. We compared nucleosome occupancy and the presence/absence of functionally conserved chromatin context to the strength of selection against spurious binding of various TF binding motifs in Saccharomyces yeast. While we find no direct relationship with nucleosome occupancy, we find strong evidence that transcription factors spatially associated with evolutionarily conserved chromatin states are under relaxed selection against accidental binding. Transcription factors (with/without) a conserved chromatin context were found to occur on average, (87.7%/49.3%) of their expected frequencies. Functional binding motifs with conserved chromatin contexts were also significantly shorter in length and more often clustered. These results indicate a role of chromatin context dependency in relaxing selection against spurious binding in nearly half of all TF binding motifs throughout the yeast genome. 2010 Elsevier B.V. All rights reserved.

  7. The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening.

    Science.gov (United States)

    Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin

    2017-04-01

    Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  8. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    Energy Technology Data Exchange (ETDEWEB)

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.; Salzberg, Steven L.; Rubin, Gerald M.; Eisen, Michael B.; Celniker, SusanE.

    2004-08-06

    The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.

  9. Post-transcription cleavage generates the 3' end of F17R transcripts in vaccinia virus

    International Nuclear Information System (INIS)

    D'Costa, Susan M.; Antczak, James B.; Pickup, David J.; Condit, Richard C.

    2004-01-01

    Most vaccinia virus intermediate and late mRNAs possess 3' ends that are extremely heterogeneous in sequence. However, late mRNAs encoding the cowpox A-type inclusion protein (ATI), the second largest subunit of the RNA polymerase, and the late telomeric transcripts possess homogeneous 3' ends. In the case of the ATI mRNA, it has been shown that the homogeneous 3' end is generated by a post-transcriptional endoribonucleolytic cleavage event. We have determined that the F17R gene also produces homogeneous transcripts generated by a post-transcriptional cleavage event. Mapping of in vivo mRNA shows that the major 3' end of the F17R transcript maps 1262 nt downstream of the F17R translational start site. In vitro transcripts spanning the in vivo 3' end are cleaved in an in vitro reaction using extracts from virus infected cells, and the site of cleavage is the same both in vivo and in vitro. Cleavage is not observed using extract from cells infected in the presence of hydroxyurea; therefore, the cleavage factor is either virus-coded or virus-induced during the post-replicative phase of virus replication. The cis-acting sequence responsible for cleavage is orientation specific and the factor responsible for cleavage activity has biochemical properties similar to the factor required for cleavage of ATI transcripts. Partially purified cleavage factor generates cleavage products of expected size when either the ATI or F17R substrates are used in vitro, strongly suggesting that cleavage of both transcripts is mediated by the same factor

  10. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein

  11. Interactions between the R2R3-MYB transcription factor, AtMYB61, and target DNA binding sites.

    Directory of Open Access Journals (Sweden)

    Michael B Prouse

    Full Text Available Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing. The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators.

  12. Inference of expanded Lrp-like feast/famine transcription factor targets in a non-model organism using protein structure-based prediction.

    Science.gov (United States)

    Ashworth, Justin; Plaisier, Christopher L; Lo, Fang Yin; Reiss, David J; Baliga, Nitin S

    2014-01-01

    Widespread microbial genome sequencing presents an opportunity to understand the gene regulatory networks of non-model organisms. This requires knowledge of the binding sites for transcription factors whose DNA-binding properties are unknown or difficult to infer. We adapted a protein structure-based method to predict the specificities and putative regulons of homologous transcription factors across diverse species. As a proof-of-concept we predicted the specificities and transcriptional target genes of divergent archaeal feast/famine regulatory proteins, several of which are encoded in the genome of Halobacterium salinarum. This was validated by comparison to experimentally determined specificities for transcription factors in distantly related extremophiles, chromatin immunoprecipitation experiments, and cis-regulatory sequence conservation across eighteen related species of halobacteria. Through this analysis we were able to infer that Halobacterium salinarum employs a divergent local trans-regulatory strategy to regulate genes (carA and carB) involved in arginine and pyrimidine metabolism, whereas Escherichia coli employs an operon. The prediction of gene regulatory binding sites using structure-based methods is useful for the inference of gene regulatory relationships in new species that are otherwise difficult to infer.

  13. Molecular Cloning and Characterization of PnbHLH1 Transcription Factor in Panax notoginseng

    Directory of Open Access Journals (Sweden)

    Xiang Zhang

    2017-07-01

    Full Text Available Panax notoginseng has been extensively used as a traditional Chinese medicine. In the current study, molecular cloning and characterization of PnbHLH1 transcription factor were explored in Panax notoginseng. The full length of the PnbHLH1 gene obtained by splicing was 1430 bp, encoding 321 amino acids. Prokaryotic expression vector pET-28a-PnbHLH1 was constructed and transferred into the BL21 prokaryotic expression strain. An electrophoretic mobility shift assay of PnbHLH1 protein binding to E-box cis-acting elements verified that PnbHLH1 belonged to the bHLH class transcription factor which could interact with the promoter region of the E-box core sequence. The expression levels of key genes involved in the biosynthesis of triterpenoid saponins in PnbHLH1 transgenic cells were higher than those in the wild cells. Similarly, the total saponin contents were increased in the PnbHLH1 transgenic cell lines compared with the wild cell lines. Such results suggest that the PnbHLH1 transcription factor is a positive regulator in the biosynthesis of triterpenoid saponins in Panax notoginseng.

  14. Roles of Arabidopsis WRKY3 and WRKY4 Transcription Factors in Plant Responses to Pathogens

    Directory of Open Access Journals (Sweden)

    Fan Baofang

    2008-06-01

    Full Text Available Abstract Background Plant WRKY DNA-binding transcription factors are involved in plant responses to biotic and abiotic responses. It has been previously shown that Arabidopsis WRKY3 and WRKY4, which encode two structurally similar WRKY transcription factors, are induced by pathogen infection and salicylic acid (SA. However, the role of the two WRKY transcription factors in plant disease resistance has not been directly analyzed. Results Both WRKY3 and WRKY4 are nuclear-localized and specifically recognize the TTGACC W-box sequences in vitro. Expression of WRKY3 and WRKY4 was induced rapidly by stress conditions generated by liquid infiltration or spraying. Stress-induced expression of WRKY4 was further elevated by pathogen infection and SA treatment. To determine directly their role in plant disease resistance, we have isolated T-DNA insertion mutants and generated transgenic overexpression lines for WRKY3 and WRKY4. Both the loss-of-function mutants and transgenic overexpression lines were examined for responses to the biotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea. The wrky3 and wrky4 single and double mutants exhibited more severe disease symptoms and support higher fungal growth than wild-type plants after Botrytis infection. Although disruption of WRKY3 and WRKY4 did not have a major effect on plant response to P. syringae, overexpression of WRKY4 greatly enhanced plant susceptibility to the bacterial pathogen and suppressed pathogen-induced PR1 gene expression. Conclusion The nuclear localization and sequence-specific DNA-binding activity support that WRKY3 and WRKY4 function as transcription factors. Functional analysis based on T-DNA insertion mutants and transgenic overexpression lines indicates that WRKY3 and WRKY4 have a positive role in plant resistance to necrotrophic pathogens and WRKY4 has a negative effect on plant resistance to biotrophic pathogens.

  15. Global Mapping of Transcription Factor Binding Sites by Sequencing Chromatin Surrogates: a Perspective on Experimental Design, Data Analysis, and Open Problems.

    Science.gov (United States)

    Wei, Yingying; Wu, George; Ji, Hongkai

    2013-05-01

    Mapping genome-wide binding sites of all transcription factors (TFs) in all biological contexts is a critical step toward understanding gene regulation. The state-of-the-art technologies for mapping transcription factor binding sites (TFBSs) couple chromatin immunoprecipitation (ChIP) with high-throughput sequencing (ChIP-seq) or tiling array hybridization (ChIP-chip). These technologies have limitations: they are low-throughput with respect to surveying many TFs. Recent advances in genome-wide chromatin profiling, including development of technologies such as DNase-seq, FAIRE-seq and ChIP-seq for histone modifications, make it possible to predict in vivo TFBSs by analyzing chromatin features at computationally determined DNA motif sites. This promising new approach may allow researchers to monitor the genome-wide binding sites of many TFs simultaneously. In this article, we discuss various experimental design and data analysis issues that arise when applying this approach. Through a systematic analysis of the data from the Encyclopedia Of DNA Elements (ENCODE) project, we compare the predictive power of individual and combinations of chromatin marks using supervised and unsupervised learning methods, and evaluate the value of integrating information from public ChIP and gene expression data. We also highlight the challenges and opportunities for developing novel analytical methods, such as resolving the one-motif-multiple-TF ambiguity and distinguishing functional and non-functional TF binding targets from the predicted binding sites. The online version of this article (doi:10.1007/s12561-012-9066-5) contains supplementary material, which is available to authorized users.

  16. Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

    Science.gov (United States)

    Reid-Bayliss, Kate S; Loeb, Lawrence A

    2017-08-29

    Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

  17. Runx transcription factors in neuronal development

    Directory of Open Access Journals (Sweden)

    Shiga Takashi

    2008-08-01

    Full Text Available Abstract Runt-related (Runx transcription factors control diverse aspects of embryonic development and are responsible for the pathogenesis of many human diseases. In recent years, the functions of this transcription factor family in the nervous system have just begun to be understood. In dorsal root ganglion neurons, Runx1 and Runx3 play pivotal roles in the development of nociceptive and proprioceptive sensory neurons, respectively. Runx appears to control the transcriptional regulation of neurotrophin receptors, numerous ion channels and neuropeptides. As a consequence, Runx contributes to diverse aspects of the sensory system in higher vertebrates. In this review, we summarize recent progress in determining the role of Runx in neuronal development.

  18. The dynamic changes of DNA methylation and histone modifications of salt responsive transcription factor genes in soybean.

    Directory of Open Access Journals (Sweden)

    Yuguang Song

    Full Text Available Epigenetic modification contributes to the regulation of gene expression and plant development under salinity stress. Here we describe the identification of 49 soybean transcription factors by microarray analysis as being inducible by salinity stress. A semi-quantitative RT-PCR-based expression assay confirmed the salinity stress inducibility of 45 of these 49 transcription factors, and showed that ten of them were up-regulated when seedlings were exposed to the demethylation agent 5-aza-2-deoxycytidine. Salinity stress was shown to affect the methylation status of four of these ten transcription factors (one MYB, one b-ZIP and two AP2/DREB family members using a combination of bisulfite sequencing and DNA methylation-sensitive DNA gel blot analysis. ChIP analysis indicated that the activation of three of the four DNA methylated transcription factors was correlated with an increased level of histone H3K4 trimethylation and H3K9 acetylation, and/or a reduced level of H3K9 demethylation in various parts of the promoter or coding regions. Our results suggest a critical role for some transcription factors' activation/repression by DNA methylation and/or histone modifications in soybean tolerance to salinity stress.

  19. Potential Role of Activating Transcription Factor 5 during Osteogenesis

    Directory of Open Access Journals (Sweden)

    Luisa Vicari

    2016-01-01

    Full Text Available Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2, encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology.

  20. Potential Role of Activating Transcription Factor 5 during Osteogenesis.

    Science.gov (United States)

    Vicari, Luisa; Calabrese, Giovanna; Forte, Stefano; Giuffrida, Raffaella; Colarossi, Cristina; Parrinello, Nunziatina Laura; Memeo, Lorenzo

    2016-01-01

    Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB) family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2), encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology.

  1. Polyphenol Compound as a Transcription Factor Inhibitor.

    Science.gov (United States)

    Park, Seyeon

    2015-10-30

    A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor-DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein-protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1), c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and β-catenin/T cell factor (Tcf)).

  2. Lactation transcriptomics in the Australian marsupial, Macropus eugenii: transcript sequencing and quantification

    Directory of Open Access Journals (Sweden)

    Whitley Jane C

    2007-11-01

    Full Text Available Abstract Background Lactation is an important aspect of mammalian biology and, amongst mammals, marsupials show one of the most complex lactation cycles. Marsupials, such as the tammar wallaby (Macropus eugenii give birth to a relatively immature newborn and progressive changes in milk composition and milk production regulate early stage development of the young. Results In order to investigate gene expression in the marsupial mammary gland during lactation, a comprehensive set of cDNA libraries was derived from lactating tissues throughout the lactation cycle of the tammar wallaby. A total of 14,837 express sequence tags were produced by cDNA sequencing. Sequence analysis and sequence assembly were used to construct a comprehensive catalogue of mammary transcripts. Sequence data from pregnant and early or late lactating specific cDNA libraries and, data from early or late lactation massively parallel sequencing strategies were combined to analyse the variation of milk protein gene expression during the lactation cycle. Conclusion Results show a steady increase in expression of genes coding for secreted protein during the lactation cycle that is associated with high proportion of transcripts coding for milk proteins. In addition, genes involved in immune function, translation and energy or anabolic metabolism are expressed across the lactation cycle. A number of potential new milk proteins or mammary gland remodelling markers, including noncoding RNAs have been identified.

  3. A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Redman Julia C

    2008-07-01

    Full Text Available Abstract Background Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs, which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants. Results We established a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes. Conclusion High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.

  4. Radiation activation of transcription factors in mammalian cells

    International Nuclear Information System (INIS)

    Kraemer, M.; Stein, B.; Mai, S.; Kunz, E.; Koenig, H.; Ponta, H.; Herrlich, P.; Rahmsdorf, H.J.; Loferer, H.; Grunicke, H.H.

    1990-01-01

    In mammalian cells radiation induces the enhanced transcription of several genes. The cis acting elements in the control region of inducible genes have been delimited by site directed mutagenesis. Several different elements have been found in different genes. They do not only activate gene transcription in response to radiation but also in response to growth factors and to tumor promoter phorbol esters. The transcription factors binding to these elements are present also in non-irradiated cells, but their DNA binding activity and their transactivating capability is increased upon irradiation. The signal chain linking the primary radiation induced signal (damaged DNA) to the activation of transcription factors involves the action of (a) protein kinase(s). (orig.)

  5. Probabilistic Inference on Multiple Normalized Signal Profiles from Next Generation Sequencing: Transcription Factor Binding Sites

    KAUST Repository

    Wong, Ka-Chun; Peng, Chengbin; Li, Yue

    2015-01-01

    With the prevalence of chromatin immunoprecipitation (ChIP) with sequencing (ChIP-Seq) technology, massive ChIP-Seq data has been accumulated. The ChIP-Seq technology measures the genome-wide occupancy of DNA-binding proteins in vivo. It is well-known that different DNA-binding protein occupancies may result in a gene being regulated in different conditions (e.g. different cell types). To fully understand a gene's function, it is essential to develop probabilistic models on multiple ChIP-Seq profiles for deciphering the gene transcription causalities. In this work, we propose and describe two probabilistic models. Assuming the conditional independence of different DNA-binding proteins' occupancies, the first method (SignalRanker) is developed as an intuitive method for ChIP-Seq genome-wide signal profile inference. Unfortunately, such an assumption may not always hold in some gene regulation cases. Thus, we propose and describe another method (FullSignalRanker) which does not make the conditional independence assumption. The proposed methods are compared with other existing methods on ENCODE ChIP-Seq datasets, demonstrating its regression and classification ability. The results suggest that FullSignalRanker is the best-performing method for recovering the signal ranks on the promoter and enhancer regions. In addition, FullSignalRanker is also the best-performing method for peak sequence classification. We envision that SignalRanker and FullSignalRanker will become important in the era of next generation sequencing. FullSignalRanker program is available on the following website: http://www.cs.toronto.edu/∼wkc/FullSignalRanker/ © 2015 IEEE.

  6. Probabilistic Inference on Multiple Normalized Signal Profiles from Next Generation Sequencing: Transcription Factor Binding Sites

    KAUST Repository

    Wong, Ka-Chun

    2015-04-20

    With the prevalence of chromatin immunoprecipitation (ChIP) with sequencing (ChIP-Seq) technology, massive ChIP-Seq data has been accumulated. The ChIP-Seq technology measures the genome-wide occupancy of DNA-binding proteins in vivo. It is well-known that different DNA-binding protein occupancies may result in a gene being regulated in different conditions (e.g. different cell types). To fully understand a gene\\'s function, it is essential to develop probabilistic models on multiple ChIP-Seq profiles for deciphering the gene transcription causalities. In this work, we propose and describe two probabilistic models. Assuming the conditional independence of different DNA-binding proteins\\' occupancies, the first method (SignalRanker) is developed as an intuitive method for ChIP-Seq genome-wide signal profile inference. Unfortunately, such an assumption may not always hold in some gene regulation cases. Thus, we propose and describe another method (FullSignalRanker) which does not make the conditional independence assumption. The proposed methods are compared with other existing methods on ENCODE ChIP-Seq datasets, demonstrating its regression and classification ability. The results suggest that FullSignalRanker is the best-performing method for recovering the signal ranks on the promoter and enhancer regions. In addition, FullSignalRanker is also the best-performing method for peak sequence classification. We envision that SignalRanker and FullSignalRanker will become important in the era of next generation sequencing. FullSignalRanker program is available on the following website: http://www.cs.toronto.edu/∼wkc/FullSignalRanker/ © 2015 IEEE.

  7. Survival-related profile, pathways, and transcription factors in ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Anne P G Crijns

    2009-02-01

    Full Text Available BACKGROUND: Ovarian cancer has a poor prognosis due to advanced stage at presentation and either intrinsic or acquired resistance to classic cytotoxic drugs such as platinum and taxoids. Recent large clinical trials with different combinations and sequences of classic cytotoxic drugs indicate that further significant improvement in prognosis by this type of drugs is not to be expected. Currently a large number of drugs, targeting dysregulated molecular pathways in cancer cells have been developed and are introduced in the clinic. A major challenge is to identify those patients who will benefit from drugs targeting these specific dysregulated pathways.The aims of our study were (1 to develop a gene expression profile associated with overall survival in advanced stage serous ovarian cancer, (2 to assess the association of pathways and transcription factors with overall survival, and (3 to validate our identified profile and pathways/transcription factors in an independent set of ovarian cancers. METHODS AND FINDINGS: According to a randomized design, profiling of 157 advanced stage serous ovarian cancers was performed in duplicate using approximately 35,000 70-mer oligonucleotide microarrays. A continuous predictor of overall survival was built taking into account well-known issues in microarray analysis, such as multiple testing and overfitting. A functional class scoring analysis was utilized to assess pathways/transcription factors for their association with overall survival. The prognostic value of genes that constitute our overall survival profile was validated on a fully independent, publicly available dataset of 118 well-defined primary serous ovarian cancers. Furthermore, functional class scoring analysis was also performed on this independent dataset to assess the similarities with results from our own dataset. An 86-gene overall survival profile discriminated between patients with unfavorable and favorable prognosis (median survival, 19

  8. Genome-wide conserved consensus transcription factor binding motifs are hyper-methylated

    Directory of Open Access Journals (Sweden)

    Down Thomas A

    2010-09-01

    Full Text Available Abstract Background DNA methylation can regulate gene expression by modulating the interaction between DNA and proteins or protein complexes. Conserved consensus motifs exist across the human genome ("predicted transcription factor binding sites": "predicted TFBS" but the large majority of these are proven by chromatin immunoprecipitation and high throughput sequencing (ChIP-seq not to be biological transcription factor binding sites ("empirical TFBS". We hypothesize that DNA methylation at conserved consensus motifs prevents promiscuous or disorderly transcription factor binding. Results Using genome-wide methylation maps of the human heart and sperm, we found that all conserved consensus motifs as well as the subset of those that reside outside CpG islands have an aggregate profile of hyper-methylation. In contrast, empirical TFBS with conserved consensus motifs have a profile of hypo-methylation. 40% of empirical TFBS with conserved consensus motifs resided in CpG islands whereas only 7% of all conserved consensus motifs were in CpG islands. Finally we further identified a minority subset of TF whose profiles are either hypo-methylated or neutral at their respective conserved consensus motifs implicating that these TF may be responsible for establishing or maintaining an un-methylated DNA state, or whose binding is not regulated by DNA methylation. Conclusions Our analysis supports the hypothesis that at least for a subset of TF, empirical binding to conserved consensus motifs genome-wide may be controlled by DNA methylation.

  9. Integration and diversity of the regulatory network composed of Maf and CNC families of transcription factors.

    Science.gov (United States)

    Motohashi, Hozumi; O'Connor, Tania; Katsuoka, Fumiki; Engel, James Douglas; Yamamoto, Masayuki

    2002-07-10

    Recent progress in the analysis of transcriptional regulation has revealed the presence of an exquisite functional network comprising the Maf and Cap 'n' collar (CNC) families of regulatory proteins, many of which have been isolated. Among Maf factors, large Maf proteins are important in the regulation of embryonic development and cell differentiation, whereas small Maf proteins serve as obligatory heterodimeric partner molecules for members of the CNC family. Both Maf homodimers and CNC-small Maf heterodimers bind to the Maf recognition element (MARE). Since the MARE contains a consensus TRE sequence recognized by AP-1, Jun and Fos family members may act to compete or interfere with the function of CNC-small Maf heterodimers. Overall then, the quantitative balance of transcription factors interacting with the MARE determines its transcriptional activity. Many putative MARE-dependent target genes such as those induced by antioxidants and oxidative stress are under concerted regulation by the CNC family member Nrf2, as clearly proven by mouse germline mutagenesis. Since these genes represent a vital aspect of the cellular defense mechanism against oxidative stress, Nrf2-null mutant mice are highly sensitive to xenobiotic and oxidative insults. Deciphering the molecular basis of the regulatory network composed of Maf and CNC families of transcription factors will undoubtedly lead to a new paradigm for the cooperative function of transcription factors.

  10. Bivariate Genomic Footprinting Detects Changes in Transcription Factor Activity

    Directory of Open Access Journals (Sweden)

    Songjoon Baek

    2017-05-01

    Full Text Available In response to activating signals, transcription factors (TFs bind DNA and regulate gene expression. TF binding can be measured by protection of the bound sequence from DNase digestion (i.e., footprint. Here, we report that 80% of TF binding motifs do not show a measurable footprint, partly because of a variable cleavage pattern within the motif sequence. To more faithfully portray the effect of TFs on chromatin, we developed an algorithm that captures two TF-dependent effects on chromatin accessibility: footprinting and motif-flanking accessibility. The algorithm, termed bivariate genomic footprinting (BaGFoot, efficiently detects TF activity. BaGFoot is robust to different accessibility assays (DNase-seq, ATAC-seq, all examined peak-calling programs, and a variety of cut bias correction approaches. BaGFoot reliably predicts TF binding and provides valuable information regarding the TFs affecting chromatin accessibility in various biological systems and following various biological events, including in cases where an absolute footprint cannot be determined.

  11. Contribution of Sequence Motif, Chromatin State, and DNA Structure Features to Predictive Models of Transcription Factor Binding in Yeast.

    Science.gov (United States)

    Tsai, Zing Tsung-Yeh; Shiu, Shin-Han; Tsai, Huai-Kuang

    2015-08-01

    Transcription factor (TF) binding is determined by the presence of specific sequence motifs (SM) and chromatin accessibility, where the latter is influenced by both chromatin state (CS) and DNA structure (DS) properties. Although SM, CS, and DS have been used to predict TF binding sites, a predictive model that jointly considers CS and DS has not been developed to predict either TF-specific binding or general binding properties of TFs. Using budding yeast as model, we found that machine learning classifiers trained with either CS or DS features alone perform better in predicting TF-specific binding compared to SM-based classifiers. In addition, simultaneously considering CS and DS further improves the accuracy of the TF binding predictions, indicating the highly complementary nature of these two properties. The contributions of SM, CS, and DS features to binding site predictions differ greatly between TFs, allowing TF-specific predictions and potentially reflecting different TF binding mechanisms. In addition, a "TF-agnostic" predictive model based on three DNA "intrinsic properties" (in silico predicted nucleosome occupancy, major groove geometry, and dinucleotide free energy) that can be calculated from genomic sequences alone has performance that rivals the model incorporating experiment-derived data. This intrinsic property model allows prediction of binding regions not only across TFs, but also across DNA-binding domain families with distinct structural folds. Furthermore, these predicted binding regions can help identify TF binding sites that have a significant impact on target gene expression. Because the intrinsic property model allows prediction of binding regions across DNA-binding domain families, it is TF agnostic and likely describes general binding potential of TFs. Thus, our findings suggest that it is feasible to establish a TF agnostic model for identifying functional regulatory regions in potentially any sequenced genome.

  12. Contribution of Sequence Motif, Chromatin State, and DNA Structure Features to Predictive Models of Transcription Factor Binding in Yeast.

    Directory of Open Access Journals (Sweden)

    Zing Tsung-Yeh Tsai

    2015-08-01

    Full Text Available Transcription factor (TF binding is determined by the presence of specific sequence motifs (SM and chromatin accessibility, where the latter is influenced by both chromatin state (CS and DNA structure (DS properties. Although SM, CS, and DS have been used to predict TF binding sites, a predictive model that jointly considers CS and DS has not been developed to predict either TF-specific binding or general binding properties of TFs. Using budding yeast as model, we found that machine learning classifiers trained with either CS or DS features alone perform better in predicting TF-specific binding compared to SM-based classifiers. In addition, simultaneously considering CS and DS further improves the accuracy of the TF binding predictions, indicating the highly complementary nature of these two properties. The contributions of SM, CS, and DS features to binding site predictions differ greatly between TFs, allowing TF-specific predictions and potentially reflecting different TF binding mechanisms. In addition, a "TF-agnostic" predictive model based on three DNA "intrinsic properties" (in silico predicted nucleosome occupancy, major groove geometry, and dinucleotide free energy that can be calculated from genomic sequences alone has performance that rivals the model incorporating experiment-derived data. This intrinsic property model allows prediction of binding regions not only across TFs, but also across DNA-binding domain families with distinct structural folds. Furthermore, these predicted binding regions can help identify TF binding sites that have a significant impact on target gene expression. Because the intrinsic property model allows prediction of binding regions across DNA-binding domain families, it is TF agnostic and likely describes general binding potential of TFs. Thus, our findings suggest that it is feasible to establish a TF agnostic model for identifying functional regulatory regions in potentially any sequenced genome.

  13. Polyphenol Compound as a Transcription Factor Inhibitor

    Directory of Open Access Journals (Sweden)

    Seyeon Park

    2015-10-01

    Full Text Available A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor–DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein–protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1, c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB and β-catenin/T cell factor (Tcf.

  14. Triptolide inhibits transcription of hTERT through down-regulation of transcription factor specificity protein 1 in primary effusion lymphoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Long, Cong; Wang, Jingchao [Department of Pathogen Biology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); Guo, Wei [Department of Pathology and Physiology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); Wang, Huan; Wang, Chao; Liu, Yu [Department of Pathogen Biology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); Sun, Xiaoping, E-mail: xsun6@whu.edu.cn [Department of Pathogen Biology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); State Key Laboratory of Virology, Wuhan University, Wuhan, 430072 (China)

    2016-01-01

    Primary effusion lymphoma (PEL) is a rare and aggressive non-Hodgkin's lymphoma. Human telomerase reverse transcriptase (hTERT), a key component responsible for the regulation of telomerase activity, plays important roles in cellular immortalization and cancer development. Triptolide purified from Tripterygium extracts displays a broad-spectrum bioactivity profile, including immunosuppressive, anti-inflammatory, and anti-tumor. In this study, it is investigated whether triptolide reduces hTERT expression and suppresses its activity in PEL cells. The mRNA and protein levels of hTERT were examined by real time-PCR and Western blotting, respectively. The activity of hTERT promoter was determined by Dual luciferase reporter assay. Our results demonstrated that triptolide decreased expression of hTERT at both mRNA and protein levels. Further gene sequence analysis indicated that the activity of hTERT promoter was suppressed by triptolide. Triptolide also reduced the half-time of hTERT. Additionally, triptolide inhibited the expression of transcription factor specificity protein 1(Sp1) in PEL cells. Furthermore, knock-down of Sp1 by using specific shRNAs resulted in down-regulation of hTERT transcription and protein expression levels. Inhibition of Sp1 by specific shRNAs enhanced triptolide-induced cell growth inhibition and apoptosis. Collectively, our results demonstrate that the inhibitory effect of triptolide on hTERT transcription is possibly mediated by inhibition of transcription factor Sp1 in PEL cells. - Highlights: • Triptolide reduces expression of hTERT by decreasing its transcription level. • Triptolide reduces promoter activity and stability of hTERT. • Triptolide down-regulates expression of Sp1. • Special Sp1 shRNAs inhibit transcription and protein expression of hTERT. • Triptolide and Sp1 shRNA2 induce cell proliferation inhibition and apoptosis.

  15. miRNA Enriched in Human Neuroblast Nuclei Bind the MAZ Transcription Factor and Their Precursors Contain the MAZ Consensus Motif.

    Science.gov (United States)

    Goldie, Belinda J; Fitzsimmons, Chantel; Weidenhofer, Judith; Atkins, Joshua R; Wang, Dan O; Cairns, Murray J

    2017-01-01

    While the cytoplasmic function of microRNA (miRNA) as post-transcriptional regulators of mRNA has been the subject of significant research effort, their activity in the nucleus is less well characterized. Here we use a human neuronal cell model to show that some mature miRNA are preferentially enriched in the nucleus. These molecules were predominantly primate-specific and contained a sequence motif with homology to the consensus MAZ transcription factor binding element. Precursor miRNA containing this motif were shown to have affinity for MAZ protein in nuclear extract. We then used Ago1/2 RIP-Seq to explore nuclear miRNA-associated mRNA targets. Interestingly, the genes for Ago2-associated transcripts were also significantly enriched with MAZ binding sites and neural function, whereas Ago1-transcripts were associated with general metabolic processes and localized with SC35 spliceosomes. These findings suggest the MAZ transcription factor is associated with miRNA in the nucleus and may influence the regulation of neuronal development through Ago2-associated miRNA induced silencing complexes. The MAZ transcription factor may therefore be important for organizing higher order integration of transcriptional and post-transcriptional processes in primate neurons.

  16. Suppression of a NAC-like transcription factor gene improves boron-toxicity tolerance in rice.

    Science.gov (United States)

    Ochiai, Kumiko; Shimizu, Akifumi; Okumoto, Yutaka; Fujiwara, Toru; Matoh, Toru

    2011-07-01

    We identified a gene responsible for tolerance to boron (B) toxicity in rice (Oryza sativa), named BORON EXCESS TOLERANT1. Using recombinant inbred lines derived from the B-toxicity-sensitive indica-ecotype cultivar IR36 and the tolerant japonica-ecotype cultivar Nekken 1, the region responsible for tolerance to B toxicity was narrowed to 49 kb on chromosome 4. Eight genes are annotated in this region. The DNA sequence in this region was compared between the B-toxicity-sensitive japonica cultivar Wataribune and the B-toxicity-tolerant japonica cultivar Nipponbare by eco-TILLING analysis and revealed a one-base insertion mutation in the open reading frame sequence of the gene Os04g0477300. The gene encodes a NAC (NAM, ATAF, and CUC)-like transcription factor and the function of the transcript is abolished in B-toxicity-tolerant cultivars. Transgenic plants in which the expression of Os04g0477300 is abolished by RNA interference gain tolerance to B toxicity.

  17. Manipulation of flowering time and branching by overexpression of the tomato transcription factor SlZFP2.

    Science.gov (United States)

    Weng, Lin; Bai, Xiaodong; Zhao, Fangfang; Li, Rong; Xiao, Han

    2016-12-01

    Flowering of higher plants is orchestrated by complex regulatory networks through integration of various environmental signals such as photoperiod, temperature, light quality and developmental cues. In Arabidopsis, transcription of the flowering integrator gene FLOWERING LOCUS T (FT) that several flowering pathways converge to is directly regulated by more than ten transcription factors. However, very little is known about the transcriptional regulation of the FT homolog SINGLE FLOWER TRUESS (SFT) in the day-neutral plant tomato (Solanum lycopersicum). Previously, we showed that the zinc finger transcription factor SlZFP2 plays important roles in regulation of seed germination and fruit ripening in tomato and also found that overexpression of SlZFP2 impacted flowering and branching. Here, we characterized in detail the early flowering and high branching phenotypes by overexpression of this transcription factor. Our data showed that overexpression of SlZFP2 accelerated flowering in an SFT-dependent manner as demonstrated by elevated SFT expression in the leaves and the transcription factor's binding ability to SFT promoter in vitro and in vivo. Furthermore, overexpression of the SlZFP2 gene in the sft plants failed to rescue the mutant's late flowering. Through analysis of grafting phenotype, growth response of branches to auxin application and transcriptome profiling by RNA sequencing, we also showed that overexpression of SlZFP2 affected shoot apical dominance through multiple regulatory pathways. Our results suggest that the transcription factor SlZFP2 has potential applications in genetic modification of plant architecture and flowering time for tomato production and other crops as well. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Emerging Functions of Transcription Factors in Malaria Parasite

    Directory of Open Access Journals (Sweden)

    Renu Tuteja

    2011-01-01

    Full Text Available Transcription is a process by which the genetic information stored in DNA is converted into mRNA by enzymes known as RNA polymerase. Bacteria use only one RNA polymerase to transcribe all of its genes while eukaryotes contain three RNA polymerases to transcribe the variety of eukaryotic genes. RNA polymerase also requires other factors/proteins to produce the transcript. These factors generally termed as transcription factors (TFs are either associated directly with RNA polymerase or add in building the actual transcription apparatus. TFs are the most common tools that our cells use to control gene expression. Plasmodium falciparum is responsible for causing the most lethal form of malaria in humans. It shows most of its characteristics common to eukaryotic transcription but it is assumed that mechanisms of transcriptional control in P. falciparum somehow differ from those of other eukaryotes. In this article we describe the studies on the main TFs such as myb protein, high mobility group protein and ApiA2 family proteins from malaria parasite. These studies show that these TFs are slowly emerging to have defined roles in the regulation of gene expression in the parasite.

  19. A Myb transcription factor of Phytophthora sojae, regulated by MAP kinase PsSAK1, is required for zoospore development.

    Directory of Open Access Journals (Sweden)

    Meng Zhang

    Full Text Available PsSAK1, a mitogen-activated protein (MAP kinase from Phytophthora sojae, plays an important role in host infection and zoospore viability. However, the downstream mechanism of PsSAK1 remains unclear. In this study, the 3'-tag digital gene expression (DGE profiling method was applied to sequence the global transcriptional sequence of PsSAK1-silenced mutants during the cysts stage and 1.5 h after inoculation onto susceptible soybean leaf tissues. Compared with the gene expression levels of the recipient P. sojae strain, several candidates of Myb family were differentially expressed (up or down in response to the loss of PsSAK1, including of a R2R3-type Myb transcription factor, PsMYB1. qRT-PCR indicated that the transcriptional level of PsMYB1 decreased due to PsSAK1 silencing. The transcriptional level of PsMYB1 increased during sporulating hyphae, in germinated cysts, and early infection. Silencing of PsMYB1 results in three phenotypes: a no cleavage of the cytoplasm into uninucleate zoospores or release of normal zoospores, b direct germination of sporangia, and c afunction in zoospore-mediated plant infection. Our data indicate that the PsMYB1 transcription factor functions downstream of MAP kinase PsSAK1 and is required for zoospore development of P. sojae.

  20. Bioinformatics Identification of Modules of Transcription Factor Binding Sites in Alzheimer's Disease-Related Genes by In Silico Promoter Analysis and Microarrays

    Directory of Open Access Journals (Sweden)

    Regina Augustin

    2011-01-01

    Full Text Available The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases.

  1. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    Science.gov (United States)

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  2. A Herpesviral Immediate Early Protein Promotes Transcription Elongation of Viral Transcripts.

    Science.gov (United States)

    Fox, Hannah L; Dembowski, Jill A; DeLuca, Neal A

    2017-06-13

    Herpes simplex virus 1 (HSV-1) genes are transcribed by cellular RNA polymerase II (RNA Pol II). While four viral immediate early proteins (ICP4, ICP0, ICP27, and ICP22) function in some capacity in viral transcription, the mechanism by which ICP22 functions remains unclear. We observed that the FACT complex (comprised of SSRP1 and Spt16) was relocalized in infected cells as a function of ICP22. ICP22 was also required for the association of FACT and the transcription elongation factors SPT5 and SPT6 with viral genomes. We further demonstrated that the FACT complex interacts with ICP22 throughout infection. We therefore hypothesized that ICP22 recruits cellular transcription elongation factors to viral genomes for efficient transcription elongation of viral genes. We reevaluated the phenotype of an ICP22 mutant virus by determining the abundance of all viral mRNAs throughout infection by transcriptome sequencing (RNA-seq). The accumulation of almost all viral mRNAs late in infection was reduced compared to the wild type, regardless of kinetic class. Using chromatin immunoprecipitation sequencing (ChIP-seq), we mapped the location of RNA Pol II on viral genes and found that RNA Pol II levels on the bodies of viral genes were reduced in the ICP22 mutant compared to wild-type virus. In contrast, the association of RNA Pol II with transcription start sites in the mutant was not reduced. Taken together, our results indicate that ICP22 plays a role in recruiting elongation factors like the FACT complex to the HSV-1 genome to allow for efficient viral transcription elongation late in viral infection and ultimately infectious virion production. IMPORTANCE HSV-1 interacts with many cellular proteins throughout productive infection. Here, we demonstrate the interaction of a viral protein, ICP22, with a subset of cellular proteins known to be involved in transcription elongation. We determined that ICP22 is required to recruit the FACT complex and other transcription

  3. NUR TRANSCRIPTION FACTORS IN STRESS AND ADDICTION

    Directory of Open Access Journals (Sweden)

    Danae eCampos-Melo

    2013-12-01

    Full Text Available The Nur transcription factors Nur77 (NGFI-B, NR4A1, Nurr1 (NR4A2 and Nor-1 (NR4A3 are a sub-family of orphan members of the nuclear receptor superfamily. These transcription factors are products of immediate early genes, whose expression is rapidly and transiently induced in the central nervous system by several types of stimuli. Nur factors are present throughout the hypothalamus-pituitary-adrenal axis where are prominently induced in response to stress. Drugs of abuse and stress also induce the expression of Nur factors in nuclei of the motivation/reward circuit of the brain, indicating their participation in the process of drug addiction and in non-hypothalamic responses to stress. Repeated use of addictive drugs and chronic stress induce long-lasting dysregulation of the brain motivation/reward circuit, due to reprogramming of gene expression and enduring alterations in neuronal function. Here, we review the data supporting that Nur transcription factors are key players in the molecular basis of the dysregulation of neuronal circuits involved in chronic stress and addiction.

  4. Expression of early transcription factors Oct-4, Sox-2 and Nanog by porcine umbilical cord (PUC matrix cells

    Directory of Open Access Journals (Sweden)

    Schultz Bruce

    2006-02-01

    Full Text Available Abstract Background Three transcription factors that are expressed at high levels in embryonic stem cells (ESCs are Nanog, Oct-4 and Sox-2. These transcription factors regulate the expression of other genes during development and are found at high levels in the pluripotent cells of the inner cell mass. The downregulation of these three transcription factors correlates with the loss of pluripotency and self-renewal, and the beginning of subsequent differentiation steps. The roles of Nanog, Oct-4 and Sox-2 have not been fully elucidated. They are important in embryonic development and maintenance of pluripotency in ESCs. We studied the expression of these transcription factors in porcine umbilical cord (PUC matrix cells. Methods Cells were isolated from Wharton's jelly of porcine umbilical cords (PUC and histochemically assayed for the presence of alkaline phosphatase and the presence of Nanog, Oct-4 and Sox-2 mRNA and protein. PCR amplicons were sequenced and compared with known sequences. The synthesis of Oct-4 and Nanog protein was analyzed using immunocytochemistry. FACS analysis was utilized to evaluate Hoechst 33342 dye-stained cells. Results PUC isolates were maintained in culture and formed colonies that express alkaline phosphatase. FACS analysis revealed a side population of Hoechst dye-excluding cells, the Hoechst exclusion was verapamil sensitive. Quantitative and non-quantitative RT-PCR reactions revealed expression of Nanog, Oct-4 and Sox-2 in day 15 embryonic discs, PUC cell isolates and porcine fibroblasts. Immunocytochemical analysis detected Nanog immunoreactivity in PUC cell nuclei, and faint labeling in fibroblasts. Oct-4 immunoreactivity was detected in the nuclei of some PUC cells, but not in fibroblasts. Conclusion Cells isolated from PUC express three transcription factors found in pluripotent stem cell markers both at the mRNA and protein level. The presence of these transcription factors, along with the other

  5. Effect of chronic uremia on the transcriptional profile of the calcified aorta analyzed by RNA sequencing

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Gravesen, Eva; Mace, Maria L.

    2016-01-01

    The development of vascular calcification (VC) in chronic uremia (CU) is a tightly regulated process controlled by factors promoting and inhibiting mineralization. Next-generation high-throughput RNA sequencing (RNA-seq) is a powerful and sensitive tool for quantitative gene expression profiling...... with an expression level of >1 reads/kilobase transcript/million mapped reads, 2,663 genes were differentially expressed with 47% upregulated genes and 53% downregulated genes in uremic rats. Significantly deregulated genes were enriched for ontologies related to the extracellular matrix, response to wounding...

  6. The cellular transcription factor CREB corresponds to activating transcription factor 47 (ATF-47) and forms complexes with a group of polypeptides related to ATF-43.

    Science.gov (United States)

    Hurst, H C; Masson, N; Jones, N C; Lee, K A

    1990-12-01

    Promoter elements containing the sequence motif CGTCA are important for a variety of inducible responses at the transcriptional level. Multiple cellular factors specifically bind to these elements and are encoded by a multigene family. Among these factors, polypeptides termed activating transcription factor 43 (ATF-43) and ATF-47 have been purified from HeLa cells and a factor referred to as cyclic AMP response element-binding protein (CREB) has been isolated from PC12 cells and rat brain. We demonstrated that CREB and ATF-47 are identical and that CREB and ATF-43 form protein-protein complexes. We also found that the cis requirements for stable DNA binding by ATF-43 and CREB are different. Using antibodies to ATF-43 we have identified a group of polypeptides (ATF-43) in the size range from 40 to 43 kDa. ATF-43 polypeptides are related by their reactivity with anti-ATF-43, DNA-binding specificity, complex formation with CREB, heat stability, and phosphorylation by protein kinase A. Certain cell types vary in their ATF-43 complement, suggesting that CREB activity is modulated in a cell-type-specific manner through interaction with ATF-43. ATF-43 polypeptides do not appear simply to correspond to the gene products of the ATF multigene family, suggesting that the size of the ATF family at the protein level is even larger than predicted from cDNA-cloning studies.

  7. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  8. The herpes viral transcription factor ICP4 forms a novel DNA recognition complex

    Science.gov (United States)

    Tunnicliffe, Richard B.; Lockhart-Cairns, Michael P.; Levy, Colin; Mould, A. Paul; Jowitt, Thomas A.; Sito, Hilary; Baldock, Clair; Sandri-Goldin, Rozanne M.

    2017-01-01

    Abstract The transcription factor ICP4 from herpes simplex virus has a central role in regulating the gene expression cascade which controls viral infection. Here we present the crystal structure of the functionally essential ICP4 DNA binding domain in complex with a segment from its own promoter, revealing a novel homo-dimeric fold. We also studied the complex in solution by small angle X-Ray scattering, nuclear magnetic resonance and surface-plasmon resonance which indicated that, in addition to the globular domain, a flanking intrinsically disordered region also recognizes DNA. Together the data provides a rationale for the bi-partite nature of the ICP4 DNA recognition consensus sequence as the globular and disordered regions bind synergistically to adjacent DNA motifs. Therefore in common with its eukaryotic host, the viral transcription factor ICP4 utilizes disordered regions to enhance the affinity and tune the specificity of DNA interactions in tandem with a globular domain. PMID:28505309

  9. miRNA Enriched in Human Neuroblast Nuclei Bind the MAZ Transcription Factor and Their Precursors Contain the MAZ Consensus Motif

    Directory of Open Access Journals (Sweden)

    Belinda J. Goldie

    2017-08-01

    Full Text Available While the cytoplasmic function of microRNA (miRNA as post-transcriptional regulators of mRNA has been the subject of significant research effort, their activity in the nucleus is less well characterized. Here we use a human neuronal cell model to show that some mature miRNA are preferentially enriched in the nucleus. These molecules were predominantly primate-specific and contained a sequence motif with homology to the consensus MAZ transcription factor binding element. Precursor miRNA containing this motif were shown to have affinity for MAZ protein in nuclear extract. We then used Ago1/2 RIP-Seq to explore nuclear miRNA-associated mRNA targets. Interestingly, the genes for Ago2-associated transcripts were also significantly enriched with MAZ binding sites and neural function, whereas Ago1-transcripts were associated with general metabolic processes and localized with SC35 spliceosomes. These findings suggest the MAZ transcription factor is associated with miRNA in the nucleus and may influence the regulation of neuronal development through Ago2-associated miRNA induced silencing complexes. The MAZ transcription factor may therefore be important for organizing higher order integration of transcriptional and post-transcriptional processes in primate neurons.

  10. A deeper look into transcription regulatory code by preferred pair distance templates for transcription factor binding sites

    KAUST Repository

    Kulakovskiy, Ivan V.; Belostotsky, A. A.; Kasianov, Artem S.; Esipova, Natalia G.; Medvedeva, Yulia; Eliseeva, Irina A.; Makeev, Vsevolod J.

    2011-01-01

    Motivation: Modern experimental methods provide substantial information on protein-DNA recognition. Studying arrangements of transcription factor binding sites (TFBSs) of interacting transcription factors (TFs) advances understanding

  11. Developmental roles of 21 Drosophila transcription factors are determined by quantitative differences in binding to an overlapping set of thousands of genomic regions

    Energy Technology Data Exchange (ETDEWEB)

    MacArthur, Stewart; Li, Xiao-Yong; Li, Jingyi; Brown, James B.; Chu, Hou Cheng; Zeng, Lucy; Grondona, Brandi P.; Hechmer, Aaron; Simirenko, Lisa; Keranen, Soile V.E.; Knowles, David W.; Stapleton, Mark; Bickel, Peter; Biggin, Mark D.; Eisen, Michael B.

    2009-05-15

    BACKGROUND: We previously established that six sequence-specific transcription factors that initiate anterior/posterior patterning in Drosophila bind to overlapping sets of thousands of genomic regions in blastoderm embryos. While regions bound at high levels include known and probable functional targets, more poorly bound regions are preferentially associated with housekeeping genes and/or genes not transcribed in the blastoderm, and are frequently found in protein coding sequences or in less conserved non-coding DNA, suggesting that many are likely non-functional. RESULTS: Here we show that an additional 15 transcription factors that regulate other aspects of embryo patterning show a similar quantitative continuum of function and binding to thousands of genomic regions in vivo. Collectively, the 21 regulators show a surprisingly high overlap in the regions they bind given that they belong to 11 DNA binding domain families, specify distinct developmental fates, and can act via different cis-regulatory modules. We demonstrate, however, that quantitative differences in relative levels of binding to shared targets correlate with the known biological and transcriptional regulatory specificities of these factors. CONCLUSIONS: It is likely that the overlap in binding of biochemically and functionally unrelated transcription factors arises from the high concentrations of these proteins in nuclei, which, coupled with their broad DNA binding specificities, directs them to regions of open chromatin. We suggest that most animal transcription factors will be found to show a similar broad overlapping pattern of binding in vivo, with specificity achieved by modulating the amount, rather than the identity, of bound factor.

  12. Computer and Statistical Analysis of Transcription Factor Binding and Chromatin Modifications by ChIP-seq data in Embryonic Stem Cell

    Directory of Open Access Journals (Sweden)

    Orlov Yuriy

    2012-06-01

    Full Text Available Advances in high throughput sequencing technology have enabled the identification of transcription factor (TF binding sites in genome scale. TF binding studies are important for medical applications and stem cell research. Somatic cells can be reprogrammed to a pluripotent state by the combined introduction of factors such as Oct4, Sox2, c-Myc, Klf4. These reprogrammed cells share many characteristics with embryonic stem cells (ESCs and are known as induced pluripotent stem cells (iPSCs. The signaling requirements for maintenance of human and murine embryonic stem cells (ESCs differ considerably. Genome wide ChIP-seq TF binding maps in mouse stem cells include Oct4, Sox2, Nanog, Tbx3, Smad2 as well as group of other factors. ChIP-seq allows study of new candidate transcription factors for reprogramming. It was shown that Nr5a2 could replace Oct4 for reprogramming. Epigenetic modifications play important role in regulation of gene expression adding additional complexity to transcription network functioning. We have studied associations between different histone modification using published data together with RNA Pol II sites. We found strong associations between activation marks and TF binding sites and present it qualitatively. To meet issues of statistical analysis of genome ChIP-sequencing maps we developed computer program to filter out noise signals and find significant association between binding site affinity and number of sequence reads. The data provide new insights into the function of chromatin organization and regulation in stem cells.

  13. Factor requirements for transcription in the Archaeon Sulfolobus shibatae.

    Science.gov (United States)

    Qureshi, S A; Bell, S D; Jackson, S P

    1997-05-15

    Archaea (archaebacteria) constitute a domain of life that is distinct from Bacteria (eubacteria) and Eucarya (eukaryotes). Although archaeal cells share many morphological features with eubacteria, their transcriptional apparatus is more akin to eukaryotic RNA polymerases I, II and III than it is to eubacterial transcription systems. Thus, in addition to possessing a 10 subunit RNA polymerase and a homologue of the TATA-binding protein (TBP), Archaea possess a polypeptide termed TFB that is homologous to eukaryotic TFIIB. Here, we investigate the factor requirements for transcription of several promoters of the archaeon Sulfolobus shibatae and its associated virus SSV. Through in vitro transcription and immunodepletion, we demonstrate that S. shibatae TBP, TFB and RNA polymerase are not complexed tightly with one another and that each is required for efficient transcription of all promoters tested. Furthermore, full transcription is restored by supplementing respective depleted extracts with recombinant TBP or TFB, indicating that TBP-associated factors or TFB-associated factors are not required. Indeed, gel-filtration suggests that Sulfolobus TBP and TFB are not associated stably with other proteins. Finally, all promoters analysed are transcribed accurately and efficiently in an in vitro system comprising recombinant TBP and TFB, together with essentially homogeneous preparation of RNA polymerase. Transcription in Archaea is therefore fundamentally homologous to that in eukaryotes, although factor requirements appear to be much less complex.

  14. Transcription factor-based biosensor

    Science.gov (United States)

    Dietrich, Jeffrey A; Keasling, Jay D

    2013-10-08

    The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.

  15. Transcription-factor-mediated DNA looping probed by high-resolution, single-molecule imaging in live E. coli cells.

    Directory of Open Access Journals (Sweden)

    Zach Hensel

    Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.

  16. Detecting Differential Transcription Factor Activity from ATAC-Seq Data

    Directory of Open Access Journals (Sweden)

    Ignacio J. Tripodi

    2018-05-01

    Full Text Available Transcription factors are managers of the cellular factory, and key components to many diseases. Many non-coding single nucleotide polymorphisms affect transcription factors, either by directly altering the protein or its functional activity at individual binding sites. Here we first briefly summarize high-throughput approaches to studying transcription factor activity. We then demonstrate, using published chromatin accessibility data (specifically ATAC-seq, that the genome-wide profile of TF recognition motifs relative to regions of open chromatin can determine the key transcription factor altered by a perturbation. Our method of determining which TFs are altered by a perturbation is simple, is quick to implement, and can be used when biological samples are limited. In the future, we envision that this method could be applied to determine which TFs show altered activity in response to a wide variety of drugs and diseases.

  17. DPI-ELISA: a fast and versatile method to specify the binding of plant transcription factors to DNA in vitro

    Directory of Open Access Journals (Sweden)

    Chaban Christina

    2010-11-01

    Full Text Available Abstract Background About 10% of all genes in eukaryote genomes are predicted to encode transcription factors. The specific binding of transcription factors to short DNA-motifs influences the expression of neighbouring genes. However, little is known about the DNA-protein interaction itself. To date there are only a few suitable methods to characterise DNA-protein-interactions, among which the EMSA is the method most frequently used in laboratories. Besides EMSA, several protocols describe the effective use of an ELISA-based transcription factor binding assay e.g. for the analysis of human NFκB binding to specific DNA sequences. Results We provide a unified protocol for this type of ELISA analysis, termed DNA-Protein-Interaction (DPI-ELISA. Qualitative analyses with His-epitope tagged plant transcription factors expressed in E. coli revealed that EMSA and DPI-ELISA result in comparable and reproducible data. The binding of AtbZIP63 to the C-box and AtWRKY11 to the W2-box could be reproduced and validated by both methods. We next examined the physical binding of the C-terminal DNA-binding domains of AtWRKY33, AtWRKY50 and AtWRKY75 to the W2-box. Although the DNA-binding domain is highly conserved among the WRKY proteins tested, the use of the DPI-ELISA discloses differences in W2-box binding properties between these proteins. In addition to these well-studied transcription factor families, we applied our protocol to AtBPC2, a member of the so far uncharacterised plant specific Basic Pentacysteine transcription factor family. We could demonstrate binding to GA/TC-dinucleotide repeat motifs by our DPI-ELISA protocol. Different buffers and reaction conditions were examined. Conclusions We successfully applied our DPI-ELISA protocol to investigate the DNA-binding specificities of three different classes of transcription factors from Arabidopsis thaliana. However, the analysis of the binding affinity of any DNA-binding protein to any given DNA

  18. Functional Profiling of Transcription Factor Genes in Neurospora crassa

    Directory of Open Access Journals (Sweden)

    Alexander J. Carrillo

    2017-09-01

    Full Text Available Regulation of gene expression by DNA-binding transcription factors is essential for proper control of growth and development in all organisms. In this study, we annotate and characterize growth and developmental phenotypes for transcription factor genes in the model filamentous fungus Neurospora crassa. We identified 312 transcription factor genes, corresponding to 3.2% of the protein coding genes in the genome. The largest class was the fungal-specific Zn2Cys6 (C6 binuclear cluster, with 135 members, followed by the highly conserved C2H2 zinc finger group, with 61 genes. Viable knockout mutants were produced for 273 genes, and complete growth and developmental phenotypic data are available for 242 strains, with 64% possessing at least one defect. The most prominent defect observed was in growth of basal hyphae (43% of mutants analyzed, followed by asexual sporulation (38%, and the various stages of sexual development (19%. Two growth or developmental defects were observed for 21% of the mutants, while 8% were defective in all three major phenotypes tested. Analysis of available mRNA expression data for a time course of sexual development revealed mutants with sexual phenotypes that correlate with transcription factor transcript abundance in wild type. Inspection of this data also implicated cryptic roles in sexual development for several cotranscribed transcription factor genes that do not produce a phenotype when mutated.

  19. A Herpesviral Immediate Early Protein Promotes Transcription Elongation of Viral Transcripts

    Directory of Open Access Journals (Sweden)

    Hannah L. Fox

    2017-06-01

    Full Text Available Herpes simplex virus 1 (HSV-1 genes are transcribed by cellular RNA polymerase II (RNA Pol II. While four viral immediate early proteins (ICP4, ICP0, ICP27, and ICP22 function in some capacity in viral transcription, the mechanism by which ICP22 functions remains unclear. We observed that the FACT complex (comprised of SSRP1 and Spt16 was relocalized in infected cells as a function of ICP22. ICP22 was also required for the association of FACT and the transcription elongation factors SPT5 and SPT6 with viral genomes. We further demonstrated that the FACT complex interacts with ICP22 throughout infection. We therefore hypothesized that ICP22 recruits cellular transcription elongation factors to viral genomes for efficient transcription elongation of viral genes. We reevaluated the phenotype of an ICP22 mutant virus by determining the abundance of all viral mRNAs throughout infection by transcriptome sequencing (RNA-seq. The accumulation of almost all viral mRNAs late in infection was reduced compared to the wild type, regardless of kinetic class. Using chromatin immunoprecipitation sequencing (ChIP-seq, we mapped the location of RNA Pol II on viral genes and found that RNA Pol II levels on the bodies of viral genes were reduced in the ICP22 mutant compared to wild-type virus. In contrast, the association of RNA Pol II with transcription start sites in the mutant was not reduced. Taken together, our results indicate that ICP22 plays a role in recruiting elongation factors like the FACT complex to the HSV-1 genome to allow for efficient viral transcription elongation late in viral infection and ultimately infectious virion production.

  20. Amplification of pico-scale DNA mediated by bacterial carrier DNA for small-cell-number transcription factor ChIP-seq

    DEFF Research Database (Denmark)

    Jakobsen, Janus S; Bagger, Frederik O; Hasemann, Marie S

    2015-01-01

    BACKGROUND: Chromatin-Immunoprecipitation coupled with deep sequencing (ChIP-seq) is used to map transcription factor occupancy and generate epigenetic profiles genome-wide. The requirement of nano-scale ChIP DNA for generation of sequencing libraries has impeded ChIP-seq on in vivo tissues of low...... transcription factor (CEBPA) and histone mark (H3K4me3) ChIP. We further demonstrate that genomic profiles are highly resilient to changes in carrier DNA to ChIP DNA ratios. CONCLUSIONS: This represents a significant advance compared to existing technologies, which involve either complex steps of pre...... cell numbers. RESULTS: We describe a robust, simple and scalable methodology for ChIP-seq of low-abundant cell populations, verified down to 10,000 cells. By employing non-mammalian genome mapping bacterial carrier DNA during amplification, we reliably amplify down to 50 pg of ChIP DNA from...

  1. Cyclin D3 interacts with human activating transcription factor 5 and potentiates its transcription activity

    International Nuclear Information System (INIS)

    Liu Wenjin; Sun Maoyun; Jiang Jianhai; Shen Xiaoyun; Sun Qing; Liu Weicheng; Shen Hailian; Gu Jianxin

    2004-01-01

    The Cyclin D3 protein is a member of the D-type cyclins. Besides serving as cell cycle regulators, D-type cyclins have been reported to be able to interact with several transcription factors and modulate their transcriptional activations. Here we report that human activating transcription factor 5 (hATF5) is a new interacting partner of Cyclin D3. The interaction was confirmed by in vivo coimmunoprecipitation and in vitro binding analysis. Neither interaction between Cyclin D1 and hATF5 nor interaction between Cyclin D2 and hATF5 was observed. Confocal microscopy analysis showed that Cyclin D3 could colocalize with hATF5 in the nuclear region. Cyclin D3 could potentiate hATF5 transcriptional activity independently of its Cdk4 partner. But Cyclin D1 and Cyclin D2 had no effect on hATF5 transcriptional activity. These data provide a new clue to understand the new role of Cyclin D3 as a transcriptional regulator

  2. Suppression of a NAC-Like Transcription Factor Gene Improves Boron-Toxicity Tolerance in Rice1

    Science.gov (United States)

    Ochiai, Kumiko; Shimizu, Akifumi; Okumoto, Yutaka; Fujiwara, Toru; Matoh, Toru

    2011-01-01

    We identified a gene responsible for tolerance to boron (B) toxicity in rice (Oryza sativa), named BORON EXCESS TOLERANT1. Using recombinant inbred lines derived from the B-toxicity-sensitive indica-ecotype cultivar IR36 and the tolerant japonica-ecotype cultivar Nekken 1, the region responsible for tolerance to B toxicity was narrowed to 49 kb on chromosome 4. Eight genes are annotated in this region. The DNA sequence in this region was compared between the B-toxicity-sensitive japonica cultivar Wataribune and the B-toxicity-tolerant japonica cultivar Nipponbare by eco-TILLING analysis and revealed a one-base insertion mutation in the open reading frame sequence of the gene Os04g0477300. The gene encodes a NAC (NAM, ATAF, and CUC)-like transcription factor and the function of the transcript is abolished in B-toxicity-tolerant cultivars. Transgenic plants in which the expression of Os04g0477300 is abolished by RNA interference gain tolerance to B toxicity. PMID:21543724

  3. Modulation of DNA binding by gene-specific transcription factors.

    Science.gov (United States)

    Schleif, Robert F

    2013-10-01

    The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

  4. Transcriptional repression of BODENLOS by HD-ZIP transcription factor HB5 in Arabidopsis thaliana.

    NARCIS (Netherlands)

    Smet, De I.; Lau, S.; Ehrismann, J.S.; Axiotis, I.; Kolb, M.; Kientz, M.; Weijers, D.; Jürgens, G.

    2013-01-01

    In Arabidopsis thaliana, the phytohormone auxin is an important patterning agent during embryogenesis and post-embryonic development, exerting effects through transcriptional regulation. The main determinants of the transcriptional auxin response machinery are AUXIN RESPONSE FACTOR (ARF)

  5. Cloning and functional analysis of human mTERFL encoding a novel mitochondrial transcription termination factor-like protein

    International Nuclear Information System (INIS)

    Chen Yao; Zhou Guangjin; Yu Min; He Yungang; Tang Wei; Lai Jianhua; He Jie; Liu Wanguo; Tan Deyong

    2005-01-01

    Serum plays an important role in the regulation of cell cycle and cell growth. To identify novel serum-inhibitory factors and study their roles in cell cycle regulation, we performed mRNA differential display analysis of U251 cells in the presence or absence of serum and cloned a novel gene encoding the human mitochondrial transcription termination factor-like protein (mTERFL). The full-length mTERFL cDNA has been isolated and the genomic structure determined. The mTERFL gene consists of three exons and encodes 385 amino acids with 52% sequence similarity to the human mitochondrial transcription termination factor (mTERF). However, mTERFL and mTERF have an opposite expression pattern in response to serum. The expression of mTERFL is dramatically inhibited by the addition of serum in serum-starved cells while the mTERF is rather induced. Northern blot analysis detected three mTERFL transcripts of 1.7, 3.2, and 3.5 kb. Besides the 3.2 kb transcript that is unique to skeletal muscle, other two transcripts express predominant in heart, liver, pancreas, and skeletal muscle. Expression of the GFP-mTERFL fusion protein in HeLa cells localized it to the mitochondria. Furthermore, ectopic expression of mTERFL suppresses cell growth and arrests cells in the G1 stage demonstrated by MTT and flow cytometry analysis. Collectively, our data suggest that mTERFL is a novel mTERF family member and a serum-inhibitory factor probably participating in the regulation of cell growth through the modulation of mitochondrial transcription

  6. Comparative analyses of six solanaceous transcriptomes reveal a high degree of sequence conservation and species-specific transcripts

    Directory of Open Access Journals (Sweden)

    Ouyang Shu

    2005-09-01

    Full Text Available Abstract Background The Solanaceae is a family of closely related species with diverse phenotypes that have been exploited for agronomic purposes. Previous studies involving a small number of genes suggested sequence conservation across the Solanaceae. The availability of large collections of Expressed Sequence Tags (ESTs for the Solanaceae now provides the opportunity to assess sequence conservation and divergence on a genomic scale. Results All available ESTs and Expressed Transcripts (ETs, 449,224 sequences for six Solanaceae species (potato, tomato, pepper, petunia, tobacco and Nicotiana benthamiana, were clustered and assembled into gene indices. Examination of gene ontologies revealed that the transcripts within the gene indices encode a similar suite of biological processes. Although the ESTs and ETs were derived from a variety of tissues, 55–81% of the sequences had significant similarity at the nucleotide level with sequences among the six species. Putative orthologs could be identified for 28–58% of the sequences. This high degree of sequence conservation was supported by expression profiling using heterologous hybridizations to potato cDNA arrays that showed similar expression patterns in mature leaves for all six solanaceous species. 16–19% of the transcripts within the six Solanaceae gene indices did not have matches among Solanaceae, Arabidopsis, rice or 21 other plant gene indices. Conclusion Results from this genome scale analysis confirmed a high level of sequence conservation at the nucleotide level of the coding sequence among Solanaceae. Additionally, the results indicated that part of the Solanaceae transcriptome is likely to be unique for each species.

  7. A transcription factor collective defines the HSN serotonergic neuron regulatory landscape.

    Science.gov (United States)

    Lloret-Fernández, Carla; Maicas, Miren; Mora-Martínez, Carlos; Artacho, Alejandro; Jimeno-Martín, Ángela; Chirivella, Laura; Weinberg, Peter; Flames, Nuria

    2018-03-22

    Cell differentiation is controlled by individual transcription factors (TFs) that together activate a selection of enhancers in specific cell types. How these combinations of TFs identify and activate their target sequences remains poorly understood. Here, we identify the cis -regulatory transcriptional code that controls the differentiation of serotonergic HSN neurons in Caenorhabditis elegans . Activation of the HSN transcriptome is directly orchestrated by a collective of six TFs. Binding site clusters for this TF collective form a regulatory signature that is sufficient for de novo identification of HSN neuron functional enhancers. Among C. elegans neurons, the HSN transcriptome most closely resembles that of mouse serotonergic neurons. Mouse orthologs of the HSN TF collective also regulate serotonergic differentiation and can functionally substitute for their worm counterparts which suggests deep homology. Our results identify rules governing the regulatory landscape of a critically important neuronal type in two species separated by over 700 million years. © 2018, Lloret-Fernández et al.

  8. RNF11 is a multifunctional modulator of growth factor receptor signalling and transcriptional regulation.

    Science.gov (United States)

    Azmi, Peter; Seth, Arun

    2005-11-01

    Our laboratory has found that the 154aa RING finger protein 11 (RNF11), has modular domains and motifs including a RING-H2 finger domain, a PY motif, an ubiquitin interacting motif (UIM), a 14-3-3 binding sequence and an AKT phosphorylation site. RNF11 represents a unique protein with no other known immediate family members yet described. Comparative genetic analysis has shown that RNF11 is highly conserved throughout evolution. This may indicate a conserved and non-redundant role for the RNF11 protein. Molecular binding assays using RNF11 have shown that RNF11 has important roles in growth factor signalling, ubiquitination and transcriptional regulation. RNF11 has been shown to interact with HECT-type E3 ubiquitin ligases Nedd4, AIP4, Smurf1 and Smurf2, as well as with Cullin1, the core protein in the multi-subunit SCF E3 ubiquitin ligase complex. Work done in our laboratory has shown that RNF11 is capable of antagonizing Smurf2-mediated inhibition of TGFbeta signalling. Furthermore, RNF11 is capable of degrading AMSH, a positive regulator of both TGFbeta and EGFR signalling pathways. Recently, we have found that RNF11 can directly enhance TGFbeta signalling through a direct association with Smad4, the common signal transducer and transcription factor in the TGFbeta, BMP, and Activin pathways. Through its association with Smad4 and other transcription factors, RNF11 may have a role in direct transcriptional regulation. Our laboratory and others have found nearly 80 protein interactions for RNF11, placing RNF11 at the cross-roads of cell signalling and transcriptional regulation. RNF11 is highly expressed in breast tumours. Deregulation of RNF11 function may prove to be harmful to patient therapeutic outcomes. RNF11 may therefore provide a novel target for cancer therapeutics. The purpose of this review is to discuss the role of RNF11 in cell signalling and transcription factor modulation with special attention given to the ubiquitin-proteasomal pathway, TGFbeta

  9. Expression of a splice variant of the platelet-activating factor receptor transcript 2 in various human cancer cell lines

    Directory of Open Access Journals (Sweden)

    Ibtissam Youlyouz

    2002-01-01

    Full Text Available Platelet-activating factor receptor (PAF-R transcripts were analysed by reverse transcriptase-polymerase chain reaction in five human cancer cell lines derived from the breast (BT20, SKBR3 and T47D cells, the pancreas (Miapaca cells and the bladder (5637 cells in order to confirm the existence of a splice variant of the PAF-R transcript 2. After cloning and sequencing, we confirmed its existence in all cell lines. It consisted of the PAF-R transcript 2 lengthening with 82 nucleotides from the 3' end of exon 1 of the PAF-R gene. The role of this elongated form of the tissue-type PAF-R transcript in cell physiology remains to be elucidated.

  10. A critique on nuclear factor-kappa B and signal transducer and activator of transcription 3: The key transcription factors in periodontal pathogenesis

    Directory of Open Access Journals (Sweden)

    Ranjith Ambili

    2017-01-01

    Full Text Available Periodontal disease is initiated by microorganisms in dental plaque, and host immunoinflammatory response to the microbial challenge helps in disease progression. Conventional periodontal therapy was mainly targeted on the elimination of microbial component. However, a better understanding of molecular aspects in host response will enable the clinicians to formulate effective host modulation therapy (HMT for the periodontal management. Inflammatory mediators were the main targets for HMT in the past. Transcription factors can regulate the production of multiple mediators simultaneously, and inhibition of these factors will be more beneficial than blocking individual molecule. Two important transcription factors implicated in chronic inflammatory diseases are nuclear factor kappa B (NF-κB and signal transducers and activators of transcription 3. The role of these factors in periodontal disease is a less explored area. This comprehensive review is aimed at unveiling the critical role of NF-κB and signal transducers and activators of transcription 3 in periodontal pathogenesis. An online search was performed using MEDLINE/PubMed database. All publications till 2016 related to NF-κB, signal transducer and activator of transcription 3 (STAT3, and inflammation were included in writing this review. A total of 27,390 references were published based on the search terms used. Out of these, 507 were related to the periodontal research published in English till 2016. Relevant papers were chosen after carefully reading the abstract. This review has attempted to comprehend the existing knowledge regarding the role of transcription factors NF-κB and STAT3 in periodontal disease. Moreover, it also provides a connecting molecular link for the periodontal medicine concept.

  11. Uncovering transcriptional interactions via an adaptive fuzzy logic approach

    Directory of Open Access Journals (Sweden)

    Chen Chung-Ming

    2009-12-01

    Full Text Available Abstract Background To date, only a limited number of transcriptional regulatory interactions have been uncovered. In a pilot study integrating sequence data with microarray data, a position weight matrix (PWM performed poorly in inferring transcriptional interactions (TIs, which represent physical interactions between transcription factors (TF and upstream sequences of target genes. Inferring a TI means that the promoter sequence of a target is inferred to match the consensus sequence motifs of a potential TF, and their interaction type such as AT or RT is also predicted. Thus, a robust PWM (rPWM was developed to search for consensus sequence motifs. In addition to rPWM, one feature extracted from ChIP-chip data was incorporated to identify potential TIs under specific conditions. An interaction type classifier was assembled to predict activation/repression of potential TIs using microarray data. This approach, combining an adaptive (learning fuzzy inference system and an interaction type classifier to predict transcriptional regulatory networks, was named AdaFuzzy. Results AdaFuzzy was applied to predict TIs using real genomics data from Saccharomyces cerevisiae. Following one of the latest advances in predicting TIs, constrained probabilistic sparse matrix factorization (cPSMF, and using 19 transcription factors (TFs, we compared AdaFuzzy to four well-known approaches using over-representation analysis and gene set enrichment analysis. AdaFuzzy outperformed these four algorithms. Furthermore, AdaFuzzy was shown to perform comparably to 'ChIP-experimental method' in inferring TIs identified by two sets of large scale ChIP-chip data, respectively. AdaFuzzy was also able to classify all predicted TIs into one or more of the four promoter architectures. The results coincided with known promoter architectures in yeast and provided insights into transcriptional regulatory mechanisms. Conclusion AdaFuzzy successfully integrates multiple types of

  12. Hybrid incompatibility arises in a sequence-based bioenergetic model of transcription factor binding.

    Science.gov (United States)

    Tulchinsky, Alexander Y; Johnson, Norman A; Watt, Ward B; Porter, Adam H

    2014-11-01

    Postzygotic isolation between incipient species results from the accumulation of incompatibilities that arise as a consequence of genetic divergence. When phenotypes are determined by regulatory interactions, hybrid incompatibility can evolve even as a consequence of parallel adaptation in parental populations because interacting genes can produce the same phenotype through incompatible allelic combinations. We explore the evolutionary conditions that promote and constrain hybrid incompatibility in regulatory networks using a bioenergetic model (combining thermodynamics and kinetics) of transcriptional regulation, considering the bioenergetic basis of molecular interactions between transcription factors (TFs) and their binding sites. The bioenergetic parameters consider the free energy of formation of the bond between the TF and its binding site and the availability of TFs in the intracellular environment. Together these determine fractional occupancy of the TF on the promoter site, the degree of subsequent gene expression and in diploids, and the degree of dominance among allelic interactions. This results in a sigmoid genotype-phenotype map and fitness landscape, with the details of the shape determining the degree of bioenergetic evolutionary constraint on hybrid incompatibility. Using individual-based simulations, we subjected two allopatric populations to parallel directional or stabilizing selection. Misregulation of hybrid gene expression occurred under either type of selection, although it evolved faster under directional selection. Under directional selection, the extent of hybrid incompatibility increased with the slope of the genotype-phenotype map near the derived parental expression level. Under stabilizing selection, hybrid incompatibility arose from compensatory mutations and was greater when the bioenergetic properties of the interaction caused the space of nearly neutral genotypes around the stable expression level to be wide. F2's showed higher

  13. Genomic analysis of NAC transcription factors in banana (Musa acuminata) and definition of NAC orthologous groups for monocots and dicots.

    Science.gov (United States)

    Cenci, Albero; Guignon, Valentin; Roux, Nicolas; Rouard, Mathieu

    2014-05-01

    Identifying the molecular mechanisms underlying tolerance to abiotic stresses is important in crop breeding. A comprehensive understanding of the gene families associated with drought tolerance is therefore highly relevant. NAC transcription factors form a large plant-specific gene family involved in the regulation of tissue development and responses to biotic and abiotic stresses. The main goal of this study was to set up a framework of orthologous groups determined by an expert sequence comparison of NAC genes from both monocots and dicots. In order to clarify the orthologous relationships among NAC genes of different species, we performed an in-depth comparative study of four divergent taxa, in dicots and monocots, whose genomes have already been completely sequenced: Arabidopsis thaliana, Vitis vinifera, Musa acuminata and Oryza sativa. Due to independent evolution, NAC copy number is highly variable in these plant genomes. Based on an expert NAC sequence comparison, we propose forty orthologous groups of NAC sequences that were probably derived from an ancestor gene present in the most recent common ancestor of dicots and monocots. These orthologous groups provide a curated resource for large-scale protein sequence annotation of NAC transcription factors. The established orthology relationships also provide a useful reference for NAC function studies in newly sequenced genomes such as M. acuminata and other plant species.

  14. BACH transcription factors in innate and adaptive immunity.

    Science.gov (United States)

    Igarashi, Kazuhiko; Kurosaki, Tomohiro; Roychoudhuri, Rahul

    2017-07-01

    BTB and CNC homology (BACH) proteins are transcriptional repressors of the basic region leucine zipper (bZIP) transcription factor family. Recent studies indicate widespread roles of BACH proteins in controlling the development and function of the innate and adaptive immune systems, including the differentiation of effector and memory cells of the B and T cell lineages, CD4 + regulatory T cells and macrophages. Here, we emphasize similarities at a molecular level in the cell-type-specific activities of BACH factors, proposing that competitive interactions of BACH proteins with transcriptional activators of the bZIP family form a common mechanistic theme underlying their diverse actions. The findings contribute to a general understanding of how transcriptional repressors shape lineage commitment and cell-type-specific functions through repression of alternative lineage programmes.

  15. Thirty-seven transcription factor genes differentially respond to a ...

    Indian Academy of Sciences (India)

    Plant transcription factors and insect defence si. Thirty-seven transcription factor genes differentially respond to a harpin protein and affect resistance to the green peach aphid in Arabidopsis. HUNLIN. PIN. RUOXUE LIŲ, BEIBEI LÜ, XIAOMENG WANG, CHUNLING ZHANG, SHUPING ZHANG, JUN QIAN, LEI CHEN,.

  16. Elucidating MicroRNA Regulatory Networks Using Transcriptional, Post-transcriptional, and Histone Modification Measurements

    Directory of Open Access Journals (Sweden)

    Sara J.C. Gosline

    2016-01-01

    Full Text Available MicroRNAs (miRNAs regulate diverse biological processes by repressing mRNAs, but their modest effects on direct targets, together with their participation in larger regulatory networks, make it challenging to delineate miRNA-mediated effects. Here, we describe an approach to characterizing miRNA-regulatory networks by systematically profiling transcriptional, post-transcriptional and epigenetic activity in a pair of isogenic murine fibroblast cell lines with and without Dicer expression. By RNA sequencing (RNA-seq and CLIP (crosslinking followed by immunoprecipitation sequencing (CLIP-seq, we found that most of the changes induced by global miRNA loss occur at the level of transcription. We then introduced a network modeling approach that integrated these data with epigenetic data to identify specific miRNA-regulated transcription factors that explain the impact of miRNA perturbation on gene expression. In total, we demonstrate that combining multiple genome-wide datasets spanning diverse regulatory modes enables accurate delineation of the downstream miRNA-regulated transcriptional network and establishes a model for studying similar networks in other systems.

  17. Deduction of upstream sequences of Xanthomonas campestris flagellar genes responding to transcription activation by FleQ

    International Nuclear Information System (INIS)

    Hu, R.-M.; Yang, T.-C.; Yang, S.-H.; Tseng, Y.-H.

    2005-01-01

    Xanthomonas campestris pv. campestris (Xcc), a close relative to Pseudomonas aeruginosa, is the pathogen causing black rot in cruciferous plants. In P. aeruginosa, FleQ serves as a cognate activator of σ 54 in transcription from several σ 54 -dependent promoters of flagellar genes. These P. aeruginosa promoters have been analyzed for FleQ-binding sequences; however, no consensus was deduced. Xcc, although lacks fleSR, has a fleQ homologue residing among over 40 contiguously clustered flagellar genes. A fleQ mutant, Xc17fleQ, constructed by insertional mutation is deficient in FleQ protein, non-flagellated, and immobile. Transcriptional fusion assays on six putative σ 54 -dependent promoters of the flagellar genes, fliE, fliQ, fliL, flgG, flgB, and flhF, indicated that each of them is also FleQ dependent. Each of these promoters has a sequence with weak consensus to 5'-gaaacCCgccgCcgctTt-3', immediately upstream of the predicted σ 54 -binding site, with an imperfect inverted repeat containing a GC-rich center flanked by several A and T at 5'- and 3'-ends, respectively. Replacing this region in fliE promoter with a HindIII recognition sequence abolished the transcription, indicating that this region responds to transcription activation by FleQ

  18. B-GATA transcription factors - insights into their structure, regulation and role in plant development

    Directory of Open Access Journals (Sweden)

    Claus eSchwechheimer

    2015-02-01

    Full Text Available GATA transcription factors are evolutionarily conserved transcriptional regulators that recognize promoter elements with a G-A-T-A core sequence. In comparison to animal genomes, the GATA transcription factor family in plants is comparatively large with approximately 30 members. In spite of a long-standing interest of plant molecular biologists in GATA factors, only research conducted in the last years has led to reliable insights into their functions during plant development. Here, we review the current knowledge on B-GATAs, one of four GATA factor subfamilies from Arabidopsis thaliana. We show that B-GATAs can be subdivided based on structural features and their biological function into family members with a C-terminal LLM- (leucine-leucine-methionine domain or an N-terminal HAN- (HANABA TARANU domain. The paralogous GNC (GATA, NITRATE-INDUCIBLE, CARBON-METABOLISM INVOLVED and CGA1/GNL (CYTOKININ-INDUCED GATA1/GNC-LIKE are introduced as LLM-domain containing B-GATAs from Arabidopsis that control germination, greening, senescence and flowering time downstream from several growth regulatory signals including light and the hormones gibberellin, auxin, and cytokinin. Arabidopsis HAN and its monocot-specific paralogs from rice (NECK LEAF1, maize (TASSEL SHEATH1, and barley (THIRD OUTER GLUME are HAN-domain-containing B-GATAs with a predominant role in embryo development and floral development. We also review GATA23, a regulator of lateral root initiation from Arabidopsis, that is closely related to GNC and GNL but has a degenerate LLM-domain that is seemingly specific for the Brassicaceae family. The Brassicaceae-specific GATA23 together with the above-mentioned monocot-specific HAN-domain GATAs provide evidence that neofunctionalization of the B-GATAs was used during plant evolution to expand the functional repertoire of these transcription factors.

  19. NAC Transcription Factors in Stress Responses and Senescence

    DEFF Research Database (Denmark)

    O'Shea, Charlotte

    Plant-specific NAM/ATAF/CUC (NAC) transcription factors have recently received considerable attention due to their significant roles in plant development and stress signalling. This interest has resulted in a number of physiological, genetic and cell biological studies of their functions. Some...... of these studies have also revealed emerging gene regulatory networks and protein-protein interaction networks. However, structural studies relating structure to function are lagging behind. Structure-function analysis of the NAC transcription factors has therefore been the main focus of this PhD thesis...... not involve significant folding-upon-binding but fuzziness or an extended ANAC046 region. The ANAC046 regulatory domain functions as an entropic chain with a bait for interactions with for example RCD1. RCD1 interacts with transcription factors from several different families, and the large stress...

  20. Diversity, expansion, and evolutionary novelty of plant DNA-binding transcription factor families.

    Science.gov (United States)

    Lehti-Shiu, Melissa D; Panchy, Nicholas; Wang, Peipei; Uygun, Sahra; Shiu, Shin-Han

    2017-01-01

    Plant transcription factors (TFs) that interact with specific sequences via DNA-binding domains are crucial for regulating transcriptional initiation and are fundamental to plant development and environmental response. In addition, expansion of TF families has allowed functional divergence of duplicate copies, which has contributed to novel, and in some cases adaptive, traits in plants. Thus, TFs are central to the generation of the diverse plant species that we see today. Major plant agronomic traits, including those relevant to domestication, have also frequently arisen through changes in TF coding sequence or expression patterns. Here our goal is to provide an overview of plant TF evolution by first comparing the diversity of DNA-binding domains and the sizes of these domain families in plants and other eukaryotes. Because TFs are among the most highly expanded gene families in plants, the birth and death process of TFs as well as the mechanisms contributing to their retention are discussed. We also provide recent examples of how TFs have contributed to novel traits that are important in plant evolution and in agriculture.This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks, edited by Dr. Erich Grotewold and Dr. Nathan Springer. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Cross-Family Transcription Factor Interactions

    NARCIS (Netherlands)

    Bemer, Marian; Dijk, van Aalt-Jan; Immink, Richard G.H.; Angenent, Gerco C.

    2017-01-01

    Specific and dynamic gene expression strongly depends on transcription factor (TF) activity and most plant TFs function in a combinatorial fashion. They can bind to DNA and control the expression of the corresponding gene in an additive fashion or cooperate by physical interactions, forming larger

  2. Theory on the mechanism of distal action of transcription factors: looping of DNA versus tracking along DNA

    International Nuclear Information System (INIS)

    Murugan, R

    2010-01-01

    In this paper, we develop a theory on the mechanism of distal action of the transcription factors, which are bound at their respective cis-regulatory enhancer modules on the promoter-RNA polymerase II (PR) complexes to initiate the transcription event in eukaryotes. We consider both the looping and tracking modes of their distal communication and calculate the mean first passage time that is required for the distal interactions of the complex of enhancer and transcription factor with the PR via both these modes. We further investigate how this mean first passage time is dependent on the length of the DNA segment (L, base-pairs) that connects the cis-regulatory binding site and the respective promoter. When the radius of curvature of this connecting segment of DNA is R that was induced upon binding of the transcription factor at the cis-acting element and RNAPII at the promoter in cis-positions, our calculations indicate that the looping mode of distal action will dominate when L is such that L > 2πR and the tracking mode of distal action will be favored when L 2 bps. It seems that the free energy associated with the binding of the transcription factor with its cis-acting element and the distance of this cis-acting element from the corresponding promoter of the gene of interest is negatively correlated. Our results suggest that the looping and tracking modes of distal action are concurrently operating on the transcription activation and the physics that determines the timescales associated with the looping/tracking in the mechanism of action of these transcription factors on the initiation of the transcription event must put a selection pressure on the distribution of the distances of cis-regulatory modules from their respective promoters of the genes. The computational analysis of the upstream sequences of promoters of various genes in the human and mouse genomes for the presence of putative cis-regulatory elements for a set of known transcription factors using

  3. Transcription factor interplay in T helper cell differentiation

    Science.gov (United States)

    Evans, Catherine M.

    2013-01-01

    The differentiation of CD4 helper T cells into specialized effector lineages has provided a powerful model for understanding immune cell differentiation. Distinct lineages have been defined by differential expression of signature cytokines and the lineage-specifying transcription factors necessary and sufficient for their production. The traditional paradigm of differentiation towards Th1 and Th2 subtypes driven by T-bet and GATA3, respectively, has been extended to incorporate additional T cell lineages and transcriptional regulators. Technological advances have expanded our view of these lineage-specifying transcription factors to the whole genome and revealed unexpected interplay between them. From these data, it is becoming clear that lineage specification is more complex and plastic than previous models might have suggested. Here, we present an overview of the different forms of transcription factor interplay that have been identified and how T cell phenotypes arise as a product of this interplay within complex regulatory networks. We also suggest experimental strategies that will provide further insight into the mechanisms that underlie T cell lineage specification and plasticity. PMID:23878131

  4. Transcription factor interplay in T helper cell differentiation.

    Science.gov (United States)

    Evans, Catherine M; Jenner, Richard G

    2013-11-01

    The differentiation of CD4 helper T cells into specialized effector lineages has provided a powerful model for understanding immune cell differentiation. Distinct lineages have been defined by differential expression of signature cytokines and the lineage-specifying transcription factors necessary and sufficient for their production. The traditional paradigm of differentiation towards Th1 and Th2 subtypes driven by T-bet and GATA3, respectively, has been extended to incorporate additional T cell lineages and transcriptional regulators. Technological advances have expanded our view of these lineage-specifying transcription factors to the whole genome and revealed unexpected interplay between them. From these data, it is becoming clear that lineage specification is more complex and plastic than previous models might have suggested. Here, we present an overview of the different forms of transcription factor interplay that have been identified and how T cell phenotypes arise as a product of this interplay within complex regulatory networks. We also suggest experimental strategies that will provide further insight into the mechanisms that underlie T cell lineage specification and plasticity.

  5. Functional characterization of tobacco transcription factor TGA2.1

    DEFF Research Database (Denmark)

    Kegler, C.; Lenk, I.; Krawczyk, S.

    2004-01-01

    Activation sequence-1 (as-1)-like regulatory cis elements mediate transcriptional activation in response to increased levels of plant signalling molecules auxin and salicylic acid (SA). Our earlier work has shown that tobacco cellular as-1-binding complex SARP (salicylic acid responsive protein...

  6. Enhanceosomes as integrators of hypoxia inducible factor (HIF) and other transcription factors in the hypoxic transcriptional response.

    Science.gov (United States)

    Pawlus, Matthew R; Hu, Cheng-Jun

    2013-09-01

    Hypoxia is a prevalent attribute of the solid tumor microenvironment that promotes the expression of genes through posttranslational modifications and stabilization of alpha subunits (HIF1α and HIF2α) of hypoxia-inducible factors (HIFs). Despite significant similarities, HIF1 (HIF1α/ARNT) and HIF2 (HIF2α/ARNT) activate common as well as unique target genes and exhibit different functions in cancer biology. More surprisingly, accumulating data indicates that the HIF1- and/or HIF2-mediated hypoxia responses can be oncogenic as well as tumor suppressive. While the role of HIF in the hypoxia response is well established, recent data support the concept that HIF is necessary, but not sufficient for the hypoxic response. Other transcription factors that are activated by hypoxia are also required for the HIF-mediated hypoxia response. HIFs, other transcription factors, co-factors and RNA poll II recruited by HIF and other transcription factors form multifactorial enhanceosome complexes on the promoters of HIF target genes to activate hypoxia inducible genes. Importantly, HIF1 or HIF2 requires distinct partners in activating HIF1 or HIF2 target genes. Because HIF enhanceosome formation is required for the gene activation and distinct functions of HIF1 and HIF2 in tumor biology, disruption of the HIF1 or HIF2 specific enhanceosome complex may prove to be a beneficial strategy in tumor treatment in which tumor growth is specifically dependent upon HIF1 or HIF2 activity. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Physiological and Pathological Transcriptional Activation of Endogenous Retroelements Assessed by RNA-Sequencing of B Lymphocytes

    Directory of Open Access Journals (Sweden)

    Jan Attig

    2017-12-01

    Full Text Available In addition to evolutionarily-accrued sequence mutation or deletion, endogenous retroelements (EREs in eukaryotic genomes are subject to epigenetic silencing, preventing or reducing their transcription, particularly in the germplasm. Nevertheless, transcriptional activation of EREs, including endogenous retroviruses (ERVs and long interspersed nuclear elements (LINEs, is observed in somatic cells, variably upon cellular differentiation and frequently upon cellular transformation. ERE transcription is modulated during physiological and pathological immune cell activation, as well as in immune cell cancers. However, our understanding of the potential consequences of such modulation remains incomplete, partly due to the relative scarcity of information regarding genome-wide ERE transcriptional patterns in immune cells. Here, we describe a methodology that allows probing RNA-sequencing (RNA-seq data for genome-wide expression of EREs in murine and human cells. Our analysis of B cells reveals that their transcriptional response during immune activation is dominated by induction of gene transcription, and that EREs respond to a much lesser extent. The transcriptional activity of the majority of EREs is either unaffected or reduced by B cell activation both in mice and humans, albeit LINEs appear considerably more responsive in the latter host. Nevertheless, a small number of highly distinct ERVs are strongly and consistently induced during B cell activation. Importantly, this pattern contrasts starkly with B cell transformation, which exhibits widespread induction of EREs, including ERVs that minimally overlap with those responsive to immune stimulation. The distinctive patterns of ERE induction suggest different underlying mechanisms and will help separate physiological from pathological expression.

  8. Hypoxic preconditioning protects photoreceptors against light damage independently of hypoxia inducible transcription factors in rods.

    Science.gov (United States)

    Kast, Brigitte; Schori, Christian; Grimm, Christian

    2016-05-01

    Hypoxic preconditioning protects photoreceptors against light-induced degeneration preserving retinal morphology and function. Although hypoxia inducible transcription factors 1 and 2 (HIF1, HIF2) are the main regulators of the hypoxic response, photoreceptor protection does not depend on HIF1 in rods. Here we used rod-specific Hif2a single and Hif1a;Hif2a double knockout mice to investigate the potential involvement of HIF2 in rods for protection after hypoxic preconditioning. To identify potential HIF2 target genes in rods we determined the retinal transcriptome of hypoxic control and rod-specific Hif2a knockouts by RNA sequencing. We show that rods do not need HIF2 for hypoxia-induced increased survival after light exposure. The transcriptomic analysis revealed a number of genes that are potentially regulated by HIF2 in rods; among those were Htra1, Timp3 and Hmox1, candidates that are interesting due to their connection to human degenerative diseases of the retina. We conclude that neither HIF1 nor HIF2 are required in photoreceptors for protection by hypoxic preconditioning. We hypothesize that HIF transcription factors may be needed in other cells to produce protective factors acting in a paracrine fashion on photoreceptor cells. Alternatively, hypoxic preconditioning induces a rod-intrinsic response that is independent of HIF transcription factors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Sequence and expression analyses of ethylene response factors highly expressed in latex cells from Hevea brasiliensis.

    Directory of Open Access Journals (Sweden)

    Piyanuch Piyatrakul

    Full Text Available The AP2/ERF superfamily encodes transcription factors that play a key role in plant development and responses to abiotic and biotic stress. In Hevea brasiliensis, ERF genes have been identified by RNA sequencing. This study set out to validate the number of HbERF genes, and identify ERF genes involved in the regulation of latex cell metabolism. A comprehensive Hevea transcriptome was improved using additional RNA reads from reproductive tissues. Newly assembled contigs were annotated in the Gene Ontology database and were assigned to 3 main categories. The AP2/ERF superfamily is the third most represented compared with other transcription factor families. A comparison with genomic scaffolds led to an estimation of 114 AP2/ERF genes and 1 soloist in Hevea brasiliensis. Based on a phylogenetic analysis, functions were predicted for 26 HbERF genes. A relative transcript abundance analysis was performed by real-time RT-PCR in various tissues. Transcripts of ERFs from group I and VIII were very abundant in all tissues while those of group VII were highly accumulated in latex cells. Seven of the thirty-five ERF expression marker genes were highly expressed in latex. Subcellular localization and transactivation analyses suggested that HbERF-VII candidate genes encoded functional transcription factors.

  10. Cloning, nucleotide sequence and transcriptional analysis of the uvrA gene from Neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Black, C.G.; Fyfe, J.A.M.; Davies, J.K.

    1997-01-01

    A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)

  11. Global transcriptional profiling of the toxic dinoflagellate Alexandrium fundyense using Massively Parallel Signature Sequencing

    Directory of Open Access Journals (Sweden)

    Anderson Donald M

    2006-04-01

    Full Text Available Abstract Background Dinoflagellates are one of the most important classes of marine and freshwater algae, notable both for their functional diversity and ecological significance. They occur naturally as free-living cells, as endosymbionts of marine invertebrates and are well known for their involvement in "red tides". Dinoflagellates are also notable for their unusual genome content and structure, which suggests that the organization and regulation of dinoflagellate genes may be very different from that of most eukaryotes. To investigate the content and regulation of the dinoflagellate genome, we performed a global analysis of the transcriptome of the toxic dinoflagellate Alexandrium fundyense under nitrate- and phosphate-limited conditions using Massively Parallel Signature Sequencing (MPSS. Results Data from the two MPSS libraries showed that the number of unique signatures found in A. fundyense cells is similar to that of humans and Arabidopsis thaliana, two eukaryotes that have been extensively analyzed using this method. The general distribution, abundance and expression patterns of the A. fundyense signatures were also quite similar to other eukaryotes, and at least 10% of the A. fundyense signatures were differentially expressed between the two conditions. RACE amplification and sequencing of a subset of signatures showed that multiple signatures arose from sequence variants of a single gene. Single signatures also mapped to different sequence variants of the same gene. Conclusion The MPSS data presented here provide a quantitative view of the transcriptome and its regulation in these unusual single-celled eukaryotes. The observed signature abundance and distribution in Alexandrium is similar to that of other eukaryotes that have been analyzed using MPSS. Results of signature mapping via RACE indicate that many signatures result from sequence variants of individual genes. These data add to the growing body of evidence for widespread gene

  12. Strong transcription blockage mediated by R-loop formation within a G-rich homopurine-homopyrimidine sequence localized in the vicinity of the promoter.

    Science.gov (United States)

    Belotserkovskii, Boris P; Soo Shin, Jane Hae; Hanawalt, Philip C

    2017-06-20

    Guanine-rich (G-rich) homopurine-homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA-DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA-DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription 'bursting') and may also have practical implications for the design of expression vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Sequence Factorization with Multiple References.

    Directory of Open Access Journals (Sweden)

    Sebastian Wandelt

    Full Text Available The success of high-throughput sequencing has lead to an increasing number of projects which sequence large populations of a species. Storage and analysis of sequence data is a key challenge in these projects, because of the sheer size of the datasets. Compression is one simple technology to deal with this challenge. Referential factorization and compression schemes, which store only the differences between input sequence and a reference sequence, gained lots of interest in this field. Highly-similar sequences, e.g., Human genomes, can be compressed with a compression ratio of 1,000:1 and more, up to two orders of magnitude better than with standard compression techniques. Recently, it was shown that the compression against multiple references from the same species can boost the compression ratio up to 4,000:1. However, a detailed analysis of using multiple references is lacking, e.g., for main memory consumption and optimality. In this paper, we describe one key technique for the referential compression against multiple references: The factorization of sequences. Based on the notion of an optimal factorization, we propose optimization heuristics and identify parameter settings which greatly influence 1 the size of the factorization, 2 the time for factorization, and 3 the required amount of main memory. We evaluate a total of 30 setups with a varying number of references on data from three different species. Our results show a wide range of factorization sizes (optimal to an overhead of up to 300%, factorization speed (0.01 MB/s to more than 600 MB/s, and main memory usage (few dozen MB to dozens of GB. Based on our evaluation, we identify the best configurations for common use cases. Our evaluation shows that multi-reference factorization is much better than single-reference factorization.

  14. Molecular Characterization of a Leaf Senescence-Related Transcription Factor BrWRKY75 of Chinese Flowering Cabbage

    Directory of Open Access Journals (Sweden)

    Xiaoli Tan

    2016-09-01

    Full Text Available WRKY is a plant-specific transcription factor (TF involved in the regulation of many biological processes; however, its role in leaf senescence of leafy vegetables remains unknown. In the present work, a WRKY TF, termed BrWRKY75 was isolated from Chinese flowering cabbage [Brassica rapa L. ssp. chinensis (L. Mokino var. utilis Tsen et Lee]. Analysis of deduced amino acid sequence and the phylogenetic tree showed that BrWRKY75 has high homology with WRKY75 from Brassica oleracea and Arabidopsis thaliana, and belongs to the II c sub-group. Sub-cellular localization and transcriptional activity analysis revealed that BrWRKY75 is a nuclear protein with transcriptional repression activity, and was up-regulated during leaf senescence. Electrophoretic mobility shift assay confirmed that BrWRKY75 directly bound to the W-box (TTGAC cis-element. Collectively, these results provide a basis for further investigation of the transcriptional regulation of Chinese flowering cabbage leaf senescence.

  15. TrSDB: a proteome database of transcription factors

    Science.gov (United States)

    Hermoso, Antoni; Aguilar, Daniel; Aviles, Francesc X.; Querol, Enrique

    2004-01-01

    TrSDB—TranScout Database—(http://ibb.uab.es/trsdb) is a proteome database of eukaryotic transcription factors based upon predicted motifs by TranScout and data sources such as InterPro and Gene Ontology Annotation. Nine eukaryotic proteomes are included in the current version. Extensive and diverse information for each database entry, different analyses considering TranScout classification and similarity relationships are offered for research on transcription factors or gene expression. PMID:14681387

  16. Cytosine methylation does not affect binding of transcription factor Sp1

    International Nuclear Information System (INIS)

    Harrington, M.A.; Jones, P.A.; Imagawa, M.; Karin, M.

    1988-01-01

    DNA methylation may be a component of a multilevel control mechanism that regulates eukaryotic gene expression. The authors used synthetic oligonucleotides to investigate the effect of cytosine methylation on the binding of the transcription factor Sp1 to its target sequence (a G+C-rich sequence known as a GC box). Concatemers of double-stranded 14-mers containing a GC box successfully competed with the human metallothionein IIA promoter for binding to Sp1 in DNase I protection experiments. The presence of 5-methylcytosine in the CpG sequence of the GC box did not influence Sp1 binding. The result was confirmed using double-stranded 20-mers containing 16 base pairs of complementary sequence. Electrophoretic gel retardation analysis of annealed 28-mers containing a GC box incubated with an Sp1-containing HeLa cell nuclear extract demonstrated the formation of DNA-protein complexes; formation of these complexes was not inhibited when an oligomer without a GC box was used as a competitor. Once again, the presence of a 5-methylcytosine residue in the GC box did not influence the binding of the protein to DNA. The results therefore preclude a direct effect of cytosine methylation on Sp1-DNA interactions

  17. Microarray-Based Identification of Transcription Factor Target Genes

    NARCIS (Netherlands)

    Gorte, M.; Horstman, A.; Page, R.B.; Heidstra, R.; Stromberg, A.; Boutilier, K.A.

    2011-01-01

    Microarray analysis is widely used to identify transcriptional changes associated with genetic perturbation or signaling events. Here we describe its application in the identification of plant transcription factor target genes with emphasis on the design of suitable DNA constructs for controlling TF

  18. Repression of meiotic genes by antisense transcription and by Fkh2 transcription factor in Schizosaccharomyces pombe.

    Science.gov (United States)

    Chen, Huei-Mei; Rosebrock, Adam P; Khan, Sohail R; Futcher, Bruce; Leatherwood, Janet K

    2012-01-01

    In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s) of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the "unspliced" signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression.

  19. JASPAR 2010: the greatly expanded open-access database of transcription factor binding profiles

    DEFF Research Database (Denmark)

    Portales-Casamar, Elodie; Thongjuea, Supat; Kwon, Andrew T

    2009-01-01

    JASPAR (http://jaspar.genereg.net) is the leading open-access database of matrix profiles describing the DNA-binding patterns of transcription factors (TFs) and other proteins interacting with DNA in a sequence-specific manner. Its fourth major release is the largest expansion of the core database...... to an active research community. As binding models are refined by newer data, the JASPAR database now uses versioning of matrices: in this release, 12% of the older models were updated to improved versions. Classification of TF families has been improved by adopting a new DNA-binding domain nomenclature...

  20. Exploring the utility of organo-polyoxometalate hybrids to inhibit SOX transcription factors.

    Science.gov (United States)

    Narasimhan, Kamesh; Micoine, Kevin; Lacôte, Emmanuel; Thorimbert, Serge; Cheung, Edwin; Hasenknopf, Bernold; Jauch, Ralf

    2014-01-01

    SOX transcription factors constitute an attractive target class for intervention with small molecules as they play a prominent role in the field of regenerative biomedicine and cancer biology. However, rationally engineering specific inhibitors that interfere with transcription factor DNA interfaces continues to be a monumental challenge in the field of transcription factor chemical biology. Polyoxometalates (POMs) are inorganic compounds that were previously shown to target the high-mobility group (HMG) of SOX proteins at nanomolar concentrations. In continuation of this work, we carried out an assessment of the selectivity of a panel of newly synthesized organo-polyoxometalate hybrids in targeting different transcription factor families to enable the usage of polyoxometalates as specific SOX transcription factor drugs. The residual DNA-binding activities of 15 different transcription factors were measured after treatment with a panel of diverse polyoxometalates. Polyoxometalates belonging to the Dawson structural class were found to be more potent inhibitors than the Keggin class. Further, organically modified Dawson polyoxometalates were found to be the most potent in inhibiting transcription factor DNA binding activity. The size of the polyoxometalates and its derivitization were found to be the key determinants of their potency. Polyoxometalates are highly potent, nanomolar range inhibitors of the DNA binding activity of the Sox-HMG family. However, binding assays involving a limited subset of structurally diverse polyoxometalates revealed a low selectivity profile against different transcription factor families. Further progress in achieving selectivity and deciphering structure-activity relationship of POMs require the identification of POM binding sites on transcription factors using elaborate approaches like X-ray crystallography and multidimensional NMR. In summary, our report reaffirms that transcription factors are challenging molecular architectures

  1. TcoF-DB v2: update of the database of human and mouse transcription co-factors and transcription factor interactions

    KAUST Repository

    Schmeier, Sebastian; Alam, Tanvir; Essack, Magbubah; Bajic, Vladimir B.

    2016-01-01

    Transcription factors (TFs) play a pivotal role in transcriptional regulation, making them crucial for cell survival and important biological functions. For the regulation of transcription, interactions of different regulatory proteins known as transcription co-factors (TcoFs) and TFs are essential in forming necessary protein complexes. Although TcoFs themselves do not bind DNA directly, their influence on transcriptional regulation and initiation, although indirect, has been shown to be significant, with the functionality of TFs strongly influenced by the presence of TcoFs. In the TcoF-DB v2 database, we collect information on TcoFs. In this article, we describe updates and improvements implemented in TcoF-DB v2. TcoF-DB v2 provides several new features that enables exploration of the roles of TcoFs. The content of the database has significantly expanded, and is enriched with information from Gene Ontology, biological pathways, diseases and molecular signatures. TcoF-DB v2 now includes many more TFs; has substantially increased the number of human TcoFs to 958, and now includes information on mouse (418 new TcoFs). TcoF-DB v2 enables the exploration of information on TcoFs and allows investigations into their influence on transcriptional regulation in humans and mice. TcoF-DB v2 can be accessed at http://tcofdb.org/.

  2. TcoF-DB v2: update of the database of human and mouse transcription co-factors and transcription factor interactions

    KAUST Repository

    Schmeier, Sebastian

    2016-10-17

    Transcription factors (TFs) play a pivotal role in transcriptional regulation, making them crucial for cell survival and important biological functions. For the regulation of transcription, interactions of different regulatory proteins known as transcription co-factors (TcoFs) and TFs are essential in forming necessary protein complexes. Although TcoFs themselves do not bind DNA directly, their influence on transcriptional regulation and initiation, although indirect, has been shown to be significant, with the functionality of TFs strongly influenced by the presence of TcoFs. In the TcoF-DB v2 database, we collect information on TcoFs. In this article, we describe updates and improvements implemented in TcoF-DB v2. TcoF-DB v2 provides several new features that enables exploration of the roles of TcoFs. The content of the database has significantly expanded, and is enriched with information from Gene Ontology, biological pathways, diseases and molecular signatures. TcoF-DB v2 now includes many more TFs; has substantially increased the number of human TcoFs to 958, and now includes information on mouse (418 new TcoFs). TcoF-DB v2 enables the exploration of information on TcoFs and allows investigations into their influence on transcriptional regulation in humans and mice. TcoF-DB v2 can be accessed at http://tcofdb.org/.

  3. Deep Sequencing Reveals the Complete Genome and Evidence for Transcriptional Activity of the First Virus-Like Sequences Identified in Aristotelia chilensis (Maqui Berry

    Directory of Open Access Journals (Sweden)

    Javier Villacreses

    2015-04-01

    Full Text Available Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1. High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs: ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV, Petuvirus genus. ORF1 encodes a movement protein (MP; ORF2 a Reverse Transcriptase (RT and a Ribonuclease H (RNase H domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs, AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq. Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant.

  4. The WRKY Transcription Factor Family in Citrus: Valuable and Useful Candidate Genes for Citrus Breeding.

    Science.gov (United States)

    Ayadi, M; Hanana, M; Kharrat, N; Merchaoui, H; Marzoug, R Ben; Lauvergeat, V; Rebaï, A; Mzid, R

    2016-10-01

    WRKY transcription factors belong to a large family of plant transcriptional regulators whose members have been reported to be involved in a wide range of biological roles including plant development, adaptation to environmental constraints and response to several diseases. However, little or poor information is available about WRKY's in Citrus. The recent release of completely assembled genomes sequences of Citrus sinensis and Citrus clementina and the availability of ESTs sequences from other citrus species allowed us to perform a genome survey for Citrus WRKY proteins. In the present study, we identified 100 WRKY members from C. sinensis (51), C. clementina (48) and Citrus unshiu (1), and analyzed their chromosomal distribution, gene structure, gene duplication, syntenic relation and phylogenetic analysis. A phylogenetic tree of 100 Citrus WRKY sequences with their orthologs from Arabidopsis has distinguished seven groups. The CsWRKY genes were distributed across all ten sweet orange chromosomes. A comprehensive approach and an integrative analysis of Citrus WRKY gene expression revealed variable profiles of expression within tissues and stress conditions indicating functional diversification. Thus, candidate Citrus WRKY genes have been proposed as potentially involved in fruit acidification, essential oil biosynthesis and abiotic/biotic stress tolerance. Our results provided essential prerequisites for further WRKY genes cloning and functional analysis with an aim of citrus crop improvement.

  5. The competence transcription factor of Bacillus subtilis recognizes short A/T-rich sequences arranged in a unique, flexible pattern along the DNA helix

    NARCIS (Netherlands)

    Hamoen, LW; Van Werkhoven, AF; Bijlsma, JJE; Dubnau, D; Venema, G

    1998-01-01

    The development of genetic competence in Bacillus subtilis is regulated by a complex signal transduction cascade, which leads to the synthesis of the competence transcription factor (CTF). Previous studies suggested that CTF is encoded by comK. ComK is required for the transcription of comK itself,

  6. Repression of Meiotic Genes by Antisense Transcription and by Fkh2 Transcription Factor in Schizosaccharomyces pombe

    Science.gov (United States)

    Chen, Huei-Mei; Rosebrock, Adam P.; Khan, Sohail R.; Futcher, Bruce; Leatherwood, Janet K.

    2012-01-01

    In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s) of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the “unspliced” signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression. PMID:22238674

  7. Repression of meiotic genes by antisense transcription and by Fkh2 transcription factor in Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Huei-Mei Chen

    Full Text Available In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the "unspliced" signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression.

  8. DNA dynamics play a role as a basal transcription factor in the positioning and regulation of gene transcription initiation

    OpenAIRE

    Alexandrov, Boian S.; Gelev, Vladimir; Yoo, Sang Wook; Alexandrov, Ludmil B.; Fukuyo, Yayoi; Bishop, Alan R.; Rasmussen, Kim ?.; Usheva, Anny

    2009-01-01

    We assess the role of DNA breathing dynamics as a determinant of promoter strength and transcription start site (TSS) location. We compare DNA Langevin dynamic profiles of representative gene promoters, calculated with the extended non-linear PBD model of DNA with experimental data on transcription factor binding and transcriptional activity. Our results demonstrate that DNA dynamic activity at the TSS can be suppressed by mutations that do not affect basal transcription factor binding–DNA co...

  9. The logic of communication: roles for mobile transcription factors in plants.

    Science.gov (United States)

    Long, Yuchen; Scheres, Ben; Blilou, Ikram

    2015-02-01

    Mobile transcription factors play many roles in plant development. Here, we compare the use of mobile transcription factors as signals with some canonical signal transduction processes in prokaryotes and eukaryotes. After an initial survey, we focus on the SHORT-ROOT pathway in Arabidopsis roots to show that, despite the simplicity of the concept of mobile transcription factor signalling, many lines of evidence reveal a surprising complexity in control mechanisms linked to this process. We argue that these controls bestow precision, robustness, and versatility on mobile transcription factor signalling. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  10. Transcription factor NF-kB as a potential biomarker for oxidative stress

    NARCIS (Netherlands)

    Berg, R. van den; Haenen, G.R.M.M.; Berg, H. van den; Bast, A.

    2001-01-01

    There is increasing interest in the involvement of transcription factors, such as of the transcription factor NF-κB (nuclear factor-κB), in the pathogenesis of various diseases. NF-κB is involved in the control of the transcription of a variety of cellular genes that regulate the inflammatory

  11. Molecular cloning of the human gene for von Willebrand factor and identification of the transcription initiation site

    International Nuclear Information System (INIS)

    Collins, C.J.; Underdahl, J.P.; Levene, R.B.; Ravera, C.P.; Morin, M.J.; Dombalagian, M.J.; Ricca, G.; Livingston, D.M.; Lynch, D.C.

    1987-01-01

    A series of overlapping cosmid genomic clones have been isolated that contain the entire coding unit of the human gene for van Willebrand factor (vWf), a major component of the hemostatic system. The cloned segments span ≅ 175 kilobases of human DNA sequence, and hybridization analysis suggest that the vWf coding unit is ≅150 kilobases in length. Within one of these clones, the vWF transcription initiation site has been mapped and a portion of the vWf promoter region has been sequenced, revealing a typical TATA box, a downstream CCAAT box, and a perfect downstream repeat of the 8 base pairs containing the transcription start site. Sequencing of a segment of another genomic clone has revealed the vWF translation termination codon. Where tested, comparative restriction analysis of cloned and chromosomal DNA segments strongly suggests that no major alterations occurred during cloning and that there is only one complete copy of the vWf gene in the human haploid genome. Similar analyses of DNA from vWf-producing endothelial cells and nonexpressing leukocytes suggest that vWf gene expression is not accompanied by gross genomic rearrangements. In addition, there is significant homology of C-terminal coding sequences among the vWf genes of several vertebrate species

  12. Theory on the mechanism of distal action of transcription factors: looping of DNA versus tracking along DNA

    Energy Technology Data Exchange (ETDEWEB)

    Murugan, R, E-mail: rmurugan@gmail.co [Department of Biotechnology, Indian Institute of Technology Madras, Chennai 600036 (India)

    2010-10-15

    of the upstream sequences of promoters of various genes in the human and mouse genomes for the presence of putative cis-regulatory elements for a set of known transcription factors using the position weight matrices available with the JASPAR database indicates the presence of cis-acting elements with maximum probability at a distance of {approx}10{sup 2} bps from the promoters which substantiates our theoretical predictions.

  13. Identification and expression analysis of ERF transcription factor genes in petunia during flower senescence and in response to hormone treatments.

    Science.gov (United States)

    Liu, Juanxu; Li, Jingyu; Wang, Huinan; Fu, Zhaodi; Liu, Juan; Yu, Yixun

    2011-01-01

    Ethylene-responsive element-binding factor (ERF) genes constitute one of the largest transcription factor gene families in plants. In Arabidopsis and rice, only a few ERF genes have been characterized so far. Flower senescence is associated with increased ethylene production in many flowers. However, the characterization of ERF genes in flower senescence has not been reported. In this study, 13 ERF cDNAs were cloned from petunia. Based on the sequence characterization, these PhERFs could be classified into four of the 12 known ERF families. Their predicted amino acid sequences exhibited similarities to ERFs from other plant species. Expression analyses of PhERF mRNAs were performed in corollas and gynoecia of petunia flower. The 13 PhERF genes displayed differential expression patterns and levels during natural flower senescence. Exogenous ethylene accelerates the transcription of the various PhERF genes, and silver thiosulphate (STS) decreased the transcription of several PhERF genes in corollas and gynoecia. PhERF genes of group VII showed a strong association with the rise in ethylene production in both petals and gynoecia, and might be associated particularly with flower senescence in petunia. The effect of sugar, methyl jasmonate, and the plant hormones abscisic acid, salicylic acid, and 6-benzyladenine in regulating the different PhERF transcripts was investigated. Functional nuclear localization signal analyses of two PhERF proteins (PhERF2 and PhERF3) were carried out using fluorescence microscopy. These results supported a role for petunia PhERF genes in transcriptional regulation of petunia flower senescence processes.

  14. Genome Binding and Gene Regulation by Stem Cell Transcription Factors

    NARCIS (Netherlands)

    J.H. Brandsma (Johan)

    2016-01-01

    markdownabstractNearly all cells of an individual organism contain the same genome. However, each cell type transcribes a different set of genes due to the presence of different sets of cell type-specific transcription factors. Such transcription factors bind to regulatory regions such as promoters

  15. Genome-scale study of the importance of binding site context for transcription factor binding and gene regulation

    Directory of Open Access Journals (Sweden)

    Ronne Hans

    2008-11-01

    Full Text Available Abstract Background The rate of mRNA transcription is controlled by transcription factors that bind to specific DNA motifs in promoter regions upstream of protein coding genes. Recent results indicate that not only the presence of a motif but also motif context (for example the orientation of a motif or its location relative to the coding sequence is important for gene regulation. Results In this study we present ContextFinder, a tool that is specifically aimed at identifying cases where motif context is likely to affect gene regulation. We used ContextFinder to examine the role of motif context in S. cerevisiae both for DNA binding by transcription factors and for effects on gene expression. For DNA binding we found significant patterns of motif location bias, whereas motif orientations did not seem to matter. Motif context appears to affect gene expression even more than it affects DNA binding, as biases in both motif location and orientation were more frequent in promoters of co-expressed genes. We validated our results against data on nucleosome positioning, and found a negative correlation between preferred motif locations and nucleosome occupancy. Conclusion We conclude that the requirement for stable binding of transcription factors to DNA and their subsequent function in gene regulation can impose constraints on motif context.

  16. Modulation of transcription factors by curcumin.

    Science.gov (United States)

    Shishodia, Shishir; Singh, Tulika; Chaturvedi, Madan M

    2007-01-01

    Curcumin is the active ingredient of turmeric that has been consumed as a dietary spice for ages. Turmeric is widely used in traditional Indian medicine to cure biliary disorders, anorexia, cough, diabetic wounds, hepatic disorders, rheumatism, and sinusitis. Extensive investigation over the last five decades has indicated that curcumin reduces blood cholesterol, prevents low-density lipoprotein oxidation, inhibits platelet aggregation, suppresses thrombosis and myocardial infarction, suppresses symptoms associated with type II diabetes, rheumatoid arthritis, multiple sclerosis, and Alzheimer's disease, inhibits HIV replication, enhances wound healing, protects from liver injury, increases bile secretion, protects from cataract formation, and protects from pulmonary toxicity and fibrosis. Evidence indicates that the divergent effects of curcumin are dependent on its pleiotropic molecular effects. These include the regulation of signal transduction pathways and direct modulation of several enzymatic activities. Most of these signaling cascades lead to the activation of transcription factors. Curcumin has been found to modulate the activity of several key transcription factors and, in turn, the cellular expression profiles. Curcumin has been shown to elicit vital cellular responses such as cell cycle arrest, apoptosis, and differentiation by activating a cascade of molecular events. In this chapter, we briefly review the effects of curcumin on transcription factors NF-KB, AP-1, Egr-1, STATs, PPAR-gamma, beta-catenin, nrf2, EpRE, p53, CBP, and androgen receptor (AR) and AR-related cofactors giving major emphasis to the molecular mechanisms of its action.

  17. Membrane-bound transcription factors: regulated release by RIP or RUP.

    Science.gov (United States)

    Hoppe, T; Rape, M; Jentsch, S

    2001-06-01

    Regulated nuclear transport of transcription factors from cytoplasmic pools is a major route by which eukaryotes control gene expression. Exquisite examples are transcription factors that are kept in a dormant state in the cytosol by membrane anchors; such proteins are released from membranes by proteolytic cleavage, which enables these transcription factors to enter the nucleus. Cleavage can be mediated either by regulated intramembrane proteolysis (RIP) catalysed by specific membrane-bound proteases or by regulated ubiquitin/proteasome-dependent processing (RUP). In both cases processing can be controlled by cues that originate at or in the vicinity of the membrane.

  18. Transcription Factors in Heart: Promising Therapeutic Targets in Cardiac Hypertrophy

    OpenAIRE

    Kohli, Shrey; Ahuja, Suchit; Rani, Vibha

    2011-01-01

    Regulation of gene expression is central to cell growth, differentiation and diseases. Context specific and signal dependent regulation of gene expression is achieved to a large part by transcription factors. Cardiac transcription factors regulate heart development and are also involved in stress regulation of the adult heart, which may lead to cardiac hypertrophy. Hypertrophy of cardiac myocytes is an outcome of the imbalance between prohypertrophic factors and anti-hypertrophic factors. Thi...

  19. Hydrogen peroxide sensing, signaling and regulation of transcription factors

    Directory of Open Access Journals (Sweden)

    H. Susana Marinho

    2014-01-01

    Full Text Available The regulatory mechanisms by which hydrogen peroxide (H2O2 modulates the activity of transcription factors in bacteria (OxyR and PerR, lower eukaryotes (Yap1, Maf1, Hsf1 and Msn2/4 and mammalian cells (AP-1, NRF2, CREB, HSF1, HIF-1, TP53, NF-κB, NOTCH, SP1 and SCREB-1 are reviewed. The complexity of regulatory networks increases throughout the phylogenetic tree, reaching a high level of complexity in mammalians. Multiple H2O2 sensors and pathways are triggered converging in the regulation of transcription factors at several levels: (1 synthesis of the transcription factor by upregulating transcription or increasing both mRNA stability and translation; (ii stability of the transcription factor by decreasing its association with the ubiquitin E3 ligase complex or by inhibiting this complex; (iii cytoplasm–nuclear traffic by exposing/masking nuclear localization signals, or by releasing the transcription factor from partners or from membrane anchors; and (iv DNA binding and nuclear transactivation by modulating transcription factor affinity towards DNA, co-activators or repressors, and by targeting specific regions of chromatin to activate individual genes. We also discuss how H2O2 biological specificity results from diverse thiol protein sensors, with different reactivity of their sulfhydryl groups towards H2O2, being activated by different concentrations and times of exposure to H2O2. The specific regulation of local H2O2 concentrations is also crucial and results from H2O2 localized production and removal controlled by signals. Finally, we formulate equations to extract from typical experiments quantitative data concerning H2O2 reactivity with sensor molecules. Rate constants of 140 M−1 s−1 and ≥1.3 × 103 M−1 s−1 were estimated, respectively, for the reaction of H2O2 with KEAP1 and with an unknown target that mediates NRF2 protein synthesis. In conclusion, the multitude of H2O2 targets and mechanisms provides an opportunity for

  20. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  1. Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Yuxiang, E-mail: yuxiangqin@126.com [Department of Biotechnology, University of Jinan, Jinan 250022 (China); Tian, Yanchen [The Key Laboratory of Plant Cell Engineering and Germplasm Innovation, Ministry of Education, School of Life Science, Shandong University, Jinan 250100 (China); Han, Lu; Yang, Xinchao [Department of Biotechnology, University of Jinan, Jinan 250022 (China)

    2013-11-15

    Highlights: •A class II WRKY transcription factor, TaWRKY79 was isolated and characterized. •TaWRKY79 was induced by NaCl or abscisic acid. •843 bp regulatory segment was sufficient to respond to ABA or NaCl treatment. •TaWRKY79 enhanced salinity and ionic tolerance while reduced sensitivity to ABA. •TaWRKY79 increased salinity and ionic tolerance in an ABA-dependent pathway. -- Abstract: The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusion between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway.

  2. Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Qin, Yuxiang; Tian, Yanchen; Han, Lu; Yang, Xinchao

    2013-01-01

    Highlights: •A class II WRKY transcription factor, TaWRKY79 was isolated and characterized. •TaWRKY79 was induced by NaCl or abscisic acid. •843 bp regulatory segment was sufficient to respond to ABA or NaCl treatment. •TaWRKY79 enhanced salinity and ionic tolerance while reduced sensitivity to ABA. •TaWRKY79 increased salinity and ionic tolerance in an ABA-dependent pathway. -- Abstract: The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusion between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway

  3. Transcription profiling of the model cyanobacterium Synechococcus sp. strain PCC 7002 by NextGen (SOLiD™ Sequencing of cDNA

    Directory of Open Access Journals (Sweden)

    Marcus eLudwig

    2011-03-01

    Full Text Available The genome of the unicellular, euryhaline cyanobacterium Synechococcus sp. PCC 7002 encodes about 3200 proteins. Transcripts were detected for nearly all annotated open reading frames by a global transcriptomic analysis by Next-Generation (SOLiDTM sequencing of cDNA. In the cDNA samples sequenced, ~90% of the mapped sequences were derived from the 16S and 23S ribosomal RNAs and ~10% of the sequences were derived from mRNAs. In cells grown photoautotrophically under standard conditions (38 °C, 1% (v/v CO2 in air, 250 µmol photons m-2 s-1, the highest transcript levels (up to 2% of the total mRNA for the most abundantly transcribed genes (e. g., cpcAB, psbA, psaA were generally derived from genes encoding structural components of the photosynthetic apparatus. High light exposure for one hour caused changes in transcript levels for genes encoding proteins of the photosynthetic apparatus, Type-1 NADH dehydrogenase complex and ATP synthase, whereas dark incubation for one hour resulted in a global decrease in transcript levels for photosynthesis-related genes and an increase in transcript levels for genes involved in carbohydrate degradation. Transcript levels for pyruvate kinase and the pyruvate dehydrogenase complex decreased sharply in cells incubated in the dark. Under dark anoxic (fermentative conditions, transcript changes indicated a global decrease in transcripts for respiratory proteins and suggested that cells employ an alternative phosphoenolpyruvate degradation pathway via phosphoenolpyruvate synthase (ppsA and the pyruvate:ferredoxin oxidoreductase (nifJ. Finally, the data suggested that an apparent operon involved in tetrapyrrole biosynthesis and fatty acid desaturation, acsF2-ho2-hemN2-desF, may be regulated by oxygen concentration.

  4. Transcription factor cooperativity in early adipogenic hotspots and super-enhancers

    DEFF Research Database (Denmark)

    Siersbæk, Rasmus; Rabiee, Atefeh; Nielsen, Ronni

    2014-01-01

    . Using a combination of advanced proteomics and genomics approaches, we identify ∼12,000 transcription factor hotspots (∼400 bp) in the early phase of adipogenesis, and we find evidence of both simultaneous and sequential binding of transcription factors at these regions. We demonstrate that hotspots...

  5. Regulation of the yeast metabolic cycle by transcription factors with periodic activities

    Directory of Open Access Journals (Sweden)

    Pellegrini Matteo

    2011-10-01

    Full Text Available Abstract Background When growing budding yeast under continuous, nutrient-limited conditions, over half of yeast genes exhibit periodic expression patterns. Periodicity can also be observed in respiration, in the timing of cell division, as well as in various metabolite levels. Knowing the transcription factors involved in the yeast metabolic cycle is helpful for determining the cascade of regulatory events that cause these patterns. Results Transcription factor activities were estimated by linear regression using time series and genome-wide transcription factor binding data. Time-translation matrices were estimated using least squares and were used to model the interactions between the most significant transcription factors. The top transcription factors have functions involving respiration, cell cycle events, amino acid metabolism and glycolysis. Key regulators of transitions between phases of the yeast metabolic cycle appear to be Hap1, Hap4, Gcn4, Msn4, Swi6 and Adr1. Conclusions Analysis of the phases at which transcription factor activities peak supports previous findings suggesting that the various cellular functions occur during specific phases of the yeast metabolic cycle.

  6. The A-myb transcription factor in neoplastic and normal B cells.

    Science.gov (United States)

    Golay, J; Facchinetti, V; Ying, G; Introna, M

    1997-07-01

    The myb family of transcription factors has been strongly implicated in the regulation of cell growth and differentiation in the haematopoietic system. The v-myb oncogene, carried by avian defective retroviruses, causes leukaemias in the chicken and transforms haematopoietic cells in vitro. Its normal cellular equivalent c-myb, has been shown to promote the proliferation and block the differentiation of haematopoietic cells in several experimental models and is required for fetal haematopoiesis. Two other members of the family have been cloned more recently, A-myb and B-myb, which show sequence homology with c-myb in several domains, of which the DNA binding domain as well as other regulatory domains. Both have been shown to be transcription factors. B-myb is also involved in the control of proliferation and differentiation, but, unlike c-myb, it is expressed in many cell types. The third member of the family, A-myb, shows the most restricted pattern of expression, suggesting a very specific role for this transcription factor. A-myb is expressed in a subpopulation of normal B lymphocytes activated in vivo and localised in the germinal center of peripheral lymphoid organs and is not detected at significant levels in all other mature or immature haematopoietic populations studied, including bone marrow cells, T lymphocytes, granulocytes, monocytes, either at rest or after in vitro activation. These studies indicate that A-myb plays a role during a narrow window of normal B cell differentiation. A-myb expression has also been studied in a wide range of neoplastic B cells, representing the whole spectrum of B cell differentiation. A-myb is strongly expressed in Burkitt's lymphomas (BL) and slg+ B-acute lymphoblastic leukaemias (B-ALL) and not in all other leukaemias/lymphomas tested, with the exception of a subset of CLL (about 25% of cases). It is intriguing that the A-myb genome has been localised relatively close to the c-myc gene on chromosome 8, suggesting that

  7. Comparison of pause predictions of two sequence-dependent transcription models

    International Nuclear Information System (INIS)

    Bai, Lu; Wang, Michelle D

    2010-01-01

    Two recent theoretical models, Bai et al (2004, 2007) and Tadigotla et al (2006), formulated thermodynamic explanations of sequence-dependent transcription pausing by RNA polymerase (RNAP). The two models differ in some basic assumptions and therefore make different yet overlapping predictions for pause locations, and different predictions on pause kinetics and mechanisms. Here we present a comprehensive comparison of the two models. We show that while they have comparable predictive power of pause locations at low NTP concentrations, the Bai et al model is more accurate than Tadigotla et al at higher NTP concentrations. The pausing kinetics predicted by Bai et al is also consistent with time-course transcription reactions, while Tadigotla et al is unsuited for this type of kinetic prediction. More importantly, the two models in general predict different pausing mechanisms even for the same pausing sites, and the Bai et al model provides an explanation more consistent with recent single molecule observations

  8. Convergent evolution of RFX transcription factors and ciliary genes predated the origin of metazoans

    Directory of Open Access Journals (Sweden)

    Chen Nansheng

    2010-05-01

    Full Text Available Abstract Background Intraflagellar transport (IFT genes, which are critical for the development and function of cilia and flagella in metazoans, are tightly regulated by the Regulatory Factor X (RFX transcription factors (TFs. However, how and when their evolutionary relationship was established remains unknown. Results We have identified evidence suggesting that RFX TFs and IFT genes evolved independently and their evolution converged before the first appearance of metazoans. Both ciliary genes and RFX TFs exist in all metazoans as well as some unicellular eukaryotes. However, while RFX TFs and IFT genes are found simultaneously in all sequenced metazoan genomes, RFX TFs do not co-exist with IFT genes in most pre-metazoans and thus do not regulate them in these organisms. For example, neither the budding yeast nor the fission yeast possesses cilia although both have well-defined RFX TFs. Conversely, most unicellular eukaryotes, including the green alga Chlamydomonas reinhardtii, have typical cilia and well conserved IFT genes but lack RFX TFs. Outside of metazoans, RFX TFs and IFT genes co-exist only in choanoflagellates including M. brevicollis, and only one fungus Allomyces macrogynus of the 51 sequenced fungus genomes. M. brevicollis has two putative RFX genes and a full complement of ciliary genes. Conclusions The evolution of RFX TFs and IFT genes were independent in pre-metazoans. We propose that their convergence in evolution, or the acquired transcriptional regulation of IFT genes by RFX TFs, played a pivotal role in the establishment of metazoan.

  9. Regulation of cell proliferation by the E2F transcription factors

    DEFF Research Database (Denmark)

    Helin, K

    1998-01-01

    Experimental data generated in the past year have further emphasized the essential role for the E2F transcription factors in the regulation of cell proliferation. Genetic studies have shown that E2F activity is required for normal development in fruitflies, and the generation of E2F-1(-/-) mice h......Fs in the proteasomes. Novel target genes for the E2F transcription factors have been identified that link the E2Fs directly to the initiation of DNA replication.......Experimental data generated in the past year have further emphasized the essential role for the E2F transcription factors in the regulation of cell proliferation. Genetic studies have shown that E2F activity is required for normal development in fruitflies, and the generation of E2F-1(-/-) mice has...... demonstrated that individual members of the E2F transcription factor family are likely to have distinct roles in mammalian development and homeostasis. Additional mechanisms regulating the activity of the E2F transcription factors have been reported, including subcellular localization and proteolysis of the E2...

  10. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    Science.gov (United States)

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

    1997-03-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

  11. SP and KLF Transcription Factors in Digestive Physiology and Diseases.

    Science.gov (United States)

    Kim, Chang-Kyung; He, Ping; Bialkowska, Agnieszka B; Yang, Vincent W

    2017-06-01

    Specificity proteins (SPs) and Krüppel-like factors (KLFs) belong to the family of transcription factors that contain conserved zinc finger domains involved in binding to target DNA sequences. Many of these proteins are expressed in different tissues and have distinct tissue-specific activities and functions. Studies have shown that SPs and KLFs regulate not only physiological processes such as growth, development, differentiation, proliferation, and embryogenesis, but pathogenesis of many diseases, including cancer and inflammatory disorders. Consistently, these proteins have been shown to regulate normal functions and pathobiology in the digestive system. We review recent findings on the tissue- and organ-specific functions of SPs and KLFs in the digestive system including the oral cavity, esophagus, stomach, small and large intestines, pancreas, and liver. We provide a list of agents under development to target these proteins. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  12. [Identifying transcription factors involved in Arabidopsis adventious shoot regeneration by RNA-Seq technology].

    Science.gov (United States)

    Wang, Xingchun; Chen, Zhao; Fan, Juan; He, Miaomiao; Han, Yuanhuai; Yang, Zhirong

    2015-04-01

    Transcriptional regulation is one of the major regulations in plant adventious shoot regeneration, but the exact mechanism remains unclear. In our study, the RNA-seq technology based on the IlluminaHiSeq 2000 sequencing platform was used to identify differentially expressed transcription factor (TF) encoding genes during callus formation stage and adventious shoot regeneration stage between wild type and adventious shoot formation defective mutant be1-3 and during the transition from dedifferentiation to redifferentiation stage in wildtype WS. Results show that 155 TFs were differentially expressed between be1-3 mutant and wild type during callus formation, of which 97 genes were up-regulated, and 58 genes were down-regulated; and that 68 genes were differentially expressed during redifferentiation stage, with 40 genes up-regulated and 28 genes down-regulated; whereas at the transition stage from dedifferentiation to redifferention in WS wild type explants, a total of 231 differentially expressed TF genes were identified, including 160 up-regualted genes and 71 down-regulated genes. Among these TF genes, the adventious shoot related transcription factor 1 (ART1) gene encoding a MYB-related (v-myb avian myeloblastosis viral oncogene homolog) TF, was up-regulated 3 217 folds, and was the highest up-regulated gene during be1-3 callus formation. Over expression of the ART1 gene caused defects in callus formation and shoot regeneration and inhibited seedling growth, indicating that the ART1 gene is a negative regulator of callus formation and shoot regeneration. This work not only enriches our knowledge about the transcriptional regulation mechanism of adventious shoot regeneration, but also provides valuable information on candidate TF genes associated with adventious shoot regeneration for future research.

  13. A Model for Dimerization of the SOX Group E Transcription Factor Family.

    Directory of Open Access Journals (Sweden)

    Sarah N Ramsook

    Full Text Available Group E members of the SOX transcription factor family include SOX8, SOX9, and SOX10. Preceding the high mobility group (HMG domain in each of these proteins is a thirty-eight amino acid region that supports the formation of dimers on promoters containing tandemly inverted sites. The purpose of this study was to obtain new structural insights into how the dimerization region functions with the HMG domain. From a mutagenic scan of the dimerization region, the most essential amino acids of the dimerization region were clustered on the hydrophobic face of a single, predicted amphipathic helix. Consistent with our hypothesis that the dimerization region directly contacts the HMG domain, a peptide corresponding to the dimerization region bound a preassembled HMG-DNA complex. Sequence conservation among Group E members served as a basis to identify two surface exposed amino acids in the HMG domain of SOX9 that were necessary for dimerization. These data were combined to make a molecular model that places the dimerization region of one SOX9 protein onto the HMG domain of another SOX9 protein situated at the opposing site of a tandem promoter. The model provides a detailed foundation for assessing the impact of mutations on SOX Group E transcription factors.

  14. The transcript release factor PTRF augments ribosomal gene transcription by facilitating reinitiation of RNA polymerase I

    Czech Academy of Sciences Publication Activity Database

    Jansa, Petr; Burek, C.; Sander, E. E.; Grummt, I.

    2001-01-01

    Roč. 29, č. 2 (2001), s. 423-429 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z5052915 Keywords : rDNA transcription * PTRF * transcription reinitiation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.373, year: 2001

  15. Evidence for a Pneumocystis carinii Flo8-like transcription factor: insights into organism adhesion.

    Science.gov (United States)

    Kottom, Theodore J; Limper, Andrew H

    2016-02-01

    Pneumocystis carinii (Pc) adhesion to alveolar epithelial cells is well established and is thought to be a prerequisite for the initiation of Pneumocystis pneumonia. Pc binding events occur in part through the major Pc surface glycoprotein Msg, as well as an integrin-like molecule termed PcInt1. Recent data from the Pc sequencing project also demonstrate DNA sequences homologous to other genes important in Candida spp. binding to mammalian host cells, as well as organism binding to polystyrene surfaces and in biofilm formation. One of these genes, flo8, a transcription factor needed for downstream cAMP/PKA-pathway-mediated activation of the major adhesion/flocculin Flo11 in yeast, was cloned from a Pc cDNA library utilizing a partial sequence available in the Pc genome database. A CHEF blot of Pc genomic DNA yielded a single band providing evidence this gene is present in the organism. BLASTP analysis of the predicted protein demonstrated 41 % homology to the Saccharomyces cerevisiae Flo8. Northern blotting demonstrated greatest expression at pH 6.0-8.0, pH comparable to reported fungal biofilm milieu. Western blot and immunoprecipitation assays of PcFlo8 protein in isolated cyst and tropic life forms confirmed the presence of the cognate protein in these Pc life forms. Heterologous expression of Pcflo8 cDNA in flo8Δ-deficient yeast strains demonstrated that the Pcflo8 was able to restore yeast binding to polystyrene and invasive growth of yeast flo8Δ cells. Furthermore, Pcflo8 promoted yeast binding to HEK293 human epithelial cells, strengthening its functional classification as a Flo8 transcription factor. Taken together, these data suggest that PcFlo8 is expressed by Pc and may exert activity in organism adhesion and biofilm formation.

  16. Phylogenetic and comparative gene expression analysis of barley (Hordeum vulgare)WRKY transcription factor family reveals putatively retained functions betweenmonocots and dicots

    Energy Technology Data Exchange (ETDEWEB)

    Mangelsen, Elke; Kilian, Joachim; Berendzen, Kenneth W.; Kolukisaoglu, Uner; Harter, Klaus; Jansson, Christer; Wanke, Dierk

    2008-02-01

    WRKY proteins belong to the WRKY-GCM1 superfamily of zinc finger transcription factors that have been subject to a large plant-specific diversification. For the cereal crop barley (Hordeum vulgare), three different WRKY proteins have been characterized so far, as regulators in sucrose signaling, in pathogen defense, and in response to cold and drought, respectively. However, their phylogenetic relationship remained unresolved. In this study, we used the available sequence information to identify a minimum number of 45 barley WRKY transcription factor (HvWRKY) genes. According to their structural features the HvWRKY factors were classified into the previously defined polyphyletic WRKY subgroups 1 to 3. Furthermore, we could assign putative orthologs of the HvWRKY proteins in Arabidopsis and rice. While in most cases clades of orthologous proteins were formed within each group or subgroup, other clades were composed of paralogous proteins for the grasses and Arabidopsis only, which is indicative of specific gene radiation events. To gain insight into their putative functions, we examined expression profiles of WRKY genes from publicly available microarray data resources and found group specific expression patterns. While putative orthologs of the HvWRKY transcription factors have been inferred from phylogenetic sequence analysis, we performed a comparative expression analysis of WRKY genes in Arabidopsis and barley. Indeed, highly correlative expression profiles were found between some of the putative orthologs. HvWRKY genes have not only undergone radiation in monocot or dicot species, but exhibit evolutionary traits specific to grasses. HvWRKY proteins exhibited not only sequence similarities between orthologs with Arabidopsis, but also relatedness in their expression patterns. This correlative expression is indicative for a putative conserved function of related WRKY proteins in mono- and dicot species.

  17. Transcriptional Activation Domains of the Candida albicans Gcn4p and Gal4p Homologs▿ †

    OpenAIRE

    Martchenko, Mikhail; Levitin, Anastasia; Whiteway, Malcolm

    2006-01-01

    Many putative transcription factors in the pathogenic fungus Candida albicans contain sequence similarity to well-defined transcriptional regulators in the budding yeast Saccharomyces cerevisiae, but this sequence similarity is often limited to the DNA binding domains of the molecules. The Gcn4p and Gal4p proteins of Saccharomyces cerevisiae are highly studied and well-understood eukaryotic transcription factors of the basic leucine zipper (Gcn4p) and C6 zinc cluster (Gal4p) families; C. albi...

  18. Identification of transcription factors ZmMYB111and ZmMYB148 involved in phenylpropanoid metabolism

    Directory of Open Access Journals (Sweden)

    Junjie eZhang

    2016-02-01

    Full Text Available Maize is the leading crop worldwide in terms of both planting area and total yields, but environmental stresses cause significant losses in productivity. Phenylpropanoid compounds play an important role in plant stress resistance; however, the mechanism of their synthesis is not fully understood, especially in regard to the expression and regulation of key genes. Phenylalanine ammonia-lyase (PAL is the first key enzyme involved in phenylpropanoid metabolism, and it has a significant effect on the synthesis of important phenylpropanoid compounds. According to the results of sequence alignments and functional prediction, we selected two conserved R2R3-MYB transcription factors as candidate genes for the regulation of phenylpropanoid metabolism. The two candidate R2R3-MYB genes, which we named ZmMYB111and ZmMYB148, were cloned, and then their structural characteristics and phylogenetic placement were predicted and analyzed. In addition, a series of evaluations were performed, including expression profiles, subcellular localization, transcription activation, protein-DNA interaction, and transient expression in maize endosperm. Our results indicated that both ZmMYB111 and ZmMYB148 are indeed R2R3-MYB transcription factors and that they may play a regulatory role in PAL gene expression.

  19. Predicting transcription factor binding sites using local over-representation and comparative genomics

    Directory of Open Access Journals (Sweden)

    Touzet Hélène

    2006-08-01

    Full Text Available Abstract Background Identifying cis-regulatory elements is crucial to understanding gene expression, which highlights the importance of the computational detection of overrepresented transcription factor binding sites (TFBSs in coexpressed or coregulated genes. However, this is a challenging problem, especially when considering higher eukaryotic organisms. Results We have developed a method, named TFM-Explorer, that searches for locally overrepresented TFBSs in a set of coregulated genes, which are modeled by profiles provided by a database of position weight matrices. The novelty of the method is that it takes advantage of spatial conservation in the sequence and supports multiple species. The efficiency of the underlying algorithm and its robustness to noise allow weak regulatory signals to be detected in large heterogeneous data sets. Conclusion TFM-Explorer provides an efficient way to predict TFBS overrepresentation in related sequences. Promising results were obtained in a variety of examples in human, mouse, and rat genomes. The software is publicly available at http://bioinfo.lifl.fr/TFM-Explorer.

  20. Inter- and intra-combinatorial regulation by transcription factors and microRNAs

    Directory of Open Access Journals (Sweden)

    Chang Joseph T

    2007-10-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are a novel class of non-coding small RNAs. In mammalian cells, miRNAs repress the translation of messenger RNAs (mRNAs or degrade mRNAs. miRNAs play important roles in development and differentiation, and they are also implicated in aging, and oncogenesis. Predictions of targets of miRNAs suggest that they may regulate more than one-third of all genes. The overall functions of mammalian miRNAs remain unclear. Combinatorial regulation by transcription factors alone or miRNAs alone offers a wide range of regulatory programs. However, joining transcriptional and post-transcriptional regulatory mechanisms enables higher complexity regulatory programs that in turn could give cells evolutionary advantages. Investigating coordinated regulation of genes by miRNAs and transcription factors (TFs from a statistical standpoint is a first step that may elucidate some of their roles in various biological processes. Results Here, we studied the nature and scope of coordination among regulators from the transcriptional and miRNA regulatory layers in the human genome. Our findings are based on genome wide statistical assessment of regulatory associations ("interactions" among the sets of predicted targets of miRNAs and sets of putative targets of transcription factors. We found that combinatorial regulation by transcription factor pairs and miRNA pairs is much more abundant than the combinatorial regulation by TF-miRNA pairs. In addition, many of the strongly interacting TF-miRNA pairs involve a subset of master TF regulators that co-regulate genes in coordination with almost any miRNA. Application of standard measures for evaluating the degree of interaction between pairs of regulators show that strongly interacting TF-miRNA, TF-TF or miRNA-miRNA pairs tend to include TFs or miRNAs that regulate very large numbers of genes. To correct for this potential bias we introduced an additional Bayesian measure that incorporates

  1. Wheat Transcription Factor TaAREB3 Participates in Drought and Freezing Tolerances in Arabidopsis.

    Science.gov (United States)

    Wang, Jingyi; Li, Qian; Mao, Xinguo; Li, Ang; Jing, Ruilian

    2016-01-01

    AREB (ABA response element binding) proteins in plants play direct regulatory roles in response to multiple stresses, but their functions in wheat (Triticum aestivum L.) are not clear. In the present study, TaAREB3, a new member of the AREB transcription factor family, was isolated from wheat. Sequence analysis showed that the TaAREB3 protein is composed of three parts, a conserved N-terminal, a variable M region, and a conserved C-terminal with a bZIP domain. It belongs to the group A subfamily of bZIP transcription factors. TaAREB3 was constitutively expressed in stems, leaves, florets, anthers, pistils, seeds, and most highly, in roots. TaAREB3 gene expression was induced with abscisic acid (ABA) and low temperature stress, and its protein was localized in the nucleus when transiently expressed in tobacco epidermal cells and stably expressed in transgenic Arabidopsis. TaAREB3 protein has transcriptional activation activity, and can bind to the ABRE cis-element in vitro. Overexpression of TaAREB3 in Arabidopsis not only enhanced ABA sensitivity, but also strengthened drought and freezing tolerances. TaAREB3 also activated RD29A, RD29B, COR15A, and COR47 by binding to their promoter regions in transgenic Arabidopsis. These results demonstrated that TaAREB3 plays an important role in drought and freezing tolerances in Arabidopsis.

  2. Identification and functional characterization of Rca1, a transcription factor involved in both antifungal susceptibility and host response in Candida albicans.

    Science.gov (United States)

    Vandeputte, Patrick; Pradervand, Sylvain; Ischer, Françoise; Coste, Alix T; Ferrari, Sélène; Harshman, Keith; Sanglard, Dominique

    2012-07-01

    The identification of novel transcription factors associated with antifungal response may allow the discovery of fungus-specific targets for new therapeutic strategies. A collection of 241 Candida albicans transcriptional regulator mutants was screened for altered susceptibility to fluconazole, caspofungin, amphotericin B, and 5-fluorocytosine. Thirteen of these mutants not yet identified in terms of their role in antifungal response were further investigated, and the function of one of them, a mutant of orf19.6102 (RCA1), was characterized by transcriptome analysis. Strand-specific RNA sequencing and phenotypic tests assigned Rca1 as the regulator of hyphal formation through the cyclic AMP/protein kinase A (cAMP/PKA) signaling pathway and the transcription factor Efg1, but also probably through its interaction with a transcriptional repressor, most likely Tup1. The mechanisms responsible for the high level of resistance to caspofungin and fluconazole observed resulting from RCA1 deletion were investigated. From our observations, we propose that caspofungin resistance was the consequence of the deregulation of cell wall gene expression and that fluconazole resistance was linked to the modulation of the cAMP/PKA signaling pathway activity. In conclusion, our large-scale screening of a C. albicans transcription factor mutant collection allowed the identification of new effectors of the response to antifungals. The functional characterization of Rca1 assigned this transcription factor and its downstream targets as promising candidates for the development of new therapeutic strategies, as Rca1 influences host sensing, hyphal development, and antifungal response.

  3. Genome-wide analysis of transcription factors during somatic embryogenesis in banana (Musa spp.) cv. Grand Naine.

    Science.gov (United States)

    Shivani; Awasthi, Praveen; Sharma, Vikrant; Kaur, Navjot; Kaur, Navneet; Pandey, Pankaj; Tiwari, Siddharth

    2017-01-01

    Transcription factors BABY BOOM (BBM), WUSCHEL (WUS), BSD, LEAFY COTYLEDON (LEC), LEAFY COTYLEDON LIKE (LIL), VIVIPAROUS1 (VP1), CUP SHAPED COTYLEDONS (CUC), BOLITA (BOL), and AGAMOUS LIKE (AGL) play a crucial role in somatic embryogenesis. In this study, we identified eighteen genes of these nine transcription factors families from the banana genome database. All genes were analyzed for their structural features, subcellular, and chromosomal localization. Protein sequence analysis indicated the presence of characteristic conserved domains in these transcription factors. Phylogenetic analysis revealed close evolutionary relationship among most transcription factors of various monocots. The expression patterns of eighteen genes in embryogenic callus containing somatic embryos (precisely isolated by Laser Capture Microdissection), non-embryogenic callus, and cell suspension cultures of banana cultivar Grand Naine were analyzed. The application of 2, 4-dichlorophenoxyacetic acid (2, 4-D) in the callus induction medium enhanced the expression of MaBBM1, MaBBM2, MaWUS2, and MaVP1 in the embryogenic callus. It suggested 2, 4-D acts as an inducer for the expression of these genes. The higher expression of MaBBM2 and MaWUS2 in embryogenic cell suspension (ECS) as compared to non-embryogenic cells suspension (NECS), suggested that these genes may play a crucial role in banana somatic embryogenesis. MaVP1 showed higher expression in both ECS and NECS, whereas MaLEC2 expression was significantly higher in NECS. It suggests that MaLEC2 has a role in the development of non-embryogenic cells. We postulate that MaBBM2 and MaWUS2 can be served as promising molecular markers for the embryogencity in banana.

  4. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  5. Genome-Wide Identification and Structural Analysis of bZIP Transcription Factor Genes in Brassica napus.

    Science.gov (United States)

    Zhou, Yan; Xu, Daixiang; Jia, Ledong; Huang, Xiaohu; Ma, Guoqiang; Wang, Shuxian; Zhu, Meichen; Zhang, Aoxiang; Guan, Mingwei; Lu, Kun; Xu, Xinfu; Wang, Rui; Li, Jiana; Qu, Cunmin

    2017-10-24

    The basic region/leucine zipper motif (bZIP) transcription factor family is one of the largest families of transcriptional regulators in plants. bZIP genes have been systematically characterized in some plants, but not in rapeseed ( Brassica napus ). In this study, we identified 247 BnbZIP genes in the rapeseed genome, which we classified into 10 subfamilies based on phylogenetic analysis of their deduced protein sequences. The BnbZIP genes were grouped into functional clades with Arabidopsis genes with similar putative functions, indicating functional conservation. Genome mapping analysis revealed that the BnbZIPs are distributed unevenly across all 19 chromosomes, and that some of these genes arose through whole-genome duplication and dispersed duplication events. All expression profiles of 247 bZIP genes were extracted from RNA-sequencing data obtained from 17 different B . napus ZS11 tissues with 42 various developmental stages. These genes exhibited different expression patterns in various tissues, revealing that these genes are differentially regulated. Our results provide a valuable foundation for functional dissection of the different BnbZIP homologs in B . napus and its parental lines and for molecular breeding studies of bZIP genes in B . napus .

  6. Mitotic Transcriptional Activation: Clearance of Actively Engaged Pol II via Transcriptional Elongation Control in Mitosis.

    Science.gov (United States)

    Liang, Kaiwei; Woodfin, Ashley R; Slaughter, Brian D; Unruh, Jay R; Box, Andrew C; Rickels, Ryan A; Gao, Xin; Haug, Jeffrey S; Jaspersen, Sue L; Shilatifard, Ali

    2015-11-05

    Although it is established that some general transcription factors are inactivated at mitosis, many details of mitotic transcription inhibition (MTI) and its underlying mechanisms are largely unknown. We have identified mitotic transcriptional activation (MTA) as a key regulatory step to control transcription in mitosis for genes with transcriptionally engaged RNA polymerase II (Pol II) to activate and transcribe until the end of the gene to clear Pol II from mitotic chromatin, followed by global impairment of transcription reinitiation through MTI. Global nascent RNA sequencing and RNA fluorescence in situ hybridization demonstrate the existence of transcriptionally engaged Pol II in early mitosis. Both genetic and chemical inhibition of P-TEFb in mitosis lead to delays in the progression of cell division. Together, our study reveals a mechanism for MTA and MTI whereby transcriptionally engaged Pol II can progress into productive elongation and finish transcription to allow proper cellular division. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites

    Directory of Open Access Journals (Sweden)

    Kristopher J. L. Irizarry

    2016-01-01

    Full Text Available Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1 that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons.

  8. Hepatic deficiency of the pioneer transcription factor FoxA restricts hepatitis B virus biosynthesis by the developmental regulation of viral DNA methylation.

    Directory of Open Access Journals (Sweden)

    Vanessa C McFadden

    2017-02-01

    Full Text Available The FoxA family of pioneer transcription factors regulates hepatitis B virus (HBV transcription, and hence viral replication. Hepatocyte-specific FoxA-deficiency in the HBV transgenic mouse model of chronic infection prevents the transcription of the viral DNA genome as a result of the failure of the developmentally controlled conversion of 5-methylcytosine residues to cytosine during postnatal hepatic maturation. These observations suggest that pioneer transcription factors such as FoxA, which mark genes for expression at subsequent developmental steps in the cellular differentiation program, mediate their effects by reversing the DNA methylation status of their target genes to permit their ensuing expression when the appropriate tissue-specific transcription factor combinations arise during development. Furthermore, as the FoxA-deficient HBV transgenic mice are viable, the specific developmental timing, abundance and isoform type of pioneer factor expression must permit all essential liver gene expression to occur at a level sufficient to support adequate liver function. This implies that pioneer transcription factors can recognize and mark their target genes in distinct developmental manners dependent upon, at least in part, the concentration and affinity of FoxA for its binding sites within enhancer and promoter regulatory sequence elements. This selective marking of cellular genes for expression by the FoxA pioneer factor compared to HBV may offer the opportunity for the specific silencing of HBV gene expression and hence the resolution of chronic HBV infections which are responsible for approximately one million deaths worldwide annually due to liver cirrhosis and hepatocellular carcinoma.

  9. Novel Strategy for Discrimination of Transcription Factor Binding Motifs Employing Mathematical Neural Network

    Science.gov (United States)

    Sugimoto, Asuka; Sumi, Takuya; Kang, Jiyoung; Tateno, Masaru

    2017-07-01

    Recognition in biological macromolecular systems, such as DNA-protein recognition, is one of the most crucial problems to solve toward understanding the fundamental mechanisms of various biological processes. Since specific base sequences of genome DNA are discriminated by proteins, such as transcription factors (TFs), finding TF binding motifs (TFBMs) in whole genome DNA sequences is currently a central issue in interdisciplinary biophysical and information sciences. In the present study, a novel strategy to create a discriminant function for discrimination of TFBMs by constituting mathematical neural networks (NNs) is proposed, together with a method to determine the boundary of signals (TFBMs) and noise in the NN-score (output) space. This analysis also leads to the mathematical limitation of discrimination in the recognition of features representing TFBMs, in an information geometrical manifold. Thus, the present strategy enables the identification of the whole space of TFBMs, right up to the noise boundary.

  10. Wound induced tanscriptional regulation of benzylisoquinoline pathway and characterization of wound inducible PsWRKY transcription factor from Papaver somniferum.

    Directory of Open Access Journals (Sweden)

    Sonal Mishra

    Full Text Available Wounding is required to be made in the walls of the green seed pod of Opium poppy prior exudation of latex. To withstand this kind of trauma plants regulate expression of some metabolites through an induced transcript level. 167 unique wound-inducible ESTs were identified by a repetitive round of cDNA subtraction after 5 hours of wounding in Papaver somniferum seedlings. Further repetitive reverse northern analysis of these ESTs revealed 80 transcripts showing more than two fold induction, validated through semi-quantitative RT-PCR & real time expression analysis. One of the major classified categories among identified ESTs belonged to benzylisoquinoline transcripts. Tissue specific metabolite analysis of benzylisoquinoline alkaloids (BIAs in response to wounding revealed increased accumulation of narcotine and papaverine. Promoter analysis of seven transcripts of BIAs pathway showed the presence of W-box cis-element with the consensus sequence of TGAC, which is the proposed binding site for WRKY type transcription factors. One of the Wound inducible 'WRKY' EST isolated from our subtracted library was made full-length and named as 'PsWRKY'. Bacterially expressed PsWRKY interacted with the W-box element having consensus sequence TTGACT/C present in the promoter region of BIAs biosynthetic pathway genes. PsWRKY further activated the TYDC promoter in yeast and transiently in tobacco BY2 cells. Preferential expression of PsWRKY in straw and capsule and its interaction with consensus W-box element present in BIAs pathway gene transcripts suggest its possible involvement in the wound induced regulation of BIAs pathway.

  11. DNA-binding specificity and molecular functions of NAC transcription factors

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Ernst, Heidi Asschenfeldt; Lo Leggio, Leila

    2005-01-01

    The family of NAC (NAM/ATAF1,2/CUC2) transcription factors has been implicated in a wide range of plant processes, but knowledge on the DNA-binding properties of the family is limited. Using a reiterative selection procedure on random oligonucleotides, we have identified consensus binding sites....... Furthermore, NAC protein binding to the CaMV 35S promoter was shown to depend on sequences similar to the consensus of the selected oligonucleotides. Electrophoretic mobility shift assays demonstrated that NAC proteins bind DNA as homo- or heterodimers and that dimerization is necessary for stable DNA binding....... The ability of NAC proteins to dimerize and to bind DNAwas analysed by structure-based mutagenesis. This identified two salt bridge-forming residues essential for NAC protein dimerization. Alteration of basic residues in a loop region containing several highly conserved residues abolished DNA binding. Thus...

  12. Induction of Epstein-Barr Virus Oncoprotein LMP1 by Transcription Factors AP-2 and Early B Cell Factor

    Science.gov (United States)

    Noda, Chieko; Narita, Yohei; Watanabe, Takahiro; Yoshida, Masahiro; Ashio, Keiji; Sato, Yoshitaka; Goshima, Fumi; Kanda, Teru; Yoshiyama, Hironori; Tsurumi, Tatsuya; Kimura, Hiroshi

    2016-01-01

    ABSTRACT Latent membrane protein 1 (LMP1) is a major oncogene essential for primary B cell transformation by Epstein-Barr virus (EBV). Previous studies suggested that some transcription factors, such as PU.1, RBP-Jκ, NF-κB, and STAT, are involved in this expression, but the underlying mechanism is unclear. Here, we identified binding sites for PAX5, AP-2, and EBF in the proximal LMP1 promoter (ED-L1p). We first confirmed the significance of PU.1 and POU domain transcription factor binding for activation of the promoter in latency III. We then focused on the transcription factors AP-2 and early B cell factor (EBF). Interestingly, among the three AP-2-binding sites in the LMP1 promoter, two motifs were also bound by EBF. Overexpression, knockdown, and mutagenesis in the context of the viral genome indicated that AP-2 plays an important role in LMP1 expression in latency II in epithelial cells. In latency III B cells, on the other hand, the B cell-specific transcription factor EBF binds to the ED-L1p and activates LMP1 transcription from the promoter. IMPORTANCE Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) is crucial for B cell transformation and oncogenesis of other EBV-related malignancies, such as nasopharyngeal carcinoma and T/NK lymphoma. Its expression is largely dependent on the cell type or condition, and some transcription factors have been implicated in its regulation. However, these previous reports evaluated the significance of specific factors mostly by reporter assay. In this study, we prepared point-mutated EBV at the binding sites of such transcription factors and confirmed the importance of AP-2, EBF, PU.1, and POU domain factors. Our results will provide insight into the transcriptional regulation of the major oncogene LMP1. PMID:26819314

  13. HOCOMOCO: towards a complete collection of transcription factor binding models for human and mouse via large-scale ChIP-Seq analysis

    KAUST Repository

    Kulakovskiy, Ivan V.; Vorontsov, Ilya E.; Yevshin, Ivan S.; Sharipov, Ruslan N.; Fedorova, Alla D.; Rumynskiy, Eugene I.; Medvedeva, Yulia A.; Magana-Mora, Arturo; Bajic, Vladimir B.; Papatsenko, Dmitry A.; Kolpakov, Fedor A.; Makeev, Vsevolod J.

    2017-01-01

    We present a major update of the HOCOMOCO collection that consists of patterns describing DNA binding specificities for human and mouse transcription factors. In this release, we profited from a nearly doubled volume of published in vivo experiments on transcription factor (TF) binding to expand the repertoire of binding models, replace low-quality models previously based on in vitro data only and cover more than a hundred TFs with previously unknown binding specificities. This was achieved by systematic motif discovery from more than five thousand ChIP-Seq experiments uniformly processed within the BioUML framework with several ChIP-Seq peak calling tools and aggregated in the GTRD database. HOCOMOCO v11 contains binding models for 453 mouse and 680 human transcription factors and includes 1302 mononucleotide and 576 dinucleotide position weight matrices, which describe primary binding preferences of each transcription factor and reliable alternative binding specificities. An interactive interface and bulk downloads are available on the web: http://hocomoco.autosome.ru and http://www.cbrc.kaust.edu.sa/hocomoco11. In this release, we complement HOCOMOCO by MoLoTool (Motif Location Toolbox, http://molotool.autosome.ru) that applies HOCOMOCO models for visualization of binding sites in short DNA sequences.

  14. HOCOMOCO: towards a complete collection of transcription factor binding models for human and mouse via large-scale ChIP-Seq analysis

    KAUST Repository

    Kulakovskiy, Ivan V.

    2017-10-31

    We present a major update of the HOCOMOCO collection that consists of patterns describing DNA binding specificities for human and mouse transcription factors. In this release, we profited from a nearly doubled volume of published in vivo experiments on transcription factor (TF) binding to expand the repertoire of binding models, replace low-quality models previously based on in vitro data only and cover more than a hundred TFs with previously unknown binding specificities. This was achieved by systematic motif discovery from more than five thousand ChIP-Seq experiments uniformly processed within the BioUML framework with several ChIP-Seq peak calling tools and aggregated in the GTRD database. HOCOMOCO v11 contains binding models for 453 mouse and 680 human transcription factors and includes 1302 mononucleotide and 576 dinucleotide position weight matrices, which describe primary binding preferences of each transcription factor and reliable alternative binding specificities. An interactive interface and bulk downloads are available on the web: http://hocomoco.autosome.ru and http://www.cbrc.kaust.edu.sa/hocomoco11. In this release, we complement HOCOMOCO by MoLoTool (Motif Location Toolbox, http://molotool.autosome.ru) that applies HOCOMOCO models for visualization of binding sites in short DNA sequences.

  15. Transcription profile of Escherichia coli: genomic SELEX search for regulatory targets of transcription factors.

    Science.gov (United States)

    Ishihama, Akira; Shimada, Tomohiro; Yamazaki, Yukiko

    2016-03-18

    Bacterial genomes are transcribed by DNA-dependent RNA polymerase (RNAP), which achieves gene selectivity through interaction with sigma factors that recognize promoters, and transcription factors (TFs) that control the activity and specificity of RNAP holoenzyme. To understand the molecular mechanisms of transcriptional regulation, the identification of regulatory targets is needed for all these factors. We then performed genomic SELEX screenings of targets under the control of each sigma factor and each TF. Here we describe the assembly of 156 SELEX patterns of a total of 116 TFs performed in the presence and absence of effector ligands. The results reveal several novel concepts: (i) each TF regulates more targets than hitherto recognized; (ii) each promoter is regulated by more TFs than hitherto recognized; and (iii) the binding sites of some TFs are located within operons and even inside open reading frames. The binding sites of a set of global regulators, including cAMP receptor protein, LeuO and Lrp, overlap with those of the silencer H-NS, suggesting that certain global regulators play an anti-silencing role. To facilitate sharing of these accumulated SELEX datasets with the research community, we compiled a database, 'Transcription Profile of Escherichia coli' (www.shigen.nig.ac.jp/ecoli/tec/). © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Identification of transcription-factor genes expressed in the Arabidopsis female gametophyte

    Directory of Open Access Journals (Sweden)

    Kang Il-Ho

    2010-06-01

    Full Text Available Abstract Background In flowering plants, the female gametophyte is typically a seven-celled structure with four cell types: the egg cell, the central cell, the synergid cells, and the antipodal cells. These cells perform essential functions required for double fertilization and early seed development. Differentiation of these distinct cell types likely involves coordinated changes in gene expression regulated by transcription factors. Therefore, understanding female gametophyte cell differentiation and function will require dissection of the gene regulatory networks operating in each of the cell types. These efforts have been hampered because few transcription factor genes expressed in the female gametophyte have been identified. To identify such genes, we undertook a large-scale differential expression screen followed by promoter-fusion analysis to detect transcription-factor genes transcribed in the Arabidopsis female gametophyte. Results Using quantitative reverse-transcriptase PCR, we analyzed 1,482 Arabidopsis transcription-factor genes and identified 26 genes exhibiting reduced mRNA levels in determinate infertile 1 mutant ovaries, which lack female gametophytes, relative to ovaries containing female gametophytes. Spatial patterns of gene transcription within the mature female gametophyte were identified for 17 transcription-factor genes using promoter-fusion analysis. Of these, ten genes were predominantly expressed in a single cell type of the female gametophyte including the egg cell, central cell and the antipodal cells whereas the remaining seven genes were expressed in two or more cell types. After fertilization, 12 genes were transcriptionally active in the developing embryo and/or endosperm. Conclusions We have shown that our quantitative reverse-transcriptase PCR differential-expression screen is sufficiently sensitive to detect transcription-factor genes transcribed in the female gametophyte. Most of the genes identified in this

  17. Breaking the mold: transcription factors in the anucleate platelet and platelet-derived microparticles

    Directory of Open Access Journals (Sweden)

    Katie L Lannan

    2015-02-01

    Full Text Available Platelets are small anucleate blood cells derived from megakaryocytes. In addition to their pivotal roles in hemostasis, platelets are the smallest, yet most abundant, immune cell and regulate inflammation, immunity, and disease progression. Although platelets lack DNA, and thus no functional transcriptional activities, they are nonetheless rich sources of RNAs, possess an intact spliceosome, and are thus capable of synthesizing proteins. Previously, it was thought that platelet RNAs and translational machinery were remnants from the megakaryocyte. We now know that the initial description of platelets as cellular fragments is an antiquated notion, as mounting evidence suggests otherwise. Therefore, it is reasonable to hypothesize that platelet transcription factors are not vestigial remnants from megakaryoctes, but have important, if only partly understood functions. Proteins play multiple cellular roles to minimize energy expenditure for maximum cellular function; thus, the same can be expected for transcription factors. In fact, numerous transcription factors have non-genomic roles, both in platelets and in nucleated cells. Our lab and others have discovered the presence and nongenomic roles of transcription factors in platelets, such as the nuclear factor kappa β (NFκB family of proteins and peroxisome proliferator activated receptor gamma (PPARγ. In addition to numerous roles in regulating platelet activation, functional transcription factors can be transferred to vascular and immune cells through platelet microparticles. This method of transcellular delivery of key immune molecules may be a vital mechanism by which platelet transcription factors regulate inflammation and immunity. At the very least, platelets are an ideal model cell to dissect out the nongenomic roles of transcription factors in nucleated cells. There is abundant evidence to suggest that transcription factors in platelets play key roles in regulating inflammatory and

  18. O-GlcNAc inhibits interaction between Sp1 and Elf-1 transcription factors

    International Nuclear Information System (INIS)

    Lim, Kihong; Chang, Hyo-Ihl

    2009-01-01

    The novel protein modification, O-linked N-acetylglucosamine (O-GlcNAc), plays an important role in various aspects of cell regulation. Although most of nuclear transcription regulatory factors are modified by O-GlcNAc, O-GlcNAc effects on transcription remain largely undefined yet. In this study, we show that O-GlcNAc inhibits a physical interaction between Sp1 and Elf-1 transcription factors, and negatively regulates transcription of placenta and embryonic expression oncofetal protein gene (Pem). These findings suggest that O-GlcNAc inhibits Sp1-mediated gene transcription possibly by interrupting Sp1 interaction with its cooperative factor.

  19. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Science.gov (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  20. CoryneRegNet: an ontology-based data warehouse of corynebacterial transcription factors and regulatory networks.

    Science.gov (United States)

    Baumbach, Jan; Brinkrolf, Karina; Czaja, Lisa F; Rahmann, Sven; Tauch, Andreas

    2006-02-14

    The application of DNA microarray technology in post-genomic analysis of bacterial genome sequences has allowed the generation of huge amounts of data related to regulatory networks. This data along with literature-derived knowledge on regulation of gene expression has opened the way for genome-wide reconstruction of transcriptional regulatory networks. These large-scale reconstructions can be converted into in silico models of bacterial cells that allow a systematic analysis of network behavior in response to changing environmental conditions. CoryneRegNet was designed to facilitate the genome-wide reconstruction of transcriptional regulatory networks of corynebacteria relevant in biotechnology and human medicine. During the import and integration process of data derived from experimental studies or literature knowledge CoryneRegNet generates links to genome annotations, to identified transcription factors and to the corresponding cis-regulatory elements. CoryneRegNet is based on a multi-layered, hierarchical and modular concept of transcriptional regulation and was implemented by using the relational database management system MySQL and an ontology-based data structure. Reconstructed regulatory networks can be visualized by using the yFiles JAVA graph library. As an application example of CoryneRegNet, we have reconstructed the global transcriptional regulation of a cellular module involved in SOS and stress response of corynebacteria. CoryneRegNet is an ontology-based data warehouse that allows a pertinent data management of regulatory interactions along with the genome-scale reconstruction of transcriptional regulatory networks. These models can further be combined with metabolic networks to build integrated models of cellular function including both metabolism and its transcriptional regulation.

  1. CEBPG transcription factor correlates with antioxidant and DNA repair genes in normal bronchial epithelial cells but not in individuals with bronchogenic carcinoma

    International Nuclear Information System (INIS)

    Mullins, D'Anna N; Crawford, Erin L; Khuder, Sadik A; Hernandez, Dawn-Alita; Yoon, Youngsook; Willey, James C

    2005-01-01

    Cigarette smoking is the primary cause of bronchogenic carcinoma (BC), yet only 10–15% of heavy smokers develop BC and it is likely that this variation in risk is, in part, genetically determined. We previously reported a set of antioxidant genes for which transcript abundance was lower in normal bronchial epithelial cells (NBEC) of BC individuals compared to non-BC individuals. In unpublished studies of the same NBEC samples, transcript abundance values for several DNA repair genes were correlated with these antioxidant genes. From these data, we hypothesized that antioxidant and DNA repair genes are co-regulated by one or more transcription factors and that inter-individual variation in expression and/or function of one or more of these transcription factors is responsible for inter-individual variation in risk for BC. The putative transcription factor recognition sites common to six of the antioxidant genes were identified through in silico DNA sequence analysis. The transcript abundance values of these transcription factors (n = 6) and an expanded group of antioxidant and DNA repair genes (n = 16) were measured simultaneously by quantitative PCR in NBEC of 24 non-BC and 25 BC individuals. CEBPG transcription factor was significantly (p < 0.01) correlated with eight of the antioxidant or DNA repair genes in non-BC individuals but not in BC individuals. In BC individuals the correlation with CEBPG was significantly (p < 0.01) lower than that of non-BC individuals for four of the genes (XRCC1, ERCC5, GSTP1, and SOD1) and the difference was nearly significant for GPX1. The only other transcription factor correlated with any of these five target genes in non-BC individuals was E2F1. E2F1 was correlated with GSTP1 among non-BC individuals, but in contrast to CEBPG, there was no significant difference in this correlation in non-BC individuals compared to BC individuals. We conclude that CEBPG is the transcription factor primarily responsible for regulating

  2. The relationship between transcription initiation RNAs and CCCTC-binding factor (CTCF localization

    Directory of Open Access Journals (Sweden)

    Taft Ryan J

    2011-08-01

    Full Text Available Abstract Background Transcription initiation RNAs (tiRNAs are nuclear localized 18 nucleotide RNAs derived from sequences immediately downstream of RNA polymerase II (RNAPII transcription start sites. Previous reports have shown that tiRNAs are intimately correlated with gene expression, RNA polymerase II binding and behaviors, and epigenetic marks associated with transcription initiation, but not elongation. Results In the present work, we show that tiRNAs are commonly found at genomic CCCTC-binding factor (CTCF binding sites in human and mouse, and that CTCF sites that colocalize with RNAPII are highly enriched for tiRNAs. To directly investigate the relationship between tiRNAs and CTCF we examined tiRNAs originating near the intronic CTCF binding site in the human tumor suppressor gene, p21 (cyclin-dependent kinase inhibitor 1A gene, also known as CDKN1A. Inhibition of CTCF-proximal tiRNAs resulted in increased CTCF localization and increased p21 expression, while overexpression of CTCF-proximal tiRNA mimics decreased CTCF localization and p21 expression. We also found that tiRNA-regulated CTCF binding influences the levels of trimethylated H3K27 at the alternate upstream p21 promoter, and affects the levels of alternate p21 (p21alt transcripts. Extending these studies to another randomly selected locus with conserved CTCF binding we found that depletion of tiRNA alters nucleosome density proximal to sites of tiRNA biogenesis. Conclusions Taken together, these data suggest that tiRNAs modulate local epigenetic structure, which in turn regulates CTCF localization.

  3. The intracellular immune receptor Rx1 regulates the DNA-binding activity of a Golden2-like transcription factor.

    Science.gov (United States)

    Townsend, Philip D; Dixon, Christopher H; Slootweg, Erik J; Sukarta, Octavina C A; Yang, Ally W H; Hughes, Timothy R; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Goverse, Aska; Cann, Martin J

    2018-03-02

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable the immune system to recognize and respond to pathogen attack. An early consequence of immune activation is transcriptional reprogramming, and some NLRs have been shown to act in the nucleus and interact with transcription factors. The Rx1 NLR protein of potato is further able to bind and distort double-stranded DNA. However, Rx1 host targets that support a role for Rx1 in transcriptional reprogramming at DNA are unknown. Here, we report a functional interaction between Rx1 and Nb Glk1, a Golden2-like transcription factor. Rx1 binds to Nb Glk1 in vitro and in planta. Nb Glk1 binds to known Golden2-like consensus DNA sequences. Rx1 reduces the binding affinity of Nb Glk1 for DNA in vitro. Nb Glk1 activates cellular responses to potato virus X, whereas Rx1 associates with Nb Glk1 and prevents its assembly on DNA in planta unless activated by PVX. This study provides new mechanistic insight into how an NLR can coordinate an immune signaling response at DNA following pathogen perceptions. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. msCentipede: Modeling Heterogeneity across Genomic Sites and Replicates Improves Accuracy in the Inference of Transcription Factor Binding.

    Directory of Open Access Journals (Sweden)

    Anil Raj

    Full Text Available Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede.

  5. msCentipede: Modeling Heterogeneity across Genomic Sites and Replicates Improves Accuracy in the Inference of Transcription Factor Binding.

    Science.gov (United States)

    Raj, Anil; Shim, Heejung; Gilad, Yoav; Pritchard, Jonathan K; Stephens, Matthew

    2015-01-01

    Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede.

  6. Specificity versus redundancy in the RAP2.4 transcription factor family of Arabidopsis thaliana: transcriptional regulation of genes for chloroplast peroxidases.

    Science.gov (United States)

    Rudnik, Radoslaw; Bulcha, Jote Tafese; Reifschneider, Elena; Ellersiek, Ulrike; Baier, Margarete

    2017-08-23

    The Arabidopsis ERFIb / RAP2.4 transcription factor family consists of eight members with highly conserved DNA binding domains. Selected members have been characterized individually, but a systematic comparison is pending. The redox-sensitive transcription factor RAP2.4a mediates chloroplast-to-nucleus redox signaling and controls induction of the three most prominent chloroplast peroxidases, namely 2-Cys peroxiredoxin A (2CPA) and thylakoid- and stromal ascorbate peroxidase (tAPx and sAPx). To test the specificity and redundancy of RAP2.4 transcription factors in the regulation of genes for chloroplast peroxidases, we compared the DNA-binding sites of the transcription factors in tertiary structure models, analyzed transcription factor and target gene regulation by qRT-PCR in RAP2.4, 2-Cys peroxiredoxin and ascorbate peroxidase T-DNA insertion lines and RAP2.4 overexpressing lines of Arabidopsis thaliana and performed promoter binding studies. All RAP2.4 proteins bound the tAPx promoter, but only the four RAP2.4 proteins with identical DNA contact sites, namely RAP2.4a, RAP2.4b, RAP2.4d and RAP2.4h, interacted stably with the redox-sensitive part of the 2CPA promoter. Gene expression analysis in RAP2.4 knockout lines revealed that RAP2.4a is the only one supporting 2CPA and chloroplast APx expression. Rap2.4h binds to the same promoter region as Rap2.4a and antagonizes 2CPA expression. Like the other six RAP2.4 proteins, Rap2.4 h promotes APx mRNA accumulation. Chloroplast ROS signals induced RAP2.4b and RAP2.4d expression, but these two transcription factor genes are (in contrast to RAP2.4a) insensitive to low 2CP availability, and their expression decreased in APx knockout lines. RAP2.4e and RAP2.4f gradually responded to chloroplast APx availability and activated specifically APx expression. These transcription factors bound, like RAP2.4c and RAP2.4g, the tAPx promoter, but hardly the 2CPA promoter. The RAP2.4 transcription factors form an environmentally and

  7. Reactivation of Latent HIV-1 Expression by Engineered TALE Transcription Factors.

    Science.gov (United States)

    Perdigão, Pedro; Gaj, Thomas; Santa-Marta, Mariana; Barbas, Carlos F; Goncalves, Joao

    2016-01-01

    The presence of replication-competent HIV-1 -which resides mainly in resting CD4+ T cells--is a major hurdle to its eradication. While pharmacological approaches have been useful for inducing the expression of this latent population of virus, they have been unable to purge HIV-1 from all its reservoirs. Additionally, many of these strategies have been associated with adverse effects, underscoring the need for alternative approaches capable of reactivating viral expression. Here we show that engineered transcriptional modulators based on customizable transcription activator-like effector (TALE) proteins can induce gene expression from the HIV-1 long terminal repeat promoter, and that combinations of TALE transcription factors can synergistically reactivate latent viral expression in cell line models of HIV-1 latency. We further show that complementing TALE transcription factors with Vorinostat, a histone deacetylase inhibitor, enhances HIV-1 expression in latency models. Collectively, these findings demonstrate that TALE transcription factors are a potentially effective alternative to current pharmacological routes for reactivating latent virus and that combining synthetic transcriptional activators with histone deacetylase inhibitors could lead to the development of improved therapies for latent HIV-1 infection.

  8. Reactivation of Latent HIV-1 Expression by Engineered TALE Transcription Factors.

    Directory of Open Access Journals (Sweden)

    Pedro Perdigão

    Full Text Available The presence of replication-competent HIV-1 -which resides mainly in resting CD4+ T cells--is a major hurdle to its eradication. While pharmacological approaches have been useful for inducing the expression of this latent population of virus, they have been unable to purge HIV-1 from all its reservoirs. Additionally, many of these strategies have been associated with adverse effects, underscoring the need for alternative approaches capable of reactivating viral expression. Here we show that engineered transcriptional modulators based on customizable transcription activator-like effector (TALE proteins can induce gene expression from the HIV-1 long terminal repeat promoter, and that combinations of TALE transcription factors can synergistically reactivate latent viral expression in cell line models of HIV-1 latency. We further show that complementing TALE transcription factors with Vorinostat, a histone deacetylase inhibitor, enhances HIV-1 expression in latency models. Collectively, these findings demonstrate that TALE transcription factors are a potentially effective alternative to current pharmacological routes for reactivating latent virus and that combining synthetic transcriptional activators with histone deacetylase inhibitors could lead to the development of improved therapies for latent HIV-1 infection.

  9. The transcription factor Nerfin-1 prevents reversion of neurons into neural stem cells.

    Science.gov (United States)

    Froldi, Francesca; Szuperak, Milan; Weng, Chen-Fang; Shi, Wei; Papenfuss, Anthony T; Cheng, Louise Y

    2015-01-15

    Cellular dedifferentiation is the regression of a cell from a specialized state to a more multipotent state and is implicated in cancer. However, the transcriptional network that prevents differentiated cells from reacquiring stem cell fate is so far unclear. Neuroblasts (NBs), the Drosophila neural stem cells, are a model for the regulation of stem cell self-renewal and differentiation. Here we show that the Drosophila zinc finger transcription factor Nervous fingers 1 (Nerfin-1) locks neurons into differentiation, preventing their reversion into NBs. Following Prospero-dependent neuronal specification in the ganglion mother cell (GMC), a Nerfin-1-specific transcriptional program maintains differentiation in the post-mitotic neurons. The loss of Nerfin-1 causes reversion to multipotency and results in tumors in several neural lineages. Both the onset and rate of neuronal dedifferentiation in nerfin-1 mutant lineages are dependent on Myc- and target of rapamycin (Tor)-mediated cellular growth. In addition, Nerfin-1 is required for NB differentiation at the end of neurogenesis. RNA sequencing (RNA-seq) and chromatin immunoprecipitation (ChIP) analysis show that Nerfin-1 administers its function by repression of self-renewing-specific and activation of differentiation-specific genes. Our findings support the model of bidirectional interconvertibility between neural stem cells and their post-mitotic progeny and highlight the importance of the Nerfin-1-regulated transcriptional program in neuronal maintenance. © 2015 Froldi et al.; Published by Cold Spring Harbor Laboratory Press.

  10. Fat mass and obesity associated gene (FTO expression is regulated negatively by the transcription factor Foxa2.

    Directory of Open Access Journals (Sweden)

    Jianjin Guo

    Full Text Available Fat mass and obesity associated gene (FTO is the first gene associated with body mass index (BMI and risk for diabetes. FTO is highly expressed in the brain and pancreas, and is involved in regulating dietary intake and energy expenditure. To investigate the transcriptional regulation of FTO expression, we created 5'-deletion constructs of the FTO promoter to determine which transcription factors are most relevant to FTO expression. The presence of an activation region at -201/+34 was confirmed by luciferase activity analysis. A potential Foxa2 (called HNF-3β binding site and an upstream stimulatory factor (USF-binding site was identified in the -100 bp fragment upstream of the transcription start site (TSS. Furthermore, using mutagenesis, we identified the Foxa2 binding sequence (-26/-14 as a negative regulatory element to the activity of the human FTO promoter. The USF binding site did not affect the FTO promoter activity. Chromatin immunoprecipitation (ChIP assays were performed to confirm Foxa2 binding to the FTO promoter. Overexpression of Foxa2 in HEK 293 cells significantly down-regulated FTO promoter activity and expression. Conversely, knockdown of Foxa2 by siRNA significantly up-regulated FTO expression. These findings suggest that Foxa2 negatively regulates the basal transcription and expression of the human FTO gene.

  11. ZBED6, a novel transcription factor derived from a domesticated DNA transposon regulates IGF2 expression and muscle growth

    DEFF Research Database (Denmark)

    Markljung, Ellen; Jiang, Lin; Jaffe, Jacob D

    2009-01-01

    and find that the protein, named ZBED6, is previously unknown, specific for placental mammals, and derived from an exapted DNA transposon. Silencing of Zbed6 in mouse C2C12 myoblasts affected Igf2 expression, cell proliferation, wound healing, and myotube formation. Chromatin immunoprecipitation (Ch......, including development and transcriptional regulation. The phenotypic effects in mutant pigs and ZBED6-silenced C2C12 myoblasts, the extreme sequence conservation, its nucleolar localization, the broad tissue distribution, and the many target genes with essential biological functions suggest that ZBED6...... is an important transcription factor in placental mammals, affecting development, cell proliferation, and growth....

  12. Transcription Factor Amr1 Induces Melanin Biosynthesis and Suppresses Virulence in Alternaria brassicicola

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Yangrae; Srivastava, Akhil; Ohm, Robin A.; Lawrence, Christopher B.; Wang, Koon-Hui; Grigoriev, Igor V.; Marahatta, Sharadchandra P.

    2012-05-01

    Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. Several A. brassicicola genes have been characterized as affecting pathogenesis of Brassica species. To study regulatory mechanisms of pathogenesis, we mined 421 genes in silico encoding putative transcription factors in a machine-annotated, draft genome sequence of A. brassicicola. In this study, targeted gene disruption mutants for 117 of the transcription factor genes were produced and screened. Three of these genes were associated with pathogenesis. Disruption mutants of one gene (AbPacC) were nonpathogenic and another gene (AbVf8) caused lesions less than half the diameter of wild-type lesions. Unexpectedly, mutants of the third gene, Amr1, caused lesions with a two-fold larger diameter than the wild type and complementation mutants. Amr1 is a homolog of Cmr1, a transcription factor that regulates melanin biosynthesis in several fungi. We created gene deletion mutants of ?amr1 and characterized their phenotypes. The ?amr1 mutants used pectin as a carbon source more efficiently than the wild type, were melanin-deficient, and more sensitive to UV light and glucanase digestion. The AMR1 protein was localized in the nuclei of hyphae and in highly melanized conidia during the late stage of plant pathogenesis. RNA-seq analysis revealed that three genes in the melanin biosynthesis pathway, along with the deleted Amr1 gene, were expressed at low levels in the mutants. In contrast, many hydrolytic enzyme-coding genes were expressed at higher levels in the mutants than in the wild type during pathogenesis. The results of this study suggested that a gene important for survival in nature negatively affected virulence, probably by a less efficient use of plant cell-wall materials. We speculate that the functions of the Amr1 gene are important to the success of A. brassicicola as a competitive saprophyte and plant parasite.

  13. WRKY transcription factor genes in wild rice Oryza nivara.

    Science.gov (United States)

    Xu, Hengjian; Watanabe, Kenneth A; Zhang, Liyuan; Shen, Qingxi J

    2016-08-01

    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  14. WdStuAp, an APSES transcription factor, is a regulator of yeast-hyphal transitions in Wangiella (Exophiala) dermatitidis.

    Science.gov (United States)

    Wang, Qin; Szaniszlo, Paul J

    2007-09-01

    APSES transcription factors are well-known regulators of fungal cellular development and differentiation. To study the function of an APSES protein in the fungus Wangiella dermatitidis, a conidiogenous and polymorphic agent of human phaeohyphomycosis with yeast predominance, the APSES transcription factor gene WdSTUA was cloned, sequenced, disrupted, and overexpressed. Analysis showed that its derived protein was most similar to the APSES proteins of other conidiogenous molds and had its APSES DNA-binding domain located in the amino-terminal half. Deletion of WdSTUA in W. dermatitidis induced convoluted instead of normal smooth colony surface growth on the rich yeast maintenance agar medium yeast extract-peptone-dextrose agar (YPDA) at 37 degrees C. Additionally, deletion of WdSTUA repressed aerial hyphal growth, conidiation, and invasive hyphal growth on the nitrogen-poor, hypha-inducing agar medium potato dextrose agar (PDA) at 25 degrees C. Ectopic overexpression of WdSTUA repressed the convoluted colony surface growth on YPDA at 37 degrees C, and also strongly repressed hyphal growth on PDA at 25 degrees C and 37 degrees C. These new results provide additional insights into the diverse roles played by APSES factors in fungi. They also suggest that the transcription factor encoded by WdSTUA is both a positive and negative morphotype regulator in W. dermatitidis and possibly other of the numerous human pathogenic, conidiogenous fungi capable of yeast growth.

  15. Peroxisome proliferator-activated receptor gamma recruits the positive transcription elongation factor b complex to activate transcription and promote adipogenesis

    DEFF Research Database (Denmark)

    Iankova, Irena; Petersen, Rasmus K; Annicotte, Jean-Sébastien

    2006-01-01

    Positive transcription elongation factor b (P-TEFb) phosphorylates the C-terminal domain of RNA polymerase II, facilitating transcriptional elongation. In addition to its participation in general transcription, P-TEFb is recruited to specific promoters by some transcription factors such as c......-Myc or MyoD. The P-TEFb complex is composed of a cyclin-dependent kinase (cdk9) subunit and a regulatory partner (cyclin T1, cyclin T2, or cyclin K). Because cdk9 has been shown to participate in differentiation processes, such as muscle cell differentiation, we studied a possible role of cdk9...... with and phosphorylation of peroxisome proliferator-activated receptor gamma (PPARgamma), which is the master regulator of this process, on the promoter of PPARgamma target genes. PPARgamma-cdk9 interaction results in increased transcriptional activity of PPARgamma and therefore increased adipogenesis....

  16. JASPAR 2016: a major expansion and update of the open-access database of transcription factor binding profiles.

    Science.gov (United States)

    Mathelier, Anthony; Fornes, Oriol; Arenillas, David J; Chen, Chih-Yu; Denay, Grégoire; Lee, Jessica; Shi, Wenqiang; Shyr, Casper; Tan, Ge; Worsley-Hunt, Rebecca; Zhang, Allen W; Parcy, François; Lenhard, Boris; Sandelin, Albin; Wasserman, Wyeth W

    2016-01-04

    JASPAR (http://jaspar.genereg.net) is an open-access database storing curated, non-redundant transcription factor (TF) binding profiles representing transcription factor binding preferences as position frequency matrices for multiple species in six taxonomic groups. For this 2016 release, we expanded the JASPAR CORE collection with 494 new TF binding profiles (315 in vertebrates, 11 in nematodes, 3 in insects, 1 in fungi and 164 in plants) and updated 59 profiles (58 in vertebrates and 1 in fungi). The introduced profiles represent an 83% expansion and 10% update when compared to the previous release. We updated the structural annotation of the TF DNA binding domains (DBDs) following a published hierarchical structural classification. In addition, we introduced 130 transcription factor flexible models trained on ChIP-seq data for vertebrates, which capture dinucleotide dependencies within TF binding sites. This new JASPAR release is accompanied by a new web tool to infer JASPAR TF binding profiles recognized by a given TF protein sequence. Moreover, we provide the users with a Ruby module complementing the JASPAR API to ease programmatic access and use of the JASPAR collection of profiles. Finally, we provide the JASPAR2016 R/Bioconductor data package with the data of this release. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. A transcript cleavage factor of Mycobacterium tuberculosis important for its survival.

    Directory of Open Access Journals (Sweden)

    Arnab China

    Full Text Available After initiation of transcription, a number of proteins participate during elongation and termination modifying the properties of the RNA polymerase (RNAP. Gre factors are one such group conserved across bacteria. They regulate transcription by projecting their N-terminal coiled-coil domain into the active center of RNAP through the secondary channel and stimulating hydrolysis of the newly synthesized RNA in backtracked elongation complexes. Rv1080c is a putative gre factor (MtbGre in the genome of Mycobacterium tuberculosis. The protein enhanced the efficiency of promoter clearance by lowering abortive transcription and also rescued arrested and paused elongation complexes on the GC rich mycobacterial template. Although MtbGre is similar in domain organization and shares key residues for catalysis and RNAP interaction with the Gre factors of Escherichia coli, it could not complement an E. coli gre deficient strain. Moreover, MtbGre failed to rescue E. coli RNAP stalled elongation complexes, indicating the importance of specific protein-protein interactions for transcript cleavage. Decrease in the level of MtbGre reduced the bacterial survival by several fold indicating its essential role in mycobacteria. Another Gre homolog, Rv3788 was not functional in transcript cleavage activity indicating that a single Gre is sufficient for efficient transcription of the M. tuberculosis genome.

  18. Nsite, NsiteH and NsiteM Computer Tools for Studying Tran-scription Regulatory Elements

    KAUST Repository

    Shahmuradov, Ilham

    2015-07-02

    Summary: Gene transcription is mostly conducted through interactions of various transcription factors and their binding sites on DNA (regulatory elements, REs). Today, we are still far from understanding the real regulatory content of promoter regions. Computer methods for identification of REs remain a widely used tool for studying and understanding transcriptional regulation mechanisms. The Nsite, NsiteH and NsiteM programs perform searches for statistically significant (non-random) motifs of known human, animal and plant one-box and composite REs in a single genomic sequence, in a pair of aligned homologous sequences and in a set of functionally related sequences, respectively.

  19. Genome-wide analysis of the WRKY transcription factors in aegilops tauschii.

    Science.gov (United States)

    Ma, Jianhui; Zhang, Daijing; Shao, Yun; Liu, Pei; Jiang, Lina; Li, Chunxi

    2014-01-01

    The WRKY transcription factors (TFs) play important roles in responding to abiotic and biotic stress in plants. However, due to its unfinished genome sequencing, relatively few WRKY TFs with full-length coding sequences (CDSs) have been identified in wheat. Instead, the Aegilops tauschii genome, which is the D-genome progenitor of the hexaploid wheat genome, provides important resources for the discovery of new genes. In this study, we performed a bioinformatics analysis to identify WRKY TFs with full-length CDSs from the A. tauschii genome. A detailed evolutionary analysis for all these TFs was conducted, and quantitative real-time PCR was carried out to investigate the expression patterns of the abiotic stress-related WRKY TFs under different abiotic stress conditions in A. tauschii seedlings. A total of 93 WRKY TFs were identified from A. tauschii, and 79 of them were found to be newly discovered genes compared with wheat. Gene phylogeny, gene structure and chromosome location of the 93 WRKY TFs were fully analyzed. These studies provide a global view of the WRKY TFs from A. tauschii and a firm foundation for further investigations in both A. tauschii and wheat. © 2015 S. Karger AG, Basel.

  20. CoryneRegNet: An ontology-based data warehouse of corynebacterial transcription factors and regulatory networks

    Directory of Open Access Journals (Sweden)

    Czaja Lisa F

    2006-02-01

    Full Text Available Abstract Background The application of DNA microarray technology in post-genomic analysis of bacterial genome sequences has allowed the generation of huge amounts of data related to regulatory networks. This data along with literature-derived knowledge on regulation of gene expression has opened the way for genome-wide reconstruction of transcriptional regulatory networks. These large-scale reconstructions can be converted into in silico models of bacterial cells that allow a systematic analysis of network behavior in response to changing environmental conditions. Description CoryneRegNet was designed to facilitate the genome-wide reconstruction of transcriptional regulatory networks of corynebacteria relevant in biotechnology and human medicine. During the import and integration process of data derived from experimental studies or literature knowledge CoryneRegNet generates links to genome annotations, to identified transcription factors and to the corresponding cis-regulatory elements. CoryneRegNet is based on a multi-layered, hierarchical and modular concept of transcriptional regulation and was implemented by using the relational database management system MySQL and an ontology-based data structure. Reconstructed regulatory networks can be visualized by using the yFiles JAVA graph library. As an application example of CoryneRegNet, we have reconstructed the global transcriptional regulation of a cellular module involved in SOS and stress response of corynebacteria. Conclusion CoryneRegNet is an ontology-based data warehouse that allows a pertinent data management of regulatory interactions along with the genome-scale reconstruction of transcriptional regulatory networks. These models can further be combined with metabolic networks to build integrated models of cellular function including both metabolism and its transcriptional regulation.

  1. Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation.

    Science.gov (United States)

    Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta

    2016-01-15

    Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Massively parallel amplicon sequencing reveals isotype-specific variability of antimicrobial peptide transcripts in Mytilus galloprovincialis.

    Directory of Open Access Journals (Sweden)

    Umberto Rosani

    Full Text Available BACKGROUND: Effective innate responses against potential pathogens are essential in the living world and possibly contributed to the evolutionary success of invertebrates. Taken together, antimicrobial peptide (AMP precursors of defensin, mytilin, myticin and mytimycin can represent about 40% of the hemocyte transcriptome in mussels injected with viral-like and bacterial preparations, and unique profiles of myticin C variants are expressed in single mussels. Based on amplicon pyrosequencing, we have ascertained and compared the natural and Vibrio-induced diversity of AMP transcripts in mussel hemocytes from three European regions. METHODOLOGY/PRINCIPAL FINDINGS: Hemolymph was collected from mussels farmed in the coastal regions of Palavas (France, Vigo (Spain and Venice (Italy. To represent the AMP families known in M. galloprovincialis, nine transcript sequences have been selected, amplified from hemocyte RNA and subjected to pyrosequencing. Hemolymph from farmed (offshore and wild (lagoon Venice mussels, both injected with 10(7 Vibrio cells, were similarly processed. Amplicon pyrosequencing emphasized the AMP transcript diversity, with Single Nucleotide Changes (SNC minimal for mytilin B/C and maximal for arthropod-like defensin and myticin C. Ratio of non-synonymous vs. synonymous changes also greatly differed between AMP isotypes. Overall, each amplicon revealed similar levels of nucleotidic variation across geographical regions, with two main sequence patterns confirmed for mytimycin and no substantial changes after immunostimulation. CONCLUSIONS/SIGNIFICANCE: Barcoding and bidirectional pyrosequencing allowed us to map and compare the transcript diversity of known mussel AMPs. Though most of the genuine cds variation was common to the analyzed samples we could estimate from 9 to 106 peptide variants in hemolymph pools representing 100 mussels, depending on the AMP isoform and sampling site. In this study, no prevailing SNC patterns related

  3. Inhibition of factor-dependent transcription termination in ...

    Indian Academy of Sciences (India)

    Inhibition of factor-dependent transcription termination in Escherichia coli might relieve xenogene silencing by abrogating. H-NS-DNA interactions in vivo. DEEPTI CHANDRAPRAKASH and ASWIN SAI NARAIN SESHASAYEE. Chromatin immunoprecipitation. MG1655 hns::3xFLAG cells were grown in liquid LB me-.

  4. HOCOMOCO: a comprehensive collection of human transcription factor binding sites models

    Science.gov (United States)

    Kulakovskiy, Ivan V.; Medvedeva, Yulia A.; Schaefer, Ulf; Kasianov, Artem S.; Vorontsov, Ilya E.; Bajic, Vladimir B.; Makeev, Vsevolod J.

    2013-01-01

    Transcription factor (TF) binding site (TFBS) models are crucial for computational reconstruction of transcription regulatory networks. In existing repositories, a TF often has several models (also called binding profiles or motifs), obtained from different experimental data. Having a single TFBS model for a TF is more pragmatic for practical applications. We show that integration of TFBS data from various types of experiments into a single model typically results in the improved model quality probably due to partial correction of source specific technique bias. We present the Homo sapiens comprehensive model collection (HOCOMOCO, http://autosome.ru/HOCOMOCO/, http://cbrc.kaust.edu.sa/hocomoco/) containing carefully hand-curated TFBS models constructed by integration of binding sequences obtained by both low- and high-throughput methods. To construct position weight matrices to represent these TFBS models, we used ChIPMunk software in four computational modes, including newly developed periodic positional prior mode associated with DNA helix pitch. We selected only one TFBS model per TF, unless there was a clear experimental evidence for two rather distinct TFBS models. We assigned a quality rating to each model. HOCOMOCO contains 426 systematically curated TFBS models for 401 human TFs, where 172 models are based on more than one data source. PMID:23175603

  5. HOCOMOCO: A comprehensive collection of human transcription factor binding sites models

    KAUST Repository

    Kulakovskiy, Ivan V.; Medvedeva, Yulia A.; Schaefer, Ulf; Kasianov, Artem S.; Vorontsov, Ilya E.; Bajic, Vladimir B.; Makeev, Vsevolod J.

    2012-01-01

    Transcription factor (TF) binding site (TFBS) models are crucial for computational reconstruction of transcription regulatory networks. In existing repositories, a TF often has several models (also called binding profiles or motifs), obtained from different experimental data. Having a single TFBS model for a TF is more pragmatic for practical applications. We show that integration of TFBS data from various types of experiments into a single model typically results in the improved model quality probably due to partial correction of source specific technique bias. We present the Homo sapiens comprehensive model collection (HOCOMOCO, http://autosome.ru/HOCOMOCO/, http://cbrc.kaust.edu.sa/ hocomoco/) containing carefully hand-curated TFBS models constructed by integration of binding sequences obtained by both low- and high-throughput methods. To construct position weight matrices to represent these TFBS models, we used ChIPMunk software in four computational modes, including newly developed periodic positional prior mode associated with DNA helix pitch. We selected only one TFBS model per TF, unless there was a clear experimental evidence for two rather distinct TFBS models. We assigned a quality rating to each model. HOCOMOCO contains 426 systematically curated TFBS models for 401 human TFs, where 172 models are based on more than one data source. The Author(s) 2012.

  6. HOCOMOCO: A comprehensive collection of human transcription factor binding sites models

    KAUST Repository

    Kulakovskiy, Ivan V.

    2012-11-21

    Transcription factor (TF) binding site (TFBS) models are crucial for computational reconstruction of transcription regulatory networks. In existing repositories, a TF often has several models (also called binding profiles or motifs), obtained from different experimental data. Having a single TFBS model for a TF is more pragmatic for practical applications. We show that integration of TFBS data from various types of experiments into a single model typically results in the improved model quality probably due to partial correction of source specific technique bias. We present the Homo sapiens comprehensive model collection (HOCOMOCO, http://autosome.ru/HOCOMOCO/, http://cbrc.kaust.edu.sa/ hocomoco/) containing carefully hand-curated TFBS models constructed by integration of binding sequences obtained by both low- and high-throughput methods. To construct position weight matrices to represent these TFBS models, we used ChIPMunk software in four computational modes, including newly developed periodic positional prior mode associated with DNA helix pitch. We selected only one TFBS model per TF, unless there was a clear experimental evidence for two rather distinct TFBS models. We assigned a quality rating to each model. HOCOMOCO contains 426 systematically curated TFBS models for 401 human TFs, where 172 models are based on more than one data source. The Author(s) 2012.

  7. Extensive polycistronism and antisense transcription in the mammalian Hox clusters.

    Directory of Open Access Journals (Sweden)

    Gaëll Mainguy

    Full Text Available The Hox clusters play a crucial role in body patterning during animal development. They encode both Hox transcription factor and micro-RNA genes that are activated in a precise temporal and spatial sequence that follows their chromosomal order. These remarkable collinear properties confer functional unit status for Hox clusters. We developed the TranscriptView platform to establish high resolution transcriptional profiling and report here that transcription in the Hox clusters is far more complex than previously described in both human and mouse. Unannotated transcripts can represent up to 60% of the total transcriptional output of a cluster. In particular, we identified 14 non-coding Transcriptional Units antisense to Hox genes, 10 of which (70% have a detectable mouse homolog. Most of these Transcriptional Units in both human and mouse present conserved sizeable sequences (>40 bp overlapping Hox transcripts, suggesting that these Hox antisense transcripts are functional. Hox clusters also display at least seven polycistronic clusters, i.e., different genes being co-transcribed on long isoforms (up to 30 kb. This work provides a reevaluated framework for understanding Hox gene function and dys-function. Such extensive transcriptions may provide a structural explanation for Hox clustering.

  8. The Related Transcriptional Enhancer Factor-1 Isoform, TEAD4216, Can Repress Vascular Endothelial Growth Factor Expression in Mammalian Cells

    Science.gov (United States)

    Appukuttan, Binoy; McFarland, Trevor J.; Stempel, Andrew; Kassem, Jean B.; Hartzell, Matthew; Zhang, Yi; Bond, Derek; West, Kelsey; Wilson, Reid; Stout, Andrew; Pan, Yuzhen; Ilias, Hoda; Robertson, Kathryn; Klein, Michael L.; Wilson, David; Smith, Justine R.; Stout, J. Timothy

    2012-01-01

    Increased cellular production of vascular endothelial growth factor (VEGF) is responsible for the development and progression of multiple cancers and other neovascular conditions, and therapies targeting post-translational VEGF products are used in the treatment of these diseases. Development of methods to control and modify the transcription of the VEGF gene is an alternative approach that may have therapeutic potential. We have previously shown that isoforms of the transcriptional enhancer factor 1-related (TEAD4) protein can enhance the production of VEGF. In this study we describe a new TEAD4 isoform, TEAD4216, which represses VEGF promoter activity. The TEAD4216 isoform inhibits human VEGF promoter activity and does not require the presence of the hypoxia responsive element (HRE), which is the sequence critical to hypoxia inducible factor (HIF)-mediated effects. The TEAD4216 protein is localized to the cytoplasm, whereas the enhancer isoforms are found within the nucleus. The TEAD4216 isoform can competitively repress the stimulatory activity of the TEAD4434 and TEAD4148 enhancers. Synthesis of the native VEGF165 protein and cellular proliferation is suppressed by the TEAD4216 isoform. Mutational analysis indicates that nuclear or cytoplasmic localization of any isoform determines whether it acts as an enhancer or repressor, respectively. The TEAD4216 isoform appears to inhibit VEGF production independently of the HRE required activity by HIF, suggesting that this alternatively spliced isoform of TEAD4 may provide a novel approach to treat VEGF-dependent diseases. PMID:22761647

  9. Transcription factor FoxO1 is essential for enamel biomineralization.

    Directory of Open Access Journals (Sweden)

    Ross A Poché

    Full Text Available The Transforming growth factor β (Tgf-β pathway, by signaling via the activation of Smad transcription factors, induces the expression of many diverse downstream target genes thereby regulating a vast array of cellular events essential for proper development and homeostasis. In order for a specific cell type to properly interpret the Tgf-β signal and elicit a specific cellular response, cell-specific transcriptional co-factors often cooperate with the Smads to activate a discrete set of genes in the appropriate temporal and spatial manner. Here, via a conditional knockout approach, we show that mice mutant for Forkhead Box O transcription factor FoxO1 exhibit an enamel hypomaturation defect which phenocopies that of the Smad3 mutant mice. Furthermore, we determined that both the FoxO1 and Smad3 mutant teeth exhibit changes in the expression of similar cohort of genes encoding enamel matrix proteins required for proper enamel development. These data raise the possibility that FoxO1 and Smad3 act in concert to regulate a common repertoire of genes necessary for complete enamel maturation. This study is the first to define an essential role for the FoxO family of transcription factors in tooth development and provides a new molecular entry point which will allow researchers to delineate novel genetic pathways regulating the process of biomineralization which may also have significance for studies of human tooth diseases such as amelogenesis imperfecta.

  10. Analysis of Transcription Factors Key for Mouse Pancreatic Development Establishes NKX2-2 and MNX1 Mutations as Causes of Neonatal Diabetes in Man

    Science.gov (United States)

    Flanagan, Sarah E.; De Franco, Elisa; Lango Allen, Hana; Zerah, Michele; Abdul-Rasoul, Majedah M.; Edge, Julie A.; Stewart, Helen; Alamiri, Elham; Hussain, Khalid; Wallis, Sam; de Vries, Liat; Rubio-Cabezas, Oscar; Houghton, Jayne A.L.; Edghill, Emma L.; Patch, Ann-Marie; Ellard, Sian; Hattersley, Andrew T.

    2014-01-01

    Summary Understanding transcriptional regulation of pancreatic development is required to advance current efforts in developing beta cell replacement therapies for patients with diabetes. Current knowledge of key transcriptional regulators has predominantly come from mouse studies, with rare, naturally occurring mutations establishing their relevance in man. This study used a combination of homozygosity analysis and Sanger sequencing in 37 consanguineous patients with permanent neonatal diabetes to search for homozygous mutations in 29 transcription factor genes important for murine pancreatic development. We identified homozygous mutations in 7 different genes in 11 unrelated patients and show that NKX2-2 and MNX1 are etiological genes for neonatal diabetes, thus confirming their key role in development of the human pancreas. The similar phenotype of the patients with recessive mutations and mice with inactivation of a transcription factor gene support there being common steps critical for pancreatic development and validate the use of rodent models for beta cell development. PMID:24411943

  11. Uncovering Transcriptional Regulatory Networks by Sparse Bayesian Factor Model

    Directory of Open Access Journals (Sweden)

    Qi Yuan(Alan

    2010-01-01

    Full Text Available Abstract The problem of uncovering transcriptional regulation by transcription factors (TFs based on microarray data is considered. A novel Bayesian sparse correlated rectified factor model (BSCRFM is proposed that models the unknown TF protein level activity, the correlated regulations between TFs, and the sparse nature of TF-regulated genes. The model admits prior knowledge from existing database regarding TF-regulated target genes based on a sparse prior and through a developed Gibbs sampling algorithm, a context-specific transcriptional regulatory network specific to the experimental condition of the microarray data can be obtained. The proposed model and the Gibbs sampling algorithm were evaluated on the simulated systems, and results demonstrated the validity and effectiveness of the proposed approach. The proposed model was then applied to the breast cancer microarray data of patients with Estrogen Receptor positive ( status and Estrogen Receptor negative ( status, respectively.

  12. Myocardin-related transcription factors are required for cardiac development and function

    OpenAIRE

    Mokalled, Mayssa H.; Carroll, Kelli J.; Cenik, Bercin K.; Chen, Beibei; Liu, Ning; Olson, Eric N.; Bassel-Duby, Rhonda

    2015-01-01

    Myocardin-Related Transcription Factors A and B (MRTF-A and MRTF-B) are highly homologous proteins that function as powerful coactivators of serum response factor (SRF), a ubiquitously expressed transcription factor essential for cardiac development. The SRF/MRTF complex binds to CArG boxes found in the control regions of genes that regulate cytoskeletal dynamics and muscle contraction, among other processes. While SRF is required for heart development and function, the role of MRTFs in the d...

  13. Exploring the utility of organo-polyoxometalate hybrids to inhibit SOX transcription factors

    Directory of Open Access Journals (Sweden)

    Kamesh Narasimhan

    2014-01-01

    Conclusion: Polyoxometalates are highly potent, nanomolar range inhibitors of the DNA binding activity of the Sox-HMG family. However, binding assays involving a limited subset of structurally diverse polyoxometalates revealed a low selectivity profile against different transcription factor families. Further progress in achieving selectivity and deciphering structure-activity relationship of POMs require the identification of POM binding sites on transcription factors using elaborate approaches like X-ray crystallography and multidimensional NMR. In summary, our report reaffirms that transcription factors are challenging molecular architectures and that future polyoxometalate chemistry must consider further modification strategies, to address the substantial challenges involved in achieving target selectivity.

  14. Hybridization-based reconstruction of small non-coding RNA transcripts from deep sequencing data.

    Science.gov (United States)

    Ragan, Chikako; Mowry, Bryan J; Bauer, Denis C

    2012-09-01

    Recent advances in RNA sequencing technology (RNA-Seq) enables comprehensive profiling of RNAs by producing millions of short sequence reads from size-fractionated RNA libraries. Although conventional tools for detecting and distinguishing non-coding RNAs (ncRNAs) from reference-genome data can be applied to sequence data, ncRNA detection can be improved by harnessing the full information content provided by this new technology. Here we present NorahDesk, the first unbiased and universally applicable method for small ncRNAs detection from RNA-Seq data. NorahDesk utilizes the coverage-distribution of small RNA sequence data as well as thermodynamic assessments of secondary structure to reliably predict and annotate ncRNA classes. Using publicly available mouse sequence data from brain, skeletal muscle, testis and ovary, we evaluated our method with an emphasis on the performance for microRNAs (miRNAs) and piwi-interacting small RNA (piRNA). We compared our method with Dario and mirDeep2 and found that NorahDesk produces longer transcripts with higher read coverage. This feature makes it the first method particularly suitable for the prediction of both known and novel piRNAs.

  15. Role of Transcription Factor Modifications in the Pathogenesis of Insulin Resistance

    Directory of Open Access Journals (Sweden)

    Mi-Young Kim

    2012-01-01

    Full Text Available Non-alcoholic fatty liver disease (NAFLD is characterized by fat accumulation in the liver not due to alcohol abuse. NAFLD is accompanied by variety of symptoms related to metabolic syndrome. Although the metabolic link between NAFLD and insulin resistance is not fully understood, it is clear that NAFLD is one of the main cause of insulin resistance. NAFLD is shown to affect the functions of other organs, including pancreas, adipose tissue, muscle and inflammatory systems. Currently efforts are being made to understand molecular mechanism of interrelationship between NAFLD and insulin resistance at the transcriptional level with specific focus on post-translational modification (PTM of transcription factors. PTM of transcription factors plays a key role in controlling numerous biological events, including cellular energy metabolism, cell-cycle progression, and organ development. Cell type- and tissue-specific reversible modifications include lysine acetylation, methylation, ubiquitination, and SUMOylation. Moreover, phosphorylation and O-GlcNAcylation on serine and threonine residues have been shown to affect protein stability, subcellular distribution, DNA-binding affinity, and transcriptional activity. PTMs of transcription factors involved in insulin-sensitive tissues confer specific adaptive mechanisms in response to internal or external stimuli. Our understanding of the interplay between these modifications and their effects on transcriptional regulation is growing. Here, we summarize the diverse roles of PTMs in insulin-sensitive tissues and their involvement in the pathogenesis of insulin resistance.

  16. Interactome analysis of transcriptional coactivator multiprotein bridging factor 1 unveils a yeast AP-1-like transcription factor involved in oxidation tolerance of mycopathogen Beauveria bassiana.

    Science.gov (United States)

    Chu, Xin-Ling; Dong, Wei-Xia; Ding, Jin-Li; Feng, Ming-Guang; Ying, Sheng-Hua

    2018-02-01

    Oxidation tolerance is an important determinant to predict the virulence and biocontrol potential of Beauveria bassiana, a well-known entomopathogenic fungus. As a transcriptional coactivator, multiprotein bridging factor 1 mediates the activity of transcription factor in diverse physiological processes, and its homolog in B. bassiana (BbMBF1) contributes to fungal oxidation tolerance. In this study, the BbMBF1-interactomes under oxidative stress and normal growth condition were deciphered by mass spectrometry integrated with the immunoprecipitation. BbMBF1p factor has a broad interaction with proteins that are involved in various cellular processes, and this interaction is dynamically regulated by oxidative stress. Importantly, a B. bassiana homolog of yeast AP-1-like transcription factor (BbAP-1) was specifically associated with the BbMBF1-interactome under oxidation and significantly contributed to fungal oxidation tolerance. In addition, qPCR analysis revealed that several antioxidant genes are jointly controlled by BbAP-1 and BbMBF1. Conclusively, it is proposed that BbMBF1p protein mediates BbAP-1p factor to transcribe the downstream antioxidant genes in B. bassiana under oxidative stress. This study demonstrates for the first time a proteomic view of the MBF1-interactome in fungi, and presents an initial framework to probe the transcriptional mechanism involved in fungal response to oxidation, which will provide a new strategy to improve the biocontrol efficacy of B. bassiana.

  17. Genome-wide analysis of WRKY transcription factors in Solanum lycopersicum.

    Science.gov (United States)

    Huang, Shengxiong; Gao, Yongfeng; Liu, Jikai; Peng, Xiaoli; Niu, Xiangli; Fei, Zhangjun; Cao, Shuqing; Liu, Yongsheng

    2012-06-01

    The WRKY transcription factors have been implicated in multiple biological processes in plants, especially in regulating defense against biotic and abiotic stresses. However, little information is available about the WRKYs in tomato (Solanum lycopersicum). The recent release of the whole-genome sequence of tomato allowed us to perform a genome-wide investigation for tomato WRKY proteins, and to compare these positively identified proteins with their orthologs in model plants, such as Arabidopsis and rice. In the present study, based on the recently released tomato whole-genome sequences, we identified 81 SlWRKY genes that were classified into three main groups, with the second group further divided into five subgroups. Depending on WRKY domains' sequences derived from tomato, Arabidopsis and rice, construction of a phylogenetic tree demonstrated distinct clustering and unique gene expansion of WRKY genes among the three species. Genome mapping analysis revealed that tomato WRKY genes were enriched on several chromosomes, especially on chromosome 5, and 16 % of the family members were tandemly duplicated genes. The tomato WRKYs from each group were shown to share similar motif compositions. Furthermore, tomato WRKY genes showed distinct temporal and spatial expression patterns in different developmental processes and in response to various biotic and abiotic stresses. The expression of 18 selected tomato WRKY genes in response to drought and salt stresses and Pseudomonas syringae invasion, respectively, was validated by quantitative RT-PCR. Our results will provide a platform for functional identification and molecular breeding study of WRKY genes in tomato and probably other Solanaceae plants.

  18. Emerging roles and regulation of MiT/TFE transcriptional factors.

    Science.gov (United States)

    Yang, Min; Liu, En; Tang, Li; Lei, Yuanyuan; Sun, Xuemei; Hu, Jiaxi; Dong, Hui; Yang, Shi-Ming; Gao, Mingfa; Tang, Bo

    2018-06-15

    The MiT/TFE transcription factors play a pivotal role in the regulation of autophagy and lysosomal biogenesis. The subcellular localization and activity of MiT/TFE proteins are primarily regulated through phosphorylation. And the phosphorylated protein is retained in the cytoplasm and subsequently translocates to the nucleus upon dephosphorylation, where it stimulates the expression of hundreds of genes, leading to lysosomal biogenesis and autophagy induction. The transcription factor-mediated lysosome-to-nucleus signaling can be directly controlled by several signaling molecules involved in the mTORC1, PKC, and AKT pathways. MiT/TFE family members have attracted much attention owing to their intracellular clearance of pathogenic factors in numerous diseases. Recently, multiple studies have also revealed the MiT/TFE proteins as master regulators of cellular metabolic reprogramming, converging on autophagic and lysosomal function and playing a critical role in cancer, suggesting that novel therapeutic strategies could be based on the modulation of MiT/TFE family member activity. Here, we present an overview of the latest research on MiT/TFE transcriptional factors and their potential mechanisms in cancer.

  19. Nascent-Seq reveals novel features of mouse circadian transcriptional regulation

    Science.gov (United States)

    Menet, Jerome S; Rodriguez, Joseph; Abruzzi, Katharine C; Rosbash, Michael

    2012-01-01

    A substantial fraction of the metazoan transcriptome undergoes circadian oscillations in many cells and tissues. Based on the transcription feedback loops important for circadian timekeeping, it is commonly assumed that this mRNA cycling reflects widespread transcriptional regulation. To address this issue, we directly measured the circadian dynamics of mouse liver transcription using Nascent-Seq (genome-wide sequencing of nascent RNA). Although many genes are rhythmically transcribed, many rhythmic mRNAs manifest poor transcriptional rhythms, indicating a prominent contribution of post-transcriptional regulation to circadian mRNA expression. This analysis of rhythmic transcription also showed that the rhythmic DNA binding profile of the transcription factors CLOCK and BMAL1 does not determine the transcriptional phase of most target genes. This likely reflects gene-specific collaborations of CLK:BMAL1 with other transcription factors. These insights from Nascent-Seq indicate that it should have broad applicability to many other gene expression regulatory issues. DOI: http://dx.doi.org/10.7554/eLife.00011.001 PMID:23150795

  20. Second generation sequencing of the mesothelioma tumor genome.

    Directory of Open Access Journals (Sweden)

    Raphael Bueno

    2010-05-01

    Full Text Available The current paradigm for elucidating the molecular etiology of cancers relies on the interrogation of small numbers of genes, which limits the scope of investigation. Emerging second-generation massively parallel DNA sequencing technologies have enabled more precise definition of the cancer genome on a global scale. We examined the genome of a human primary malignant pleural mesothelioma (MPM tumor and matched normal tissue by using a combination of sequencing-by-synthesis and pyrosequencing methodologies to a 9.6X depth of coverage. Read density analysis uncovered significant aneuploidy and numerous rearrangements. Method-dependent informatics rules, which combined the results of different sequencing platforms, were developed to identify and validate candidate mutations of multiple types. Many more tumor-specific rearrangements than point mutations were uncovered at this depth of sequencing, resulting in novel, large-scale, inter- and intra-chromosomal deletions, inversions, and translocations. Nearly all candidate point mutations appeared to be previously unknown SNPs. Thirty tumor-specific fusions/translocations were independently validated with PCR and Sanger sequencing. Of these, 15 represented disrupted gene-encoding regions, including kinases, transcription factors, and growth factors. One large deletion in DPP10 resulted in altered transcription and expression of DPP10 transcripts in a set of 53 additional MPM tumors correlated with survival. Additionally, three point mutations were observed in the coding regions of NKX6-2, a transcription regulator, and NFRKB, a DNA-binding protein involved in modulating NFKB1. Several regions containing genes such as PCBD2 and DHFR, which are involved in growth factor signaling and nucleotide synthesis, respectively, were selectively amplified in the tumor. Second-generation sequencing uncovered all types of mutations in this MPM tumor, with DNA rearrangements representing the dominant type.

  1. Extracellular Matrix-Regulated Gene Expression RequiresCooperation of SWI/SNF and Transcription Factors

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.

    2006-05-25

    Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.

  2. Defining the plasticity of transcription factor binding sites by Deconstructing DNA consensus sequences: the PhoP-binding sites among gamma/enterobacteria.

    Directory of Open Access Journals (Sweden)

    Oscar Harari

    2010-07-01

    Full Text Available Transcriptional regulators recognize specific DNA sequences. Because these sequences are embedded in the background of genomic DNA, it is hard to identify the key cis-regulatory elements that determine disparate patterns of gene expression. The detection of the intra- and inter-species differences among these sequences is crucial for understanding the molecular basis of both differential gene expression and evolution. Here, we address this problem by investigating the target promoters controlled by the DNA-binding PhoP protein, which governs virulence and Mg(2+ homeostasis in several bacterial species. PhoP is particularly interesting; it is highly conserved in different gamma/enterobacteria, regulating not only ancestral genes but also governing the expression of dozens of horizontally acquired genes that differ from species to species. Our approach consists of decomposing the DNA binding site sequences for a given regulator into families of motifs (i.e., termed submotifs using a machine learning method inspired by the "Divide & Conquer" strategy. By partitioning a motif into sub-patterns, computational advantages for classification were produced, resulting in the discovery of new members of a regulon, and alleviating the problem of distinguishing functional sites in chromatin immunoprecipitation and DNA microarray genome-wide analysis. Moreover, we found that certain partitions were useful in revealing biological properties of binding site sequences, including modular gains and losses of PhoP binding sites through evolutionary turnover events, as well as conservation in distant species. The high conservation of PhoP submotifs within gamma/enterobacteria, as well as the regulatory protein that recognizes them, suggests that the major cause of divergence between related species is not due to the binding sites, as was previously suggested for other regulators. Instead, the divergence may be attributed to the fast evolution of orthologous target

  3. Physical interactions among plant MADS-box transcription factors and their biological relevance

    NARCIS (Netherlands)

    Nougalli Tonaco, I.A.

    2008-01-01

    The biological interpretation of the genome starts from transcription, and many different signaling pathways are integrated at this level. Transcription factors play a central role in the transcription process, because they select the down-stream genes and determine their spatial and temporal

  4. Cooperative binding of transcription factors promotes bimodal gene expression response.

    Directory of Open Access Journals (Sweden)

    Pablo S Gutierrez

    Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.

  5. Specification of jaw identity by the Hand2 transcription factor

    Science.gov (United States)

    Funato, Noriko; Kokubo, Hiroki; Nakamura, Masataka; Yanagisawa, Hiromi; Saga, Yumiko

    2016-01-01

    Acquisition of the lower jaw (mandible) was evolutionarily important for jawed vertebrates. In humans, syndromic craniofacial malformations often accompany jaw anomalies. The basic helix-loop-helix transcription factor Hand2, which is conserved among jawed vertebrates, is expressed in the neural crest in the mandibular process but not in the maxillary process of the first branchial arch. Here, we provide evidence that Hand2 is sufficient for upper jaw (maxilla)-to-mandible transformation by regulating the expression of homeobox transcription factors in mice. Altered Hand2 expression in the neural crest transformed the maxillae into mandibles with duplicated Meckel’s cartilage, which resulted in an absence of the secondary palate. In Hand2-overexpressing mutants, non-Hox homeobox transcription factors were dysregulated. These results suggest that Hand2 regulates mandibular development through downstream genes of Hand2 and is therefore a major determinant of jaw identity. Hand2 may have influenced the evolutionary acquisition of the mandible and secondary palate. PMID:27329940

  6. In vivo bioimaging with tissue-specific transcription factor activated luciferase reporters.

    OpenAIRE

    Buckley, SM; Delhove, JM; Perocheau, DP; Karda, R; Rahim, AA; Howe, SJ; Ward, NJ; Birrell, MA; Belvisi, MG; Arbuthnot, P; Johnson, MR; Waddington, SN; McKay, TR

    2015-01-01

    The application of transcription factor activated luciferase reporter cassettes in vitro is widespread but potential for in vivo application has not yet been realized. Bioluminescence imaging enables non-invasive tracking of gene expression in transfected tissues of living rodents. However the mature immune response limits luciferase expression when delivered in adulthood. We present a novel approach of tissue-targeted delivery of transcription factor activated luciferase reporter lentiviruse...

  7. Transcriptome-wide identification of bread wheat WRKY transcription factors in response to drought stress.

    Science.gov (United States)

    Okay, Sezer; Derelli, Ebru; Unver, Turgay

    2014-10-01

    The WRKY superfamily of transcription factors was shown to be involved in biotic and abiotic stress responses in plants such as wheat (Triticum aestivum L.), one of the major crops largely cultivated and consumed all over the world. Drought is an important abiotic stress resulting in a considerable amount of loss in agronomical yield. Therefore, identification of drought responsive WRKY members in wheat has a profound significance. Here, a total of 160 TaWRKY proteins were characterized according to sequence similarity, motif varieties, and their phylogenetic relationships. The conserved sequences of the TaWRKYs were aligned and classified into three main groups and five subgroups. A novel motif in wheat, WRKYGQR, was identified. To putatively determine the drought responsive TaWRKY members, publicly available RNA-Seq data were analyzed for the first time in this study. Through in silico searches, 35 transcripts were detected having an identity to ten known TaWRKY genes. Furthermore, relative expression levels of TaWRKY16/TaWRKY16-A, TaWRKY17, TaWRKY19-C, TaWRKY24, TaWRKY59, TaWRKY61, and TaWRKY82 were measured in root and leaf tissues of drought-tolerant Sivas 111/33 and susceptible Atay 85 cultivars. All of the quantified TaWRKY transcripts were found to be up-regulated in root tissue of Sivas 111/33. Differential expression of TaWRKY16, TaWRKY24, TaWRKY59, TaWRKY61 and TaWRKY82 genes was discovered for the first time upon drought stress in wheat. These comprehensive analyses bestow a better understanding about the WRKY TFs in bread wheat under water deficit, and increased number of drought responsive WRKYs would contribute to the molecular breeding of tolerant wheat cultivars.

  8. Theoretical evaluation of transcriptional pausing effect on the attenuation in trp leader sequence

    OpenAIRE

    Suzuki, H.; Kunisawa, T.; Otsuka, J.

    1986-01-01

    The effect of transcriptional pausing on attenuation is investigated theoretically on the basis of the attenuation control mechanism presented by Oxender et al. (Oxender, D. L., G. Zurawski, and C. Yanofsky, 1979, Proc. Natl. Acad. Sci. USA. 76:5524-5528). An extended stochastic model including the RNA polymerase pausing in the leader region is developed to calculate the probability of relative position between the RNA polymerase transcribing the trp leader sequence and the ribosome translati...

  9. In silico and biological survey of transcription-associated proteins implicated in the transcriptional machinery during the erythrocytic development of Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    Bischoff Emmanuel

    2010-01-01

    Full Text Available Abstract Background Malaria is the most important parasitic disease in the world with approximately two million people dying every year, mostly due to Plasmodium falciparum infection. During its complex life cycle in the Anopheles vector and human host, the parasite requires the coordinated and modulated expression of diverse sets of genes involved in epigenetic, transcriptional and post-transcriptional regulation. However, despite the availability of the complete sequence of the Plasmodium falciparum genome, we are still quite ignorant about Plasmodium mechanisms of transcriptional gene regulation. This is due to the poor prediction of nuclear proteins, cognate DNA motifs and structures involved in transcription. Results A comprehensive directory of proteins reported to be potentially involved in Plasmodium transcriptional machinery was built from all in silico reports and databanks. The transcription-associated proteins were clustered in three main sets of factors: general transcription factors, chromatin-related proteins (structuring, remodelling and histone modifying enzymes, and specific transcription factors. Only a few of these factors have been molecularly analysed. Furthermore, from transcriptome and proteome data we modelled expression patterns of transcripts and corresponding proteins during the intra-erythrocytic cycle. Finally, an interactome of these proteins based either on in silico or on 2-yeast-hybrid experimental approaches is discussed. Conclusion This is the first attempt to build a comprehensive directory of potential transcription-associated proteins in Plasmodium. In addition, all complete transcriptome, proteome and interactome raw data were re-analysed, compared and discussed for a better comprehension of the complex biological processes of Plasmodium falciparum transcriptional regulation during the erythrocytic development.

  10. GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

    Science.gov (United States)

    Naito, Yuki; Bono, Hidemasa

    2012-07-01

    GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

  11. Sensitive detection of viral transcripts in human tumor transcriptomes.

    Directory of Open Access Journals (Sweden)

    Sven-Eric Schelhorn

    Full Text Available In excess of 12% of human cancer incidents have a viral cofactor. Epidemiological studies of idiopathic human cancers indicate that additional tumor viruses remain to be discovered. Recent advances in sequencing technology have enabled systematic screenings of human tumor transcriptomes for viral transcripts. However, technical problems such as low abundances of viral transcripts in large volumes of sequencing data, viral sequence divergence, and homology between viral and human factors significantly confound identification of tumor viruses. We have developed a novel computational approach for detecting viral transcripts in human cancers that takes the aforementioned confounding factors into account and is applicable to a wide variety of viruses and tumors. We apply the approach to conducting the first systematic search for viruses in neuroblastoma, the most common cancer in infancy. The diverse clinical progression of this disease as well as related epidemiological and virological findings are highly suggestive of a pathogenic cofactor. However, a viral etiology of neuroblastoma is currently contested. We mapped 14 transcriptomes of neuroblastoma as well as positive and negative controls to the human and all known viral genomes in order to detect both known and unknown viruses. Analysis of controls, comparisons with related methods, and statistical estimates demonstrate the high sensitivity of our approach. Detailed investigation of putative viral transcripts within neuroblastoma samples did not provide evidence for the existence of any known human viruses. Likewise, de-novo assembly and analysis of chimeric transcripts did not result in expression signatures associated with novel human pathogens. While confounding factors such as sample dilution or viral clearance in progressed tumors may mask viral cofactors in the data, in principle, this is rendered less likely by the high sensitivity of our approach and the number of biological replicates

  12. Sasquatch: predicting the impact of regulatory SNPs on transcription factor binding from cell- and tissue-specific DNase footprints.

    Science.gov (United States)

    Schwessinger, Ron; Suciu, Maria C; McGowan, Simon J; Telenius, Jelena; Taylor, Stephen; Higgs, Doug R; Hughes, Jim R

    2017-10-01

    In the era of genome-wide association studies (GWAS) and personalized medicine, predicting the impact of single nucleotide polymorphisms (SNPs) in regulatory elements is an important goal. Current approaches to determine the potential of regulatory SNPs depend on inadequate knowledge of cell-specific DNA binding motifs. Here, we present Sasquatch, a new computational approach that uses DNase footprint data to estimate and visualize the effects of noncoding variants on transcription factor binding. Sasquatch performs a comprehensive k -mer-based analysis of DNase footprints to determine any k -mer's potential for protein binding in a specific cell type and how this may be changed by sequence variants. Therefore, Sasquatch uses an unbiased approach, independent of known transcription factor binding sites and motifs. Sasquatch only requires a single DNase-seq data set per cell type, from any genotype, and produces consistent predictions from data generated by different experimental procedures and at different sequence depths. Here we demonstrate the effectiveness of Sasquatch using previously validated functional SNPs and benchmark its performance against existing approaches. Sasquatch is available as a versatile webtool incorporating publicly available data, including the human ENCODE collection. Thus, Sasquatch provides a powerful tool and repository for prioritizing likely regulatory SNPs in the noncoding genome. © 2017 Schwessinger et al.; Published by Cold Spring Harbor Laboratory Press.

  13. Conformational and mechanical changes of DNA upon transcription factor binding detected by a QCM and transmission line model.

    Science.gov (United States)

    de-Carvalho, Jorge; Rodrigues, Rogério M M; Tomé, Brigitte; Henriques, Sílvia F; Mira, Nuno P; Sá-Correia, Isabel; Ferreira, Guilherme N M

    2014-04-21

    A novel quartz crystal microbalance (QCM) analytical method is developed based on the transmission line model (TLM) algorithm to analyze the binding of transcription factors (TFs) to immobilized DNA oligoduplexes. The method is used to characterize the mechanical properties of biological films through the estimation of the film dynamic shear moduli, G and G, and the film thickness. Using the Saccharomyces cerevisiae transcription factor Haa1 (Haa1DBD) as a biological model two sensors were prepared by immobilizing DNA oligoduplexes, one containing the Haa1 recognition element (HRE(wt)) and another with a random sequence (HRE(neg)) used as a negative control. The immobilization of DNA oligoduplexes was followed in real time and we show that DNA strands initially adsorb with low or non-tilting, laying flat close to the surface, which then lift-off the surface leading to final film tilting angles of 62.9° and 46.7° for HRE(wt) and HRE(neg), respectively. Furthermore we show that the binding of Haa1DBD to HRE(wt) leads to a more ordered and compact film, and forces a 31.7° bending of the immobilized HRE(wt) oligoduplex. This work demonstrates the suitability of the QCM to monitor the specific binding of TFs to immobilized DNA sequences and provides an analytical methodology to study protein-DNA biophysics and kinetics.

  14. Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum

    Directory of Open Access Journals (Sweden)

    Busche Tobias

    2012-09-01

    Full Text Available Abstract Background The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Results Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. Conclusions The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly

  15. Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum.

    Science.gov (United States)

    Busche, Tobias; Silar, Radoslav; Pičmanová, Martina; Pátek, Miroslav; Kalinowski, Jörn

    2012-09-03

    The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly shutdown the SigH-dependent stress response after the cells have

  16. Strand transfer and elongation of HIV-1 reverse transcription is facilitated by cell factors in vitro.

    Directory of Open Access Journals (Sweden)

    David Warrilow

    Full Text Available Recent work suggests a role for multiple host factors in facilitating HIV-1 reverse transcription. Previously, we identified a cellular activity which increases the efficiency of HIV-1 reverse transcription in vitro. Here, we describe aspects of the activity which shed light on its function. The cellular factor did not affect synthesis of strong-stop DNA but did improve downstream DNA synthesis. The stimulatory activity was isolated by gel filtration in a single fraction of the exclusion volume. Velocity-gradient purified HIV-1, which was free of detectable RNase activity, showed poor reverse transcription efficiency but was strongly stimulated by partially purified cell proteins. Hence, the cell factor(s did not inactivate an RNase activity that might degrade the viral genomic RNA and block completion of reverse transcription. Instead, the cell factor(s enhanced first strand transfer and synthesis of late reverse transcription suggesting it stabilized the reverse transcription complex. The factor did not affect lysis of HIV-1 by Triton X-100 in the endogenous reverse transcription (ERT system, and ERT reactions with HIV-1 containing capsid mutations, which varied the biochemical stability of viral core structures and impeded reverse transcription in cells, showed no difference in the ability to be stimulated by the cell factor(s suggesting a lack of involvement of the capsid in the in vitro assay. In addition, reverse transcription products were found to be resistant to exogenous DNase I activity when the active fraction was present in the ERT assay. These results indicate that the cell factor(s may improve reverse transcription by facilitating DNA strand transfer and DNA synthesis. It also had a protective function for the reverse transcription products, but it is unclear if this is related to improved DNA synthesis.

  17. Transcriptional profiling of endocrine cerebro-osteodysplasia using microarray and next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Piya Lahiry

    Full Text Available BACKGROUND: Transcriptome profiling of patterns of RNA expression is a powerful approach to identify networks of genes that play a role in disease. To date, most mRNA profiling of tissues has been accomplished using microarrays, but next-generation sequencing can offer a richer and more comprehensive picture. METHODOLOGY/PRINCIPAL FINDINGS: ECO is a rare multi-system developmental disorder caused by a homozygous mutation in ICK encoding intestinal cell kinase. We performed gene expression profiling using both cDNA microarrays and next-generation mRNA sequencing (mRNA-seq of skin fibroblasts from ECO-affected subjects. We then validated a subset of differentially expressed transcripts identified by each method using quantitative reverse transcription-polymerase chain reaction (qRT-PCR. Finally, we used gene ontology (GO to identify critical pathways and processes that were abnormal according to each technical platform. Methodologically, mRNA-seq identifies a much larger number of differentially expressed genes with much better correlation to qRT-PCR results than the microarray (r² = 0.794 and 0.137, respectively. Biologically, cDNA microarray identified functional pathways focused on anatomical structure and development, while the mRNA-seq platform identified a higher proportion of genes involved in cell division and DNA replication pathways. CONCLUSIONS/SIGNIFICANCE: Transcriptome profiling with mRNA-seq had greater sensitivity, range and accuracy than the microarray. The two platforms generated different but complementary hypotheses for further evaluation.

  18. An engineered tale-transcription factor rescues transcription of factor VII impaired by promoter mutations and enhances its endogenous expression in hepatocytes.

    Science.gov (United States)

    Barbon, Elena; Pignani, Silvia; Branchini, Alessio; Bernardi, Francesco; Pinotti, Mirko; Bovolenta, Matteo

    2016-06-24

    Tailored approaches to restore defective transcription responsible for severe diseases have been poorly explored. We tested transcription activator-like effectors fused to an activation domain (TALE-TFs) in a coagulation factor VII (FVII) deficiency model. In this model, the deficiency is caused by the -94C > G or -61T > G mutation, which abrogate the binding of Sp1 or HNF-4 transcription factors. Reporter assays in hepatoma HepG2 cells naturally expressing FVII identified a single TALE-TF (TF4) that, by targeting the region between mutations, specifically trans-activated both the variant (>100-fold) and wild-type (20-40-fold) F7 promoters. Importantly, in the genomic context of transfected HepG2 and transduced primary hepatocytes, TF4 increased F7 mRNA and protein levels (2- to 3-fold) without detectable off-target effects, even for the homologous F10 gene. The ectopic F7 expression in renal HEK293 cells was modestly affected by TF4 or by TALE-TF combinations. These results provide experimental evidence for TALE-TFs as gene-specific tools useful to counteract disease-causing promoter mutations.

  19. A host basal transcription factor is a key component for infection of rice by TALE-carrying bacteria.

    Science.gov (United States)

    Yuan, Meng; Ke, Yinggen; Huang, Renyan; Ma, Ling; Yang, Zeyu; Chu, Zhaohui; Xiao, Jinghua; Li, Xianghua; Wang, Shiping

    2016-07-29

    Transcription activator-like effectors (TALEs) are sequence-specific DNA binding proteins found in a range of plant pathogenic bacteria, where they play important roles in host-pathogen interactions. However, it has been unclear how TALEs, after they have been injected into the host cells, activate transcription of host genes required for infection success. Here, we show that the basal transcription factor IIA gamma subunit TFIIAγ5 from rice is a key component for infection by the TALE-carrying bacterium Xanthomonas oryzae pv. oryzae, the causal agent for bacterial blight. Direct interaction of several TALEs with TFIIAγ5 is required for activation of disease susceptibility genes. Conversely, reduced expression of the TFIIAγ5 host gene limits the induction of susceptibility genes and thus decreases bacterial blight symptoms. Suppression or mutation of TFIIAγ5 can also reduce bacterial streak, another devastating disease of rice caused by TALE-carrying X. oryzae pv. oryzicola. These results have important implications for formulating a widely applicable strategy with which to improve resistance of plants to TALE-carrying pathogens.

  20. CACTA-superfamily transposable element is inserted in MYB transcription factor gene of soybean line producing variegated seeds.

    Science.gov (United States)

    Yan, Fan; Di, Shaokang; Takahashi, Ryoji

    2015-08-01

    The R gene of soybean, presumably encoding a MYB transcription factor, controls seed coat color. The gene consists of multiple alleles, R (black), r-m (black spots and (or) concentric streaks on brown seed), and r (brown seed). This study was conducted to determine the structure of the MYB transcription factor gene in a near-isogenic line (NIL) having r-m allele. PCR amplification of a fragment of the candidate gene Glyma.09G235100 generated a fragment of about 1 kb in the soybean cultivar Clark, whereas a fragment of about 14 kb in addition to fragments of 1 and 1.4 kb were produced in L72-2040, a Clark 63 NIL with the r-m allele. Clark 63 is a NIL of Clark with the rxp and Rps1 alleles. A DNA fragment of 13 060 bp was inserted in the intron of Glyma.09G235100 in L72-2040. The fragment had the CACTA motif at both ends, imperfect terminal inverted repeats (TIR), inverse repetition of short sequence motifs close to the 5' and 3' ends, and a duplication of three nucleotides at the site of integration, indicating that it belongs to a CACTA-superfamily transposable element. We designated the element as Tgm11. Overall nucleotide sequence, motifs of TIR, and subterminal repeats were similar to those of Tgm1 and Tgs1, suggesting that these elements comprise a family.

  1. Characterization of senscence-associated NAC transcription factors in Barley (Hordeum Vulgare L.)

    DEFF Research Database (Denmark)

    Podzimska, Dagmara Agata

    , such as yield, biomass production and nutrient quality, and NAC (NAM, ATAF1/2 and CUC2) transcription factors are promising targets for the breeding. The aim of this thesis was thus to assess the role of NAC transcription factors in regulation of senescence in barley (Hordeum vulgare L.) and to contribute...

  2. The Inflammatory Transcription Factors NFκB, STAT1 and STAT3 Drive Age-Associated Transcriptional Changes in the Human Kidney

    Science.gov (United States)

    O’Brown, Zach K.; Van Nostrand, Eric L.; Higgins, John P.; Kim, Stuart K.

    2015-01-01

    Human kidney function declines with age, accompanied by stereotyped changes in gene expression and histopathology, but the mechanisms underlying these changes are largely unknown. To identify potential regulators of kidney aging, we compared age-associated transcriptional changes in the human kidney with genome-wide maps of transcription factor occupancy from ChIP-seq datasets in human cells. The strongest candidates were the inflammation-associated transcription factors NFκB, STAT1 and STAT3, the activities of which increase with age in epithelial compartments of the renal cortex. Stimulation of renal tubular epithelial cells with the inflammatory cytokines IL-6 (a STAT3 activator), IFNγ (a STAT1 activator), or TNFα (an NFκB activator) recapitulated age-associated gene expression changes. We show that common DNA variants in RELA and NFKB1, the two genes encoding subunits of the NFκB transcription factor, associate with kidney function and chronic kidney disease in gene association studies, providing the first evidence that genetic variation in NFκB contributes to renal aging phenotypes. Our results suggest that NFκB, STAT1 and STAT3 underlie transcriptional changes and chronic inflammation in the aging human kidney. PMID:26678048

  3. Local gene regulation details a recognition code within the LacI transcriptional factor family.

    Directory of Open Access Journals (Sweden)

    Francisco M Camas

    2010-11-01

    Full Text Available The specific binding of regulatory proteins to DNA sequences exhibits no clear patterns of association between amino acids (AAs and nucleotides (NTs. This complexity of protein-DNA interactions raises the question of whether a simple set of wide-coverage recognition rules can ever be identified. Here, we analyzed this issue using the extensive LacI family of transcriptional factors (TFs. We searched for recognition patterns by introducing a new approach to phylogenetic footprinting, based on the pervasive presence of local regulation in prokaryotic transcriptional networks. We identified a set of specificity correlations--determined by two AAs of the TFs and two NTs in the binding sites--that is conserved throughout a dominant subgroup within the family regardless of the evolutionary distance, and that act as a relatively consistent recognition code. The proposed rules are confirmed with data of previous experimental studies and by events of convergent evolution in the phylogenetic tree. The presence of a code emphasizes the stable structural context of the LacI family, while defining a precise blueprint to reprogram TF specificity with many practical applications.

  4. A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

    Science.gov (United States)

    Martin, Elizabeth M.; Fry, Rebecca C.

    2016-01-01

    Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

  5. Problem-Solving Test: The Mechanism of Transcription Termination by the Rho Factor

    Science.gov (United States)

    Szeberenyi, Jozsef

    2012-01-01

    Transcription termination comes in two forms in "E. coli" cells. Rho-dependent termination requires the binding of a termination protein called Rho factor to the transcriptional machinery at the terminator region, whereas Rho-independent termination is achieved by conformational changes in the transcript itself. This article presents a test…

  6. The Arabidopsis thaliana NAC transcription factor family: structure-function relationships and determinants of ANAC019 stress signalling

    DEFF Research Database (Denmark)

    Jensen, Michael K; Kjaersgaard, Trine; Nielsen, Michael M.

    2010-01-01

    -termini. Nine of the ten NAC domains analysed bind a previously identified conserved DNA target sequence with a CGT[GA] core, although with different affinities. Likewise, all but one of the NAC proteins analysed is dependent on the C-terminal region for transactivational activity. In silico analyses show......TFs (transcription factors) are modular proteins minimally containing a DBD (DNA-binding domain) and a TRD (transcription regulatory domain). NAC [for NAM (no apical meristem), ATAF, CUC (cup-shaped cotyledon)] proteins comprise one of the largest plant TF families. They are key regulators...... of stress perception and developmental programmes, and most share an N-terminal NAC domain. On the basis of analyses of gene expression data and the phylogeny of Arabidopsis thaliana NAC TFs we systematically decipher structural and functional specificities of the conserved NAC domains and the divergent C...

  7. Pharmacological targeting of the transcription factor SOX18 delays breast cancer in mice

    Science.gov (United States)

    Overman, Jeroen; Fontaine, Frank; Moustaqil, Mehdi; Mittal, Deepak; Sierecki, Emma; Sacilotto, Natalia; Zuegg, Johannes; Robertson, Avril AB; Holmes, Kelly; Salim, Angela A; Mamidyala, Sreeman; Butler, Mark S; Robinson, Ashley S; Lesieur, Emmanuelle; Johnston, Wayne; Alexandrov, Kirill; Black, Brian L; Hogan, Benjamin M; De Val, Sarah; Capon, Robert J; Carroll, Jason S; Bailey, Timothy L; Koopman, Peter; Jauch, Ralf; Smyth, Mark J; Cooper, Matthew A; Gambin, Yann; Francois, Mathias

    2017-01-01

    Pharmacological targeting of transcription factors holds great promise for the development of new therapeutics, but strategies based on blockade of DNA binding, nuclear shuttling, or individual protein partner recruitment have yielded limited success to date. Transcription factors typically engage in complex interaction networks, likely masking the effects of specifically inhibiting single protein-protein interactions. Here, we used a combination of genomic, proteomic and biophysical methods to discover a suite of protein-protein interactions involving the SOX18 transcription factor, a known regulator of vascular development and disease. We describe a small-molecule that is able to disrupt a discrete subset of SOX18-dependent interactions. This compound selectively suppressed SOX18 transcriptional outputs in vitro and interfered with vascular development in zebrafish larvae. In a mouse pre-clinical model of breast cancer, treatment with this inhibitor significantly improved survival by reducing tumour vascular density and metastatic spread. Our studies validate an interactome-based molecular strategy to interfere with transcription factor activity, for the development of novel disease therapeutics. DOI: http://dx.doi.org/10.7554/eLife.21221.001 PMID:28137359

  8. Mitochondrial transcription factor A protects human retinal ...

    African Journals Online (AJOL)

    Purpose: To investigate the impact of mitochondrial transcription factor A (TFAM), as a modulator of NF-κB, on proliferation of hypoxia-induced human retinal endothelial cell (HREC), and the probable mechanism. Methods: After exposure to hypoxia (1 % O2) for 5 days, cell proliferation and cell cycle of HREC were ...

  9. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

    1987-01-01

    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

  10. Transcription factor Amr1 induces melanin biosynthesis and suppresses virulence in Alternaria brassicicola.

    Directory of Open Access Journals (Sweden)

    Yangrae Cho

    Full Text Available Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. Several A. brassicicola genes have been characterized as affecting pathogenesis of Brassica species. To study regulatory mechanisms of pathogenesis, we mined 421 genes in silico encoding putative transcription factors in a machine-annotated, draft genome sequence of A. brassicicola. In this study, targeted gene disruption mutants for 117 of the transcription factor genes were produced and screened. Three of these genes were associated with pathogenesis. Disruption mutants of one gene (AbPacC were nonpathogenic and another gene (AbVf8 caused lesions less than half the diameter of wild-type lesions. Unexpectedly, mutants of the third gene, Amr1, caused lesions with a two-fold larger diameter than the wild type and complementation mutants. Amr1 is a homolog of Cmr1, a transcription factor that regulates melanin biosynthesis in several fungi. We created gene deletion mutants of Δamr1 and characterized their phenotypes. The Δamr1 mutants used pectin as a carbon source more efficiently than the wild type, were melanin-deficient, and more sensitive to UV light and glucanase digestion. The AMR1 protein was localized in the nuclei of hyphae and in highly melanized conidia during the late stage of plant pathogenesis. RNA-seq analysis revealed that three genes in the melanin biosynthesis pathway, along with the deleted Amr1 gene, were expressed at low levels in the mutants. In contrast, many hydrolytic enzyme-coding genes were expressed at higher levels in the mutants than in the wild type during pathogenesis. The results of this study suggested that a gene important for survival in nature negatively affected virulence, probably by a less efficient use of plant cell-wall materials. We speculate that the functions of the Amr1 gene are important to the success of A. brassicicola as a competitive saprophyte and plant parasite.

  11. Identification of cisregulatory elements and bioinformatic prediction of transcriptional factors involved in regulation of miRNAs in plants

    International Nuclear Information System (INIS)

    Perez Quintero, Alvaro; Lopez, Camilo

    2013-01-01

    MicroRNAs (miRNAs) are a group of small non coding MAS involved in the control of gene expression through the degradation of miRNAs in a sequence specific manner, miRNAs expression is dependent on RNA polymerase ii as most of the coding protein genes. The regulation of miRNAs expression is under the coordinated and combinatorial control of transcription factors (TFS). A bioinformatics approach was carried out to identify transcription factor binding sites (TFBS) in the promoter of miRNAs genes in 17 different plant species and the possible involvement of TF in antibacterial response was analyzed. In nine of the plants studied significant differences in TFBS distribution in the promoter of miRNAs were observed when compare to the promoter of protein coding genes. TFBS as CCA1, T-box y SORLREP3 were present on the promoters of the cassava miRNAs induced in response to the infection by the bacteria Xanthomonas axonopodis pv. manihotis. These TFBS are also present in the promoter of genes coding for proteins involved in circadian rhythm and light responses, suggesting a crosstalk between these process and immune plant responses. Taken together, the results here described give insight about the transcriptional mechanisms involved in the expression of miRNAs.

  12. A novel method for improved accuracy of transcription factor binding site prediction

    KAUST Repository

    Khamis, Abdullah M.; Motwalli, Olaa Amin; Oliva, Romina; Jankovic, Boris R.; Medvedeva, Yulia; Ashoor, Haitham; Essack, Magbubah; Gao, Xin; Bajic, Vladimir B.

    2018-01-01

    Identifying transcription factor (TF) binding sites (TFBSs) is important in the computational inference of gene regulation. Widely used computational methods of TFBS prediction based on position weight matrices (PWMs) usually have high false positive rates. Moreover, computational studies of transcription regulation in eukaryotes frequently require numerous PWM models of TFBSs due to a large number of TFs involved. To overcome these problems we developed DRAF, a novel method for TFBS prediction that requires only 14 prediction models for 232 human TFs, while at the same time significantly improves prediction accuracy. DRAF models use more features than PWM models, as they combine information from TFBS sequences and physicochemical properties of TF DNA-binding domains into machine learning models. Evaluation of DRAF on 98 human ChIP-seq datasets shows on average 1.54-, 1.96- and 5.19-fold reduction of false positives at the same sensitivities compared to models from HOCOMOCO, TRANSFAC and DeepBind, respectively. This observation suggests that one can efficiently replace the PWM models for TFBS prediction by a small number of DRAF models that significantly improve prediction accuracy. The DRAF method is implemented in a web tool and in a stand-alone software freely available at http://cbrc.kaust.edu.sa/DRAF.

  13. A novel method for improved accuracy of transcription factor binding site prediction

    KAUST Repository

    Khamis, Abdullah M.

    2018-03-20

    Identifying transcription factor (TF) binding sites (TFBSs) is important in the computational inference of gene regulation. Widely used computational methods of TFBS prediction based on position weight matrices (PWMs) usually have high false positive rates. Moreover, computational studies of transcription regulation in eukaryotes frequently require numerous PWM models of TFBSs due to a large number of TFs involved. To overcome these problems we developed DRAF, a novel method for TFBS prediction that requires only 14 prediction models for 232 human TFs, while at the same time significantly improves prediction accuracy. DRAF models use more features than PWM models, as they combine information from TFBS sequences and physicochemical properties of TF DNA-binding domains into machine learning models. Evaluation of DRAF on 98 human ChIP-seq datasets shows on average 1.54-, 1.96- and 5.19-fold reduction of false positives at the same sensitivities compared to models from HOCOMOCO, TRANSFAC and DeepBind, respectively. This observation suggests that one can efficiently replace the PWM models for TFBS prediction by a small number of DRAF models that significantly improve prediction accuracy. The DRAF method is implemented in a web tool and in a stand-alone software freely available at http://cbrc.kaust.edu.sa/DRAF.

  14. Comprehensive Interrogation of Natural TALE DNA Binding Modules and Transcriptional Repressor Domains

    Science.gov (United States)

    Cong, Le; Zhou, Ruhong; Kuo, Yu-chi; Cunniff, Margaret; Zhang, Feng

    2012-01-01

    Transcription activator-like effectors (TALE) are sequence-specific DNA binding proteins that harbor modular, repetitive DNA binding domains. TALEs have enabled the creation of customizable designer transcriptional factors and sequence-specific nucleases for genome engineering. Here we report two improvements of the TALE toolbox for achieving efficient activation and repression of endogenous gene expression in mammalian cells. We show that the naturally occurring repeat variable diresidue (RVD) Asn-His (NH) has high biological activity and specificity for guanine, a highly prevalent base in mammalian genomes. We also report an effective TALE transcriptional repressor architecture for targeted inhibition of transcription in mammalian cells. These findings will improve the precision and effectiveness of genome engineering that can be achieved using TALEs. PMID:22828628

  15. ERP, a new member of the ets transcription factor/oncoprotein family: cloning, characterization, and differential expression during B-lymphocyte development.

    Science.gov (United States)

    Lopez, M; Oettgen, P; Akbarali, Y; Dendorfer, U; Libermann, T A

    1994-05-01

    The ets gene family encodes a group of proteins which function as transcription factors under physiological conditions and, if aberrantly expressed, can cause cellular transformation. We have recently identified two regulatory elements in the murine immunoglobulin heavy-chain (IgH) enhancer, pi and microB, which exhibit striking similarity to binding sites for ets-related proteins. To identify ets-related transcriptional regulators expressed in pre-B lymphocytes that may interact with either the pi or the microB site, we have used a PCR approach with degenerate oligonucleotides encoding conserved sequences in all members of the ets family. We have cloned the gene for a new ets-related transcription factor, ERP (ets-related protein), from the murine pre-B cell line BASC 6C2 and from mouse lung tissue. The ERP protein contains a region of high homology with the ETS DNA-binding domain common to all members of the ets transcription factor/oncoprotein family. Three additional smaller regions show homology to the ELK-1 and SAP-1 genes, a subgroup of the ets gene family that interacts with the serum response factor. Full-length ERP expresses only negligible DNA-binding activity by itself. Removal of the carboxy terminus enables ERP to interact with a variety of ets-binding sites including the E74 site, the IgH enhancer pi site, and the lck promoter ets site, suggesting a carboxy-terminal negative regulatory domain. At least three ERP-related transcripts are expressed in a variety of tissues. However, within the B-cell lineage, ERP is highly expressed primarily at early stages of B-lymphocyte development, and expression declines drastically upon B-cell maturation, correlating with the enhancer activity of the IgH pi site. These data suggest that ERP might play a role in B-cell development and in IgH gene regulation.

  16. E2F1 and p53 Transcription Factors as Accessory Factors for Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    David G. Johnson

    2012-10-01

    Full Text Available Many of the biochemical details of nucleotide excision repair (NER have been established using purified proteins and DNA substrates. In cells however, DNA is tightly packaged around histones and other chromatin-associated proteins, which can be an obstacle to efficient repair. Several cooperating mechanisms enhance the efficiency of NER by altering chromatin structure. Interestingly, many of the players involved in modifying chromatin at sites of DNA damage were originally identified as regulators of transcription. These include ATP-dependent chromatin remodelers, histone modifying enzymes and several transcription factors. The p53 and E2F1 transcription factors are well known for their abilities to regulate gene expression in response to DNA damage. This review will highlight the underappreciated, transcription-independent functions of p53 and E2F1 in modifying chromatin structure in response to DNA damage to promote global NER.

  17. Arabidopsis R2R3-MYB transcription factor AtMYB60 functions as a transcriptional repressor of anthocyanin biosynthesis in lettuce (Lactuca sativa).

    Science.gov (United States)

    Park, Jong-Sug; Kim, Jung-Bong; Cho, Kang-Jin; Cheon, Choong-Ill; Sung, Mi-Kyung; Choung, Myoung-Gun; Roh, Kyung-Hee

    2008-06-01

    The MYB transcription factors play important roles in the regulation of many secondary metabolites at the transcriptional level. We evaluated the possible roles of the Arabidopsis R2R3-MYB transcription factors in flavonoid biosynthesis because they are induced by UV-B irradiation but their associated phenotypes are largely unexplored. We isolated their genes by RACE-PCR, and performed transgenic approach and metabolite analyses in lettuce (Lactuca sativa). We found that one member of this protein family, AtMYB60, inhibits anthocyanin biosynthesis in the lettuce plant. Wild-type lettuce normally accumulates anthocyanin, predominantly cyanidin and traces of delphinidin, and develops a red pigmentation. However, the production and accumulation of anthocyanin pigments in AtMYB60-overexpressing lettuce was inhibited. Using RT-PCR analysis, we also identified the complete absence or reduction of dihydroflavonol 4-reductase (DFR) transcripts in AtMYB60- overexpressing lettuce (AtMYB60-117 and AtMYB60-112 lines). The correlation between the overexpression of AtMYB60 and the inhibition of anthocyanin accumulation suggests that the transcription factorAtMYB60 controls anthocyanin biosynthesis in the lettuce leaf. Clarification of the roles of the AtMYB60 transcription factor will facilitate further studies and provide genetic tools to better understand the regulation in plants of the genes controlled by the MYB-type transcription factors. Furthermore, the characterization of AtMYB60 has implications for the development of new varieties of lettuce and other commercially important plants with metabolic engineering approaches.

  18. The mitochondrial transcription factor A functions in mitochondrial base excision repair

    DEFF Research Database (Denmark)

    Canugovi, Chandrika; Maynard, Scott; Bayne, Anne-Cécile V

    2010-01-01

    Mitochondrial transcription factor A (TFAM) is an essential component of mitochondrial nucleoids. TFAM plays an important role in mitochondrial transcription and replication. TFAM has been previously reported to inhibit nucleotide excision repair (NER) in vitro but NER has not yet been detected i...

  19. Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family.

    Science.gov (United States)

    Dai, Qi; Ren, Aiming; Westholm, Jakub O; Duan, Hong; Patel, Dinshaw J; Lai, Eric C

    2015-01-01

    Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain ("BEN-solo" factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional

  20. Interaction between FMDV Lpro and transcription factor ADNP is required for viral replication

    Science.gov (United States)

    The foot-and-mouth disease virus (FMDV) leader protease (Lpro) inhibits host translation and transcription affecting the expression of several factors involved in innate immunity. In this study, we have identified the host transcription factor ADNP (activity dependent neuroprotective protein) as an ...

  1. WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

    Directory of Open Access Journals (Sweden)

    Pesole Graziano

    2007-02-01

    Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.

  2. Posttranslational modifications of Forkhead box O transcription factors

    NARCIS (Netherlands)

    Horst, Aart Arno van der

    2006-01-01

    FOXO transcription factors play an important role in essential biological processes such as differentiation, proliferation, apoptosis, DNA repair, metabolism and stress resistance. Phosphorylation is the modification that was first found on FOXOs and much of the subsequent studies focused on this

  3. Preparation, crystallization and preliminary X-ray diffraction analysis of the DNA-binding domain of the Ets transcription factor in complex with target DNA

    Energy Technology Data Exchange (ETDEWEB)

    Suwa, Yoshiaki; Nakamura, Teruya; Toma, Sachiko; Ikemizu, Shinji; Kai, Hirofumi; Yamagata, Yuriko, E-mail: yamagata@gpo.kumamoto-u.ac.jp [Graduate School of Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973 (Japan)

    2008-03-01

    The complex between the Ets domain of Ets2 and its target DNA has been crystallized. The crystals diffracted to 3.0 Å resolution. The Ets2 transcription factor is a member of the Ets transcription-factor family. Ets2 plays a role in the malignancy of cancer and in Down’s syndrome by regulating the transcription of various genes. The DNA-binding domain of Ets2 (Ets domain; ETSD), which contains residues that are highly conserved among Ets transcription-factor family members, was expressed as a GST-fusion protein. The aggregation of ETSD produced after thrombin cleavage could be prevented by treatment with NDSB-195 (nondetergent sulfobetaine 195). ETSD was crystallized in complex with DNA containing the Ets2 target sequence (GGAA) by the hanging-drop vapour-diffusion method. The best crystals were grown using 25% PEG 3350, 80 mM magnesium acetate, 50 mM sodium cacodylate pH 5.0/5.5 as the reservoir at 293 K. The crystals belonged to space group C2, with unit-cell parameters a = 85.89, b = 95.52, c = 71.89 Å, β = 101.7° and a V{sub M} value of 3.56 Å{sup 3} Da{sup −1}. Diffraction data were collected to a resolution of 3.0 Å.

  4. Preparation, crystallization and preliminary X-ray diffraction analysis of the DNA-binding domain of the Ets transcription factor in complex with target DNA

    International Nuclear Information System (INIS)

    Suwa, Yoshiaki; Nakamura, Teruya; Toma, Sachiko; Ikemizu, Shinji; Kai, Hirofumi; Yamagata, Yuriko

    2008-01-01

    The complex between the Ets domain of Ets2 and its target DNA has been crystallized. The crystals diffracted to 3.0 Å resolution. The Ets2 transcription factor is a member of the Ets transcription-factor family. Ets2 plays a role in the malignancy of cancer and in Down’s syndrome by regulating the transcription of various genes. The DNA-binding domain of Ets2 (Ets domain; ETSD), which contains residues that are highly conserved among Ets transcription-factor family members, was expressed as a GST-fusion protein. The aggregation of ETSD produced after thrombin cleavage could be prevented by treatment with NDSB-195 (nondetergent sulfobetaine 195). ETSD was crystallized in complex with DNA containing the Ets2 target sequence (GGAA) by the hanging-drop vapour-diffusion method. The best crystals were grown using 25% PEG 3350, 80 mM magnesium acetate, 50 mM sodium cacodylate pH 5.0/5.5 as the reservoir at 293 K. The crystals belonged to space group C2, with unit-cell parameters a = 85.89, b = 95.52, c = 71.89 Å, β = 101.7° and a V M value of 3.56 Å 3 Da −1 . Diffraction data were collected to a resolution of 3.0 Å

  5. InFusion: Advancing Discovery of Fusion Genes and Chimeric Transcripts from Deep RNA-Sequencing Data.

    Directory of Open Access Journals (Sweden)

    Konstantin Okonechnikov

    Full Text Available Analysis of fusion transcripts has become increasingly important due to their link with cancer development. Since high-throughput sequencing approaches survey fusion events exhaustively, several computational methods for the detection of gene fusions from RNA-seq data have been developed. This kind of analysis, however, is complicated by native trans-splicing events, the splicing-induced complexity of the transcriptome and biases and artefacts introduced in experiments and data analysis. There are a number of tools available for the detection of fusions from RNA-seq data; however, certain differences in specificity and sensitivity between commonly used approaches have been found. The ability to detect gene fusions of different types, including isoform fusions and fusions involving non-coding regions, has not been thoroughly studied yet. Here, we propose a novel computational toolkit called InFusion for fusion gene detection from RNA-seq data. InFusion introduces several unique features, such as discovery of fusions involving intergenic regions, and detection of anti-sense transcription in chimeric RNAs based on strand-specificity. Our approach demonstrates superior detection accuracy on simulated data and several public RNA-seq datasets. This improved performance was also evident when evaluating data from RNA deep-sequencing of two well-established prostate cancer cell lines. InFusion identified 26 novel fusion events that were validated in vitro, including alternatively spliced gene fusion isoforms and chimeric transcripts that include intergenic regions. The toolkit is freely available to download from http:/bitbucket.org/kokonech/infusion.

  6. The transcriptional network that controls growth arrest and differentiation in a human myeloid leukemia cell line

    DEFF Research Database (Denmark)

    Suzuki, Harukazu; Forrest, Alistair R R; van Nimwegen, Erik

    2009-01-01

    , we identified the key transcription regulators, their time-dependent activities and target genes. Systematic siRNA knockdown of 52 transcription factors confirmed the roles of individual factors in the regulatory network. Our results indicate that cellular states are constrained by complex networks......Using deep sequencing (deepCAGE), the FANTOM4 study measured the genome-wide dynamics of transcription-start-site usage in the human monocytic cell line THP-1 throughout a time course of growth arrest and differentiation. Modeling the expression dynamics in terms of predicted cis-regulatory sites...... involving both positive and negative regulatory interactions among substantial numbers of transcription factors and that no single transcription factor is both necessary and sufficient to drive the differentiation process....

  7. The WRKY Transcription Factor Genes in Lotus japonicus.

    Science.gov (United States)

    Song, Hui; Wang, Pengfei; Nan, Zhibiao; Wang, Xingjun

    2014-01-01

    WRKY transcription factor genes play critical roles in plant growth and development, as well as stress responses. WRKY genes have been examined in various higher plants, but they have not been characterized in Lotus japonicus. The recent release of the L. japonicus whole genome sequence provides an opportunity for a genome wide analysis of WRKY genes in this species. In this study, we identified 61 WRKY genes in the L. japonicus genome. Based on the WRKY protein structure, L. japonicus WRKY (LjWRKY) genes can be classified into three groups (I-III). Investigations of gene copy number and gene clusters indicate that only one gene duplication event occurred on chromosome 4 and no clustered genes were detected on chromosomes 3 or 6. Researchers previously believed that group II and III WRKY domains were derived from the C-terminal WRKY domain of group I. Our results suggest that some WRKY genes in group II originated from the N-terminal domain of group I WRKY genes. Additional evidence to support this hypothesis was obtained by Medicago truncatula WRKY (MtWRKY) protein motif analysis. We found that LjWRKY and MtWRKY group III genes are under purifying selection, suggesting that WRKY genes will become increasingly structured and functionally conserved.

  8. Bioinformatic detection of E47, E2F1 and SREBP1 transcription factors as potential regulators of genes associated to acquisition of endometrial receptivity

    Directory of Open Access Journals (Sweden)

    Croxatto Horacio B

    2011-01-01

    Full Text Available Abstract Background The endometrium is a dynamic tissue whose changes are driven by the ovarian steroidal hormones. Its main function is to provide an adequate substrate for embryo implantation. Using microarray technology, several reports have provided the gene expression patterns of human endometrial tissue during the window of implantation. However it is required that biological connections be made across these genomic datasets to take full advantage of them. The objective of this work was to perform a research synthesis of available gene expression profiles related to acquisition of endometrial receptivity for embryo implantation, in order to gain insights into its molecular basis and regulation. Methods Gene expression datasets were intersected to determine a consensus endometrial receptivity transcript list (CERTL. For this cluster of genes we determined their functional annotations using available web-based databases. In addition, promoter sequences were analyzed to identify putative transcription factor binding sites using bioinformatics tools and determined over-represented features. Results We found 40 up- and 21 down-regulated transcripts in the CERTL. Those more consistently increased were C4BPA, SPP1, APOD, CD55, CFD, CLDN4, DKK1, ID4, IL15 and MAP3K5 whereas the more consistently decreased were OLFM1, CCNB1, CRABP2, EDN3, FGFR1, MSX1 and MSX2. Functional annotation of CERTL showed it was enriched with transcripts related to the immune response, complement activation and cell cycle regulation. Promoter sequence analysis of genes revealed that DNA binding sites for E47, E2F1 and SREBP1 transcription factors were the most consistently over-represented and in both up- and down-regulated genes during the window of implantation. Conclusions Our research synthesis allowed organizing and mining high throughput data to explore endometrial receptivity and focus future research efforts on specific genes and pathways. The discovery of possible

  9. Mechanism of transcription activation at the comG promoter by the competence transcription factor ComK of Bacillus subtilis

    NARCIS (Netherlands)

    Susanna, KA; van der Werff, AF; den Hengst, CD; Calles, B; Salas, M; Venema, G; Hamoen, LW; Kuipers, OP

    The development of genetic competence in Bacillus subtilis is regulated by a complex signal transduction cascade, which results in the synthesis of the competence transcription factor, encoded by comK. ComK is required for the transcription of the late competence genes that encode the DNA binding

  10. footprintDB: a database of transcription factors with annotated cis elements and binding interfaces.

    Science.gov (United States)

    Sebastian, Alvaro; Contreras-Moreira, Bruno

    2014-01-15

    Traditional and high-throughput techniques for determining transcription factor (TF) binding specificities are generating large volumes of data of uneven quality, which are scattered across individual databases. FootprintDB integrates some of the most comprehensive freely available libraries of curated DNA binding sites and systematically annotates the binding interfaces of the corresponding TFs. The first release contains 2422 unique TF sequences, 10 112 DNA binding sites and 3662 DNA motifs. A survey of the included data sources, organisms and TF families was performed together with proprietary database TRANSFAC, finding that footprintDB has a similar coverage of multicellular organisms, while also containing bacterial regulatory data. A search engine has been designed that drives the prediction of DNA motifs for input TFs, or conversely of TF sequences that might recognize input regulatory sequences, by comparison with database entries. Such predictions can also be extended to a single proteome chosen by the user, and results are ranked in terms of interface similarity. Benchmark experiments with bacterial, plant and human data were performed to measure the predictive power of footprintDB searches, which were able to correctly recover 10, 55 and 90% of the tested sequences, respectively. Correctly predicted TFs had a higher interface similarity than the average, confirming its diagnostic value. Web site implemented in PHP,Perl, MySQL and Apache. Freely available from http://floresta.eead.csic.es/footprintdb.

  11. Unique CCT repeats mediate transcription of the TWIST1 gene in mesenchymal cell lines

    International Nuclear Information System (INIS)

    Ohkuma, Mizue; Funato, Noriko; Higashihori, Norihisa; Murakami, Masanori; Ohyama, Kimie; Nakamura, Masataka

    2007-01-01

    TWIST1, a basic helix-loop-helix transcription factor, plays critical roles in embryo development, cancer metastasis and mesenchymal progenitor differentiation. Little is known about transcriptional regulation of TWIST1 expression. Here we identified DNA sequences responsible for TWIST1 expression in mesenchymal lineage cell lines. Reporter assays with TWIST1 promoter mutants defined the -102 to -74 sequences that are essential for TWIST1 expression in human and mouse mesenchymal cell lines. Tandem repeats of CCT, but not putative CREB and NF-κB sites in the sequences substantially supported activity of the TWIST1 promoter. Electrophoretic mobility shift assay demonstrated that the DNA sequences with the CCT repeats formed complexes with nuclear factors, containing, at least, Sp1 and Sp3. These results suggest critical implication of the CCT repeats in association with Sp1 and Sp3 factors in sustaining expression of the TWIST1 gene in mesenchymal cells

  12. Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

    Science.gov (United States)

    Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

    2014-08-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  13. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  14. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  15. Mammalian transcriptional hotspots are enriched for tissue specific enhancers near cell type specific highly expressed genes and are predicted to act as transcriptional activator hubs.

    Science.gov (United States)

    Joshi, Anagha

    2014-12-30

    Transcriptional hotspots are defined as genomic regions bound by multiple factors. They have been identified recently as cell type specific enhancers regulating developmentally essential genes in many species such as worm, fly and humans. The in-depth analysis of hotspots across multiple cell types in same species still remains to be explored and can bring new biological insights. We therefore collected 108 transcription-related factor (TF) ChIP sequencing data sets in ten murine cell types and classified the peaks in each cell type in three groups according to binding occupancy as singletons (low-occupancy), combinatorials (mid-occupancy) and hotspots (high-occupancy). The peaks in the three groups clustered largely according to the occupancy, suggesting priming of genomic loci for mid occupancy irrespective of cell type. We then characterized hotspots for diverse structural functional properties. The genes neighbouring hotspots had a small overlap with hotspot genes in other cell types and were highly enriched for cell type specific function. Hotspots were enriched for sequence motifs of key TFs in that cell type and more than 90% of hotspots were occupied by pioneering factors. Though we did not find any sequence signature in the three groups, the H3K4me1 binding profile had bimodal peaks at hotspots, distinguishing hotspots from mono-modal H3K4me1 singletons. In ES cells, differentially expressed genes after perturbation of activators were enriched for hotspot genes suggesting hotspots primarily act as transcriptional activator hubs. Finally, we proposed that ES hotspots might be under control of SetDB1 and not DNMT for silencing. Transcriptional hotspots are enriched for tissue specific enhancers near cell type specific highly expressed genes. In ES cells, they are predicted to act as transcriptional activator hubs and might be under SetDB1 control for silencing.

  16. Statistical approaches to use a model organism for regulatory sequences annotation of newly sequenced species.

    Directory of Open Access Journals (Sweden)

    Pietro Liò

    Full Text Available A major goal of bioinformatics is the characterization of transcription factors and the transcriptional programs they regulate. Given the speed of genome sequencing, we would like to quickly annotate regulatory sequences in newly-sequenced genomes. In such cases, it would be helpful to predict sequence motifs by using experimental data from closely related model organism. Here we present a general algorithm that allow to identify transcription factor binding sites in one newly sequenced species by performing Bayesian regression on the annotated species. First we set the rationale of our method by applying it within the same species, then we extend it to use data available in closely related species. Finally, we generalise the method to handle the case when a certain number of experiments, from several species close to the species on which to make inference, are available. In order to show the performance of the method, we analyse three functionally related networks in the Ascomycota. Two gene network case studies are related to the G2/M phase of the Ascomycota cell cycle; the third is related to morphogenesis. We also compared the method with MatrixReduce and discuss other types of validation and tests. The first network is well known and provides a biological validation test of the method. The two cell cycle case studies, where the gene network size is conserved, demonstrate an effective utility in annotating new species sequences using all the available replicas from model species. The third case, where the gene network size varies among species, shows that the combination of information is less powerful but is still informative. Our methodology is quite general and could be extended to integrate other high-throughput data from model organisms.

  17. Hybrid Sequencing of Full-Length cDNA Transcripts of Stems and Leaves in Dendrobium officinale

    Directory of Open Access Journals (Sweden)

    Liu He

    2017-10-01

    Full Text Available Dendrobium officinale is an extremely valuable orchid used in traditional Chinese medicine, so sought after that it has a higher market value than gold. Although the expression profiles of some genes involved in the polysaccharide synthesis have previously been investigated, little research has been carried out on their alternatively spliced isoforms in D. officinale. In addition, information regarding the translocation of sugars from leaves to stems in D. officinale also remains limited. We analyzed the polysaccharide content of D. officinale leaves and stems, and completed in-depth transcriptome sequencing of these two diverse tissue types using second-generation sequencing (SGS and single-molecule real-time (SMRT sequencing technology. The results of this study yielded a digital inventory of gene and mRNA isoform expressions. A comparative analysis of both transcriptomes uncovered a total of 1414 differentially expressed genes, including 844 that were up-regulated and 570 that were down-regulated in stems. Of these genes, one sugars will eventually be exported transporter (SWEET and one sucrose transporter (SUT are expressed to a greater extent in D. officinale stems than in leaves. Two glycosyltransferase (GT and four cellulose synthase (Ces genes undergo a distinct degree of alternative splicing. In the stems, the content of polysaccharides is twice as much as that in the leaves. The differentially expressed GT and transcription factor (TF genes will be the focus of further study. The genes DoSWEET4 and DoSUT1 are significantly expressed in the stem, and are likely to be involved in sugar loading in the phloem.

  18. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    OpenAIRE

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A

    1997-01-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, delet...

  19. A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

    Directory of Open Access Journals (Sweden)

    Mi Zhao

    Full Text Available We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

  20. A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

    Science.gov (United States)

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

  1. A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

    Science.gov (United States)

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

  2. Genome-wide identification of the potato WRKY transcription factor family.

    Science.gov (United States)

    Zhang, Chao; Wang, Dongdong; Yang, Chenghui; Kong, Nana; Shi, Zheng; Zhao, Peng; Nan, Yunyou; Nie, Tengkun; Wang, Ruoqiu; Ma, Haoli; Chen, Qin

    2017-01-01

    WRKY transcription factors play pivotal roles in regulation of stress responses. This study identified 79 WRKY genes in potato (Solanum tuberosum). Based on multiple sequence alignment and phylogenetic relationships, WRKY genes were classified into three major groups. The majority of WRKY genes belonged to Group II (52 StWRKYs), Group III had 14 and Group I consisted of 13. The phylogenetic tree further classified Group II into five sub-groups. All StWRKY genes except StWRKY79 were mapped on potato chromosomes, with eight tandem duplication gene pairs and seven segmental duplication gene pairs found from StWRKY family genes. The expression analysis of 22 StWRKYs showed their differential expression levels under various stress conditions. Cis-element prediction showed that a large number of elements related to drought, heat and salicylic acid were present in the promotor regions of StWRKY genes. The expression analysis indicated that seven StWRKYs seemed to respond to stress (heat, drought and salinity) and salicylic acid treatment. These genes are candidates for abiotic stress signaling for further research.

  3. Advanced Glycation End-Products affect transcription factors regulating insulin gene expression

    International Nuclear Information System (INIS)

    Puddu, A.; Storace, D.; Odetti, P.; Viviani, G.L.

    2010-01-01

    Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic β-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.

  4. The related transcriptional enhancer factor-1 isoform, TEAD4(216, can repress vascular endothelial growth factor expression in mammalian cells.

    Directory of Open Access Journals (Sweden)

    Binoy Appukuttan

    Full Text Available Increased cellular production of vascular endothelial growth factor (VEGF is responsible for the development and progression of multiple cancers and other neovascular conditions, and therapies targeting post-translational VEGF products are used in the treatment of these diseases. Development of methods to control and modify the transcription of the VEGF gene is an alternative approach that may have therapeutic potential. We have previously shown that isoforms of the transcriptional enhancer factor 1-related (TEAD4 protein can enhance the production of VEGF. In this study we describe a new TEAD4 isoform, TEAD4(216, which represses VEGF promoter activity. The TEAD4(216 isoform inhibits human VEGF promoter activity and does not require the presence of the hypoxia responsive element (HRE, which is the sequence critical to hypoxia inducible factor (HIF-mediated effects. The TEAD4(216 protein is localized to the cytoplasm, whereas the enhancer isoforms are found within the nucleus. The TEAD4(216 isoform can competitively repress the stimulatory activity of the TEAD4(434 and TEAD4(148 enhancers. Synthesis of the native VEGF(165 protein and cellular proliferation is suppressed by the TEAD4(216 isoform. Mutational analysis indicates that nuclear or cytoplasmic localization of any isoform determines whether it acts as an enhancer or repressor, respectively. The TEAD4(216 isoform appears to inhibit VEGF production independently of the HRE required activity by HIF, suggesting that this alternatively spliced isoform of TEAD4 may provide a novel approach to treat VEGF-dependent diseases.

  5. High-mobility group (HMG) protein HMG-1 and TATA-binding protein-associated factor TAF(II)30 affect estrogen receptor-mediated transcriptional activation.

    Science.gov (United States)

    Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F

    1997-07-01

    The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.

  6. The NAC transcription factor family in maritime pine (Pinus Pinaster): molecular regulation of two genes involved in stress responses.

    Science.gov (United States)

    Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción

    2015-10-24

    NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.

  7. Activating transcription factor 3 promotes loss of the acinar cell phenotype in response to cerulein-induced pancreatitis in mice.

    Science.gov (United States)

    Fazio, Elena N; Young, Claire C; Toma, Jelena; Levy, Michael; Berger, Kurt R; Johnson, Charis L; Mehmood, Rashid; Swan, Patrick; Chu, Alphonse; Cregan, Sean P; Dilworth, F Jeffrey; Howlett, Christopher J; Pin, Christopher L

    2017-09-01

    Pancreatitis is a debilitating disease of the exocrine pancreas that, under chronic conditions, is a major susceptibility factor for pancreatic ductal adenocarcinoma (PDAC). Although down-regulation of genes that promote the mature acinar cell fate is required to reduce injury associated with pancreatitis, the factors that promote this repression are unknown. Activating transcription factor 3 (ATF3) is a key mediator of the unfolded protein response, a pathway rapidly activated during pancreatic insult. Using chromatin immunoprecipitation followed by next-generation sequencing, we show that ATF3 is bound to the transcriptional regulatory regions of >30% of differentially expressed genes during the initiation of pancreatitis. Of importance, ATF3-dependent regulation of these genes was observed only upon induction of pancreatitis, with pathways involved in inflammation, acinar cell differentiation, and cell junctions being specifically targeted. Characterizing expression of transcription factors that affect acinar cell differentiation suggested that acinar cells lacking ATF3 maintain a mature cell phenotype during pancreatitis, a finding supported by maintenance of junctional proteins and polarity markers. As a result, Atf3 -/- pancreatic tissue displayed increased tissue damage and inflammatory cell infiltration at early time points during injury but, at later time points, showed reduced acinar-to-duct cell metaplasia. Thus our results reveal a critical role for ATF3 as a key regulator of the acinar cell transcriptional response during injury and may provide a link between chronic pancreatitis and PDAC. © 2017 Fazio et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  8. DNA repair helicase: a component of BTF2 (TFIIH) basic transcription factor. (research article)

    NARCIS (Netherlands)

    L. Schaeffer; R. Roy (Richard); S. Humbert; V. Moncollin; W. Vermeulen (Wim); J.H.J. Hoeijmakers (Jan); P. Chambon; J-M. Egly (Jean-Marc)

    1993-01-01

    textabstractThe human BTF2 basic transcription factor (also called TFIIH), which is similar to the delta factor in rat and factor b in yeast, is required for class II gene transcription. A strand displacement assay was used to show that highly purified preparation of BTF2 had an adenosine

  9. Altered binding of human histone gene transcription factors during the shutdown of proliferation and onset of differentiation in HL-60 cells

    International Nuclear Information System (INIS)

    Stein, G.; Lian, J.; Stein, J.; Shalhoub, V.; Wright, K.; Pauli, U.; Van Wijnen, A.; Briggs, R.

    1989-01-01

    Two sites of protein-DNA interaction have been identified in vivo and in vitro in the proximal promoter regions of an H4 and an H3 human histone gene. In proliferating cells, these genes are transcribed throughout the cell cycle, and both the more distal site I and the proximal site II are occupied by promoter-binding factors. In this report the authors demonstrate that during the shutdown of proliferation and onset of differentiation of the human promyelocytic leukemia cell line HL-60 into cells that exhibit phenotypic properties of monocytes, histone gene expression is down-regulated at the level of transcription. In vivo occupancy of site I by promoter factors persists in the differentiated HL-60 cells, but protein-DNA interactions at site II are selectively lost. Furthermore, in vitro binding activity of the site II promoter factor HiNF-D is lost in differentiated cells, and nuclear extracts from differentiated cells do not support in vitro transcription of these histone genes. The results suggest that the interaction of HiNF-D with proximal promoter site II sequences plays a primary role in rendering cell growth-regulated histone genes transcribable in proliferating cells. It appears that while cell-cycle control of histone gene expression is mediated by both transcription and mRNA stability, with the shutdown of proliferation and onset of differentiation, histone gene expression is regulated at the transcriptional level

  10. Versatile Gene-Specific Sequence Tags for Arabidopsis Functional Genomics: Transcript Profiling and Reverse Genetics Applications

    Science.gov (United States)

    Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian

    2004-01-01

    Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341

  11. Asap: a framework for over-representation statistics for transcription factor binding sites

    DEFF Research Database (Denmark)

    Marstrand, Troels T; Frellsen, Jes; Moltke, Ida

    2008-01-01

    -founded choice. METHODOLOGY: We introduce a software package, Asap, for fast searching with position weight matrices that include several standard methods for assessing over-representation. We have compared the ability of these methods to detect over-represented transcription factor binding sites in artificial......BACKGROUND: In studies of gene regulation the efficient computational detection of over-represented transcription factor binding sites is an increasingly important aspect. Several published methods can be used for testing whether a set of hypothesised co-regulated genes share a common regulatory...... regime based on the occurrence of the modelled transcription factor binding sites. However there is little or no information available for guiding the end users choice of method. Furthermore it would be necessary to obtain several different software programs from various sources to make a well...

  12. UV-induced transcription from the human immunodeficiency virus type 1 (HIV-1) long terminal repeat and UV-induced secretion of an extracellular factor that induces HIV-1 transcription in nonirradiated cells

    International Nuclear Information System (INIS)

    Stein, B.; Kraemer, M.R.; Rahmsdorf, H.J.; Ponta, H.; Herrlich, P.

    1989-01-01

    UV irradiation, but not visible sunlight, induces the transcription of human immunodeficiency virus type 1 (HIV-1). Chimeric constructs carrying all or parts of the HIV-1 long terminal repeat linked to an indicator gene were transfected into HeLa cells or murine and human T-cell lines, and their response to irradiation was tested. The cis-acting element conferring UV responsiveness is identical to the sequence binding transcription factor NF kappa B. UV irradiation enhances NF kappa B binding activity as assayed by gel retardation experiments. Interestingly, the requirement for UV irradiation can be replaced by cocultivation of transfected cells with UV-irradiated nontransfected (HIV-1-negative) cells. A UV-induced extracellular protein factor is detected in the culture medium conditioned by UV-treated cells. The factor is produced upon UV irradiation by several murine and human cell lines, including HeLa, Molt-4, and Jurkat, and acts on several cells. These data suggest that the UV response of keratinocytes in human skin can be magnified and spread to deeper layers that are more shielded, including the Langerhans cells, and that this indirect UV response may contribute to the activation of HIV-1 in humans

  13. Functional Characterization of Tea (Camellia sinensis MYB4a Transcription Factor Using an Integrative Approach

    Directory of Open Access Journals (Sweden)

    Mingzhuo Li

    2017-06-01

    Full Text Available Green tea (Camellia sinensis, Cs abundantly produces a diverse array of phenylpropanoid compounds benefiting human health. To date, the regulation of the phenylpropanoid biosynthesis in tea remains to be investigated. Here, we report a cDNA isolated from leaf tissues, which encodes a R2R3-MYB transcription factor. Amino acid sequence alignment and phylogenetic analysis indicate that it is a member of the MYB4-subgroup and named as CsMYB4a. Transcriptional and metabolic analyses show that the expression profile of CsMYB4a is negatively correlated to the accumulation of six flavan-3-ols and other phenolic acids. GFP fusion analysis shows CsMYB4a’s localization in the nucleus. Promoters of five tea phenylpropanoid pathway genes are isolated and characterized to contain four types of AC-elements, which are targets of MYB4 members. Interaction of CsMYB4a and five promoters shows that CsMYB4a decreases all five promoters’ activity. To further characterize its function, CsMYB4a is overexpressed in tobacco plants. The resulting transgenic plants show dwarf, shrinking and yellowish leaf, and early senescence phenotypes. A further genome-wide transcriptomic analysis reveals that the expression levels of 20 tobacco genes involved in the shikimate and the phenylpropanoid pathways are significantly downregulated in transgenic tobacco plants. UPLC-MS and HPLC based metabolic profiling reveals significant reduction of total lignin content, rutin, chlorogenic acid, and phenylalanine in CsMYB4a transgenic tobacco plants. Promoter sequence analysis of the 20 tobacco genes characterizes four types of AC-elements. Further CsMYB4a-AC element and CsMYB4a-promoter interaction analyses indicate that the negative regulation of CsMYB4a on the shikimate and phenylpropanoid pathways in tobacco is via reducing promoter activity. Taken together, all data indicate that CsMYB4a negatively regulates the phenylpropanoid and shikimate pathways.Highlight: A tea (Camellia

  14. Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L. in response to fungal pathogens and hormone treatments

    Directory of Open Access Journals (Sweden)

    Deyholos Michael K

    2009-06-01

    Full Text Available Abstract Background Members of plant WRKY transcription factor families are widely implicated in defense responses and various other physiological processes. For canola (Brassica napus L., no WRKY genes have been described in detail. Because of the economic importance of this crop, and its evolutionary relationship to Arabidopsis thaliana, we sought to characterize a subset of canola WRKY genes in the context of pathogen and hormone responses. Results In this study, we identified 46 WRKY genes from canola by mining the expressed sequence tag (EST database and cloned cDNA sequences of 38 BnWRKYs. A phylogenetic tree was constructed using the conserved WRKY domain amino acid sequences, which demonstrated that BnWRKYs can be divided into three major groups. We further compared BnWRKYs to the 72 WRKY genes from Arabidopsis and 91 WRKY from rice, and we identified 46 presumptive orthologs of AtWRKY genes. We examined the subcellular localization of four BnWRKY proteins using green fluorescent protein (GFP and we observed the fluorescent green signals in the nucleus only. The responses of 16 selected BnWRKY genes to two fungal pathogens, Sclerotinia sclerotiorum and Alternaria brassicae, were analyzed by quantitative real time-PCR (qRT-PCR. Transcript abundance of 13 BnWRKY genes changed significantly following pathogen challenge: transcripts of 10 WRKYs increased in abundance, two WRKY transcripts decreased after infection, and one decreased at 12 h post-infection but increased later on (72 h. We also observed that transcript abundance of 13/16 BnWRKY genes was responsive to one or more hormones, including abscisic acid (ABA, and cytokinin (6-benzylaminopurine, BAP and the defense signaling molecules jasmonic acid (JA, salicylic acid (SA, and ethylene (ET. We compared these transcript expression patterns to those previously described for presumptive orthologs of these genes in Arabidopsis and rice, and observed both similarities and differences in

  15. Valproic acid disrupts the oscillatory expression of core circadian rhythm transcription factors.

    Science.gov (United States)

    Griggs, Chanel A; Malm, Scott W; Jaime-Frias, Rosa; Smith, Catharine L

    2018-01-15

    Valproic acid (VPA) is a well-established therapeutic used in treatment of seizure and mood disorders as well as migraines and a known hepatotoxicant. About 50% of VPA users experience metabolic disruptions, including weight gain, hyperlipidemia, and hyperinsulinemia, among others. Several of these metabolic abnormalities are similar to the effects of circadian rhythm disruption. In the current study, we examine the effect of VPA exposure on the expression of core circadian transcription factors that drive the circadian clock via a transcription-translation feedback loop. In cells with an unsynchronized clock, VPA simultaneously upregulated the expression of genes encoding core circadian transcription factors that regulate the positive and negative limbs of the feedback loop. Using low dose glucocorticoid, we synchronized cultured fibroblast cells to a circadian oscillatory pattern. Whether VPA was added at the time of synchronization or 12h later at CT12, we found that VPA disrupted the oscillatory expression of multiple genes encoding essential transcription factors that regulate circadian rhythm. Therefore, we conclude that VPA has a potent effect on the circadian rhythm transcription-translation feedback loop that may be linked to negative VPA side effects in humans. Furthermore, our study suggests potential chronopharmacology implications of VPA usage. Copyright © 2017. Published by Elsevier Inc.

  16. Design, construction, and analysis of specific zinc finger nucleases for microphthalmia - associate transcription factor

    Directory of Open Access Journals (Sweden)

    Wenwen Wang

    2012-08-01

    Full Text Available This work studied the design, construction, and cleavage analysis of zinc finger nucleases (ZFNs that could cut the specific sequences within microphthalmia - associate transcription factor (mitfa of zebra fish. The target site and ZFPs were selected and designed with zinc finger tools, while the ZFPs were synthesized using DNAWorks and two-step PCR. The ZFNs were constructed, expressed, purified, and analyzed in vitro. As expected, the designed ZFNs could create a double-stand break (DSB at the target site in vitro. The DNAWorks, two-step PCR, and an optimized process of protein expression were firstly induced in the construction of ZFNs successfully, which was an effective and simplified protocol. These results could be useful for further application of ZFNs - mediated gene targeting.

  17. Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

    Energy Technology Data Exchange (ETDEWEB)

    Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

    2007-02-21

    Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

  18. The transcription factor KLF2 restrains CD4⁺ T follicular helper cell differentiation.

    Science.gov (United States)

    Lee, June-Yong; Skon, Cara N; Lee, You Jeong; Oh, Soohwan; Taylor, Justin J; Malhotra, Deepali; Jenkins, Marc K; Rosenfeld, M Geoffrey; Hogquist, Kristin A; Jameson, Stephen C

    2015-02-17

    T follicular helper (Tfh) cells are essential for efficient B cell responses, yet the factors that regulate differentiation of this CD4(+) T cell subset are incompletely understood. Here we found that the KLF2 transcription factor serves to restrain Tfh cell generation. Induced KLF2 deficiency in activated CD4(+) T cells led to increased Tfh cell generation and B cell priming, whereas KLF2 overexpression prevented Tfh cell production. KLF2 promotes expression of the trafficking receptor S1PR1, and S1PR1 downregulation is essential for efficient Tfh cell production. However, KLF2 also induced expression of the transcription factor Blimp-1, which repressed transcription factor Bcl-6 and thereby impaired Tfh cell differentiation. Furthermore, KLF2 induced expression of the transcription factors T-bet and GATA3 and enhanced Th1 differentiation. Hence, our data indicate KLF2 is pivotal for coordinating CD4(+) T cell differentiation through two distinct and complementary mechanisms: via control of T cell localization and by regulation of lineage-defining transcription factors. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Cell-type specificity of ChIP-predicted transcription factor binding sites

    Directory of Open Access Journals (Sweden)

    Håndstad Tony

    2012-08-01

    Full Text Available Abstract Background Context-dependent transcription factor (TF binding is one reason for differences in gene expression patterns between different cellular states. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq identifies genome-wide TF binding sites for one particular context—the cells used in the experiment. But can such ChIP-seq data predict TF binding in other cellular contexts and is it possible to distinguish context-dependent from ubiquitous TF binding? Results We compared ChIP-seq data on TF binding for multiple TFs in two different cell types and found that on average only a third of ChIP-seq peak regions are common to both cell types. Expectedly, common peaks occur more frequently in certain genomic contexts, such as CpG-rich promoters, whereas chromatin differences characterize cell-type specific TF binding. We also find, however, that genotype differences between the cell types can explain differences in binding. Moreover, ChIP-seq signal intensity and peak clustering are the strongest predictors of common peaks. Compared with strong peaks located in regions containing peaks for multiple transcription factors, weak and isolated peaks are less common between the cell types and are less associated with data that indicate regulatory activity. Conclusions Together, the results suggest that experimental noise is prevalent among weak peaks, whereas strong and clustered peaks represent high-confidence binding events that often occur in other cellular contexts. Nevertheless, 30-40% of the strongest and most clustered peaks show context-dependent regulation. We show that by combining signal intensity with additional data—ranging from context independent information such as binding site conservation and position weight matrix scores to context dependent chromatin structure—we can predict whether a ChIP-seq peak is likely to be present in other cellular contexts.

  20. DOT/FAA Human Factors Workshop on Aviation (5th). Transcript.

    Science.gov (United States)

    1982-01-01

    This document is a verbatim transcript of the proceedings of the Fifth Human Factors Workshop held at the Mike Monroney Aeronautical Center in Oklahoma City, Oklahoma, on July 7-9, 1981. The Sixth Human Factors Workshop was held at the same facility ...

  1. Intrinsic terminators in Mycoplasma hyopneumoniae transcription.

    Science.gov (United States)

    Fritsch, Tiago Ebert; Siqueira, Franciele Maboni; Schrank, Irene Silveira

    2015-04-08

    Mycoplasma hyopneumoniae, an important pathogen of swine, exhibits a low guanine and cytosine (GC) content genome. M. hyopneumoniae genome is organised in long transcriptional units and promoter sequences have been mapped upstream of all transcription units. These analysis provided insights into the gene organisation and transcription initiation at the genome scale. However, the presence of transcriptional terminator sequences in the M. hyopneumoniae genome is poorly understood. In silico analyses demonstrated the presence of putative terminators in 82% of the 33 monocistronic units (mCs) and in 74% of the 116 polycistronic units (pCs) considering different classes of terminators. The functional activity of 23 intrinsic terminators was confirmed by RT-PCR and qPCR. Analysis of all terminators found by three software algorithms, combined with experimental results, allowed us to propose a pattern of RNA hairpin formation during the termination process and to predict the location of terminators in the M. hyopneumoniae genome sequence. The stem-loop structures of intrinsic terminators of mycoplasma diverge from the pattern of terminators found in other bacteria due the low content of guanine and cytosine. In M. hyopneumoniae, transcription can end after a transcriptional unit and before its terminator sequence and can also continue past the terminator sequence with RNA polymerases gradually releasing the RNA.

  2. Gata4 expression in lateral mesoderm is downstream of BMP4 and isactivated directly by Forkhead and GATA transcription factors through adistal enhancer element

    Energy Technology Data Exchange (ETDEWEB)

    Rojas, Anabel; De Val, Sarah; Heidt, Analeah B.; Xu, Shan-Mei; Bristow, James; Black, Brian L.

    2005-05-20

    The GATA family of zinc-finger transcription factors plays key roles in the specification and differentiation of multiple cell types during development. GATA4 is an early regulator of gene expression during the development of endoderm and mesoderm, and genetic studies in mice have demonstrated that GATA4 is required for embryonic development.Despite the importance of GATA4 in tissue specification and differentiation, the mechanisms by which Gata4 expression is activated and the transcription factor pathways upstream of GATA4 remain largely undefined. To identify transcriptional regulators of Gata4 in the mouse,we screened conserved noncoding sequences from the mouse Gata4 gene for enhancer activity in transgenic embryos. Here, we define the regulation of a distal enhancer element from Gata4 that is sufficient to direct expression throughout the lateral mesoderm, beginning at 7.5 days of mouse embryonic development. The activity of this enhancer is initially broad but eventually becomes restricted to the mesenchyme surrounding the liver. We demonstrate that the function of this enhancer in transgenic embryos is dependent upon highly conserved Forkhead and GATA transcription factor binding sites, which are bound by FOXF1 and GATA4,respectively. Furthermore, the activity of the Gata4 lateral mesoderm enhancer is attenuated by the BMP antagonist Noggin, and the enhancer is not activated in Bmp4-null embryos. Thus, these studies establish that Gata4 is a direct transcriptional target of Forkhead and GATA transcription factors in the lateral mesoderm, and demonstrate that Gata4lateral mesoderm enhancer activation requires BMP4, supporting a model in which GATA4 serves as a downstream effector of BMP signaling in the lateral mesoderm.

  3. The transcription factor ATF3 is upregulated during chondrocyte differentiation and represses cyclin D1 and A gene transcription

    Directory of Open Access Journals (Sweden)

    James Claudine G

    2006-09-01

    Full Text Available Abstract Background Coordinated chondrocyte proliferation and differentiation are required for normal endochondral bone growth. Transcription factors binding to the cyclicAMP response element (CRE are known to regulate these processes. One member of this family, Activating Tanscription Factor 3 (ATF3, is expressed during skeletogenesis and acts as a transcriptional repressor, but the function of this protein in chondrogenesis is unknown. Results Here we demonstrate that Atf3 mRNA levels increase during mouse chondrocyte differentiation in vitro and in vivo. In addition, Atf3 mRNA levels are increased in response to cytochalasin D treatment, an inducer of chondrocyte maturation. This is accompanied by increased Atf3 promoter activity in cytochalasin D-treated chondrocytes. We had shown earlier that transcription of the cell cycle genes cyclin D1 and cyclin A in chondrocytes is dependent on CREs. Here we demonstrate that overexpression of ATF3 in primary mouse chondrocytes results in reduced transcription of both genes, as well as decreased activity of a CRE reporter plasmid. Repression of cyclin A transcription by ATF3 required the CRE in the cyclin A promoter. In parallel, ATF3 overexpression reduces the activity of a SOX9-dependent promoter and increases the activity of a RUNX2-dependent promoter. Conclusion Our data suggest that transcriptional induction of the Atf3 gene in maturing chondrocytes results in down-regulation of cyclin D1 and cyclin A expression as well as activation of RUNX2-dependent transcription. Therefore, ATF3 induction appears to facilitate cell cycle exit and terminal differentiation of chondrocytes.

  4. Transcription factors as readers and effectors of DNA methylation.

    Science.gov (United States)

    Zhu, Heng; Wang, Guohua; Qian, Jiang

    2016-08-01

    Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease.

  5. The MYST family histone acetyltransferase complex regulates stress resistance and longevity through transcriptional control of DAF-16/FOXO transcription factors.

    Science.gov (United States)

    Ikeda, Takako; Uno, Masaharu; Honjoh, Sakiko; Nishida, Eisuke

    2017-08-09

    The well-known link between longevity and the Sir2 histone deacetylase family suggests that histone deacetylation, a modification associated with repressed chromatin, is beneficial to longevity. However, the molecular links between histone acetylation and longevity remain unclear. Here, we report an unexpected finding that the MYST family histone acetyltransferase complex (MYS-1/TRR-1 complex) promotes rather than inhibits stress resistance and longevity in Caenorhabditis elegans Our results show that these beneficial effects are largely mediated through transcriptional up-regulation of the FOXO transcription factor DAF-16. MYS-1 and TRR-1 are recruited to the promoter regions of the daf-16 gene, where they play a role in histone acetylation, including H4K16 acetylation. Remarkably, we also find that the human MYST family Tip60/TRRAP complex promotes oxidative stress resistance by up-regulating the expression of FOXO transcription factors in human cells. Tip60 is recruited to the promoter regions of the foxo1 gene, where it increases H4K16 acetylation levels. Our results thus identify the evolutionarily conserved role of the MYST family acetyltransferase as a key epigenetic regulator of DAF-16/FOXO transcription factors. © 2017 The Authors.

  6. Significant associations of the mitochondrial transcription factor A promoter polymorphisms with marbling and subcutaneous fat depth in Wagyu x Limousin F2 crosses

    International Nuclear Information System (INIS)

    Jiang, Zhihua; Kunej, Tanja; Michal, Jennifer J.; Gaskins, Charles T.; Reeves, Jerry J.; Busboom, Jan R.; Dovc, Peter; Wright, Raymond W.

    2005-01-01

    Mitochondrial transcription factor A (TFAM), a nucleus-encoded protein, regulates the initiation of transcription and replication of mitochondrial DNA (mtDNA). Decreased expression of nuclear-encoded mitochondrial genes has been associated with onset of obesity in mice. Therefore, we hypothesized genetic variants in TFAM gene influence mitochondrial biogenesis consequently affecting body fat deposition and energy metabolism. In the present study, both cDNA (2259 bp) and genomic DNA (16,666 bp) sequences were generated for the bovine TFAM gene using a combination of in silico cloning with targeted region PCR amplification. Alignment of both cDNA and genomic sequences led to the determination of genomic organization and characterization of the promoter region of the bovine TFAM gene. Two closely linked A/C and C/T single nucleotide polymorphisms (SNPs) were found in the bovine TFAM promoter and then genotyped on 237 Wagyu x Limousin F 2 animals with recorded phenotypes for marbling and subcutaneous fat depth (SFD). Statistical analysis demonstrated that both SNPs and their haplotypes were associated with marbling (P = 0.0153 for A/C, P = 0.0026 for C/T, and P = 0.0004 for haplotype) and SFD (P = 0.0200 for A/C, P = 0.0039 for C/T, and P = 0.0029 for haplotype), respectively. A search for transcriptional regulatory elements using MatInspector indicated that both SNPs lead to a gain/loss of six putative-binding sites for transcription factors relevant to fat deposition and energy metabolism. Our results suggest for the first time that TFAM gene plays an important role in lipid metabolism and may be a strong candidate gene for obesity in mammals

  7. Transcription Factor Repertoire of Necrotrophic Fungal Phytopathogen Ascochyta rabiei: Predominance of MYB Transcription Factors As Potential Regulators of Secretome

    Directory of Open Access Journals (Sweden)

    Sandhya Verma

    2017-06-01

    Full Text Available Transcription factors (TFs are the key players in gene expression and their study is highly significant for shedding light on the molecular mechanisms and evolutionary history of organisms. During host–pathogen interaction, extensive reprogramming of gene expression facilitated by TFs is likely to occur in both host and pathogen. To date, the knowledge about TF repertoire in filamentous fungi is in infancy. The necrotrophic fungus Ascochyta rabiei, that causes destructive Ascochyta blight (AB disease of chickpea (Cicer arietinum, demands more comprehensive study for better understanding of Ascochyta-legume pathosystem. In the present study, we performed the genome-wide identification and analysis of TFs in A. rabiei. Taking advantage of A. rabiei genome sequence, we used a bioinformatic approach to predict the TF repertoire of A. rabiei. For identification and classification of A. rabiei TFs, we designed a comprehensive pipeline using a combination of BLAST and InterProScan software. A total of 381 A. rabiei TFs were predicted and divided into 32 fungal specific families of TFs. The gene structure, domain organization and phylogenetic analysis of abundant families of A. rabiei TFs were also carried out. Comparative study of A. rabiei TFs with that of other necrotrophic, biotrophic, hemibiotrophic, symbiotic, and saprotrophic fungi was performed. It suggested presence of both conserved as well as unique features among them. Moreover, cis-acting elements on promoter sequences of earlier predicted A. rabiei secretome were also identified. With the help of published A. rabiei transcriptome data, the differential expression of TF and secretory protein coding genes was analyzed. Furthermore, comprehensive expression analysis of few selected A. rabiei TFs using quantitative real-time polymerase chain reaction revealed variety of expression patterns during host colonization. These genes were expressed in at least one of the time points tested post

  8. Incorporating evolution of transcription factor binding sites into ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Identifying transcription factor binding sites (TFBSs) is essential to elucidate ... alignments with parts annotated as gap lessly aligned TFBSs (pair-profile hits) are generated. Moreover, the pair- profile related parameters are derived in a sound statistical framework. ... Much research has gone into the study of the evolution of.

  9. Identification of a novel and unique transcription factor in the intraerythrocytic stage of Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Kanako Komaki-Yasuda

    Full Text Available The mechanisms of stage-specific gene regulation in the malaria parasite Plasmodium falciparum are largely unclear, with only a small number of specific regulatory transcription factors (AP2 family having been identified. In particular, the transcription factors that function in the intraerythrocytic stage remain to be elucidated. Previously, as a model case for stage-specific transcription in the P. falciparum intraerythrocytic stage, we analyzed the transcriptional regulation of pf1-cys-prx, a trophozoite/schizont-specific gene, and suggested that some nuclear factors bind specifically to the cis-element of pf1-cys-prx and enhance transcription. In the present study, we purified nuclear factors from parasite nuclear extract by 5 steps of chromatography, and identified a factor termed PREBP. PREBP is not included in the AP2 family, and is a novel protein with four K-homology (KH domains. The KH domain is known to be found in RNA-binding or single-stranded DNA-binding proteins. PREBP is well conserved in Plasmodium species and partially conserved in phylum Apicomplexa. To evaluate the effects of PREBP overexpression, we used a transient overexpression and luciferase assay combined approach. Overexpression of PREBP markedly enhanced luciferase expression under the control of the pf1-cys-prx cis-element. These results provide the first evidence of a novel transcription factor that activates the gene expression in the malaria parasite intraerythrocytic stage. These findings enhance our understanding of the evolution of specific transcription machinery in Plasmodium and other eukaryotes.

  10. TAF(II)250: a transcription toolbox.

    Science.gov (United States)

    Wassarman, D A; Sauer, F

    2001-08-01

    Activation of RNA-polymerase-II-dependent transcription involves conversion of signals provided by gene-specific activator proteins into the synthesis of messenger RNA. This conversion requires dynamic structural changes in chromatin and assembly of general transcription factors (GTFs) and RNA polymerase II at core promoter sequence elements surrounding the transcription start site of genes. One hallmark of transcriptional activation is the interaction of DNA-bound activators with coactivators such as the TATA-box binding protein (TBP)-associated factors (TAF(II)s) within the GTF TFIID. TAF(II)250 possesses a variety of activities that are likely to contribute to the initial steps of RNA polymerase II transcription. TAF(II)250 is a scaffold for assembly of other TAF(II)s and TBP into TFIID, TAF(II)250 binds activators to recruit TFIID to particular promoters, TAF(II)250 regulates binding of TBP to DNA, TAF(II)250 binds core promoter initiator elements, TAF(II)250 binds acetylated lysine residues in core histones, and TAF(II)250 possesses protein kinase, ubiquitin-activating/conjugating and acetylase activities that modify histones and GTFs. We speculate that these activities achieve two goals--(1) they aid in positioning and stabilizing TFIID at particular promoters, and (2) they alter chromatin structure at the promoter to allow assembly of GTFs--and we propose a model for how TAF(II)250 converts activation signals into active transcription.

  11. Biological effects of tolerable level chronic boron intake on transcription factors.

    Science.gov (United States)

    Orenay Boyacioglu, Seda; Korkmaz, Mehmet; Kahraman, Erkan; Yildirim, Hatice; Bora, Selin; Ataman, Osman Yavuz

    2017-01-01

    The mechanism of boron effect on human transcription and translation has not been fully understood. In the current study it was aimed to reveal the role of boron on the expression of certain transcription factors that play key roles in many cellular pathways on human subjects chronically exposed to low amounts of boron. The boron concentrations in drinking water samples were 1.57±0.06mg/l for boron group while the corresponding value for the control group was 0.016±0.002mg/l. RNA isolation was performed using PAX gene RNA kit on the blood samples from the subjects. The RNA was then reverse transcribed into cDNA and analyzed using the Human Transcription Factors RT 2 Profiler™ PCR Arrays. While the boron amount in urine was detected as 3.56±1.47mg/day in the boron group, it was 0.72±0.30mg/day in the control group. Daily boron intake of the boron and control groups were calculated to be 6.98±3.39 and 1.18±0.41mg/day, respectively. The expression levels of the transcription factor genes were compared between the boron and control groups and no statistically significant difference was detected (P>0.05). The data suggest that boron intake at 6.98±3.39mg/day, which is the dose at which beneficial effects might be seen, does not result in toxicity at molecular level since the expression levels of transcription factors are not changed. Although boron intake over this level will seem to increase RNA synthesis, further examination of the topic is needed using new molecular epidemiological data. Copyright © 2016 Elsevier GmbH. All rights reserved.

  12. Transcription-factor occupancy at HOT regions quantitatively predicts RNA polymerase recruitment in five human cell lines.

    KAUST Repository

    Foley, Joseph W; Sidow, Arend

    2013-01-01

    BACKGROUND: High-occupancy target (HOT) regions are compact genome loci occupied by many different transcription factors (TFs). HOT regions were initially defined in invertebrate model organisms, and we here show that they are a ubiquitous feature of the human gene-regulation landscape. RESULTS: We identified HOT regions by a comprehensive analysis of ChIP-seq data from 96 DNA-associated proteins in 5 human cell lines. Most HOT regions co-localize with RNA polymerase II binding sites, but many are not near the promoters of annotated genes. At HOT promoters, TF occupancy is strongly predictive of transcription preinitiation complex recruitment and moderately predictive of initiating Pol II recruitment, but only weakly predictive of elongating Pol II and RNA transcript abundance. TF occupancy varies quantitatively within human HOT regions; we used this variation to discover novel associations between TFs. The sequence motif associated with any given TF's direct DNA binding is somewhat predictive of its empirical occupancy, but a great deal of occupancy occurs at sites without the TF's motif, implying indirect recruitment by another TF whose motif is present. CONCLUSIONS: Mammalian HOT regions are regulatory hubs that integrate the signals from diverse regulatory pathways to quantitatively tune the promoter for RNA polymerase II recruitment.

  13. Transcription-factor occupancy at HOT regions quantitatively predicts RNA polymerase recruitment in five human cell lines.

    KAUST Repository

    Foley, Joseph W

    2013-10-20

    BACKGROUND: High-occupancy target (HOT) regions are compact genome loci occupied by many different transcription factors (TFs). HOT regions were initially defined in invertebrate model organisms, and we here show that they are a ubiquitous feature of the human gene-regulation landscape. RESULTS: We identified HOT regions by a comprehensive analysis of ChIP-seq data from 96 DNA-associated proteins in 5 human cell lines. Most HOT regions co-localize with RNA polymerase II binding sites, but many are not near the promoters of annotated genes. At HOT promoters, TF occupancy is strongly predictive of transcription preinitiation complex recruitment and moderately predictive of initiating Pol II recruitment, but only weakly predictive of elongating Pol II and RNA transcript abundance. TF occupancy varies quantitatively within human HOT regions; we used this variation to discover novel associations between TFs. The sequence motif associated with any given TF\\'s direct DNA binding is somewhat predictive of its empirical occupancy, but a great deal of occupancy occurs at sites without the TF\\'s motif, implying indirect recruitment by another TF whose motif is present. CONCLUSIONS: Mammalian HOT regions are regulatory hubs that integrate the signals from diverse regulatory pathways to quantitatively tune the promoter for RNA polymerase II recruitment.

  14. Finite-size effects in transcript sequencing count distribution: its power-law correction necessarily precedes downstream normalization and comparative analysis.

    Science.gov (United States)

    Wong, Wing-Cheong; Ng, Hong-Kiat; Tantoso, Erwin; Soong, Richie; Eisenhaber, Frank

    2018-02-12

    Though earlier works on modelling transcript abundance from vertebrates to lower eukaroytes have specifically singled out the Zip's law, the observed distributions often deviate from a single power-law slope. In hindsight, while power-laws of critical phenomena are derived asymptotically under the conditions of infinite observations, real world observations are finite where the finite-size effects will set in to force a power-law distribution into an exponential decay and consequently, manifests as a curvature (i.e., varying exponent values) in a log-log plot. If transcript abundance is truly power-law distributed, the varying exponent signifies changing mathematical moments (e.g., mean, variance) and creates heteroskedasticity which compromises statistical rigor in analysis. The impact of this deviation from the asymptotic power-law on sequencing count data has never truly been examined and quantified. The anecdotal description of transcript abundance being almost Zipf's law-like distributed can be conceptualized as the imperfect mathematical rendition of the Pareto power-law distribution when subjected to the finite-size effects in the real world; This is regardless of the advancement in sequencing technology since sampling is finite in practice. Our conceptualization agrees well with our empirical analysis of two modern day NGS (Next-generation sequencing) datasets: an in-house generated dilution miRNA study of two gastric cancer cell lines (NUGC3 and AGS) and a publicly available spike-in miRNA data; Firstly, the finite-size effects causes the deviations of sequencing count data from Zipf's law and issues of reproducibility in sequencing experiments. Secondly, it manifests as heteroskedasticity among experimental replicates to bring about statistical woes. Surprisingly, a straightforward power-law correction that restores the distribution distortion to a single exponent value can dramatically reduce data heteroskedasticity to invoke an instant increase in

  15. Stage-specific regulation of four HD-ZIP III transcription factors during polar pattern formation in Larix leptolepis somatic embryos.

    Science.gov (United States)

    Li, Shui-gen; Li, Wan-feng; Han, Su-ying; Yang, Wen-hua; Qi, Li-wang

    2013-06-15

    Polar auxin transport provides a developmental signal for cell fate specification during somatic embryogenesis. Some members of the HD-ZIP III transcription factors participate in regulation of auxin transport, but little is known about this regulation in somatic embryogenesis. Here, four HD-ZIP III homologues from Larix leptolepis were identified and designated LaHDZ31, 32, 33 and 34. The occurrence of a miR165/166 target sequence in all four cDNA sequences indicated that they might be targets of miR165/166. Identification of the cleavage products of LaHDZ31 and LaHDZ32 in vivo confirmed that they were regulated by miRNA. Their mRNA accumulation patterns during somatic embryogenesis and the effects of 1-N-naphthylphthalamic acid (NPA) on their transcript levels and somatic embryo maturation were investigated. The results showed that the four genes had higher transcript levels at mature stages than at the proliferation stage, and that NPA treatment down-regulated the mRNA abundance of LaHDZ31, 32 and 33 at cotyledonary embryo stages, but had no effect on the mRNA abundance of LaHDZ34. We concluded that these four members of Larix HD-ZIP III family might participate in polar auxin transport and the development of somatic embryos, providing new insights into the regulatory mechanisms of somatic embryogenesis. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. bZIPs and WRKYs: two large transcription factor families executing two different functional strategies

    Directory of Open Access Journals (Sweden)

    Carles eMarco Llorca

    2014-04-01

    Full Text Available bZIPs and WRKYs are two important plant transcription factor families regulating diverse developmental and stress-related processes. Since a partial overlap in these biological processes is obvious, it can be speculated that they fulfill non-redundant functions in a complex regulatory network. Here, we focus on the regulatory mechanisms that are so far described for bZIPs and WRKYs. bZIP factors need to heterodimerize for DNA-binding and regulation of transcription, and based on a bioinformatics approach, bZIPs can build up more than the double of protein interactions than WRKYs. In contrast, an enrichment of the WRKY DNA-binding motifs can be found in WRKY promoters, a phenomenon which is not observed for the bZIP family. Thus, the two transcription factor families follow two different functional strategies in which WRKYs regulate each other’s transcription in a transcriptional network whereas bZIP action relies on intensive heterodimerization.

  17. Cisplatin- and UV-damaged DNA lure the basal transcription factor TFIID/TBP.

    NARCIS (Netherlands)

    P. Vichi; F. Coin (Frédéric); J-P. Renaud (Jean-Paul); W. Vermeulen (Wim); J.H.J. Hoeijmakers (Jan); D. Moras; J-M. Egly (Jean-Marc)

    1997-01-01

    textabstractA connection between transcription and DNA repair was demonstrated previously through the characterization of TFIIH. Using filter binding as well as in vitro transcription challenge competition assays, we now show that the promoter recognition factor TATA box-binding protein (TBP)/TFIID

  18. Engineered zinc-finger transcription factors inhibit the replication and transcription of HBV in vitro and in vivo.

    Science.gov (United States)

    Luo, Wei; Wang, Junxia; Xu, Dengfeng; Bai, Huili; Zhang, Yangli; Zhang, Yuhong; Li, Xiaosong

    2018-04-01

    In the present study, an artificial zinc-finger transcription factor eukaryotic expression vector specifically recognizing and binding to the hepatitis B virus (HBV) enhancer (Enh) was constructed, which inhibited the replication and expression of HBV DNA. The HBV EnhI‑specific pcDNA3.1‑artificial transcription factor (ATF) vector was successfully constructed, and then transformed or injected into HepG2.2.15 cells and HBV transgenic mice, respectively. The results demonstrated that the HBV EnhI (1,070‑1,234 bp)‑specific ATF significantly inhibited the replication and transcription of HBV DNA in vivo and in vitro. The HBV EnhI‑specific ATF may be a meritorious component of progressive combination therapies for eliminating HBV DNA in infected patients. A radical cure for chronic HBV infection may become feasible by using this bioengineering technology.

  19. Diversity among POU transcription factors in chromatin recognition and cell fate reprogramming.

    Science.gov (United States)

    Malik, Vikas; Zimmer, Dennis; Jauch, Ralf

    2018-05-01

    The POU (Pit-Oct-Unc) protein family is an evolutionary ancient group of transcription factors (TFs) that bind specific DNA sequences to direct gene expression programs. The fundamental importance of POU TFs to orchestrate embryonic development and to direct cellular fate decisions is well established, but the molecular basis for this activity is insufficiently understood. POU TFs possess a bipartite 'two-in-one' DNA binding domain consisting of two independently folding structural units connected by a poorly conserved and flexible linker. Therefore, they represent a paradigmatic example to study the molecular basis for the functional versatility of TFs. Their modular architecture endows POU TFs with the capacity to accommodate alternative composite DNA sequences by adopting different quaternary structures. Moreover, associations with partner proteins crucially influence the selection of their DNA binding sites. The plentitude of DNA binding modes confers the ability to POU TFs to regulate distinct genes in the context of different cellular environments. Likewise, different binding modes of POU proteins to DNA could trigger alternative regulatory responses in the context of different genomic locations of the same cell. Prominent POU TFs such as Oct4, Brn2, Oct6 and Brn4 are not only essential regulators of development but have also been successfully employed to reprogram somatic cells to pluripotency and neural lineages. Here we review biochemical, structural, genomic and cellular reprogramming studies to examine how the ability of POU TFs to select regulatory DNA, alone or with partner factors, is tied to their capacity to epigenetically remodel chromatin and drive specific regulatory programs that give cells their identities.

  20. MADS interactomics : towards understanding the molecular mechanisms of plant MADS-domain transcription factor function

    NARCIS (Netherlands)

    Smaczniak, C.D.

    2013-01-01

    Protein-protein and protein-DNA interactions are essential for the molecular action of transcription factors. By combinatorial binding to target gene promoters, transcription factors are able to up- or down-regulate the expression of these genes. MADS-domain proteins comprise a large family of

  1. Functional analysis of limb transcriptional enhancers in the mouse.

    Science.gov (United States)

    Nolte, Mark J; Wang, Ying; Deng, Jian Min; Swinton, Paul G; Wei, Caimiao; Guindani, Michele; Schwartz, Robert J; Behringer, Richard R

    2014-01-01

    Transcriptional enhancers are genomic sequences bound by transcription factors that act together with basal transcriptional machinery to regulate gene transcription. Several high-throughput methods have generated large datasets of tissue-specific enhancer sequences with putative roles in developmental processes. However, few enhancers have been deleted from the genome to determine their roles in development. To understand the roles of two enhancers active in the mouse embryonic limb bud we deleted them from the genome. Although the genes regulated by these enhancers are unknown, they were selected because they were identified in a screen for putative limb bud-specific enhancers associated with p300, an acetyltransferase that participates in protein complexes that promote active transcription, and because the orthologous human enhancers (H1442 and H280) drive distinct lacZ expression patterns in limb buds of embryonic day (E) 11.5 transgenic mice. We show that the orthologous mouse sequences, M1442 and M280, regulate dynamic expression in the developing limb. Although significant transcriptional differences in enhancer-proximal genes in embryonic limb buds accompany the deletion of M1442 and M280 no gross limb malformations during embryonic development were observed, demonstrating that M1442 and M280 are not required for mouse limb development. However, M280 is required for the development and/or maintenance of body size; M280 mice are significantly smaller than controls. M280 also harbors an "ultraconserved" sequence that is identical between human, rat, and mouse. This is the first report of a phenotype resulting from the deletion of an ultraconserved element. These studies highlight the importance of determining enhancer regulatory function by experiments that manipulate them in situ and suggest that some of an enhancer's regulatory capacities may be developmentally tolerated rather than developmentally required. © 2014 Wiley Periodicals, Inc.

  2. Structure-dependent inhibition of the ETS-family transcription factor PU.1 by novel heterocyclic diamidines

    Science.gov (United States)

    Munde, Manoj; Wang, Shuo; Kumar, Arvind; Stephens, Chad E.; Farahat, Abdelbasset A.; Boykin, David W.; Wilson, W. David; Poon, Gregory M. K.

    2014-01-01

    ETS transcription factors mediate a wide array of cellular functions and are attractive targets for pharmacological control of gene regulation. We report the inhibition of the ETS-family member PU.1 with a panel of novel heterocyclic diamidines. These diamidines are derivatives of furamidine (DB75) in which the central furan has been replaced with selenophene and/or one or both of the bridging phenyl has been replaced with benzimidazole. Like all ETS proteins, PU.1 binds sequence specifically to 10-bp sites by inserting a recognition helix into the major groove of a 5′-GGAA-3′ consensus, accompanied by contacts with the flanking minor groove. We showed that diamidines target the minor groove of AT-rich sequences on one or both sides of the consensus and disrupt PU.1 binding. Although all of the diamidines bind to one or both of the expected sequences within the binding site, considerable heterogeneity exists in terms of stoichiometry, site–site interactions and induced DNA conformation. We also showed that these compounds accumulate in live cell nuclei and inhibit PU.1-dependent gene transactivation. This study demonstrates that heterocyclic diamidines are capable of inhibiting PU.1 by targeting the flanking sequences and supports future efforts to develop agents for inhibiting specific members of the ETS family. PMID:24157839

  3. Generalizing and learning protein-DNA binding sequence representations by an evolutionary algorithm

    KAUST Repository

    Wong, Ka Chun

    2011-02-05

    Protein-DNA bindings are essential activities. Understanding them forms the basis for further deciphering of biological and genetic systems. In particular, the protein-DNA bindings between transcription factors (TFs) and transcription factor binding sites (TFBSs) play a central role in gene transcription. Comprehensive TF-TFBS binding sequence pairs have been found in a recent study. However, they are in one-to-one mappings which cannot fully reflect the many-to-many mappings within the bindings. An evolutionary algorithm is proposed to learn generalized representations (many-to-many mappings) from the TF-TFBS binding sequence pairs (one-to-one mappings). The generalized pairs are shown to be more meaningful than the original TF-TFBS binding sequence pairs. Some representative examples have been analyzed in this study. In particular, it shows that the TF-TFBS binding sequence pairs are not presumably in one-to-one mappings. They can also exhibit many-to-many mappings. The proposed method can help us extract such many-to-many information from the one-to-one TF-TFBS binding sequence pairs found in the previous study, providing further knowledge in understanding the bindings between TFs and TFBSs. © 2011 Springer-Verlag.

  4. Generalizing and learning protein-DNA binding sequence representations by an evolutionary algorithm

    KAUST Repository

    Wong, Ka Chun; Peng, Chengbin; Wong, Manhon; Leung, Kwongsak

    2011-01-01

    Protein-DNA bindings are essential activities. Understanding them forms the basis for further deciphering of biological and genetic systems. In particular, the protein-DNA bindings between transcription factors (TFs) and transcription factor binding sites (TFBSs) play a central role in gene transcription. Comprehensive TF-TFBS binding sequence pairs have been found in a recent study. However, they are in one-to-one mappings which cannot fully reflect the many-to-many mappings within the bindings. An evolutionary algorithm is proposed to learn generalized representations (many-to-many mappings) from the TF-TFBS binding sequence pairs (one-to-one mappings). The generalized pairs are shown to be more meaningful than the original TF-TFBS binding sequence pairs. Some representative examples have been analyzed in this study. In particular, it shows that the TF-TFBS binding sequence pairs are not presumably in one-to-one mappings. They can also exhibit many-to-many mappings. The proposed method can help us extract such many-to-many information from the one-to-one TF-TFBS binding sequence pairs found in the previous study, providing further knowledge in understanding the bindings between TFs and TFBSs. © 2011 Springer-Verlag.

  5. Targeted genome regulation via synthetic programmable transcriptional regulators

    KAUST Repository

    Piatek, Agnieszka Anna

    2016-04-19

    Regulation of gene transcription controls cellular functions and coordinates responses to developmental, physiological and environmental cues. Precise and efficient molecular tools are needed to characterize the functions of single and multiple genes in linear and interacting pathways in a native context. Modular DNA-binding domains from zinc fingers (ZFs) and transcriptional activator-like proteins (TALE) are amenable to bioengineering to bind DNA target sequences of interest. As a result, ZF and TALE proteins were used to develop synthetic programmable transcription factors. However, these systems are limited by the requirement to re-engineer proteins for each new target sequence. The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR associated 9 (Cas9) genome editing tool was recently repurposed for targeted transcriptional regulation by inactivation of the nuclease activity of Cas9. Due to the facile engineering, simplicity, precision and amenability to library construction, the CRISPR/Cas9 system is poised to revolutionize the functional genomics field across diverse eukaryotic species. In this review, we discuss the development of synthetic customizable transcriptional regulators and provide insights into their current and potential applications, with special emphasis on plant systems, in characterization of gene functions, elucidation of molecular mechanisms and their biotechnological applications. © 2016 Informa UK Limited, trading as Taylor & Francis Group

  6. Molecular characterization of Quercus suber MYB1, a transcription factor up-regulated in cork tissues.

    Science.gov (United States)

    Almeida, Tânia; Menéndez, Esther; Capote, Tiago; Ribeiro, Teresa; Santos, Conceição; Gonçalves, Sónia

    2013-01-15

    The molecular processes associated with cork development in Quercus suber L. are poorly understood. A previous molecular approach identified a list of genes potentially important for cork formation and differentiation, providing a new basis for further molecular studies. This report is the first molecular characterization of one of these candidate genes, QsMYB1, coding for an R2R3-MYB transcription factor. The R2R3-MYB gene sub-family has been described as being involved in the phenylpropanoid and lignin pathways, both involved in cork biosynthesis. The results showed that the expression of QsMYB1 is putatively mediated by an alternative splicing (AS) mechanism that originates two different transcripts (QsMYB1.1 and QsMYB1.2), differing only in the 5'-untranslated region, due to retention of the first intron in one of the variants. Moreover, within the retained intron, a simple sequence repeat (SSR) was identified. The upstream regulatory region of QsMYB1 was extended by a genome walking approach, which allowed the identification of the putative gene promoter region. The relative expression pattern of QsMYB1 transcripts determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR) revealed that both transcripts were up-regulated in cork tissues; the detected expression was several times higher in newly formed cork harvested from trees producing virgin, second or reproduction cork when compared with wood. Moreover, the expression analysis of QsMYB1 in several Q. suber organs showed very low expression in young branches and roots, whereas in leaves, immature acorns or male flowers, no expression was detected. These preliminary results suggest that QsMYB1 may be related to secondary growth and, in particular, with the cork biosynthesis process with a possible alternative splicing mechanism associated with its regulatory function. Copyright © 2012 Elsevier GmbH. All rights reserved.

  7. A trans-acting Variant within the Transcription Factor RIM101 Interacts with Genetic Background to Determine its Regulatory Capacity.

    Directory of Open Access Journals (Sweden)

    Timothy Read

    2016-01-01

    Full Text Available Most genetic variants associated with disease occur within regulatory regions of the genome, underscoring the importance of defining the mechanisms underlying differences in regulation of gene expression between individuals. We discovered a pair of co-regulated, divergently oriented transcripts, AQY2 and ncFRE6, that are expressed in one strain of Saccharomyces cerevisiae, ∑1278b, but not in another, S288c. By combining classical genetics techniques with high-throughput sequencing, we identified a trans-acting single nucleotide polymorphism within the transcription factor RIM101 that causes the background-dependent expression of both transcripts. Subsequent RNA-seq experiments revealed that RIM101 regulates many more targets in S288c than in ∑1278b and that deletion of RIM101 in both backgrounds abrogates the majority of differential expression between the strains. Strikingly, only three transcripts undergo a significant change in expression after swapping RIM101 alleles between backgrounds, implying that the differences in the RIM101 allele lead to a remarkably focused transcriptional response. However, hundreds of RIM101-dependent targets undergo a subtle but consistent shift in expression in the S288c RIM101-swapped strain, but not its ∑1278b counterpart. We conclude that ∑1278b may harbor a variant(s that buffers against widespread transcriptional dysregulation upon introduction of a non-native RIM101 allele, emphasizing the importance of accounting for genetic background when assessing the impact of a regulatory variant.

  8. Mechanisms of transcriptional repression by histone lysine methylation

    DEFF Research Database (Denmark)

    Hublitz, Philip; Albert, Mareike; Peters, Antoine H F M

    2009-01-01

    . In this report, we review the recent literature to deduce mechanisms underlying Polycomb and H3K9 methylation mediated repression, and describe the functional interplay with activating H3K4 methylation. We summarize recent data that indicate a close relationship between GC density of promoter sequences......, transcription factor binding and the antagonizing activities of distinct epigenetic regulators such as histone methyltransferases (HMTs) and histone demethylases (HDMs). Subsequently, we compare chromatin signatures associated with different types of transcriptional outcomes from stable repression to highly...

  9. NAC Transcription Factors of Barley (Hordeum vulgare L.) and their Involvement in Leaf Senescence

    DEFF Research Database (Denmark)

    Wagner, Michael

    parts of the senescence process. The specific aims of this study were therefore (1) to establish and characterise the NAC transcription factors of the model cereal crop barley (Hordeum vulgare L.) (2) to identify and study putative barley NAC transcription factors involved in the regulation of leaf...

  10. An apple MYB transcription factor, MdMYB3, is involved in regulation of anthocyanin biosynthesis and flower development.

    Science.gov (United States)

    Vimolmangkang, Sornkanok; Han, Yuepeng; Wei, Guochao; Korban, Schuyler S

    2013-11-07

    Red coloration of fruit is an important trait in apple, and it is mainly attributed to the accumulation of anthocyanins, a class of plant flavonoid metabolites. Anthocyanin biosynthesis is genetically determined by structural and regulatory genes. Plant tissue pigmentation patterns are mainly controlled by expression profiles of regulatory genes. Among these regulatory genes are MYB transcription factors (TFs), wherein the class of two-repeats (R2R3) is deemed the largest, and these are associated with the anthocyanin biosynthesis pathway. Although three MdMYB genes, almost identical in nucleotide sequences, have been identified in apple, it is likely that there are other R2R3 MYB TFs that are present in the apple genome that are also involved in the regulation of coloration of red color pigmentation of the skin of apple fruits. In this study, a novel R2R3 MYB gene has been isolated and characterized in apple. This MYB gene is closely related to the Arabidopsis thaliana AtMYB3, and has been designated as MdMYB3. This TF belongs to the subgroup 4 R2R3 family of plant MYB transcription factors. This apple MdMYB3 gene is mapped onto linkage group 15 of the integrated apple genetic map. Transcripts of MdMYB3 are detected in all analyzed tissues including leaves, flowers, and fruits. However, transcripts of MdMYB3 are higher in excocarp of red-skinned apple cultivars than that in yellowish-green skinned apple cultivars. When this gene is ectopically expressed in Nicotiana tabacum cv. Petite Havana SR1, flowers of transgenic tobacco lines carrying MdMYB3 have exhibited increased pigmentation and accumulate higher levels of anthocyanins and flavonols than wild-type flowers. Overexpression of MdMYB3 has resulted in transcriptional activation of several flavonoid pathway genes, including CHS, CHI, UFGT, and FLS. Moreover, peduncles of flowers and styles of pistils of transgenic plants overexpressing MdMYB3 are longer than those of wild-type plants, thus suggesting that this

  11. Genetic Variants in Transcription Factors Are Associated With the Pharmacokinetics and Pharmacodynamics of Metformin

    Science.gov (United States)

    Goswami, S; Yee, SW; Stocker, S; Mosley, JD; Kubo, M; Castro, R; Mefford, JA; Wen, C; Liang, X; Witte, J; Brett, C; Maeda, S; Simpson, MD; Hedderson, MM; Davis, RL; Roden, DM; Giacomini, KM; Savic, RM

    2014-01-01

    One-third of type 2 diabetes patients do not respond to metformin. Genetic variants in metformin transporters have been extensively studied as a likely contributor to this high failure rate. Here, we investigate, for the first time, the effect of genetic variants in transcription factors on metformin pharmacokinetics (PK) and response. Overall, 546 patients and healthy volunteers contributed their genome-wide, pharmacokinetic (235 subjects), and HbA1c data (440 patients) for this analysis. Five variants in specificity protein 1 (SP1), a transcription factor that modulates the expression of metformin transporters, were associated with changes in treatment HbA1c (P < 0.01) and metformin secretory clearance (P < 0.05). Population pharmacokinetic modeling further confirmed a 24% reduction in apparent clearance in homozygous carriers of one such variant, rs784888. Genetic variants in other transcription factors, peroxisome proliferator–activated receptor-α and hepatocyte nuclear factor 4-α, were significantly associated with HbA1c change only. Overall, our study highlights the importance of genetic variants in transcription factors as modulators of metformin PK and response. PMID:24853734

  12. Pluripotency transcription factors and Tet1/2 maintain Brd4-independent stem cell identity.

    Science.gov (United States)

    Finley, Lydia W S; Vardhana, Santosha A; Carey, Bryce W; Alonso-Curbelo, Direna; Koche, Richard; Chen, Yanyang; Wen, Duancheng; King, Bryan; Radler, Megan R; Rafii, Shahin; Lowe, Scott W; Allis, C David; Thompson, Craig B

    2018-05-01

    A robust network of transcription factors and an open chromatin landscape are hallmarks of the naive pluripotent state. Recently, the acetyllysine reader Brd4 has been implicated in stem cell maintenance, but the relative contribution of Brd4 to pluripotency remains unclear. Here, we show that Brd4 is dispensable for self-renewal and pluripotency of embryonic stem cells (ESCs). When maintained in their ground state, ESCs retain transcription factor binding and chromatin accessibility independent of Brd4 function or expression. In metastable ESCs, Brd4 independence can be achieved by increased expression of pluripotency transcription factors, including STAT3, Nanog or Klf4, so long as the DNA methylcytosine oxidases Tet1 and Tet2 are present. These data reveal that Brd4 is not essential for ESC self-renewal. Rather, the levels of pluripotency transcription factor abundance and Tet1/2 function determine the extent to which bromodomain recognition of protein acetylation contributes to the maintenance of gene expression and cell identity.

  13. Function of the PHA-4/FOXA transcription factor during C. elegans post-embryonic development

    Directory of Open Access Journals (Sweden)

    Chen Di

    2008-02-01

    Full Text Available Abstract Background pha-4 encodes a forkhead box (FOX A transcription factor serving as the C. elegans pharynx organ identity factor during embryogenesis. Using Serial Analysis of Gene Expression (SAGE, comparison of gene expression profiles between growing stages animals and long-lived, developmentally diapaused dauer larvae revealed that pha-4 transcription is increased in the dauer stage. Results Knocking down pha-4 expression by RNAi during post-embryonic development showed that PHA-4 is essential for dauer recovery, gonad and vulva development. daf-16, which encodes a FOXO transcription factor regulated by insulin/IGF-1 signaling, shows overlapping expression patterns and a loss-of-function post-embryonic phenotype similar to that of pha-4 during dauer recovery. pha-4 RNAi and daf-16 mutations have additive effects on dauer recovery, suggesting these two regulators may function in parallel pathways. Gene expression studies using RT-PCR and GFP reporters showed that pha-4 transcription is elevated under starvation, and a conserved forkhead transcription factor binding site in the second intron of pha-4 is important for the neuronal expression. The vulval transcription of lag-2, which encodes a ligand for the LIN-12/Notch lateral signaling pathway, is inhibited by pha-4 RNAi, indicating that LAG-2 functions downstream of PHA-4 in vulva development. Conclusion Analysis of PHA-4 during post-embryonic development revealed previously unsuspected functions for this important transcriptional regulator in dauer recovery, and may help explain the network of transcriptional control integrating organogenesis with the decision between growth and developmental arrest at the dauer entry and exit stages.

  14. Molecular architecture of transcription factor hotspots in early adipogenesis

    DEFF Research Database (Denmark)

    Siersbæk, Rasmus; Baek, Songjoon; Rabiee, Atefeh

    2014-01-01

    motif on chromatin, and we suggest that this may be a general mechanism for integrating external signals on chromatin. Furthermore, we find evidence of extensive recruitment of transcription factors to hotspots through alternative mechanisms not involving their known motifs and demonstrate...

  15. A transcription factor for cold sensation!

    Directory of Open Access Journals (Sweden)

    Milbrandt Jeffrey

    2005-03-01

    Full Text Available Abstract The ability to feel hot and cold is critical for animals and human beings to survive in the natural environment. Unlike other sensations, the physiology of cold sensation is mostly unknown. In the present study, we use genetically modified mice that do not express nerve growth factor-inducible B (NGFIB to investigate the possible role of NGFIB in cold sensation. We found that genetic deletion of NGFIB selectively affected behavioral responses to cold stimuli while behavioral responses to noxious heat or mechanical stimuli were normal. Furthermore, behavioral responses remained reduced or blocked in NGFIB knockout mice even after repetitive application of cold stimuli. Our results provide strong evidence that the first transcription factor NGFIB determines the ability of animals to respond to cold stimulation.

  16. A regulating element essential for PDGFRA transcription is recognized by neural tube defect-associated PRX homeobox transcription factors

    NARCIS (Netherlands)

    Joosten, Paul H. L. J.; Toepoel, Mascha; van Oosterhout, Dirk; Afink, Gijs B.; van Zoelen, Everardus J. J.

    2002-01-01

    We have previously shown that deregulated expression of the platelet-derived growth factor alpha-receptor (PDGFRA) can be associated with neural tube defects (NTDs) in both men and mice. In the present study, we have investigated the transcription factors that control the up-regulation of PDGFRA

  17. The Hv NAC6 transcription factor: a positive regulator of penetration resistance in barley and Arabidopsis

    DEFF Research Database (Denmark)

    Jensen, Michael Krogh; Rung, Jesper Henrik; Gregersen, Per Langkjaer

    2007-01-01

    Pathogens induce the expression of many genes encoding plant transcription factors, though specific knowledge of the biological function of individual transcription factors remains scarce. NAC transcription factors are encoded in plants by a gene family with proposed functions in both abiotic...... and biotic stress adaptation, as well as in developmental processes. In this paper, we provide convincing evidence that a barley NAC transcription factor has a direct role in regulating basal defence. The gene transcript was isolated by differential display from barley leaves infected with the biotrophic...... powdery mildew fungus, Blumeria graminis f.sp. hordei (Bgh). The full-length cDNA clone was obtained using 5'-RACE and termed HvNAC6, due to its high similarity to the rice homologue, OsNAC6. Gene silencing of HvNAC6 during Bgh inoculation compromises penetration resistance in barley epidermal cells...

  18. Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

    Science.gov (United States)

    Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

    2017-02-09

    In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

  19. “Jump Start and Gain” Model for Dosage Compensation in Drosophila Based on Direct Sequencing of Nascent Transcripts

    Directory of Open Access Journals (Sweden)

    Francesco Ferrari

    2013-11-01

    Full Text Available Dosage compensation in Drosophila is mediated by the MSL complex, which increases male X-linked gene expression approximately 2-fold. The MSL complex preferentially binds the bodies of active genes on the male X, depositing H4K16ac with a 3′ bias. Two models have been proposed for the influence of the MSL complex on transcription: one based on promoter recruitment of RNA polymerase II (Pol II, and a second featuring enhanced transcriptional elongation. Here, we utilize nascent RNA sequencing to document dosage compensation during transcriptional elongation. We also compare X and autosomes from published data on paused and elongating polymerase in order to assess the role of Pol II recruitment. Our results support a model for differentially regulated elongation, starting with release from 5′ pausing and increasing through X-linked gene bodies. Our results highlight facilitated transcriptional elongation as a key mechanism for the coordinated regulation of a diverse set of genes.

  20. ERK-dependent phosphorylation of the transcription initiation factor TIF-IA is required for RNA polymerase I transcription and cell growth

    DEFF Research Database (Denmark)

    Zhao, Jian; Yuan, Xuejun; Frödin, Morten

    2003-01-01

    -specific transcription initiation factor TIF-IA. Activation of TIF-IA and ribosomal gene transcription is sensitive to PD98059, indicating that TIF-IA is targeted by MAPK in vivo. Phosphopeptide mapping and mutational analysis reveals two serine residues (S633 and S649) that are phosphorylated by ERK and RSK kinases....... Replacement of S649 by alanine inactivates TIF-IA, inhibits pre-rRNA synthesis, and retards cell growth. The results provide a link between growth factor signaling, ribosome production, and cell growth, and may have a major impact on the mechanism of cell transformation....

  1. Modelling reveals kinetic advantages of co-transcriptional splicing.

    Directory of Open Access Journals (Sweden)

    Stuart Aitken

    2011-10-01

    Full Text Available Messenger RNA splicing is an essential and complex process for the removal of intron sequences. Whereas the composition of the splicing machinery is mostly known, the kinetics of splicing, the catalytic activity of splicing factors and the interdependency of transcription, splicing and mRNA 3' end formation are less well understood. We propose a stochastic model of splicing kinetics that explains data obtained from high-resolution kinetic analyses of transcription, splicing and 3' end formation during induction of an intron-containing reporter gene in budding yeast. Modelling reveals co-transcriptional splicing to be the most probable and most efficient splicing pathway for the reporter transcripts, due in part to a positive feedback mechanism for co-transcriptional second step splicing. Model comparison is used to assess the alternative representations of reactions. Modelling also indicates the functional coupling of transcription and splicing, because both the rate of initiation of transcription and the probability that step one of splicing occurs co-transcriptionally are reduced, when the second step of splicing is abolished in a mutant reporter.

  2. Modelling reveals kinetic advantages of co-transcriptional splicing.

    Science.gov (United States)

    Aitken, Stuart; Alexander, Ross D; Beggs, Jean D

    2011-10-01

    Messenger RNA splicing is an essential and complex process for the removal of intron sequences. Whereas the composition of the splicing machinery is mostly known, the kinetics of splicing, the catalytic activity of splicing factors and the interdependency of transcription, splicing and mRNA 3' end formation are less well understood. We propose a stochastic model of splicing kinetics that explains data obtained from high-resolution kinetic analyses of transcription, splicing and 3' end formation during induction of an intron-containing reporter gene in budding yeast. Modelling reveals co-transcriptional splicing to be the most probable and most efficient splicing pathway for the reporter transcripts, due in part to a positive feedback mechanism for co-