WorldWideScience

Sample records for transcriptase-pcr diagnostic tests

  1. Calibrated user-friendly reverse transcriptase-PCR assay

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Rammer, P

    1998-01-01

    We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...

  2. Development of a pan-Simbu real-time reverse transcriptase PCR for the detection of Simbu serogroup viruses and comparison with SBV diagnostic PCR systems.

    Science.gov (United States)

    Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd

    2013-11-05

    Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable

  3. Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR

    OpenAIRE

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2014-01-01

    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

  4. Review: Diagnostic accuracy of PCR-based detection tests for Helicobacter Pylori in stool samples.

    Science.gov (United States)

    Khadangi, Fatemeh; Yassi, Maryam; Kerachian, Mohammad Amin

    2017-12-01

    Although different methods have been established to detect Helicobacter pylori (H. pylori) infection, identifying infected patients is an ongoing challenge. The aim of this meta-analysis was to provide pooled diagnostic accuracy measures for stool PCR test in the diagnosis of H. pylori infection. In this study, a systematic review and meta-analysis were carried out on various sources, including MEDLINE, Web of Sciences, and the Cochrane Library from April 1, 1999, to May 1, 2016. This meta-analysis adheres to the guidelines provided by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses report (PRISMA Statement). The clinical value of DNA stool PCR test was based on the pooled false positive, false negative, true positive, and true negative of different genes. Twenty-six of 328 studies identified met the eligibility criteria. Stool PCR test had a performance of 71% (95% CI: 68-73) sensitivity, 96% (95% CI: 94-97) specificity, and 65.6 (95% CI: 30.2-142.5) diagnostic odds ratio (DOR) in diagnosis of H. pylori. The DOR of genes which showed the highest performance of stool PCR tests was as follows: 23S rRNA 152.5 (95% CI: 55.5-418.9), 16S rRNA 67.9 (95%CI: 6.4-714.3), and glmM 68.1 (95%CI: 20.1-231.7). The sensitivity and specificity of stool PCR test are relatively in the same spectrum of other diagnostic methods for the detection of H. pylori infection. In descending order of significance, the most diagnostic candidate genes using PCR detection were 23S rRNA, 16S rRNA, and glmM. PCR for 23S rRNA gene which has the highest performance could be applicable to detect H. pylori infection. © 2017 John Wiley & Sons Ltd.

  5. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  6. Utility of dengue NS1 antigen rapid diagnostic test for use in difficult to reach areas and its comparison with dengue NS1 ELISA and qRT-PCR.

    Science.gov (United States)

    Shukla, Mohan K; Singh, Neeru; Sharma, Ravendra K; Barde, Pradip V

    2017-07-01

    The objective of this study was to demonstrate the utility of dengue virus (DENV) non structural protein 1 (NS1) based rapid diagnostic test (RDT) for use in tribal and difficult to reach areas for early dengue (DEN) diagnosis in acute phase patients and evaluate its sensitivity and specificity against DENV NS1 enzyme linked immune sorbent assay (ELISA) and real time reverse transcriptase polymerase chain reaction (qRT-PCR). The DENV NS1 RDT was used for preliminary diagnosis during outbreaks in difficult to reach rural and tribal areas. The diagnosis was confirmed by DENV NS1 ELISA in the laboratory. The samples were also tested and serotyped by qRT-PCR. The results were evaluated using statistical tests. The DENV NS1 RDT showed 99.2% sensitivity and 96.0% specificity when analyzed using DENV NS1 ELISA as standard. The specificity and sensitivity of the RDT when compared with qRT-PCR was 93.6% and 91.1%, respectively. The serotype specific evaluation showed more than 90% sensitivity and specificity for DENV-1, 2, and 3. The RDT proved a good diagnostic tool in difficult to reach rural and tribal areas. Further evaluation studies with different commercially available RDTs in different field conditions are essential, that will help clinicians and patients for treatment and programme managers for timely intervention. © 2017 Wiley Periodicals, Inc.

  7. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

    Science.gov (United States)

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  8. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

    Science.gov (United States)

    Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

    2005-01-01

    Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

  9. Molecular diagnostic PCR handbook

    International Nuclear Information System (INIS)

    Viljoen, G.J.; Crowther, J.R.; Nel, L.H.

    2005-01-01

    The uses of nucleic acid-directed methods have increased significantly in the past five years and have made important contributions to disease control country programmes for improving national and international trade. These developments include the more routine use of PCR as a diagnostic tool in veterinary diagnostic laboratories. However, there are many problems associated with the transfer and particularly, the application of this technology. These include lack of consideration of: the establishment of quality-assured procedures, the required set-up of the laboratory and the proper training of staff. This can lead to a situation where results are not assured. This book gives a comprehensive account of the practical aspects of PCR and strong consideration is given to ensure its optimal use in a laboratory environment. This includes the setting-up of a PCR laboratory; Good Laboratory Practice and standardised PCR protocols to detect animal disease pathogens. Examples of Standard Operating Procedures as used in individual specialist laboratories and an outline of training materials necessary for PCR technology transfer are presented. The difficulties, advantages and disadvantages in PCR applications are explained and placed in context with other test systems. Emphasis is placed on the use of PCR for detection of pathogens, with a particular focus on diagnosticians and scientists from the developing world. It is hoped that this book will enable readers from various disciplines and levels of expertise to better judge the merits of PCR and to increase their skills and knowledge in order to assist in a more logical, efficient and assured use of this technology

  10. Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

    Science.gov (United States)

    Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

    2016-04-01

    Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

  11. Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

    Directory of Open Access Journals (Sweden)

    Tandale Babasaheb V

    2008-12-01

    Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

  12. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....

  13. Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR.

    Science.gov (United States)

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2014-06-01

    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  15. PCR-based verification of positive rapid diagnostic tests for intestinal protozoa infections with variable test band intensity.

    Science.gov (United States)

    Becker, Sören L; Müller, Ivan; Mertens, Pascal; Herrmann, Mathias; Zondie, Leyli; Beyleveld, Lindsey; Gerber, Markus; du Randt, Rosa; Pühse, Uwe; Walter, Cheryl; Utzinger, Jürg

    2017-10-01

    Stool-based rapid diagnostic tests (RDTs) for pathogenic intestinal protozoa (e.g. Cryptosporidium spp. and Giardia intestinalis) allow for prompt diagnosis and treatment in resource-constrained settings. Such RDTs can improve individual patient management and facilitate population-based screening programmes in areas without microbiological laboratories for confirmatory testing. However, RDTs are difficult to interpret in case of 'trace' results with faint test band intensities and little is known about whether such ambiguous results might indicate 'true' infections. In a longitudinal study conducted in poor neighbourhoods of Port Elizabeth, South Africa, a total of 1428 stool samples from two cohorts of schoolchildren were examined on the spot for Cryptosporidium spp. and G. intestinalis using an RDT (Crypto/Giardia DuoStrip; Coris BioConcept). Overall, 121 samples were positive for G. intestinalis and the RDT suggested presence of cryptosporidiosis in 22 samples. After a storage period of 9-10 months in cohort 1 and 2-3 months in cohort 2, samples were subjected to multiplex PCR (BD Max™ Enteric Parasite Panel, Becton Dickinson). Ninety-three percent (112/121) of RDT-positive samples for G. intestinalis were confirmed by PCR, with a correlation between RDT test band intensity and quantitative pathogen load present in the sample. For Cryptosporidium spp., all positive RDTs had faintly visible lines and these were negative on PCR. The performance of the BD Max™ PCR was nearly identical in both cohorts, despite the prolonged storage at disrupted cold chain conditions in cohort 1. The Crypto/Giardia DuoStrip warrants further validation in communities with a high incidence of diarrhoea. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Reverse-Transcriptase PCR Detection of Leptospira: Absence of Agreement with Single-Specimen Microscopic Agglutination Testing.

    Science.gov (United States)

    Waggoner, Jesse J; Balassiano, Ilana; Mohamed-Hadley, Alisha; Vital-Brazil, Juliana Magalhães; Sahoo, Malaya K; Pinsky, Benjamin A

    2015-01-01

    Reference diagnostic tests for leptospirosis include nucleic acid amplification tests, bacterial culture, and microscopic agglutination testing (MAT) of acute and convalescent serum. However, clinical laboratories often do not receive paired specimens. In the current study, we tested serum samples using a highly sensitive real-time nucleic acid amplification test for Leptospira and compared results to MAT performed on the same specimens. 478 serum samples from suspected leptospirosis cases in Rio de Janeiro were tested using a real-time RT-PCR for the diagnosis of leptospirosis, malaria and dengue (the Lepto-MD assay). The Lepto-MD assay detects all species of Leptospira (saprophytic, intermediate, and pathogenic), and in the current study, we demonstrate that this assay amplifies both Leptospira RNA and DNA. Dengue virus RNA was identified in 10 patients, and no cases of malaria were detected. A total of 65 samples (13.6%) were positive for Leptospira: 35 samples (7.3%) in the Lepto-MD assay, 33 samples (6.9%) by MAT, and 3 samples tested positive by both (kappa statistic 0.02). Poor agreement between methods was consistent regardless of the titer used to define positive MAT results or the day of disease at sample collection. Leptospira nucleic acids were detected in the Lepto-MD assay as late as day 22, and cycle threshold values did not differ based on the day of disease. When Lepto-MD assay results were added to the MAT results for all patients in 2008 (n=818), the number of detected leptospirosis cases increased by 30.4%, from 102 (12.5%) to 133 (16.3%). This study demonstrates a lack of agreement between nucleic acid detection of Leptospira and single-specimen MAT, which may result from the clearance of bacteremia coinciding with the appearance of agglutinating antibodies. A combined testing strategy for acute leptospirosis, including molecular and serologic testing, appears necessary to maximize case detection.

  17. Comparison of agar gel immunodiffusion test, enzyme-linked immunosorbent assay and PCR in diagnostics of enzootic bovine leukosis

    Directory of Open Access Journals (Sweden)

    Malovrh Tadej

    2005-01-01

    Full Text Available Bovine leukaemia virus (BLV is a retrovirus that induces a chronic infection in cattle. Once infected, cattle remain virus carriers for life and start to show an antibody response within a few weeks after infection. Eradication and control of the disease are based on early diagnostics and segregation of the carriers. The choice of a diagnostic method depends on the eradication programme, money resources and characteristics of the herd to be analysed. The agar gel immunodiffusion (AGID test has been the serological test of choice for routine diagnosis of serum samples. Nevertheless, in more recent years, the enzyme-linked immunosorbent assay (ELISA has replaced the AGID for large scale testing. For this purpose, commercially available BLV-ELISA kits were compared to the AGID and to the polymerase chain reaction (PCR method performed with two sets of primers, amplifying env region. The ELISA kit based on the p24 core protein was found to be less specific and served as a screening test. The ELISA kit based on the envelope glycoprotein (gpSI served as a verification test and gave a good correlation with the AGID test and PCR method. However, ELISA showed a higher sensitivity than AGID. The p24 based ELiSA was useful for screening a large number of samples, whereas gp51 based ELISA, AGID and PCR were more important for detecting the antibody response against the individual BLV-proteins and therefore for verification of the infection with BLV.

  18. Accurate, Fast and Cost-Effective Diagnostic Test for Monosomy 1p36 Using Real-Time Quantitative PCR

    Directory of Open Access Journals (Sweden)

    Pricila da Silva Cunha

    2014-01-01

    Full Text Available Monosomy 1p36 is considered the most common subtelomeric deletion syndrome in humans and it accounts for 0.5–0.7% of all the cases of idiopathic intellectual disability. The molecular diagnosis is often made by microarray-based comparative genomic hybridization (aCGH, which has the drawback of being a high-cost technique. However, patients with classic monosomy 1p36 share some typical clinical characteristics that, together with its common prevalence, justify the development of a less expensive, targeted diagnostic method. In this study, we developed a simple, rapid, and inexpensive real-time quantitative PCR (qPCR assay for targeted diagnosis of monosomy 1p36, easily accessible for low-budget laboratories in developing countries. For this, we have chosen two target genes which are deleted in the majority of patients with monosomy 1p36: PRKCZ and SKI. In total, 39 patients previously diagnosed with monosomy 1p36 by aCGH, fluorescent in situ hybridization (FISH, and/or multiplex ligation-dependent probe amplification (MLPA all tested positive on our qPCR assay. By simultaneously using these two genes we have been able to detect 1p36 deletions with 100% sensitivity and 100% specificity. We conclude that qPCR of PRKCZ and SKI is a fast and accurate diagnostic test for monosomy 1p36, costing less than 10 US dollars in reagent costs.

  19. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  20. Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

    Science.gov (United States)

    Spackman, Erica; Suarez, David L

    2005-01-01

    Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

  1. Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments.

    Science.gov (United States)

    Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen

    2011-02-01

    Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

  2. Forensic pregnancy diagnostics with placental mRNA markers

    NARCIS (Netherlands)

    J. Gauvin (Jeanot); D. Zubakov (Dmitry); J. van Rhee-Binkhorst (Joke); A. Kloosterman (Ate); E.A.P. Steegers (Eric); M.H. Kayser (Manfred)

    2010-01-01

    textabstractCurrent methods for pregnancy diagnostics are based on immunodetection of pregnancy-specific proteins and in a forensic context suffer from sensitivity and specificity issues. Here, we applied reverse transcriptase polymerase chain reaction (RT-PCR) technology to 11 genes previously

  3. Diagnostic value of nested-PCR for identification of Malassezia species in dandruff

    Science.gov (United States)

    Jusuf, N. K.; Nasution, T. A.; Ullyana, S.

    2018-03-01

    Dandruff or pityriasis simplex is a condition of abnormal occurrence of formation of yellowish white scales from the scalp. Many factors play a role in the pathogenesis of dandruff, i.e.colonization of Malassezia species. Examination of Malassezia species previously done by culture as the gold standard. However, there are various difficulties in doing the culture. Identification method with anested-polymerase chain reaction (nested-PCR) is expected to provide quickly and easily detected. This study aimedto determine the diagnostic value of nested-PCR in the identification of Malassezia species in dandruff. From 21 subjects, scales from the scalp were taken and sent to the laboratory for nested-PCR identification. Statistical analysis of diagnostic test carried out to determine sensitivity, specificity, positive predictive value, and negative predictive value. The results showed nested-PCR detected 10 sample (47.6%) positive for Malassezia species consist of M. sympodialis (23.8%); M. slooffiae (9.5%); M. furfur (4.8%); M. globosa and M. furfur (4.8%); and M. restricta and M. sympodialis (4.8%). Detection of Malassezia species by nested-PCR has 100% in sensitivity whereas the specificity was 55%. Nested-PCR test has high sensitivity. Therefore nested-PCR may be considered for a faster and simpler alternative examination in identification for Malassezia species in dandruff.

  4. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  5. A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic

    Science.gov (United States)

    Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.

    2007-01-01

    Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.

  6. Prognostic role of a multigene reverse transcriptase-PCR assay in patients with node-negative breast cancer not receiving adjuvant systemic therapy.

    Science.gov (United States)

    Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N

    2005-05-01

    To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.

  7. Standardization of diagnostic PCR for the detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Malorny, B.; Tassios, P.T.; Radstrom, P.

    2003-01-01

    In vitro amplification of nucleic acids using the polymerase chain reaction (PCR) has become, since its discovery in the 1980s, a powerful diagnostic tool for the analysis of microbial infections as well as for the analysis of microorganisms in food samples. However, despite its potential, PCR has...... neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...

  8. Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

    Science.gov (United States)

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

    2004-01-01

    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

  9. Diagnostic PCR tests for Microsporum audouinii, M. canis and Trichophyton infections

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, Anna; Swierkowska, Aleksandra; Lindhardt Saunte, Ditte Marie

    2010-01-01

    ; 25 routine specimens from patients suspected of having dermatophytosis; 10 hair specimens from guinea pigs experimentally infected with M. canis; and two samples from un-infected control animals. DNA was prepared by a 10-min procedure from pure cultures as previously described. The 302 bp PCR product....... Finally, the Microsporum PCR was positive for 10/10 guinea pig specimens from infected animals but for 0/2 of the control animal samples. The evaluation of the two PCR tests indicated excellent sensitivity and specificity....

  10. Performance of rapid diagnostic test, blood-film microscopy and PCR for the diagnosis of malaria infection among febrile children from Korogwe District, Tanzania

    DEFF Research Database (Denmark)

    Mahende, Coline; Ngasala, Billy; Lusingu, John

    2016-01-01

    with fever and/or history of fever in the previous 48 h attending outpatient clinics. Blood samples were collected for identification of Plasmodium falciparum infection using histidine-rich-protein-2 (HRP-2)-based malaria RDT, light microscopy and conventional PCR. Results: A total of 867 febrile patients......Background: Rapid diagnostic tests (RDT) and light microscopy are still recommended for diagnosis to guide the clinical management of malaria despite difficult challenges in rural settings. The performance of these tests may be affected by several factors, including malaria prevalence and intensity...... of transmission. The study evaluated the diagnostic performance of malaria RDT, light microscopy and polymerase chain reaction (PCR) in detecting malaria infections among febrile children at outpatient clinic in Korogwe District, northeastern Tanzania. Methods: The study enrolled children aged 2-59 months...

  11. Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method

    DEFF Research Database (Denmark)

    Malorny, B.; Hoorfar, Jeffrey; Hugas, M.

    2003-01-01

    A collaborative study involving four European laboratories was conducted to investigate the diagnostic accuracy of a Salmonella specific PCR-based method, which was evaluated within the European FOOD-PCR project (http://www.pcr.dk). Each laboratory analysed by the PCR a set of independent obtained...... presumably naturally contaminated samples and compared the results with the microbiological culture method. The PCR-based method comprised a preenrichment step in buffered peptone water followed by a thermal cell lysis using a closed tube resin-based method. Artificially contaminated minced beef and whole......-based diagnostic methods and is currently proposed as international standard document....

  12. A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method

    OpenAIRE

    Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao

    2015-01-01

    Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

  13. Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity

    Science.gov (United States)

    House, M.L.; Kim, C.H.; Reno, P.W.

    1998-01-01

    Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.

  14. Pneumocystis PCR: It Is Time to Make PCR the Test of Choice.

    Science.gov (United States)

    Doyle, Laura; Vogel, Sherilynn; Procop, Gary W

    2017-01-01

    The testing strategy for Pneumocystis at the Cleveland Clinic changed from toluidine blue staining to polymerase chain reaction (PCR). We studied the differences in positivity rates for these assays and compared each with the detection of Pneumocystis in companion specimens by cytology and surgical pathology. We reviewed the results of all Pneumocystis test orders 1 year before and 1 year after the implementation of a Pneumocystis -specific PCR. We also reviewed the corresponding cytology and surgical pathology results, if performed. Finally, we reviewed the medical records of patients with rare Pneumocystis detected by PCR in an effort to differentiate colonization vs true disease. Toluidine blue staining and surgical pathology had similar sensitivities and negative predictive values, both of which were superior to cytology. There was a >4-fold increase in the annual detection of Pneumocystis by PCR compared with toluidine blue staining (toluidine blue staining: 11/1583 [0.69%] vs PCR: 44/1457 [3.0%]; chi-square P < .001). PCR detected 1 more case than surgical pathology and was far more sensitive than cytology. Chart review demonstrated that the vast majority of patients with rare Pneumocystis detected were immunosuppressed, had radiologic findings supportive of this infection, had no other pathogens detected, and were treated for pneumocystosis by the clinical team. PCR was the most sensitive method for the detection of Pneumocystis and should be considered the diagnostic test of choice. Correlation with clinical and radiologic findings affords discrimination of early true disease from the far rarer instances of colonization.

  15. Effect of specific or random c-DNA priming on sensitivity of tyrosinase nested RT-PCR : Potential clinical relevance

    NARCIS (Netherlands)

    Calogero, A; Hospers, GAP; Timmer-Bosscha, H; Mulder, NH; Schraffordt Koops, H.

    2000-01-01

    The reverse transcriptase polymerase chain reaction (RT-PCR) can be of clinical relevance in identifying malignant melanoma cells in blood or tissues of patients at risk for disseminated melanoma. The diagnostic value of this marker however, is still controversial. The objective of this study was to

  16. New PCR diagnostic systems for the detection and quantification of porcine cytomegalovirus (PCMV).

    Science.gov (United States)

    Morozov, Vladimir A; Morozov, Alexey V; Denner, Joachim

    2016-05-01

    Pigs are frequently infected with porcine cytomegalovirus (PCMV). Infected adult animals may not present with symptoms of disease, and the virus remains latent. However, the virus may be transmitted to human recipients receiving pig transplants. Recently, it was shown that pig-to-non-human-primate xenotransplantations showed 2 to 3 times lower transplant survival when the donor pig was infected with PCMV. Therefore, highly sensitive methods are required to select virus-free pigs and to examine xenotransplants. Seven previously established PCR detection systems targeting the DNA polymerase gene of PCMV were examined by comparison of thermodynamic parameters of oligonucleotides, and new diagnostic nested PCR and real-time PCR systems with improved parameters and high sensitivity were established. The detection limit of conventional PCR was estimated to be 15 copies, and that of the nested PCR was 5 copies. The sensitivity of the real-time PCR with a TaqMan probe was two copies. An equal efficiency of the newly established detection systems was shown by parallel testing of DNA from sera and blood of six pigs, identifying the same animals as PCMV infected. These new diagnostic PCR systems will improve the detection of PCMV and therefore increase the safety of porcine xenotransplants.

  17. The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2014-03-01

    Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

  18. Performance Evaluation of Commercial Dengue Diagnostic Tests for Early Detection of Dengue in Clinical Samples

    Directory of Open Access Journals (Sweden)

    Tuan Nur Akmalina Mat Jusoh

    2017-01-01

    Full Text Available The shattering rise in dengue virus infections globally has created a need for an accurate and validated rapid diagnostic test for this virus. Rapid diagnostic test (RDT and reverse transcription-polymerase chain reaction (RT-PCR diagnostic detection are useful tools for diagnosis of early dengue infection. We prospectively evaluated the diagnostic performance of nonstructural 1 (NS1 RDT and real-time RT-PCR diagnostic kits in 86 patient serum samples. Thirty-six samples were positive for dengue NS1 antigen while the remaining 50 were negative when tested with enzyme-linked immunosorbent assay (ELISA. Commercially available RDTs for NS1 detection, RTK ProDetect™, and SD Bioline showed high sensitivity of 94% and 89%, respectively, compared with ELISA. GenoAmp® Trioplex Real-Time RT-PCR and RealStar® Dengue RT-PCR tests presented a comparable kappa agreement with 0.722. The result obtained from GenoAmp® Real-Time RT-PCR Dengue test showed that 14 samples harbored dengue virus type 1 (DENV-1, 8 samples harbored DENV-2, 2 samples harbored DENV-3, and 1 sample harbored DENV-4. 1 sample had a double infection with DENV-1 and DENV-2. The NS1 RDTs and real-time RT-PCR tests were found to be a useful diagnostic for early and rapid diagnosis of acute dengue and an excellent surveillance tool in our battle against dengue.

  19. Comparison of bacterial culture and qPCR testing of rectal and pen floor samples as diagnostic approaches to detect enterotoxic Escherichia coli in nursery pigs

    DEFF Research Database (Denmark)

    Weber, N. R.; Nielsen, J. P.; Hjulsager, Charlotte Kristiane

    2017-01-01

    Enterotoxigenic E. coli (ETEC) are a major cause of diarrhoea in weaned pigs. The objective of this study was to evaluate the agreement at pen level among three different diagnostic approaches for the detection of ETEC in groups of nursery pigs with diarrhoea. The diagnostic approaches used were......: bacterial culturing of faecal samples from three pigs (per pen) with clinical diarrhoea and subsequent testing for virulence genes in E. coli isolates; bacterial culturing of pen floor samples and subsequent testing for virulence genes in E. coli isolates; qPCR testing of pen floor samples in order...... to determine the quantity of F18 and F4 genes. The study was carried out in three Danish pig herds and included 31 pens with a pen-level diarrhoea prevalence of > 25%, as well as samples from 93 diarrhoeic nursery pigs from these pens. All E. coli isolates were analysed by PCR and classified as ETEC when genes...

  20. Novel approach for assessing performance of PCR cyclers used for diagnostic testing

    DEFF Research Database (Denmark)

    Schoder, D.; Schmalwieser, A.; Schauberger, G.

    2005-01-01

    of thermal homogeneities became most evident at the denaturation level during the first 15 s. At the time point zero, the accurate cyclers showed temperature deviations of 0.5 to 1.5 degrees C, whereas less-accurate cyclers failed to reach the set temperature by 13 to 20 degrees C. Consequently, the two less......As part of a large international project for validation and standardization of PCR, the influence of thermocyclers on PCR was tested. Six brand-new, Peltier technology-driven 96-well thermocyclers were subjected to a novel and stringent in-tube (not block) physical testing. The temperature...

  1. Direct comparison of flow-FISH and qPCR as diagnostic tests for telomere length measurement in humans.

    Directory of Open Access Journals (Sweden)

    Fernanda Gutierrez-Rodrigues

    Full Text Available Telomere length measurement is an essential test for the diagnosis of telomeropathies, which are caused by excessive telomere erosion. Commonly used methods are terminal restriction fragment (TRF analysis by Southern blot, fluorescence in situ hybridization coupled with flow cytometry (flow-FISH, and quantitative PCR (qPCR. Although these methods have been used in the clinic, they have not been comprehensively compared. Here, we directly compared the performance of flow-FISH and qPCR to measure leukocytes' telomere length of healthy individuals and patients evaluated for telomeropathies, using TRF as standard. TRF and flow-FISH showed good agreement and correlation in the analysis of healthy subjects (R(2 = 0.60; p<0.0001 and patients (R(2 = 0.51; p<0.0001. In contrast, the comparison between TRF and qPCR yielded modest correlation for the analysis of samples of healthy individuals (R(2 = 0.35; p<0.0001 and low correlation for patients (R(2 = 0.20; p = 0.001; Bland-Altman analysis showed poor agreement between the two methods for both patients and controls. Quantitative PCR and flow-FISH modestly correlated in the analysis of healthy individuals (R(2 = 0.33; p<0.0001 and did not correlate in the comparison of patients' samples (R(2 = 0.1, p = 0.08. Intra-assay coefficient of variation (CV was similar for flow-FISH (10.8 ± 7.1% and qPCR (9.5 ± 7.4%; p = 0.35, but the inter-assay CV was lower for flow-FISH (9.6 ± 7.6% vs. 16 ± 19.5%; p = 0.02. Bland-Altman analysis indicated that flow-FISH was more precise and reproducible than qPCR. Flow-FISH and qPCR were sensitive (both 100% and specific (93% and 89%, respectively to distinguish very short telomeres. However, qPCR sensitivity (40% and specificity (63% to detect telomeres below the tenth percentile were lower compared to flow-FISH (80% sensitivity and 85% specificity. In the clinical setting, flow-FISH was more accurate, reproducible, sensitive, and specific in the measurement of human

  2. Comparison of PCR and common clinical tests for the diagnosis of H. pylori in dyspeptic patients.

    Science.gov (United States)

    Pacheco, N; Mago, V; Gómez, I; Gueneau, P; Guelrud, M; Reyes, N; Pericchi, L R; Domínguez-Bello, M G

    2001-04-01

    Helicobacter pylori has been recognized as a major gastric pathogen. The objective of this study was to assess the diagnostic value of common clinical tests to detect H. pylori infection, by comparison with PCR. Serum and gastric biopsy specimens from 106 dyspeptic patients were examined. Serology was performed with Pyloriset Dry test, and biopsies were examined histologically, for rapid urease activity and PCR amplification of an ureA gene segment of H. pylori. PCR primers were specific for H. pylori and required at least 1.47 pg of H. pylori DNA, corresponding to about 800 bacterial cells. According to serology, histology, rapid urease, and PCR, positive results were respectively found in 56%, 86%, 64%, and 85% of dyspeptic patients, primarily with gastritis. Relative to PCR, the sensitivity (and specificity) was 55% (38%) for serology, 86% (13%) for histology, 70% (69%) for urease. When combining histology and urease, Bayesian analysis of data indicated no advantage of using combined methods over rapid urease test alone. Histology should not any longer be considered a gold standard test for Helicobacter pylori. Urea breath test still seems the first option for non invasive diagnostic. If an invasive diagnostic is justified, highly specific and sensitive molecular methods should be used to examine specimens.

  3. PCR testing for diagnosis of Ichthyophonus hoferi: reply to LaPatra & Kocan (2013).

    Science.gov (United States)

    Hamazaki, Toshihide; Kahler, Eryn; Borba, Bonnie M; Burton, Tamara

    2013-11-06

    LaPatra & Kocan (2013) critiqued our paper Hamazaki et al. (2013; Dis Aquat Org 105:21-25) for data not supporting the conclusions of 'PCR testing is as accurate as culture…', but they neither pointed out what part of our data did not support our conclusion, nor did they provide any contrary scientific evidence supporting their argument that PCR testing is less accurate than culture. In the absence of any contradictory data, we stand by our data and our conclusion: PCR test is as suitable as culture as a diagnostic and field surveillance tool.

  4. Design and performance of the CDC real-time reverse transcriptase PCR swine flu panel for detection of 2009 A (H1N1) pandemic influenza virus.

    Science.gov (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

    2011-07-01

    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.

  5. Diagnostic validation of three test methods for detection of cyprinid herpesvirus 3 (CyHV-3).

    Science.gov (United States)

    Clouthier, Sharon C; McClure, Carol; Schroeder, Tamara; Desai, Megan; Hawley, Laura; Khatkar, Sunita; Lindsay, Melissa; Lowe, Geoff; Richard, Jon; Anderson, Eric D

    2017-03-06

    Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of koi herpesvirus disease in koi and common carp. The disease is notifiable to the World Organisation for Animal Health. Three tests-quantitative polymerase chain reaction (qPCR), conventional PCR (cPCR) and virus isolation by cell culture (VI)-were validated to assess their fitness as diagnostic tools for detection of CyHV-3. Test performance metrics of diagnostic accuracy were sensitivity (DSe) and specificity (DSp). Repeatability and reproducibility were measured to assess diagnostic precision. Estimates of test accuracy, in the absence of a gold standard reference test, were generated using latent class models. Test samples originated from wild common carp naturally exposed to CyHV-3 or domesticated koi either virus free or experimentally infected with the virus. Three laboratories in Canada participated in the precision study. Moderate to high repeatability (81 to 99%) and reproducibility (72 to 97%) were observed for the qPCR and cPCR tests. The lack of agreement observed between some of the PCR test pair results was attributed to cross-contamination of samples with CyHV-3 nucleic acid. Accuracy estimates for the PCR tests were 99% for DSe and 93% for DSp. Poor precision was observed for the VI test (4 to 95%). Accuracy estimates for VI/qPCR were 90% for DSe and 88% for DSp. Collectively, the results show that the CyHV-3 qPCR test is a suitable tool for surveillance, presumptive diagnosis and certification of individuals or populations as CyHV-3 free.

  6. Diagnostic accuracy of tuberculous lymphadenitis fine needle aspiration biopsy confirmed by PCR as gold standard

    Science.gov (United States)

    DSuryadi; Delyuzar; Soekimin

    2018-03-01

    Indonesia is the second country with the TB (tuberculosis) burden in the world. Improvement in controlling TB and reducing the complications can accelerate early diagnosis and correct treatment. PCR test is a gold standard. However, it is quite expensive for routine diagnosis. Therefore, an accurate and cheaper diagnostic method such as fine needle aspiration biopsy is needed. The study aimsto determine the accuracy of fine needle aspiration biopsy cytology in the diagnosis of tuberculous lymphadenitis. A cross-sectional analytic study was conducted to the samples from patients suspected with tuberculous lymphadenitis. The fine needle aspiration biopsy (FNAB)test was performed and confirmed by PCR test.There is a comparison to the sensitivity, specificity, accuracy, positive predictive value and negative predictive value of both methods. Sensitivity (92.50%), specificity (96.49%), accuracy (94.85%), positive predictive value (94.87%) and negative predictive value (94.83%) were in FNAB test compared to gold standard. We concluded that fine needle aspiration biopsy is a recommendation for a cheaper and accurate diagnostic test for tuberculous lymphadenitis diagnosis.

  7. 9 CFR 146.13 - Testing.

    Science.gov (United States)

    2010-01-01

    ...) Enzyme-linked immunosorbent assay (ELISA). ELISA must be conducted using test kits approved by the... conducted on all ELISA-positive samples. (B) The AGID test must be conducted using reagents approved by the... time reverse transcriptase/polymerase chain reaction (RRT-PCR) assay. (A) The RRT-PCR tests must be...

  8. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta

    2005-08-01

    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  9. Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

    Science.gov (United States)

    Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

    2012-04-13

    Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

  10. Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR.

    Directory of Open Access Journals (Sweden)

    Kirill V Sergueev

    Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.

  11. Design and Performance of the CDC Real-Time Reverse Transcriptase PCR Swine Flu Panel for Detection of 2009 A (H1N1) Pandemic Influenza Virus▿†‡

    Science.gov (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

    2011-01-01

    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260

  12. Nested-PCR and a new ELISA-based NovaLisa test kit for malaria diagnosis in an endemic area of Thailand.

    Science.gov (United States)

    Thongdee, Pimwan; Chaijaroenkul, Wanna; Kuesap, Jiraporn; Na-Bangchang, Kesara

    2014-08-01

    Microscopy is considered as the gold standard for malaria diagnosis although its wide application is limited by the requirement of highly experienced microscopists. PCR and serological tests provide efficient diagnostic performance and have been applied for malaria diagnosis and research. The aim of this study was to investigate the diagnostic performance of nested PCR and a recently developed an ELISA-based new rapid diagnosis test (RDT), NovaLisa test kit, for diagnosis of malaria infection, using microscopic method as the gold standard. The performance of nested-PCR as a malaria diagnostic tool is excellent with respect to its high accuracy, sensitivity, specificity, and ability to discriminate Plasmodium species. The sensitivity and specificity of nested-PCR compared with the microscopic method for detection of Plasmodium falciparum, Plasmodium vivax, and P. falciparum/P. vivax mixed infection were 71.4 vs 100%, 100 vs 98.7%, and 100 vs 95.0%, respectively. The sensitivity and specificity of the ELISA-based NovaLisa test kit compared with the microscopic method for detection of Plasmodium genus were 89.0 vs 91.6%, respectively. NovaLisa test kit provided comparable diagnostic performance. Its relatively low cost, simplicity, and rapidity enables large scale field application.

  13. Establishment of realtime RT-PCR assay to detect polio virus in the Acute Flaccid Paralysis laboratory surveillance

    Directory of Open Access Journals (Sweden)

    Nike Susanti

    2016-07-01

    Polio Vaccine into Vaccine-Derived Poliovirus still continue. Since 1991, WHO has developedAcute Flaccid Paralysis (AFP laboratory based surveillance. In 2014, the polioviruses identification by real-timeReverse Transcriptase Polymerase Chain Reaction (rRT-PCR, has been introduced to National Polio Laboratory(NPL Center for Biomedical and Basic Technology of Health. The objective of the rRT-PCR application is to havefaster and better diagnostic methods to monitor the circulation and mutation of polio viruses.Methods: Isolate tested by rRT-PCR using a combination of primers and probe mentioned by WHO manual.The viral RNA is converted to cDNA using reverse transcriptase and amplified in a PCR reaction using Taqpolymerase. The PCR products are detected and identified by hybridization with specific probes. The combinationof primers and probes will result in the serotype identification and intratypic differentiation of poliovirus isolates.Results: In 2014 NPL Jakarta received 604 AFP cases through the surveillance system, five cases foundpositive for polio viruses by culture. All of the specimens were positive for polio vaccine viruses. Twocases were polio virus type P2 (40%, one cases polio virus type P1 (20%, 1 case polio virus type P3(20% and one case mix polio viruses type P1+P2 (20%.Conclusion: The real-time PCR assay was able to help the identification of polio viruses rapidly in Jakartalab. The test can be utilized for monitoring the population routinely immunized with OPV. (Health ScienceJournal of Indonesia 2016;7:27-31Keywords: ITD, Poliovirus, Identification, rRT-PCR

  14. Outcome on EPIZONE Extension on VER/ VNN: Diagnostics, proficiency test and qRT-PCR validation

    DEFF Research Database (Denmark)

    Bigarré, Laurent; Panzarin, Valentina; Baud, Marine

    2012-01-01

    1 is to bring valuable genetic information on the second genome component of a given isolate. ANSES has developed new DNA probes targeting RNA1 with the goal of detecting all genotypes of nodaviruses. The aim of the project is thus: - To organize, conduct and report an inter-laboratory proficiency...... test for detection of aquatic nodaviruses by real time RT-PCR targeting RNA1 and RNA2, respectively. - To test a newly developed real-time RT-PCR targeting RNA1: sensitivity, specificity, range of detection and genetic information provided by sequencing the PCR product. Materials & methods Primers...... to be extracted by each partner. In the meantime, ANSES produced and distributed RNA extracted from healthy or infected fish (2 genogroups), or cell culture; one sample from cell culture had to be serially diluted to test the sensitivity of each method in partners’ hands. Samples were tested in duplicates...

  15. Estimating diagnostic test accuracies for Brachyspira hyodysenteriae accounting for the complexities of population structure in food animals.

    Directory of Open Access Journals (Sweden)

    Sonja Hartnack

    Full Text Available For swine dysentery, which is caused by Brachyspira hyodysenteriae infection and is an economically important disease in intensive pig production systems worldwide, a perfect or error-free diagnostic test ("gold standard" is not available. In the absence of a gold standard, Bayesian latent class modelling is a well-established methodology for robust diagnostic test evaluation. In contrast to risk factor studies in food animals, where adjustment for within group correlations is both usual and required for good statistical practice, diagnostic test evaluation studies rarely take such clustering aspects into account, which can result in misleading results. The aim of the present study was to estimate test accuracies of a PCR originally designed for use as a confirmatory test, displaying a high diagnostic specificity, and cultural examination for B. hyodysenteriae. This estimation was conducted based on results of 239 samples from 103 herds originating from routine diagnostic sampling. Using Bayesian latent class modelling comprising of a hierarchical beta-binomial approach (which allowed prevalence across individual herds to vary as herd level random effect, robust estimates for the sensitivities of PCR and culture, as well as for the specificity of PCR, were obtained. The estimated diagnostic sensitivity of PCR (95% CI and culture were 73.2% (62.3; 82.9 and 88.6% (74.9; 99.3, respectively. The estimated specificity of the PCR was 96.2% (90.9; 99.8. For test evaluation studies, a Bayesian latent class approach is well suited for addressing the considerable complexities of population structure in food animals.

  16. Performance of the Directigen EZ Flu A+B rapid influenza diagnostic test to detect pandemic influenza A/H1N1 2009.

    Science.gov (United States)

    Boyanton, Bobby L; Almradi, Amro; Mehta, Tejal; Robinson-Dunn, Barbara

    2014-04-01

    The Directigen EZ Flu A+B rapid influenza diagnostic test, as compared to real-time reverse transcriptase polymerase chain reaction, demonstrated suboptimal performance to detect pandemic influenza A/H1N1 2009. Age- and viral load-stratified test sensitivity ranged from 33.3 to 84.6% and 0 to 100%, respectively. © 2013.

  17. A Rapid and Low-Cost PCR Thermal Cycler for Infectious Disease Diagnostics.

    Directory of Open Access Journals (Sweden)

    Kamfai Chan

    Full Text Available The ability to make rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a great step forward in global health. Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. Unfortunately, most commercial thermal cyclers are expensive and need continuous electrical power supply, so they are not suitable for uses in low-resource settings. We have previously reported a low-cost and simple approach to amplify DNA using vacuum insulated stainless steel thermoses food cans, which we have named it thermos thermal cycler or TTC. Here, we describe the use of an improved set up to enable the detection of viral RNA targets by reverse-transcription PCR (RT-PCR, thus expanding the TTC's ability to identify highly infectious, RNA virus-based diseases in low resource settings. The TTC was successful in demonstrating high-speed and sensitive detection of DNA or RNA targets of sexually transmitted diseases, HIV/AIDS, Ebola hemorrhagic fever, and dengue fever. Our innovative TTC costs less than $200 to build and has a capacity of at least eight tubes. In terms of speed, the TTC's performance exceeded that of commercial thermal cyclers tested. When coupled with low-cost endpoint detection technologies such as nucleic acid lateral-flow assay or a cell-phone-based fluorescence detector, the TTC will increase the availability of on-site molecular diagnostics in low-resource settings.

  18. Improved detection of Burkholderia pseudomallei from non-blood clinical specimens using enrichment culture and PCR: narrowing diagnostic gap in resource-constrained settings.

    Science.gov (United States)

    Tellapragada, Chaitanya; Shaw, Tushar; D'Souza, Annet; Eshwara, Vandana Kalwaje; Mukhopadhyay, Chiranjay

    2017-07-01

    To evaluate the diagnostic utility of enrichment culture and PCR for improved case detection rates of non-bacteraemic form of melioidosis in limited resource settings. Clinical specimens (n = 525) obtained from patients presenting at a tertiary care hospital of South India with clinical symptoms suggestive of community-acquired pneumonia, lower respiratory tract infections, superficial or internal abscesses, chronic skin ulcers and bone or joint infections were tested for the presence of Burkholderia pseudomallei using conventional culture (CC), enrichment culture (EC) and PCR. Sensitivity, specificity, positive and negative predictive values of CC and PCR were initially deduced using EC as the gold standard method. Further, diagnostic accuracies of all the three methods were analysed using Bayesian latent class modelling (BLCM). Detection rates of B. pseudomallei using CC, EC and PCR were 3.8%, 5.3% and 6%, respectively. Diagnostic sensitivities and specificities of CC and PCR were 71.4, 98.4% and 100 and 99.4%, respectively in comparison with EC as the gold standard test. With Bayesian latent class modelling, EC and PCR demonstrated sensitivities of 98.7 and 99.3%, respectively, while CC showed a sensitivity of 70.3% for detection of B. pseudomallei. An increase of 1.6% (95% CI: 1.08-4.32%) in the case detection rate of melioidosis was observed in the study population when EC and/or PCR were used in adjunct to the conventional culture technique. Our study findings underscore the diagnostic superiority of enrichment culture and/or PCR over conventional microbiological culture for improved case detection of melioidosis from non-blood clinical specimens. © 2017 John Wiley & Sons Ltd.

  19. Bayesian estimation of test characteristics of real-time PCR, bacteriological culture and California mastitis test for diagnosis of intramammary infections with Staphylococcus aureus in dairy cattle at routine milk recordings.

    Science.gov (United States)

    Mahmmod, Yasser S; Toft, Nils; Katholm, Jørgen; Grønbæk, Carsten; Klaas, Ilka C

    2013-11-01

    Danish farmers can order a real-time PCR mastitis diagnostic test on routinely taken cow-level samples from milk recordings. Validation of its performance in comparison to conventional mastitis diagnostics under field conditions is essential for efficient control of intramammary infections (IMI) with Staphylococcus aureus (S. aureus). Therefore, the objective of this study was to estimate the sensitivity (Se) and specificity (Sp) of real-time PCR, bacterial culture (BC) and California mastitis test (CMT) for the diagnosis of the naturally occurring IMI with S. aureus in routinely collected milk samples using latent class analysis (LCA) to avoid the assumption of a perfect reference test. Using systematic random sampling, a total of 609 lactating dairy cows were selected from 6 dairy herds with bulk tank milk PCR cycle threshold (Ct) value ≤39 for S. aureus. At routine milk recordings, automatically obtained cow-level (composite) milk samples were analyzed by PCR and at the same milking, 2436 quarter milk samples were collected aseptically for BC and CMT. Results showed that 140 cows (23%) were positive for S. aureus IMI by BC while 170 cows (28%) were positive by PCR. Estimates of Se and Sp for PCR were higher than test estimates of BC and CMT. SeCMT was higher than SeBC however, SpBC was higher than SpCMT. SePCR was 91%, while SeBC was 53%, and SeCMT was 61%. SpPCR was 99%, while SpBC was 89%, and SpCMT was 65%. In conclusion, PCR has a higher performance than the conventional diagnostic tests (BC and CMT) suggesting its usefulness as a routine test for accurate diagnosis of S. aureus IMI from dairy cows at routine milk recordings. The use of LCA provided estimates of the test characteristics for two currently diagnostic tests (BC, CMT) and a novel technique (real-time PCR) for diagnosing S. aureus IMI under field conditions at routine milk recordings in Denmark. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

    2018-01-01

    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  1. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

    Science.gov (United States)

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2017-09-01

    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  2. Does more favourable handling of the cerebrospinal fluid increase the diagnostic sensitivity of Borrelia burgdorferi sensu lato-specific PCR in Lyme neuroborreliosis?

    Science.gov (United States)

    Forselv, Kristine J N; Lorentzen, Åslaug R; Ljøstad, Unn; Mygland, Åse; Eikeland, Randi; Kjelland, Vivian; Noraas, Sølvi; Quarsten, Hanne

    2018-04-01

    Tests for direct detection of Borrelia burgdorferi sensu lato (Bb) in Lyme neuroborreliosis (LNB) are needed. Detection of Bb DNA using PCR is promising, but clinical utility is hampered by low diagnostic sensitivity. We aimed to examine whether diagnostic sensitivity can be improved by the use of larger cerebrospinal fluid (CSF) volumes and faster handling of samples. Patients who underwent CSF examination for LNB were included. We collected two millilitres of CSF for PCR analysis, extracted DNA from the pellets within 24 h and analysed the eluate by two real-time PCR protocols (16S rRNA and OspA). Patients who fulfilled diagnostic criteria for LNB were classified as LNB cases and the rest as controls. Bb DNA in CSF was detected by PCR in seven of 28 adults with LNB. Two were Bb antibody negative. No Bb DNA was detected in CSF from 137 controls. Diagnostic sensitivity was 25% and specificity 100%. There was a non-significant trend towards larger CSF sample volume, faster handling of the sample, shorter duration of symptoms, and higher CSF cell count in the PCR-positive cases. We did not find that optimized handling of CSF increased diagnostic sensitivity of PCR in adults with LNB. However, our case series is small and we hypothesize that the importance of these factors will be clarified in further studies with larger case series and altered study design. PCR for diagnosis of LNB may be useful in cases without Bb antibodies due to short duration of symptoms.

  3. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  4. The diagnostic accuracy of three rapid diagnostic tests for typhoid fever at Chittagong Medical College Hospital, Chittagong, Bangladesh.

    Science.gov (United States)

    Maude, Rapeephan R; de Jong, Hanna K; Wijedoru, Lalith; Fukushima, Masako; Ghose, Aniruddha; Samad, Rasheda; Hossain, Mohammed Amir; Karim, Mohammed Rezaul; Faiz, Mohammed Abul; Parry, Christopher M

    2015-10-01

    To determine the diagnostic accuracy of three rapid diagnostic tests (RDTs) for typhoid fever in febrile hospitalised patients in Bangladesh. Febrile adults and children admitted to Chittagong Medical College Hospital, Bangladesh, were investigated with Bact/Alert(®) blood cultures and real-time PCR to detect Salmonella enterica Typhi and Paratyphi A and assays for Rickettsia, leptospirosis and dengue fever. Acute serum samples were examined with the LifeAssay (LA) Test-it™ Typhoid IgM lateral flow assay detecting IgM antibodies against S. Typhi O antigen, CTKBiotech Onsite Typhoid IgG/IgM Combo Rapid-test cassette lateral flow assay detecting IgG and IgM antibodies against S. Typhi O and H antigens and SD Bioline line assay for IgG and IgM antibodies against S. Typhi proteins. In 300 malaria smear-negative febrile patients [median (IQR) age of 13.5 (5-31) years], 34 (11.3%) had confirmed typhoid fever: 19 positive by blood culture for S. Typhi (three blood PCR positive) and 15 blood culture negative but PCR positive for S. Typhi in blood. The respective sensitivity and specificity of the three RDTs in patients using a composite reference standard of blood culture and/or PCR-confirmed typhoid fever were 59% and 61% for LifeAssay, 59% and 74% for the CTK IgM and/or IgG, and 24% and 96% for the SD Bioline RDT IgM and/or IgG. The LifeAssay RDT had a sensitivity of 63% and a specificity of 91% when modified with a positive cut-off of ≥2+ and analysed using a Bayesian latent class model. These typhoid RDTs demonstrated moderate diagnostic accuracies, and better tests are needed. © 2015 The Authors. Tropical Medicine & International Health Published by John Wiley & Sons Ltd.

  5. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

    Science.gov (United States)

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

    2018-03-01

    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  6. PCR diagnostics underestimate the prevalence of avian malaria (Plasmodium relictum) in experimentally-infected passerines

    Science.gov (United States)

    Jarvi, Susan I.; Schultz, Jeffrey J.; Atkinson, Carter T.

    2002-01-01

    Several polymerase chain reaction (PCR)-based methods have recently been developed for diagnosing malarial infections in both birds and reptiles, but a critical evaluation of their sensitivity in experimentally-infected hosts has not been done. This study compares the sensitivity of several PCR-based methods for diagnosing avian malaria (Plasmodium relictum) in captive Hawaiian honeycreepers using microscopy and a recently developed immunoblotting technique. Sequential blood samples were collected over periods of up to 4.4 yr after experimental infection and rechallenge to determine both the duration and detectability of chronic infections. Two new nested PCR approaches for detecting circulating parasites based on P. relictum 18S rRNA genes and the thrombospondin-related anonymous protein (TRAP) gene are described. The blood smear and the PCR tests were less sensitive than serological methods for detecting chronic malarial infections. Individually, none of the diagnostic methods was 100% accurate in detecting subpatent infections, although serological methods were significantly more sensitive (97%) than either nested PCR (61–84%) or microscopy (27%). Circulating parasites in chronically infected birds either disappear completely from circulation or to drop to intensities below detectability by nested PCR. Thus, the use of PCR as a sole means of detection of circulating parasites may significantly underestimate true prevalence.

  7. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  8. Epidemiology of meningitis with a negative CSF Gram stain: under-utilization of available diagnostic tests.

    Science.gov (United States)

    Nesher, L; Hadi, C M; Salazar, L; Wootton, S H; Garey, K W; Lasco, T; Luce, A M; Hasbun, R

    2016-01-01

    Meningitis with a negative cerebrospinal fluid Gram stain (CSF-GS) poses a diagnostic challenge as more than 50% of patients remain without an aetiology. The introduction of polymerase chain reaction (PCR) and arboviral serologies have increased diagnostic capabilities, yet large scale epidemiological studies evaluating their use in clinical practice are lacking. We conducted a prospective observational study in New Orleans between November 1999 and September 2008 (early era) when PCR was not widely available, and in Houston between November 2008 and June 2013 (modern era), when PCR was commonly used. Patients presenting with meningitis and negative CSF-GS were followed for 4 weeks. All investigations, PCR used, and results were recorded as they became available. In 323 patients enrolled, PCR provided the highest diagnostic yield (24·2%) but was ordered for 128 (39·6%) patients; followed by serology for arboviruses (15%) that was ordered for 100 (31%) of all patients. The yield of blood cultures was (10·3%) and that of CSF cultures was 4%; the yield for all other tests was meningitis and a negative CSF-GS, but both tests are being under-utilized.

  9. Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

    Science.gov (United States)

    Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

    2014-09-01

    Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We

  10. Analytical and diagnostic performance of a qPCR assay for Ichthyophonus spp. compared to the tissue culture 'gold standard'.

    Science.gov (United States)

    Lowe, Vanessa C; Hershberger, Paul K; Friedman, Carolyn S

    2018-06-04

    Parasites of the genus Ichthyophonus infect many fish species and have a non-uniform distribution within host tissues. Due in part to this uneven distribution, the comparative sensitivity and accuracy of using molecular-based detection methods versus culture to estimate parasite prevalence is under debate. We evaluated the analytical and diagnostic performance of an existing qPCR assay in comparison to the 'gold standard' culture method using Pacific herring Clupea pallasii with known exposure history. We determined that the assay is suitable for use in this host, and diagnostic specificity was consistently high (>98%) in both heart and liver tissues. Diagnostic sensitivity could not be fully assessed due to low infection rates, but our results suggest that qPCR is not as sensitive as culture under all circumstances. Diagnostic sensitivity of qPCR relative to culture is likely affected by the amount of sample processed. The prevalence values estimated by the 2 methods were not significantly different when sample amounts were equal (heart tissue), but when the assayed sample amounts were unequal (liver tissue), the culture method detected a significantly higher prevalence of the parasite than qPCR. Further, culture of liver also detected significantly more Ichthyophonus infections than culture of heart, suggesting that the density and distribution of parasites in tissues also plays a role in assay sensitivity. This sensitivity issue would be most problematic for fish with light infections. Although qPCR does not detect the presence of a live organism, DNA-based pathogen detection methods provide the opportunity for alternate testing strategies when culture is not possible.

  11. First round of external quality assessment of dengue diagnostics in the WHO Western Pacific Region, 2013

    Directory of Open Access Journals (Sweden)

    Kwoon Yong Pok

    2015-06-01

    Full Text Available Objective: Accurate laboratory testing is a critical component of dengue surveillance and control. The objective of this programme was to assess dengue diagnostic proficiency among national-level public health laboratories in the World Health Organization (WHO Western Pacific Region. Methods: Nineteen national-level public health laboratories performed routine dengue diagnostic assays on a proficiency testing panel consisting of two modules: one containing commercial serum samples spiked with cultured dengue viruses for the detection of nucleic acid and non-structural protein 1 (NS1 (Module A and one containing human serum samples for the detection of anti-dengue virus antibodies (Module B. A review of logistics arrangements was also conducted. Results: All 16 laboratories testing Module A performed reverse transcriptase polymerase chain reaction (RT-PCR for both RNA and serotype detection. Of these, 15 had correct results for RNA detection and all 16 correctly serotyped the viruses. All nine laboratories performing NS1 antigen detection obtained the correct results. Sixteen of the 18 laboratories using IgM assays in Module B obtained the correct results as did the 13 laboratories that performed IgG assays. Detection of ongoing/recent dengue virus infection by both molecular (RT-PCR and serological methods (IgM was available in 15/19 participating laboratories. Discussion: This first round of external quality assessment of dengue diagnostics was successfully conducted in national-level public health laboratories in the WHO Western Pacific Region, revealing good proficiency in both molecular and serological testing. Further comprehensive diagnostic testing for dengue virus and other priority pathogens in the Region will be assessed during future rounds.

  12. Retrospective Review of Treponema pallidum PCR and Serology Results: Are Both Tests Necessary?

    Science.gov (United States)

    Brischetto, Anna; Gassiep, Ian; Whiley, David; Norton, Robert

    2018-05-01

    There has been a resurgence of syphilis diagnoses in Australia. We investigated whether our Treponema pallidum PCR test provides any additional diagnostic information over syphilis serology (chemiluminescence immunoassay [CMIA], Treponema pallidum particle agglutination [TPPA] assay, and the rapid plasma reagin [RPR] flocculation test). A retrospective audit of all T. pallidum PCR requests that came through our laboratory from January 2010 to June 2017 was conducted; data collected included age, gender, site of swab, and results from T. pallidum PCR, syphilis serology, and herpes simplex virus 1 (HSV-1) and HSV-2 PCRs. A total of 441 T. pallidum PCR tests were performed; on average, 3 T. pallidum PCRs per month were requested in 2011, and this rate increased to 17.2 requests per month in 2017. A total of 323 patients had both T. pallidum PCR and syphilis serology performed, with 67% of swabs taken from the genitals. T. pallidum PCR gave positive results for 61/323 (19%) patients; of these 61 patients, 59 (97%) also had positive syphilis serology results ( T. pallidum PCR sensitivity, 68%; specificity, 99%; positive predictive value, 97%; negative predictive value, 89%). Syphilis serology was positive for 91/323 patients (28%); of these 91 patients, 61 (66%) were also T. pallidum PCR positive (syphilis serology sensitivity, 97%; specificity, 88%; positive predictive value, 60%; negative predictive value, 99%). The Cohen's kappa value was 0.74, indicating substantial agreement between the two tests. Our results show that most patients with positive T. pallidum PCR results also had positive syphilis serology. Therefore, T. pallidum PCR adds little clinical value over serology for the diagnosis of syphilis in certain clinical settings. Copyright © 2018 American Society for Microbiology.

  13. A diagnostic PCR assay for the detection of an Australian epidemic strain of Pseudomonas aeruginosa

    Science.gov (United States)

    2010-01-01

    Background Chronic lung infection with the bacterium Pseudomonas aeruginosa is one of the hallmarks of cystic fibrosis (CF) and is associated with worsening lung function, increased hospitalisation and reduced life expectancy. A virulent clonal strain of P. aeruginosa (Australian epidemic strain I; AES-I) has been found to be widespread in CF patients in eastern Australia. Methods Suppression subtractive hybridization (SSH) was employed to identify genetic sequences that are present in the AES-I strain but absent from the sequenced reference strain PAO1. We used PCR to evaluate the distribution of several of the AES-I loci amongst a collection of 188 P. aeruginosa isolates which was comprised of 35 AES-I isolates (as determined by PFGE), 78 non-AES-I CF isolates including other epidemic CF strains as well as 69 P. aeruginosa isolates from other clinical and environmental sources. Results We have identified a unique AES-I genetic locus that is present in all 35 AES-I isolates tested and not present in any of the other 153 P. aeruginosa strains examined. We have used this unique AES-I locus to develop a diagnostic PCR and a real-time PCR assay to detect the presence of P. aeruginosa and AES-I in patient sputum samples. Conclusions We have developed diagnostic PCR assays that are 100% sensitive and 100% specific for the P. aeruginosa strain AES-I. We have also shown that Whatman FTA® Elute cards may be used with PCR-based assays to rapidly detect the presence of P. aeruginosa strains in CF sputum. PMID:20637114

  14. A diagnostic PCR assay for the detection of an Australian epidemic strain of Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Murphy Anna

    2010-07-01

    Full Text Available Abstract Background Chronic lung infection with the bacterium Pseudomonas aeruginosa is one of the hallmarks of cystic fibrosis (CF and is associated with worsening lung function, increased hospitalisation and reduced life expectancy. A virulent clonal strain of P. aeruginosa (Australian epidemic strain I; AES-I has been found to be widespread in CF patients in eastern Australia. Methods Suppression subtractive hybridization (SSH was employed to identify genetic sequences that are present in the AES-I strain but absent from the sequenced reference strain PAO1. We used PCR to evaluate the distribution of several of the AES-I loci amongst a collection of 188 P. aeruginosa isolates which was comprised of 35 AES-I isolates (as determined by PFGE, 78 non-AES-I CF isolates including other epidemic CF strains as well as 69 P. aeruginosa isolates from other clinical and environmental sources. Results We have identified a unique AES-I genetic locus that is present in all 35 AES-I isolates tested and not present in any of the other 153 P. aeruginosa strains examined. We have used this unique AES-I locus to develop a diagnostic PCR and a real-time PCR assay to detect the presence of P. aeruginosa and AES-I in patient sputum samples. Conclusions We have developed diagnostic PCR assays that are 100% sensitive and 100% specific for the P. aeruginosa strain AES-I. We have also shown that Whatman FTA® Elute cards may be used with PCR-based assays to rapidly detect the presence of P. aeruginosa strains in CF sputum.

  15. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  16. Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction.

    Science.gov (United States)

    Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

    2017-11-27

    Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  17. Characteristics of diagnostic tests used in the 2002 low-pathogenicity avian influenza H7N2 outbreak in Virginia.

    Science.gov (United States)

    Elvinger, François; Akey, Bruce L; Senne, Dennis A; Pierson, F William; Porter-Spalding, Barbara A; Spackman, Erica; Suarez, David L

    2007-07-01

    An outbreak of low-pathogenicity avian influenza (LPAI) H7N2 occurred in 2002 in the Shenandoah Valley, a high-density poultry production region in Virginia. Infected flocks were identified through a combination of observation of clinical signs and laboratory diagnostic tests designed to detect avian influenza (AI) antibodies, virus, or H7-specific RNA. In this report, fitness for purpose of 3 virus/RNA detection assays used during the outbreak was examined: 1) antigen capture enzyme immunoassay (AC-EIA), 2) real-time reverse transcription polymerase chain reaction (RRT-PCR), and 3) virus isolation (VI). Results from testing 762 turkey and 2,216 chicken tracheal swab pooled specimens were analyzed to determine diagnostic sensitivities and specificities of these tests under field conditions using Bayesian techniques for validation of diagnostic tests in the absence of a "gold standard." Diagnostic sensitivities (with 95% probability intervals) in turkeys of AC-EIA and RRT-PCR, in reference to VI, were 65.9 (50.6; 81.3)% and 85.1 (71.9; 95.7)% and of VI 92.9 (78.0; 98.8)% in reference to AC-EIA or 88.7 (76.0; 97.2)% in reference to RRT-PCR; in chickens, diagnostic sensitivities were 75.1 (45.6; 94.2)%, 86.3 (65.9; 97.1)%, and 86.2 (65.8; 97.1)% or 86.3 (66.4; 97.2)%, respectively. Specificities were 99.1 (97.9; 99.8)%, 98.9 (98.0; 99.5)%, and 98.6 (97.4; 99.4)% or 98.8 (97.8; 99.5)% in turkeys and between 99.25% and 99.27% with probability intervals of approximately +/-0.4% for all tests in chickens. Simultaneous use of AC-EIA and RRT-PCR contributed significantly to the rapid control of the outbreak, but the AI RRT-PCR assay with >85% sensitivity and approximately 99% specificity, combined with relatively low cost and fast turnaround, could be used as the sole diagnostic test in outbreaks of LPAI.

  18. Concordance in diagnostic testing for respiratory pathogens of bighorn sheep

    Science.gov (United States)

    Walsh, Daniel P.; Cassirer, E. Frances; Bonds, Michael D.; Brown, Daniel R.; Edwards, William H.; Weiser, Glen C.; Drew, Mark L.; Briggs, Robert E.; Fox, Karen A.; Miller, Michael W.; Shanthalingam, Sudarvili; Srikumaran, Subramaniam; Besser, Thomas E.

    2016-01-01

    Reliable diagnostic tests are essential for disease investigation and management. This is particularly true for diseases of free-ranging wildlife where sampling is logistically difficult precluding retesting. Clinical assays for wildlife diseases frequently vary among laboratories because of lack of appropriate standardized commercial kits. Results of diagnostic testing may also be called into question when investigators report different etiologies for disease outbreaks, despite similar clinical and pathologic findings. To evaluate reliability of diagnostic testing for respiratory pathogens of bighorn sheep (Ovis canadensis), we conducted a series of ring tests across 6 laboratories routinely involved in detection of Mycoplasma ovipneumoniae, Pasteurellaceae, lktA (the Pasteurellaceae gene encoding leukotoxin), and 3 reference laboratories. Consistency of results for replicate samples within laboratories was high (median agreement = 1.0). Agreement between laboratories was high for polymerase chain reaction (PCR) detection of M. ovipneumoniae and culture isolation of Mannheimia spp. and Bibersteinia trehalosi(median agreement = 0.89–0.95, Kappa = 0.65–0.74), and lower for PCR detection of Mannheimiaspp. lktA (median agreement = 0.58, Kappa = 0.12). Most errors on defined status samples were false negatives, suggesting test sensitivity was a greater problem than specificity. However, tests for M. haemolytica and lktA yielded some false positive results. Despite differences in testing protocols, median agreement among laboratories and correct classification of controls for most agents was ≥0.80, meeting or exceeding the standard required by federal proficiency testing programs. This information is valuable for interpreting test results, laboratory quality assessments, and advancing diagnosis of respiratory disease in wild sheep. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  19. Performance of a real-time PCR assay in routine bovine mastitis diagnostics compared with in-depth conventional culture.

    Science.gov (United States)

    Hiitiö, Heidi; Riva, Rauna; Autio, Tiina; Pohjanvirta, Tarja; Holopainen, Jani; Pyörälä, Satu; Pelkonen, Sinikka

    2015-05-01

    Reliable identification of the aetiological agent is crucial in mastitis diagnostics. Real-time PCR is a fast, automated tool for detecting the most common udder pathogens directly from milk. In this study aseptically taken quarter milk samples were analysed with a real-time PCR assay (Thermo Scientific PathoProof Mastitis Complete-12 Kit, Thermo Fisher Scientific Ltd.) and by semi-quantitative, in-depth bacteriological culture (BC). The aim of the study was to evaluate the diagnostic performance of the real-time PCR assay in routine use. A total of 294 quarter milk samples from routine mastitis cases were cultured in the national reference laboratory of Finland and examined with real-time PCR. With BC, 251 out of 294 (85.7%) of the milk samples had at least one colony on the plate and 38 samples were considered contaminated. In the PCR mastitis assay, DNA of target species was amplified in 244 samples out of 294 (83.0%). The most common bacterial species detected in the samples, irrespective of the diagnostic method, was the coagulase negative staphylococci (CNS) group (later referred as Staphylococcus spp.) followed by Staphylococcus aureus. Sensitivity (Se) and specificity (Sp) for the PCR assay to provide a positive Staph. aureus result was 97.0 and 95.8% compared with BC. For Staphylococcus spp., the corresponding figures were 86.7 and 75.4%. Our results imply that PCR performed well as a diagnostic tool to detect Staph. aureus but may be too nonspecific for Staphylococcus spp. in routine use with the current cut-off Ct value (37.0). Using PCR as the only microbiological method for mastitis diagnostics, clinical relevance of the results should be carefully considered before further decisions, for instance antimicrobial treatment, especially when minor pathogens with low amount of DNA have been detected. Introducing the concept of contaminated samples should also be considered.

  20. [Telomerase in lung cancer. Testing the activity of the "immortaligy enzyme" bronchial biopsies increases the diagnostic yield in cases of suspected peripheral bronchogenic carcinomas].

    Science.gov (United States)

    Freitag, L; Litterst, P; Obertrifter, B; Velehorschi, V; Kemmer, H P; Linder, A; Brightman, I

    2000-11-01

    The proliferative capability is time-limited in normal somatic cells by the shortening of their chromosomal ends, the telomeres (Hayflick limit). An important feature of malignant cells is their immortality. The probably most common mechanism of tumour cells to achieve unlimited replicability is the activation of the enzyme telomerase. The reverse transcriptase can compensate the loss of telomeres. Using a PCR-based TRAP assay we found telomerase activity in tumour biopsies, exsudates and bronchial washings in various thoracic malignancies. In 38 of 47 patients with suspected peripheral lung cancer eventually surgery or invasive procedures proved a malignancy. In fluoroscopically guided bronchial brushings from 25 of these 38 patients (66%) the TRAP assay revealed telomerase activity. There was a single false positive case (tuberculosis) and with a single exception, the simultaneously taken brushes of the contralateral lobes were all telomerase negative. In 23 patients (61%) tumour cells were found in the cytological examination. In 33 patients at least one marker was positive. Thus the combination of cytology and telomerase test in bronchial brush biopsies attained a diagnostic yield of 87%.

  1. Diagnostic accuracy of a loop-mediated isothermal PCR assay for detection of Orientia tsutsugamushi during acute Scrub Typhus infection.

    Science.gov (United States)

    Paris, Daniel H; Blacksell, Stuart D; Nawtaisong, Pruksa; Jenjaroen, Kemajittra; Teeraratkul, Achara; Chierakul, Wirongrong; Wuthiekanun, Vanaporn; Kantipong, Pacharee; Day, Nicholas P J

    2011-09-01

    There is an urgent need to develop rapid and accurate point-of-care (POC) technologies for acute scrub typhus diagnosis in low-resource, primary health care settings to guide clinical therapy. In this study we present the clinical evaluation of loop-mediated isothermal PCR assay (LAMP) in the context of a prospective fever study, including 161 patients from scrub typhus-endemic Chiang Rai, northern Thailand. A robust reference comparator set comprising following 'scrub typhus infection criteria' (STIC) was used: a) positive cell culture isolate and/or b) an admission IgM titer ≥1∶12,800 using the 'gold standard' indirect immunofluorescence assay (IFA) and/or c) a 4-fold rising IFA IgM titer and/or d) a positive result in at least two out of three PCR assays. Compared to the STIC criteria, all PCR assays (including LAMP) demonstrated high specificity ranging from 96-99%, with sensitivities varying from 40% to 56%, similar to the antibody based rapid test, which had a sensitivity of 47% and a specificity of 95%. The diagnostic accuracy of the LAMP assay was similar to realtime and nested conventional PCR assays, but superior to the antibody-based rapid test in the early disease course. The combination of DNA- and antibody-based detection methods increased sensitivity with minimal reduction of specificity, and expanded the timeframe of adequate diagnostic coverage throughout the acute phase of scrub typhus.

  2. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    Science.gov (United States)

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Comparison between the diagnostic accuracy of clinico-pathological and molecular tests for feline infectious peritonitis (FIP

    Directory of Open Access Journals (Sweden)

    Angelica Stranieri

    2015-07-01

    Full Text Available The aim of this study was to compare the diagnostic accuracy for feline infectious peritonitis (FIP of conventional clinic-pathological tests with that of molecular tests such as routine PCR and PCR followed by the sequencing of the Spike (S gene. Blood, effusion and tissues specimens were collected from 21 FIP suspected cats. In vivo examination consisted of CBC, serum protein electrophoresis, AGP measurement, cytological and biochemical examination and the evaluation of the ΔTNC on effusions, and of molecular tests such the screening PCR (target: 3’UTR region and the PCR directed towards the S gene followed by the amplification products sequencing in order to detect the aminoacidic substitution recently considered diagnostic for FIP1. These molecular techniques were applied to tissues collected during necropsy, which also allowed forming an FIP group (13 cats and a non-FIP group (5 cats based on histology and immunohistochemistry. The best test on tissues was immunohistochemistry (sens: 92.3%; spec: 100%, while the screening PCR suffered of low specificity (spec: 33.3% and the S gene sequencing showed low sensitivity (sens: 69.2%.On effusions, the best tests resulted screening PCR and cytology (sens and spec: 100% in comparison with the ΔTNC measurement (sens: 85.7 %; spec: 100% and the S gene sequencing (sens: 42.8%; spec: 100%.On blood, the best test resulted AGP measurement (sens: 81.8%; spec: 100%, while serum protein electrophoresis showed a surprisingly low sensitivity (sens: 41.7%. Screening PCR (sens: 55.6%; spec: 100% and S gene sequencing (sens: 33.3%; spec: 100% proved again low accuracy.

  4. Bayesian estimation of test characteristics of real-time PCR, bacteriological culture and California mastitis test for diagnosis of intramammary infections with Staphylococcus aureus in dairy cattle at routine milk recordings

    DEFF Research Database (Denmark)

    Mahmmod, Yasser; Toft, Nils; Katholm, Jørgen

    2013-01-01

    Danish farmers can order a real-time PCR mastitis diagnostic test on routinely takencow-level samples from milk recordings. Validation of its performance in comparison toconventional mastitis diagnostics under field conditions is essential for efficient control ofintramammary infections (IMI......) with Staphylococcus aureus (S. aureus). Therefore, the objec-tive of this study was to estimate the sensitivity (Se) and specificity (Sp) of real-time PCR,bacterial culture (BC) and California mastitis test (CMT) for the diagnosis of the naturallyoccurring IMI with S. aureus in routinely collected milk samples using...... latent class anal-ysis (LCA) to avoid the assumption of a perfect reference test. Using systematic randomsampling, a total of 609 lactating dairy cows were selected from 6 dairy herds with bulktank milk PCR cycle threshold (Ct) value ≤39 for S. aureus. At routine milk recordings, auto-matically obtained...

  5. Evaluation of a nested PCR test and bacterial culture of swabs from the nasal passages and from abscesses in relation to diagnosis of Streptococcus equi infection (strangles)

    DEFF Research Database (Denmark)

    Grønbæk, L.M.; Angen, Øystein; Vigre, Håkan

    2006-01-01

    . Methods: Two herds with natural outbreaks of strangles were visited over a period of 15 weeks and 323 samples originating from 35 horses investigated. The diagnostic use of a nested PCR test was evaluated using a collection of 165 isolates of Lancefield group C streptococci (species specificity) and swabs...... from nasal passages or from abscesses from horses infected with S. equi (diagnostic sensitivity). Results: All 45 S. equi isolates tested positive in the nested PCR, whereas no amplicon was formed when testing the other 120 Lancefield group C isolates. A total of 43 samples were collected from 11...... horses with and without clinical signs. Conclusions and potential relevance: The nested PCR test represents a species-specific and -sensitive method for diagnosis of S. equi from clinical samples. It may, however, be desirable in future to develop detection methods with high diagnostic sensitivity...

  6. Diagnostic efficacy of a real time-PCR assay for Chlamydia trachomatis infection in infertile women in north India

    Directory of Open Access Journals (Sweden)

    Benu Dhawan

    2014-01-01

    Full Text Available Background & objectives: Little is known about the prevalence of Chlamydia trachomatis infection in Indian women with infertility. To improve the diagnosis of C. trachomatis infection in developing countries, there is an urgent need to establish cost-effective molecular test with high sensitivity and specificity. This study was conducted to determine the diagnostic utility of a real time-PCR assay for detention of C. trachomatis infection in infertile women attending an infertility clinic in north India. The in house real time-PCR assay was also compared with a commercial real-time PCR based detection system. Methods: Endocervical swabs, collected from 200 infertile women were tested for C. trachomatis by three different PCR assays viz. in-house real time-PCR targeting the cryptic plasmid using published primers, along with omp1 gene and cryptic plasmid based conventional PCR assays. Specimens were also subjected to direct fluorescence assay (DFA and enzyme immunoassay (EIA Performance of in-house real time-PCR was compared with that of COBAS Taqman C. trachomatis Test, version 2.0 on all in-house real time-PCR positive sample and 30 consecutive negative samples. Results: C. trachomatis infection was found in 13.5 per cent (27/200 infertile women by in-house real time-PCR, 11.5 per cent (23/200 by cryptic plasmid and/or omp1 gene based conventional PCR, 9 per cent (18/200 by DFA and 6.5 per cent (7/200 by EIA. The in-house real time-PCR exhibited a sensitivity and specificity of 100 per cent, considering COBAS Taqman CT Test as the gold standard. The negative and positive predictive values of the in-house real time-PCR were 100 per cent. The in-house real time-PCR could detect as low as 10 copies of C. trachomatis DNA per reaction. Interpretation & conclusions: In-house real time-PCR targeting the cryptic plasmid of C. trachomatis exhibited an excellent sensitivity and specificity similar to that of COBAS Taqman CT Test, v2.0 for detection of C

  7. Effects of canine parvovirus strain variations on diagnostic test results and clinical management of enteritis in dogs.

    Science.gov (United States)

    Markovich, Jessica E; Stucker, Karla M; Carr, Alaina H; Harbison, Carole E; Scarlett, Janet M; Parrish, Colin R

    2012-07-01

    To estimate the prevalence of canine parvovirus (CPV) strains among dogs with enteritis admitted to a referral hospital in the southwestern United States during an 11-month period and to compare diagnostic test results, disease severity, and patient outcome among CPV strains. Prospective observational study. 72 dogs with histories and clinical signs of parvoviral enteritis. For each dog, a fecal sample or rectal swab specimen was evaluated for CPV antigen via an ELISA. Subsequently, fecal samples (n = 42 dogs) and pharyngeal swab specimens (16) were obtained and tested for CPV antigen via an ELISA and CPV DNA via a PCR assay. For specimens with CPV-positive results via PCR assay, genetic sequencing was performed to identify the CPV strain. 56 dogs tested positive for CPV via ELISA or PCR assay. For 42 fecal samples tested via both ELISA and PCR assay, 27 had positive results via both assays, whereas 6 had positive PCR assay results only. Ten pharyngeal swab specimens yielded positive PCR assay results. Genetic sequencing was performed on 34 fecal or pharyngeal swab specimens that had CPV-positive PCR assay results; 25 (73.5%) were identified as containing CPV type-2c, and 9 (26.5%) were identified as containing CPV type-2b. No association was found between CPV strain and disease severity or clinical outcome. CPV type-2b and CPV type-2c posed similar health risks for dogs; therefore, genetic sequencing of CPV does not appear necessary for clinical management of infected patients. The diagnostic tests used could detect CPV type-2c.

  8. [Diagnostic significance of serum free DNA human telomerase reverse transcriptase quantitative determination on spinal cord injury].

    Science.gov (United States)

    Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B

    2018-02-06

    Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.

  9. Diagnostic Methods for Feline Coronavirus: A Review

    Directory of Open Access Journals (Sweden)

    Saeed Sharif

    2010-01-01

    Full Text Available Feline coronaviruses (FCoVs are found throughout the world. Infection with FCoV can result in a diverse range of signs from clinically inapparent infections to a highly fatal disease called feline infectious peritonitis (FIP. FIP is one of the most serious viral diseases of cats. While there is neither an effective vaccine, nor a curative treatment for FIP, a diagnostic protocol for FCoV would greatly assist in the management and control of the virus. Clinical findings in FIP are non-specific and not helpful in making a differential diagnosis. Haematological and biochemical abnormalities in FIP cases are also non-specific. The currently available serological tests have low specificity and sensitivity for detection of active infection and cross-react with FCoV strains of low pathogenicity, the feline enteric coronaviruses (FECV. Reverse transcriptase polymerase chain reaction (RT-PCR has been used to detect FCoV and is rapid and sensitive, but results must be interpreted in the context of clinical findings. At present, a definitive diagnosis of FIP can be established only by histopathological examination of biopsies. This paper describes and compares diagnostic methods for FCoVs and includes a brief account of the virus biology, epidemiology, and pathogenesis.

  10. The role of pleural fluid MAGE RT-nested PCR in the diagnosis of malignant pleural effusion.

    Science.gov (United States)

    Jeon, Eun Ju; Park, Hye Kyeong; Jeon, Kyeongman; Koh, Won-Jung; Suh, Gee Young; Chung, Man Pyo; Kim, Hojoong; Kwon, O Jung; Ki, Chang-Seok; Kim, Jong-Won; Shim, Young Mog; Um, Sang-Won

    2012-11-01

      Melanoma antigen (MAGE) genes are expressed in tumor cells, the testis and the placenta. The purpose of this prospective study was to investigate the sensitivity, specificity, and accuracy of the carcinoembryonic antigen (CEA), MAGE reverse transcriptase-nested polymerase chain reaction (RT-nested PCR), and cytology of pleural fluid in the diagnosis of malignant pleural effusion.   Patients in whom unilateral pleural effusion was identified on chest radiography from January to December 2009 were included in the study. MAGE genes were analyzed by RT-nested PCR using MAGE A1-6 common primers.   Of 81 enrolled patients, 46 were diagnosed as malignant pleural effusion, and 24 were diagnosed as benign pleural effusion. The diagnoses of 11 patients were not confirmed in this study. The diagnostic sensitivity, specificity, and accuracy of MAGE RT-nested PCR were 61.4%, 95.7%, and 73.1%, respectively. The diagnostic sensitivities of cytology and CEA (>5 ng/mL) were 61.4% and 75.0%, respectively. Among 17 patients with negative cytology who had malignant pleural effusion, 12 and 10 patients were positive for CEA (>5.0 ng/mL) and MAGE RT-nested PCR, respectively. However, of five patients with malignant pleural effusion that was not recognized by cytology and CEA, MAGE RT-nested PCR correctly predicted a malignant etiology in only one additional patient (20%).   MAGE RT-nested PCR seems to add little on the combination of conventional methods in the diagnosis of malignant effusion. © 2012 Tianjin Lung Cancer Institute and Wiley Publishing Asia Pty. Ltd.

  11. Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P

    2011-12-08

    RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.

  12. Development and assessment of molecular diagnostic tests for 15 enteropathogens causing childhood diarrhoea: a multicentre study.

    Science.gov (United States)

    Liu, Jie; Kabir, Furqan; Manneh, Jainaba; Lertsethtakarn, Paphavee; Begum, Sharmin; Gratz, Jean; Becker, Steve M; Operario, Darwin J; Taniuchi, Mami; Janaki, Lalitha; Platts-Mills, James A; Haverstick, Doris M; Kabir, Mamun; Sobuz, Shihab U; Nakjarung, Kaewkanya; Sakpaisal, Pimmada; Silapong, Sasikorn; Bodhidatta, Ladaporn; Qureshi, Shahida; Kalam, Adil; Saidi, Queen; Swai, Ndealilia; Mujaga, Buliga; Maro, Athanasia; Kwambana, Brenda; Dione, Michel; Antonio, Martin; Kibiki, Gibson; Mason, Carl J; Haque, Rashidul; Iqbal, Najeeha; Zaidi, Anita K M; Houpt, Eric R

    2014-08-01

    Childhood diarrhoea can be caused by many pathogens that are difficult to assay in the laboratory. Molecular diagnostic techniques provide a uniform method to detect and quantify candidate enteropathogens. We aimed to develop and assess molecular tests for identification of enteropathogens and their association with disease. We developed and assessed molecular diagnostic tests for 15 enteropathogens across three platforms-PCR-Luminex, multiplex real-time PCR, and TaqMan array card-at five laboratories worldwide. We judged the analytical and clinical performance of these molecular techniques against comparator methods (bacterial culture, ELISA, and PCR) using 867 diarrhoeal and 619 non-diarrhoeal stool specimens. We also measured molecular quantities of pathogens to predict the association with diarrhoea, by univariate logistic regression analysis. The molecular tests showed very good analytical and clinical performance at all five laboratories. Comparator methods had limited sensitivity compared with the molecular techniques (20-85% depending on the target) but good specificity (median 97·3%, IQR 96·5-98·9; mean 95·2%, SD 9·1). Positive samples by comparator methods usually had higher molecular quantities of pathogens than did negative samples, across almost all platforms and for most pathogens (pMolecular diagnostic tests can be implemented successfully and with fidelity across laboratories around the world. In the case of diarrhoea, these techniques can detect pathogens with high sensitivity and ascribe diarrhoeal associations based on quantification, including in mixed infections, providing rich and unprecedented measurements of infectious causes. Bill & Melinda Gates Foundation Next Generation Molecular Diagnostics Project. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Species-specific nested PCR as a diagnostic tool for Brucella ovis infection in rams

    Directory of Open Access Journals (Sweden)

    L.F. Costa

    2013-02-01

    Full Text Available The aim of the present study was to evaluate a species-specific nested PCR based on a previously described species-specific PCR for detection of B. ovis in semen and urine samples of experimentally infected rams. The performance of the species-specific nested PCR was compared with the results of a genus-specific PCR. Fourteen rams were experimentally infected with the Brucella ovis REO 198 strain and samples of semen and urine were collected every week up to 180 days post infection. Out of 83 semen samples collected, 42 (50.6% were positive for the species-specific nested PCR, and 23 (27.7% were positive for the genus-specific PCR. Out of 75 urine samples, 49 (65.3% were positive for the species-specific nested PCR, whereas 11 (14.6% were genus-specific PCR positive. Species-specific nested PCR was significantly more sensitive (P<0.001 than the genus-specific PCR in semen and urine from experimentally infected rams. In conclusion, the species-specific nested PCR developed in this study may be used as a diagnostic tool for the detection of B. ovis in semen and urine samples from suspected rams.

  14. Dilution testing using rapid diagnostic tests in a HIV diagnostic algorithm: a novel alternative for confirmation testing in resource limited settings.

    Science.gov (United States)

    Shanks, Leslie; Siddiqui, M Ruby; Abebe, Almaz; Piriou, Erwan; Pearce, Neil; Ariti, Cono; Masiga, Johnson; Muluneh, Libsework; Wazome, Joseph; Ritmeijer, Koert; Klarkowski, Derryck

    2015-05-14

    Current WHO testing guidelines for resource limited settings diagnose HIV on the basis of screening tests without a confirmation test due to cost constraints. This leads to a potential risk of false positive HIV diagnosis. In this paper, we evaluate the dilution test, a novel method for confirmation testing, which is simple, rapid, and low cost. The principle of the dilution test is to alter the sensitivity of a rapid diagnostic test (RDT) by dilution of the sample, in order to screen out the cross reacting antibodies responsible for falsely positive RDT results. Participants were recruited from two testing centres in Ethiopia where a tiebreaker algorithm using 3 different RDTs in series is used to diagnose HIV. All samples positive on the initial screening RDT and every 10th negative sample underwent testing with the gold standard and dilution test. Dilution testing was performed using Determine™ rapid diagnostic test at 6 different dilutions. Results were compared to the gold standard of Western Blot; where Western Blot was indeterminate, PCR testing determined the final result. 2895 samples were recruited to the study. 247 were positive for a prevalence of 8.5 % (247/2895). A total of 495 samples underwent dilution testing. The RDT diagnostic algorithm misclassified 18 samples as positive. Dilution at the level of 1/160 was able to correctly identify all these 18 false positives, but at a cost of a single false negative result (sensitivity 99.6 %, 95 % CI 97.8-100; specificity 100 %, 95 % CI: 98.5-100). Concordance between the gold standard and the 1/160 dilution strength was 99.8 %. This study provides proof of concept for a new, low cost method of confirming HIV diagnosis in resource-limited settings. It has potential for use as a supplementary test in a confirmatory algorithm, whereby double positive RDT results undergo dilution testing, with positive results confirming HIV infection. Negative results require nucleic acid testing to rule out false

  15. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

    Science.gov (United States)

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

    2017-02-01

    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  16. Influenceof antimicrobial therapy on the sensitivity of legionella PCR - three case report

    Directory of Open Access Journals (Sweden)

    Renato Eržen

    2007-02-01

    Full Text Available Background: L. pneumophila is a possible causative agent of severe community and hospital acquired pneumonia. Available diagnostic tests have a lot of shortcomings. Detection of Legionella DNA with the PCR technique is a promissing new method allowing diagnosis within clinically useful time.Methods: Three cases of severe Legionella pneumonia were followed with the PCR technique, urinary antigen and serologic methods.Results: Diagnostic tests have different sensitivity and specificity and also different shortcomings. Serologic tests are unable to provide diagnosis within clinically useful time. Urinary antigen is specific just for L. pneumophila serotype 1. Antimicrobial treatment has impact on the sensitivity of Legionella PCR.Conclusions: Detection of L. pneumophila infection with the PCR technique in addition to urinary antigen testing is likely to be the best diagnostic tool for the detection of all species within a time frame that will affect clinical management.

  17. Usefulness of Two Aspergillus PCR Assays and Aspergillus Galactomannan and β-d-Glucan Testing of Bronchoalveolar Lavage Fluid for Diagnosis of Chronic Pulmonary Aspergillosis.

    Science.gov (United States)

    Urabe, Naohisa; Sakamoto, Susumu; Sano, Go; Suzuki, Junko; Hebisawa, Akira; Nakamura, Yasuhiko; Koyama, Kazuya; Ishii, Yoshikazu; Tateda, Kazuhiro; Homma, Sakae

    2017-06-01

    We evaluated the usefulness of an Aspergillus galactomannan (GM) test, a β-d-glucan (βDG) test, and two different Aspergillus PCR assays of bronchoalveolar lavage fluid (BALF) samples for the diagnosis of chronic pulmonary aspergillosis (CPA). BALF samples from 30 patients with and 120 patients without CPA were collected. We calculated the sensitivity, specificity, positive predictive value, negative predictive value, positive likelihood ratio, negative likelihood ratio, and diagnostic odds ratio for each test individually and in combination with other tests. The optical density index values, as determined by receiver operating characteristic analysis, for the diagnosis of CPA were 0.5 and 100 for GM and βDG testing of BALF, respectively. The sensitivity and specificity of the GM test, βDG test, and PCR assays 1 and 2 were 77.8% and 90.0%, 77.8% and 72.5%, 86.7% and 84.2%, and 66.7% and 94.2%, respectively. A comparison of the PCR assays showed that PCR assay 1 had a better sensitivity, a better negative predictive value, and a better negative likelihood ratio and PCR assay 2 had a better specificity, a better positive predictive value, and a better positive likelihood ratio. The combination of the GM and βDG tests had the highest diagnostic odds ratio. The combination of the GM and βDG tests on BALF was more useful than any single test for diagnosing CPA. Copyright © 2017 American Society for Microbiology.

  18. Comparative Evaluation Of Conventional Rt-pcr And Real-time Rt-pcr (rrt-pcr) For Detection Of Avian Metapneumovirus Subtype A [comparação Entre As Técnicas De Rt-pcr Convencional E Rt-pcr Em Tempo Real Para A Detecção Do Metapneumovírus Aviários Subtipo A

    OpenAIRE

    Ferreira H.L.; Spilki F.R.; dos Santos M.M.A.B.; de Almeida R.S.; Arns C.W.

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  19. Latent class analysis of bulk tank milk PCR and ELISA testing for herd level diagnosis of Mycoplasma bovis

    DEFF Research Database (Denmark)

    Nielsen, Per Kantsø; Petersen, Mette Bisgaard; Nielsen, Liza Rosenbaum

    2015-01-01

    of this study was to evaluate the herd-level diagnostic performance of an indirect ELISA test by comparison to a real-time PCR test when diagnosing M. bovis in cattle herds of bulk tank milk. Bulk tank milk samples from Danish dairy herds (N=3437) were analysed with both the antibody detecting BIO K 302 M...

  20. Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

    Science.gov (United States)

    Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

    2003-12-01

    A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

  1. PCR testing for diagnosis of Ichthyophonus hoferi: comment on Hamazaki et al. (2013).

    Science.gov (United States)

    LaPatra, S E; Kocan, R M

    2013-11-06

    It is our opinion that Hamazaki et al. (2013; Dis Aquat Org 105:21-25) overstate the usefulness of PCR as a field diagnostic technique and underestimate the accuracy and utility of in vitro explant culture. In order for field diagnostic studies to be meaningful they should accurately and dependably identify the infected individuals within a population, both subclinical and clinical cases. Although explant culture, like most techniques, can miss some infected individuals, 'false positives' are impossible, unlike for cPCR based methodologies.

  2. A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

    Science.gov (United States)

    Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  3. Testing for Genetically Modified Foods Using PCR

    Science.gov (United States)

    Taylor, Ann; Sajan, Samin

    2005-01-01

    The polymerase chain reaction (PCR) is a Nobel Prize-winning technique that amplifies a specific segment of DNA and is commonly used to test for the presence of genetic modifications. Students use PCR to test corn meal and corn-muffin mixes for the presence of a promoter commonly used in genetically modified foods, the cauliflower mosaic virus 35S…

  4. Rapid antigen detection test for respiratory syncytial virus diagnosis as a diagnostic tool.

    Science.gov (United States)

    Mesquita, Flávio da Silva; Oliveira, Danielle Bruna Leal de; Crema, Daniela; Pinez, Célia Miranda Nunes; Colmanetti, Thaís Cristina; Thomazelli, Luciano Matsumia; Gilio, Alfredo Elias; Vieira, Sandra Elisabeth; Martinez, Marina Baquerizo; Botosso, Viviane Fongaro; Durigon, Edison Luiz

    The aim of this study was to evaluate the QuickVue ® RSV Test Kit (QUIDEL Corp, CA, USA) as a screening tool for respiratory syncytial virus in children with acute respiratory disease in comparison with the indirect immunofluorescence assay as gold standard. In Brazil, rapid antigen detection tests for respiratory syncytial virus are not routinely utilized as a diagnostic tool, except for the diagnosis of dengue and influenza. The authors retrospectively analyzed 486 nasopharyngeal aspirate samples from children under age 5 with acute respiratory infection, between December 2013 and August 2014, the samples were analyzed by indirect immunofluorescence assay and QuickVue ® RSV Test kit. Samples with discordant results were analyzed by real time PCR and nucleotide sequencing. From 313 positive samples by immunofluorescence assays, 282 (90%) were also positive by the rapid antigen detection test, two were positive only by rapid antigen detection test, 33 were positive only by immunofluorescence assays, and 171 were positive by both methods. The 35 samples with discordant results were analyzed by real time PCR; the two samples positive only by rapid antigen detection test and the five positive only by immunofluorescence assays were also positive by real time PCR. There was no relation between the negativity by QuickVue ® RSV Test and viral load or specific strain. The QuickVue ® RSV Test showed sensitivity of 90%, specificity of 98.8%, predictive positive value of 99.3%, and negative predictive value of 94.6%, with accuracy of 93.2% and agreement κ index of 0.85 in comparison to immunofluorescence assay. This study demonstrated that the QuickVue ® RSV Test Kit can be effective in early detection of Respiratory syncytial virus in nasopharyngeal aspirate and is reliable for use as a diagnostic tool in pediatrics. Copyright © 2016 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  5. Rapid antigen detection test for respiratory syncytial virus diagnosis as a diagnostic tool,

    Directory of Open Access Journals (Sweden)

    Flávio da Silva Mesquita

    Full Text Available Abstract Objective: The aim of this study was to evaluate the QuickVue® RSV Test Kit (QUIDEL Corp, CA, USA as a screening tool for respiratory syncytial virus in children with acute respiratory disease in comparison with the indirect immunofluorescence assay as gold standard. In Brazil, rapid antigen detection tests for respiratory syncytial virus are not routinely utilized as a diagnostic tool, except for the diagnosis of dengue and influenza. Methods: The authors retrospectively analyzed 486 nasopharyngeal aspirate samples from children under age 5 with acute respiratory infection, between December 2013 and August 2014, the samples were analyzed by indirect immunofluorescence assay and QuickVue® RSV Test kit. Samples with discordant results were analyzed by real time PCR and nucleotide sequencing. Results: From 313 positive samples by immunofluorescence assays, 282 (90% were also positive by the rapid antigen detection test, two were positive only by rapid antigen detection test, 33 were positive only by immunofluorescence assays, and 171 were positive by both methods. The 35 samples with discordant results were analyzed by real time PCR; the two samples positive only by rapid antigen detection test and the five positive only by immunofluorescence assays were also positive by real time PCR. There was no relation between the negativity by QuickVue® RSV Test and viral load or specific strain. The QuickVue® RSV Test showed sensitivity of 90%, specificity of 98.8%, predictive positive value of 99.3%, and negative predictive value of 94.6%, with accuracy of 93.2% and agreement κ index of 0.85 in comparison to immunofluorescence assay. Conclusions: This study demonstrated that the QuickVue® RSV Test Kit can be effective in early detection of Respiratory syncytial virus in nasopharyngeal aspirate and is reliable for use as a diagnostic tool in pediatrics.

  6. 42 CFR 410.32 - Diagnostic x-ray tests, diagnostic laboratory tests, and other diagnostic tests: Conditions.

    Science.gov (United States)

    2010-10-01

    ... Procedural Terminology published by the American Medical Association. (3) Levels of supervision. Except where... & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES MEDICARE PROGRAM SUPPLEMENTARY MEDICAL INSURANCE (SMI) BENEFITS Medical and Other Health Services § 410.32 Diagnostic x-ray tests, diagnostic laboratory...

  7. Schistosoma real-time PCR as diagnostic tool for international travellers and migrants.

    Science.gov (United States)

    Cnops, Lieselotte; Tannich, Egbert; Polman, Katja; Clerinx, Jan; Van Esbroeck, Marjan

    2012-10-01

    To evaluate the use of a genus-specific PCR that combines high sensitivity with the detection of different Schistosoma species for diagnosis in international travellers and migrants in comparison to standard microscopy. The genus-specific real-time PCR was developed to target the 28S ribosomal RNA gene of the major human Schistosoma species. It was validated for analytical specificity and reproducibility and demonstrated an analytical sensitivity of 0.2 eggs per gram of faeces. Its diagnostic performance was further evaluated on 152 faecal, 32 urine and 38 serum samples from patients presenting at the outpatient clinic of the Institute of Tropical Medicine in Antwerp (Belgium). We detected Schistosoma DNA in 76 faecal (50.0%) and five urine (15.6%) samples of which, respectively, nine and one were not detected by standard microscopy. Only two of the 38 serum samples of patients with confirmed schistosomiasis were positive with the presently developed PCR. Sequence analysis on positive faecal samples allowed identification of the Schistosoma species complex. The real-time PCR is highly sensitive and may offer added value in diagnosing imported schistosomiasis. The genus-specific PCR can detect all schistosome species that are infectious to humans and performs very well with faeces and urine, but not in serum. © 2012 Blackwell Publishing Ltd.

  8. Comparison of rapid diagnostic tests to detect Mycobacterium avium subsp. paratuberculosis disseminated infection in bovine liver.

    Science.gov (United States)

    Zarei, Mehdi; Ghorbanpour, Masoud; Tajbakhsh, Samaneh; Mosavari, Nader

    2017-08-01

    Mycobacterium avium subsp. paratuberculosis (MAP) causes Johne's disease, a chronic enteritis in cattle and other domestic and wild ruminants. The presence of MAP in tissues other than intestines and associated lymph nodes, such as meat and liver, is a potential public health concern. In the present study, the relationship between the results of rapid diagnostic tests of the Johne's disease, such as serum ELISA, rectal scraping PCR, and acid-fast staining, and the presence of MAP in liver was evaluated. Blood, liver, and rectal scraping samples were collected from 200 slaughtered cattle with unknown Johne's disease status. ELISA was performed to determine the MAP antibody activity in the serum. Acid-fast staining was performed on rectal scraping samples, and PCR was performed on rectal scraping and liver samples. PCR-positive liver samples were used for mycobacterial culture. Overall, the results of this study demonstrated that MAP can be detected and cultured from liver of slaughtered cattle and rapid diagnostic tests of Johne's disease have limited value in detecting cattle with MAP infection in liver. These findings show that the presence of MAP in liver tissue may occur in cows with negative results for rapid diagnostic tests and vice versa. Hence, liver might represent another possible risk of human exposure to MAP. Given concerns about a potential zoonotic role for MAP, these results show the necessity to find new methods for detecting cattle with MAP disseminated infection.

  9. Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

    DEFF Research Database (Denmark)

    Munch, M.; Nielsen, L.P.; Handberg, Kurt

    2001-01-01

    A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

  10. [Tropheryma whipplei and Whipple disease: false positive PCR detections of Tropheryma whipplei in diagnostic samples are rare].

    Science.gov (United States)

    Le Scanff, J; Gaultier, J B; Durand, D Vital; Durieu, I; Celard, M; Benito, Y; Vandenesch, F; Rousset, H

    2008-11-01

    PCR can be used to detect T. whipplei (Tw) in samples from variable tissue types and body fluids. We report clinical, evolutive characteristics and final diagnosis in patients with positive Tw PCR assay. Retrospective study of Tw PCR realized since 10years in a microbiology laboratory. Twenty-five Tw PCR assays were positive among 200 realized. Diagnosis was not confirmed in six cases. One patient was missing for follow up. Eighteen patients presented with Whipple's disease. Among these 18 patients, 14 had a classic Whipple's disease, three patients presented an endocarditis and one patient isolated neurological manifestations. Ten patients presented fever, seven a weight loss and 12 joint involvement. Four patients presented cutaneous manifestations, only six had gastrointestinal symptoms. Neurological involvement was reported in five cases, pulmonary symptoms in four cases, cardiac involvement in six cases and ocular signs in two cases. Anemia was reported in four patients and elevated levels of acute-phase reactants in 14 cases. Positive predictive value of Tw PCR for Whipple's disease diagnosis was 75%. Thirteen patients had a good evolution with antibiotics. Three patients presented recurrence and two cases with cardiovascular involvement died. Whipple's disease is rare but often mentioned in internist experience. The diagnosis should be every time confirmed. Tw PCR assay is an important diagnostic tool but is not sufficient to establish the diagnosis and must be interpreted with histopathology and immunohistochemical testing results.

  11. Preanalytical blood sample workup for cell-free DNA analysis using Droplet Digital PCR for future molecular cancer diagnostics.

    Science.gov (United States)

    van Ginkel, Joost H; van den Broek, Daan A; van Kuik, Joyce; Linders, Dorothé; de Weger, Roel; Willems, Stefan M; Huibers, Manon M H

    2017-10-01

    In current molecular cancer diagnostics, using blood samples of cancer patients for the detection of genetic alterations in plasma (cell-free) circulating tumor DNA (ctDNA) is an emerging practice. Since ctDNA levels in blood are low, highly sensitive Droplet Digital PCR (ddPCR) can be used for detecting rare mutational targets. In order to perform ddPCR on blood samples, a standardized procedure for processing and analyzing blood samples is necessary to facilitate implementation into clinical practice. Therefore, we assessed the technical sample workup procedure for ddPCR on blood plasma samples. Blood samples from healthy individuals, as well as lung cancer patients were analyzed. We compared different methods and protocols for sample collection, storage, centrifugation, isolation, and quantification. Cell-free DNA (cfDNA) concentrations of several wild-type targets and BRAF and EGFR-mutant ctDNA concentrations quantified by ddPCR were primary outcome measurements. Highest cfDNA concentrations were measured in blood collected in serum tubes. No significant differences in cfDNA concentrations were detected between various time points of up to 24 h until centrifugation. Highest cfDNA concentrations were detected after DNA isolation with the Quick cfDNA Serum & Plasma Kit, while plasma isolation using the QIAamp Circulating Nucleic Acid Kit yielded the most consistent results. DdPCR results on cfDNA are highly dependent on multiple factors during preanalytical sample workup, which need to be addressed during the development of this diagnostic tool for cancer diagnostics in the future. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  12. A comparative kinetic RT/-PCR strategy for the quantitation of mRNAs in microdissected human renal biopsy specimens.

    Science.gov (United States)

    Del Prete, D; Forino, M; Gambaro, G; D'Angelo, A; Baggio, B; Anglani, F

    1998-01-01

    Molecular biology techniques, to be applicable to a diagnostic renal biopsy specimen, should (1) be highly sensitive to be performed on a very small quantity of tissue; (2) be quantitative because they have to analyze genes normally expressed in the tissue and (3) allow the analysis of as large a number of genes as possible. Among different methods, only the reverse-transcriptase polymerase chain reaction (RT/-PCR) might comply with previous requisites, but the few RT/-PCR examples on renal biopsies in the literature do not allow starting RNA quantification and quality control; furthermore they have the drawback of analyzing only few genes. In an ongoing study to assess the expression of a number of genes in glomeruli and in tubulointerstitium of patients with different nephropathies, we developed a comparative RT/-PCR kinetic strategy based on the purification and quantification of total glomerular and tubulointerstitial RNA and on the use of an internal standard, the housekeeping gene G3PDH. We demonstrate that in microdissected diagnostic renal biopsies (1) glomerular and interstitial starting RNA can be quantified; (2) the G3PDH gene may be used both as an internal standard and as an indirect marker of RNA integrity; (3) as low as 28 ng of total RNA is sufficient to obtain PCR products of eight genes, and (4) it is worth to operate on microdissected biopsy specimens because of the different expression of genes in the two renal compartments.

  13. Comparison of bacterial culture and qPCR testing of rectal and pen floor samples as diagnostic approaches to detect enterotoxic Escherichia coli in nursery pigs

    DEFF Research Database (Denmark)

    Weber, N. R.; Nielsen, J. P.; Hjulsager, Charlotte Kristiane

    2017-01-01

    Enterotoxigenic E. coli (ETEC) are a major cause of diarrhoea in weaned pigs. The objective of this study was to evaluate the agreement at pen level among three different diagnostic approaches for the detection of ETEC in groups of nursery pigs with diarrhoea. The diagnostic approaches used were...... to determine the quantity of F18 and F4 genes. The study was carried out in three Danish pig herds and included 31 pens with a pen-level diarrhoea prevalence of > 25%, as well as samples from 93 diarrhoeic nursery pigs from these pens. All E. coli isolates were analysed by PCR and classified as ETEC when genes...... was observed between the detection of ETEC by bacterial culture and qPCR in the same pen floor sample in 26 (83.9%, Kappa = 0.679) pens. Conclusion: We observed an acceptable agreement for the detection of ETEC-positive diarrhoeic nursery pigs in pen samples for both bacterial culture of pen floor samples...

  14. Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

    Science.gov (United States)

    Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

    2003-01-01

    Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

  15. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  16. Preanalytical blood sample workup for cell-free DNA analysis using Droplet Digital PCR for future molecular cancer diagnostics

    NARCIS (Netherlands)

    van Ginkel, Joost H.; van den Broek, Daan A.; van Kuik, Joyce; Linders, Dorothé; de Weger, Roel; Willems, Stefan M.; Huibers, Manon M.H.

    2017-01-01

    In current molecular cancer diagnostics, using blood samples of cancer patients for the detection of genetic alterations in plasma (cell-free) circulating tumor DNA (ctDNA) is an emerging practice. Since ctDNA levels in blood are low, highly sensitive Droplet Digital PCR (ddPCR) can be used for

  17. Diagnosis of Caprine Arthritis Encephalitis Virus infection in dairy goats by ELISA, PCR and Viral Culture.

    Science.gov (United States)

    Panneum, S; Rukkwamsuk, T

    2017-03-01

    For preventive and control strategies of Caprine Arthritis Encephalitis Virus (CAEV) infection in dairy goats, performance of the available diagnostic tests was described as one of the most important and necessary aspects. The study aimed at evaluating the diagnostic test performance, including PCR, ELISA and viral culture, for CAEV infection in dairy goats in Thailand. Blood samples of 29 dairy goats from five low- to medium-prevalence herds and one very low-prevalence herd were collected for PCR and ELISA methods. The performance of these two diagnostic methods was evaluated by comparing with cytopathic effects (CPE) in the co-cultivation of CAEV and primary synovial cells. Results indicated that sensitivity, specificity were, respectively, 69.6%, 100%, for PCR; and 95.7%, 83.3% for ELISA. The PCR assay tended to have lower sensitivity and higher specificity than ELISA. When multiple tests were applied, parallel testing provided sensitivity and specificity of 98.7% and 83.3%, while series testing showed sensitivity and specificity of 66.6% and 100% respectively. These results indicated that combination of ELISA and PCR provided some advantages and possibly offered optimal methods to detect CAEV-infected goats. Kappa value of the agreement between PCR and ELISA test was 0.34, indicating fair agreement. Regarding the possibility of antigenic variation between CAEV strains used in both PCR and ELISA assays, the actual circulating CAEV strain should be reviewed in order to develop and enhance the diagnostic tests using the CAE viral antigens derived from specific local strains of Thailand.

  18. A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

    Directory of Open Access Journals (Sweden)

    Vanessa Suin

    2014-01-01

    Full Text Available A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR, based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  19. Diagnostic performance of Schistosoma real-time PCR in urine samples from Kenyan children infected with Schistosoma haematobium

    DEFF Research Database (Denmark)

    Vinkeles Melchers, Natalie V. S.; van Dam, Govert J.; Shaproski, David

    2014-01-01

    treatment. METHODOLOGY: Previously collected urine samples (N = 390) from 114 preselected proven parasitological and/or clinical S. haematobium positive Kenyan schoolchildren were analyzed by a Schistosoma internal transcribed spacer-based real-time PCR after 14 years of storage. Pre-treatment day......, respectively. Based on the 'gold standard', PCR showed high sensitivity (>92%) as compared to >31% sensitivity for microscopy, both pre- and post-treatment. CONCLUSIONS/SIGNIFICANCE: Detection and quantification of Schistosoma DNA in urine by real-time PCR was shown to be a powerful and specific diagnostic...

  20. A real-time PCR antibiogram for drug-resistant sepsis.

    Directory of Open Access Journals (Sweden)

    John R Waldeisen

    Full Text Available Current molecular diagnostic techniques for susceptibility testing of septicemia rely on genotyping for the presence of known resistance cassettes. This technique is intrinsically vulnerable due to the inability to detect newly emergent resistance genes. Traditional phenotypic susceptibility testing has always been a superior method to assay for resistance; however, relying on the multi-day growth period to determine which antimicrobial to administer jeopardizes patient survival. These factors have resulted in the widespread and deleterious use of broad-spectrum antimicrobials. The real-time PCR antibiogram, described herein, combines universal phenotypic susceptibility testing with the rapid diagnostic capabilities of PCR. We have developed a procedure that determines susceptibility by monitoring pathogenic load with the highly conserved 16S rRNA gene in blood samples exposed to different antimicrobial drugs. The optimized protocol removes heme and human background DNA from blood, which allows standard real-time PCR detection systems to be employed with high sensitivity (<100 CFU/mL. Three strains of E. coli, two of which were antimicrobial resistant, were spiked into whole blood and exposed to three different antibiotics. After real-time PCR-based determination of pathogenic load, a ΔC(t<3.0 between untreated and treated samples was found to indicate antimicrobial resistance (P<0.01. Minimum inhibitory concentration was determined for susceptible bacteria and pan-bacterial detection was demonstrated with 3 gram-negative and 2 gram-positive bacteria. Species identification was performed via analysis of the hypervariable amplicons. In summary, we have developed a universal diagnostic phenotyping technique that assays for the susceptibility of drug-resistant septicemia with the speed of PCR. The real-time PCR antibiogram achieves detection, susceptibility testing, minimum inhibitory concentration determination, and identification in less than 24

  1. [PCR testing for Bordetella pertussis in household contacts as a diagnostic tool for atypical whooping cough in unvaccinated young infants].

    Science.gov (United States)

    Cosnes-Lambe, Cecile; Raymond, Josette; Vallet, Christelle; Armengaud, Jean-Baptiste; Bosdure, Emmanuelle; Catalano-Pons, Charlotte; Chalumeau, Martin; El Hajje, Marie-Joelle; Moulin, Florence; de Suremain, Nathalie; Reglier-Poupet, Hélène; Poyart, Claire; Gendrel, Dominique

    2008-10-01

    False-negative findings of polymerase chain reaction (PCR) for genuine pertussis as well as the numerous atypical forms of whooping cough make it difficult to diagnose this disease in young babies. For two years, real-time PCR was performed to test for Bordetella pertussis in 86 infants younger than 6 months hospitalized for apnea or paroxysmal and/or vomiting cough and in 205 of their household contacts, whether or not they coughed. Group 1 included 30 infants for whom PCR detected B. pertussis (25 of whom were also RSV+). PCR was also positive for at least one household contact in 25/30 families. This group included 16 babies with apnea and 12 who developed a whooping cough during follow-up. Group 2 comprised 12 infants whose PCR was negative while at least one household contact had positive results. Five of these infants had severe apnea and 6 developed a whooping cough. Group 3 included 44 infants (28 RSV +) for whom PCR was negative in the index case and in the household contacts: none developed a whooping cough during follow-up. Only 3 of the 54 positive household contacts had a paroxysmal cough or a typical whooping cough and 12 had no cough at all. Positive PCR in a household contact, symptomatic or not, is helpful for the diagnosis of atypical whooping cough in young infants.

  2. Beyond Diagnostic Accuracy: The Clinical Utility of Diagnostic Tests

    NARCIS (Netherlands)

    Bossuyt, Patrick M. M.; Reitsma, Johannes B.; Linnet, Kristian; Moons, Karel G. M.

    2012-01-01

    Like any other medical technology or intervention, diagnostic tests should be thoroughly evaluated before their introduction into daily practice. Increasingly, decision makers, physicians, and other users of diagnostic tests request more than simple measures of a test's analytical or technical

  3. Evaluating the accuracy of molecular diagnostic testing for canine visceral leishmaniasis using latent class analysis.

    Directory of Open Access Journals (Sweden)

    Manuela da Silva Solcà

    Full Text Available Host tissues affected by Leishmania infantum have differing degrees of parasitism. Previously, the use of different biological tissues to detect L. infantum DNA in dogs has provided variable results. The present study was conducted to evaluate the accuracy of molecular diagnostic testing (qPCR in dogs from an endemic area for canine visceral leishmaniasis (CVL by determining which tissue type provided the highest rate of parasite DNA detection. Fifty-one symptomatic dogs were tested for CVL using serological, parasitological and molecular methods. Latent class analysis (LCA was performed for accuracy evaluation of these methods. qPCR detected parasite DNA in 100% of these animals from at least one of the following tissues: splenic and bone marrow aspirates, lymph node and skin fragments, blood and conjunctival swabs. Using latent variable as gold standard, the qPCR achieved a sensitivity of 95.8% (CI 90.4-100 in splenic aspirate; 79.2% (CI 68-90.3 in lymph nodes; 77.3% (CI 64.5-90.1 in skin; 75% (CI 63.1-86.9 in blood; 50% (CI 30-70 in bone marrow; 37.5% (CI 24.2-50.8 in left-eye; and 29.2% (CI 16.7-41.6 in right-eye conjunctival swabs. The accuracy of qPCR using splenic aspirates was further evaluated in a random larger sample (n = 800, collected from dogs during a prevalence study. The specificity achieved by qPCR was 76.7% (CI 73.7-79.6 for splenic aspirates obtained from the greater sample. The sensitivity accomplished by this technique was 95% (CI 93.5-96.5 that was higher than those obtained for the other diagnostic tests and was similar to that observed in the smaller sampling study. This confirms that the splenic aspirate is the most effective type of tissue for detecting L. infantum infection. Additionally, we demonstrated that LCA could be used to generate a suitable gold standard for comparative CVL testing.

  4. Application and evaluation of RT-PCR-ELISA for the nucleoprotein and RT-PCR for detection of low-pathogenic H5 and H7 subtypes of avian influenza virus

    DEFF Research Database (Denmark)

    Dybkær, Karen; Munch, Mette; Handberg, Kurt J.

    2004-01-01

    Three 1-tube Reverse Transcriptase Polymerase Chain Reactions (RT-PCR) directed against the genes encoding the nucleoprotein (NP) and the H5 and H7 hemagglutinin (HA) gene, respectively, were used for detection of avian influenza virus (AIV) in various specimens. A total of 1,040 samples...... originating from chickens experimentally infected with 2 different low pathogenic avian influenza viruses, from domestic ducks and from wild aquatic birds were examined. The outcome of 1) the universal AIV RT-PCR including a PCR-enzyme-linked immunosorbent assay (ELISA) procedure directed against NP (NP RT...

  5. Bench-top validation testing of selected immunological and molecular Renibacterium salmoninarum diagnostic assays by comparison with quantitative bacteriological culture

    Science.gov (United States)

    Elliott, D.G.; Applegate, L.J.; Murray, A.L.; Purcell, M.K.; McKibben, C.L.

    2013-01-01

    No gold standard assay exhibiting error-free classification of results has been identified for detection of Renibacterium salmoninarum, the causative agent of salmonid bacterial kidney disease. Validation of diagnostic assays for R. salmoninarum has been hindered by its unique characteristics and biology, and difficulties in locating suitable populations of reference test animals. Infection status of fish in test populations is often unknown, and it is commonly assumed that the assay yielding the most positive results has the highest diagnostic accuracy, without consideration of misclassification of results. In this research, quantification of R. salmoninarum in samples by bacteriological culture provided a standardized measure of viable bacteria to evaluate analytical performance characteristics (sensitivity, specificity and repeatability) of non-culture assays in three matrices (phosphate-buffered saline, ovarian fluid and kidney tissue). Non-culture assays included polyclonal enzyme-linked immunosorbent assay (ELISA), direct smear fluorescent antibody technique (FAT), membrane-filtration FAT, nested polymerase chain reaction (nested PCR) and three real-time quantitative PCR assays. Injection challenge of specific pathogen-free Chinook salmon, Oncorhynchus tshawytscha (Walbaum), with R. salmoninarum was used to estimate diagnostic sensitivity and specificity. Results did not identify a single assay demonstrating the highest analytical and diagnostic performance characteristics, but revealed strengths and weaknesses of each test.

  6. A quantitative reverse-transcriptase PCR assay for the assessment of drug activities against intracellular Theileria annulata schizonts

    Directory of Open Access Journals (Sweden)

    Isabel Hostettler

    2014-12-01

    Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.

  7. Diagnostic performances of two rapid tests for detection of feline leukemia virus antigen in sera of experimentally feline leukemia virus-infected cats

    Directory of Open Access Journals (Sweden)

    Matthew R Krecic

    2017-12-01

    Full Text Available Objectives The objective of this study was to compare the diagnostic sensitivities and specificities of WITNESS FeLV-FIV (Zoetis and SNAP FIV/FeLV Combo Test (IDEXX for the detection of FeLV p27 antigen in the sera of experimentally feline leukemia virus (FeLV-infected cats. Methods Diagnostic sensitivities of WITNESS and SNAP were determined through testing of 47 serum samples collected from cats day 56 post-experimental infection with a virulent FeLV Rickard strain. Successful experimental infection was confirmed based on observation of FeLV antigen and proviral DNA in anti-coagulated (EDTA whole-blood samples by immunofluorescent antibody (IFA test and PCR, respectively. Diagnostic specificities of both tests were determined through testing of sera of 92 laboratory-housed, non-FeLV-exposed specific pathogen-free (SPF cats. Results Forty-one of 47 blood samples were IFA positive, whereas all 47 samples were PCR positive. All 92 non-FeLV-infected SPF cats were IFA and PCR negative. In comparison to IFA as the reference method, both WITNESS and SNAP tests yielded equivalent sensitivities and specificities of 100% and 97.8%, respectively. In comparison to PCR as the reference method, both WITNESS and SNAP tests likewise performed equivalently, with sensitivities and specificities of 91.5% and 100%, respectively. Conclusions and relevance Sensitivity and specificity of WITNESS FeLV-FIV for identifying FeLV p27 antigen in the sera of these experimentally FeLV-infected and non-FeLV-exposed SPF cats equaled those of the SNAP FIV/FeLV Combo Test. However, all positive results, regardless of the point-of-care test used, should be confirmed before making clinical decisions such as segregation from other cats or euthanasia.

  8. Multiplex PCR from Menstrual Blood: A Non-Invasive Cost-Effective Approach to Reduce Diagnostic Dilemma for Genital Tuberculosis.

    Science.gov (United States)

    Paine, Suman K; Basu, Analabha; Choudhury, Rajib Gon; Bhattacharya, Basudev; Chatterjee, Sidhartha; Bhattacharya, Chandra

    2018-03-16

    Genital tuberculosis (GTB) is a potent contributor to irreversible damage to the reproductive system and infertility in females. As no gold standard diagnostic tool is yet available, clinical suspicion and relatively insensitive approaches such as histopathology, laparoscopy and hysterosalpingogram are currently critical determinants in the diagnosis of GTB. Although a polymerase chain reaction (PCR)-based assay using endometrial tissue seems promising, sampling does require an invasive procedure. We hypothesized that menstrual blood may provide an alternate non-invasive source of samples for PCR-based GTB diagnosis. We enrolled 195 women with primary infertility in whom GTB was suspected. We obtained ethics committee approval from our institution and written informed consent from subjects. Endometrial tissue and menstrual blood was collected from the subjects and culture, histopathology, and multiplex PCR with both sample type was performed for each subject. The sensitivity and specificity of multiplex PCR was, respectively, 90.2 and 86.1% for menstrual blood, 95.8 and 84.3% for endometrial tissue, and 64.8 and 93.2% for histopathology staining. A strong clinical suspicion aided with multiplex PCR using menstrual blood may significantly reduce the diagnostic dilemma for GTB diagnosis in a non-invasive, sensitive, rapid, and cost-effective manner.

  9. The effects of culture independent diagnostic testing on the diagnosis and reporting of enteric bacterial pathogens in Queensland, 2010 to 2014.

    Science.gov (United States)

    May, Fiona J; Stafford, Russell J; Carroll, Heidi; Robson, Jennifer Mb; Vohra, Renu; Nimmo, Graeme R; Bates, John; Kirk, Martyn D; Fearnley, Emily J; Polkinghorne, Benjamin G

    2017-09-01

    Changes in diagnostic laboratory testing procedures can impact on the number of cases notified and the public health surveillance of enteric pathogens. Culture independent diagnostic testing using a multiplex polymerase chain reaction (PCR) test was introduced for the rapid detection of bacterial enteric pathogens in pathology laboratories in Queensland, Australia, from late 2013 onwards. We conducted a retrospective descriptive study using laboratory data to assess the impact of the introduction of PCR testing on four common enteric pathogens, Salmonella, Campylobacter, Shigella and Yersinia, in Queensland between 2010 and 2014. The number of stool specimens tested and the proportion positive for each of the four pathogens increased in 2014 after the introduction of culture independent diagnostic testing. Among the specimens tested by both PCR and culture, 12% of Salmonella positive stools, 36% of Campylobacter positive stools, 74% of Shigella / enteroinvasive Escherichia coli positive stools and 65% of Yersinia positive stools were PCR positive only. Including those where culture was not performed, 19% of Salmonella positive stools, 44% of Campylobacter positive stools, 83% of Shigella positive stools and 79% of Yersinia positive stools had no cultured isolate available for further characterisation. The detection and tracking of foodborne and non-foodborne gastrointestinal outbreaks will become more difficult as culture independent diagnostic testing becomes more widespread. Until new techniques for characterisation of pathogens directly from clinical specimens have been developed, we recommend laboratories continue to culture specimens concurrently or reflexively with culture independent diagnostic tests. This work is copyright. You may download, display, print and reproduce the whole or part of this work in unaltered form for your own personal use or, if you are part of an organisation, for internal use within your organisation, but only if you or your

  10. Species-specific diagnostic assays for Bonamia ostreae and B. exitiosa in European flat oyster Ostrea edulis: conventional, real-time and multiplex PCR.

    Science.gov (United States)

    Ramilo, Andrea; Navas, J Ignacio; Villalba, Antonio; Abollo, Elvira

    2013-05-27

    Bonamia ostreae and B. exitiosa have caused mass mortalities of various oyster species around the world and co-occur in some European areas. The World Organisation for Animal Health (OIE) has included infections with both species in the list of notifiable diseases. However, official methods for species-specific diagnosis of either parasite have certain limitations. In this study, new species-specific conventional PCR (cPCR) and real-time PCR techniques were developed to diagnose each parasite species. Moreover, a multiplex PCR method was designed to detect both parasites in a single assay. The analytical sensitivity and specificity of each new method were evaluated. These new procedures were compared with 2 OIE-recommended methods, viz. standard histology and PCR-RFLP. The new procedures showed higher sensitivity than the OIE recommended ones for the diagnosis of both species. The sensitivity of tests with the new primers was higher using oyster gills and gonad tissue, rather than gills alone. The lack of a 'gold standard' prevented accurate estimation of sensitivity and specificity of the new methods. The implementation of statistical tools (maximum likelihood method) for the comparison of the diagnostic tests showed the possibility of false positives with the new procedures, although the absence of a gold standard precluded certainty. Nevertheless, all procedures showed negative results when used for the analysis of oysters from a Bonamia-free area.

  11. Evaluation of NGS and RT-PCR Methods for ALK Rearrangement in European NSCLC Patients: Results from the European Thoracic Oncology Platform Lungscape Project.

    Science.gov (United States)

    Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota; Smyth, Paul; Soltermann, Alex; Bubendorf, Lukas; Speel, Ernst-Jan; Marchetti, Antonio; Nonaka, Daisuke; Monkhorst, Kim; Hager, Henrik; Martorell, Miguel; Sejda, Aleksandra; Cheney, Richard; Hernandez-Losa, Javier; Verbeken, Eric; Weder, Walter; Savic, Spasenija; Di Lorito, Alessia; Navarro, Atilio; Felip, Enriqueta; Warth, Arne; Baas, Paul; Meldgaard, Peter; Blackhall, Fiona; Dingemans, Anne-Marie; Dienemann, Hendrik; Dziadziuszko, Rafal; Vansteenkiste, Johan; O'Brien, Cathal; Geiger, Thomas; Sherlock, Jon; Schageman, Jeoffrey; Dafni, Urania; Kammler, Roswitha; Kerr, Keith; Thunnissen, Erik; Stahel, Rolf; Peters, Solange

    2018-03-01

    The reported prevalence of ALK receptor tyrosine kinase gene (ALK) rearrangement in NSCLC ranges from 2% to 7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proved to be a reproducible and sensitive technique. Reverse-transcriptase polymerase chain reaction (RT-PCR) has also been advocated, and most recently, the advent of targeted next-generation sequencing (NGS) for ALK and other fusions has become possible. This study compares anaplastic lymphoma kinase (ALK) evaluation with all four techniques in resected NSCLC from the large European Thoracic Oncology Platform Lungscape cohort. A total of 96 cases from the European Thoracic Oncology Platform Lungscape iBiobank, with any ALK immunoreactivity were examined by FISH, central RT-PCR, and NGS. An H-score higher than 120 defines IHC positivity. RNA was extracted from the same formalin-fixed, paraffin-embedded tissues. For RT-PCR, primers covered the most frequent ALK translocations. For NGS, the Oncomine Solid Tumour Fusion Transcript Kit (Thermo Fisher Scientific, Waltham, MA) was used. The concordance was assessed using the Cohen κ coefficient (two-sided α ≤ 5%). NGS provided results for 77 of the 95 cases tested (81.1%), whereas RT-PCR provided results for 77 of 96 (80.2%). Concordance occurred in 55 cases of the 60 cases tested with all four methods (43 ALK negative and 12 ALK positive). Using ALK copositivity for IHC and FISH as the criterion standard, we derived a sensitivity for RT-PCR/NGS of 70.0%/85.0%, with a specificity of 87.1%/79.0%. When either RT-PCR or NGS was combined with IHC, the sensitivity remained the same, whereas the specificity increased to 88.7% and 83.9% respectively. NGS evaluation with the Oncomine Solid Tumour Fusion transcript kit and RT-PCR proved to have high sensitivity and specificity, advocating their use in routine practice. For maximal sensitivity and specificity, ALK status should be

  12. High-resolution melting PCR assay, applicable for diagnostics and screening studies, allowing detection and differentiation of several Babesia spp. infecting humans and animals.

    Science.gov (United States)

    Rozej-Bielicka, Wioletta; Masny, Aleksander; Golab, Elzbieta

    2017-10-01

    The goal of the study was to design a single tube PCR test for detection and differentiation of Babesia species in DNA samples obtained from diverse biological materials. A multiplex, single tube PCR test was designed for amplification of approximately 400 bp region of the Babesia 18S rRNA gene. Universal primers were designed to match DNA of multiple Babesia spp. and to have low levels of similarity to DNA sequences of other intracellular protozoa and Babesia hosts. The PCR products amplified from Babesia DNA isolated from human, dog, rodent, deer, and tick samples were subjected to high-resolution melting analysis for Babesia species identification. The designed test allowed detection and differentiation of four Babesia species, three zoonotic (B. microti, B. divergens, B. venatorum) and one that is generally not considered zoonotic-Babesia canis. Both detection and identification of all four species were possible based on the HRM curves of the PCR products in samples obtained from the following: humans, dogs, rodents, and ticks. No cross-reactivity with DNA of Babesia hosts or Plasmodium falciparum and Toxoplasma gondii was observed. The lack of cross-reactivity with P. falciparum DNA might allow using the assay in endemic malaria areas. The designed assay is the first PCR-based test for detection and differentiation of several Babesia spp. of medical and veterinary importance, in a single tube reaction. The results of the study show that the designed assay for Babesia detection and identification could be a practical and inexpensive tool for diagnostics and screening studies of diverse biological materials.

  13. Comparative evaluation of serum, FTA filter-dried blood and oral fluid as sample material for PRRSV diagnostics by RT-qPCR in a small-scale experimental study.

    Science.gov (United States)

    Steinrigl, Adolf; Revilla-Fernández, Sandra; Wodak, Eveline; Schmoll, Friedrich; Sattler, Tatjana

    2014-01-01

    Recently, research into alternative sample materials, such as oral fluid or filter-dried blood has been intensified, in order to facilitate cost-effective and animal-friendly sampling of individuals or groups of pigs for diagnostic purposes. The objective of this study was to compare the sensitivity of porcine reproductive and respiratory syndrome virus (PRRSV)-RNA detection by reverse transcription quantitative real-time PCR (RT-qPCR) in serum, FTA filter-dried blood and oral fluid sampled from individual pigs. Ten PRRSV negative pigs were injected with an EU-type PRRSV live vaccine. Blood and oral fluid samples were taken from each pig before, and 4, 7, 14 and 21 days after vaccination. All samples were then analyzed by PRRSV RT-qPCR. In serum, eight often pigs tested RT-qPCR positive at different time points post infection. Absolute quantification showed low serum PRRSV-RNA loads in most samples. In comparison to serum, sensitivity of PRRSV-RNA detection was strongly reduced in matched FTA filter-dried blood and in oral fluid from the same pigs. These results indicate that with low PRRSV-RNA loads the diagnostic sensitivity of PRRSV-RNA detection by RT-qPCR achieved with serum is currently unmatched by either FTA filter-dried blood or oral fluid.

  14. Testing the sensitivity of Nested PCR method to detect Aspergillus fumigates in experimentally infected Sputum samples

    International Nuclear Information System (INIS)

    Ramadan, A.; Soukkaria, S.

    2013-01-01

    Fungal infections caused by Aspergillus species generally are occupying a second place among invasive fungal infections in the world, especially A. fumigatus, which is considered the main cause of invasive Aspergillosis (IA). Although IA rarely infects immunocompetent individuals, however, it can lead to death in immunocompromised patients. Therefore, it is necessary to diagnose the infection early in order to treat the disease efficiently. However, the conventional diagnostic tools, currently used to detect infections, has low sensitivity and reliability. Polymerase chain reaction (PCR) technology distribution as a molecular and high sensitive technology has allowed us to make comparative study between sensitivity of traditional currently used diagnostic method and Nested-PCR, the result of the study of sputum samples that experimentally infected with different concentrations of A.fumigatus spores ramping from 10 to10 6 spore/ml, have high sensitivity and specificity of Nested-PCR in detecting the lower concentrations, comparing with traditional diagnostic method (culture on Sabouraud media) that were negative in all concetrations. (author)

  15. Comparing diagnostic tests on benefit-risk.

    Science.gov (United States)

    Pennello, Gene; Pantoja-Galicia, Norberto; Evans, Scott

    2016-01-01

    Comparing diagnostic tests on accuracy alone can be inconclusive. For example, a test may have better sensitivity than another test yet worse specificity. Comparing tests on benefit risk may be more conclusive because clinical consequences of diagnostic error are considered. For benefit-risk evaluation, we propose diagnostic yield, the expected distribution of subjects with true positive, false positive, true negative, and false negative test results in a hypothetical population. We construct a table of diagnostic yield that includes the number of false positive subjects experiencing adverse consequences from unnecessary work-up. We then develop a decision theory for evaluating tests. The theory provides additional interpretation to quantities in the diagnostic yield table. It also indicates that the expected utility of a test relative to a perfect test is a weighted accuracy measure, the average of sensitivity and specificity weighted for prevalence and relative importance of false positive and false negative testing errors, also interpretable as the cost-benefit ratio of treating non-diseased and diseased subjects. We propose plots of diagnostic yield, weighted accuracy, and relative net benefit of tests as functions of prevalence or cost-benefit ratio. Concepts are illustrated with hypothetical screening tests for colorectal cancer with test positive subjects being referred to colonoscopy.

  16. How to appraise a diagnostic test

    Directory of Open Access Journals (Sweden)

    Ramanitharan Manikandan

    2011-01-01

    Full Text Available Urologists frequently encounter problems in making a clinical diagnosis whose resolution requires the use of diagnostic tests. With an ever increasing choice of investigations being available, the urologist often has to decide which diagnostic test(s will best resolve the patient′s diagnostic problem. In this article, we aim to help the urologist understand how to critically appraise studies on diagnostic tests and make a rational choice. This article presents the guiding principles in scientifically assessing studies on diagnostic tests by proposing a clinical scenario. The authors describe a standardized protocol to assess the validity of the test and its relevance to the clinical problem that can help the urologist in decision making. The three important issues to be considered when evaluating the validity of the study are to identify how the study population was chosen, how the test was performed and whether there is a comparison to the gold standard test so as to confirm or refute the diagnosis. Then, the urologist would need to know the probability of the test in providing the correct diagnosis in an individual patient in order to decide about its utility in solving the diagnostic dilemma. By performing the steps described in this article, the urologist would be able to critically appraise diagnostic studies and draw meaningful conclusions about the investigations in terms of validity, results and its applicability to the patient′s problem. This would provide a scientific basis for using diagnostic tests for improving patient care.

  17. Bayesian modelling to estimate the test characteristics of coprology, coproantigen ELISA and a novel real-time PCR for the diagnosis of taeniasis.

    Science.gov (United States)

    Praet, Nicolas; Verweij, Jaco J; Mwape, Kabemba E; Phiri, Isaac K; Muma, John B; Zulu, Gideon; van Lieshout, Lisette; Rodriguez-Hidalgo, Richar; Benitez-Ortiz, Washington; Dorny, Pierre; Gabriël, Sarah

    2013-05-01

    To estimate and compare the performances of coprology, copro-Ag ELISA and real-time polymerase chain reaction assay (copro-PCR) for detection of Taenia solium tapeworm carriers. The three diagnostic tests were applied on 817 stool samples collected in two Zambian communities where taeniasis is endemic. A Bayesian approach was used to allow estimation of the test characteristics. Two (0.2%; 95% Confidence Interval (CI): 0-0.8), 67 (8.2%; 95% CI: 6.4-10.3) and 10 (1.2%; 95% CI: 0.5-2.2) samples were positive using coprology, copro-Ag ELISA and copro-PCR, respectively. Specificities of 99.9%, 92.0% and 99.0% were determined for coprology, copro-Ag ELISA and copro-PCR, respectively. Sensitivities of 52.5%, 84.5% and 82.7% were determined for coprology, copro-Ag ELISA and copro-PCR, respectively. We urge for additional studies exploring possible cross-reactions of the copro-Ag ELISA and for the use of more sensitive tests, such as copro-PCR, for the detection of tapeworm carriers, which is a key factor in controlling the parasite in endemic areas. © 2013 Blackwell Publishing Ltd.

  18. Simultaneous detection of five different DNA targets by real-time Taqman PCR using the Roche LightCycler480: Application in viral molecular diagnostics

    NARCIS (Netherlands)

    Molenkamp, Richard; van der Ham, Alwin; Schinkel, Janke; Beld, Marcel

    2007-01-01

    One of the most interesting aspects of real-time PCR based on the detection of fluorophoric labeled oligonucleotides is the possibility of being able to detect conveniently multiple targets in the same PCR reaction. Recently, Roche Diagnostics launched a real-time PCR platform, the LightCycler480

  19. Blood culture-negative endocarditis: Improving the diagnostic yield using new diagnostic tools.

    Science.gov (United States)

    Fournier, Pierre-Edouard; Gouriet, Frédérique; Casalta, Jean-Paul; Lepidi, Hubert; Chaudet, Hervé; Thuny, Franck; Collart, Frédéric; Habib, Gilbert; Raoult, Didier

    2017-11-01

    Blood culture-negative endocarditis (BCNE) may represent up to 70% of all endocarditis cases, depending on series. From 2001 to 2009, we implemented in our laboratory a multimodal diagnostic strategy for BCNE that included systematized testing of blood, and when available, valvular biopsy specimens using serological, broad range molecular, and histopathological assays. A causative microorganism was identified in 62.7% of patients.In this study from January 2010 to December 2015, in an effort to increase the number of identified causative microorganisms, we prospectively added to our diagnostic protocol specific real-time (RT) polymerase chain reaction (PCR) assays targeting various endocarditis agents, and applied them to all patients with BCNE admitted to the 4 public hospitals in Marseille, France.A total of 283 patients with BCNE were included in the study. Of these, 177 were classified as having definite endocarditis. Using our new multimodal diagnostic strategy, we identified an etiology in 138 patients (78.0% of cases). Of these, 3 were not infective (2.2%) and 1 was diagnosed as having Mycobacterium bovis BCG endocarditis. By adding specific PCR assays from blood and valvular biopsies, which exhibited a significantly greater sensitivity (P < 10) than other methods, causative agents, mostly enterococci, streptococci, and zoonotic microorganisms, were identified in an additional 27 patients (14 from valves only, 11 from blood only, and 2 from both). Finally, in another 107 patients, a pathogen was detected using serology in 37, valve culture in 8, broad spectrum PCR from valvular biopsies and blood in 19 and 2, respectively, immunohistochemistry from valves in 3, and a combination of several assays in 38.By adding specific RT-PCR assays to our systematic PCR testing of patients with BCNE, we increased the diagnostic efficiency by 24.3%, mostly by detecting enterococci and streptococci that had not been detected by other diagnostic methods, but also agents

  20. Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

    NARCIS (Netherlands)

    Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.

    2010-01-01

    Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

  1. Prospective comparison of the detection rates of human enterovirus and parechovirus RT-qPCR and viral culture in different pediatric specimens

    NARCIS (Netherlands)

    de Crom, S C M; Obihara, C C; de Moor, R A; Veldkamp, E J M; van Furth, A M; Rossen, J W A

    2013-01-01

    BACKGROUND: Reverse-transcriptase quantitative real-time polymerase chain reaction (RT-qPCR) has become the gold standard for the diagnosis of human enterovirus (EV) and parechovirus (HPeV) infections. The detection rate of RT-qPCR in different pediatric body specimens has not been compared

  2. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected...

  3. Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report

    Directory of Open Access Journals (Sweden)

    Lapadula Giuseppe

    2007-05-01

    Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.

  4. Detection of Echinococcus multilocularis by MC-PCR: evaluation of diagnostic sensitivity and specificity without gold standard

    Directory of Open Access Journals (Sweden)

    Helene Wahlström

    2016-03-01

    Full Text Available Introduction: A semi-automated magnetic capture probe-based DNA extraction and real-time PCR method (MC-PCR, allowing for a more efficient large-scale surveillance of Echinococcus multilocularis occurrence, has been developed. The test sensitivity has previously been evaluated using the sedimentation and counting technique (SCT as a gold standard. However, as the sensitivity of the SCT is not 1, test characteristics of the MC-PCR was also evaluated using latent class analysis, a methodology not requiring a gold standard. Materials and methods: Test results, MC-PCR and SCT, from a previous evaluation of the MC-PCR using 177 foxes shot in the spring (n=108 and autumn 2012 (n=69 in high prevalence areas in Switzerland were used. Latent class analysis was used to estimate the test characteristics of the MC-PCR. Although it is not the primary aim of this study, estimates of the test characteristics of the SCT were also obtained. Results and discussion: This study showed that the sensitivity of the MC-PCR was 0.88 [95% posterior credible interval (PCI 0.80–0.93], which was not significantly different than the SCT, 0.83 (95% PCI 0.76–0.88, which is currently considered as the gold standard. The specificity of both tests was high, 0.98 (95% PCI 0.94–0.99 for the MC-PCR and 0.99 (95% PCI 0.99–1 for the SCT. In a previous study, using fox scats from a low prevalence area, the specificity of the MC-PCR was higher, 0.999% (95% PCI 0.997–1. One reason for the lower estimate of the specificity in this study could be that the MC-PCR detects DNA from infected but non-infectious rodents eaten by foxes. When using MC-PCR in low prevalence areas or areas free from the parasite, a positive result in the MC-PCR should be regarded as a true positive. Conclusion: The sensitivity of the MC-PCR (0.88 was comparable to the sensitivity of SCT (0.83.

  5. Use of quantitative molecular diagnostic methods to identify causes of diarrhoea in children: a reanalysis of the GEMS case-control study.

    Science.gov (United States)

    Liu, Jie; Platts-Mills, James A; Juma, Jane; Kabir, Furqan; Nkeze, Joseph; Okoi, Catherine; Operario, Darwin J; Uddin, Jashim; Ahmed, Shahnawaz; Alonso, Pedro L; Antonio, Martin; Becker, Stephen M; Blackwelder, William C; Breiman, Robert F; Faruque, Abu S G; Fields, Barry; Gratz, Jean; Haque, Rashidul; Hossain, Anowar; Hossain, M Jahangir; Jarju, Sheikh; Qamar, Farah; Iqbal, Najeeha Talat; Kwambana, Brenda; Mandomando, Inacio; McMurry, Timothy L; Ochieng, Caroline; Ochieng, John B; Ochieng, Melvin; Onyango, Clayton; Panchalingam, Sandra; Kalam, Adil; Aziz, Fatima; Qureshi, Shahida; Ramamurthy, Thandavarayan; Roberts, James H; Saha, Debasish; Sow, Samba O; Stroup, Suzanne E; Sur, Dipika; Tamboura, Boubou; Taniuchi, Mami; Tennant, Sharon M; Toema, Deanna; Wu, Yukun; Zaidi, Anita; Nataro, James P; Kotloff, Karen L; Levine, Myron M; Houpt, Eric R

    2016-09-24

    Diarrhoea is the second leading cause of mortality in children worldwide, but establishing the cause can be complicated by diverse diagnostic approaches and varying test characteristics. We used quantitative molecular diagnostic methods to reassess causes of diarrhoea in the Global Enteric Multicenter Study (GEMS). GEMS was a study of moderate to severe diarrhoea in children younger than 5 years in Africa and Asia. We used quantitative real-time PCR (qPCR) to test for 32 enteropathogens in stool samples from cases and matched asymptomatic controls from GEMS, and compared pathogen-specific attributable incidences with those found with the original GEMS microbiological methods, including culture, EIA, and reverse-transcriptase PCR. We calculated revised pathogen-specific burdens of disease and assessed causes in individual children. We analysed 5304 sample pairs. For most pathogens, incidence was greater with qPCR than with the original methods, particularly for adenovirus 40/41 (around five times), Shigella spp or enteroinvasive Escherichia coli (EIEC) and Campylobactor jejuni o C coli (around two times), and heat-stable enterotoxin-producing E coli ([ST-ETEC] around 1·5 times). The six most attributable pathogens became, in descending order, Shigella spp, rotavirus, adenovirus 40/41, ST-ETEC, Cryptosporidium spp, and Campylobacter spp. Pathogen-attributable diarrhoeal burden was 89·3% (95% CI 83·2-96·0) at the population level, compared with 51·5% (48·0-55·0) in the original GEMS analysis. The top six pathogens accounted for 77·8% (74·6-80·9) of all attributable diarrhoea. With use of model-derived quantitative cutoffs to assess individual diarrhoeal cases, 2254 (42·5%) of 5304 cases had one diarrhoea-associated pathogen detected and 2063 (38·9%) had two or more, with Shigella spp and rotavirus being the pathogens most strongly associated with diarrhoea in children with mixed infections. A quantitative molecular diagnostic approach improved population

  6. Towards Modernizing the Characterization of Shock and Detonation Physics Performance via Novel Diagnostics and Tests

    Science.gov (United States)

    Salyer, Terry

    2017-06-01

    For the bulk of detonation performance experiments, a fairly basic set of diagnostic techniques has evolved as the standard for acquiring the necessary measurements. Gold standard techniques such as pin switches and streak cameras still produce the high-quality data required, yet much room remains for improvement with regard to ease of use, cost of fielding, breadth of data, and diagnostic versatility. Over the past several years, an alternate set of diagnostics has been under development to replace many of these traditional techniques. Pulse Correlation Reflectometry (PCR) is a capable substitute for pin switches with the advantage of obtaining orders of magnitude more data at a small fraction of the cost and fielding time. Spectrally Encoded Imaging (SEI) can replace most applications of streak camera with the advantage of imaging surfaces through a single optical fiber that are otherwise optically inaccessible. Such diagnostics advance the measurement state of the art, but even further improvements may come through revamping the standardized tests themselves such as the copper cylinder expansion test. At the core of this modernization, the aforementioned diagnostics play a significant role in revamping and improving the standard test suite for the present era. This research was performed under the auspices of the United States Department of Energy.

  7. The limitations of point of care testing for pandemic influenza: what clinicians and public health professionals need to know.

    Science.gov (United States)

    Hatchette, Todd F; Bastien, Nathalie; Berry, Jody; Booth, Tim F; Chernesky, Max; Couillard, Michel; Drews, Steven; Ebsworth, Anthony; Fearon, Margaret; Fonseca, Kevin; Fox, Julie; Gagnon, Jean-Nicolas; Guercio, Steven; Horsman, Greg; Jorowski, Cathy; Kuschak, Theodore; Li, Yan; Majury, Anna; Petric, Martin; Ratnam, Sam; Smieja, Marek; Van Caeseele, Paul

    2009-01-01

    As the world prepares for the next influenza pandemic, governments have made significant funding commitments to vaccine development and antiviral stockpiling. While these are essential components to pandemic response, rapid and accurate diagnostic testing remains an often neglected cornerstone of pandemic influenza preparedness. Clinicians and Public Health Practitioners need to understand the benefits and drawbacks of different influenza tests in both seasonal and pandemic settings. Culture has been the traditional gold standard for influenza diagnosis but requires from 1-10 days to generate a positive result, compared to nucleic acid detection methods such as real time reverse transcriptase polymerase chain reaction (RT-PCR). Although the currently available rapid antigen detection kits can generate results in less than 30 minutes, their sensitivity is suboptimal and they are not recommended for the detection of novel influenza viruses. Until point-of-care (POC) tests are improved, PILPN recommends that the best option for pandemic influenza preparation is the enhancement of nucleic acid-based testing capabilities across Canada.

  8. Molecular Tools for Diagnosis of Visceral Leishmaniasis: Systematic Review and Meta-Analysis of Diagnostic Test Accuracy

    Science.gov (United States)

    de Ruiter, C. M.; van der Veer, C.; Leeflang, M. M. G.; Deborggraeve, S.; Lucas, C.

    2014-01-01

    Molecular methods have been proposed as highly sensitive tools for the detection of Leishmania parasites in visceral leishmaniasis (VL) patients. Here, we evaluate the diagnostic accuracy of these tools in a meta-analysis of the published literature. The selection criteria were original studies that evaluate the sensitivities and specificities of molecular tests for diagnosis of VL, adequate classification of study participants, and the absolute numbers of true positives and negatives derivable from the data presented. Forty studies met the selection criteria, including PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA), and loop-mediated isothermal amplification (LAMP). The sensitivities of the individual studies ranged from 29 to 100%, and the specificities ranged from 25 to 100%. The pooled sensitivity of PCR in whole blood was 93.1% (95% confidence interval [CI], 90.0 to 95.2), and the specificity was 95.6% (95% CI, 87.0 to 98.6). The specificity was significantly lower in consecutive studies, at 63.3% (95% CI, 53.9 to 71.8), due either to true-positive patients not being identified by parasitological methods or to the number of asymptomatic carriers in areas of endemicity. PCR for patients with HIV-VL coinfection showed high diagnostic accuracy in buffy coat and bone marrow, ranging from 93.1 to 96.9%. Molecular tools are highly sensitive assays for Leishmania detection and may contribute as an additional test in the algorithm, together with a clear clinical case definition. We observed wide variety in reference standards and study designs and now recommend consecutively designed studies. PMID:24829226

  9. The agony of choice in dermatophyte diagnostics-performance of different molecular tests and culture in the detection of Trichophyton rubrum and Trichophyton interdigitale.

    Science.gov (United States)

    Kupsch, C; Ohst, T; Pankewitz, F; Nenoff, P; Uhrlaß, S; Winter, I; Gräser, Y

    2016-08-01

    Dermatophytosis caused by dermatophytes of the genera Trichophyton and Microsporum belong to the most frequent mycoses worldwide. Molecular detection methods proved to be highly sensitive and enable rapid and accurate detection of dermatophyte species from clinical specimens. For the first time, we compare the performance of different molecular methods with each other and with conventional diagnostics in the detection of dermatophytoses caused by Trichophyton rubrum and Trichophyton interdigitale in clinical specimens (nail, skin and hair). The compared molecular methods comprise two already published PCR-ELISAs, a published quantitative RT-PCR as well as a newly developed PCR-ELISA targeting the internal transcribed spacer region. We investigated the sensitivity of the assays by analysing 375 clinical samples. In 148 specimens (39.5%) a positive result was gained in at least one of the four molecular tests or by culture, but the number of detected agents differed significantly between some of the assays. The most sensitive assay, a PCR-ELISA targeting a microsatellite region, detected 81 T. rubrum infections followed by an internal transcribed spacer PCR-ELISA (60), quantitative RT-PCR (52) and a topoisomerase II PCR-ELISA (51), whereas cultivation resulted in T. rubrum identification in 37 samples. The pros and cons of all four tests in routine diagnostics are discussed. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  10. Evaluation of a Multiplex Real-Time Reverse Transcriptase PCR Assay for Detection and Differentiation of Influenza Viruses A and B during the 2001-2002 Influenza Season in Israel

    Science.gov (United States)

    Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella

    2005-01-01

    The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650

  11. Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

    Science.gov (United States)

    Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

    2001-07-01

    Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

  12. PCR diagnosis of PRRS virus in oral fluids from weaned Danish pigs

    DEFF Research Database (Denmark)

    Heiselberg, P. R.; Hjulsager, Charlotte Kristiane; Pedersen, K. S.

    2012-01-01

    herds. Oral fluid was collected by providing 1 cotton rope in each selected pen for 30 minutes. Blood samples from 5 systematic randomly selected pigs in each pen were taken and the separated serum was pooled penwise. Different purification methods were tested in order to decrease the content of PCR...... inhibitors in the RNA extract of oral fluid. QIAamp Viral RNA Mini Kit (QIAGEN) was selected for purification of RNA from oral fluid and serum. Purified RNA was tested for PRRSV by real-time RT-PCR by a modified previously published assay1. Overall agreement, diagnostic sensitivity and diagnostic specificity...

  13. MT-PCR panel detection of canine parvovirus (CPV-2): Vaccine and wild-type CPV-2 can be difficult to differentiate in canine diagnostic fecal samples.

    Science.gov (United States)

    Meggiolaro, Maira N; Ly, Anna; Rysnik-Steck, Benjamin; Silva, Carolina; Zhang, Joshua; Higgins, Damien P; Muscatello, Gary; Norris, Jacqueline M; Krockenberger, Mark; Šlapeta, Jan

    2017-06-01

    Canine parvovirus (CPV-2) remains an important cause of devastating enteritis in young dogs. It can be successfully prevented with live attenuated CPV-2 vaccines when given at the appropriate age and in the absence of maternal antibody interference. Rapid diagnosis of parvoviral enteritis in young dogs is essential to ensuring suitable barrier nursing protocols within veterinary hospitals. The current diagnostic trend is to use multiplexed PCR panels to detect an array of pathogens commonly responsible for diarrhea in dogs. The multiplexed PCR assays do not distinguish wild from vaccine CPV-2. They are highly sensitive and detect even a low level of virus shedding, such as those caused by the CPV-2 vaccine. The aim of this study was to identify the CPV-2 subtypes detected in diagnostic specimens and rule out occult shedding of CPV-2 vaccine strains. For a total of 21 samples that tested positive for CPV-2 in a small animal fecal pathogens diagnostic multiplexed tandem PCR (MT-PCR) panel during 2014-2016 we partially characterized the VP2 gene of CPV-2. Vaccine CPV-2 strain, wild type CPV-2a subtypes and vaccine-like CPV-2b subtypes were detected. High copy number was indicative of wild-type CPV-2a presence, but presence of vaccine-like CPV-2b had a variable copy number in fecal samples. A yardstick approach to a copy number or C t -value to discriminate vaccine strain from a wild type virus of CPV-2 can be, in some cases, potentially misleading. Therefore, discriminating vaccine strain from a wild type subtype of CPV-2 remains ambitious. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

    International Nuclear Information System (INIS)

    Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.

    2006-01-01

    Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

  15. Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing

    Science.gov (United States)

    Espy, M. J.; Uhl, J. R.; Sloan, L. M.; Buckwalter, S. P.; Jones, M. F.; Vetter, E. A.; Yao, J. D. C.; Wengenack, N. L.; Rosenblatt, J. E.; Cockerill, F. R.; Smith, T. F.

    2006-01-01

    Real-time PCR has revolutionized the way clinical microbiology laboratories diagnose many human microbial infections. This testing method combines PCR chemistry with fluorescent probe detection of amplified product in the same reaction vessel. In general, both PCR and amplified product detection are completed in an hour or less, which is considerably faster than conventional PCR detection methods. Real-time PCR assays provide sensitivity and specificity equivalent to that of conventional PCR combined with Southern blot analysis, and since amplification and detection steps are performed in the same closed vessel, the risk of releasing amplified nucleic acids into the environment is negligible. The combination of excellent sensitivity and specificity, low contamination risk, and speed has made real-time PCR technology an appealing alternative to culture- or immunoassay-based testing methods for diagnosing many infectious diseases. This review focuses on the application of real-time PCR in the clinical microbiology laboratory. PMID:16418529

  16. Comparison of IHC, FISH and RT-PCR methods for detection of ALK rearrangements in 312 non-small cell lung cancer patients in Taiwan.

    Science.gov (United States)

    Wu, Yi-Cheng; Chang, Il-Chi; Wang, Chi-Liang; Chen, Tai-Di; Chen, Ya-Ting; Liu, Hui-Ping; Chu, Yen; Chiu, Yu-Ting; Wu, Tzu-Hua; Chou, Li-Hui; Chen, Yi-Rong; Huang, Shiu-Feng

    2013-01-01

    Recently Echinoderm microtubule-associated protein-like 4- anaplastic lymphoma kinase (EML4-ALK) fusion gene has become an important biomarker for ALK tyrosine kinase inhibitor (crizotinib) treatment in NSCLC. However, the best detection method and the significance of EML4-ALK variant types remain uncertain. Reverse transcriptase-polymerase chain reaction (RT-PCR), fluorescence in Situ hybridization (FISH) and Immunohistochemical (IHC) stain were performed on tumor tissues of 312 NSCLC patients for detection of ALK rearrangements. Mutation analyses for EGFR and KRAS genes were also performed. Thirteen of the 312 patients (4.17%) had ALK rearrangements detected by RT-PCR. If RT-PCR data was used as the gold standard, FISH tests had a low sensitivity (58.33%), but very good specificity (99.32%). IHC stain had better sensitivity (91.67%) than FISH, but lower specificity (79.52%), when the cut off was IHC2+. All of the 8 patients with high abundance of EML4-ALK positive cells in tumor tissues (assessed by the signal intensities of the RT-PCR product), were also have high expression of ALK protein (IHC3+), and positive for FISH, except one failed in FISH. Variants 3a+3b (4/5, 80%) of EML4-ALK fusion gene were more common to have high abundance of EML4-ALK positive cells in tumor tissues than variant 1 (1/3, 33.3%). Meta-analysis of the published data of 2273 NSCLC patients revealed that variant 3 (23/44, 52.3%) was the most common type in Chinese population, while variant 1 (28/37, 75.7%) was most common in Caucasian. Among the three detection methods, RT-PCR could detect not only the presence of EML4-ALK fusion gene and their variant types, but also the abundance of EML4-ALK positive cells in NSCLC tumor tissues. The latter two factors might affect the treatment response to anti-ALK inhibitor. Including RT-PCR as a diagnostic test for ALK inhibitor treatment in the prospective clinical trials is recommended.

  17. Comparison of IHC, FISH and RT-PCR methods for detection of ALK rearrangements in 312 non-small cell lung cancer patients in Taiwan.

    Directory of Open Access Journals (Sweden)

    Yi-Cheng Wu

    Full Text Available BACKGROUND: Recently Echinoderm microtubule-associated protein-like 4- anaplastic lymphoma kinase (EML4-ALK fusion gene has become an important biomarker for ALK tyrosine kinase inhibitor (crizotinib treatment in NSCLC. However, the best detection method and the significance of EML4-ALK variant types remain uncertain. METHODS: Reverse transcriptase-polymerase chain reaction (RT-PCR, fluorescence in Situ hybridization (FISH and Immunohistochemical (IHC stain were performed on tumor tissues of 312 NSCLC patients for detection of ALK rearrangements. Mutation analyses for EGFR and KRAS genes were also performed. RESULTS: Thirteen of the 312 patients (4.17% had ALK rearrangements detected by RT-PCR. If RT-PCR data was used as the gold standard, FISH tests had a low sensitivity (58.33%, but very good specificity (99.32%. IHC stain had better sensitivity (91.67% than FISH, but lower specificity (79.52%, when the cut off was IHC2+. All of the 8 patients with high abundance of EML4-ALK positive cells in tumor tissues (assessed by the signal intensities of the RT-PCR product, were also have high expression of ALK protein (IHC3+, and positive for FISH, except one failed in FISH. Variants 3a+3b (4/5, 80% of EML4-ALK fusion gene were more common to have high abundance of EML4-ALK positive cells in tumor tissues than variant 1 (1/3, 33.3%. Meta-analysis of the published data of 2273 NSCLC patients revealed that variant 3 (23/44, 52.3% was the most common type in Chinese population, while variant 1 (28/37, 75.7% was most common in Caucasian. CONCLUSIONS: Among the three detection methods, RT-PCR could detect not only the presence of EML4-ALK fusion gene and their variant types, but also the abundance of EML4-ALK positive cells in NSCLC tumor tissues. The latter two factors might affect the treatment response to anti-ALK inhibitor. Including RT-PCR as a diagnostic test for ALK inhibitor treatment in the prospective clinical trials is recommended.

  18. Absolute quantification by droplet digital PCR versus analog real-time PCR

    Science.gov (United States)

    Hindson, Christopher M; Chevillet, John R; Briggs, Hilary A; Gallichotte, Emily N; Ruf, Ingrid K; Hindson, Benjamin J; Vessella, Robert L; Tewari, Muneesh

    2014-01-01

    Nanoliter-sized droplet technology paired with digital PCR (ddPCR) holds promise for highly precise, absolute nucleic acid quantification. Our comparison of microRNA quantification by ddPCR and real-time PCR revealed greater precision (coefficients of variation decreased by 37–86%) and improved day-to-day reproducibility (by a factor of seven) of ddPCR but with comparable sensitivity. When we applied ddPCR to serum microRNA biomarker analysis, this translated to superior diagnostic performance for identifying individuals with cancer. PMID:23995387

  19. Development of an improved species specific PCR test for detection of Haemophilus parasuis

    DEFF Research Database (Denmark)

    Angen, Øystein; Oliveira, Simone; Ahrens, Peter

    2007-01-01

    , the present PCR test was found to be 100% species specific for H. parasuis, in contrast to the PCR test of Oliveira et al., which also tested positive for strains belonging to A. indolicus, A. porcinus, and A. minor, species commonly occurring in the upper respiratory tract. However, when the PCR test...... with representatives of H. parasuis. The test was further evaluated on 55 clinical samples from 16 Danish pigs suspected for being infected with H. parasuis, showing polyserositis or septicemia at autopsy as well as on 492 nasal swabs. The test was compared with the performance of a PCR test earlier published...... by Oliveira et al. [Oliveira, S., Galina, L., Pijoan, C., 2001. Development of a PCR test to diagnose Haemophilus parasuis infections. J. Vet. Diagn. Invest. 13, 495-501]. The sensitivity of the present PCR test was found to be slightly lower when applied on clinical samples from diseased pigs and 10-fold...

  20. Analytical Performance of Four Polymerase Chain Reaction (PCR and Real Time PCR (qPCR Assays for the Detection of Six Leishmania Species DNA in Colombia

    Directory of Open Access Journals (Sweden)

    Cielo M. León

    2017-10-01

    Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.

  1. Analytical Performance of Four Polymerase Chain Reaction (PCR) and Real Time PCR (qPCR) Assays for the Detection of Six Leishmania Species DNA in Colombia

    Science.gov (United States)

    León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.

    2017-01-01

    Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670

  2. Methods for Real-Time PCR-Based Diagnosis of Chlamydia pneumoniae, Chlamydia psittaci, and Chlamydia abortus Infections in an Opened Molecular Diagnostic Platform.

    Science.gov (United States)

    Opota, Onya; Brouillet, René; Greub, Gilbert; Jaton, Katia

    2017-01-01

    The advances in molecular biology of the last decades have dramatically improved the field of diagnostic bacteriology. In particular, PCR-based technologies have impacted the diagnosis of infections caused by obligate intracellular bacteria such as pathogens from the Chlamydiacae family. Here, we describe a real-time PCR-based method using the Taqman technology for the diagnosis of Chlamydia pneumoniae, Chlamydia psittaci, and Chlamydia abortus infection. The method presented here can be applied to various clinical samples and can be adapted on opened molecular diagnostic platforms.

  3. Diagnostic performance of a rapid in-clinic test for the detection of Canine Parvovirus under different storage conditions and vaccination status.

    Science.gov (United States)

    Kantere, Maria C; Athanasiou, Labrini V; Spyrou, Vassiliki; Kyriakis, Constantinos S; Kontos, Vassilios; Chatzopoulos, Dimitrios C; Tsokana, Constantina N; Billinis, Charalambos

    2015-04-01

    Canine parvovirus (CPV) is one of the most common causes of acute haemorrhagic enteritis in young dogs, while clinical diagnosis is often indecisive. The aim of our study was to evaluate the diagnostic accuracy of an in-clinic rapid test in the detection of CPV infection in dogs. To this end, we compared the Rapid Diagnostic Kit of Canine Parvovirus, Coronavirus and Rotavirus antigen (Quicking(®)) to PCR, which is considered as the most reliable diagnostic method. A total of 78 duplicated faecal samples were collected from diarrhoeic dogs. Vaccination history within a month prior to the onset of diarrhoea was reported for 12 of the sampled dogs. The rapid diagnostic test was performed in 23 of the faecal samples directly, while the rest were placed into a sterile cotton tipped swab suitable for collection and transportation of viruses (Sigma Σ-VCM(®)) and stored at -20 °C. The sensitivity of the Quicking rapid diagnostic test compared to PCR in the total number of samples, in samples from non-vaccinated dogs and in samples tested directly after collection were 22.22% (95% CI: 13.27-33.57%), 26.67% (95% CI: 16.08-39.66%) and 76.47% (95% CI: 50.10-93.04%) respectively, while the specificity of the test was 100% in any case. In conclusion, negative results do not exclude parvoenteritis from the differential diagnosis, especially in dogs with early vaccination history, but a positive result almost certainly indicates CPV infection. An improved sensitivity may be expected when the test is performed immediately. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Clinical and Demographic Stratification of Test Performance: A Pooled Analysis of Five Laboratory Diagnostic Methods for American Cutaneous Leishmaniasis

    Science.gov (United States)

    Boggild, Andrea K.; Ramos, Ana P.; Espinosa, Diego; Valencia, Braulio M.; Veland, Nicolas; Miranda-Verastegui, Cesar; Arevalo, Jorge; Low, Donald E.; Llanos-Cuentas, Alejandro

    2010-01-01

    We evaluated performance characteristics of five diagnostic methods for cutaneous leishmaniasis. Patients who came to the Leishmania Clinic of Hospital Nacional Cayetano Heredia in Lima, Peru, were enrolled in the study. Lesion smears, culture, microculture, polymerase chain reaction (PCR), and leishmanin skin test (LST) were performed. A total of 145 patients with 202 lesions were enrolled: 114 patients with 161 lesions fulfilled criteria for cutaneous leishmaniasis. Sensitivity and specificity were 57.8% (95% confidence interval [CI] = 50.2–65.4%) and 100.0% for culture, 78.3% (95% CI = 71.9–84.7%) and 100.0% for microculture, 71.4% (95% CI = 64.4–78.4%) and 100.0% for smears, 78.2% (95% CI = 70.6–85.8%) and 77.4% (95% CI = 62.7–92.1%) for LST, and 96.9% (95% CI = 94.2–99.6%) and 65.9% (95% CI = 51.4–80.4%) for PCR. PCR was more sensitive than the other assays (P < 0.001). Sensitivities of culture, smears, and LST varied by lesion duration and appearance. PCR offers performance advantages over other assays, irrespective of patient age, sex, lesion duration, or appearance. That clinical factors influence performance of non-molecular assays offers clinicians a patient-focused approach to diagnostic test selection. PMID:20682880

  5. Validation of a Real Time PCR for Classical Swine Fever Diagnosis

    Directory of Open Access Journals (Sweden)

    Natanael Lamas Dias

    2014-01-01

    Full Text Available The viral disease classical swine fever (CSF, caused by a Pestivirus, is one of the major causes of economic losses for pig farming. The aim of this work was to validate a RT-qPCR using Taqman for detection of CSF in swine tissues. The parameters for the validation followed the specifications of the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals of the World Organization for Animal Health (OIE and the guide ABNT NBR ISO/IEC 17025:2005. The analysis of the 5′NTR region of CSF virus was performed in 145 samples from 29 infected pigs and in 240 samples from 80 pigs originated in the Brazilian CSF-free zone. The tissues tested were spleen, kidney, blood, tonsils, and lymph nodes. Sequencing of the positive samples for 5′NTR region was performed to evaluate the specificity of the RT-qPCR. Tests performed for the RT-qPCR validation demonstrated that the PCR assay was efficient in detecting RNA from CSF virus in all materials from different tissues of infected animals. Furthermore, RNA from CSF virus was not detected in samples of swine originated from the Brazilian CSF-free zone. Hence, it is concluded that RT-qPCR can be used as a complementary diagnostic for CSF.

  6. Validation of a real time PCR for classical Swine Fever diagnosis.

    Science.gov (United States)

    Dias, Natanael Lamas; Fonseca Júnior, Antônio Augusto; Oliveira, Anapolino Macedo; Sales, Erica Bravo; Alves, Bruna Rios Coelho; Dorella, Fernanda Alves; Camargos, Marcelo Fernandes

    2014-01-01

    The viral disease classical swine fever (CSF), caused by a Pestivirus, is one of the major causes of economic losses for pig farming. The aim of this work was to validate a RT-qPCR using Taqman for detection of CSF in swine tissues. The parameters for the validation followed the specifications of the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals of the World Organization for Animal Health (OIE) and the guide ABNT NBR ISO/IEC 17025:2005. The analysis of the 5'NTR region of CSF virus was performed in 145 samples from 29 infected pigs and in 240 samples from 80 pigs originated in the Brazilian CSF-free zone. The tissues tested were spleen, kidney, blood, tonsils, and lymph nodes. Sequencing of the positive samples for 5'NTR region was performed to evaluate the specificity of the RT-qPCR. Tests performed for the RT-qPCR validation demonstrated that the PCR assay was efficient in detecting RNA from CSF virus in all materials from different tissues of infected animals. Furthermore, RNA from CSF virus was not detected in samples of swine originated from the Brazilian CSF-free zone. Hence, it is concluded that RT-qPCR can be used as a complementary diagnostic for CSF.

  7. Validation of a Real Time PCR for Classical Swine Fever Diagnosis

    Science.gov (United States)

    Dias, Natanael Lamas; Fonseca Júnior, Antônio Augusto; Oliveira, Anapolino Macedo; Sales, Érica Bravo; Alves, Bruna Rios Coelho; Dorella, Fernanda Alves

    2014-01-01

    The viral disease classical swine fever (CSF), caused by a Pestivirus, is one of the major causes of economic losses for pig farming. The aim of this work was to validate a RT-qPCR using Taqman for detection of CSF in swine tissues. The parameters for the validation followed the specifications of the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals of the World Organization for Animal Health (OIE) and the guide ABNT NBR ISO/IEC 17025:2005. The analysis of the 5′NTR region of CSF virus was performed in 145 samples from 29 infected pigs and in 240 samples from 80 pigs originated in the Brazilian CSF-free zone. The tissues tested were spleen, kidney, blood, tonsils, and lymph nodes. Sequencing of the positive samples for 5′NTR region was performed to evaluate the specificity of the RT-qPCR. Tests performed for the RT-qPCR validation demonstrated that the PCR assay was efficient in detecting RNA from CSF virus in all materials from different tissues of infected animals. Furthermore, RNA from CSF virus was not detected in samples of swine originated from the Brazilian CSF-free zone. Hence, it is concluded that RT-qPCR can be used as a complementary diagnostic for CSF. PMID:24818039

  8. O-5S quantitative real-time PCR: a new diagnostic tool for laboratory confirmation of human onchocerciasis.

    Science.gov (United States)

    Mekonnen, Solomon A; Beissner, Marcus; Saar, Malkin; Ali, Solomon; Zeynudin, Ahmed; Tesfaye, Kassahun; Adbaru, Mulatu G; Battke, Florian; Poppert, Sven; Hoelscher, Michael; Löscher, Thomas; Bretzel, Gisela; Herbinger, Karl-Heinz

    2017-10-02

    Onchocerciasis is a parasitic disease caused by the filarial nematode Onchocerca volvulus. In endemic areas, the diagnosis is commonly confirmed by microscopic examination of skin snip samples, though this technique is considered to have low sensitivity. The available melting-curve based quantitative real-time PCR (qPCR) using degenerated primers targeting the O-150 repeat of O. volvulus was considered insufficient for confirming the individual diagnosis, especially in elimination studies. This study aimed to improve detection of O. volvulus DNA in clinical samples through the development of a highly sensitive qPCR assay. A novel hydrolysis probe based qPCR assay was designed targeting the specific sequence of the O. volvulus O-5S rRNA gene. A total of 200 clinically suspected onchocerciasis cases were included from Goma district in South-west Ethiopia, from October 2012 through May 2013. Skin snip samples were collected and subjected to microscopy, O-150 qPCR, and the novel O-5S qPCR. Among the 200 individuals, 133 patients tested positive (positivity rate of 66.5%) and 67 negative by O-5S qPCR, 74 tested positive by microscopy (37.0%) and 78 tested positive by O-150 qPCR (39.0%). Among the 133 O-5S qPCR positive individuals, microscopy and O-150 qPCR detected 55.6 and 59.4% patients, respectively, implying a higher sensitivity of O-5S qPCR than microscopy and O-150 qPCR. None of the 67 individuals who tested negative by O-5S qPCR tested positive by microscopy or O-150 qPCR, implying 100% specificity of the newly designed O-5S qPCR assay. The novel O-5S qPCR assay is more sensitive than both microscopic examination and the existing O-150 qPCR for the detection of O. volvulus from skin snip samples. The newly designed assay is an important step towards appropriate individual diagnosis and control of onchocerciasis.

  9. Material Biocompatibility for PCR Microfluidic Chips

    KAUST Repository

    Kodzius, Rimantas

    2010-04-23

    As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.

  10. Material Biocompatibility for PCR Microfluidic Chips

    KAUST Repository

    Kodzius, Rimantas; Chang, Donald Choy; Gong, Xiuqing; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yi, Xin

    2010-01-01

    As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.

  11. Detection of hepatitis C virus RNA using reverse transcription PCR

    International Nuclear Information System (INIS)

    Yap, S.F.

    1998-01-01

    Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

  12. Use of RT-PCR and elisa techniques for the diagnostic of infectious bronchitis virus in broilers at slaughter

    Directory of Open Access Journals (Sweden)

    Davi de Oliveira Almeida

    2015-03-01

    Full Text Available ABSTRACT. Almeida D.O., Tortely R., Nascimento E.R., Khan M., Pereira V.L.A & Babapoor S. [Use of RT-PCR and elisa techniques for the diagnostic of infectious bronchitis virus in broilers at slaughter.] Uso das técnicas de RT-PCR e elisa no diagnóstico da bronquite infecciosa em frangos de corte ao abate. Revista Brasileira de Medicina Veterinária, 37(1:55-59, 2015. Departamento de Saúde Coletiva Veterinária e Saúde Pública, Universidade Federal Fluminense, Rua Vital Brazil Filho, 64, Santa Rosa, Niterói, RJ 24230-340, Brasil. E-mail: elmiro@vm.uff.br Avian infectious bronchitis (IB is a viral, acute and highly contagious disease caused by infectious bronchitis virus (IBV. The disease affects broilers improvement and performance causing major economic losses in the world poultry industry. Generally, IBV infections can be diagnosed by detection of IBV itself or the specific antibody response. This study aimed to detect IBV in broilers under Sanitary Inspection by RT-PCR and ELISA, comparing the results and relating them with the average weight of the flock. Samples were collected from 40 vaccinated broiler flocks under Sanitary Inspection at slaughter. Ten birds from every flock were randomly selected and blood samples were collected for ELISA as well three birds had their trachea and caecal tonsils collected for RT- -PCR test. From 40 flocks, 30 were IBV positive by ELISA and 26 by RT-PCR, in which 15 were detected simultaneously in trachea and caecal tonsil and 5 in each sample. There was no agreement between ELISA and RT-PCR results regarding IBV diagnosis as well positivity in both tests was not statistically significant with the average weight of the flock. There was an improvement on IBV diagnosis when caecal tonsils and tracheas were used instead of just one of them. Considering the only vaccine serotype allowed by Brazilian government is the Mass serotype and its persistence in broilers would only be detected up to 28 days

  13. Comparative evaluation of molecular diagnostic tests for Nucleospora salmonis and prevalence in migrating juvenile salmonids from the Snake River, USA

    Science.gov (United States)

    Badil, Samantha; Elliott, Diane G.; Kurobe, Tomofumi; Hedrick, Ronald P.; Clemens, Kathy; Blair, Marilyn; Purcell, Maureen K.

    2011-01-01

    Nucleospora salmonis is an intranuclear microsporidian that primarily infects lymphoblast cells and contributes to chronic lymphoblastosis and a leukemia-like condition in a range of salmonid species. The primary goal of this study was to evaluate the prevalence of N. salmonis in out-migrating juvenile hatchery and wild Chinook salmon Oncorhynchus tshawytscha and steelhead O. mykiss from the Snake River in the U.S. Pacific Northwest. To achieve this goal, we first addressed the following concerns about current molecular diagnostic tests for N. salmonis: (1) nonspecific amplification patterns by the published nested polymerase chain reaction (nPCR) test, (2) incomplete validation of the published quantitative PCR (qPCR) test, and (3) whether N. salmonis can be detected reliably from nonlethal samples. Here, we present an optimized nPCR protocol that eliminates nonspecific amplification. During validation of the published qPCR test, our laboratory developed a second qPCR test that targeted a different gene sequence and used different probe chemistry for comparison purposes. We simultaneously evaluated the two different qPCR tests for N. salmonis and found that both assays were highly specific, sensitive, and repeatable. The nPCR and qPCR tests had good overall concordance when DNA samples derived from both apparently healthy and clinically diseased hatchery rainbow trout were tested. Finally, we demonstrated that gill snips were a suitable tissue for nonlethal detection of N. salmonis DNA in juvenile salmonids. Monitoring of juvenile salmonid fish in the Snake River over a 3-year period revealed low prevalence of N. salmonis in hatchery and wild Chinook salmon and wild steelhead but significantly higher prevalence in hatchery-derived steelhead. Routine monitoring of N. salmonis is not performed for all hatchery steelhead populations. At present, the possible contribution of this pathogen to delayed mortality of steelhead has not been determined.

  14. Molecular evidence of malaria and zoonotic diseases among rapid diagnostic test-negative febrile patients in low-transmission season, Mali

    DEFF Research Database (Denmark)

    Touré, Mahamoudou; Petersen, Pelle T; Bathily, Sidy N'd

    2017-01-01

    From November to December 2012 in Sélingué-Mali, blood samples from 88 febrile patients who tested negative by malaria Paracheck (®) rapid diagnostic tests (RDTs) were used to assess the presence of sub-RDT Plasmodium falciparum as well as Borrelia, Coxiella burnetii, and Babesia applying molecular...... tools. Plasmodium sp. was present among 57 (60.2%) of the 88 malaria RDT-negative patients, whereas the prevalence of Borrelia, C. burnetii, and Babesia were 3.4% (N = 3), 1.1% (N = 1), and 0.0%, respectively. The additional diagnostic use of polymerase chain reaction (PCR) identified a high proportion...

  15. 1968 Prototype Diagnostic Test.

    Science.gov (United States)

    Veterans Administration Hospital, Bedford, MA.

    This true-false diagnostic test was used for pretesting of employees at a Veterans Administration Hospital. The test is comprised of 20 items. An alternate test--Classification Questionnaire--was used for testing after remedial training. (For related document, see TM 002 334.) (DB)

  16. Molecular tools for diagnosis of visceral leishmaniasis: systematic review and meta-analysis of diagnostic test accuracy.

    Science.gov (United States)

    de Ruiter, C M; van der Veer, C; Leeflang, M M G; Deborggraeve, S; Lucas, C; Adams, E R

    2014-09-01

    Molecular methods have been proposed as highly sensitive tools for the detection of Leishmania parasites in visceral leishmaniasis (VL) patients. Here, we evaluate the diagnostic accuracy of these tools in a meta-analysis of the published literature. The selection criteria were original studies that evaluate the sensitivities and specificities of molecular tests for diagnosis of VL, adequate classification of study participants, and the absolute numbers of true positives and negatives derivable from the data presented. Forty studies met the selection criteria, including PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA), and loop-mediated isothermal amplification (LAMP). The sensitivities of the individual studies ranged from 29 to 100%, and the specificities ranged from 25 to 100%. The pooled sensitivity of PCR in whole blood was 93.1% (95% confidence interval [CI], 90.0 to 95.2), and the specificity was 95.6% (95% CI, 87.0 to 98.6). The specificity was significantly lower in consecutive studies, at 63.3% (95% CI, 53.9 to 71.8), due either to true-positive patients not being identified by parasitological methods or to the number of asymptomatic carriers in areas of endemicity. PCR for patients with HIV-VL coinfection showed high diagnostic accuracy in buffy coat and bone marrow, ranging from 93.1 to 96.9%. Molecular tools are highly sensitive assays for Leishmania detection and may contribute as an additional test in the algorithm, together with a clear clinical case definition. We observed wide variety in reference standards and study designs and now recommend consecutively designed studies. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  17. Improved molecular detection of Babesia infections in animals using a novel quantitative real-time PCR diagnostic assay targeting mitochondrial DNA.

    Science.gov (United States)

    Qurollo, Barbara A; Archer, Nikole R; Schreeg, Megan E; Marr, Henry S; Birkenheuer, Adam J; Haney, Kaitlin N; Thomas, Brittany S; Breitschwerdt, Edward B

    2017-03-07

    Babesiosis is a protozoal, tick transmitted disease found worldwide in humans, wildlife and domesticated animals. Commonly used approaches to diagnose babesiosis include microscopic examination of peripheral blood smears, detection of circulating antibodies and PCR. To screen and differentiate canine Babesia infections many PCR assays amplify the 18S rRNA gene. These sequences contain hypervariable regions flanked by highly conserved regions allowing for amplification of a broad-range of Babesia spp. However, differences in the 18S rRNA gene sequence of distantly related clades can make it difficult to design assays that will amplify all Babesia species while excluding the amplification of other eukaryotes. By targeting Babesia mitochondrial genome (mtDNA), we designed a novel three primer qPCR with greater sensitivity and broader screening capabilities to diagnose and differentiate Babesia spp. Using 13 Babesia mtDNA sequences, a region spanning two large subunit rRNA gene fragments (lsu5-lsu4) was aligned to design three primers for use in a qPCR assay (LSU qPCR) capable of amplifying a wide range of Babesia spp. Plasmid clones were generated and used as standards to determine efficiency, linear dynamic range and analytical sensitivity. Animals naturally infected with vector-borne pathogens were tested retrospectively and prospectively to determine relative clinical sensitivity and specificity by comparing the LSU qPCR to an established 18S rDNA qPCR. The LSU qPCR efficiencies ranged between 92 and 100% with the limit of detection at five copies/reaction. The assay did not amplify mammalian host or other vector-borne pathogen gDNA except Cytauxzoon felis (a feline protozoal pathogen). The LSU qPCR assay amplified 12 different Babesia. sp. and C. felis from 31/31 (100%) archived samples, whereas the 18S qPCR amplified only 26/31 (83.9%). By prospective analysis, 19/394 diagnostic accessions (4.8%) were LSU qPCR positive, compared to 11/394 (2.8%) 18S rDNA qPCR

  18. A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.

    Directory of Open Access Journals (Sweden)

    Sandra J Laney

    2008-06-01

    Full Text Available Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript.Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes.This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.

  19. Parallel susceptibility testing of bacteria through culture-quantitative PCR in 96-well plates

    Directory of Open Access Journals (Sweden)

    Jun Luo

    2018-05-01

    Full Text Available Objective: The methods combining culture and quantitative PCR(qPCR offer new solutions for rapid antibiotic susceptibility testing(AST. However, the multiple steps of DNA extraction and cold storage of PCR reagents needed make them unsuitable for rapid high throughput AST. In this study, a parallel culture-qPCR method was developed to overcome above problems. Method: In this method, bacteria culture and DNA extraction automatically and simultaneously completed through using a common PCR instrument as a controllable heating device. A lyophilized 16S rDNA targeted qPCR reagent was also developed, which was stable and could be kept at 4 °C for long time and at 37 °C for about two months. Result: Testing of 36 P. aeruginosa isolates and 28 S. aureus isolates showed that the method had good agreements with the standard broth microdilution method, with an overall agreement of 97.22% (95% CI, 85.83–99.51 for P. aeruginosa and 96.43% (95% CI, 79.76–99.81 for S. aureus. This method could test 12 samples against a panel of up to 7 antibiotics simultaneously in two 96-well PCR plates within 4 h, which greatly improves the testing efficiency of the culture-qPCR method. Conclusion: With rapidness to obtain results and the capabilities for automation and multiple-sample testing, the parallel culture-qPCR method would have great potentials in clinical labs. Keywords: Antibiotic susceptibility testing, Thermo-cold lysis, Lyophilized qPCR reagent, Quantitative PCR, Bacteria

  20. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang

    2010-06-01

    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  1. The diagnostic utility of stabilized blood for detection of foot-and-mouth disease virus RNA by RT-qPCR

    DEFF Research Database (Denmark)

    S. Fontél, Kristina; Bøtner, Anette; Belsham, Graham

    In Europe, clinical signs indicative of foot-and-mouth disease (FMD), would immediately lead to collection of blood and relevant organ material for further laboratory examination for this vesicular disease virus. Today, the first line system for detection of virus in the sample material is real t...... time RT-PCR (RT-qPCR). The aim of this study was to investigate the diagnostic utility of stabilized blood for detection of FMDV RNA in this system....

  2. DNA Differential Diagnosis of Taeniasis and Cysticercosis by Multiplex PCR

    Science.gov (United States)

    Yamasaki, Hiroshi; Allan, James C.; Sato, Marcello Otake; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Qiu, Dongchuan; Mamuti, Wulamu; Craig, Philip S.; Ito, Akira

    2004-01-01

    Multiplex PCR was established for differential diagnosis of taeniasis and cysticercosis, including their causative agents. For identification of the parasites, multiplex PCR with cytochrome c oxidase subunit 1 gene yielded evident differential products unique for Taenia saginata and Taenia asiatica and for American/African and Asian genotypes of Taenia solium with molecular sizes of 827, 269, 720, and 984 bp, respectively. In the PCR-based detection of tapeworm carriers using fecal samples, the diagnostic markers were detected from 7 of 14 and 4 of 9 T. solium carriers from Guatemala and Indonesia, respectively. Test sensitivity may have been reduced by the length of time (up to 12 years) that samples were stored and/or small sample volumes (ca. 30 to 50 mg). However, the diagnostic markers were detected by nested PCR in five worm carriers from Guatemalan cases that were found to be negative by multiplex PCR. It was noteworthy that a 720 bp-diagnostic marker was detected from a T. solium carrier who was egg-free, implying that it is possible to detect worm carriers and treat before mature gravid proglottids are discharged. In contrast to T. solium carriers, 827-bp markers were detected by multiplex PCR in all T. saginata carriers. The application of the multiplex PCR would be useful not only for surveillance of taeniasis and cysticercosis control but also for the molecular epidemiological survey of these cestode infections. PMID:14766815

  3. Diagnostic evaluation of rapid tests for scrub typhus in the Indian population is needed.

    Science.gov (United States)

    Shivalli, Siddharudha

    2016-05-12

    Owing to frequent outbreaks witnessed in different parts of the country in the recent past, scrub typhus is being described as a re-emerging infectious disease in India. Differentiating scrub typhus from other endemic diseases like malaria, leptospirosis, dengue fever, typhoid, etc. is difficult due to overlapping clinical features and a lower positivity for eschars in Asian populations. Hence, the diagnosis heavily relies on laboratory tests. Costs and the need of technical expertise limit the wide use of indirect immunoperoxidase or immunofluorescence assays, ELISA and PCR. The Weil-Felix test is the most commonly used and least expensive serological test, but lacks both sensitivity and specificity. Hence, the diagnosis of scrub typhus is often delayed or overlooked. With due consideration of the cost, rapidity, single test result and simplicity of interpretation, rapid diagnostic tests have come into vogue. However, evaluation of rapid diagnostic tests for scrub typhus in the Indian population is needed to justify or discourage their use. Research studies are needed to find the most suitable test in terms of the rapidity of the result, simplicity of the procedure, ease of interpretation and cost to be used in the Indian populace.

  4. Myasthenia Gravis: Tests and Diagnostic Methods

    Science.gov (United States)

    ... Focus on MG Newsletter MG Quarterly Test & Diagnostic methods In addition to a complete medical and neurological ... How can I help? About MGFA Test & Diagnostic methods Treatment for MG FAQ's Upcoming Events 2018 MG ...

  5. Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay.

    Science.gov (United States)

    Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M

    2008-10-01

    The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.

  6. A longitudinal evaluation of Treponema pallidum PCR testing in early syphilis

    Directory of Open Access Journals (Sweden)

    Shields Matt

    2012-12-01

    Full Text Available Abstract Background Syphilis is a growing public health problem among men who have sex with men (MSM globally. Rapid and accurate detection of syphilis is vital to ensure patients and their contacts receive timely treatment and reduce ongoing transmission. Methods We evaluated a PCR assay for the diagnosis of Treponema pallidum using swabs of suspected early syphilis lesions in longitudinally assessed MSM. Results We tested 260 MSM for T pallidum by PCR on 288 occasions: 77 (26.7% had early syphilis that was serologically confirmed at baseline or within six weeks, and 211 (73.3% remained seronegative for syphilis. Of 55 men with primary syphilis, 49 were PCR positive, giving a sensitivity of 89.1% (95% CI: 77.8%-95.9% and a specificity of 99.1% (95% CI: 96.5%-99.9%. Of 22 men with secondary syphilis, 11 were PCR positive, giving a sensitivity of 50% (95% CI: 28.2%-71.8% and a specificity of 100% (95% CI: 66.4%-71.8%. Of the 77 syphilis cases, 43 (56% were HIV positive and the sensitivity and specificity of the PCR test did not vary by HIV status. The PCR test was able to detect up to five (10% primary infections that were initially seronegative, including one HIV positive man with delayed seroconversion to syphilis (72 to 140 days and one HIV positive man who did not seroconvert to syphilis over 14 months follow-up. Both men had been treated for syphilis within a week of the PCR test. Conclusions T pallidum PCR is a potentially powerful tool for the early diagnosis of primary syphilis, particularly where a serological response has yet to develop.

  7. Specific PCR-based detection of Alternaria helianthi

    DEFF Research Database (Denmark)

    Udayashankar, A.C.; Nayaka, S. Chandra; Archana, B.

    2012-01-01

    Alternaria helianthi is an important seed-borne pathogenic fungus responsible for blight disease in sunflower. The current detection methods, which are based on culture and morphological identification, are time-consuming, laborious and are not always reliable. A PCR-based diagnostic method...... tested. The detection limit of the PCR method was of 10 pg from template DNA. The primers could also detect the pathogen in infected sunflower seed. This species-specific PCR method provides a quick, simple, powerful and reliable alternative to conventional methods in the detection and identification...

  8. Detection of Leishmania infantum in animals and their ectoparasites by conventional PCR and real time PCR.

    Science.gov (United States)

    de Morais, Rayana Carla Silva; Gonçalves, Suênia da Cunha; Costa, Pietra Lemos; da Silva, Kamila Gaudêncio; da Silva, Fernando José; Silva, Rômulo Pessoa E; de Brito, Maria Edileuza Felinto; Brandão-Filho, Sinval Pinto; Dantas-Torres, Filipe; de Paiva-Cavalcanti, Milena

    2013-04-01

    Visceral leishmaniosis (VL) is a parasitic disease caused by Leishmania infantum, which is primarily transmitted by phlebotomine sandflies. However, there has been much speculation on the role of other arthropods in the transmission of VL. Thus, the aim of this study was to assess the presence of L. infantum in cats, dogs and their ectoparasites in a VL-endemic area in northeastern Brazil. DNA was extracted from blood samples and ectoparasites, tested by conventional PCR (cPCR) and quantitative real time PCR (qPCR) targeting the L. infantum kinetoplast DNA. A total of 280 blood samples (from five cats and 275 dogs) and 117 ectoparasites from dogs were collected. Animals were apparently healthy and not previously tested by serological or molecular diagnostic methods. Overall, 213 (76.1 %) animals and 51 (43.6 %) ectoparasites were positive to L. infantum, with mean parasite loads of 795.2, 31.9 and 9.1 fg in dogs, cats and ectoparasites, respectively. Concerning the positivity between dogs and their ectoparasites, 32 (15.3 %) positive dogs were parasitized by positive ectoparasites. The overall concordance between the PCR protocols used was 59.2 %, with qPCR being more efficient than cPCR; 34.1 % of all positive samples were exclusively positive by qPCR. The high number of positive animals and ectoparasites also indicates that they could serve as sentinels or indicators of the circulation of L. infantum in risk areas.

  9. DETECTION OF CLASSICAL SWINE FEVER VIRUS BY RT-PCR IN WEST BENGAL, INDIA

    Directory of Open Access Journals (Sweden)

    Sumit Chowdhury

    2016-12-01

    Full Text Available Classical swine fever is a deadly disease of swine, caused by a RNA virus. The present study has identified presence of the classical swine fever virus (CSFV in pigs of West Bengal by one step reverse transcriptase PCR (RT-PCR performed using 5’ NTR specific primers. Internal organs from clinically affected pigs were examined from three districts of West Bengal. RT-PCT has identified presence of CSFV in all the tissues examined confirming presence of CSFV in different parts of the state.

  10. Internally controlled, generic real-time PCR for quantification and multiplex real-time PCR with serotype-specific probes for serotyping of dengue virus infections

    NARCIS (Netherlands)

    Menting, Sandra; Thai, Khoa T. D.; Nga, Tran T. T.; Phuong, Hoang L.; Klatser, Paul; Wolthers, Katja C.; Binh, Tran Q.; de Vries, Peter J.; Beld, Marcel

    2011-01-01

    Dengue has become a global public health problem and a sensitive diagnostic test for early phase detection can be life saving. An internally controlled, generic real-time PCR was developed and validated by testing serial dilutions of a DENV positive control RNA in the presence of a fixed amount of

  11. Diagnosis of asthma: diagnostic testing.

    Science.gov (United States)

    Brigham, Emily P; West, Natalie E

    2015-09-01

    Asthma is a heterogeneous disease, encompassing both atopic and non-atopic phenotypes. Diagnosis of asthma is based on the combined presence of typical symptoms and objective tests of lung function. Objective diagnostic testing consists of 2 components: (1) demonstration of airway obstruction, and (2) documentation of variability in degree of obstruction. A review of current guidelines and literature was performed regarding diagnostic testing for asthma. Spirometry with bronchodilator reversibility testing remains the mainstay of asthma diagnostic testing for children and adults. Repetition of the test over several time points may be necessary to confirm airway obstruction and variability thereof. Repeated peak flow measurement is relatively simple to implement in a clinical and home setting. Bronchial challenge testing is reserved for patients in whom the aforementioned testing has been unrevealing but clinical suspicion remains, though is associated with low specificity. Demonstration of eosinophilic inflammation, via fractional exhaled nitric oxide measurement, or atopy, may be supportive of atopic asthma, though diagnostic utility is limited particularly in nonatopic asthma. All efforts should be made to confirm the diagnosis of asthma in those who are being presumptively treated but have not had objective measurements of variability in the degree of obstruction. Multiple testing modalities are available for objective confirmation of airway obstruction and variability thereof, consistent with a diagnosis of asthma in the appropriate clinical context. Providers should be aware that both these characteristics may be present in other disease states, and may not be specific to a diagnosis of asthma. © 2015 ARS-AAOA, LLC.

  12. The effect of various disinfectants on detection of avian influenza virus by real time RT-PCR.

    Science.gov (United States)

    Suarez, D L; Spackman, E; Senne, D A; Bulaga, L; Welsch, A C; Froberg, K

    2003-01-01

    An avian influenza (AI) real time reverse transcriptase-polymerase chain reaction (RRT-PCR) test was previously shown to be a rapid and sensitive method to identify AI virus-infected birds in live-bird markets (LBMs). The test can also be used to identify avian influenza virus (AIV) from environmental samples. Consequently, the use of RRT-PCR was being considered as a component of the influenza eradication program in the LBMs to assure that each market was properly cleaned and disinfected before allowing the markets to be restocked. However, the RRT-PCR test cannot differentiate between live and inactivated virus, particularly in environmental samples where the RRT-PCR test potentially could amplify virus that had been inactivated by commonly used disinfectants, resulting in a false positive test result. To determine whether this is a valid concern, a study was conducted in three New Jersey LBMs that were previously shown to be positive for the H7N2 AIV. Environmental samples were collected from all three markets following thorough cleaning and disinfection with a phenolic disinfectant. Influenza virus RNA was detected in at least one environmental sample from two of the three markets when tested by RRT-PCR; however, all samples were negative by virus isolation using the standard egg inoculation procedure. As a result of these findings, laboratory experiments were designed to evaluate several commonly used disinfectants for their ability to inactivate influenza as well as disrupt the RNA so that it could not be detected by the RRT-PCR test. Five disinfectants were tested: phenolic disinfectants (Tek-trol and one-stroke environ), a quaternary ammonia compound (Lysol no-rinse sanitizer), a peroxygen compound (Virkon-S), and sodium hypochlorite (household bleach). All five disinfectants were effective at inactivating AIV at the recommended concentrations, but AIV RNA in samples inactivated with phenolic and quaternary ammonia compounds could still be detected by RRT-PCR

  13. A small noncoding RNA signature found in exosomes of GBM patient serum as a diagnostic tool.

    Science.gov (United States)

    Manterola, Lorea; Guruceaga, Elizabeth; Gállego Pérez-Larraya, Jaime; González-Huarriz, Marisol; Jauregui, Patricia; Tejada, Sonia; Diez-Valle, Ricardo; Segura, Victor; Samprón, Nicolás; Barrena, Cristina; Ruiz, Irune; Agirre, Amaia; Ayuso, Angel; Rodríguez, Javier; González, Alvaro; Xipell, Enric; Matheu, Ander; López de Munain, Adolfo; Tuñón, Teresa; Zazpe, Idoya; García-Foncillas, Jesús; Paris, Sophie; Delattre, Jean Yves; Alonso, Marta M

    2014-04-01

    Glioblastoma multiforme (GBM) is the most frequent malignant brain tumor in adults, and its prognosis remains dismal despite intensive research and therapeutic advances. Diagnostic biomarkers would be clinically meaningful to allow for early detection of the tumor and for those cases in which surgery is contraindicated or biopsy results are inconclusive. Recent findings show that GBM cells release microvesicles that contain a select subset of cellular proteins and RNA. The aim of this hypothesis-generating study was to assess the diagnostic potential of miRNAs found in microvesicles isolated from the serum of GBM patients. To control disease heterogeneity, we used patients with newly diagnosed GBM. In the discovery stage, PCR-based TaqMan Low Density Arrays followed by individual quantitative reverse transcriptase polymerase chain reaction were used to test the differences in the miRNA expression levels of serum microvesicles among 25 GBM patients and healthy controls paired by age and sex. The detected noncoding RNAs were then validated in another 50 GBM patients. We found that the expression levels of 1 small noncoding RNA (RNU6-1) and 2 microRNAs (miR-320 and miR-574-3p) were significantly associated with a GBM diagnosis. In addition, RNU6-1 was consistently an independent predictor of a GBM diagnosis. Altogether our results uncovered a small noncoding RNA signature in microvesicles isolated from GBM patient serum that could be used as a fast and reliable differential diagnostic biomarker.

  14. Qualitative and quantitative polymerase chain reaction (PCR) for detection of Leishmania in spleen samples from naturally infected dogs.

    Science.gov (United States)

    Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares

    2012-03-23

    Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic

  15. Diagnostic value of enzyme linked immuno-sorbent assay for cytomegalovirus disease.

    Directory of Open Access Journals (Sweden)

    Priya K

    2002-07-01

    Full Text Available BACKGROUND: Since interpretation of results of enzyme linked immuno-sorbent assay (ELISA for diagnosis of Cytomegalovirus (CMV infection in India is difficult, its diagnostic value required evaluation. AIMS: To evaluate the diagnostic value of ELISA against polymerase chain reaction (PCR in CMV disease. SETTINGS AND DESIGN: Results of ELISA test for CMV antibodies in CMV-DNA PCR positive and negative patients and normal healthy blood donors were analysed. METHODS AND MATERIAL: Anti-CMV antibodies were assayed by ELISA on the sera of 26 CMV PCR positive and 21 PCR negative patients and 35 normal healthy blood donors. STATISTICAL ANALYSIS: Chi square and Fischer exact test were used for statistical analysis. RESULTS: Anti-CMV antibodies (IgG or IgG and IgM were present in 20 (76.9% of 26 PCR positive and 13 (61.9% of 21 PCR negative patients. ELISA was negative in six (23.1% of 26 PCR positive patients. Of the 28 paediatric patients, ELISA was positive in 14 (73.7% of 19 PCR positive and three (33.3% of nine PCR negative patients showing a statistically significant difference (Chi square test, P value 0.038. Among the 19 patients having complications after organ transplant, ELISA showed anti-CMV antibodies in six (85.7% of seven PCR positive and 11 (91.7% of 12 PCR negative patients showing no significant difference. CMV-DNA was not detected in the buffy coat of 35 sero-positive blood donors. CONCLUSION: ELISA has no diagnostic value in the detection of CMV activation although it may help in the differential diagnosis of CMV infection in the paediatric age group.

  16. Rapid Detection of the Chlamydiaceae and Other Families in the Order Chlamydiales: Three PCR Tests

    Science.gov (United States)

    Everett, Karin D. E.; Hornung, Linda J.; Andersen, Arthur A.

    1999-01-01

    Few identification methods will rapidly or specifically detect all bacteria in the order Chlamydiales, family Chlamydiaceae. In this study, three PCR tests based on sequence data from over 48 chlamydial strains were developed for identification of these bacteria. Two tests exclusively recognized the Chlamydiaceae: a multiplex test targeting the ompA gene and the rRNA intergenic spacer and a TaqMan test targeting the 23S ribosomal DNA. The multiplex test was able to detect as few as 200 inclusion-forming units (IFU), while the TaqMan test could detect 2 IFU. The amplicons produced in these tests ranged from 132 to 320 bp in length. The third test, targeting the 23S rRNA gene, produced a 600-bp amplicon from strains belonging to several families in the order Chlamydiales. Direct sequence analysis of this amplicon has facilitated the identification of new chlamydial strains. These three tests permit ready identification of chlamydiae for diagnostic and epidemiologic study. The specificity of these tests indicates that they might also be used to identify chlamydiae without culture or isolation. PMID:9986815

  17. Evaluation of the diagnostic value of serologic microagglutination testing and a polymerase chain reaction assay for diagnosis of acute leptospirosis in dogs in a referral center.

    Science.gov (United States)

    Fraune, Claudia Kümmerle; Schweighauser, Ariane; Francey, Thierry

    2013-05-15

    To determine the diagnostic value of a serologic microagglutination test (MAT) and a PCR assay on urine and blood for the diagnosis of leptospirosis in dogs with acute kidney injury (AKI). Cross-sectional study. Animals-76 dogs with AKI in a referral hospital (2008 to 2009). Dogs' leptospirosis status was defined with a paired serologic MAT against a panel of 11 Leptospira serovars as leptospirosis-associated (n = 30) or nonleptospirosis-associated AKI (12). In 34 dogs, convalescent serologic testing was not possible, and leptospirosis status was classified as undetermined. The diagnostic value of the MAT single acute or convalescent blood sample was determined in dogs in which leptospirosis status could be classified. The diagnostic value of a commercially available genus-specific PCR assay was evaluated by use of 36 blood samples and 20 urine samples. Serologic acute testing of an acute blood sample had a specificity of 100% (95% CI, 76% to 100%), a sensitivity of 50% (33% to 67%), and an accuracy of 64% (49% to 77%). Serologic testing of a convalescent blood sample had a specificity of 92% (65% to 99%), a sensitivity of 100% (87% to 100%), and an accuracy of 98% (88% to 100%). Results of the Leptospira PCR assay were negative for all samples from dogs for which leptospirosis status could be classified. Serologic MAT results were highly accurate for diagnosis of leptospirosis in dogs, despite a low sensitivity for early diagnosis. In this referral setting of dogs pretreated with antimicrobials, testing of blood and urine samples with a commercially available genus-specific PCR assay did not improve early diagnosis.

  18. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  19. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.

    Science.gov (United States)

    Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko

    2011-01-01

    HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

  20. Diagnostic and prognostic signatures from the small non-coding RNA transcriptome in prostate cancer

    DEFF Research Database (Denmark)

    Martens-Uzunova, E S; Jalava, S E; Dits, N F

    2011-01-01

    Prostate cancer (PCa) is the most frequent male malignancy and the second most common cause of cancer-related death in Western countries. Current clinical and pathological methods are limited in the prediction of postoperative outcome. It is becoming increasingly evident that small non-coding RNA...... signatures of 102 fresh-frozen patient samples during PCa progression by miRNA microarrays. Both platforms were cross-validated by quantitative reverse transcriptase-PCR. Besides the altered expression of several miRNAs, our deep sequencing analyses revealed strong differential expression of small nucleolar...... RNAs (snoRNAs) and transfer RNAs (tRNAs). From microarray analysis, we derived a miRNA diagnostic classifier that accurately distinguishes normal from cancer samples. Furthermore, we were able to construct a PCa prognostic predictor that independently forecasts postoperative outcome. Importantly...

  1. HRP2 and pLDH-Based Rapid Diagnostic Tests, Expert Microscopy, and PCR for Detection of Malaria Infection during Pregnancy and at Delivery in Areas of Varied Transmission: A Prospective Cohort Study in Burkina Faso and Uganda.

    Directory of Open Access Journals (Sweden)

    Daniel J Kyabayinze

    Full Text Available Intermittent screening and treatment (IST of malaria during pregnancy has been proposed as an alternative to intermittent preventive treatment in pregnancy (IPTp, where IPTp is failing due to drug resistance. However, the antenatal parasitaemias are frequently very low, and the most appropriate screening test for IST has not been defined.We conducted a multi-center prospective study of 990 HIV-uninfected women attending ANC in two different malaria transmission settings at Tororo District Hospital, eastern Uganda and Colsama Health Center in western Burkina Faso. Women were enrolled in the study in the second or third trimester of pregnancy and followed to delivery, generating 2,597 blood samples for analysis. Screening tests included rapid diagnostic tests (RDTs targeting histidine-rich protein 2 (HRP2 and parasite lactate dehydrogenase (pLDH and microscopy, compared to nPCR as a reference standard. At enrolment, the proportion of pregnant women who were positive for P. falciparum by HRP2/pan pLDH RDT, Pf pLDH/pan pLDH RDT, microscopy and PCR was 38%, 29%, 36% and 44% in Uganda and 21%, 16%, 15% and 35% in Burkina Faso, respectively. All test positivity rates declined during follow-up. In comparison to PCR, the sensitivity of the HRP2/pan pLDH RDT, Pf pLDH/pan pLDH RDT and microscopy was 75.7%, 60.1% and 69.7% in Uganda, 55.8%, 42.6% and 55.8% in Burkina Faso respectively for all antenatal visits. Specificity was greater than 96% for all three tests. Comparison of accuracy using generalized estimating equation revealed that the HRP2- detecting RDT was the most accurate test in both settings.The study suggests that HRP2-based RDTs are the most appropriate point-of-care test currently available for use during pregnancy especially for symptomatic women, but will still miss some PCR-positive women. The clinical significance of these very low density infections needs to be better defined.

  2. Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

    Science.gov (United States)

    Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

    2014-01-13

    Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The

  3. Methodology of diagnostic tests in hepatology

    DEFF Research Database (Denmark)

    Christensen, Erik

    2009-01-01

    The performance of diagnostic tests can be assessed by a number of methods. These include sensitivity, specificity,positive and negative predictive values, likelihood ratios and receiver operating characteristic (ROC) curves. This paper describes the methods and explains which information...... they provide. Sensitivity and specificity provides measures of the diagnostic accuracy of a test in diagnosing the condition. The positive and negative predictive values estimate the probability of the condition from the test-outcome and the condition's prevalence. The likelihood ratios bring together......' and plotting sensitivity as a function of 1-specificity. The ROC-curve can be used to define optimal cut-off values for a test, to assess the diagnostic accuracy of the test, and to compare the usefulness of different tests in the same patients. Under certain conditions it may be possible to utilize a test...

  4. Differential Diagnosis of Malaria on Truelab Uno®, a Portable, Real-Time, MicroPCR Device for Point-Of-Care Applications.

    Directory of Open Access Journals (Sweden)

    Chandrasekhar Bhaskaran Nair

    Full Text Available Sensitive and specific detection of malarial parasites is crucial in controlling the significant malaria burden in the developing world. Also important is being able to identify life threatening Plasmodium falciparum malaria quickly and accurately to reduce malaria related mortality. Existing methods such as microscopy and rapid diagnostic tests (RDTs have major shortcomings. Here, we describe a new real-time PCR-based diagnostic test device at point-of-care service for resource-limited settings.Truenat® Malaria, a chip-based microPCR test, was developed by bigtec Labs, Bangalore, India, for differential identification of Plasmodium falciparum and Plasmodium vivax parasites. The Truenat Malaria tests runs on bigtec's Truelab Uno® microPCR device, a handheld, battery operated, and easy-to-use real-time microPCR device. The performance of Truenat® Malaria was evaluated versus the WHO nested PCR protocol. The Truenat® Malaria was further evaluated in a triple-blinded study design using a sample panel of 281 specimens created from the clinical samples characterized by expert microscopy and a rapid diagnostic test kit by the National Institute of Malaria Research (NIMR. A comparative evaluation was done on the Truelab Uno® and a commercial real-time PCR system.The limit of detection of the Truenat Malaria assay was found to be <5 parasites/μl for both P. falciparum and P. vivax. The Truenat® Malaria test was found to have sensitivity and specificity of 100% each, compared to the WHO nested PCR protocol based on the evaluation of 100 samples. The sensitivity using expert microscopy as the reference standard was determined to be around 99.3% (95% CI: 95.5-99.9 at the species level. Mixed infections were identified more accurately by Truenat Malaria (32 samples identified as mixed versus expert microscopy and RDTs which detected 4 and 5 mixed samples, respectively.The Truenat® Malaria microPCR test is a valuable diagnostic tool and

  5. Differential Diagnosis of Malaria on Truelab Uno®, a Portable, Real-Time, MicroPCR Device for Point-Of-Care Applications.

    Science.gov (United States)

    Nair, Chandrasekhar Bhaskaran; Manjula, Jagannath; Subramani, Pradeep Annamalai; Nagendrappa, Prakash B; Manoj, Mulakkapurath Narayanan; Malpani, Sukriti; Pullela, Phani Kumar; Subbarao, Pillarisetti Venkata; Ramamoorthy, Siva; Ghosh, Susanta K

    2016-01-01

    Sensitive and specific detection of malarial parasites is crucial in controlling the significant malaria burden in the developing world. Also important is being able to identify life threatening Plasmodium falciparum malaria quickly and accurately to reduce malaria related mortality. Existing methods such as microscopy and rapid diagnostic tests (RDTs) have major shortcomings. Here, we describe a new real-time PCR-based diagnostic test device at point-of-care service for resource-limited settings. Truenat® Malaria, a chip-based microPCR test, was developed by bigtec Labs, Bangalore, India, for differential identification of Plasmodium falciparum and Plasmodium vivax parasites. The Truenat Malaria tests runs on bigtec's Truelab Uno® microPCR device, a handheld, battery operated, and easy-to-use real-time microPCR device. The performance of Truenat® Malaria was evaluated versus the WHO nested PCR protocol. The Truenat® Malaria was further evaluated in a triple-blinded study design using a sample panel of 281 specimens created from the clinical samples characterized by expert microscopy and a rapid diagnostic test kit by the National Institute of Malaria Research (NIMR). A comparative evaluation was done on the Truelab Uno® and a commercial real-time PCR system. The limit of detection of the Truenat Malaria assay was found to be <5 parasites/μl for both P. falciparum and P. vivax. The Truenat® Malaria test was found to have sensitivity and specificity of 100% each, compared to the WHO nested PCR protocol based on the evaluation of 100 samples. The sensitivity using expert microscopy as the reference standard was determined to be around 99.3% (95% CI: 95.5-99.9) at the species level. Mixed infections were identified more accurately by Truenat Malaria (32 samples identified as mixed) versus expert microscopy and RDTs which detected 4 and 5 mixed samples, respectively. The Truenat® Malaria microPCR test is a valuable diagnostic tool and implementation should be

  6. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research.

    Directory of Open Access Journals (Sweden)

    Lisa A Waddell

    Full Text Available There has been an increasing incidence of Lyme disease (LD in Canada and the United States corresponding to the expanding range of the Ixodes tick vector and Lyme disease agent (Borrelia burgdorferi sensu stricto. There are many diagnostic tests for LD available in North America, all of which have some performance issues, and physicians are concerned about the appropriate use and interpretation of these tests. The objective of this systematic review is to summarize the North American evidence on the accuracy of diagnostic tests and test regimes at various stages of LD. Included in the review are 48 studies on diagnostic tests used in North America published since 1995. Thirteen studies examined a two-tier serological test protocol vs. clinical diagnosis, 24 studies examined single assays vs. clinical diagnosis, 9 studies examined single immunoblot vs. clinical diagnosis, 7 studies compared culture or PCR direct detection methods vs. clinical diagnosis, 22 studies compared two or more tests with each other and 8 studies compared a two-tiered serological test protocol to another test. Recent studies examining the sensitivity and specificity of various test protocols noted that the Immunetics® C6 B. burgdorferi ELISA™ and the two tier approach have superior specificity compared to proposed replacements, and the CDC recommended western blot algorithm has equivalent or superior specificity over other proposed test algorithms. There is a dramatic increase in test sensitivity with progression of B. burgdorferi infection from early to late LD. Direct detection methods, culture and PCR of tissue or blood samples were not as sensitive or timely compared to serological testing. It was also noted that there are a large number of both commercial (n = 42 and in-house developed tests used by private laboratories which have not been evaluated in the primary literature.

  7. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research

    Science.gov (United States)

    Lindsay, Robbin; Ogden, Nicholas

    2016-01-01

    There has been an increasing incidence of Lyme disease (LD) in Canada and the United States corresponding to the expanding range of the Ixodes tick vector and Lyme disease agent (Borrelia burgdorferi sensu stricto). There are many diagnostic tests for LD available in North America, all of which have some performance issues, and physicians are concerned about the appropriate use and interpretation of these tests. The objective of this systematic review is to summarize the North American evidence on the accuracy of diagnostic tests and test regimes at various stages of LD. Included in the review are 48 studies on diagnostic tests used in North America published since 1995. Thirteen studies examined a two-tier serological test protocol vs. clinical diagnosis, 24 studies examined single assays vs. clinical diagnosis, 9 studies examined single immunoblot vs. clinical diagnosis, 7 studies compared culture or PCR direct detection methods vs. clinical diagnosis, 22 studies compared two or more tests with each other and 8 studies compared a two-tiered serological test protocol to another test. Recent studies examining the sensitivity and specificity of various test protocols noted that the Immunetics® C6 B. burgdorferi ELISA™ and the two tier approach have superior specificity compared to proposed replacements, and the CDC recommended western blot algorithm has equivalent or superior specificity over other proposed test algorithms. There is a dramatic increase in test sensitivity with progression of B. burgdorferi infection from early to late LD. Direct detection methods, culture and PCR of tissue or blood samples were not as sensitive or timely compared to serological testing. It was also noted that there are a large number of both commercial (n = 42) and in-house developed tests used by private laboratories which have not been evaluated in the primary literature. PMID:28002488

  8. Field application of SD bioline malaria Ag Pf/Pan rapid diagnostic test for malaria in Greece.

    Science.gov (United States)

    Tseroni, Maria; Pervanidou, Danai; Tserkezou, Persefoni; Rachiotis, George; Pinaka, Ourania; Baka, Agoritsa; Georgakopoulou, Theano; Vakali, Annita; Dionysopoulou, Martha; Terzaki, Irene; Marka, Andriani; Detsis, Marios; Evlampidou, Zafiroula; Mpimpa, Anastasia; Vassalou, Evdokia; Tsiodras, Sotirios; Tsakris, Athanasios; Kremastinou, Jenny; Hadjichristodoulou, Christos

    2015-01-01

    Greece, a malaria-free country since 1974, has experienced re-emergence of Plasmodium vivax autochthonous malaria cases in some agriculture areas over the last three years. In early 2012, an integrated control programme (MALWEST Project) was launched in order to prevent re-establishment of the disease. In the context of this project, the rapid diagnostic tests (RDT) of SD Bioline Malaria Ag Pf/Pan that detects hrp-2 and pan-LDH antigens were used. The aim of this study was to assess the field application of the RDT for the P. vivax diagnosis in comparison to light microscopy and polymerase chain reaction (PCR). A total of 955 samples were tested with all three diagnostic tools. Agreement of RDT against microscopy and PCR for the diagnosis of P. vivax was satisfactory (K value: 0.849 and 0.976, respectively). The sensitivity, specificity and positive predictive value of RDT against PCR was 95.6% (95% C.I.: 84.8-99.3), 100% (95% C.I.: 99.6-100.0) and 100% (95% CI: 91.7-100.0) respectively, while the sensitivity, specificity and positive predictive value of RDT against microscopic examination was 97.4% (95% C.I.: 86.1-99.6), 99.4% (95% C.I.: 98.6-99.8) and 86.1% (95% CI: 72.1-94.7), respectively. Our results indicate that RDT performed satisfactory in a non-endemic country and therefore is recommended for malaria diagnosis, especially in areas where health professionals lack experience on light microscopy.

  9. Partial validation of a TaqMan real-time quantitative PCR for the detection of ranaviruses

    DEFF Research Database (Denmark)

    Stilwell, Natalie K.; Whittington, Richard J.; Hick, Paul M.

    2018-01-01

    Ranaviruses are globally emerging pathogens negatively impacting wild and cultured fish, amphibians, and reptiles. Although conventional and diagnostic real-time PCR (qPCR) assays have been developed to detect ranaviruses, these assays often have not been tested against the known diversity of ran...

  10. Diagnostic performance of fecal quantitative real-time polymerase chain reaction for detection of Lawsonia intracellularis–associated proliferative enteropathy in nursery pigs

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre

    2013-01-01

    Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...

  11. Molecular diagnostics for human leptospirosis.

    Science.gov (United States)

    Waggoner, Jesse J; Pinsky, Benjamin A

    2016-10-01

    The definitive diagnosis of leptospirosis, which results from infection with spirochetes of the genus Leptospira, currently relies on the use of culture, serological testing (microscopic agglutination testing), and molecular detection. The purpose of this review is to describe new molecular diagnostics for Leptospira and discuss advancements in the use of available methods. Efforts have been focused on improving the clinical sensitivity of Leptospira detection using molecular methods. In this review, we describe a reoptimized pathogenic species-specific real-time PCR (targeting lipL32) that has demonstrated improved sensitivity, findings by two groups that real-time reverse-transcription PCR assays targeting the 16S rrs gene can improve detection, and two new loop-mediated amplification techniques. Quantitation of leptospiremia, detection in different specimen types, and the complementary roles played by molecular detection and microscopic agglutination testing will be discussed. Finally, a protocol for Leptospira strain subtyping using variable number tandem repeat targets and high-resolution melting will be described. Molecular diagnostics have an established role for the diagnosis of leptospirosis and provide an actionable diagnosis in the acute setting. The use of real-time reverse-transcription PCR for testing serum/plasma and cerebrospinal fluid, when available, may improve the detection of Leptospira without decreasing clinical specificity.

  12. Pitfalls in PCR troubleshooting: Expect the unexpected?

    Directory of Open Access Journals (Sweden)

    Livia Schrick

    2016-01-01

    Full Text Available PCR is a well-understood and established laboratory technique often used in molecular diagnostics. Huge experience has been accumulated over the last years regarding the design of PCR assays and their set-up, including in-depth troubleshooting to obtain the optimal PCR assay for each purpose. Here we report a PCR troubleshooting that came up with a surprising result never observed before. With this report we hope to sensitize the reader to this peculiar problem and to save troubleshooting efforts in similar situations, especially in time-critical and ambitious diagnostic settings.

  13. HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors

    DEFF Research Database (Denmark)

    Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran

    2017-01-01

    BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...

  14. Evaluation of NGS and RT-PCR methods for ALK rearrangement in European NSCLC patients

    DEFF Research Database (Denmark)

    Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota

    2018-01-01

    INTRODUCTION: The reported prevalence of ALK rearrangement in NSCLC ranges from 2%-7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proven to be a reproducible and sensitive technique. Reverse transcriptase...

  15. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  16. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  17. Translating microarray data for diagnostic testing in childhood leukaemia

    International Nuclear Information System (INIS)

    Hoffmann, Katrin; Firth, Martin J; Beesley, Alex H; Klerk, Nicholas H de; Kees, Ursula R

    2006-01-01

    Recent findings from microarray studies have raised the prospect of a standardized diagnostic gene expression platform to enhance accurate diagnosis and risk stratification in paediatric acute lymphoblastic leukaemia (ALL). However, the robustness as well as the format for such a diagnostic test remains to be determined. As a step towards clinical application of these findings, we have systematically analyzed a published ALL microarray data set using Robust Multi-array Analysis (RMA) and Random Forest (RF). We examined published microarray data from 104 ALL patients specimens, that represent six different subgroups defined by cytogenetic features and immunophenotypes. Using the decision-tree based supervised learning algorithm Random Forest (RF), we determined a small set of genes for optimal subgroup distinction and subsequently validated their predictive power in an independent patient cohort. We achieved very high overall ALL subgroup prediction accuracies of about 98%, and were able to verify the robustness of these genes in an independent panel of 68 specimens obtained from a different institution and processed in a different laboratory. Our study established that the selection of discriminating genes is strongly dependent on the analysis method. This may have profound implications for clinical use, particularly when the classifier is reduced to a small set of genes. We have demonstrated that as few as 26 genes yield accurate class prediction and importantly, almost 70% of these genes have not been previously identified as essential for class distinction of the six ALL subgroups. Our finding supports the feasibility of qRT-PCR technology for standardized diagnostic testing in paediatric ALL and should, in conjunction with conventional cytogenetics lead to a more accurate classification of the disease. In addition, we have demonstrated that microarray findings from one study can be confirmed in an independent study, using an entirely independent patient cohort

  18. Development of a Real-time PCR test for porcine group A rotavirus diagnosis

    Directory of Open Access Journals (Sweden)

    Elizabeth C.M. Marconi

    2015-01-01

    Full Text Available Group A Rotavirus (RVA is one of the most common causes of diarrhea in humans and several animal species. A SYBR-Green Real-Time polymerase chain reaction (PCR was developed to diagnose RVA from porcine fecal samples, targeting amplification of a 137-bp fragment of nonstructural protein 5 (NSP5 gene using mRNA of bovine NADH-desidrogenase-5 as exogenous internal control. Sixty-five samples were tested (25 tested positive for conventional PCR and genetic sequencing. The overall agreement (kappa was 0.843, indicating 'very good' concordance between tests, presenting 100% of relative sensitivity (25+ Real Time PCR/25+ Conventional PCR and 87.5% of relative sensitivity (35- Real Time PCR/40- Conventional PCR. The results also demonstrated high intra- and inter-assay reproducibility (coefficient of variation ≤1.42%; thus, this method proved to be a fast and sensitive approach for the diagnosis of RVA in pigs.

  19. The Diagnostic Utility of Bact/ALERT and Nested PCR in the Diagnosis of Tuberculous Meningitis.

    Science.gov (United States)

    Sastry, Apurba Sankar; Bhat K, Sandhya; Kumudavathi

    2013-01-01

    The early laboratory diagnosis of Tuberculous Meningitis (TBM) is crucial, to start the antitubercular chemotherapy and to prevent its complications. However, the conventional methods are either less sensitive or time consuming. Hence, the diagnostic potentials of BacT/ALERT and Polymerase Chain Reaction (PCR) was evaluated in this study. The study group comprised of 62 cases and 33 controls. The cases were divided according to Ahuja's criteria into the confirmed (two cases), highly probable (19 cases), probable (26 cases) and the possible (15 cases) subgroups. Ziehl Neelsen's (ZN) and Auramine Phenol (AP) staining, Lowenstein Jensen (LJ) medium culture, BacT/ALERT and nested Polymerase Chain Reaction (PCR) which targeted IS6110 were carried out on all the patients. The sensitivity of the LJ culture was 3.22%. BacT/ALERT showed a sensitivity and a specificity of 25.80% and 100% and those of nested PCR were found to be 40.32% and 96.97% respectively. The mean detection time of growth of the LJ culture was 31.28 days, whereas that of BacT/ALERT was 20.68 days. The contamination rate in the LJ culture and BacT/ALERT were 7.2% and 5.8% respectively. Nested PCR was found to be more sensitive, followed by BacT/ALERT as compared to the LJ culture and smear microscopy. As both false negative and false positive results have been reported for nested PCR, so it should not be used alone as a criterion for initiating or terminating the therapy, but it should be supported by clinical, radiological, cytological and other microbiological findings.

  20. A review of the public health management of shigellosis in Australia in the era of culture-independent diagnostic testing.

    Science.gov (United States)

    Tai, Alex Y C; Easton, Marion; Encena, Jess; Rotty, Jessica; Valcanis, Mary; Howden, Benjamin P; Slota-Kan, Simon; Gregory, Joy

    2016-12-01

    To review the national case definition for shigellosis following the introduction of culture independent diagnostic testing by clinical laboratories and provide evidence to reform jurisdictional public health practices for the management shigellosis., . A review of all Australian jurisdictional public health guidelines for shigellosis was conducted. Victorian 2014 shigellosis data were analysed: demographics and risk factors for cases identified by conventional culture or culture-independent diagnostic methods were described. There was considerable variation in reporting of cases to the National Notifiable Disease Surveillance System (NNDSS) by the eight Australian jurisdictions, with an array of classifications based on diagnostic testing methodologies. Analysis of Victorian 2014 shigellosis data found that culture positive cases were more likely to have reported men who have sex with men (MSM) as a risk factor than PCR positive only cases (p<0.0001) and less likely to have reported overseas travel during their incubation period (p<0.0001). Over a 10-year period (2005 to 2014), only two of 86 cases who were employed in high-risk occupations had ongoing positive faecal cultures after appropriate treatment. The national surveillance case definition for shigellosis should be reviewed to facilitate standardised reporting across Australia. All jurisdictions must consider the public health significance of PCR positive only results in their surveillance risk assessments to inform management of shigellosis cases. © 2016 Public Health Association of Australia.

  1. Evaluation of Anthelmintic Resistance and Exhaust Air Dust PCR as a Diagnostic Tool in Mice Enzootically Infected with Aspiculuris tetraptera

    Science.gov (United States)

    Kapoor, Pratibha; Hayes, Yumiko O; Jarrell, Leslie T; Bellinger, Dwight A; Thomas, Rhiannon D; Lawson, Gregory W; Arkema, Jaclyn D; Fletcher, Craig A; Nielsen, Judith N

    2017-01-01

    The entry of infectious agents in rodent colonies occurs despite robust sentinel monitoring programs, strict quarantine measures, and stringent biosecurity practices. In light of several outbreaks with Aspiculuris tetraptera in our facilities, we investigated the presence of anthelmintic resistance and the use of exhaust air dust (EAD) PCR for early detection of A. tetraptera infection. To determine anthelmintic resistance, C57BL/6, DBA/2, and NCr nude mice were experimentally inoculated with embryonated A. tetraptera ova harvested from enzootically infected mice, followed by treatment with 150 ppm fenbendazole in feed, 150 ppm fenbendazole plus 5 ppm piperazine in feed, or 2.1 mg/mL piperazine in water for 4 or 8 wk. Regardless of the mouse strain or treatment, no A. tetraptera were recovered at necropsy, indicating the lack of resistance in the worms to anthelmintic treatment. In addition, 10 of 12 DBA/2 positive-control mice cleared the A. tetraptera infection without treatment. To evaluate the feasibility of EAD PCR for A. tetraptera, 69 cages of breeder mice enzootically infected with A. tetraptera were housed on a Tecniplast IVC rack as a field study. On day 0, 56% to 58% of the cages on this rack tested positive for A. tetraptera by PCR and fecal centrifugation flotation (FCF). PCR from EAD swabs became positive for A. tetraptera DNA within 1 wk of placing the above cages on the rack. When these mice were treated with 150 ppm fenbendazole in feed, EAD PCR reverted to pinworm-negative after 1 mo of treatment and remained negative for an additional 8 wk. The ability of EAD PCR to detect few A. tetraptera positive mice was investigated by housing only 6 infected mice on another IVC rack as a field study. The EAD PCR from this rack was positive for A. tetraptera DNA within 1 wk of placing the positive mice on it. These findings demonstrate that fenbendazole is still an effective anthelmintic and that EAD PCR is a rapid, noninvasive assay that may be a useful

  2. Diagnostic molecular microbiology: a 2013 snapshot.

    Science.gov (United States)

    Fairfax, Marilynn Ransom; Salimnia, Hossein

    2013-12-01

    Molecular testing has a large and increasing role in the diagnosis of infectious diseases. It has evolved significantly since the first probe tests were FDA approved in the early 1990s. This article highlights the uses of molecular techniques in diagnostic microbiology, including "older," as well as innovative, probe techniques, qualitative and quantitative RT-PCR, highly multiplexed PCR panels, some of which use sealed microfluidic test cartridges, MALDI TOF, and nuclear magnetic resonance. Tests are grouped together by technique and target. Tests with similar roles for similar analytes are compared with respect to benefits, drawbacks, and possible problems. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Performance of nested RT-PCR on CSF for tuberculous meningitis diagnosis in HIV-infected patients.

    Science.gov (United States)

    Gualberto, F A S; Gonçalves, M G; Fukasawa, L O; Santos, A M Ramos Dos; Sacchi, C T; Harrison, L H; Boulware, D R; Vidal, J E

    2017-10-01

    Timely diagnosis of tuberculous meningitis (TBM) in patients with human immunodeficiency virus (HIV) infection remains a challenge. Despite the current scale-up of the Xpert® MTB/RIF assay, other molecular diagnostic tools are necessary, particularly in referral centres in low- and middle-income countries without Xpert testing. To determine the diagnostic performance of nested real-time polymerase chain reaction (nRT-PCR) in HIV-infected TBM patients categorised according to standardised clinical case definitions. Based on clinical, laboratory and imaging data, HIV-infected patients with suspected TBM were prospectively categorised as 'definite TBM', 'probable TBM', 'possible TBM' or 'not TBM'. We evaluated nRT-PCR sensitivity and specificity in diagnosing TBM among definite TBM cases, and among definite + probable TBM cases. Ninety-two participants were enrolled in the study. nRT-PCR sensitivity for definite TBM (n = 8) was 100% (95%CI 67-100) and 86% (95%CI 60-96) for both definite and probable TBM (n = 6). Assuming that 'not TBM' patients (n = 74) were true-negatives, nRT-PCR specificity was 100% (95%CI 95-100). The possible TBM group (n = 4) had no nRT-PCR positives. The nRT-PCR is a useful rule-in test for HIV-infected patients with TBM according to international consensus case definitions. As nRT-PCR cannot exclude TBM, studies comparing and combining nRT-PCR with other assays are necessary for a rule-out test.

  5. Molecular detection of Plasmodium knowlesi in a Dutch traveler by real-time PCR.

    Science.gov (United States)

    Link, Lonneke; Bart, Aldert; Verhaar, Nienke; van Gool, Tom; Pronk, Marjolijn; Scharnhorst, Volkher

    2012-07-01

    Plasmodium knowlesi infection with low parasitemia presents a diagnostic challenge, as rapid diagnostic tests are often negative and identification to the species level by microscopy is difficult. P. knowlesi malaria in a traveler is described, and real-time PCR is demonstrated to support fast and reliable diagnosis and identification to the species level.

  6. The diagnostic value of endoscopy and Helicobacter pylori tests for peptic ulcer patients in late post-treatment setting

    Directory of Open Access Journals (Sweden)

    Kull Ingrid

    2004-10-01

    Full Text Available Abstract Background Guidelines for management of peptic ulcer patients after the treatment are largely directed to detection of H. pylori infection using only non-invasive tests. We compared the diagnostic value of non-invasive and endoscopy based H. pylori tests in a late post-treatment setting. Methods Altogether 34 patients with dyspeptic complaints were referred for gastroscopy 5 years after the treatment of peptic ulcer using a one-week triple therapy scheme. The endoscopic and histologic findings were evaluated according to the Sydney classification. Bacteriological, PCR and cytological investigations and 13C-UBT tests were performed. Results Seventeen patients were defined H. pylori positive by 13C-UBT test, PCR and histological examination. On endoscopy, peptic ulcer persisted in 4 H. pylori positive cases. Among the 6 cases with erosions of the gastric mucosa, only two patients were H. pylori positive. Mucosal atrophy and intestinal metaplasia were revealed both in the H. pylori positive and H. pylori negative cases. Bacteriological examination revealed three clarithromycin resistant H. pylori strains. Cytology failed to prove validity for diagnosing H. pylori in a post-treatment setting. Conclusions In a late post-treatment setting, patients with dyspepsia should not be monitored only by non-invasive investigation methods; it is also justified to use the classical histological evaluation of H. pylori colonisation, PCR and bacteriology as they have shown good concordance with 13C-UBT. Moreover, endoscopy and histological investigation of a gastric biopsy have proved to be the methods with an additional diagnostic value, providing the physician with information about inflammatory, atrophic and metaplastic lesions of the stomach in dyspeptic H. pylori positive and negative patients. Bacteriological methods are suggested for detecting the putative antimicrobial resistance of H. pylori, aimed at successful eradication of infection in

  7. Evaluation of the Ortho-Clinical Diagnostics Vitros ECi Anti-HCV test: comparison with three other methods.

    Science.gov (United States)

    Watterson, Jeannette M; Stallcup, Paulina; Escamilla, David; Chernay, Patrick; Reyes, Alfred; Trevino, Sylvia C

    2007-01-01

    After observing a high incidence of low positive hepatitis C virus (HCV) antibody screens by the Ortho-Clinical Vitros ECi test (Orthoclinical Diagnostics, Raritan, NJ), we compared results against those obtained using another chemiluminescent analyzer, as well as two U.S. Food and Drug Administration (FDA)-approved confirmatory methodologies. To ascertain the true anti-HCV status of samples deemed low-positive by the Ortho-Clinical Vitros ECi test, we tested samples using the ADVIA Centaur HCV screen test (Siemens Medical Solutions Diagnostics), the Chiron recombinant immunoblot assay (RIBA) test (Chiron Corp., Emeryville, CA), and the Roche COBAS Amplicor HCV qualitative test (Roche Diagnostics, Indianapolis, IN) in a series of studies. Of 94 specimens positive by Vitros ECi, 19% were observed to be negative by Centaur. A separate study of 91 samples with signal-to-cutoff (s/co) values less than 8.0 showed that all but one was negative for HCV ribonucleic acid (RNA). In comparison with RIBA, 100% (77) samples positive by the Vitros ECi test with s/co values less than 12.0 were negative or indeterminate by RIBA. A final study comparing all four methods side-by-side showed 63% disagreement by Centaur for Vitros ECi low-positive samples, 75% disagreement by RIBA, and 97% disagreement by polymerase chain reaction (PCR). In conclusion, the Ortho-Clinical Vitros ECi Anti-HCV test yields a high rate of false-positive results in the low s/co range in our patient population. (c) 2007 Wiley-Liss, Inc.

  8. Avaliação das técnicas de RT-PCR e heminested RT-PCR em cérebros de cães com sinais neurológicos compatíveis com cinomose

    Directory of Open Access Journals (Sweden)

    Adriana Cortez

    2015-12-01

    Full Text Available The diagnostic value of RT-PCR and hemi-nested RT-PCR (hnRT-PCR was compared in brain samples of dogs presenting neurological signs compatible with canine distemper. Samples of central nervous system (CNS were collected from 68 dogs and tested by direct immunofluorescence test (RFID and, independent of the results, they were stored at -20°C for at least three years. They were submitted to the RT-PCR and hnRT-PCR techniques aiming to determine the gene responsible for the viral nucleoprotein decoding. Fifty-nine samples were positive for RIFD, 40 for RT-PCR (Kappa = 0.358 and 54 for hnRT-PCR (Kappa = 0.740. All nine RIFD negative samples were also negative for RT-PCR and hnRT-PCR. In spite of the storage duration and proper sample conditions, the estimated accordance between hnRT-PCR and RIFD demonstrated that hnRT-PCR technique can be applied in retrospective studies.

  9. The interpretation of diagnostic tests

    International Nuclear Information System (INIS)

    Lamk, M.; Lamki, M.D.

    1987-01-01

    The progress of nuclear and other diagnostic imaging is near rampant. With almost every issue of the major journals in this field, a new diagnostic test, or at least a new utility of an old test is described. Before we accept these innovations, we have to have a clear understanding of the clinical performance of the test. The major criteria are the sensitivity and the specificity of the test. From these derived other statistical parameters such as accuracy or efficiency of that test; also, the receiver operating characteristic (ROC) curves may then be evaluated and used in comparison of different tests. When we know the prevalence of the disease tested in the population we are investigating, we can then derive the predictive value of a positive or a negative result. This introduction tries to explain these parameters to help the reader understand the literature dealing with the subject of efficacy of imaging procedures. It is not intended as a critical review of the literature on the subject or a comprehensive overview of the subject matter. The benefit derived from explaination of statistical concepts to physicians is documented in a recent publication. Explaination of these basic statistical parameters will be followed by a demonstration of the utility of multiple testing with these parameters. The reader is thereby introduced to relevant statistical concepts that must be grasped for full comprehension of published results of a new diagnostic imaging modality, or before clinical decision making

  10. Automated 5 ' nuclease PCR assay for identification of Salmonella enterica

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Ahrens, Peter; Rådström, P.

    2000-01-01

    -point fluorescence (FAM) signals for the samples and positive control (TET) signals (relative sensitivity [Delta Rn], >0.6). The diagnostic specificity of the method was assessed using 120 non-Salmonella strains, which all resulted in negative FAM signals (Delta Rn, less than or equal to 0.5). All 100 rough...... Salmonella strains tested resulted in positive FAM and TET signals. In addition, it was found that the complete PCR mixture, predispensed in microwell plates, could be stored for up to 3 months at -20 degrees C, Thus, the diagnostic TaqMan assay developed can be a useful and simple alternative method......A simple and ready-to-go test based on a 5' nuclease (TaqMan) PCR technique was developed for identification of presumptive Salmonella enterica isolates. The results were compared with those of conventional methods. The TaqMan assay was evaluated for its ability to accurately detect 210 S. enterica...

  11. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo

    2016-06-01

    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  12. Reliability of rapid diagnostic tests in diagnosing pregnancy-associated malaria in north-eastern Tanzania

    DEFF Research Database (Denmark)

    Minja, Daniel T.; Schmiegelow, Christentze; Oesterholt, Mayke

    2012-01-01

    dehydrogenase (pLDH) based RDTs (Parascreen™) or HRP-2 only (Paracheck Pf® and ParaHIT®f), microscopy and nested Plasmodium species diagnostic PCR. Results: From a cohort of 924 pregnant women who completed the follow up, complete RDT and microscopy data was available for 5,555 blood samples and of these 442...... (RDTs) could be an ideal diagnostic complement to microscopy, due to their ease of use and adequate sensitivity in detecting even sub-microscopic infections. Polymerase chain reaction (PCR) is even more sensitive, but it is mainly used for research purposes. The accuracy and reliability of RDTs...... in diagnosing PAM was evaluated using microscopy and PCR. Methods: A cohort of pregnant women in north-eastern Tanzania was followed throughout pregnancy for detection of plasmodial infection using venous and placental blood samples evaluated by histidine rich protein 2 (HRP-2) and parasite lactate...

  13. Evaluation of rapid diagnostic test kits for feline leukemia virus infection using samples from naturally infected cats

    Directory of Open Access Journals (Sweden)

    Jiayou Liu

    2016-09-01

    Full Text Available Objectives Feline leukemia virus (FeLV is a potentially life-threatening oncogenic retrovirus. The p27 viral core protein is produced by the virus in infected feline cells, is found in the cytoplasm in several blood cells and can be free in the serum and plasma. ELISA or particle-based immunoassay are commonly used to detect the presence of the p27 core protein in samples obtained from blood. The objective of this study was to compare the performance of several in-clinic tests: the SNAP Feline Triple Test (IDEXX Laboratories, the WITNESS FeLV-FIV Test (Zoetis and the VetScan Feline FeLV/FIV Rapid Test (Abaxis. Methods The sample population (100 positive, 105 negative samples consisted of serum and plasma samples submitted to IDEXX’s worldwide reference laboratory for feline retrovirus testing. Virus isolation and reverse transcriptase PCR results were not available and so samples were judged to be positive or negative based on the results of the ViraCHEK FeLV (Zoetis microtiter plate assay. Results The percentage of samples positive and negative for FeLV p27 antigen using the three in-clinic tests compared with the ViraCHEK method were as follows: IDEXX Feline Triple (positive 98.0%, negative 100%; Zoetis WITNESS (positive 79.0%, negative 97.1%; Abaxis VetScan (positive 73.0%, negative 97.1%. Conclusions and relevance The SNAP Feline Triple Test demonstrated a high level of agreement for FeLV-positive and FeLV-negative samples when assessed in this model. Results of FeLV assays can vary among tests.

  14. Evaluation of rapid diagnostic test kits for feline leukemia virus infection using samples from naturally infected cats.

    Science.gov (United States)

    Liu, Jiayou; O'Connor, Thomas; Beall, Melissa; Chandrashekar, Ramaswamy; Lappin, Michael

    2016-01-01

    Feline leukemia virus (FeLV) is a potentially life-threatening oncogenic retrovirus. The p27 viral core protein is produced by the virus in infected feline cells, is found in the cytoplasm in several blood cells and can be free in the serum and plasma. ELISA or particle-based immunoassay are commonly used to detect the presence of the p27 core protein in samples obtained from blood. The objective of this study was to compare the performance of several in-clinic tests: the SNAP Feline Triple Test (IDEXX Laboratories), the WITNESS FeLV-FIV Test (Zoetis) and the VetScan Feline FeLV/FIV Rapid Test (Abaxis). The sample population (100 positive, 105 negative samples) consisted of serum and plasma samples submitted to IDEXX's worldwide reference laboratory for feline retrovirus testing. Virus isolation and reverse transcriptase PCR results were not available and so samples were judged to be positive or negative based on the results of the ViraCHEK FeLV (Zoetis) microtiter plate assay. The percentage of samples positive and negative for FeLV p27 antigen using the three in-clinic tests compared with the ViraCHEK method were as follows: IDEXX Feline Triple (positive 98.0%, negative 100%); Zoetis WITNESS (positive 79.0%, negative 97.1%); Abaxis VetScan (positive 73.0%, negative 97.1%). The SNAP Feline Triple Test demonstrated a high level of agreement for FeLV-positive and FeLV-negative samples when assessed in this model. Results of FeLV assays can vary among tests.

  15. Polymerase study: Improved detection of Salmonella and Campylobacter through the optimized use of DNA polymerases in diagnostic real-time PCR

    DEFF Research Database (Denmark)

    Søndergaard, Mette Sofie Rousing; Löfström, Charlotta; Al-Habib, Zahra Fares Sayer

    DNA extractions and intermediate or bad with the crude extractions, while TaKaRa ExTaq HS only performed well with the purest extractions of fecal samples and intermediate with semi-automated magnetic beads based extracted fecal samples. In conclusion, our data shows that exchanging the DNA polymerase......Diagnostic analyses of foodborne pathogens are increasingly based on molecular methods such as PCR, which can improve the sensitivity and reduce the analysis time. The core of PCR is the enzyme performing the reaction: the DNA polymerase. Changing the polymerase can influence the sensitivity...... commercially available polymerases and four master mixes in two validated PCR assays, for Campylobacter and Salmonella, respectively, to develop more sensitive, robust and cost effective assays. The polymerases were screened on purified DNA and the five best performing, for each PCR assay, were then applied...

  16. The market trend analysis and prospects of cancer molecular diagnostics kits.

    Science.gov (United States)

    Seo, Ju Hwan; Lee, Joon Woo; Cho, Daemyeong

    2018-01-01

    The molecular diagnostics market can be broadly divided into PCR (rt-PCR, d-PCR), NGS(Next Generation Sequencing), Microarray, FISH(Fluorescent in situ-hybridization) and other categories, based on the diagnostic technique. Also, depending on the disease being diagnosed, the market can also be divided into cancer, infectious diseases, HIV/STDs (herpes, syphilis), and women's health issues such as breast cancer, cervical cancer, ovarian cancer, HPV(human papillomavirus), and vaginitis.Chromosome analysis (including Fluorescent In-situ Hybridization) is one type of blood cancer diagnostic method, which involves the direct detection of individual cells with chromosomal translocation, but there have been problems of sensitivity when using this method. PCR targeting individual genes or the RT (reverse transcription)-PCR method offers outstanding sensitivity, but one drawback is the risk of false-positive reaction caused by contamination of samples, etc. Blood cancer molecular diagnostics kits allow us to overcome these shortcomings, and related products have been under development, with a focus on improving detection sensitivity, enabling multiple tests, and reducing the cost and diagnostic time. Blood cancer molecular diagnostics is usually performed based on platforms such as PCR. The global market for blood cancer molecular diagnostics kits is $ 335.9 million as of 2016 and is expected to reach $ 6980 million in 2026 with an average annual growth rate of 32.9%. The market in South Korea is anticipated to grow at an average annual rate of 28.9%, from $ 3.75 million as of 2016 to $ 60.89 million in 2026. The Market for blood cancer molecular diagnostics kits is judged to be higher in growth possibility due to the increase in the number of cancer patients.

  17. Diagnostic tests based on human basophils

    DEFF Research Database (Denmark)

    Kleine-Tebbe, Jörg; Erdmann, Stephan; Knol, Edward F

    2006-01-01

    -maximal responses, termed 'intrinsic sensitivity'. These variables give rise to shifts in the dose-response curves which, in a diagnostic setting where only a single antigen concentration is employed, may produce false-negative data. Thus, in order to meaningfully utilize the current basophil activation tests....... Diagnostic studies using CD63 or CD203c in hymenoptera, food and drug allergy are critically discussed. Basophil-based tests are indicated for allergy testing in selected cases but should only be performed by experienced laboratories....

  18. [Evaluation of cytomegalovirus quantification in blood by the R-gene real-time PCR test].

    Science.gov (United States)

    Marque-Juillet, S; Touzard, A; Monnier, S; Fernand-Laurent, C; Therby, A; Rigaudeau, S; Harzic, M

    2010-04-01

    Diagnosing the presence of cytomegalovirus (CMV) in the blood of immunodepressed patients is often done by quantitative polymerase chain reaction (Q-PCR) even though the reference method remains the antigenemia pp65 (Ag-pp65) test. To define the predictive value of the Q-PCR in the diagnosis of CMV disease and assess treatment efficacy using the CMV R-gene test. To compare the Q-PCR results and feasibility with those of the Ag-pp65 test. The Q-PCR was performed in 34 whole blood samples (frozen at -80 degrees C until use) from five patients diagnosed with CMV disease, defined as the presence of clinical signs and Ag-pp65 in the nuclei of more than two cells. After extraction, viral DNA was quantified in each sample using the Q-PCR CMV R-gene kit according to the manufacturer's instructions. Immediately after blood was drawn, the Ag-pp65 test had been performed in 32 samples using CINAkit (Argene). The 16 samples positive by the Ag-pp65 test were also positive by PCR; six samples negative by the Ag-pp65 test were positive by PCR; and the remaining 10 samples were negative by both techniques. During treatment, the two markers' kinetics were similar. The CMV R-gene test has a predictive value as good as that of the Ag-pp65 test but is fast and easier to use. A prospective study with a greater number of patients is needed to define the prediction threshold for CMV disease. Copyright 2009 Elsevier Masson SAS. All rights reserved.

  19. Ureaplasma parvum prosthetic joint infection detected by PCR.

    Science.gov (United States)

    Farrell, John J; Larson, Joshua A; Akeson, Jeffrey W; Lowery, Kristin S; Rounds, Megan A; Sampath, Rangarajan; Bonomo, Robert A; Patel, Robin

    2014-06-01

    We describe the first reported case of Ureaplasma parvum prosthetic joint infection (PJI) detected by PCR. Ureaplasma species do not possess a cell wall and are usually associated with colonization and infection of mucosal surfaces (not prosthetic material). U. parvum is a relatively new species name for certain serovars of Ureaplasma urealyticum, and PCR is useful for species determination. Our patient presented with late infection of his right total knee arthroplasty. Intraoperative fluid and tissue cultures and pre- and postoperative synovial fluid cultures were all negative. To discern the pathogen, we employed PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS). Our patient's failure to respond to empirical antimicrobial treatment and our previous experience with PCR/ESI-MS in culture-negative cases of infection prompted us to use this approach over other diagnostic modalities. PCR/ESI-MS detected U. parvum in all samples. U. parvum-specific PCR testing was performed on all synovial fluid samples to confirm the U. parvum detection. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  20. Soil Baiting, Rapid PCR Assay and Quantitative Real Time PCR to Diagnose Late Blight of Potato in Quarantine Programs

    Directory of Open Access Journals (Sweden)

    Touseef Hussain

    2018-05-01

    Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.

  1. Novel diagnostic PCR assay for Burkholderia cenocepacia epidemic strain ST32 and its utility in monitoring infection in cystic fibrosis patients

    Czech Academy of Sciences Publication Activity Database

    Dědečková, K.; Kalferstová, L.; Strnad, Hynek; Vávrová, J.; Dřevínek, P.

    2013-01-01

    Roč. 12, č. 5 (2013), s. 475-481 ISSN 1569-1993 Institutional support: RVO:68378050 Keywords : Burkholderia cenocepacia * diagnostic PCR * B. cenocepacia ST32 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.820, year: 2013

  2. Performance of a High-Sensitivity Rapid Diagnostic Test for Plasmodium falciparum Malaria in Asymptomatic Individuals from Uganda and Myanmar and Naive Human Challenge Infections.

    Science.gov (United States)

    Das, Smita; Jang, Ihn Kyung; Barney, Becky; Peck, Roger; Rek, John C; Arinaitwe, Emmanuel; Adrama, Harriet; Murphy, Maxwell; Imwong, Mallika; Ling, Clare L; Proux, Stephane; Haohankhunnatham, Warat; Rist, Melissa; Seilie, Annette M; Hanron, Amelia; Daza, Glenda; Chang, Ming; Nakamura, Tomoka; Kalnoky, Michael; Labarre, Paul; Murphy, Sean C; McCarthy, James S; Nosten, Francois; Greenhouse, Bryan; Allauzen, Sophie; Domingo, Gonzalo J

    2017-11-01

    Sensitive field-deployable diagnostic tests can assist malaria programs in achieving elimination. The performance of a new Alere™ Malaria Ag P.f Ultra Sensitive rapid diagnostic test (uRDT) was compared with the currently available SD Bioline Malaria Ag P.f RDT in blood specimens from asymptomatic individuals in Nagongera, Uganda, and in a Karen Village, Myanmar, representative of high- and low-transmission areas, respectively, as well as in pretreatment specimens from study participants from four Plasmodium falciparum -induced blood-stage malaria (IBSM) studies. A quantitative reverse transcription PCR (qRT-PCR) and a highly sensitive enzyme-linked immunosorbent assay (ELISA) test for histidine-rich protein II (HRP2) were used as reference assays. The uRDT showed a greater than 10-fold lower limit of detection for HRP2 compared with the RDT. The sensitivity of the uRDT was 84% and 44% against qRT-PCR in Uganda and Myanmar, respectively, and that of the RDT was 62% and 0% for the same two sites. The specificities of the uRDT were 92% and 99.8% against qRT-PCR for Uganda and Myanmar, respectively, and 99% and 99.8% against the HRP2 reference ELISA. The RDT had specificities of 95% and 100% against qRT-PCR for Uganda and Myanmar, respectively, and 96% and 100% against the HRP2 reference ELISA. The uRDT detected new infections in IBSM study participants 1.5 days sooner than the RDT. The uRDT has the same workflow as currently available RDTs, but improved performance characteristics to identify asymptomatic malaria infections. The uRDT may be a useful tool for malaria elimination strategies.

  3. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    Directory of Open Access Journals (Sweden)

    Qin E-de

    2010-06-01

    Full Text Available Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009 influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same as that of each single-target RT-PCR for pandemic H1N1 and even more sensitive for H5N1 with the same primers and probes. No cross reactivity of detecting other subtype influenza viruses or respiratory tract viruses was observed. Two hundred and thirty-six clinical specimens were tested by comparing with single real-time RT-PCR and result from the duplex assay was 100% consistent with the results of single real-time RT-PCR and sequence analysis.

  4. Molecular malaria diagnostics: A systematic review and meta-analysis.

    Science.gov (United States)

    Roth, Johanna M; Korevaar, Daniël A; Leeflang, Mariska M G; Mens, Pètra F

    2016-01-01

    Accurate diagnosis of malaria is essential for identification and subsequent treatment of the disease. Currently, microscopy and rapid diagnostic tests are the most commonly used diagnostics, next to treatment based on clinical signs only. These tests are easy to deploy, but have a relatively high detection limit. With declining prevalence in many areas, there is an increasing need for more sensitive diagnostics. Molecular tools may be a suitable alternative, although costs and technical requirements currently hamper their implementation in resource limited settings. A range of (near) point-of-care diagnostics is therefore under development, including simplifications in sample preparation, amplification and/or read-out of the test. Accuracy data, in combination with technical characteristics, are essential in determining which molecular test, if any, would be the most promising to be deployed. This review presents a comprehensive overview of the currently available molecular malaria diagnostics, ranging from well-known tests to platforms in early stages of evaluation, and systematically evaluates their published accuracy. No important difference in accuracy was found between the most commonly used PCR-based assays (conventional, nested and real-time PCR), with most of them having high sensitivity and specificity, implying that there are no reasons other than practical ones to choose one technique over the other. Loop-mediated isothermal amplification and other (novel) diagnostics appear to be highly accurate as well, with some offering potential to be used in resource-limited settings.

  5. Prenatal Genetic Diagnostic Tests

    Science.gov (United States)

    ... are available for many inherited disorders. The main disadvantage is that diagnostic testing carries a very small ... chromosomes, arranged in order of size. Microarray: A technology that examines all of a person’s genes to ...

  6. Rapid antigen detection test for respiratory syncytial virus diagnosis as a diagnostic tool

    Directory of Open Access Journals (Sweden)

    Flávio da Silva Mesquita

    2017-05-01

    Full Text Available Objective: The aim of this study was to evaluate the QuickVue® RSV Test Kit (QUIDEL Corp, CA, USA as a screening tool for respiratory syncytial virus in children with acute respiratory disease in comparison with the indirect immunofluorescence assay as gold standard. In Brazil, rapid antigen detection tests for respiratory syncytial virus are not routinely utilized as a diagnostic tool, except for the diagnosis of dengue and influenza. Methods: The authors retrospectively analyzed 486 nasopharyngeal aspirate samples from children under age 5 with acute respiratory infection, between December 2013 and August 2014, the samples were analyzed by indirect immunofluorescence assay and QuickVue® RSV Test kit. Samples with discordant results were analyzed by real time PCR and nucleotide sequencing. Results: From 313 positive samples by immunofluorescence assays, 282 (90% were also positive by the rapid antigen detection test, two were positive only by rapid antigen detection test, 33 were positive only by immunofluorescence assays, and 171 were positive by both methods. The 35 samples with discordant results were analyzed by real time PCR; the two samples positive only by rapid antigen detection test and the five positive only by immunofluorescence assays were also positive by real time PCR. There was no relation between the negativity by QuickVue® RSV Test and viral load or specific strain. The QuickVue® RSV Test showed sensitivity of 90%, specificity of 98.8%, predictive positive value of 99.3%, and negative predictive value of 94.6%, with accuracy of 93.2% and agreement κ index of 0.85 in comparison to immunofluorescence assay. Conclusions: This study demonstrated that the QuickVue® RSV Test Kit can be effective in early detection of Respiratory syncytial virus in nasopharyngeal aspirate and is reliable for use as a diagnostic tool in pediatrics. Resumo: Objetivo: Avaliar o teste QuickVue® RSV Test Kit (QUIDEL Corp, CA, EUA para o diagn

  7. Advantages and disadvantages of current diagnostic tests for the detection of Helicobacter pylori.

    Science.gov (United States)

    Mégraud, F

    1996-01-01

    Current tests used to detect Helicobacter pylori are either invasive (histological detection, culture, the polymerase chain reaction (PCR), smear examination) or non-invasive (serology, 13C-urea breath test). These tests vary in their sensitivity and specificity, and the choice of test will depend on the situation, for example, whether the test is to detect infection or the success of eradication treatment. The accuracy of histological tests depends, to a large degree, on the expertise of the pathologist, while the accuracy of culture can depend on the conditions in which the specimen is transported and processed. When performed under optimal conditions, both techniques give very good results. The PCR test has similar sensitivity and specificity to histological and culture tests but a strict protocol must be followed to avoid contamination with H. pylori DNA. The rapid urease test (with a reading taken 1 hour later) is suitable for diagnosis before treatment but its sensitivity decreases after treatment. Smear examination has limited sensitivity. The urea breath test and serology (specific IgG detected by enzyme-linked immunosorbent assay with purified antigens) have sensitivities close to those using the best of the biopsy methods. Other points to consider when selecting a test are its availability, the rapidity of the results (which can range from a few minutes to 2 weeks), possibilities for retrospective analysis, quantification and the detection of pathogenic properties, the globality of certain tests that present an overall picture of the stomach, thus avoiding errors in sampling, and the cost of the test. Important added value can be gained from certain tests: histology allows evaluation of the status of the mucosa, culture allows strain typing and tests for antibiotic susceptibility, and the breath test can confirm successful eradication without endoscopy. When the diagnostic tests are performed correctly, most of them are highly accurate.

  8. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR for detection of avian metapneumovirus subtype A Comparação entre as técnicas de RT-PCR convencional e RT-PCR em tempo real para a detecção do metapneumovírus aviários subtipo A

    Directory of Open Access Journals (Sweden)

    Helena Lage Ferreira

    2009-08-01

    Full Text Available Avian metapneumovirus (AMPV belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F gene and nucleocapsid (N gene were compared with an established test for the attachment (G gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3 to 10¹ TCID50 mL-1. The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.O metapneumovírus aviário (AMPV pertence ao gênero Metapneumovirus, família Paramyxoviridae. Isolamento viral, sorologia e detecção do RNA genômico são atualmente as técnicas utilizadas para o diagnóstico desse agente. O objetivo do presente estudo foi comparar a detecção de RNA viral de seis isolados de AMPV, subtipo A (AMPV/A, utilizando diferentes métodos de RT-PCR convencional e real time RT-PCR (RRT-PCR. Duas novas técnicas de RT-PCR convencional e duas técnicas de RRT-PCR, ambas para a detecção dos genes da nucleoproteína (N e da proteína de fusão (F, foram comparadas com um RT-PCR previamente estabelecido para a detecção do AMPV (gene da glicoproteína -G. Todos esses métodos foram capazes de detectar os isolados AMPV/A. As técnicas RRT-PCR (genes F e N mostraram os menores limites de detecção (10(0.3 to 10¹ TCID50 mL-1. Os resultados sugerem que as técnicas RT-PCR convencional (gene F e as técnicas de RRT-PCR (gene F e N desenvolvidas no presente estudo podem ser utilizadas com sucesso para a detecção do

  9. Improved diagnostic PCR assay for Actinobacillus pleuropneumoniae based on the nucleotide sequence of an outer membrane lipoprotein

    DEFF Research Database (Denmark)

    Gram, Trine; Ahrens, Peter

    1998-01-01

    species related to A. pleuropneumoniae or isolated from pigs were assayed. They were all found negative in the PCR, as were tonsil cultures from 50 pigs of an A. pleuropneumoniae-negative herd. The sensitivity assessed by agarose gel analysis of the PCR product was 10(2) CFU/PCR test tube. The specificity...

  10. Malaria diagnosis by PCR revealed differential distribution of mono and mixed species infections by Plasmodium falciparum and P. vivax in India.

    Science.gov (United States)

    Siwal, Nisha; Singh, Upasana Shyamsunder; Dash, Manoswini; Kar, Sonalika; Rani, Swati; Rawal, Charu; Singh, Rajkumar; Anvikar, Anupkumar R; Pande, Veena; Das, Aparup

    2018-01-01

    Malaria is a vector-borne infectious disease, caused by five different species of the genus Plasmodium, and is endemic to many tropical and sub-tropical countries of the globe. At present, malaria diagnosis at the primary health care level in India is conducted by either microscopy or rapid diagnostic test (RDT). In recent years, molecular diagnosis (by PCR assay), has emerged as the most sensitive method for malaria diagnosis. India is highly endemic to malaria and shoulders the burden of two major malaria parasites, Plasmodium falciparum and P. vivax. Previous studies using PCR diagnostic assay had unraveled several interesting facts on distribution of malaria parasites in India. However, these studies had several limitations from small sample size to limited geographical areas of sampling. In order to mitigate these limitations, we have collected finger-prick blood samples from 2,333 malaria symptomatic individuals in nine states from 11 geographic locations, covering almost the entire malaria endemic regions of India and performed all the three diagnostic tests (microscopy, RDT and PCR assay) and also have conducted comparative assessment on the performance of the three diagnostic tests. Since PCR assay turned out to be highly sensitive (827 malaria positive cases) among the three types of tests, we have utilized data from PCR diagnostic assay for analyses and inferences. The results indicate varied distributional prevalence of P. vivax and P. falciparum according to locations in India, and also the mixed species infection due to these two species. The proportion of P. falciparum to P. vivax was found to be 49:51, and percentage of mixed species infections due to these two parasites was found to be 13% of total infections. Considering India is set for malaria elimination by 2030, the present malaria epidemiological information is of high importance.

  11. Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi

    Directory of Open Access Journals (Sweden)

    Danielle C. Leal

    2011-07-01

    Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.

  12. A proline racemase based PCR for identification of Trypanosoma vivax in cattle blood.

    Directory of Open Access Journals (Sweden)

    Regassa Fikru

    Full Text Available A study was conducted to develop a Trypanosoma vivax (T. vivax specific PCR based on the T. vivax proline racemase (TvPRAC gene. Forward and reverse primers were designed that bind at 764-783 bp and 983-1002 bp of the gene. To assess its specificity, TvPRAC PCR was conducted on DNA extracted from different haemotropic pathogens: T. vivax from Nigeria, Ethiopia and Venezuela, T. congolense Savannah type, T. brucei brucei, T. evansi, T. equiperdum, T. theileri, Theileria parva, Anaplasma marginale, Babesia bovis and Babesia bigemina and from bovine, goat, mouse, camel and human blood. The analytical sensitivity of the TvPRAC PCR was compared with that of the ITS-1 PCR and the 18S PCR-RFLP on a dilution series of T. vivax DNA in water. The diagnostic performance of the three PCRs was compared on 411 Ethiopian bovine blood specimens collected in a former study. TvPRAC PCR proved to be fully specific for T. vivax, irrespective of its geographical origin. Its analytical sensitivity was lower than that of ITS-1 PCR. On these bovine specimens, TvPRAC PCR detected 8.3% T. vivax infections while ITS-1 PCR and 18S PCR-RFLP detected respectively 22.6 and 6.1% T. vivax infections. The study demonstrates that a proline racemase based PCR could be used, preferably in combination with ITS-1 PCR, as a species-specific diagnostic test for T. vivax infections worldwide.

  13. Clinical validation of a point-of-care multiplexed in vitro immunoassay using monoclonal antibodies (the MSD influenza test) in four hospitals in Vietnam.

    Science.gov (United States)

    van Doorn, H Rogier; Kinh, Nguyen van; Tuan, Ha Manh; Tuan, Tran Anh; Minh, Ngo Ngoc Quang; Bryant, Juliet E; Hang, Vu thi Ty; Uyen, Le thi Tham; Thinh, Le Quoc; Anh, Tran thi Ngoc; Lan, Nguyen Phu Huong; Trung, Nguyen Vu; Taylor, Walter; Merson, Laura; Wertheim, Heiman F L; Farrar, Jeremy; Wolbers, Marcel; Chau, Nguyen van Vinh; de Jong, Menno D

    2012-05-01

    Point-of-care (POC) diagnostic tests for influenza can considerably shorten the time to clinical decision making. An investigational POC test based on a multiplexed immunoassay was developed by Meso Scale Diagnostics, LLC (MSD), with the objective to make a more sensitive rapid test that can also subtype influenza A viruses (1977 H1, H3, and H5). Between February and November 2010, we conducted a prospective multicenter study at four hospitals in Vietnam and compared the performance of this test to that of the WHO/CDC real-time reverse transcriptase PCR (RT-PCR) on nasal and throat swab specimens from patients presenting with influenza-like illness. Five hundred sixty-three adults and children with a median age of 25 months were enrolled. Sensitivity and specificity of the test with combined results from nasal and throat swab samples were 74.0% (131/177) and 99.7% (351/352), respectively, compared to RT-PCR. The POC test was as sensitive for influenza virus B as for influenza virus A (74.4% [64/86] versus 73.6% [67/91]). The positivity rate was associated with lower cycle threshold values (a marker for higher viral loads), sample type (73.6% for nasal swab versus 52.4% for throat swab), and younger age. A total of 210 (18.7%) out of 1,126 MSD tests failed, and for 34 (6%) of patients, both test samples failed (these were excluded from the performance analysis). Subtyping could be assessed only for influenza virus A/H3N2, as 1977 H1N1 was not circulating at the time and no H5N1-infected patients were enrolled, and was successful only in 9/54 patients infected with H3 influenza virus who had a positive POC test result for influenza virus A. This novel POC test provided highly sensitive detection of influenza viruses A and B compared to the reported sensitivities of other rapid tests. However, 18.7% of tests failed for technical reasons and subtyping for H3 was poor. Drawbacks to the technology include the requirement for a dedicated reader instrument and the need for

  14. Diagnostic Utility of Broad Range Bacterial 16S rRNA Gene PCR with Degradation of Human and Free Bacterial DNA in Bloodstream Infection Is More Sensitive Than an In-House Developed PCR without Degradation of Human and Free Bacterial DNA

    Directory of Open Access Journals (Sweden)

    Petra Rogina

    2014-01-01

    Full Text Available We compared a commercial broad range 16S rRNA gene PCR assay (SepsiTest to an in-house developed assay (IHP. We assessed whether CD64 index, a biomarker of bacterial infection, can be used to exclude patients with a low probability of systemic bacterial infection. From January to March 2010, 23 patients with suspected sepsis were enrolled. CD64 index, procalcitonin, and C-reactive protein were measured on admission. Broad range 16S rRNA gene PCR was performed from whole blood (SepsiTest or blood plasma (IHP and compared to blood culture results. Blood samples spiked with Staphylococcus aureus were used to assess sensitivity of the molecular assays in vitro. CD64 index was lower in patients where possible sepsis was excluded than in patients with microbiologically confirmed sepsis (P=0.004. SepsiTest identified more relevant pathogens than blood cultures (P=0.008; in three patients (13% results from blood culture and SepsiTest were congruent, whereas in four cases (17.4% relevant pathogens were detected by SepsiTest only. In vitro spiking experiments suggested equal sensitivity of SepsiTest and IHP. A diagnostic algorithm using CD64 index as a decision maker to perform SepsiTest shows improved detection of pathogens in patients with suspected blood stream infection and may enable earlier targeted antibiotic therapy.

  15. The Optimization of Molecular Detection of Clinical Isolates of Brucella in Blood Cultures by eryD Transcriptase Gene for Confirmation of Culture-Negative Samples.

    Science.gov (United States)

    Tabibnejad, Mahsa; Alikhani, Mohammad Yousef; Arjomandzadegan, Mohammad; Hashemi, Seyed Hamid; Naseri, Zahra

    2016-04-01

    Brucellosis is a zoonosis disease which is widespread across the world. The aim of the present study is the evaluation of culture-negative blood samples. A total of 100 patients with suspected brucellosis were included in this experimental study and given positive serological tests. Diagnosis was performed on patients with clinical symptoms of the disease, followed by the detection of a titer that was equal to or more than 1:160 (in endemic areas) by the standard tube agglutination method. Blood samples were cultured by a BACTEC 9050 system, and subsequently by Brucella agar. At the same time, DNA from all blood samples was extracted by Qiagen Kit Company (Qia Amp Mini Kit). A molecular assay of blood samples was carried out by detection of eryD transcriptase and bcsp 31 genes in specific double PCR reactions. The specificity of the primers was evaluated by DNA from pure and approved Brucella colonies found in the blood samples, by DNA from other bacteria, and by ordinary PCR. DNA extraction from the pure colonies was carried out by both Qiagen Kit and Chelex 100 methods; the two were compared. 39 cases (39%) had positive results when tested by the BACTEC system, and 61 cases (61%) became negative. 23 culture-positive blood samples were randomly selected for PCR reactions; all showed 491 bp for the eryD gene and 223 bp for the bcsp 31 gene. Interestingly, out of 14 culture-negative blood samples, 13 cases showed positive bonds in PCR. The specificity of the PCR method was equal to 100%. DNA extraction from pure cultures was done by both Chelex 100 and Qiagen Kit; these showed the same results for all samples. The results prove that the presented double PCR method could be used to detect positive cases from culture-negative blood samples. The Chelex 100 method is simpler and safer than the use of Qiagen Kit for DNA extraction.

  16. Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis.

    Science.gov (United States)

    Chen, Derrick J; Procop, Gary W; Vogel, Sherilynn; Yen-Lieberman, Belinda; Richter, Sandra S

    2015-11-01

    The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Evaluating Diagnostic Point-of-Care Tests in Resource-Limited Settings

    Science.gov (United States)

    Drain, Paul K; Hyle, Emily P; Noubary, Farzad; Freedberg, Kenneth A; Wilson, Douglas; Bishai, William; Rodriguez, William; Bassett, Ingrid V

    2014-01-01

    Diagnostic point-of-care (POC) testing is intended to minimize the time to obtain a test result, thereby allowing clinicians and patients to make an expeditious clinical decision. As POC tests expand into resource-limited settings (RLS), the benefits must outweigh the costs. To optimize POC testing in RLS, diagnostic POC tests need rigorous evaluations focused on relevant clinical outcomes and operational costs, which differ from evaluations of conventional diagnostic tests. Here, we reviewed published studies on POC testing in RLS, and found no clearly defined metric for the clinical utility of POC testing. Therefore, we propose a framework for evaluating POC tests, and suggest and define the term “test efficacy” to describe a diagnostic test’s capacity to support a clinical decision within its operational context. We also proposed revised criteria for an ideal diagnostic POC test in resource-limited settings. Through systematic evaluations, comparisons between centralized diagnostic testing and novel POC technologies can be more formalized, and health officials can better determine which POC technologies represent valuable additions to their clinical programs. PMID:24332389

  18. Sensitivity of PCR IS6110 in relation to culture and staining in Pott′s disease

    Directory of Open Access Journals (Sweden)

    Manoj Kumar

    2013-01-01

    Full Text Available Background: Rapid diagnosis is essential to decrease the morbidity and mortality of Pott′s disease. The bacteriological methods are time-consuming or insensitive. Polymerase chain reaction (PCR provides a rapid diagnostic tool and hope for early diagnosis of this disease. The aim of this study was to compare and assess of a rapid and effective method among diagnostic battery (Ziehl-Neelsen (ZN microscopy, BACTEC culture and PCR of Pott′s disease. Materials and Methods: Sixty-five specimens from clinico-radiological suspected cases of Pott′s disease were included in this study. They were processed for ZN microscopy, BACTEC culture, and PCR IS6110. The tests tool′s efficiency, positive agreement Kc (Kappa coefficient, and significance level (P value were calculated for correlation between PCR and performed tests. Results: The PCR sensitivity reached to 96% and 46.3% among positive and negative specimens on ZN microscopy. Further, 94% and 36.4% sensitivity were found among positive and negative specimens by BACTEC culture. The total 38 (58.5% specimens were detected either ZN microscopy or by BACTEC culture. Thus, the overall sensitivity and specificity of PCR were 95% and 74.1%. The kappa coefficient and P value, calculated for PCR against BACTEC culture and combined results of performed bacteriological tests were (Kc=0.60, (P<0.001 and (Kc=0.70, (P<0.001, respectively. Above statistical relations showed a fair agreement with significant differences. Conclusion: The PCR IS6110 may be useful in rapid detection of clinico-radiological suspected cases of Pott′s disease and those that are negative with bacteriological methods.

  19. Performance of a Highly Sensitive Mycobacterium tuberculosis Complex Real-Time PCR Assay for Diagnosis of Pulmonary Tuberculosis in a Low-Prevalence Setting: a Prospective Intervention Study.

    Science.gov (United States)

    Vinuesa, Víctor; Borrás, Rafael; Briones, María Luisa; Clari, María Ángeles; Cresencio, Vicenta; Giménez, Estela; Muñoz, Carmen; Oltra, Rosa; Servera, Emilio; Scheelje, Talia; Tornero, Carlos; Navarro, David

    2018-05-01

    The potential impact of routine real-time PCR testing of respiratory specimens from patients with presumptive tuberculosis in terms of diagnostic accuracy and time to tuberculosis treatment inception in low-prevalence settings remains largely unexplored. We conducted a prospective intervention cohort study. Respiratory specimens from 1,020 patients were examined by acid-fast bacillus smear microscopy, tested by a real-time Mycobacterium tuberculosis complex PCR assay (Abbott RealTi me MTB PCR), and cultured in mycobacterial media. Seventeen patients tested positive by PCR (5 were acid-fast bacillus smear positive and 12 acid-fast bacillus smear negative), and Mycobacterium tuberculosis was recovered from cultures for 12 of them. Patients testing positive by PCR and negative by culture ( n = 5) were treated and deemed to have responded to antituberculosis therapy. There were no PCR-negative/culture-positive cases, and none of the patients testing positive for nontuberculous mycobacteria ( n = 20) yielded a positive PCR result. The data indicated that routine testing of respiratory specimens from patients with presumptive tuberculosis by the RealTi me MTB PCR assay improves the tuberculosis diagnostic yield and may reduce the time to antituberculosis treatment initiation. On the basis of our data, we propose a novel mycobacterial laboratory algorithm for tuberculosis diagnosis. Copyright © 2018 American Society for Microbiology.

  20. A Robust PCR Protocol for HIV Drug Resistance Testing on Low-Level Viremia Samples

    Directory of Open Access Journals (Sweden)

    Shivani Gupta

    2017-01-01

    Full Text Available The prevalence of drug resistance (DR mutations in people with HIV-1 infection, particularly those with low-level viremia (LLV, supports the need to improve the sensitivity of amplification methods for HIV DR genotyping in order to optimize antiretroviral regimen and facilitate HIV-1 DR surveillance and relevant research. Here we report on a fully validated PCR-based protocol that achieves consistent amplification of the protease (PR and reverse transcriptase (RT regions of HIV-1 pol gene across many HIV-1 subtypes from LLV plasma samples. HIV-spiked plasma samples from the External Quality Assurance Program Oversight Laboratory (EQAPOL, covering various HIV-1 subtypes, as well as clinical specimens were used to optimize and validate the protocol. Our results demonstrate that this protocol has a broad HIV-1 subtype coverage and viral load span with high sensitivity and reproducibility. Moreover, the protocol is robust even when plasma sample volumes are limited, the HIV viral load is unknown, and/or the HIV subtype is undetermined. Thus, the protocol is applicable for the initial amplification of the HIV-1 PR and RT genes required for subsequent genotypic DR assays.

  1. [Diagnostic test scale SI5: Assessment of sacroiliac joint dysfunction].

    Science.gov (United States)

    Acevedo González, Juan C; Quintero Oliveros, Silvia

    2015-01-01

    Sacroiliac joint dysfunction is a known cause of low back pain. We think that a diagnostic score scale (SI5) may be performed to assess diagnostic utility of clinical signs of sacroiliac joint dysfunction. The primary aim of the present study was to conduct the pilot study of our new diagnostic score scale, the SI5, for sacroiliac joint syndrome. We reviewed the literature on clinical characteristics, diagnostic tests and imaging most commonly used in diagnosing sacroiliac joint dysfunction. Our group evaluated the diagnostic utility of these aspects and we used those considered most representative to develop the SI5 diagnostic scale. The SI5 scale was applied to 22 patients with low back pain; afterwards, the standard test for diagnosing this pathology (selective blockage of the SI joint) was also performed on these patients. The sensitivity and specificity for each sign were also assessed and the diagnostic scale called SI5 was then proposed, based on these data. The most sensitive clinical tests for diagnosing SI joint dysfunction were 2 patient-reported clinical characteristics, the Laguerre Test, sacroiliac rocking test and Yeomans test (greater than 80% sensitivity). The tests with greatest diagnostic specificity (>80%) were the Lewitt test, Piedallu test and Gillet test. The proposed SI5 test score scale showed sensitivity of 73% and specificity of 71%. Sacroiliac joint syndrome has been shown to produce low back pain frequently; however, the diagnostic value of examination tests for sacroiliac joint pain has been questioned by other authors. The pilot study on the SI5 diagnostic score scale showed good sensitivity and specificity. However, the process of statistical validation of the SI5 needs to be continued. Copyright © 2014 Sociedad Española de Neurocirugía. Published by Elsevier España. All rights reserved.

  2. Systematic reviews of diagnostic test accuracy

    DEFF Research Database (Denmark)

    Leeflang, Mariska M G; Deeks, Jonathan J; Gatsonis, Constantine

    2008-01-01

    More and more systematic reviews of diagnostic test accuracy studies are being published, but they can be methodologically challenging. In this paper, the authors present some of the recent developments in the methodology for conducting systematic reviews of diagnostic test accuracy studies....... Restrictive electronic search filters are discouraged, as is the use of summary quality scores. Methods for meta-analysis should take into account the paired nature of the estimates and their dependence on threshold. Authors of these reviews are advised to use the hierarchical summary receiver...

  3. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  4. Evaluation of serological diagnostic tests for typhoid fever in Papua New Guinea using a composite reference standard.

    Science.gov (United States)

    Siba, Valentine; Horwood, Paul F; Vanuga, Kilagi; Wapling, Johanna; Sehuko, Rebecca; Siba, Peter M; Greenhill, Andrew R

    2012-11-01

    Typhoid fever remains a major global health problem. A major impediment to improving outcomes is the lack of appropriate diagnostic tools, which have not significantly improved in low-income settings for 100 years. We evaluated two commercially available rapid diagnostic tests (Tubex and TyphiDot), a prototype (TyphiRapid TR-02), and the commonly used single-serum Widal test in a previously reported high-burden area of Papua New Guinea. Samples were collected from 530 outpatients with axillary temperatures of ≥37.5°C, and analysis was conducted on all malaria-negative samples (n = 500). A composite reference standard of blood culture and PCR was used, by which 47 participants (9.4%) were considered typhoid fever positive. The sensitivity and specificity of the Tubex (51.1% and 88.3%, respectively) and TyphiDot (70.0% and 80.1%, respectively) tests were not high enough to warrant their ongoing use in this setting; however, the sensitivity and specificity for the TR-02 prototype were promising (89.4% and 85.0%, respectively). An axillary temperature of ≥38.5°C correlated with typhoid fever (P = 0.014). With an appropriate diagnostic test, conducting typhoid fever diagnosis only on patients with high-grade fever could dramatically decrease the costs associated with diagnosis while having no detrimental impact on the ability to accurately diagnose the illness.

  5. Implementation of broad screening with Ebola rapid diagnostic tests in Forécariah, Guinea

    Directory of Open Access Journals (Sweden)

    Frantz Jean Louis

    2017-03-01

    Full Text Available Background: Laboratory-enhanced surveillance is critical for rapidly detecting the potential re-emergence of Ebola virus disease. Rapid diagnostic tests (RDT for Ebola antigens could expand diagnostic capacity for Ebola virus disease. Objectives: The Guinean National Coordination for Ebola Response conducted a pilot implementation to determine the feasibility of broad screening of patients and corpses with the OraQuick® Ebola RDT. Methods: The implementation team developed protocols and trained healthcare workers to screen patients and corpses in Forécariah prefecture, Guinea, from 15 October to 30 November 2015. Data collected included number of consultations, number of fevers reported or measured, number of tests performed for patients or corpses and results of confirmatory RT-PCR testing. Data on malaria RDT results were collected for comparison. Feedback from Ebola RDT users was collected informally during supervision visits and forums. Results: There were 3738 consultations at the 15 selected healthcare facilities; 74.6% of consultations were for febrile illness. Among 2787 eligible febrile patients, 2633 were tested for malaria and 1628 OraQuick® Ebola RDTs were performed. A total of 322 OraQuick® Ebola RDTs were conducted on corpses. All Ebola tests on eligible patients were negative. Conclusions: Access to Ebola testing was expanded by the implementation of RDTs in an emergency situation. Feedback from Ebola RDT users and lessons learned will contribute to improving quality for RDT expansion.

  6. A step forward in molecular diagnostics of lyssaviruses--results of a ring trial among European laboratories.

    Directory of Open Access Journals (Sweden)

    Melina Fischer

    Full Text Available Rabies is a lethal and notifiable zoonotic disease for which diagnostics have to meet the highest standards. In recent years, an evolution was especially seen in molecular diagnostics with a wide variety of different detection methods published. Therefore, a first international ring trial specifically designed on the use of reverse transcription polymerase chain reaction (RT-PCR for detection of lyssavirus genomic RNA was organized. The trial focussed on assessment and comparison of the performance of conventional and real-time assays. In total, 16 European laboratories participated. All participants were asked to investigate a panel of defined lyssavirus RNAs, consisting of Rabies virus (RABV and European bat lyssavirus 1 and 2 (EBLV-1 and -2 RNA samples, with systems available in their laboratory. The ring trial allowed the important conclusion that conventional RT-PCR assays were really robust assays tested with a high concordance between different laboratories and assays. The real-time RT-PCR system by Wakeley et al. (2005 in combination with an intercalating dye, and the combined version by Hoffmann and co-workers (2010 showed good sensitivity for the detection of all RABV samples included in this test panel. Furthermore, all used EBLV-specific assays, real-time RT-PCRs as well as conventional RT-PCR systems, were shown to be suitable for a reliable detection of EBLVs. It has to be mentioned that differences were seen in the performance between both the individual RT-PCR systems and the laboratories. Laboratories which used more than one molecular assay for testing the sample panel always concluded a correct sample result. Due to the markedly high genetic diversity of lyssaviruses, the application of different assays in diagnostics is needed to achieve a maximum of diagnostic accuracy. To improve the knowledge about the diagnostic performance proficiency testing at an international level is recommended before using lyssavirus molecular

  7. [Diagnostic tools for canine parvovirus infection].

    Science.gov (United States)

    Proksch, A L; Hartmann, K

    2015-01-01

    Canine parvovirus (CPV) infection is one of the most important and common infectious diseases in dogs, in particular affecting young puppies when maternal antibodies have waned and vaccine-induced antibodies have not yet developed. The mortality rate remains high. Therefore, a rapid and safe diagnostic tool is essential to diagnose the disease to 1) provide intensive care treatment and 2) to identify virus-shedding animals and thus prevent virus spread. Whilst the detection of antibodies against CPV is considered unsuitable to diagnose the disease, there are several different methods to directly detect complete virus, virus antigen or DNA. Additionally, to test in commercial laboratories, rapid in-house tests based on ELISA are available worldwide. The specificity of the ELISA rapid in-house tests is reported to be excellent. However, results on sensitivity vary and high numbers of false-negative results are commonly reported, which potentially leads to misdiagnosis. Polymerase chain reaction (PCR) is a very sensitive and specific diagnostic tool. It also provides the opportunity to differentiate vaccine strains from natural infection when sequencing is performed after PCR.

  8. Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

    International Nuclear Information System (INIS)

    Bavand, M.R.; Laub, O.

    1988-01-01

    Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

  9. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

    Science.gov (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

    2007-10-01

    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  10. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  11. PCR artifact in testing for homologous recombination in genomic editing in zebrafish.

    Directory of Open Access Journals (Sweden)

    Minho Won

    Full Text Available We report a PCR-induced artifact in testing for homologous recombination in zebrafish. We attempted to replace the lnx2a gene with a donor cassette, mediated by a TALEN induced double stranded cut. The donor construct was flanked with homology arms of about 1 kb at the 5' and 3' ends. Injected embryos (G0 were raised and outcrossed to wild type fish. A fraction of the progeny appeared to have undergone the desired homologous recombination, as tested by PCR using primer pairs extending from genomic DNA outside the homology region to a site within the donor cassette. However, Southern blots revealed that no recombination had taken place. We conclude that recombination happened during PCR in vitro between the donor integrated elsewhere in the genome and the lnx2a locus. We conclude that PCR alone may be insufficient to verify homologous recombination in genome editing experiments in zebrafish.

  12. Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2010-12-01

    Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

  13. Practical tools to implement massive parallel pyrosequencing of PCR products in next generation molecular diagnostics.

    Directory of Open Access Journals (Sweden)

    Kim De Leeneer

    Full Text Available Despite improvements in terms of sequence quality and price per basepair, Sanger sequencing remains restricted to screening of individual disease genes. The development of massively parallel sequencing (MPS technologies heralded an era in which molecular diagnostics for multigenic disorders becomes reality. Here, we outline different PCR amplification based strategies for the screening of a multitude of genes in a patient cohort. We performed a thorough evaluation in terms of set-up, coverage and sequencing variants on the data of 10 GS-FLX experiments (over 200 patients. Crucially, we determined the actual coverage that is required for reliable diagnostic results using MPS, and provide a tool to calculate the number of patients that can be screened in a single run. Finally, we provide an overview of factors contributing to false negative or false positive mutation calls and suggest ways to maximize sensitivity and specificity, both important in a routine setting. By describing practical strategies for screening of multigenic disorders in a multitude of samples and providing answers to questions about minimum required coverage, the number of patients that can be screened in a single run and the factors that may affect sensitivity and specificity we hope to facilitate the implementation of MPS technology in molecular diagnostics.

  14. Immuno-PCR, a new technique for the serodiagnosis of tuberculosis.

    Science.gov (United States)

    Mehta, Promod K; Dahiya, Bhawna; Sharma, Suman; Singh, Netrapal; Dharra, Renu; Thakur, Zoozeal; Mehta, Neeru; Gupta, Krishna B; Gupta, Mahesh C; Chaudhary, Dhruva

    2017-08-01

    Rapid and accurate diagnosis of tuberculosis (TB) is essential to control the disease. The conventional microbiological tests have limitations and there is an urgent need to devise a simple, rapid and reliable point-of-care (POC) test. The failure of TB diagnostic tests based on antibody detection due to inconsistent and imprecise results has stimulated renewed interest in the development of rapid antigen detection methods. However, the World Health Organization (WHO) has emphasized to continue research for designing new antibody-based detection tests with improved accuracy. Immuno-polymerase chain reaction (I-PCR) combines the simplicity and versatility of enzyme-linked immunosorbent assay (ELISA) with the exponential amplification capacity and sensitivity of PCR thus leading to several-fold increase in sensitivity in comparison to analogous ELISA. In this review, we have described the serodiagnostic potential of I-PCR assays for an early diagnosis of TB based on the detection of potential mycobacterial antigens and circulating antibodies in body fluids of TB patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Comparison of agglutination test, microscopy and nPCR for ...

    African Journals Online (AJOL)

    action (nPCR) for the detection of T. gondii infection in mice (n=399) inoculated with heart .... Direct Agglutination Test (DAT) (Toxo screen DA, Biomerieux®, France) fol- ... 0.3 µl external forward Primer (50 µM), 0.3 µl external reverse Primer.

  16. Value of PCR in sonication fluid for the diagnosis of orthopedic hardware-associated infections: Has the molecular era arrived?

    Science.gov (United States)

    Renz, Nora; Cabric, Sabrina; Morgenstern, Christian; Schuetz, Michael A; Trampuz, Andrej

    2018-04-01

    Bone healing disturbance following fracture fixation represents a continuing challenge. We evaluated a novel fully automated polymerase chain reaction (PCR) assay using sonication fluid from retrieved orthopedic hardware to diagnose infection. In this prospective diagnostic cohort study, explanted orthopedic hardware materials from consecutive patients were investigated by sonication and the resulting sonication fluid was analyzed by culture (standard procedure) and multiplex PCR (investigational procedure). Hardware-associated infection was defined as visible purulence, presence of a sinus tract, implant on view, inflammation in peri-implant tissue or positive culture. McNemar's chi-squared test was used to compare the performance of diagnostic tests. For the clinical performance all pathogens were considered, whereas for analytical performance only microorganisms were considered for which primers are included in the PCR assay. Among 51 patients, hardware-associated infection was diagnosed in 38 cases (75%) and non-infectious causes in 13 patients (25%). The sensitivity for diagnosing infection was 66% for peri-implant tissue culture, 84% for sonication fluid culture, 71% (clinical performance) and 77% (analytical performance) for sonication fluid PCR, the specificity of all tests was >90%. The analytical sensitivity of PCR was higher for gram-negative bacilli (100%), coagulase-negative staphylococci (89%) and Staphylococcus aureus (75%) than for Cutibacterium (formerly Propionibacterium) acnes (57%), enterococci (50%) and Candida spp. (25%). The performance of sonication fluid PCR for diagnosis of orthopedic hardware-associated infection was comparable to culture tests. The additional advantage of PCR was short processing time (PCR has the potential to complement conventional cultures. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Evaluation of an Immunochromatographic Strip (Xenostrip –Tv Test for Diagnosis of Vaginal Trichomoniasis Compared with Wet Mount and PCR Assay

    Directory of Open Access Journals (Sweden)

    MH Feiz-Haddad

    2008-09-01

    Full Text Available "nBackground: Trichomoniasis, caused by Trichomonas vaginalis, is one of the most common sexually transmitted infections in the world. Diagnosis of T. vaginalis is performed by different methods, including wet mount, culture, serological methods and PCR, which required laboratory equipments and expert laboratory personnel. The aim of this study was evaluation of immunochromatographic strip test (Xenostrip-Tv for diagnosis of vaginal trichomoniasis compared with wet mount and PCR assay."nMethods: In this prospective study vaginal swabs were obtained from 100 women with genital complaints demanding a speculum examination, referred to Imam Khomeini and Amir Kabir hospitals in Ahwaz, Khuzestan Province. Samples were first examined by wet mount and Xenostrip-Tv. PCR assay was performed in the next step using TVK3 and TVK7 primers initially. The positive samples were then confirmed by the second PCR assay using TVA5-1 and TVA6 primers."nResults: PCR with TVA5-1 and TVA6 primers was determined as gold standard. The wet mount as well as Xenostrip-Tv sensitivity and specificity were 73.3% and 100%, respectively in comparison with gold standard. The sensitivity and specificity of PCR with primers TVK3 and TVK7 were also determined as 100% and 96.6%, respectively. The infection rates were 14% for wet mount and Xenostrip-Tv, 21% for PCR with primers TVK3 plus TVK7 and 19% with the gold standard PCR using TVA5-1 and TVA6 primers."nConclusion: Xenostrip- Tv could be used for diagnosis of vaginal trichomoniasis in regions with no laboratory diagnostic facilities.

  18. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

    Science.gov (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  19. Development of a PCR test for identification of Haemophilus somnus in pure and mixed cultures

    DEFF Research Database (Denmark)

    Angen, Øystein; Ahrens, Peter; Tegtmeier, Conny

    1998-01-01

    a single colony of H. somnus in the presence of 10(9) CFU of P. multocida even after 2 days of incubation. In conclusion, the present PCR test has been shown to represent a specific test for identification of H. somnus both in pure and mixed cultures. It represents a quick, sensitive and reliable method...... rise to an amplicon in the PCR test. The performance of the test on mixed cultures was evaluated by adding P. multocida to serial dilutions of H. somnus and incubating the agarplates for 1 and 2 days. This showed that the PCR test applied to the harvest from an agarplate can be expected to detect...

  20. Real time RT-PCR assay for detection of different serotypes of FMDV in Egypt

    Directory of Open Access Journals (Sweden)

    Laila El-Shehawy

    Full Text Available Aim: The present study indicated that rRT-PCR could be provided for the detection of FMDV in infected, contact and carrier cattle and also provide a rapid sensitive tool aiming to aid in rapid disease detection and control. Foot and Mouth disease virus serotypes O and A still existing in Egypt. In January 2012, sever outbreaks struck the animal population in most Egyptian 1 governorates. The causative virus was identified as FMDV SAT2. Material and Methods: Five samples of tongue epithelium (ET and five oesophageal-pharyngeal (OP fluid samples were collected from FMD suspected cattle in infected farm at El-Fayoum and 20 OP samples from in-contact cattle at the same farm in addition to 30 OP samples from apparently healthy cattle at three different localities in El-Fayoum governorate (12 from Fayoum; 9 from Sinoras and 9 from Edsa in order to detect carrier cattle. All of these samples were collected during November and December 2011 and January 2012. Results: All the ET and OP samples were inoculated on BHK cell culture and baby mice. The obtained results were identified using complement fixation test in addition to real-time reverse transcriptase polymerase chain reaction (rRT-PCR. In the infected farm at El-Fayoum FMDV type SAT2 was detected in cattle which are considered as the first introduction of this type while FMDV type O and SAT2 were detected in the in-contact cattle in the same farm. The sensitivity of rRT-PCR was cleared in the in-contact cattle as 13 out of 20 OP samples were positive to FMDV by rRT-PCR while 11 out of 20 OP samples were positive to FMDV by CFT. The OP samples collected from apparently healthy cattle from Fayoum, Sinoras and Edsa localities in Fayoum governorate demonstrate the circulation of the FMDV type A, O and the recent SAT2 in carrier cattle which threaten cattle population in Fayoum governorate. Also the sensitivity of real time RT-PCR over the CFT in detection of FMDV carrier cattle was clearly noticed in

  1. Performance of a RT-PCR Assay in Comparison to FISH and Immunohistochemistry for the Detection of ALK in Non-Small Cell Lung Cancer.

    Science.gov (United States)

    Hout, David R; Schweitzer, Brock L; Lawrence, Kasey; Morris, Stephan W; Tucker, Tracy; Mazzola, Rosetta; Skelton, Rachel; McMahon, Frank; Handshoe, John; Lesperance, Mary; Karsan, Aly; Saltman, David L

    2017-08-01

    Patients with lung cancers harboring an activating anaplastic lymphoma kinase ( ALK ) rearrangement respond favorably to ALK inhibitor therapy. Fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) are validated and widely used screening tests for ALK rearrangements but both methods have limitations. The ALK RGQ RT-PCR Kit (RT-PCR) is a single tube quantitative real-time PCR assay for high throughput and automated interpretation of ALK expression. In this study, we performed a direct comparison of formalin-fixed paraffin-embedded (FFPE) lung cancer specimens using all three ALK detection methods. The RT-PCR test (diagnostic cut-off Δ C t of ≤8) was shown to be highly sensitive (100%) when compared to FISH and IHC. Sequencing of RNA detected full-length ALK transcripts or EML4-ALK and KIF5B-ALK fusion variants in discordant cases in which ALK expression was detected by the ALK RT-PCR test but negative by FISH and IHC. The overall specificity of the RT-PCR test for the detection of ALK in cases without full-length ALK expression was 94% in comparison to FISH and sequencing. These data support the ALK RT-PCR test as a highly efficient and reliable diagnostic screening approach to identify patients with non-small cell lung cancer whose tumors are driven by oncogenic ALK.

  2. Galactomannan and Real-Time PCR in the diagnosis of invasive Aspergillosis: preliminary data

    Directory of Open Access Journals (Sweden)

    Cristina Pedrotti

    2014-03-01

    Full Text Available The diagnosis of invasive aspergillosis is notoriously difficult. The standard culture-based methods have shown considerable limitations in performance. For this reason, non-culture methods have been increasingly employed for the diagnosis of invasive aspergillosis, and, among them, the methods based on Real-Time polymerase chain reaction (RT-PCR. In this study we assess the contribution in lowering diagnosis errors provided by the RT-PCR method when run alongside other methods. We analyzed 23 biological samples, 14 serum samples, and 9 bronchoalveolar lavage samples (BAL from 10 immunocompromised patients who were selected according to EORTC/MSG criteria (European Organization for Research and Treatment of Cancer/Mycoses Study Group. On the serum sample we searched the galactomannan (GM (Platelia Aspergillus® and the fungal genome (MycAssayTMAspergillus; the BAL samples were subjected also to the culture tests. In 11 serum samples the results showed concordance between GM and RT–PCR tests, while in 3 samples we report discordance: 2 results were GM positive and RT-PCR negative, and 1 results GM negative and RT-PCR indeterminate. In 5 BAL samples the results showed concordance between the two methods, while 4 were GM positive and RT-PCR negative. The data, although still preliminary, suggest an increased accuracy in the diagnosis of suspected invasive aspergillosis when employing both RT-PCR and GM tests given that the RT-PCR test eliminates the false positive results of the GM test. The PCR methods require, however, further applications of this type of diagnostic because of the severe limit given by the lack of standardization.

  3. Real-time PCR in virology

    OpenAIRE

    Mackay, Ian M.; Arden, Katherine E.; Nitsche, Andreas

    2002-01-01

    The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of P...

  4. Cytological diagnostic of lymphadenitis tuberculosis by eosinophilic material

    Science.gov (United States)

    Delyuzar; Amir, Z.; Kusumawati, L.

    2018-03-01

    AFB sputum and chest X-ray are used to identify patients with pulmonary TB. For extrapulmonary TB, fine needle aspiration cytology is needed, even though occasionally found not atypical feature in the form of eosinophilic material with dark brown particles, suspected as TB. This research was to show that eosinophilic material with dark brown particles is accurate as new criteria for the cytological diagnosis of TB. By performing fine needle aspiration biopsy stained with Giemsa, if an eosinophilic material with dark brown particles was encountered, we continued with Ziehl-Neelsen AFB stain and confirmed with PCR. To assess accuracy, we used a diagnostic test to evaluate sensitivity and specificity of eosinophilic material with dark brown particles by using AFB and PCR as the gold standard. The sensitivity and specificity of cytological diagnosis in tuberculosis of eosinophilic material with dark brown particles were 93.65% and 70.99%, respectively if confirmed with AFB. On the other hand, if confirmed with PCR using Mycobacterium tuberculosis DNA, the sensitivity and specificity were 98.95% and 96.79%, respectively. In conclusion, eosinophilic masses with dark brown particles is accurate as new criteria of TB diagnostic cytology with high sensitivity and specificity confirmed with AFB and PCR test.

  5. Eliminating PCR contamination

    International Nuclear Information System (INIS)

    Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.

    1991-01-01

    The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs

  6. Reverse transcriptase real-time PCR for detection and quantification of viable Campylobacter jejuni directly from poultry faecal samples

    DEFF Research Database (Denmark)

    Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

    2012-01-01

    Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...

  7. External quality assessment of dengue and chikungunya diagnostics in the Asia Pacific region, 2015

    Directory of Open Access Journals (Sweden)

    Li Ting Soh

    2016-04-01

    Full Text Available Objective: To conduct an external quality assessment (EQA of dengue and chikungunya diagnostics among national-level public health laboratories in the Asia Pacific region following the first round of EQA for dengue diagnostics in 2013. Methods: Twenty-four national-level public health laboratories performed routine diagnostic assays on a proficiency testing panel consisting of two modules. Module A contained serum samples spiked with cultured dengue virus (DENV or chikungunya virus (CHIKV for the detection of nucleic acid and DENV non-structural protein 1 (NS1 antigen. Module B contained human serum samples for the detection of anti-DENV antibodies. Results: Among 20 laboratories testing Module A, 17 (85% correctly detected DENV RNA by reverse transcription polymerase chain reaction (RT-PCR, 18 (90% correctly determined serotype and 19 (95% correctly identified CHIKV by RT-PCR. Ten of 15 (66.7% laboratories performing NS1 antigen assays obtained the correct results. In Module B, 18/23 (78.3% and 20/20 (100% of laboratories correctly detected anti-DENV IgM and IgG, respectively. Detection of acute/recent DENV infection by both molecular (RT-PCR and serological methods (IgM was available in 19/24 (79.2% participating laboratories. Discussion: Accurate laboratory testing is a critical component of dengue and chikungunya surveillance and control. This second round of EQA reveals good proficiency in molecular and serological diagnostics of these diseases in the Asia Pacific region. Further comprehensive diagnostic testing, including testing for Zika virus, should comprise future iterations of the EQA.

  8. Identification of HIV Mutation as Diagnostic Biomarker through Next Generation Sequencing.

    Science.gov (United States)

    Shaw, Wen Hui; Lin, Qianqian; Muhammad, Zikry Zhiwei Bin Roslee; Lee, Jia Jun; Khong, Wei Xin; Ng, Oon Tek; Tan, Eng Lee; Li, Peng

    2016-07-01

    Current clinical detection of Human immunodeficiency virus 1 (HIV-1) is used to target viral genes and proteins. However, the immunoassay, such as viral culture or Polymerase Chain Reaction (PCR), lacks accuracy in the diagnosis, as these conventional assays rely on the stable genome and HIV-1 is a highly-mutated virus. Next generation sequencing (NGS) promises to be transformative for the practice of infectious disease, and the rapidly reducing cost and processing time mean that this will become a feasible technology in diagnostic and research laboratories in the near future. The technology offers the superior sensitivity to detect the pathogenic viruses, including unknown and unexpected strains. To leverage the NGS technology in order to improve current HIV-1 diagnosis and genotyping methods. Ten blood samples were collected from HIV-1 infected patients which were diagnosed by RT PCR at Singapore Communicable Disease Centre, Tan Tock Seng Hospital from October 2014 to March 2015. Viral RNAs were extracted from blood plasma and reversed into cDNA. The HIV-1 cDNA samples were cleaned up using a PCR purification kit and the sequencing library was prepared and identified through MiSeq. Two common mutations were observed in all ten samples. The common mutations were identified at genome locations 1908 and 2104 as missense and silent mutations respectively, conferring S37N and S3S found on aspartic protease and reverse transcriptase subunits. The common mutations identified in this study were not previously reported, therefore suggesting the potential for them to be used for identification of viral infection, disease transmission and drug resistance. This was especially the case for, missense mutation S37N which could cause an amino acid change in viral proteases thus reducing the binding affinity of some protease inhibitors. Thus, the unique common mutations identified in this study could be used as diagnostic biomarkers to indicate the origin of infection as being

  9. Understanding the properties of diagnostic tests - Part 2: Likelihood ratios.

    Science.gov (United States)

    Ranganathan, Priya; Aggarwal, Rakesh

    2018-01-01

    Diagnostic tests are used to identify subjects with and without disease. In a previous article in this series, we examined some attributes of diagnostic tests - sensitivity, specificity, and predictive values. In this second article, we look at likelihood ratios, which are useful for the interpretation of diagnostic test results in everyday clinical practice.

  10. The use of digital PCR to improve the application of quantitative molecular diagnostic methods for tuberculosis.

    Science.gov (United States)

    Devonshire, Alison S; O'Sullivan, Denise M; Honeyborne, Isobella; Jones, Gerwyn; Karczmarczyk, Maria; Pavšič, Jernej; Gutteridge, Alice; Milavec, Mojca; Mendoza, Pablo; Schimmel, Heinz; Van Heuverswyn, Fran; Gorton, Rebecca; Cirillo, Daniela Maria; Borroni, Emanuele; Harris, Kathryn; Barnard, Marinus; Heydenrych, Anthenette; Ndusilo, Norah; Wallis, Carole L; Pillay, Keshree; Barry, Thomas; Reddington, Kate; Richter, Elvira; Mozioğlu, Erkan; Akyürek, Sema; Yalçınkaya, Burhanettin; Akgoz, Muslum; Žel, Jana; Foy, Carole A; McHugh, Timothy D; Huggett, Jim F

    2016-08-03

    Real-time PCR (qPCR) based methods, such as the Xpert MTB/RIF, are increasingly being used to diagnose tuberculosis (TB). While qualitative methods are adequate for diagnosis, the therapeutic monitoring of TB patients requires quantitative methods currently performed using smear microscopy. The potential use of quantitative molecular measurements for therapeutic monitoring has been investigated but findings have been variable and inconclusive. The lack of an adequate reference method and reference materials is a barrier to understanding the source of such disagreement. Digital PCR (dPCR) offers the potential for an accurate method for quantification of specific DNA sequences in reference materials which can be used to evaluate quantitative molecular methods for TB treatment monitoring. To assess a novel approach for the development of quality assurance materials we used dPCR to quantify specific DNA sequences in a range of prototype reference materials and evaluated accuracy between different laboratories and instruments. The materials were then also used to evaluate the quantitative performance of qPCR and Xpert MTB/RIF in eight clinical testing laboratories. dPCR was found to provide results in good agreement with the other methods tested and to be highly reproducible between laboratories without calibration even when using different instruments. When the reference materials were analysed with qPCR and Xpert MTB/RIF by clinical laboratories, all laboratories were able to correctly rank the reference materials according to concentration, however there was a marked difference in the measured magnitude. TB is a disease where the quantification of the pathogen could lead to better patient management and qPCR methods offer the potential to rapidly perform such analysis. However, our findings suggest that when precisely characterised materials are used to evaluate qPCR methods, the measurement result variation is too high to determine whether molecular quantification

  11. Rapid identification of HPV 16 and 18 by multiplex nested PCR-immunochromatographic test.

    Science.gov (United States)

    Kuo, Yung-Bin; Li, Yi-Shuan; Chan, Err-Cheng

    2015-02-01

    Human papillomavirus (HPV) types 16 and 18 are known to be high-risk viruses that cause cervical cancer. An HPV rapid testing kit that could help physicians to make early and more informed decisions regarding patient care is needed urgently but not yet available. This study aimed to develop a multiplex nested polymerase chain reaction-immunochromatographic test (PCR-ICT) for the rapid identification of HPV 16 and 18. A multiplex nested PCR was constructed to amplify the HPV 16 and 18 genotype-specific L1 gene fragments and followed by ICT which coated with antibodies to identify rapidly the different PCR products. The type-specific gene regions of high-risk HPV 16 and 18 could be amplified successfully by multiplex nested PCR at molecular sizes of approximately 99 and 101bp, respectively. The capture antibodies raised specifically against the moleculars labeled on the PCR products could be detected simultaneously both HPV 16 and 18 in one strip. Under optimal conditions, this PCR-ICT assay had the capability to detect HPV in a sample with as low as 100 copies of HPV viral DNA. The PCR-ICT system has the advantage of direct and simultaneous detection of two high-risk HPV 16 and 18 DNA targets in one sample, which suggested a significant potential of this assay for clinical application. Copyright © 2014. Published by Elsevier B.V.

  12. Operational evaluation of rapid diagnostic testing for Ebola Virus Disease in Guinean laboratories.

    Directory of Open Access Journals (Sweden)

    Amanda VanSteelandt

    Full Text Available Rapid Diagnostic Tests (RDTs for Ebola Virus Disease (EVD at the point of care have the potential to increase access and acceptability of EVD testing and the speed of patient isolation and secure burials for suspect cases. A pilot program for EVD RDTs in high risk areas of Guinea was introduced in October 2015. This paper presents concordance data between EVD RDTs and PCR testing in the field as well as an assessment of the acceptability, feasibility, and quality assurance of the RDT program.Concordance data were compiled from laboratory surveillance databases. The operational measures of the laboratory-based EVD RDT program were evaluated at all 34 sentinel sites in Guinea through: (1 a technical questionnaire filled by the lab technicians who performed the RDTs, (2 a checklist filled by the evaluator during the site visits, and (3 direct observation of the lab technicians performing the quality control test. Acceptability of the EVD RDT was good for technicians, patients, and families although many technicians (69.8% expressed concern for their safety while performing the test. The feasibility of the program was good based on average technician knowledge scores (6.6 out of 8 but basic infrastructure, equipment, and supplies were lacking. There was much room for improvement in quality assurance of the program.The implementation of new diagnostics in weak laboratory systems requires general training in quality assurance, biosafety and communication with patients in addition to specific training for the new test. Corresponding capacity building in terms of basic equipment and a long-term commitment to transfer supervision and quality improvement to national public health staff are necessary for successful implementation.

  13. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    International Nuclear Information System (INIS)

    Lina MR; Dadang S; Budiman Bela

    2004-01-01

    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  14. A high-throughput pipeline for the design of real-time PCR signatures

    Directory of Open Access Journals (Sweden)

    Reifman Jaques

    2010-06-01

    Full Text Available Abstract Background Pathogen diagnostic assays based on polymerase chain reaction (PCR technology provide high sensitivity and specificity. However, the design of these diagnostic assays is computationally intensive, requiring high-throughput methods to identify unique PCR signatures in the presence of an ever increasing availability of sequenced genomes. Results We present the Tool for PCR Signature Identification (TOPSI, a high-performance computing pipeline for the design of PCR-based pathogen diagnostic assays. The TOPSI pipeline efficiently designs PCR signatures common to multiple bacterial genomes by obtaining the shared regions through pairwise alignments between the input genomes. TOPSI successfully designed PCR signatures common to 18 Staphylococcus aureus genomes in less than 14 hours using 98 cores on a high-performance computing system. Conclusions TOPSI is a computationally efficient, fully integrated tool for high-throughput design of PCR signatures common to multiple bacterial genomes. TOPSI is freely available for download at http://www.bhsai.org/downloads/topsi.tar.gz.

  15. The use of short and long PCR products for improved detection of prunus necrotic ringspot virus in woody plants.

    Science.gov (United States)

    Rosner, A; Maslenin, L; Spiegel, S

    1997-09-01

    The reverse transcriptase-polymerase chain reaction (RT-PCR) was used for detection of prunus necrotic ringspot virus (PNRSV) in dormant peach and almond trees by the application of two different pairs of primers yielding a short and a long product, respectively. The relative amount of the short (200 base pair, bp) product was higher than the longer (785 bp) product. PNRSV was detected better in plant tissues with a low virus concentration (e.g. dormant trees) by amplification of the short PCR product, whereas the long product was product was produced at higher virus titers. Simultaneous amplification of both short and long products was demonstrated using a three-primer mixture in a single reaction tube. In this assay, amplification of either PCR product indicated the presence of PNRSV-specific sequences in the plant tissue examined, thus covering a wide range of virus concentrations in a single test. Dilution of the RNA extracted from infected plant material resulted in a steep decline in the amplification of both short and long PCR products. In contrast, serial dilutions of the intermediate cDNA template differentially affected the amplification patterns: the relative amount of the short product increased whereas that of the long product decreased. These results may explain the preferential amplification of the short PCR product observed in samples containing low virus concentrations.

  16. Development and validation of a quantitative PCR assay for Ichthyophonus spp.

    Science.gov (United States)

    White, Vanessa C; Morado, J Frank; Crosson, Lisa M; Vadopalas, Brent; Friedman, Carolyn S

    2013-04-29

    Members of the genus Ichthyophonus are trophically transmitted, cosmopolitan parasites that affect numerous fish species worldwide. A quantitative PCR (qPCR) assay specific for genus Ichthyophonus 18S ribosomal DNA was developed for parasite detection and surveillance. The new assay was tested for precision, repeatability, reproducibility, and both analytical sensitivity and specificity. Diagnostic sensitivity and specificity were estimated using tissue samples from a wild population of walleye pollock Theragra chalcogramma. Ichthyophonus sp. presence in tissue samples was determined by qPCR, conventional PCR (cPCR), and histology. Parasite prevalence estimates varied depending upon the detection method employed and tissue type tested. qPCR identified the greatest number of Ichthyophonus sp.-positive cases when applied to walleye pollock skeletal muscle. The qPCR assay proved sensitive and specific for Ichthyophonus spp. DNA, but like cPCR, is only a proxy for infection. When compared to cPCR, qPCR possesses added benefits of parasite DNA quantification and a 100-fold increase in analytical sensitivity. Because this novel assay is specific for known members of the genus, it is likely appropriate for detecting Ichthyophonus spp. DNA in various hosts from multiple regions. However, species-level identification and isotype variability would require DNA sequencing. In addition to distribution and prevalence applications, this assay could be modified and adapted for use with zooplankton or environmental samples. Such applications could aid in investigating alternate routes of transmission and life history strategies typical to members of the genus Ichthyophonus.

  17. MOLECULAR DIAGNOSTICS OF YERSINIA RUCKERI

    Directory of Open Access Journals (Sweden)

    Yu. Rud

    2014-06-01

    Full Text Available Purpose. The analysis of nucleotide sequences of the 16S rDNA gene of virulent strains of Yersinia ruckeri and to develop the method of molecular diagnostic of enteric redmouth disease. Methodology. By the method of CLUSTALW algorithm in MEGA software version 6.0 the nucleotide sequences of the 16S rDNA gene of virulent strains of Yersinia ruckeri were analysed. For development of molecular diagnostic of Y. ruckeri the method of polymerase chain reaction (PCR was used. Primer selection was carried out in software VectorNTI11 and on-line-service BLAST. The PCR products were investigated by the methods of sequencing and nucleotide analysis. Findings. Based on PCR assay the method of molecular diagnostic of enteric redmouth disease agent, bacterium Y. ruckeri was developed. It was shown that specific oligonucleotide primers generated PCR products in size of 600 base pairs. PCR products were investigated by the sequencing that showed right targeting of primers in reaction. Originality. Among high-conservative gene of 16S rDNA of Y. ruckeri the fragment of DNA was determined to which the specific primers for rapid diagnostic of virulent strains were selected. Practical Value. Rapid diagnostic of yersiniosis will allow to identify an agent of this infectious disease, bacterium Y. ruckeri, and to provide the prophylactic or medical measures in the fish farming of Ukraine.

  18. Dengue Virus NS1 Protein as a Diagnostic Marker: Commercially Available ELISA and Comparison to qRT-PCR and Serological Diagnostic Assays Currently Used by the State of Florida

    Directory of Open Access Journals (Sweden)

    Jason H. Ambrose

    2017-01-01

    Full Text Available Background. The proper management of patients infected with dengue virus requires early detection. Here, real-time molecular assays have proven useful but have limitations, whereas ELISAs that detect antibodies are still favored but results are obtained too late to be of clinical value. The production of DENV NS1 peaks early during infection and its detection can combine the advantages of both diagnostic approaches. Methods. This study compared assays currently used for detecting DENV infection at the Florida Department of Health including anti-DENV IgM and IgG ELISAs as well as qRT-PCR, against a commercially available DENV NS1 ELISA. These comparisons were made among a group of 21 human sera. Results. Nine of 14 (64.3% DENV qRT-PCR+ samples were also DENV NS1+. Interestingly, the 5 NS1− samples that were qRT-PCR+ were additionally IgM− and IgG+ suggesting a nonprimary infection. Compared to qRT-PCR, the NS1 assay had a sensitivity of 64.3%, specificity 100%, PPV of 100%, and NPV of 58.3%. Conclusions. The NS1 ELISA performed as expected in known DENV qRT-PCR+ samples; however negative NS1 results for qRT-PCR+ and IgG+ sera seemingly reduced the usefulness of the NS1 ELISA for nonprimary cases. We therefore conclude that diagnosis obtained via DENV NS1 ELISA deserves further investigation.

  19. Use of Multiplex Real-Time PCR To Diagnose Scrub Typhus.

    Science.gov (United States)

    Tantibhedhyangkul, Wiwit; Wongsawat, Ekkarat; Silpasakorn, Saowaluk; Waywa, Duangdao; Saenyasiri, Nuttawut; Suesuay, Jintapa; Thipmontree, Wilawan; Suputtamongkol, Yupin

    2017-05-01

    Scrub typhus, caused by Orientia tsutsugamushi , is a common cause of acute undifferentiated febrile illness in the Asia-Pacific region. However, its nonspecific clinical manifestation often prevents early diagnosis. We propose the use of PCR and serologic tests as diagnostic tools. Here, we developed a multiplex real-time PCR assay using hydrolysis (TaqMan) probes targeting O. tsutsugamushi 47-kDa, groEL , and human interferon beta (IFN-β gene) genes to improve early diagnosis of scrub typhus. The amplification efficiency was higher than 94%, and the lower detection limit was 10 copies per reaction. We used a human gene as an internal DNA quality and quantity control. To determine the sensitivity of this PCR assay, we selected patients with confirmed scrub typhus who exhibited a clear 4-fold increase in the level of IgG and/or IgM. The PCR assay result was positive in 45 of 52 patients, indicating a sensitivity of 86.5% (95% confidence interval [CI]: 74.2 to 94.4). The PCR assessment was negative for all 136 non-scrub typhus patients, indicating a specificity of 100% (95% CI: 97.3 to 100). In addition, this test helped diagnose patients with inconclusive immunofluorescence assay (IFA) results and using single blood samples. In conclusion, the real-time PCR assay proposed here is sensitive and specific in diagnosing scrub typhus. Combining PCR and serologic tests will improve the diagnosis of scrub typhus among patients presenting with acute febrile illness. Copyright © 2017 American Society for Microbiology.

  20. Diagnostic Tests in Human Brucellosis

    Directory of Open Access Journals (Sweden)

    Hamid Reza Nouri

    2014-07-01

    Full Text Available Context: Brucellosis represents a zoonotic bacterial disease, caused by a gram negative bacterium called Brucella. Between the diverses pecies of this bacteria, B. melitensis, B. abortus, B. suis and B. canis consist the main causes of the disease in humans.More than half a million new cases of Brucellosis are reported annually. Consequently, brucellosis is a remarkable threat for the health of society. Because of the multiple nonspecific clinical signs of this infection, such as fever (60% of cases, night sweating, insomnia and anorexia, which are similar to other diseases, the detection of brucellosis is time-consuming and needs more scrutiny. Evidence Acquisition: Blood culture is considered the gold standard for the detection of brucellosis and the sensitivity of this test in the acute form is high. However, for the chronic type of disease, it is remarkably low, in addition, in some cases, it needs long reaction times. Nevertheless, today, some kinds of tests like automatic culturing system and serological methods, such as Rose Bengal (RB test, serum agglutination test (SAT, 2-mercaptoethanol (2ME and coombs, which are operated based on agglutination, are useful for the problems mentioned earlier. Conclusion: Although serological methods are common for the diagnosis of brucellosis, false results are observable for several methods, such as the SAT method. Tests like the enzyme-linked immunosorbent assay (ELISA, for the screening of specific traits, although confirmed, have their advantages and defects. The lateral flow assay (LFA shows promising evidence to be effective in the diagnosis of brucellosis. The polymerase chain reaction (PCR is more prevalent than other common tests, according to sensitivity and fast answering potency in case of molecular diagnosis. Also, PCR is proper for patients' follow-up during the period of treatment and crimination of relapse by this method is easier compared to others.

  1. The indication area of a diagnostic test. Part I--discounting gain and loss in diagnostic certainty

    NARCIS (Netherlands)

    Stalpers, Lukas J. A.; Nelemans, Patty J.; Geurts, Sandra M. E.; Jansen, Erik; de Boer, Peter; Verbeek, André L. M.

    2015-01-01

    Test performance is conventionally expressed by gain in diagnostic certainty. We propose net diagnostic gain and indication area as more appropriate measures of test performance; then, the loss in certainty due to misclassification and the information of "no test" would be performed are taken into

  2. The applicability of real-time PCR in the diagnostic of cutaneous leishmaniasis and parasite quantification for clinical management: Current status and perspectives.

    Science.gov (United States)

    Moreira, Otacilio C; Yadon, Zaida E; Cupolillo, Elisa

    2017-09-29

    Cutaneous leishmaniasis (CL) is spread worldwide and is the most common manifestation of leishmaniasis. Diagnosis is performed by combining clinical and epidemiological features, and through the detection of Leishmania parasites (or DNA) in tissue specimens or trough parasite isolation in culture medium. Diagnosis of CL is challenging, reflecting the pleomorphic clinical manifestations of this disease. Skin lesions vary in severity, clinical appearance, and duration, and in some cases, they can be indistinguishable from lesions related to other diseases. Over the past few decades, PCR-based methods, including real-time PCR assays, have been developed for Leishmania detection, quantification and species identification, improving the molecular diagnosis of CL. This review provides an overview of many real-time PCR methods reported for the diagnostic evaluation of CL and some recommendations for the application of these methods for quantification purposes for clinical management and epidemiological studies. Furthermore, the use of real-time PCR for Leishmania species identification is also presented. The advantages of real-time PCR protocols are numerous, including increased sensitivity and specificity and simpler standardization of diagnostic procedures. However, despite the numerous assays described, there is still no consensus regarding the methods employed. Furthermore, the analytical and clinical validation of CL molecular diagnosis has not followed international guidelines so far. A consensus methodology comprising a DNA extraction protocol with an exogenous quality control and an internal reference to normalize parasite load is still needed. In addition, the analytical and clinical performance of any consensus methodology must be accurately assessed. This review shows that a standardization initiative is essential to guide researchers and clinical laboratories towards the achievement of a robust and reproducible methodology, which will permit further evaluation

  3. Limitations of typhoid fever diagnostics and the need for prevention

    NARCIS (Netherlands)

    Smits, Henk L.

    2013-01-01

    Evaluation of: Siba V, Horwood PF, Vanuga K et al. Evaluation of serological diagnostic tests for typhoid fever in Papua New Guinea using a composite reference standard. Clin. Vaccine Immunol. 19(11), 1833-1837 (2012). The study under review evaluated serological tests for typhoid fever against PCR

  4. Antimicrobial susceptibility testing by Australian veterinary diagnostic laboratories.

    Science.gov (United States)

    Hardefeldt, L Y; Marenda, M; Crabb, H; Stevenson, M A; Gilkerson, J R; Billman-Jacobe, H; Browning, G F

    2018-04-01

    The national strategy for tackling antimicrobial resistance highlights the need for antimicrobial stewardship in veterinary practice and for surveillance of antimicrobial susceptibility in veterinary pathogens. Diagnostic laboratories have an important role in facilitating both of these processes, but it is unclear whether data from veterinary diagnostic laboratories are similar enough to allow for compilation and if there is consistent promotion of appropriate antimicrobial use embedded in the approaches of different laboratories to susceptibility testing. A cross-sectional study of antimicrobial susceptibility testing and reporting procedures by Australian veterinary diagnostic laboratories was conducted in 2017 using an online questionnaire. All 18 veterinary diagnostic laboratories in Australia completed the questionnaire. Kirby-Bauer disc diffusion was the method predominantly used for antimicrobial susceptibility testing and was used to evaluate 86% of all isolates, although two different protocols were used across the 18 laboratories (CLSI 15/18, CDS 3/18). Minimum inhibitory concentrations were never reported by 61% of laboratories. Common isolates were consistently reported on across all species, except for gram-negative isolates in pigs, for which there was some variation in the approach to reporting. There was considerable diversity in the panels of antimicrobials used for susceptibility testing on common isolates and no consistency was apparent between laboratories for any bacterial species. We recommend that nationally agreed and consistent antimicrobial panels for routine susceptibility testing should be developed and a uniform set of guidelines should be adopted by veterinary diagnostic laboratories in Australia. © 2018 Australian Veterinary Association.

  5. Diagnostic accuracy of two multiplex real-time polymerase chain reaction assays for the diagnosis of meningitis in children in a resource-limited setting.

    Directory of Open Access Journals (Sweden)

    Jermaine Khumalo

    Full Text Available Accurate etiological diagnosis of meningitis is important, but difficult in resource-limited settings due to prior administration of antibiotics and lack of viral diagnostics. We aimed to develop and validate 2 real-time multiplex PCR (RT-PCR assays for the detection of common causes of community-acquired bacterial and viral meningitis in South African children.We developed 2 multiplex RT- PCRs for detection of S. pneumoniae, N. meningitidis, H. influenzae, enteroviruses, mumps virus and herpes simplex virus. We tested residual CSF samples from children presenting to a local paediatric hospital over a one-year period, whose CSF showed an abnormal cell count. Results were compared with routine diagnostic tests and the final discharge diagnosis. We calculated accuracy of the bacterial RT-PCR assay compared to CSF culture and using World Health Organisation definitions of laboratory-confirmed bacterial meningitis.From 292 samples, bacterial DNA was detected in 12 (4.1% and viral nucleic acids in 94 (32%. Compared to CSF culture, the sensitivity and specificity of the bacterial RT-PCR was 100% and 97.2% with complete agreement in organism identification. None of the cases positive by viral RT-PCR had a bacterial cause confirmed on CSF culture. Only 9/90 (10% of patients diagnosed clinically as bacterial meningitis or partially treated bacterial meningitis tested positive with the bacterial RT-PCR.In this population the use of 2 multiplex RT-PCRs targeting 6 common pathogens gave promising results. If introduced into routine diagnostic testing, these multiplex RT-PCR assays would supplement other diagnostic tests, and have the potential to limit unnecessary antibiotic therapy and hospitalisation.

  6. Comparison of Established Diagnostic Methodologies and a Novel Bacterial smpB Real-Time PCR Assay for Specific Detection of Haemophilus influenzae Isolates Associated with Respiratory Tract Infections.

    Science.gov (United States)

    Reddington, Kate; Schwenk, Stefan; Tuite, Nina; Platt, Gareth; Davar, Danesh; Coughlan, Helena; Personne, Yoann; Gant, Vanya; Enne, Virve I; Zumla, Alimuddin; Barry, Thomas

    2015-09-01

    Haemophilus influenzae is a significant causative agent of respiratory tract infections (RTI) worldwide. The development of a rapid H. influenzae diagnostic assay that would allow for the implementation of infection control measures and also improve antimicrobial stewardship for patients is required. A number of nucleic acid diagnostics approaches that detect H. influenzae in RTIs have been described in the literature; however, there are reported specificity and sensitivity limitations for these assays. In this study, a novel real-time PCR diagnostic assay targeting the smpB gene was designed to detect all serogroups of H. influenzae. The assay was validated using a panel of well-characterized Haemophilus spp. Subsequently, 44 Haemophilus clinical isolates were collected, and 36 isolates were identified as H. influenzae using a gold standard methodology that combined the results of matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and a fucK diagnostic assay. Using the novel smpB diagnostic assay, 100% concordance was observed with the gold standard, demonstrating a sensitivity of 100% (95% confidence interval [CI], 90.26% to 100.00%) and a specificity of 100% (95% CI, 63.06% to 100.00%) when used on clinical isolates. To demonstrate the clinical utility of the diagnostic assay presented, a panel of lower RTI samples (n = 98) were blindly tested with the gold standard and smpB diagnostic assays. The results generated were concordant for 94/98 samples tested, demonstrating a sensitivity of 90.91% (95% CI, 78.33% to 97.47%) and a specificity of 100% (95% CI, 93.40% to 100.00%) for the novel smpB assay when used directly on respiratory specimens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    Science.gov (United States)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  8. SYBR green-based real-time reverse transcription-PCR for typing and subtyping of all hemagglutinin and neuraminidase genes of avian influenza viruses and comparison to standard serological subtyping tests

    Science.gov (United States)

    Tsukamoto, K.; Javier, P.C.; Shishido, M.; Noguchi, D.; Pearce, J.; Kang, H.-M.; Jeong, O.M.; Lee, Y.-J.; Nakanishi, K.; Ashizawa, T.

    2012-01-01

    Continuing outbreaks of H5N1 highly pathogenic (HP) avian influenza virus (AIV) infections of wild birds and poultry worldwide emphasize the need for global surveillance of wild birds. To support the future surveillance activities, we developed a SYBR green-based, real-time reverse transcriptase PCR (rRT-PCR) for detecting nucleoprotein (NP) genes and subtyping 16 hemagglutinin (HA) and 9 neuraminidase (NA) genes simultaneously. Primers were improved by focusing on Eurasian or North American lineage genes; the number of mixed-base positions per primer was set to five or fewer, and the concentration of each primer set was optimized empirically. Also, 30 cycles of amplification of 1:10 dilutions of cDNAs from cultured viruses effectively reduced minor cross- or nonspecific reactions. Under these conditions, 346 HA and 345 NA genes of 349 AIVs were detected, with average sensitivities of NP, HA, and NA genes of 10 1.5, 10 2.3, and 10 3.1 50% egg infective doses, respectively. Utility of rRT-PCR for subtyping AIVs was compared with that of current standard serological tests by using 104 recent migratory duck virus isolates. As a result, all HA genes and 99% of the NA genes were genetically subtyped, while only 45% of HA genes and 74% of NA genes were serologically subtyped. Additionally, direct subtyping of AIVs in fecal samples was possible by 40 cycles of amplification: approximately 70% of HA and NA genes of NP gene-positive samples were successfully subtyped. This validation study indicates that rRT-PCR with optimized primers and reaction conditions is a powerful tool for subtyping varied AIVs in clinical and cultured samples. Copyright ?? 2012, American Society for Microbiology. All Rights Reserved.

  9. The impact of new trends in POCTs for companion diagnostics, non-invasive testing and molecular diagnostics.

    Science.gov (United States)

    Huckle, David

    2015-06-01

    Point-of-care diagnostics have been slowly developing over several decades and have taken on a new importance in current healthcare delivery for both diagnostics and development of new drugs. Molecular diagnostics have become a key driver of technology change and opened up new areas in companion diagnostics for use alongside pharmaceuticals and in new clinical approaches such as non-invasive testing. Future areas involving smartphone and other information technology advances, together with new developments in molecular biology, microfluidics and surface chemistry are adding to advances in the market. The focus for point-of-care tests with molecular diagnostic technologies is focused on advancing effective applications.

  10. Establishing diagnostic cut-off criteria for the COBAS AmpliPrep/COBAS TaqMan HIV-1 Qualitative test through validation against the Amplicor DNA test v1.5 for infant diagnosis using dried blood spots.

    Science.gov (United States)

    Maritz, Jean; Preiser, Wolfgang; van Zyl, Gert U

    2012-02-01

    As antibody testing cannot confirm HIV-1 infection in children less than 18 months of age, diagnosis in these children depends on nucleic acid testing. The COBAS(®) AmpliPrep/COBAS(®) TaqMan(®) (CAP/CTM, Roche(®) Molecular Systems, Inc., Branchburg, NJ) HIV-1 Qualitative test is a total nucleic acid real-time PCR assay utilising whole EDTA blood or dried blood spots (DBS), which recently replaced the Roche(®) AMPLICOR(®) DNA test v1.5 (Amplicor) as the diagnostic HIV PCR assay in many South African laboratories. For the Amplicor assay, stringent diagnostic criteria were previously formulated for the local population, and a comparison reported the CAP/CTM's sensitivity at 99.7% and specificity at 100% for both sample types compared to these Amplicor criteria. To validate the assay prior to introduction in our laboratory and to define stringent diagnostic cut-off criteria. Whole EDTA blood samples from patients younger than 18 months sent for routine HIV-1 diagnosis were tested by Amplicor, and positive results were confirmed from DBS. CAP/CTM assays were subsequently performed from DBS. The CAP/CTM had a sensitivity of 98.8% and a specificity of 97.1%, but a positive predictive value (PPV) of only 78.7% compared to the Amplicor assay. Samples positive by CAP/CTM but negative by Amplicor displayed poor amplification curves compared to concordant positive samples. Upon re-testing those with sufficient material available by CAP/CTM, all showed negative results. The decreased PPV may either be due to false positive CAP/CTM results, or increased sensitivity compared to the Amplicor assay. Criteria were formulated for defining presumed false-positive results. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Benefits and challenges of molecular diagnostics for childhood tuberculosis

    Directory of Open Access Journals (Sweden)

    Cristina Gutierrez

    2016-01-01

    Full Text Available Expanding tuberculosis (TB-diagnostic services, including access to rapid tests, is a World Health Organization (WHO strategy to accelerate progress toward ending TB. Faster and more sensitive molecular tests capable of diagnosing TB and drug-resistant TB have the technical capacity to address limitations associated with smears and cultures by increasing accuracy and shortening turnaround times as compared with those of these conventional laboratory methods. Nucleic acid amplification assays used to detect and analyze Mycobacterium tuberculosis (MTB-complex nucleic acids can be used directly on specimens from patients suspected of having TB. Recently, several commercial molecular tests were developed to detect MTB and determine the drug resistance (DR based on detection of specific genetic mutations conferring resistance. The first to be endorsed by the WHO was molecular line-probe assay technology. This test uses polymerase chain reaction (PCR and reverse-hybridization methods to rapidly identify MTB and DR-related mutations simultaneously. More recently, the WHO endorsed Xpert MTB/RIF, Cepheid Inc, CA, USA, a fully automated assay used for TB diagnosis that relies upon PCR techniques for detection of TB and rifampicin resistance-related mutations. Other promising molecular TB assays for simplifying PCR-based testing protocols and increasing their accuracy are under development and evaluation. Although we lack a practical gold standard for the diagnosis of childhood TB, its bacteriological confirmation is always recommended to be sought whenever possible prior to a diagnostic decision being made. Conventional diagnostic laboratory TB tests are less efficient for children as compared with adults, because sufficient sputum samples are more difficult to collect from infants and young children, and their disease is often paucibacillary, resulting in smear-negative disease. These inherent challenges associated with childhood TB are due to

  12. Benefits and challenges of molecular diagnostics for childhood tuberculosis.

    Science.gov (United States)

    Gutierrez, Cristina

    2016-12-01

    Expanding tuberculosis (TB)-diagnostic services, including access to rapid tests, is a World Health Organization (WHO) strategy to accelerate progress toward ending TB. Faster and more sensitive molecular tests capable of diagnosing TB and drug-resistant TB have the technical capacity to address limitations associated with smears and cultures by increasing accuracy and shortening turnaround times as compared with those of these conventional laboratory methods. Nucleic acid amplification assays used to detect and analyze Mycobacterium tuberculosis (MTB)-complex nucleic acids can be used directly on specimens from patients suspected of having TB. Recently, several commercial molecular tests were developed to detect MTB and determine the drug resistance (DR) based on detection of specific genetic mutations conferring resistance. The first to be endorsed by the WHO was molecular line-probe assay technology. This test uses polymerase chain reaction (PCR) and reverse-hybridization methods to rapidly identify MTB and DR-related mutations simultaneously. More recently, the WHO endorsed Xpert MTB/RIF, Cepheid Inc, CA, USA, a fully automated assay used for TB diagnosis that relies upon PCR techniques for detection of TB and rifampicin resistance-related mutations. Other promising molecular TB assays for simplifying PCR-based testing protocols and increasing their accuracy are under development and evaluation. Although we lack a practical gold standard for the diagnosis of childhood TB, its bacteriological confirmation is always recommended to be sought whenever possible prior to a diagnostic decision being made. Conventional diagnostic laboratory TB tests are less efficient for children as compared with adults, because sufficient sputum samples are more difficult to collect from infants and young children, and their disease is often paucibacillary, resulting in smear-negative disease. These inherent challenges associated with childhood TB are due to immunological- and

  13. 3D printing and milling a real-time PCR device for infectious disease diagnostics.

    Science.gov (United States)

    Mulberry, Geoffrey; White, Kevin A; Vaidya, Manjusha; Sugaya, Kiminobu; Kim, Brian N

    2017-01-01

    Diagnosing infectious diseases using quantitative polymerase chain reaction (qPCR) offers a conclusive result in determining the infection, the strain or type of pathogen, and the level of infection. However, due to the high-cost instrumentation involved and the complexity in maintenance, it is rarely used in the field to make a quick turnaround diagnosis. In order to provide a higher level of accessibility than current qPCR devices, a set of 3D manufacturing methods is explored as a possible option to fabricate a low-cost and portable qPCR device. The key advantage of this approach is the ability to upload the digital format of the design files on the internet for wide distribution so that people at any location can simply download and feed into their 3D printers for quick manufacturing. The material and design are carefully selected to minimize the number of custom parts that depend on advanced manufacturing processes which lower accessibility. The presented 3D manufactured qPCR device is tested with 20-μL samples that contain various concentrations of lentivirus, the same type as HIV. A reverse-transcription step is a part of the device's operation, which takes place prior to the qPCR step to reverse transcribe the target RNA from the lentivirus into complementary DNA (cDNA). This is immediately followed by qPCR which quantifies the target sequence molecules in the sample during the PCR amplification process. The entire process of thermal control and time-coordinated fluorescence reading is automated by closed-loop feedback and a microcontroller. The resulting device is portable and battery-operated, with a size of 12 × 7 × 6 cm3 and mass of only 214 g. By uploading and sharing the design files online, the presented low-cost qPCR device may provide easier access to a robust diagnosis protocol for various infectious diseases, such as HIV and malaria.

  14. 3D printing and milling a real-time PCR device for infectious disease diagnostics

    Science.gov (United States)

    Mulberry, Geoffrey; White, Kevin A.; Vaidya, Manjusha; Sugaya, Kiminobu

    2017-01-01

    Diagnosing infectious diseases using quantitative polymerase chain reaction (qPCR) offers a conclusive result in determining the infection, the strain or type of pathogen, and the level of infection. However, due to the high-cost instrumentation involved and the complexity in maintenance, it is rarely used in the field to make a quick turnaround diagnosis. In order to provide a higher level of accessibility than current qPCR devices, a set of 3D manufacturing methods is explored as a possible option to fabricate a low-cost and portable qPCR device. The key advantage of this approach is the ability to upload the digital format of the design files on the internet for wide distribution so that people at any location can simply download and feed into their 3D printers for quick manufacturing. The material and design are carefully selected to minimize the number of custom parts that depend on advanced manufacturing processes which lower accessibility. The presented 3D manufactured qPCR device is tested with 20-μL samples that contain various concentrations of lentivirus, the same type as HIV. A reverse-transcription step is a part of the device’s operation, which takes place prior to the qPCR step to reverse transcribe the target RNA from the lentivirus into complementary DNA (cDNA). This is immediately followed by qPCR which quantifies the target sequence molecules in the sample during the PCR amplification process. The entire process of thermal control and time-coordinated fluorescence reading is automated by closed-loop feedback and a microcontroller. The resulting device is portable and battery-operated, with a size of 12 × 7 × 6 cm3 and mass of only 214 g. By uploading and sharing the design files online, the presented low-cost qPCR device may provide easier access to a robust diagnosis protocol for various infectious diseases, such as HIV and malaria. PMID:28586401

  15. The investigation of the truncated mbtA gene within the mycobactin cluster of Mycobacterium avium subspecies paratuberculosis as a novel diagnostic marker for real-time PCR.

    Science.gov (United States)

    de Kruijf, Marcel; Coffey, Aidan; O'Mahony, Jim

    2017-05-01

    The inability of Mycobacterium avium subspecies paratuberculosis (MAP) to produce endogenous mycobactin in-vitro is most likely due to the presence of a truncated mbtA gene within the mycobactin cluster of MAP. The main goal of this study was to investigate this unique mbtA truncation as a potential novel PCR diagnostic marker for MAP. Novel primers were designed that were located within the truncated region and the contiguous MAP2179 gene. Primers were evaluated against non-MAP isolates and no amplicons were generated. The detection limit of this mbtA-MAP2179 target was evaluated using a range of MAP DNA concentrations, MAP inoculated faecal material and 20 MAP isolates. The performance of mbtA-MAP2179 was compared to the established f57 target. The detection limits recorded for MAP K-10 DNA and from MAP K-10 inoculated faecal samples were 0.34pg and 10 4 CFU/g respectively for both f57 and mbtA-MAP2179. A detection limit of 10 3 CFU/g was recorded for both targets, but not achieved consistently. The detection limit of MAP from inoculated faecal material was successful at 10 3 CFU/g for mbtA-MAP2179 when FAM probe real-time PCR was used. A MAP cell concentration of 10 2 CFU/g was detected successfully, but again not consistently achieved. All 20 mycobacterial isolates were successfully identified as MAP by f57 and mbtA-MAP2179. Interestingly, the mbtA-MAP2179 real-time PCR assay resulted in the formation of a unique melting curve profile that contained two melting curve peaks rather than one single peak. This melting curve phenomenon was attributed towards the asymmetrical GC% distribution within the mbtA-MAP2179 amplicon. This study investigated the implementation of the mbtA-MAP2179 target as a novel diagnostic marker and the detection limits obtained with mbtA-MAP2179 were comparable to the established f57 target, making the mbtA-MAP2179 an adequate confirmatory target. Moreover, the mbtA-MAP2179 target could be implemented in multiplex real-time PCR assays and

  16. Immunochromatographic diagnostic test analysis using Google Glass.

    Science.gov (United States)

    Feng, Steve; Caire, Romain; Cortazar, Bingen; Turan, Mehmet; Wong, Andrew; Ozcan, Aydogan

    2014-03-25

    We demonstrate a Google Glass-based rapid diagnostic test (RDT) reader platform capable of qualitative and quantitative measurements of various lateral flow immunochromatographic assays and similar biomedical diagnostics tests. Using a custom-written Glass application and without any external hardware attachments, one or more RDTs labeled with Quick Response (QR) code identifiers are simultaneously imaged using the built-in camera of the Google Glass that is based on a hands-free and voice-controlled interface and digitally transmitted to a server for digital processing. The acquired JPEG images are automatically processed to locate all the RDTs and, for each RDT, to produce a quantitative diagnostic result, which is returned to the Google Glass (i.e., the user) and also stored on a central server along with the RDT image, QR code, and other related information (e.g., demographic data). The same server also provides a dynamic spatiotemporal map and real-time statistics for uploaded RDT results accessible through Internet browsers. We tested this Google Glass-based diagnostic platform using qualitative (i.e., yes/no) human immunodeficiency virus (HIV) and quantitative prostate-specific antigen (PSA) tests. For the quantitative RDTs, we measured activated tests at various concentrations ranging from 0 to 200 ng/mL for free and total PSA. This wearable RDT reader platform running on Google Glass combines a hands-free sensing and image capture interface with powerful servers running our custom image processing codes, and it can be quite useful for real-time spatiotemporal tracking of various diseases and personal medical conditions, providing a valuable tool for epidemiology and mobile health.

  17. Application of diagnostic tests for mycoplasmal infections of desert and gopher tortoises with management recommendations

    Science.gov (United States)

    Brown, D.R.; Schumacher, Isabella M.; Mclaughlin, Grace S.; Wendland, L.D.; Brown, Mary E.; Klein, P.A.; Jacobson, E.R.

    2002-01-01

    Mycoplasmosis is a transmissible upper respiratory tract disease that has affected plans for management and conservation of wild desert and gopher tortoises in the United States. Although impact of mycoplasmosis on populations of desert and gopher tortoises is unknown, increased prevalence of seropositive animals as well as field observations of clinically ill tortoises have occurred in association with declining populations. In order to help in the identification of potentially infected animals, three tests have been developed to diagnose mycoplasmal infections of tortoises: 1) direct mycoplasmal culture; 2) detection of mycolplasmal chromosomal DNA by polymerase chain reaction (PCR); and 3) detection of anti-Mycoplasma antibodies in tortoise plasma by enzyme-linked immunosorbent assay (ELISA). Each test provides different, complementary information that collectively can be used to define tortoise mycoplasmal infection status. The types of samples required, the predictive value, interpretation, and cost vary among tests. These assays have been used for epidemiological surveys and in decision making for relocation, repatriation, or captive management of tortoises to minimize the risk of outbreaks of mycoplasmal respiratory disease and spread of the causative agent of this disease. Certain features of mycoplasmal infections of tortoises and other animals create a diagnostic dilemma. Multiple Mycoplasma species can cause respiratory disease with identical clinical presentations. Further, individual strains of a given species may vary with respect to their virulence potential, and some species may be commensals rather than pathogens. Current diagnostic tests may not differentiate among mycoplasmal species or strains or permit determination of pathogenicity of individual isolates. Thus, the information provided by testing is not a simple 'positive' vs. 'negative' issue. While these tests provide much needed information on the exposure of tortoise populations to

  18. Efficiency of Nested-PCR in Detecting Asymptomatic Cases toward Malaria Elimination Program in an Endemic Area of Iran.

    Directory of Open Access Journals (Sweden)

    Habibollah Turki

    2015-03-01

    Full Text Available The aim of this study was to detect low parasite and asymptomatic malaria infections by means of three malaria diagnostic tests, in a low transmission region of Minab district, Hormozgan Province, southern Iran.Blood samples of 200 healthy volunteers from Bagh-e-Malek area were evaluated using microscopic, rapid diagnostic tests (RDT and nested-PCR to inspect malaria parasite.The results showed no Plasmodium parasite in subjects by means of microscopy and RDT. However, 3 P. vivax positive samples (1.5% were discovered by Nested-PCR while microscopy and RDT missed the cases.Microscopy as the gold standard method and RDT correctly identified 98.5% of cases, and molecular analysis is sensitive and reliable, especially in the detection of "asymptomatic" infections for active case surveillance. Regarding the existence of asymptomatic malaria in endemic area of Hormozgan, Iran, nested-PCR could be considered as a sensitive tool to interrupt malaria transmission in the country, beside the microscopic and RDT methods.

  19. Efficiency of Nested-PCR in Detecting Asymptomatic Cases toward Malaria Elimination Program in an Endemic Area of Iran.

    Science.gov (United States)

    Turki, Habibollah; Raeisi, Ahmad; Malekzadeh, Kianoosh; Ghanbarnejad, Amin; Zoghi, Samaneh; Yeryan, Masoud; Abedi Nejad, Masoumeh; Mohseni, Fatemeh; Shekari, Mohammad

    2015-01-01

    The aim of this study was to detect low parasite and asymptomatic malaria infections by means of three malaria diagnostic tests, in a low transmission region of Minab district, Hormozgan Province, southern Iran. Blood samples of 200 healthy volunteers from Bagh-e-Malek area were evaluated using microscopic, rapid diagnostic tests (RDT) and nested-PCR to inspect malaria parasite. The results showed no Plasmodium parasite in subjects by means of microscopy and RDT. However, 3 P. vivax positive samples (1.5%) were discovered by Nested-PCR while microscopy and RDT missed the cases. Microscopy as the gold standard method and RDT correctly identified 98.5% of cases, and molecular analysis is sensitive and reliable, especially in the detection of "asymptomatic" infections for active case surveillance. Regarding the existence of asymptomatic malaria in endemic area of Hormozgan, Iran, nested-PCR could be considered as a sensitive tool to interrupt malaria transmission in the country, beside the microscopic and RDT methods.

  20. Development of a Real-time PCR test for porcine group A rotavirus diagnosis

    OpenAIRE

    Marconi, Elizabeth C.M.; Bernardes, Nara T.C.G.; Beserra, Laila A.R.; Silva, Fernanda D.F.; Gregori, Fabio

    2015-01-01

    Group A Rotavirus (RVA) is one of the most common causes of diarrhea in humans and several animal species. A SYBR-Green Real-Time polymerase chain reaction (PCR) was developed to diagnose RVA from porcine fecal samples, targeting amplification of a 137-bp fragment of nonstructural protein 5 (NSP5) gene using mRNA of bovine NADH-desidrogenase-5 as exogenous internal control. Sixty-five samples were tested (25 tested positive for conventional PCR and genetic sequencing). The overall agreement (...

  1. Developmental stage of strongyle eggs affects the outcome variations of real-time PCR analysis

    DEFF Research Database (Denmark)

    Andersen, Ulla Vestergaard; Haakansson, I. T.; Roust, Tina

    2013-01-01

    extent developmental stages can affect the variation of diagnostic test results. This study investigated the influence of developmental stages of strongyle eggs on the variation real-time polymerase chain reaction (PCR) results. Mixed species strongyle eggs were obtained from the faeces of a naturally...

  2. Development and validation of a real-time PCR assay for the detection of anguillid herpesvirus 1.

    Science.gov (United States)

    van Beurden, S J; Voorbergen-Laarman, M A; Roozenburg, I; van Tellingen, J; Haenen, O L M; Engelsma, M Y

    2016-01-01

    Anguillid herpesvirus 1 (AngHV1) causes a haemorrhagic disease with increased mortality in wild and farmed European eel, Anguilla anguilla (L.) and Japanese eel Anguilla japonica, Temminck & Schlegel). Detection of AngHV1 is currently based on virus isolation in cell culture, antibody-based typing assays or conventional PCR. We developed, optimized and concisely validated a diagnostic TaqMan probe based real-time PCR assay for the detection of AngHV1. The primers and probe target AngHV1 open reading frame 57, encoding the capsid protease and scaffold protein. Compared to conventional PCR, the developed real-time PCR is faster, less labour-intensive and has a reduced risk of cross-contamination. The real-time PCR assay was shown to be analytically sensitive and specific and has a high repeatability, efficiency and r(2) -value. The diagnostic performance of the assay was determined by testing 10% w/v organ suspensions and virus cultures from wild and farmed European eels from the Netherlands by conventional and real-time PCR. The developed real-time PCR assay is a useful tool for the rapid and sensitive detection of AngHV1 in 10% w/v organ suspensions from wild and farmed European eels. © 2015 John Wiley & Sons Ltd.

  3. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Directory of Open Access Journals (Sweden)

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  4. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  5. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  6. Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

    Science.gov (United States)

    Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

    2011-01-01

    Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

  7. Quantifying the Accuracy of a Diagnostic Test or Marker

    NARCIS (Netherlands)

    Linnet, Kristian; Bossuyt, Patrick M. M.; Moons, Karel G. M.; Reitsma, Johannes B. R.

    2012-01-01

    BACKGROUND: In recent years, increasing focus has been directed to the methodology for evaluating (new) tests or biomarkers. A key step in the evaluation of a diagnostic test is the investigation into its accuracy. CONTENT: We reviewed the literature on how to assess the accuracy of diagnostic

  8. Novel approach based on one-tube nested PCR and a lateral flow strip for highly sensitive diagnosis of tuberculous meningitis.

    Science.gov (United States)

    Sun, Yajuan; Chen, Jiajun; Li, Jia; Xu, Yawei; Jin, Hui; Xu, Na; Yin, Rui; Hu, Guohua

    2017-01-01

    Rapid and sensitive detection of Mycobacterium tuberculosis (M. Tb) in cerebrospinal fluid is crucial in the diagnosis of tuberculous meningitis (TBM), but conventional diagnostic technologies have limited sensitivity and specificity or are time-consuming. In this work, a novel, highly sensitive molecular diagnostic method, one-tube nested PCR-lateral flow strip test (OTNPCR-LFST), was developed for detecting M. tuberculosis. This one-tube nested PCR maintains the sensitivity of conventional two-step nested PCR and reduces both the chance of cross-contamination and the time required for analysis. The PCR product was detected by a lateral flow strip assay, which provided a basis for migration of the test to a point-of-care (POC) microfluidic format. The developed assay had an improved sensitivity compared with traditional PCR, and the limit of detection was up to 1 fg DNA isolated from M. tuberculosis. The assay was also specific for M. tuberculosis, and no cross-reactions were found in other non-target bacteria. The application of this technique to clinical samples was successfully evaluated, and OTNPCR-LFST showed 89% overall sensitivity and 100% specificity for TBM patients. This one-tube nested PCR-lateral flow strip assay is useful for detecting M. tuberculosis in TBM due to its rapidity, high sensitivity and simple manipulation.

  9. Immune pressure analysis of protease and reverse transcriptase ...

    African Journals Online (AJOL)

    /dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...

  10. Local Sensitivity and Diagnostic Tests

    NARCIS (Netherlands)

    Magnus, J.R.; Vasnev, A.L.

    2004-01-01

    In this paper we confront sensitivity analysis with diagnostic testing.Every model is misspecified, but a model is useful if the parameters of interest (the focus) are not sensitive to small perturbations in the underlying assumptions. The study of the e ect of these violations on the focus is

  11. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Directory of Open Access Journals (Sweden)

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  12. A new real-time PCR assay for rapid identification of the S. aureus/MRSA strains

    Directory of Open Access Journals (Sweden)

    Ivan Manga

    2013-01-01

    Full Text Available The Methicillin-resistant Staphylococcus aureus (MRSA with the livestock-associated MRSA (LA-MRSA are of great interest to scientists and general public. The aim of our study was to present a new more rapid and reliable diagnostic method working on the RT-PCR platform applicable for monitoring of MRSA/S. aureus. The parallel testing of the S. aureus specific nuc gene sequence and the mecA gene sequence was utilised for this purpose. A collection of ten S. aureus/MRSA reference strains, fifteen genetically related non S. aureus reference strains and fifty-six environmental samples was employed for estimation of the assay performance and parameters. The environmental samples acquired in the Czech livestock farms were represented with the livestock and human nasal mucosae or skin swabs, the slaughter meat swabs and were chosen preferentially from individuals with previously confi rmed or suspected positive MRSA/S. aureus cases. The classic selective cultivation approach with the biochemical test and agar disk diffusion test was accepted as reference diagnostic method. As there were no culture positive samples that were negative using RT-PCR, our method featured with 100% sensitivity in comparison to reference method. The limit of detection allowed to identify from tens to hundreds copies of S. aureus/MRSA genome. Further, the RT-PCR assay featured with 100% inclusivity and 95% exclusivity at Cq value below 30. These parameters suggested on powerful and reliable diagnostic method with real potential of practical utilisation. We consider our method as ideal for testing of individual suspected colonies, when the results can be acquired in less than 1.5 hour.

  13. Development and clinical evaluation of a rapid diagnostic kit for feline leukemia virus infection.

    Science.gov (United States)

    Kim, Won-Shik; Chong, Chom-Kyu; Kim, Hak-Yong; Lee, Gyu-Cheol; Jeong, Wooseog; An, Dong-Jun; Jeoung, Hye-Young; Lee, Jae-In; Lee, Young-Ki

    2014-01-01

    Feline leukemia virus (FeLV) causes a range of neoplastic and degenerative diseases in cats. To obtain a more sensitive and convenient diagnosis of the disease, we prepared monoclonal antibodies specific for the FeLV p27 to develop a rapid diagnostic test with enhanced sensitivity and specificity. Among these antibodies, we identified two clones (hybridomas 8F8B5 and 8G7D1) that specifically bound to FeLV and were very suitable for a diagnostic kit. The affinity constants for 8F8B5 and 8G7D1 were 0.35 × 10⁸ and 0.86 × 10⁸, respectively. To investigate the diagnostic abilities of the rapid kit using these antibodies, we performed several clinical studies. Assessment of analytical sensitivity revealed that the detection threshold of the rapid diagnostic test was 2 ng/mL for recombinant p27 and 12.5 × 10⁴ IU/mL for FeLV. When evaluating 252 cat sera samples, the kit was found to have a kappa value of 0.88 compared to polymerase chain reaction (PCR), indicating a significant correlation between data from the rapid diagnostic test and PCR. Sensitivity and specificity of the kit were 95.2% (20/21) and 98.5% (257/261), respectively. Our results demonstrated that the rapid diagnostic test would be a suitable diagnostic tool for the rapid detection of FeLV infection in cats.

  14. Management of uncomplicated malaria in febrile under five-year-old children by community health workers in Madagascar: reliability of malaria rapid diagnostic tests

    Directory of Open Access Journals (Sweden)

    Ratsimbasoa Arsène

    2012-03-01

    Full Text Available Abstract Background Early diagnosis, as well as prompt and effective treatment of uncomplicated malaria, are essential components of the anti-malaria strategy in Madagascar to prevent severe malaria, reduce mortality and limit malaria transmission. The purpose of this study was to assess the performance of the malaria rapid diagnostic tests (RDTs used by community health workers (CHWs by comparing RDT results with two reference methods (microscopy and Polymerase Chain Reaction, PCR. Methods Eight CHWs in two districts, each with a different level of endemic malaria transmission, were trained to use RDTs in the management of febrile children under five years of age. RDTs were performed by CHWs in all febrile children who consulted for fever. In parallel, retrospective parasitological diagnoses were made by microscopy and PCR. The results of these different diagnostic methods were analysed to evaluate the diagnostic performance of the RDTs administered by the CHWs. The stability of the RDTs stored by CHWs was also evaluated. Results Among 190 febrile children with suspected malaria who visited CHWs between February 2009 and February 2010, 89.5% were found to be positive for malaria parasites by PCR, 51.6% were positive by microscopy and 55.8% were positive by RDT. The performance accuracy of the RDTs used by CHWs in terms of sensitivity, specificity, positive and negative predictive values was greater than 85%. Concordance between microscopy and RDT, estimated by the Kappa value was 0.83 (95% CI: 0.75-0.91. RDTs stored by CHWs for 24 months were capable of detecting Plasmodium falciparum in blood at a level of 200 parasites/μl. Conclusion Introduction of easy-to-use diagnostic tools, such as RDTs, at the community level appears to be an effective strategy for improving febrile patient management and for reducing excessive use of anti-malarial drugs.

  15. DiagTest3Grp: An R Package for Analyzing Diagnostic Tests with Three Ordinal Groups

    Directory of Open Access Journals (Sweden)

    Jingqin Luo

    2012-10-01

    Full Text Available Medical researchers endeavor to identify potentially useful biomarkers to develop marker-based screening assays for disease diagnosis and prevention. Useful summary measures which properly evaluate the discriminative ability of diagnostic markers are critical for this purpose. Literature and existing software, for example, R packages nicely cover summary measures for diagnostic markers used for the binary case (e.g., healthy vs. diseased. An intermediate population at an early disease stage usually exists between the healthy and the fully diseased population in many disease processes. Supporting utilities for three-group diagnostic tests are highly desired and important for identifying patients at the early disease stage for timely treatments. However, application packages which provide summary measures for three ordinal groups are currently lacking. This paper focuses on two summary measures of diagnostic accuracy—volume under the receiver operating characteristic surface and the extended Youden index, with three diagnostic groups. We provide the R package DiagTest3Grp to estimate, under both parametric and nonparametric assumptions, the two summary measures and the associated variances, as well as the optimal cut-points for disease diagnosis. An omnibus test for multiple markers and a Wald test for two markers, on independent or paired samples, are incorporated to compare diagnostic accuracy across biomarkers. Sample size calculation under the normality assumption can be performed in the R package to design future diagnostic studies. A real world application evaluating the diagnostic accuracy of neuropsychological markers for Alzheimer’s disease is used to guide readers through step-by-step implementation of DiagTest3Grp to demonstrate its utility.

  16. Analysis of molecular intra-patient variation and delineation of a prognostic 12-gene signature in non-muscle invasive bladder cancer; technology transfer from microarrays to PCR

    DEFF Research Database (Denmark)

    Andersen, Lars Dyrskjøt; Reinert, Thomas; Novoradovsky, A

    2012-01-01

    . Methods: We measured the intra-patient variation of an 88-gene progression signature using 39 metachronous tumours from 17 patients. For delineation of the optimal quantitative reverse transcriptase PCR panel of markers, we used 115 tumour samples from patients in Denmark, Sweden, UK and Spain. Results...

  17. Whole Genome Sequencing Increases Molecular Diagnostic Yield Compared with Current Diagnostic Testing for Inherited Retinal Disease.

    Science.gov (United States)

    Ellingford, Jamie M; Barton, Stephanie; Bhaskar, Sanjeev; Williams, Simon G; Sergouniotis, Panagiotis I; O'Sullivan, James; Lamb, Janine A; Perveen, Rahat; Hall, Georgina; Newman, William G; Bishop, Paul N; Roberts, Stephen A; Leach, Rick; Tearle, Rick; Bayliss, Stuart; Ramsden, Simon C; Nemeth, Andrea H; Black, Graeme C M

    2016-05-01

    To compare the efficacy of whole genome sequencing (WGS) with targeted next-generation sequencing (NGS) in the diagnosis of inherited retinal disease (IRD). Case series. A total of 562 patients diagnosed with IRD. We performed a direct comparative analysis of current molecular diagnostics with WGS. We retrospectively reviewed the findings from a diagnostic NGS DNA test for 562 patients with IRD. A subset of 46 of 562 patients (encompassing potential clinical outcomes of diagnostic analysis) also underwent WGS, and we compared mutation detection rates and molecular diagnostic yields. In addition, we compared the sensitivity and specificity of the 2 techniques to identify known single nucleotide variants (SNVs) using 6 control samples with publically available genotype data. Diagnostic yield of genomic testing. Across known disease-causing genes, targeted NGS and WGS achieved similar levels of sensitivity and specificity for SNV detection. However, WGS also identified 14 clinically relevant genetic variants through WGS that had not been identified by NGS diagnostic testing for the 46 individuals with IRD. These variants included large deletions and variants in noncoding regions of the genome. Identification of these variants confirmed a molecular diagnosis of IRD for 11 of the 33 individuals referred for WGS who had not obtained a molecular diagnosis through targeted NGS testing. Weighted estimates, accounting for population structure, suggest that WGS methods could result in an overall 29% (95% confidence interval, 15-45) uplift in diagnostic yield. We show that WGS methods can detect disease-causing genetic variants missed by current NGS diagnostic methodologies for IRD and thereby demonstrate the clinical utility and additional value of WGS. Copyright © 2016 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

  18. Multiplex real-time PCR assay for Legionella species.

    Science.gov (United States)

    Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

    2015-12-01

    Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Directory of Open Access Journals (Sweden)

    Claudia de Camargo Tozato

    2016-01-01

    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  20. Multiplex hydrolysis probe real-time PCR for simultaneous detection of hepatitis A virus and hepatitis E virus.

    Science.gov (United States)

    Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli

    2014-05-30

    Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.

  1. Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

    Science.gov (United States)

    Amendola, R

    1994-11-01

    The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

  2. Non-Culture Diagnostics for Invasive Candidiasis: Promise and Unintended Consequences

    Science.gov (United States)

    Clancy, Cornelius J.; Nguyen, M. Hong

    2018-01-01

    Blood cultures are positive for Candida species in candidiasis, respectively. Non-culture tests such as mannan, anti-mannan antibody, Candida albicans germ tube antibody (CAGTA), 1,3-β-d-glucan (BDG), the T2Candida nanodiagnostic panel, and polymerase chain reaction (PCR) are available for clinical use, but their roles in patient care are uncertain. Sensitivity/specificity of combined mannan/anti-mannan, BDG, T2Candida and PCR for candidemia are ~80%/80%, ~80%/80%, ~90%/98%, and ~90%/90%, respectively. Limited data for intra-abdominal candidiasis suggest CAGTA, BDG sensitivity/specificity of ~65%/75% and PCR sensitivity of ~85–90%. PCR specificity has varied widely for intra-abdominal candidiasis (33–97%), and T2Candida data are lacking. Tests will be useful if restricted to cases in which positive and negative predictive values (PPVs, NPVs) differ in a clinically meaningful way from the pre-test likelihood of invasive candidiasis. In some patients, PPVs are sufficient to justify antifungal treatment, even if blood cultures are negative. In most patients, NPVs of each test are excellent, which may support decisions to withhold antifungal therapy. If test results are not interpreted judiciously, non-culture diagnostics may have unintended consequences for stewardship and infection prevention programs. In particular, discrepant non-culture test-positive/culture-negative results may promote inappropriate antifungal treatment of patients who are unlikely to have candidiasis, and lead to spurious reporting of hospital-acquired infections. In conclusion, non-culture Candida diagnostics have potential to advance patient care, but this promise will be realized only if users understand tests’ strengths and limitations, and plan proactively for how best to employ them at their hospitals. PMID:29463043

  3. Antigen persistence of rapid diagnostic tests in pregnant women in Nanoro, Burkina Faso, and the implications for the diagnosis of malaria in pregnancy.

    Science.gov (United States)

    Kattenberg, Johanna H; Tahita, Christian M; Versteeg, Inge A J; Tinto, Halidou; Traoré-Coulibaly, Maminata; Schallig, Henk D F H; Mens, Petra F

    2012-05-01

    To evaluate persistence of several Plasmodium antigens in pregnant women after treatment and compare diagnostics during treatment follow-up. Thirty-two pregnant women (N = 32) with confirmed malaria infection by a histidine-rich protein 2 (HRP2)-based rapid diagnostic test (RDT) and microscopy were followed for 28 days after artemisinin-based combination therapy (ACT). A Plasmodium lactate dehydrogenase (pLDH)-based RDT and two ELISAs based on the detection of dihydrofolate reductase-thymidylate synthase (DHFR-TS) and haeme detoxification protein (HDP) were compared with each other and to RT-PCR at each visit. The mean visit number (95% confidence interval) on which the HRP2-based RDT was still positive after treatment was 3.4 (2.7-4.1) visits with some patients still positive at day 28. This is significantly later than the pLDH-based RDT [0.84 (0.55-1.1)], microscopy (median 1, range 1-3), DHFR-TS-ELISA [1.7 (1.1-2.3)] and RT-PCR (median 2, range 1-5) (P pregnant women and can generate problems when using this test during intermittent preventive treatment (IPTp). DHFR-TS is less persistent than HRP2, making it a potentially interesting target for diagnosis. © 2012 Blackwell Publishing Ltd.

  4. Blood culture-PCR to optimise typhoid fever diagnosis after controlled human infection identifies frequent asymptomatic cases and evidence of primary bacteraemia.

    Science.gov (United States)

    Darton, Thomas C; Zhou, Liqing; Blohmke, Christoph J; Jones, Claire; Waddington, Claire S; Baker, Stephen; Pollard, Andrew J

    2017-04-01

    Improved diagnostics for typhoid are needed; a typhoid controlled human infection model may accelerate their development and translation. Here, we evaluated a blood culture-PCR assay for detecting infection after controlled human infection with S. Typhi and compared test performance with optimally performed blood cultures. Culture-PCR amplification of blood samples was performed alongside daily blood culture in 41 participants undergoing typhoid challenge. Study endpoints for typhoid diagnosis (TD) were fever and/or bacteraemia. Overall, 24/41 (59%) participants reached TD, of whom 21/24 (86%) had ≥1 positive blood culture (53/674, 7.9% of all cultures) or 18/24 (75%) had ≥1 positive culture-PCR assay result (57/684, 8.3%). A further five non-bacteraemic participants produced culture-PCR amplicons indicating infection; overall sensitivity/specificity of the assay compared to the study endpoints were 70%/65%. We found no significant difference between blood culture and culture-PCR methods in ability to identify cases (12 mismatching pairs, p = 0.77, binomial test). Clinical and stool culture metadata demonstrated that additional culture-PCR amplification positive individuals likely represented true cases missed by blood culture, suggesting the overall attack rate may be 30/41 (73%) rather than 24/41 (59%). Several participants had positive culture-PCR results soon after ingesting challenge providing new evidence for occurrence of an early primary bacteraemia. Overall the culture-PCR assay performed well, identifying extra typhoid cases compared with routine blood culture alone. Despite limitations to widespread field-use, the benefits of increased diagnostic yield, reduced blood volume and faster turn-around-time, suggest that this assay could enhance laboratory typhoid diagnostics in research applications and high-incidence settings. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  5. Validation of a PCR-based method for detection of food-borne thermotolerant Campylobacters in a multicenter collaborative trial

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Cook, N.; D'Agostino, M.

    2004-01-01

    A PCR-based method for rapid detection of food-borne thermotolerant campylobacters was evaluated through a collaborative trial with 12 laboratories testing spiked carcass rinse samples. The method showed an interlaboratory diagnostic sensitivity of 96.7% and a diagnostic specificity of 100% for c......% for chicken samples, while these values were 94.2 and 83.3%, respectively, for pig samples....

  6. Demise of Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry as an Infectious Diseases Diagnostic Tool.

    Science.gov (United States)

    Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer

    2018-01-18

    Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  7. Diagnostic accuracy of the ROCHE Septifast PCR system for the rapid detection of blood pathogens in neonatal sepsis-A prospective clinical trial.

    Science.gov (United States)

    Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith

    2017-01-01

    Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.

  8. An SSP-PCR method for the rapid detection of disease-associated alleles HLA-A*29 and HLA-B*51.

    Science.gov (United States)

    Amstutz, U; Schaerer, D; Andrey, G; Wirthmueller, U; Largiadèr, C R

    2018-05-15

    HLA-A*29 and HLA-B*51 are associated with birdshot uveitis and Behçet's disease, respectively, and are used as a diagnostic criterion in patients with suspected disease, requiring their detection in diagnostic laboratories. While commercial tests for individual HLA alleles are available for other disease-associated HLA variants, no similar allele-specific assays are available for HLA-A*29 and -B*51. Here, we report SSP-PCR methods for the detection of HLA-A*29 and -B*51 using a single PCR reaction per allele. The assays were tested in 30 and 32 previously HLA-typed samples, respectively, representing >97% of HLA-A alleles and >93% of HLA-B alleles in a European population. A concordance of 100% was observed with previous typing results, validating these methods for use in a diagnostic or research context. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  9. Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

    Science.gov (United States)

    Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

    2005-01-01

    We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

  10. Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa

    Directory of Open Access Journals (Sweden)

    Aline Aki Tanikawa

    2013-08-01

    Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.

  11. Lichtheimia Infection in a Lymphoma Patient: Case Report and a Brief Review of the Available Diagnostic Tools.

    Science.gov (United States)

    Zimmerli, Stefan; Bialek, Ralf; Blau, Igor W; Christe, Andreas; Lass-Flörl, Cornelia; Presterl, Elisabeth

    2016-08-01

    We describe the case of a patient with a T-lymphoblastic lymphoma whose disseminated mucormycosis was diagnosed with delay, and we address the diagnostic and therapeutic decision-making process and review the diagnostic workup of patients with potential IFD. The diagnosis was delayed despite a suggestive radiological presentation of the patient's pulmonary lesion. The uncommon risk profile (T-lymphoblastic lymphoma, short neutropenic phases) wrongly led to a low level of suspicion. The diagnosis was also hampered by the lack of indirect markers for infections caused by Mucorales, the low sensitivity of both fungal culture and panfungal PCR, and the limited availability of species-specific PCR. A high level of suspicion of IFD is needed, and aggressive diagnostic procedures should be promptly initiated even in apparently low-risk patients with uncommon presentations. The extent of the analytical workup should be decided on a case-by-case base. Diagnostic tests such as the galactomannan and β-D-glucan test and/or PCR on biological material followed by sequencing should be chosen according to their availability and after evaluation of their specificity and sensitivity. In high-risk patients, preemptive therapy with a broad-spectrum mould-active antifungal agent should be started before definitive diagnostic findings become available.

  12. Comparison of three human papillomavirus DNA detection methods: Next generation sequencing, multiplex-PCR and nested-PCR followed by Sanger based sequencing.

    Science.gov (United States)

    da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui

    2016-05-01

    To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.

  13. qPCR detection of Mycobacterium leprae in biopsies and slit skin smear of different leprosy clinical forms

    Directory of Open Access Journals (Sweden)

    Michelle de Campos Soriani Azevedo

    2017-01-01

    Full Text Available Leprosy, whose etiological agent is Mycobacterium leprae, is a chronic infectious disease that mainly affects the skin and peripheral nervous system. The diagnosis of leprosy is based on clinical evaluation, whereas histopathological analysis and bacilloscopy are complementary diagnostic tools. Quantitative PCR (qPCR, a current useful tool for diagnosis of infectious diseases, has been used to detect several pathogens including Mycobacterium leprae. The validation of this technique in a robust set of samples comprising the different clinical forms of leprosy is still necessary. Thus, in this study samples from 126 skin biopsies (collected from patients on all clinical forms and reactional states of leprosy and 25 slit skin smear of leprosy patients were comparatively analyzed by qPCR (performed with primers for the RLEP region of M. leprae DNA and routine bacilloscopy performed in histological sections or in slit skin smear. Considering clinical diagnostic as the gold standard, 84.9% of the leprosy patients were qPCR positive in skin biopsies, resulting in 84.92% sensitivity, with 84.92 and 61.22% positive (PPV and negative (NPV predictive values, respectively. Concerning bacilloscopy of histological sections (BI/H, the sensitivity was 80.15% and the PPV and NPV were 80.15 and 44.44%, respectively. The concordance between qPCR and BI/H was 87.30%. Regarding the slit skin smear, 84% of the samples tested positive in the qPCR. Additionally, qPCR showed 100% specificity, since all samples from different mycobacteria, from healthy individuals, and from other granulomatous diseases presented negative results. In conclusion, the qPCR technique for detection of M. leprae using RLEP primers proved to be specific and sensitive, and qPCR can be used as a complementary test to diagnose leprosy irrespective of the clinical form of disease.

  14. qPCR detection of Mycobacterium leprae in biopsies and slit skin smear of different leprosy clinical forms.

    Science.gov (United States)

    Azevedo, Michelle de Campos Soriani; Ramuno, Natália Mortari; Fachin, Luciana Raquel Vincenzi; Tassa, Mônica; Rosa, Patrícia Sammarco; Belone, Andrea de Faria Fernandes; Diório, Suzana Madeira; Soares, Cleverson Teixeira; Garlet, Gustavo Pompermaier; Trombone, Ana Paula Favaro

    Leprosy, whose etiological agent is Mycobacterium leprae, is a chronic infectious disease that mainly affects the skin and peripheral nervous system. The diagnosis of leprosy is based on clinical evaluation, whereas histopathological analysis and bacilloscopy are complementary diagnostic tools. Quantitative PCR (qPCR), a current useful tool for diagnosis of infectious diseases, has been used to detect several pathogens including Mycobacterium leprae. The validation of this technique in a robust set of samples comprising the different clinical forms of leprosy is still necessary. Thus, in this study samples from 126 skin biopsies (collected from patients on all clinical forms and reactional states of leprosy) and 25 slit skin smear of leprosy patients were comparatively analyzed by qPCR (performed with primers for the RLEP region of M. leprae DNA) and routine bacilloscopy performed in histological sections or in slit skin smear. Considering clinical diagnostic as the gold standard, 84.9% of the leprosy patients were qPCR positive in skin biopsies, resulting in 84.92% sensitivity, with 84.92 and 61.22% positive (PPV) and negative (NPV) predictive values, respectively. Concerning bacilloscopy of histological sections (BI/H), the sensitivity was 80.15% and the PPV and NPV were 80.15 and 44.44%, respectively. The concordance between qPCR and BI/H was 87.30%. Regarding the slit skin smear, 84% of the samples tested positive in the qPCR. Additionally, qPCR showed 100% specificity, since all samples from different mycobacteria, from healthy individuals, and from other granulomatous diseases presented negative results. In conclusion, the qPCR technique for detection of M. leprae using RLEP primers proved to be specific and sensitive, and qPCR can be used as a complementary test to diagnose leprosy irrespective of the clinical form of disease. Copyright © 2016 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

  15. Performance of automated multiplex PCR using sonication fluid for diagnosis of periprosthetic joint infection: a prospective cohort.

    Science.gov (United States)

    Renz, Nora; Feihl, Susanne; Cabric, Sabrina; Trampuz, Andrej

    2017-12-01

    Sonication of explanted prostheses improved the microbiological diagnosis of periprosthetic joint infections (PJI). We evaluated the performance of automated multiplex polymerase chain reaction (PCR) using sonication fluid for the microbiological diagnosis of PJI. In a prospective cohort using uniform definition criteria for PJI, explanted joint prostheses were investigated by sonication and the resulting sonication fluid was analyzed by culture and multiplex PCR. McNemar's Chi-squared test was used to compare the performance of diagnostic tests. Among 111 patients, PJI was diagnosed in 78 (70%) and aseptic failure in 33 (30%). For the diagnosis of PJI, the sensitivity and specificity of periprosthetic tissue culture was 51 and 100%, of sonication fluid culture 58 and 100%, and of sonication fluid PCR 51 and 94%, respectively. Among 70 microorganisms, periprosthetic tissue culture grew 52 (74%), sonication fluid culture grew 50 (71%) and sonication fluid PCR detected 37 pathogens (53%). If only organisms are considered, for which primers are included in the test panel, PCR detected 37 of 58 pathogens (64%). The sonication fluid PCR missed 19 pathogens (predominantly oral streptococci and anaerobes), whereas 7 additional microorganisms were detected only by PCR (including Cutibacterium spp. and coagulase-negative staphylococci). The performance of multiplex PCR using sonication fluid is comparable to culture of periprosthetic tissue or sonication fluid. The advantages of PCR are short processing time (PCR, especially of low-virulent organisms.

  16. Impact of helminth diagnostic test performance on estimation of risk factors and outcomes in HIV-positive adults.

    Directory of Open Access Journals (Sweden)

    Michael B Arndt

    Full Text Available BACKGROUND: Traditional methods using microscopy for the detection of helminth infections have limited sensitivity. Polymerase chain reaction (PCR assays enhance detection of helminths, particularly low burden infections. However, differences in test performance may modify the ability to detect associations between helminth infection, risk factors, and sequelae. We compared these associations using microscopy and PCR. METHODS: This cross-sectional study was nested within a randomized clinical trial conducted at 3 sites in Kenya. We performed microscopy and real-time multiplex PCR for the stool detection and quantification of Ascaris lumbricoides, Necator americanus, Ancylostoma duodenale, Strongyloides stercoralis, and Schistosoma species. We utilized regression to evaluate associations between potential risk factors or outcomes and infection as detected by either method. RESULTS: Of 153 HIV-positive adults surveyed, 55(36.0% and 20(13.1% were positive for one or more helminth species by PCR and microscopy, respectively (p<0.001. PCR-detected infections were associated with farming (Prevalence Ratio 1.57, 95% CI: 1.02, 2.40, communal water source (PR 3.80, 95% CI: 1.01, 14.27, and no primary education (PR 1.54, 95% CI: 1.14, 2.33, whereas microscopy-detected infections were not associated with any risk factors under investigation. Microscopy-detected infections were associated with significantly lower hematocrit and hemoglobin (means of -3.56% and -0.77 g/dl and a 48% higher risk of anemia (PR 1.48, 95% CI: 1.17, 1.88 compared to uninfected. Such associations were absent for PCR-detected infections unless infection intensity was considered, Infections diagnosed with either method were associated with increased risk of eosinophilia (PCR PR 2.42, 95% CI: 1.02, 5.76; microscopy PR 2.92, 95% CI: 1.29, 6.60. CONCLUSION: Newer diagnostic methods, including PCR, improve the detection of helminth infections. This heightened sensitivity may improve the

  17. DIFFERENTIATION BETWEEN Staphylococcus aureus, S. intermedius AND S. hyicus USING PHENOTYPICAL TESTS AND PCR

    Directory of Open Access Journals (Sweden)

    E. A. GANDRA

    2009-01-01

    Full Text Available

    The aim of this work was to compare the use of two phenotypical tests (beta-galactosidase and acriflavine sensitivity and PCR for the coa and nuc gene sequences, for the identification of three species of coagulase positive staphylococcus (CPS: S. aureus, S. intermedius and S. hyicus. Sixty five staphylococcus isolates, previously characterized as CPS through the coagulase, thermonuclease and catalase production tests and Gram staining, were identified at species level using the beta-galactosidase production tests and sensitivity to acriflavine (7 g.mL-1. At the same time, the DNA of these isolates was extracted and amplified by PCR, using primers for the coa gene, specific for S. aureus, and for the nuc gene, specific for S. intermedius and for S. hyicus. It was possible to differentiate the three species of Staphylococcus through phenotypical tests as well as through the molecular technique. There was no difference in discriminatory power between the two techniques used, but the reproducibility and reliability of the technique based on PCR make this technique more precise.

  18. Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

    International Nuclear Information System (INIS)

    Zhu Hanneng; Chen Wenying; Xiong Sidong

    2000-01-01

    Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

  19. Reporting Diagnostic Scores in Educational Testing: Temptations, Pitfalls, and Some Solutions

    Science.gov (United States)

    Sinharay, Sandip; Puhan, Gautam; Haberman, Shelby J.

    2010-01-01

    Diagnostic scores are of increasing interest in educational testing due to their potential remedial and instructional benefit. Naturally, the number of educational tests that report diagnostic scores is on the rise, as are the number of research publications on such scores. This article provides a critical evaluation of diagnostic score reporting…

  20. A Real-Time PCR Detection of Genus Salmonella in Meat and Milk Samples

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-05-01

    Full Text Available The aim of this study was follow the contamination of ready to eat milk and meat products with Salmonella spp. by using the Step One real-time PCR. Classical microbiological methods for detection of food-borne bacteria involve the use of pre-enrichment and/or specific enrichment, followed by the isolation of the bacteria in solid media and a final confirmation by biochemical and/or serological tests. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In the investigated samples without incubation we could detect strain of Salmonella sp. in five out of twenty three samples (swabs. This Step One real-time PCR assay is extremely useful for any laboratory in possession of a real-time PCR. It is a fast, reproducible, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future. Our results indicated that the Step One real-time PCR assay developed in this study could sensitively detect Salmonella spp. in ready to eat food.

  1. Rapid, sensitive and effective diagnostic tools for foot-and-mouth disease virus in Africa

    Directory of Open Access Journals (Sweden)

    Christopher J. Kasanga

    2014-04-01

    Full Text Available Speed is paramount in the diagnosis of highly infectious diseases, such as foot-and-mouth disease (FMD, as well as for emerging diseases; however, simplicity is required if a test is to be deployed in the field. Recent developments in molecular biology have enabled the specific detection of FMD virus (FMDV by reverse-transcription loop-mediated isothermal amplification (RT-LAMP, real-time  reverse-transcription polymerase chain reaction (RT-qPCR and sequencing. RT-LAMP enables amplification of the FMDV RNA-dependent RNA polymerase 3D(pol gene at 63 °C (in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase for 1 h, whilst RT-qPCR amplifies the same gene in approximately 2 h 30 min. In this study, we compared the sensitivity and effectiveness of RT-LAMP against RT-qPCR for the detection of the FMDV 3D(pol gene in 179 oesophageal-pharyngeal scraping samples (collected by probang obtained from clinically healthy cattle and buffalo in Malawi, Mozambique and Tanzania in 2010. The FMDV detection rate was higher with RT-LAMP (30.2%; n = 54 than with RT-qPCR (17.3%; n = 31. All samples positive by RT-qPCR (Cq ≤ 32.0 were also positive for the RT-LAMP assay; and both assays proved to be highly specific for the FMDV target sequence. In addition, the VP1 sequences of 10 viruses isolated from positive samples corresponded to the respective FMDV serotypes and genotypes. Our findings indicate that the performance of RT-LAMP is superior to RT-qPCR. Accordingly, we consider this test to have great potential with regard to the specific detection and surveillance of infectious diseases of humans and animals in resource-compromised developing countries.

  2. Automation of diagnostic genetic testing: mutation detection by cyclic minisequencing.

    Science.gov (United States)

    Alagrund, Katariina; Orpana, Arto K

    2014-01-01

    The rising role of nucleic acid testing in clinical decision making is creating a need for efficient and automated diagnostic nucleic acid test platforms. Clinical use of nucleic acid testing sets demands for shorter turnaround times (TATs), lower production costs and robust, reliable methods that can easily adopt new test panels and is able to run rare tests in random access principle. Here we present a novel home-brew laboratory automation platform for diagnostic mutation testing. This platform is based on the cyclic minisequecing (cMS) and two color near-infrared (NIR) detection. Pipetting is automated using Tecan Freedom EVO pipetting robots and all assays are performed in 384-well micro plate format. The automation platform includes a data processing system, controlling all procedures, and automated patient result reporting to the hospital information system. We have found automated cMS a reliable, inexpensive and robust method for nucleic acid testing for a wide variety of diagnostic tests. The platform is currently in clinical use for over 80 mutations or polymorphisms. Additionally to tests performed from blood samples, the system performs also epigenetic test for the methylation of the MGMT gene promoter, and companion diagnostic tests for analysis of KRAS and BRAF gene mutations from formalin fixed and paraffin embedded tumor samples. Automation of genetic test reporting is found reliable and efficient decreasing the work load of academic personnel.

  3. A web-based test of residents' skills in diagnostic radiology

    International Nuclear Information System (INIS)

    Finlay, K.; Norman, G.R.; Keane, D.R.; Stolberg, H.

    2006-01-01

    To develop an objective, Web-based tool for evaluating residents' knowledge of diagnostic radiology. We developed and tested a Web-based evaluation tool (the Diagnostic Radiology Skills Test) that consists of 3 tests, one in each of 3 domains of diagnostic radiology: chest, gastrointestinal, and musculoskeletal imaging. Each test comprises 30 cases representing a range of difficulty in the domain, including normal states, normal variants, typical cases of common diagnoses, and cases with more subtle findings. Cases are presented with a long menu of domain-specific possible diagnoses (response options), each coded for diagnostic appropriateness. Our subjects were 21 residents in postgraduate year (PGY) 2 to 5 and 11 experts in diagnostic radiology. Subjects accessed the tool via a Web site on our Web server. Residents test results were compared for reliability and validity across domain, case, and training level. In addition, results were correlated with commonly used established and objective evaluation tools. The tool demonstrated consistent monotonic improvement in performance with training level. It showed acceptable reliability in discriminating between residents at different performance levels, both within and across training levels (r = 0.53 within level and 0.69 across levels). Test results also had concurrent validity against the American College of Radiology In-Training Examination, a widely accepted objective assessment tool (r = 0.65, P < 0.01), and 2 Objective Structured Clinical Examinations (OSCEs) focusing on diagnostic skills (r = 0.78 and r 0.69, P < 0.01, respectively). Our study demonstrates the feasibility of a Web-based, standardized, objective assessment method for evaluating residents' performance. (author)

  4. Predictors of Inappropriate Use of Diagnostic Tests and Management of Bronchiolitis

    Science.gov (United States)

    Sarmiento, Lorena; Rojas-Soto, Gladys E.

    2017-01-01

    Background The aim of the present study was to determine predictors of inappropriate use of diagnostic tests and management of bronchiolitis in a population of hospitalized infants. Methods In an analytical cross-sectional study, we determined independent predictors of the inappropriate use of diagnostic tests and management of bronchiolitis in a population of hospitalized infants. We defined a composite outcome score as the main outcome variable. Results Of the 303 included patients, 216 (71.3%) experienced an inappropriate use of diagnostic tests and treatment of bronchiolitis. After controlling for potential confounders, it was found that atopic dermatitis (OR 5.30; CI 95% 1.14–24.79; p = 0.034), length of hospital stay (OR 1.48; CI 95% 1.08–2.03; p = 0.015), and the number of siblings (OR 1.92; CI 95% 1.13–3.26; p = 0.015) were independent predictors of an inappropriate use of diagnostic tests and treatment of the disease. Conclusions Inappropriate use of diagnostic tests and treatment of bronchiolitis was a highly prevalent outcome in our population of study. Participants with atopic dermatitis, a longer hospital stay, and a greater number of siblings were at increased risk for inappropriate use of diagnostic tests and management of the disease. PMID:28758127

  5. PCR based diagnostic assay targeting the beta tubulin gene for the detection of Trichomonas vaginalis infection in vaginal swab samples of symptomatic and asymptomatic women in India

    Directory of Open Access Journals (Sweden)

    Surya Prakash Dwivedi

    2012-10-01

    Full Text Available Objective: To develop an in-house PCR based diagnostic assay for identification of strains isolated from symptomatic and asymptomatic subjects of India, targeting the 毬 -tubulin gene using specific primers. Methods: In the present study a primer set is designed to target a well-conserved region in the beta-tubulin gene of Trichomonas vaginalis (T. vaginalis. All strains of T. vaginalis were tested and successfully detected by PCR yielding a single predicted product of 198 bp in gel electrophoresis, while there was negative response with DNA from Giardia lamblia, Toxoplasma gondii, Leishmania donovani and Entamoeba histolytica. The sensitivity and specificity for a single T. vaginalis cell per PCR was achieved. Axenic Culture, performed with long term axenized T. vaginalis culture system, was routinely examined to identify T. vaginalis. Results: The PCR based investigations with 498 vaginal swab samples from women attending OPD clinics of Halberg Hospital Moradabad and Queen Mary ’s Hospital, Lucknow, India and 17 long term axenic cultures maintained at PGIMER, Chandigarh, India using primer set BTUB 1 & BTUB 2 showed sensitivity and specificity response of 98% and 100%, respectively, while wet preparation in clinically isolated samples responded up to 62.5%. The PCR product sequencing result of symptomatic strains (SS1 of T. vaginalis (744 bp long was submitted to NCBI (Accession No: JF513200. It shows maximum identity 98 % with XM_001284521 Trichomonas vaginalis G-3 beta-tubulin (btub putative partial mRNA. Conclusions: The data gathered in the present study entail that the diagnosis of T. vaginalis infection by PCR may be established as a sensitive and specific protocol, to be incorporated into a joint strategy for the screening of multiple STDs by employing molecular amplification technique. The merits and precautions of the protocol have been discussed.

  6. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  7. Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-10-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  8. Development of real-time PCR tests for the detection of Tenebrio molitor in food and feed.

    Science.gov (United States)

    Debode, Frédéric; Marien, Aline; Gérard, Amaury; Francis, Frédéric; Fumière, Olivier; Berben, Gilbert

    2017-08-01

    Insects are rich in proteins and could be an alternative source of proteins to feed animals and humans. Numerous companies have started the production of insects for feed purposes. In Europe, these processed animal proteins are not yet authorised by legislation as many questions still need to be answered concerning this 'novel food'. Authorisations will be possible when methods of authentication of the products are available. In this study we propose real-time PCR methods for the specific detection of the mealworm (Tenebriomolitor), one of the most widely used insects for food and feed production. Two PCR assays are proposed: the first based on the wingless gene and the second based on the cadherin gene. The PCR tests amplify fragments of 87 bp. These qualitative methods were tested according to several performance criteria. The specificity was tested on 34 insect species' DNA, but also on non-insect species including crustacean, mammals, birds and plants. The limit of detection was determined and was below 20 copies for the two PCR tests. The applicability of the tests was demonstrated by the analysis of real-life processed samples containing T. molitor.

  9. Culture-independent identification and quantification of Gallibacterium anatis (G. anatis) by real-time quantitative PCR

    DEFF Research Database (Denmark)

    Wang, Chong; Robles, Francisco; Ramirez, Saul

    2016-01-01

    Gallibacterium is a genus within the family Pasteurellaceae characterized by a high level of phenotypic and genetic diversity. No diagnostic method has yet been described, which allows species-specific identification of Gallibacterium anatis. The aim of this study was to develop a real...... published conventional PCR method and culture-based identification, respectively. The detection rates were 97%, 78% and 34% for the current qPCR, the conventional PCR and the culture-based identification method, respectively. The qPCR assay was able to detect the gene gyrB in serial dilutions of 10......-time quantitative PCR (qPCR) method allowing species-specific identification and quantification of G. anatis. A G. anatis specific DNA sequence was identified in the gyrase subunit B gene (gyrB) and used to design a TaqMan probe and corresponding primers. The specificity of the assay was tested on 52 bacterial...

  10. Optimal Combinations of Diagnostic Tests Based on AUC.

    Science.gov (United States)

    Huang, Xin; Qin, Gengsheng; Fang, Yixin

    2011-06-01

    When several diagnostic tests are available, one can combine them to achieve better diagnostic accuracy. This article considers the optimal linear combination that maximizes the area under the receiver operating characteristic curve (AUC); the estimates of the combination's coefficients can be obtained via a nonparametric procedure. However, for estimating the AUC associated with the estimated coefficients, the apparent estimation by re-substitution is too optimistic. To adjust for the upward bias, several methods are proposed. Among them the cross-validation approach is especially advocated, and an approximated cross-validation is developed to reduce the computational cost. Furthermore, these proposed methods can be applied for variable selection to select important diagnostic tests. The proposed methods are examined through simulation studies and applications to three real examples. © 2010, The International Biometric Society.

  11. A Review of Conventional PCR Assays for the Detection of Selected Phytopathogens of Wheat.

    Science.gov (United States)

    Kuzdraliński, Adam; Kot, Anna; Szczerba, Hubert; Nowak, Michał; Muszyńska, Marta

    2017-01-01

    Infection of phyllosphere (stems, leaves, husks, and grains) by pathogenic fungi reduces the wheat yield and grain quality. Detection of the main wheat pathogenic fungi provides information about species composition and allows effective and targeted plant treatment. Since conventional procedures for the detection of these organisms are unreliable and time consuming, diagnostic DNA-based methods are required. Nucleic acid amplification technologies are independent of the morphological and biochemical characteristics of fungi. Microorganisms do not need to be cultured. Therefore, a number of PCR-based methodologies have been developed for the identification of key pathogenic fungi, such as Fusarium spp., Puccinia spp., Zymoseptoria tritici, Parastagonospora nodorum, Blumeria graminis f. sp. tritici, and Pyrenophora tritici-repentis. This article reviews frequently used DNA regions for fungus identification and discusses already known PCR assays for detection of the aforementioned wheat pathogens. We demonstrate that PCR-based wheat pathogen identification assays require further research. In particular, the number of diagnostic tests for Fusarium graminearum, Puccinia spp., and P. tritici-repentis are insufficient. © 2017 S. Karger AG, Basel.

  12. Improving prescribing practices with rapid diagnostic tests (RDTs)

    DEFF Research Database (Denmark)

    Burchett, Helen E D; Leurent, Baptiste; Baiden, Frank

    2017-01-01

    OBJECTIVES: The overuse of antimalarial drugs is widespread. Effective methods to improve prescribing practice remain unclear. We evaluated the impact of 10 interventions that introduced rapid diagnostic tests for malaria (mRDTs) on the use of tests and adherence to results in different contexts...... packages, supervision, supplies and community sensitisation. OUTCOME MEASURES: Analysis explored variation in: (1) uptake of mRDTs (% febrile patients tested); (2) provider adherence to positive mRDTs (% Plasmodium falciparum positive prescribed/given Artemisinin Combination Treatment); (3) provider...... characteristics fitted with their own priorities. Goodness of fit of mRDTs with existing consultation and diagnostic practices appeared crucial to maximising the impact of mRDTs on care, as did prior familiarity with malaria testing; adequate human resources and supplies; possible alternative treatments for m...

  13. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    OpenAIRE

    Kang, Xiao-ping; Jiang, Tao; Li, Yong-qiang; Lin, Fang; Liu, Hong; Chang, Guo-hui; Zhu, Qing-yu; Qin, E-de; Qin, Cheng-feng; Yang, Yin-hui

    2010-01-01

    Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009) influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose) for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same a...

  14. Reverse transcriptase inhibitors as potential colorectal microbicides.

    Science.gov (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J

    2009-05-01

    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.

  15. Design of primers for pertussis diagnosis by Real Time PCR and determination of its sensitivity and specificity in comparison with commercial kits.

    Directory of Open Access Journals (Sweden)

    Hamidreza Monavari

    2013-12-01

    Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.

  16. Evaluation of a novel real-time PCR test based on the ssrA gene for the identification of group B streptococci in vaginal swabs.

    LENUS (Irish Health Repository)

    Wernecke, Martina

    2009-01-01

    BACKGROUND: Despite the implementation of prevention guidelines, early-onset group B streptococci (GBS) disease remains a cause of neonatal morbidity and mortality worldwide. Strategies to identify women who are at risk of transmitting GBS to their infant and the administration of intrapartum antibiotics have greatly reduced the incidence of neonatal GBS disease. However, there is a requirement for a rapid diagnostic test for GBS that can be carried out in a labour ward setting especially for women whose GBS colonisation status is unknown at the time of delivery. We report the design and evaluation of a real-time PCR test (RiboSEQ GBS test) for the identification of GBS in vaginal swabs from pregnant women. METHODS: The qualitative real-time PCR RiboSEQ GBS test was designed based on the bacterial ssrA gene and incorporates a competitive internal standard control. The analytical sensitivity of the test was established using crude lysate extracted from serial dilutions of overnight GBS culture using the IDI Lysis kit. Specificity studies were performed using DNA prepared from a panel of GBS strains, related streptococci and other species found in the genital tract environment. The RiboSEQ GBS test was evaluated on 159 vaginal swabs from pregnant women and compared with the GeneOhm StrepB Assay and culture for the identification of GBS. RESULTS: The RiboSEQ GBS test is specific and has an analytical sensitivity of 1-10 cell equivalents. The RiboSEQ GBS test was 96.4% sensitive and 95.8% specific compared to "gold standard" culture for the identification of GBS in vaginal swabs from pregnant women. In this study, the RiboSEQ GBS test performed slightly better than the commercial BD GeneOhm StrepB Assay which gave a sensitivity of 94.6% and a specificity of 89.6% compared to culture. CONCLUSION: The RiboSEQ GBS test is a valuable method for the rapid, sensitive and specific detection of GBS in pregnant women. This study also validates the ssrA gene as a suitable and

  17. Subtyping of swine influenza viruses using a high-throughput real time PCR platform

    DEFF Research Database (Denmark)

    Goecke, Nicole Bakkegård; Krog, Jesper Schak; Hjulsager, Charlotte Kristiane

    ). The results revealed that the performance of the dynamic chip was similar to conventional real time analysis. Discussion and conclusion. Application of the chip for subtyping of swine influenza has resulted in a significant reduction in time, cost and working hours. Thereby, it is possible to offer diagnostic...... test and subsequent subtyping is performed by real time RT-PCR (RT-qPCR) but several assays are needed to cover the wide range of circulating subtypes which is expensive,resource and time demanding. To mitigate these restrictions the high-throughput qPCR platform BioMark (Fluidigm) has been explored...... services with reduced price and turnover time which will facilitate choice of vaccines and by that lead to reduction of antibiotic used....

  18. Non-Culture Diagnostics for Invasive Candidiasis: Promise and Unintended Consequences

    Directory of Open Access Journals (Sweden)

    Cornelius J. Clancy

    2018-02-01

    Full Text Available Blood cultures are positive for Candida species in < 50% and < 20% of hematogenously disseminated and intra-abdominal candidiasis, respectively. Non-culture tests such as mannan, anti-mannan antibody, Candida albicans germ tube antibody (CAGTA, 1,3-β-d-glucan (BDG, the T2Candida nanodiagnostic panel, and polymerase chain reaction (PCR are available for clinical use, but their roles in patient care are uncertain. Sensitivity/specificity of combined mannan/anti-mannan, BDG, T2Candida and PCR for candidemia are ~80%/80%, ~80%/80%, ~90%/98%, and ~90%/90%, respectively. Limited data for intra-abdominal candidiasis suggest CAGTA, BDG sensitivity/specificity of ~65%/75% and PCR sensitivity of ~85–90%. PCR specificity has varied widely for intra-abdominal candidiasis (33–97%, and T2Candida data are lacking. Tests will be useful if restricted to cases in which positive and negative predictive values (PPVs, NPVs differ in a clinically meaningful way from the pre-test likelihood of invasive candidiasis. In some patients, PPVs are sufficient to justify antifungal treatment, even if blood cultures are negative. In most patients, NPVs of each test are excellent, which may support decisions to withhold antifungal therapy. If test results are not interpreted judiciously, non-culture diagnostics may have unintended consequences for stewardship and infection prevention programs. In particular, discrepant non-culture test-positive/culture-negative results may promote inappropriate antifungal treatment of patients who are unlikely to have candidiasis, and lead to spurious reporting of hospital-acquired infections. In conclusion, non-culture Candida diagnostics have potential to advance patient care, but this promise will be realized only if users understand tests’ strengths and limitations, and plan proactively for how best to employ them at their hospitals.

  19. Drug sensitivity testing platforms for gastric cancer diagnostics.

    Science.gov (United States)

    Lau, Vianne; Wong, Andrea Li-Ann; Ng, Christopher; Mok, Yingting; Lakshmanan, Manikandan; Yan, Benedict

    2016-02-01

    Gastric cancer diagnostics has traditionally been histomorphological and primarily the domain of surgical pathologists. Although there is an increasing usage of molecular and genomic techniques for clinical diagnostics, there is an emerging field of personalised drug sensitivity testing. In this review, we describe the various personalised drug sensitivity testing platforms and discuss the challenges facing clinical adoption of these assays for gastric cancer. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  20. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis.

    Science.gov (United States)

    Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin

    2017-08-02

    Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.

  1. Diagnostic PCR: Comparative sensitivity of four probe chemistries

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Löfström, Charlotta; Sommer, Helle Mølgaard

    2009-01-01

    Three probe chemistries: locked nucleic acid (LNA), minor groove binder (MGB) and Scorpion were compared with a TaqMan probe in a validated real-time PCR assay for detection of food-borne thermotolerant Campylobacter. The LNA probe produced significantly lower Ct-values and a higher proportion of...

  2. No gold standard estimation of the sensitivity and specificity of two molecular diagnostic protocols for Trypanosoma brucei spp. in Western Kenya.

    Directory of Open Access Journals (Sweden)

    Barend Mark de Clare Bronsvoort

    2010-01-01

    Full Text Available African animal trypanosomiasis is caused by a range of tsetse transmitted protozoan parasites includingTrypanosoma vivax, Trypanosoma congolense and Trypansoma brucei. In Western Kenya and other parts of East Africa two subspecies of T. brucei, T.b. brucei and the zoonoticT.b. rhodesiense, co-circulate in livestock. A range of polymerase chain reactions (PCR have been developed as important molecular diagnostic tools for epidemiological investigations of T. brucei s.l. in the animal reservoir and of its zoonotic potential. Quantification of the relative performance of different diagnostic PCRs is essential to ensure comparability of studies. This paper describes an evaluation of two diagnostic test systems for T. brucei using a T. brucei s.l. specific PCR [1] and a single nested PCR targeting the Internal Transcribed Spacer (ITS regions of trypanosome ribosomal DNA [2]. A Bayesian formulation of the Hui-Walter latent class model was employed to estimate their test performance in the absence of a gold standard test for detecting T.brucei s.l. infections in ear-vein blood samples from cattle, pig, sheep and goat populations in Western Kenya, stored on Whatman FTA cards. The results indicate that the system employing the T. brucei s.l. specific PCR (Se1=0.760 had a higher sensitivity than the ITS-PCR (Se2=0.640; both have high specificity (Sp1=0.998; Sp2=0.997. The true prevalences for livestock populations were estimated (pcattle=0.091, ppigs=0.066, pgoats=0.005, psheep=0.006, taking into account the uncertainties in the specificity and sensitivity of the two test systems. Implications of test performance include the required survey sample size; due to its higher sensitivity and specificity, the T. brucei s.l. specific PCR requires a consistently smaller sample size than the ITS-PCR for the detection of T. brucei s.l. However the ITS-PCR is able to simultaneously screen samples for other pathogenic trypanosomes and may thus be, overall, a better

  3. A MIQE-compliant real-time PCR assay for Aspergillus detection.

    Directory of Open Access Journals (Sweden)

    Gemma L Johnson

    Full Text Available The polymerase chain reaction (PCR is widely used as a diagnostic tool in clinical laboratories and is particularly effective for detecting and identifying infectious agents for which routine culture and microscopy methods are inadequate. Invasive fungal disease (IFD is a major cause of morbidity and mortality in immunosuppressed patients, and optimal diagnostic criteria are contentious. Although PCR-based methods have long been used for the diagnosis of invasive aspergillosis (IA, variable performance in clinical practice has limited their value. This shortcoming is a consequence of differing sample selection, collection and preparation protocols coupled with a lack of standardisation of the PCR itself. Furthermore, it has become clear that the performance of PCR-based assays in general is compromised by the inadequacy of experimental controls, insufficient optimisation of assay performance as well as lack of transparency in reporting experimental details. The recently published "Minimum Information for the publication of real-time Quantitative PCR Experiments" (MIQE guidelines provide a blueprint for good PCR assay design and unambiguous reporting of experimental detail and results. We report the first real-time quantitative PCR (qPCR assay targeting Aspergillus species that has been designed, optimised and validated in strict compliance with the MIQE guidelines. The hydrolysis probe-based assay, designed to target the 18S rRNA DNA sequence of Aspergillus species, has an efficiency of 100% (range 95-107%, a dynamic range of at least six orders of magnitude and limits of quantification and detection of 6 and 0.6 Aspergillus fumigatus genomes, respectively. It does not amplify Candida, Scedosporium, Fusarium or Rhizopus species and its clinical sensitivity is demonstrated in histological material from proven IA cases, as well as concordant PCR and galactomannan data in matched broncho-alveolar lavage and blood samples. The robustness

  4. Rapid and sensitive multiplex single-tube nested PCR for the identification of five human Plasmodium species.

    Science.gov (United States)

    Saito, Takahiro; Kikuchi, Aoi; Kaneko, Akira; Isozumi, Rie; Teramoto, Isao; Kimura, Masatsugu; Hirasawa, Noriyasu; Hiratsuka, Masahiro

    2018-06-01

    Malaria is caused by five species of Plasmodium in humans. Microscopy is currently used for pathogen detection, requiring considerable training and technical expertise as the parasites are often difficult to differentiate morphologically. Rapid diagnostic tests are as reliable as microscopy and offer faster diagnoses but possess lower detection limits and are incapable of distinguishing among the parasitic species. To improve global health efforts towards malaria control, a rapid, sensitive, species-specific, and economically viable diagnostic method is needed. In this study, we designed a malaria diagnostic method involving a multiplex single-tube nested PCR targeting Plasmodium mitochondrial cytochrome c oxidase III and single-stranded tag hybridization chromatographic printed-array strip. The detection sensitivity was found to be at least 40 times higher than that of agarose gel electrophoresis with ethidium bromide. This system also enables the identification of both single- and mixed-species malaria infections. The assay was validated with 152 Kenyan samples; using nested PCR as the standard, the assay's sensitivity and specificity were 88.7% and 100.0%, respectively. The turnaround time required, from PCR preparation to signal detection, is 90min. Our method should improve the diagnostic speed, treatment efficacy, and control of malaria, in addition to facilitating surveillance within global malaria eradication programs. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Measurement of Gene Expression in Archival Paraffin-Embedded Tissues

    Science.gov (United States)

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C.; Shak, Steven; Kiefer, Michael C.; Esteban, Jose M.; Baker, Joffre B.

    2004-01-01

    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10-μm FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests. PMID:14695316

  6. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Science.gov (United States)

    Santiago, Gilberto A; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L

    2013-01-01

    Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1-4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  7. Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay

    Directory of Open Access Journals (Sweden)

    Khandaker Shadia

    2012-01-01

    Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11

  8. Nonparametric predictive inference for combining diagnostic tests with parametric copula

    Science.gov (United States)

    Muhammad, Noryanti; Coolen, F. P. A.; Coolen-Maturi, T.

    2017-09-01

    Measuring the accuracy of diagnostic tests is crucial in many application areas including medicine and health care. The Receiver Operating Characteristic (ROC) curve is a popular statistical tool for describing the performance of diagnostic tests. The area under the ROC curve (AUC) is often used as a measure of the overall performance of the diagnostic test. In this paper, we interest in developing strategies for combining test results in order to increase the diagnostic accuracy. We introduce nonparametric predictive inference (NPI) for combining two diagnostic test results with considering dependence structure using parametric copula. NPI is a frequentist statistical framework for inference on a future observation based on past data observations. NPI uses lower and upper probabilities to quantify uncertainty and is based on only a few modelling assumptions. While copula is a well-known statistical concept for modelling dependence of random variables. A copula is a joint distribution function whose marginals are all uniformly distributed and it can be used to model the dependence separately from the marginal distributions. In this research, we estimate the copula density using a parametric method which is maximum likelihood estimator (MLE). We investigate the performance of this proposed method via data sets from the literature and discuss results to show how our method performs for different family of copulas. Finally, we briefly outline related challenges and opportunities for future research.

  9. Laboratory diagnostics of malaria

    Science.gov (United States)

    Siahaan, L.

    2018-03-01

    Even now, malaria treatment should only be administered after laboratory confirmation. There are several principal methods for diagnosing malaria. All these methods have their disadvantages.Presumptive treatment of malaria is widely practiced where laboratory tests are not readily available. Microscopy of Giemsa-stained thick and thin blood films remains the gold standard for the diagnosis of malaria infection. The technique of slide preparation, staining and reading are well known and standardized, and so is the estimate of the parasite density and parasite stages. Microscopy is not always available or feasible at primary health services in limited resource settings due to cost, lack of skilled manpower, accessories and reagents required. Rapid diagnostic tests (RDTs) are potential tools for parasite-based diagnosis since the tests are accurate in detecting malaria infections and are easy to use. The test is based on the capture of parasite antigen that released from parasitized red blood cells using monoclonal antibodies prepared against malaria antigen target. Polymerase Chain Reaction (PCR), depend on DNA amplification approaches and have higher sensitivity than microscopy. PCR it is not widely used due to the lack of a standardized methodology, high costs, and the need for highly-trained staff.

  10. ITER diagnostics: Maintenance and commissioning in the hot cell test bed

    International Nuclear Information System (INIS)

    Walker, C.I.; Barnsley, R.; Costley, A.E.; Gottfried, R.; Haist, B.; Itami, K.; Kondoh, T.; Loesser, G.D.; Palmer, J.; Sugie, T.; Tesini, A.; Vayakis, G.

    2005-01-01

    In-vessel diagnostic equipment in ITER integrated in six equatorial and 12 upper ports, 16 divertor cassettes and five lower ports is designed to be removed in modules and then repaired, tested and commissioned in the same location at the ITER hot cell. The repair requirements and tests on these components are described along with design features that facilitate repair. The testing establishes the repair strategy, qualifies the refurbishment work and finally checks the mechanical and diagnostic function before the return of the modules. At the hot cell, a dummy port is provided for tests of mechanical and vacuum integrity as well as commissioning of the diagnostic equipment. The scope of the hot cell maintenance and commissioning activities is summarised and an overview of the integration of the diagnostic equipment is given

  11. Diagnosis of Dengue Infection Using Conventional and Biosensor Based Techniques

    Science.gov (United States)

    Parkash, Om; Hanim Shueb, Rafidah

    2015-01-01

    Dengue is an arthropod-borne viral disease caused by four antigenically different serotypes of dengue virus. This disease is considered as a major public health concern around the world. Currently, there is no licensed vaccine or antiviral drug available for the prevention and treatment of dengue disease. Moreover, clinical features of dengue are indistinguishable from other infectious diseases such as malaria, chikungunya, rickettsia and leptospira. Therefore, prompt and accurate laboratory diagnostic test is urgently required for disease confirmation and patient triage. The traditional diagnostic techniques for the dengue virus are viral detection in cell culture, serological testing, and RNA amplification using reverse transcriptase PCR. This paper discusses the conventional laboratory methods used for the diagnosis of dengue during the acute and convalescent phase and highlights the advantages and limitations of these routine laboratory tests. Subsequently, the biosensor based assays developed using various transducers for the detection of dengue are also reviewed. PMID:26492265

  12. Sensitive Molecular Diagnostics for Cutaneous Leishmaniasis.

    Science.gov (United States)

    Sagi, Orli; Berkowitz, Anat; Codish, Shlomi; Novack, Victor; Rashti, Aviv; Akad, Fouad; Shemer-Avni, Yonat

    2017-01-01

    Rapid diagnosis of cutaneous leishmaniasis (CL) and identification of Leishmania species is highly important for the disease management. In Israel, CL is caused mainly by Leishmania major and Leishmania tropica species. We established an easy to handle point of care lesion-swabbing, combined with a highly sensitive multiplex real time PCR (multiplex qPCR) for accurate and rapid diagnosis of Leishmania species. Using three probes: one general for: Leishmania species, and two specific for L major , and L tropica , we screened 1783 clinical samples collected during two years. Leishmania species was found in 1086 individuals, 1008 L major , and 70 L tropica . Eight samples positive for Leishmania species only, were further tested using a second set of multiplex qPCR developed, and were found positive for Leishmania braziliensis and Leishmania infantum/donovani (2 and 6 samples, concomitantly). Taken together, the test enabled diagnostics and better treatment of Leishmania infections from the Old World (1078 samples) and the New World (8 samples), and the subtyping of the dominant strains in the region, as well as in returning travelers'.

  13. Same-day PCR testing of Salmonella in meat: from research to routine application at slaughterhouses

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Löfström, Charlotta; Josefsen, Mathilde Hartmann

    2011-01-01

    Development of a rapid PCR technique is described, which enables slaughterhouses to apply same-day testing for Salmonella in carcasses and fresh meat. The technique is based on a shortened pre-enrichment time and 1-h DNA purification using paramagnetic beads (or an easy-to-use boiling method) fol......) followed by Salmonella detection by real-time PCR. Final protocols have been approved for meat testing (fresh meat and carcass swabs) by the Nordval validation organization for Nordic countries....

  14. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

    NARCIS (Netherlands)

    Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.

    2003-01-01

    Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

  15. Multiplex polymerase chain reaction test for the diagnosis of acute viral hepatitis A.

    Science.gov (United States)

    Heo, Nae-Yun; Lim, Young-Suk; An, Jihyun; Ko, Sun-Young; Oh, Heung-Bum

    2012-12-01

    The early diagnosis of acute hepatitis A (AHA) is hindered because serum IgM against hepatitis A virus (HAV) can yield false-negative results during the window period. This study evaluated the diagnostic accuracy of a polymerase chain reaction (PCR) kit for HAV RNA for the diagnosis of AHA. Samples were collected from 136 patients with acute severe hepatitis at their admission to Asan Medical Center between June 2010 and July 2010. Samples were analyzed for serum IgM anti-HAV using an immunoassay test and for qualitative HAV RNA using the Magicplex HepaTrio PCR test kit. The diagnostic accuracies of these methods were tested on the basis of clinical and laboratory diagnoses of AHA. The concordance rate and kappa value between IgM anti-HAV and HAV RNA PCR were 88.2% and 0.707, respectively. For the diagnosis of AHA, the sensitivity and specificity of IgM anti-HAV were 90.7% and 100%, respectively, when an "equivocal" result was regarded as positive; and 79.1% and 100%, respectively, when an "equivocal" result was regarded as negative. The sensitivity and specificity of HAV RNA PCR were 81.4% and 100%, respectively. All four patients with negative IgM anti-HAV and positive HAV RNA PCR results and all four patients with equivocal IgM anti-HAV RNA and positive HAV RNA PCR results were eventually diagnosed with AHA. The qualitative HAV RNA PCR test has an equivalent diagnostic accuracy for AHA compared to IgM anti-HAV and may be more sensitive during the window period.

  16. Diagnostic PCR: validation and sample preparation are two sides of the same coin

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Wolffs, Petra; Radstrøm, Peter

    2004-01-01

    Increased use of powerful PCR technology for the routine detection of pathogens has focused attention on the need for international validation and preparation of official non-commercial guidelines. Bacteria of epidemiological importance should be the prime focus, although a "validation...... of quantitative reference DNA material and reagents, production of stringent protocols and tools for thermal cycler performance testing, uncomplicated sample preparation techniques, and extensive ring trials for assessment of the efficacy of selected matrix/pathogen detection protocols....

  17. Reduction of the use of antimicrobial drugs following the rapid detection of Streptococcus agalactiae in the vagina at delivery by real-time PCR assay.

    Science.gov (United States)

    Poncelet-Jasserand, E; Forges, F; Varlet, M-N; Chauleur, C; Seffert, P; Siani, C; Pozzetto, B; Ros, A

    2013-08-01

    To assess whether the determination of the presence of group B streptococci (GBS) in the vagina using a rapid polymerase chain reaction (PCR) assay at delivery was able to spare useless antimicrobial treatments, as compared with conventional culture at 34-38 weeks of gestation. Practical evaluation and prospective cost-effectiveness analysis. A university hospital in France. A cohort of 225 women in labour at the University-Hospital of Saint-Etienne. Each woman had a conventional culture performed at 34-38 weeks of gestation. At the beginning of labour, two vaginal swabs were sampled for rapid PCR testing and culture. The decision to prescribe a prophylactic antimicrobial treatment or not was taken according to the result of the PCR test. A comparative cost-effectiveness analysis of the two diagnostic strategies was carried out. Number of women receiving inadequate prophylactic antimicrobial drugs following each testing strategy, costs of PCR testing and culture, frequency of vaginal GBS, and diagnostic performance of the PCR test at delivery. The percentage of unnecessarily treated women was significantly reduced using the rapid test versus conventional culture (4.5 and 13.6%, respectively; P < 0.001). The rate of vaginal GBS at delivery was 12.5%. The incremental cost-effectiveness ratio (ICER) for each inadequate management avoided was €36 and €173 from the point of view of the healthcare system and hospital, respectively. The PCR assay reduced the number of inadequate antimicrobial treatments aimed to prevent the early onset of GBS disease. However, this strategy generates extra costs that must be put into balance with its clinical benefits. © 2013 The Authors BJOG An International Journal of Obstetrics and Gynaecology © 2013 RCOG.

  18. Diagnostic reliability of MMPI-2 computer-based test interpretations.

    Science.gov (United States)

    Pant, Hina; McCabe, Brian J; Deskovitz, Mark A; Weed, Nathan C; Williams, John E

    2014-09-01

    Reflecting the common use of the MMPI-2 to provide diagnostic considerations, computer-based test interpretations (CBTIs) also typically offer diagnostic suggestions. However, these diagnostic suggestions can sometimes be shown to vary widely across different CBTI programs even for identical MMPI-2 profiles. The present study evaluated the diagnostic reliability of 6 commercially available CBTIs using a 20-item Q-sort task developed for this study. Four raters each sorted diagnostic classifications based on these 6 CBTI reports for 20 MMPI-2 profiles. Two questions were addressed. First, do users of CBTIs understand the diagnostic information contained within the reports similarly? Overall, diagnostic sorts of the CBTIs showed moderate inter-interpreter diagnostic reliability (mean r = .56), with sorts for the 1/2/3 profile showing the highest inter-interpreter diagnostic reliability (mean r = .67). Second, do different CBTIs programs vary with respect to diagnostic suggestions? It was found that diagnostic sorts of the CBTIs had a mean inter-CBTI diagnostic reliability of r = .56, indicating moderate but not strong agreement across CBTIs in terms of diagnostic suggestions. The strongest inter-CBTI diagnostic agreement was found for sorts of the 1/2/3 profile CBTIs (mean r = .71). Limitations and future directions are discussed. PsycINFO Database Record (c) 2014 APA, all rights reserved.

  19. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Polymeric LabChip real-time PCR as a point-of-care-potential diagnostic tool for rapid detection of influenza A/H1N1 virus in human clinical specimens.

    Directory of Open Access Journals (Sweden)

    Hyun-Ok Song

    Full Text Available It is clinically important to be able to detect influenza A/H1N1 virus using a fast, portable, and accurate system that has high specificity and sensitivity. To achieve this goal, it is necessary to develop a highly specific primer set that recognizes only influenza A viral genes and a rapid real-time PCR system that can detect even a single copy of the viral gene. In this study, we developed and validated a novel fluidic chip-type real-time PCR (LabChip real-time PCR system that is sensitive and specific for the detection of influenza A/H1N1, including the pandemic influenza strain A/H1N1 of 2009. This LabChip real-time PCR system has several remarkable features: (1 It allows rapid quantitative analysis, requiring only 15 min to perform 30 cycles of real-time PCR. (2 It is portable, with a weight of only 5.5 kg. (3 The reaction cost is low, since it uses disposable plastic chips. (4 Its high efficiency is equivalent to that of commercially available tube-type real-time PCR systems. The developed disposable LabChip is an economic, heat-transferable, light-transparent, and easy-to-fabricate polymeric chip compared to conventional silicon- or glass-based labchip. In addition, our LabChip has large surface-to-volume ratios in micro channels that are required for overcoming time consumed for temperature control during real-time PCR. The efficiency of the LabChip real-time PCR system was confirmed using novel primer sets specifically targeted to the hemagglutinin (HA gene of influenza A/H1N1 and clinical specimens. Eighty-five human clinical swab samples were tested using the LabChip real-time PCR. The results demonstrated 100% sensitivity and specificity, showing 72 positive and 13 negative cases. These results were identical to those from a tube-type real-time PCR system. This indicates that the novel LabChip real-time PCR may be an ultra-fast, quantitative, point-of-care-potential diagnostic tool for influenza A/H1N1 with a high sensitivity and

  1. Multiplexed Molecular Assays for Rapid Rule-Out of Foot-and-Mouth Disease

    Energy Technology Data Exchange (ETDEWEB)

    Lenhoff, R; Naraghi-Arani, P; Thissen, J; Olivas, J; Carillo, C; Chinn, C; Rasmussen, M; Messenger, S; Suer, L; Smith, S M; Tammero, L; Vitalis, E; Slezak, T R; Hullinger, P J; Hindson, B J; Hietala, S; Crossley, B; Mcbride, M

    2007-06-26

    A nucleic acid-based multiplexed assay was developed that combines detection of foot-and-mouth disease virus (FMDV) with rule-out assays for two other foreign animal diseases and four domestic animal diseases that cause vesicular or ulcerative lesions indistinguishable from FMDV infection in cattle, sheep and swine. The FMDV 'look-alike' diagnostic assay panel contains five PCR and twelve reverse transcriptase PCR (RT-PCR) signatures for a total of seventeen simultaneous PCR amplifications for seven diseases plus incorporating four internal assay controls. It was developed and optimized to amplify both DNA and RNA viruses simultaneously in a single tube and employs Luminex{trademark} liquid array technology. Assay development including selection of appropriate controls, a comparison of signature performance in single and multiplex testing against target nucleic acids, as well of limits of detection for each of the individual signatures is presented. While this assay is a prototype and by no means a comprehensive test for FMDV 'look-alike' viruses, an assay of this type is envisioned to have benefit to a laboratory network in routine surveillance and possibly for post-outbreak proof of freedom from foot-and-mouth disease.

  2. Comparison between quantitative nucleic acid sequence-based amplification, real-time reverse transcriptase PCR, and real-time PCR for quantification of Leishmania parasites

    NARCIS (Netherlands)

    van der Meide, Wendy; Guerra, Jorge; Schoone, Gerard; Farenhorst, Marit; Coelho, Leila; Faber, William; Peekel, Inge; Schallig, Henk

    2008-01-01

    DNA or RNA amplification methods for detection of Leishmania parasites have advantages regarding sensitivity and potential quantitative characteristics in comparison with conventional diagnostic methods but are often still not routinely applied. However, the use and application of molecular assays

  3. A diagnostic test for apraxia in stroke patients: internal consistency and diagnostic value.

    NARCIS (Netherlands)

    Heugten, C.M. van; Dekker, J.; Deelman, B.G.; Stehmann-Saris, F.C.; Kinebanian, A.

    1999-01-01

    The internal consistency and the diagnostic value of a test for apraxia in patients having had a stroke are presented. Results indicate that the items of the test form a strong and consistent scale: Cronbach's alpha as well as the results of a Mokken scale analysis present good reliability and good

  4. Analysis of the Astronomy Diagnostic Test

    Science.gov (United States)

    Brogt, Erik; Sabers, Darrell; Prather, Edward E.; Deming, Grace L.; Hufnagel, Beth; Slater, Timothy F.

    2007-01-01

    Seventy undergraduate class sections were examined from the database of Astronomy Diagnostic Test (ADT) results of Deming and Hufnagel to determine if course format correlated with ADT normalized gain scores. Normalized gains were calculated for four different classroom scenarios: lecture, lecture with discussion, lecture with lab, and lecture…

  5. Diagnostic development and support of MHD test facilities

    Energy Technology Data Exchange (ETDEWEB)

    1990-01-01

    The Diagnostic Instrumentation and Analysis Laboratory (DIAL) at Mississippi State University (MSU) is developing diagnostic instruments for MHD power train data acquisition and for support of MHD component development test facilities. Microprocessor-controlled optical instruments, initially developed for Heat Recovery/Seed Recovery support, are being refined, and new systems to measure temperatures and gas-seed-slag stream characteristics are being developed. To further data acquisition and analysis capabilities, the diagnostic systems are being interfaced with DIAL's computers. Technical support for the diagnostic needs of the national MHD research effort is being provided. DIAL personnel will also cooperate with government agencies and private industries to improve the transformation of research and development results into processes, products and services applicable to their needs. 25 figs., 6 tabs.

  6. Diagnostic development and support of MHD test facilities

    International Nuclear Information System (INIS)

    Shepard, W.S.; Cook, R.L.

    1990-01-01

    The Diagnostic Instrumentation and Analysis Laboratory (DIAL) at Mississippi State University (MSU) is developing diagnostic instruments for MHD power train data acquisition and for support of MHD component development test facilities. Microprocessor-controlled optical instruments, initially developed for Heat Recovery/ Seed Recovery support, are being refined, and new systems to measure temperatures and gas-seed-slag stream characteristics are being developed. To further data acquisition and analysis capabilities, the diagnostic systems are being interfaced with DIAL's computers. Technical support for the diagnostic needs of the national MHD research effort is being provided. DIAL personnel will also cooperate with government agencies and private industries to improve the transformation of research and development results into processes, products and services applicable to their needs

  7. Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR.

    Science.gov (United States)

    Tatti, Enrico; McKew, Boyd A; Whitby, Corrine; Smith, Cindy J

    2016-06-11

    Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

  8. Estimation of test characteristics of real-time PCR and bacterial culture for diagnosis of subclinical intramammary infections with Streptococcus agalactiae in Danish dairy cattle in 2012 using latent class analysis.

    Science.gov (United States)

    Mahmmod, Yasser S; Toft, Nils; Katholm, Jørgen; Grønbæk, Carsten; Klaas, Ilka C

    2013-05-01

    The misdiagnosis of intramammary infections (IMI) with Streptococcus agalactiae (S. agalactiae) could lead farmers to treat or cull animals unnecessarily. The objective of this field study was to estimate the sensitivity (Se) and specificity (Sp) of real-time PCR at different cut-offs for cycle threshold (Ct) values against bacterial culture (BC) for diagnosis of S. agalactiae IMI using latent class analysis to avoid the assumption of a perfect reference test. A total of 614 dairy cows were randomly selected from 6 herds with bulk tank PCR Ct value ≤ 39 for S. agalactiae and S. aureus. At milk recording, 2456 quarter milk samples were taken aseptically for BC and the routinely taken cow level milk samples were analyzed by PCR. Results showed that 53 cows (8.6%) were positive for S. agalactiae IMI by BC. Sensitivity of PCR at cut-offs; ≤ 39, ≤ 37, ≤ 34, and ≤ 32, was 96.2%, 91.9%, 87.2% and 73.9%, while Se of BC was 25.7%, 29.9%, 59.9% and 72.1%. Specificity of PCR at cut-offs; ≤ 39, ≤ 37, ≤ 34, and ≤ 32, was 96.8%, 96.9%, 96.7%, and 97.22%, while Sp of BC was 99.7%, 99.5%, 99.2%, and 98.9%. The estimated prevalence of S. agalactiae IMI by PCR was higher than the apparent prevalence at the tested cut-offs, indicating under estimation of S. agalactiae IMI in the examined dairy cows. In conclusion, Se of PCR is always higher than Se of BC at all tested cut-offs. The lower cut-off, the more comparable becomes Se of PCR and Se of BC. The changes in Se in both PCR and BC at different Ct-value cut-offs may indicate a change in the definition of the latent infection. The similar Se of both tests at cut-off ≤ 32 may indicate high concentrations of S. agalactiae viable cells, representing a cow truly/heavily infected with S. agalactiae and thus easier to detect with BC. At cut-off ≤ 39 the latent definition of infection may reflect a more general condition of cows being positive for S. agalactiae. Our findings indicate that PCR Ct-value cut-offs should

  9. Comparison of the conventional diagnostic modalities, bactec culture and polymerase chain reaction test for diagnosis of tuberculosis

    Directory of Open Access Journals (Sweden)

    Negi S

    2005-01-01

    Full Text Available PURPOSE: To evaluate the performance of 65 kDa antigen based PCR assay in clinical samples obtained from pulmonary and extrapulmonary cases of tuberculosis. METHODS: One hundred and fifty six samples were processed for detection of Mycobacterium tuberculosis by ZN smear examination, LJ medium culture, BACTEC radiometric culture and PCR tests. RESULTS: A significant difference was seen in the sensitivities of different tests, the figures being 74.4% for PCR test, 33.79% for ZN smear examination, 48.9% for LJ culture and 55.8% for BACTEC culture (P0.05 as far as specificity of different tests was concerned. PCR test sensitivity in pulmonary and extrapulmonary clinical samples were 72.7% and 75.9% respectively and found to be significantly higher (PM.tuberculosis was 24.03 days by LJ medium culture, 12.89 days by BACTEC culture and less than one day by PCR test. CONCLUSIONS: PCR is a rapid and sensitive method for the early diagnosis of pulmonary and extrapulmonary tuberculosis.

  10. 9 CFR 147.8 - Procedures for preparing egg yolk samples for diagnostic tests.

    Science.gov (United States)

    2010-01-01

    ... samples for diagnostic tests. 147.8 Section 147.8 Animals and Animal Products ANIMAL AND PLANT HEALTH... IMPROVEMENT PLAN Blood Testing Procedures § 147.8 Procedures for preparing egg yolk samples for diagnostic... for diagnostic testing. (b) The authorized laboratory must identify each egg as to the breeding flock...

  11. Rapid diagnostic tests for typhoid and paratyphoid (enteric) fever.

    Science.gov (United States)

    Wijedoru, Lalith; Mallett, Sue; Parry, Christopher M

    2017-05-26

    Differentiating both typhoid (Salmonella Typhi) and paratyphoid (Salmonella Paratyphi A) infection from other causes of fever in endemic areas is a diagnostic challenge. Although commercial point-of-care rapid diagnostic tests (RDTs) for enteric fever are available as alternatives to the current reference standard test of blood or bone marrow culture, or to the widely used Widal Test, their diagnostic accuracy is unclear. If accurate, they could potentially replace blood culture as the World Health Organization (WHO)-recommended main diagnostic test for enteric fever. To assess the diagnostic accuracy of commercially available rapid diagnostic tests (RDTs) and prototypes for detecting Salmonella Typhi or Paratyphi A infection in symptomatic persons living in endemic areas. We searched the Cochrane Infectious Diseases Group Specialized Register, MEDLINE, Embase, Science Citation Index, IndMED, African Index Medicus, LILACS, ClinicalTrials.gov, and the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) up to 4 March 2016. We manually searched WHO reports, and papers from international conferences on Salmonella infections. We also contacted test manufacturers to identify studies. We included diagnostic accuracy studies of enteric fever RDTs in patients with fever or with symptoms suggestive of enteric fever living in endemic areas. We classified the reference standard used as either Grade 1 (result from a blood culture and a bone marrow culture) or Grade 2 (result from blood culture and blood polymerase chain reaction, or from blood culture alone). Two review authors independently extracted the test result data. We used a modified QUADAS-2 extraction form to assess methodological quality. We performed a meta-analysis when there were sufficient studies for the test and heterogeneity was reasonable. Thirty-seven studies met the inclusion criteria and included a total of 5080 participants (range 50 to 1732). Enteric fever prevalence

  12. Antiphospholipid Syndrome Laboratory Testing and Diagnostic Strategies

    Science.gov (United States)

    Ortel, Thomas L.

    2016-01-01

    The Antiphospholipid Syndrome (APS) is diagnosed in patients with recurrent thromboembolic events and/or pregnancy loss in the presence of persistent laboratory evidence for antiphospholipid antibodies. Diagnostic tests for the detection of antiphospholipid antibodies include laboratory assays that detect anticardiolipin antibodies, lupus anticoagulants, and anti-β2-glycoprotein I antibodies. These assays have their origins beginning more than sixty years ago, with the identification of the biologic false positive test for syphilis, the observation of ‘circulating anticoagulants’ in certain patients with systemic lupus erythematosus, the identification of cardiolipin as a key component in the serologic test for syphilis, and the recognition and characterization of a ‘cofactor’ for antibody binding to phospholipids. Although these assays have been used clinically for many years, there are still problems with the accurate diagnosis of patients with this syndrome. For example, lupus anticoagulant testing can be difficult to interpret in patients receiving anticoagulant therapy, but most patients with a thromboembolic event will already be anticoagulated before the decision to perform the tests has been made. In addition to understanding limitations of the assays, clinicians also need to be aware of which patients should be tested and not obtain testing on patients unlikely to have APS. New tests and diagnostic strategies are in various stages of development and should help improve our ability to accurately diagnose this important clinical disorder. PMID:22473619

  13. Clinical evaluation and validation of laboratory methods for the diagnosis of Bordetella pertussis infection: Culture, polymerase chain reaction (PCR) and anti-pertussis toxin IgG serology (IgG-PT).

    Science.gov (United States)

    Lee, Adria D; Cassiday, Pamela K; Pawloski, Lucia C; Tatti, Kathleen M; Martin, Monte D; Briere, Elizabeth C; Tondella, M Lucia; Martin, Stacey W

    2018-01-01

    The appropriate use of clinically accurate diagnostic tests is essential for the detection of pertussis, a poorly controlled vaccine-preventable disease. The purpose of this study was to estimate the sensitivity and specificity of different diagnostic criteria including culture, multi-target polymerase chain reaction (PCR), anti-pertussis toxin IgG (IgG-PT) serology, and the use of a clinical case definition. An additional objective was to describe the optimal timing of specimen collection for the various tests. Clinical specimens were collected from patients with cough illness at seven locations across the United States between 2007 and 2011. Nasopharyngeal and blood specimens were collected from each patient during the enrollment visit. Patients who had been coughing for ≤ 2 weeks were asked to return in 2-4 weeks for collection of a second, convalescent blood specimen. Sensitivity and specificity of each diagnostic test were estimated using three methods-pertussis culture as the "gold standard," composite reference standard analysis (CRS), and latent class analysis (LCA). Overall, 868 patients were enrolled and 13.6% were B. pertussis positive by at least one diagnostic test. In a sample of 545 participants with non-missing data on all four diagnostic criteria, culture was 64.0% sensitive, PCR was 90.6% sensitive, and both were 100% specific by LCA. CRS and LCA methods increased the sensitivity estimates for convalescent serology and the clinical case definition over the culture-based estimates. Culture and PCR were most sensitive when performed during the first two weeks of cough; serology was optimally sensitive after the second week of cough. Timing of specimen collection in relation to onset of illness should be considered when ordering diagnostic tests for pertussis. Consideration should be given to including IgG-PT serology as a confirmatory test in the Council of State and Territorial Epidemiologists (CSTE) case definition for pertussis.

  14. 30 CFR 250.522 - When do I have to repeat casing diagnostic testing?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When do I have to repeat casing diagnostic... Operations Casing Pressure Management § 250.522 When do I have to repeat casing diagnostic testing? Casing diagnostic testing must be repeated according to the following table: When * * * you must repeat diagnostic...

  15. A Rapid and Low-Cost PCR Thermal Cycler for Low Resource Settings.

    Directory of Open Access Journals (Sweden)

    Grace Wong

    Full Text Available Many modern molecular diagnostic assays targeting nucleic acids are typically confined to developed countries or to the national reference laboratories of developing-world countries. The ability to make technologies for the rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a revolutionary step forward in global health. Many molecular assays are also developed based on polymerase chain reactions (PCR, which require thermal cyclers that are relatively heavy (>20 pounds and need continuous electrical power. The temperature ramping speed of most economical thermal cyclers are relatively slow (2 to 3 °C/s so a polymerase chain reaction can take 1 to 2 hours. Most of all, these thermal cyclers are still too expensive ($2k to $4k for low-resource setting uses.In this article, we demonstrate the development of a low-cost and rapid water bath based thermal cycler that does not require active temperature control or continuous power supply during PCR. This unit costs $130 to build using commercial off-the-shelf items. The use of two or three vacuum-insulated stainless-steel Thermos food jars containing heated water (for denaturation and annealing/extension steps and a layer of oil on top of the water allow for significantly stabilized temperatures for PCR to take place. Using an Arduino-based microcontroller, we automate the "archaic" method of hand-transferring PCR tubes between water baths.We demonstrate that this innovative unit can deliver high speed PCR (17 s per PCR cycle with the potential to go beyond the 1,522 bp long amplicons tested in this study and can amplify from templates down to at least 20 copies per reaction. The unit also accepts regular PCR tubes and glass capillary tubes. The PCR efficiency of our thermal cycler is not different from other commercial thermal cyclers. When combined with a rapid nucleic acid detection approach, the thermos thermal cycler (TTC can enable on-site molecular

  16. BEAMing and Droplet Digital PCR Analysis of Mutant IDH1 mRNA in Glioma Patient Serum and Cerebrospinal Fluid Extracellular Vesicles

    Directory of Open Access Journals (Sweden)

    Walter W Chen

    2013-01-01

    Full Text Available Development of biofluid-based molecular diagnostic tests for cancer is an important step towards tumor characterization and real-time monitoring in a minimally invasive fashion. Extracellular vesicles (EVs are released from tumor cells into body fluids and can provide a powerful platform for tumor biomarkers because they carry tumor proteins and nucleic acids. Detecting rare point mutations in the background of wild-type sequences in biofluids such as blood and cerebrospinal fluid (CSF remains a major challenge. Techniques such as BEAMing (beads, emulsion, amplification, magnetics PCR and droplet digital PCR (ddPCR are substantially more sensitive than many other assays for mutant sequence detection. Here, we describe a novel approach that combines biofluid EV RNA and BEAMing RT-PCR (EV-BEAMing, as well droplet digital PCR to interrogate mutations from glioma tumors. EVs from CSF of patients with glioma were shown to contain mutant IDH1 transcripts, and we were able to reliably detect and quantify mutant and wild-type IDH1 RNA transcripts in CSF of patients with gliomas. EV-BEAMing and EV-ddPCR represent a valuable new strategy for cancer diagnostics, which can be applied to a variety of biofluids and neoplasms.

  17. More Than Just Accuracy: A Novel Method to Incorporate Multiple Test Attributes in Evaluating Diagnostic Tests Including Point of Care Tests.

    Science.gov (United States)

    Thompson, Matthew; Weigl, Bernhard; Fitzpatrick, Annette; Ide, Nicole

    2016-01-01

    Current frameworks for evaluating diagnostic tests are constrained by a focus on diagnostic accuracy, and assume that all aspects of the testing process and test attributes are discrete and equally important. Determining the balance between the benefits and harms associated with new or existing tests has been overlooked. Yet, this is critically important information for stakeholders involved in developing, testing, and implementing tests. This is particularly important for point of care tests (POCTs) where tradeoffs exist between numerous aspects of the testing process and test attributes. We developed a new model that multiple stakeholders (e.g., clinicians, patients, researchers, test developers, industry, regulators, and health care funders) can use to visualize the multiple attributes of tests, the interactions that occur between these attributes, and their impacts on health outcomes. We use multiple examples to illustrate interactions between test attributes (test availability, test experience, and test results) and outcomes, including several POCTs. The model could be used to prioritize research and development efforts, and inform regulatory submissions for new diagnostics. It could potentially provide a way to incorporate the relative weights that various subgroups or clinical settings might place on different test attributes. Our model provides a novel way that multiple stakeholders can use to visualize test attributes, their interactions, and impacts on individual and population outcomes. We anticipate that this will facilitate more informed decision making around diagnostic tests.

  18. Molecular Diagnostic Tests for Microsporidia

    Directory of Open Access Journals (Sweden)

    Kaya Ghosh

    2009-01-01

    Full Text Available The Microsporidia are a ubiquitous group of eukaryotic obligate intracellular parasites which were recognized over 100 years ago with the description of Nosema bombycis, a parasite of silkworms. It is now appreciated that these organisms are related to the Fungi. Microsporidia infect all major animal groups most often as gastrointestinal pathogens; however they have been reported from every tissue and organ, and their spores are common in environmental sources such as ditch water. Several different genera of these organisms infect humans, but the majority of infections are due to either Enterocytozoon bieneusi or Encephalitozoon species. These pathogens can be difficult to diagnose, but significant progress has been made in the last decade in the development of molecular diagnostic reagents for these organisms. This report reviews the molecular diagnostic tests that have been described for the identification of the microsporidia that infect humans.

  19. Are rapid diagnostic tests more accurate in diagnosis of plasmodium falciparum malaria compared to microscopy at rural health centres?

    Directory of Open Access Journals (Sweden)

    Magnussen Pascal

    2010-12-01

    Full Text Available Abstract Background Prompt, accurate diagnosis and treatment with artemisinin combination therapy remains vital to current malaria control. Blood film microscopy the current standard test for diagnosis of malaria has several limitations that necessitate field evaluation of alternative diagnostic methods especially in low income countries of sub-Saharan Africa where malaria is endemic. Methods The accuracy of axillary temperature, health centre (HC microscopy, expert microscopy and a HRP2-based rapid diagnostic test (Paracheck was compared in predicting malaria infection using polymerase chain reaction (PCR as the gold standard. Three hundred patients with a clinical suspicion of malaria based on fever and or history of fever from a low and high transmission setting in Uganda were consecutively enrolled and provided blood samples for all tests. Accuracy of each test was calculated overall with 95% confidence interval and then adjusted for age-groups and level of transmission intensity using a stratified analysis. The endpoints were: sensitivity, specificity, positive predictive value (PPV and negative predictive value (NPV. This study is registered with Clinicaltrials.gov, NCT00565071. Results Of the 300 patients, 88(29.3% had fever, 56(18.7% were positive by HC microscopy, 47(15.7% by expert microscopy, 110(36.7% by Paracheck and 89(29.7% by PCR. The overall sensitivity >90% was only shown by Paracheck 91.0% [95%CI: 83.1-96.0]. The sensitivity of expert microscopy was 46%, similar to HC microscopy. The superior sensitivity of Paracheck compared to microscopy was maintained when data was stratified for transmission intensity and age. The overall specificity rates were: Paracheck 86.3% [95%CI: 80.9-90.6], HC microscopy 93.4% [95%CI: 89.1-96.3] and expert microscopy 97.2% [95%CI: 93.9-98.9]. The NPV >90% was shown by Paracheck 95.8% [95%CI: 91.9-98.2]. The overall PPV was Conclusion The HRP2-based RDT has shown superior sensitivity compared to

  20. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Directory of Open Access Journals (Sweden)

    Gilberto A Santiago

    Full Text Available Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV. There are four genetically distinct DENVs (DENV-1-4 that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  1. Network meta-analysis of diagnostic test accuracy studies identifies and ranks the optimal diagnostic tests and thresholds for health care policy and decision-making.

    Science.gov (United States)

    Owen, Rhiannon K; Cooper, Nicola J; Quinn, Terence J; Lees, Rosalind; Sutton, Alex J

    2018-07-01

    Network meta-analyses (NMA) have extensively been used to compare the effectiveness of multiple interventions for health care policy and decision-making. However, methods for evaluating the performance of multiple diagnostic tests are less established. In a decision-making context, we are often interested in comparing and ranking the performance of multiple diagnostic tests, at varying levels of test thresholds, in one simultaneous analysis. Motivated by an example of cognitive impairment diagnosis following stroke, we synthesized data from 13 studies assessing the efficiency of two diagnostic tests: Mini-Mental State Examination (MMSE) and Montreal Cognitive Assessment (MoCA), at two test thresholds: MMSE accounting for the correlations between multiple test accuracy measures from the same study. We developed and successfully fitted a model comparing multiple tests/threshold combinations while imposing threshold constraints. Using this model, we found that MoCA at threshold decision making. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Efficient strategies to find diagnostic test accuracy studies in kidney journals.

    Science.gov (United States)

    Rogerson, Thomas E; Ladhani, Maleeka; Mitchell, Ruth; Craig, Jonathan C; Webster, Angela C

    2015-08-01

    Nephrologists looking for quick answers to diagnostic clinical questions in MEDLINE can use a range of published search strategies or Clinical Query limits to improve the precision of their searches. We aimed to evaluate existing search strategies for finding diagnostic test accuracy studies in nephrology journals. We assessed the accuracy of 14 search strategies for retrieving diagnostic test accuracy studies from three nephrology journals indexed in MEDLINE. Two investigators hand searched the same journals to create a reference set of diagnostic test accuracy studies to compare search strategy results against. We identified 103 diagnostic test accuracy studies, accounting for 2.1% of all studies published. The most specific search strategy was the Narrow Clinical Queries limit (sensitivity: 0.20, 95% CI 0.13-0.29; specificity: 0.99, 95% CI 0.99-0.99). Using the Narrow Clinical Queries limit, a searcher would need to screen three (95% CI 2-6) articles to find one diagnostic study. The most sensitive search strategy was van der Weijden 1999 Extended (sensitivity: 0.95; 95% CI 0.89-0.98; specificity 0.55, 95% CI 0.53-0.56) but required a searcher to screen 24 (95% CI 23-26) articles to find one diagnostic study. Bachmann 2002 was the best balanced search strategy, which was sensitive (0.88, 95% CI 0.81-0.94), but also specific (0.74, 95% CI 0.73-0.75), with a number needed to screen of 15 (95% CI 14-17). Diagnostic studies are infrequently published in nephrology journals. The addition of a strategy for diagnostic studies to a subject search strategy in MEDLINE may reduce the records needed to screen while preserving adequate search sensitivity for routine clinical use. © 2015 Asian Pacific Society of Nephrology.

  3. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Science.gov (United States)

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  4. Aspergillus Galactomannan Enzyme Immunoassay and Quantitative PCR for Diagnosis of Invasive Aspergillosis with Bronchoalveolar Lavage Fluid

    Science.gov (United States)

    Musher, Benjamin; Fredricks, David; Leisenring, Wendy; Balajee, S. Arunmozhi; Smith, Caitlin; Marr, Kieren A.

    2004-01-01

    Invasive pulmonary aspergillosis (IPA) is frequent and often fatal in hematopoietic stem cell transplant patients. Diagnosis requires microbiological or histopathologic demonstration of the organism in tissues; however, cultivation of Aspergillus species from respiratory secretions has low diagnostic sensitivity. Assays to detect Aspergillus antigen or DNA in bronchoalveolar lavage (BAL) fluid could facilitate earlier diagnosis, thereby guiding optimal therapy and obviating the need for additional costly and potentially morbid diagnostic evaluation. We evaluated the performance of a galactomannan enzyme immunoassay (GM EIA; Bio-Rad) by using a range of index cutoffs to define positivity and a quantitative PCR (qPCR) assay for the detection of Aspergillus species from BAL samples of patients with proven and probable IPA (case patients; n = 49) and without IPA (control patients; n = 50). The sensitivity of the GM EIA was 61% with an index cutoff of 1.0 and 76% with an index cutoff of 0.5; the corresponding specificities were 98 and 94%, respectively. The sensitivity and specificity of qPCR assay were 67 and 100%, respectively. The sensitivity with 22 culture-negative BAL specimens from patients with IPA was 41% for GM EIA with an index cutoff of 1.0, 59% for GM EIA with an index cutoff of 0.5, and 36% for qPCR assay. GM EIA indices and DNA quantities corresponded to BAL fungal burdens, with culture-positive samples having larger amounts of antigen and DNA compared to culture-negative samples. GM EIA and qPCR assay add to the sensitivity of BAL for diagnosing IPA in high-risk patients, with excellent specificity. Adjunctive use of these tests may reduce dependence on invasive diagnostic procedures. PMID:15583275

  5. Use of malaria rapid diagnostic tests by community health workers in Afghanistan: cluster randomised trial.

    Science.gov (United States)

    Leslie, Toby; Rowland, Mark; Mikhail, Amy; Cundill, Bonnie; Willey, Barbara; Alokozai, Asif; Mayan, Ismail; Hasanzai, Anwar; Baktash, Sayed Habibullah; Mohammed, Nader; Wood, Molly; Rahimi, Habib-U-Rahman; Laurent, Baptiste; Buhler, Cyril; Whitty, Christopher J M

    2017-07-07

    The World Health Organisation (WHO) recommends parasitological diagnosis of malaria before treatment, but use of malaria rapid diagnostic tests (mRDTs) by community health workers (CHWs) has not been fully tested within health services in south and central Asia. mRDTs could allow CHWs to diagnose malaria accurately, improving treatment of febrile illness. A cluster randomised trial in community health services was undertaken in Afghanistan. The primary outcome was the proportion of suspected malaria cases correctly treated for polymerase chain reaction (PCR)-confirmed malaria and PCR negative cases receiving no antimalarial drugs measured at the level of the patient. CHWs from 22 clusters (clinics) received standard training on clinical diagnosis and treatment of malaria; 11 clusters randomised to the intervention arm received additional training and were provided with mRDTs. CHWs enrolled cases of suspected malaria, and the mRDT results and treatments were compared to blind-read PCR diagnosis. In total, 256 CHWs enrolled 2400 patients with 2154 (89.8%) evaluated. In the intervention arm, 75.3% (828/1099) were treated appropriately vs. 17.5% (185/1055) in the control arm (cluster adjusted risk ratio: 3.72, 95% confidence interval 2.40-5.77; p < 0.001). In the control arm, 85.9% (164/191) with confirmed Plasmodium vivax received chloroquine compared to 45.1% (70/155) in the intervention arm (p < 0.001). Overuse of chloroquine in the control arm resulted in 87.6% (813/928) of those with no malaria (PCR negative) being treated vs. 10.0% (95/947) in the intervention arm, p < 0.001. In the intervention arm, 71.4% (30/42) of patients with P. falciparum did not receive artemisinin-based combination therapy, partly because operational sensitivity of the RDTs was low (53.2%, 38.1-67.9). There was high concordance between recorded RDT result and CHW prescription decisions: 826/950 (87.0%) with a negative test were not prescribed an antimalarial. Co

  6. International Interlaboratory Digital PCR Study Demonstrating High Reproducibility for the Measurement of a Rare Sequence Variant.

    Science.gov (United States)

    Whale, Alexandra S; Devonshire, Alison S; Karlin-Neumann, George; Regan, Jack; Javier, Leanne; Cowen, Simon; Fernandez-Gonzalez, Ana; Jones, Gerwyn M; Redshaw, Nicholas; Beck, Julia; Berger, Andreas W; Combaret, Valérie; Dahl Kjersgaard, Nina; Davis, Lisa; Fina, Frederic; Forshew, Tim; Fredslund Andersen, Rikke; Galbiati, Silvia; González Hernández, Álvaro; Haynes, Charles A; Janku, Filip; Lacave, Roger; Lee, Justin; Mistry, Vilas; Pender, Alexandra; Pradines, Anne; Proudhon, Charlotte; Saal, Lao H; Stieglitz, Elliot; Ulrich, Bryan; Foy, Carole A; Parkes, Helen; Tzonev, Svilen; Huggett, Jim F

    2017-02-07

    This study tested the claim that digital PCR (dPCR) can offer highly reproducible quantitative measurements in disparate laboratories. Twenty-one laboratories measured four blinded samples containing different quantities of a KRAS fragment encoding G12D, an important genetic marker for guiding therapy of certain cancers. This marker is challenging to quantify reproducibly using quantitative PCR (qPCR) or next generation sequencing (NGS) due to the presence of competing wild type sequences and the need for calibration. Using dPCR, 18 laboratories were able to quantify the G12D marker within 12% of each other in all samples. Three laboratories appeared to measure consistently outlying results; however, proper application of a follow-up analysis recommendation rectified their data. Our findings show that dPCR has demonstrable reproducibility across a large number of laboratories without calibration. This could enable the reproducible application of molecular stratification to guide therapy and, potentially, for molecular diagnostics.

  7. Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests

    Directory of Open Access Journals (Sweden)

    Papa Mze Nasserdine

    2016-01-01

    Full Text Available In the Union of Comoros, interventions for combating malaria have contributed to a spectacular decrease in the prevalence of the disease. We studied the current distribution of Plasmodium species on the island of Grande Comore using nested PCR. The rapid diagnostic tests (RDTs currently used in the Comoros are able to identify Plasmodium falciparum but no other Plasmodium species. In this study, we tested 211 RDTs (158 positive and 53 negative. Among the 158 positive RDTs, 22 were positive for HRP2, 3 were positive only for pLDH, and 133 were positive for HRP2 and pLDH. DNA was extracted from a proximal part of the nitrocellulose membrane of RDTs. A total of 159 samples were positive by nested PCR. Of those, 156 (98.11% were positive for P. falciparum, 2 (1.25% were positive for P. vivaxI, and 1 (0.62% was positive for P. malariae. None of the samples were positive for P. ovale. Our results show that P. falciparum is still the most dominant species on the island of Grande Comore, but P. vivax and P. malariae are present at a low prevalence.

  8. Comparison of toxicity neutralization-, ELISA- and PCR tests for typing of Clostridium perfringens and detection of the enterotoxin gene by PCR

    DEFF Research Database (Denmark)

    Møller, Kristian; Ahrens, Peter

    1996-01-01

    A polymerase chain reaction (PCR) was developed for the specific amplification of a part of each of the five Clostridium perfringens toxin genes: alpha (alpha), beta (beta), epsilon (epsilon), iota (iota), and enterotoxin (CPE). While the toxicity neutralization test (TNT) only showed limited...

  9. Significantly improved PCR-based clonality testing in B-cell malignancies by use of multiple immunoglobulin gene targets. Report of the BIOMED-2 Concerted Action BHM4-CT98-3936.

    NARCIS (Netherlands)

    Evans, P.A.; Pott, C.; Groenen, P.J.T.A.; Salles, G.; Davi, F.; Berger, F.; Garcia, J.F.; Krieken, J.H.J.M. van; Pals, S.; Kluin, P.; Schuuring, E.; Spaargaren, M.; Boone, E.; Gonzalez, D.; Martinez, B.; Villuendas, R.; Gameiro, P.; Diss, T.C.; Mills, K.; Morgan, G.J.; Carter, G.I.; Milner, B.J.; Pearson, D.; Hummel, M.; Jung, W.; Ott, M.; Canioni, D.; Beldjord, K.; Bastard, C.; Delfau-Larue, M.H.; Dongen, J.J.M. van; Molina, T.J.; Cabecadas, J.

    2007-01-01

    Polymerase chain reaction (PCR) assessment of clonal immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements is an important diagnostic tool in mature B-cell neoplasms. However, lack of standardized PCR protocols resulting in a high level of false negativity has hampered comparability of

  10. Comparison of a conventional and nested PCR for diagnostic confirmation and genotyping of Orientia tsutsugamushi.

    Science.gov (United States)

    Janardhanan, Jeshina; Prakash, John Antony Jude; Abraham, Ooriapadickal C; Varghese, George M

    2014-05-01

    A nested polymerase chain reaction (PCR) targeting the 56-kDa antigen gene is currently the most commonly used molecular technique for confirmation of scrub typhus and genotyping of Orientia tsutsugamushi. In this study, we have compared the commonly used nested PCR (N-PCR) with a single-step conventional PCR (C-PCR) for amplification and genotyping. Eschar samples collected from 24 patients with scrub typhus confirmed by IgM enzyme-linked immunosorbent assay were used for DNA extraction following which amplifications were carried out using nested and C-PCR methods. The amplicons were sequenced and compared to other sequences in the database using BLAST. Conventional PCR showed a high positivity rate of 95.8% compared to the 75% observed using N-PCR. On sequence analysis, the N-PCR amplified region showed more variation among strains than the C-PCR amplified region. The C-PCR, which is more economical, provided faster and better results compared to N-PCR. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Evaluation of diagnostic methods for the detection of Helicobacter pylori in gastric biopsy specimens of dyspeptic patients

    Directory of Open Access Journals (Sweden)

    Ivy Bastos Ramis

    2012-09-01

    Full Text Available Helicobacter pylori infects nearly 50% of the world's population. This microorganism is accepted as the most important agent of gastritis and as a risk factor for peptic ulcer disease and gastric adenocarcinoma. Currently many diagnostic methods exist for detecting H. pylori, however they all have limitations, thus it is recommend a combination of at least two methods. The aim of this study was to evaluate diagnostic methods, such as in-house urease test, culture and Polymerase Chain Reaction (PCR, for the detection of the H. pylori in gastric biopsy specimens of 144 dyspeptic patients, using as gold standard the association between histology and rapid urease test. According to the gold standard used in this study, 48 (33.3% patients were infected with H. pylori, while 96 (66.7% were classified as not infected. The in-house urease test and the PCR were the most sensitive methods (100%, followed by culture (85.4%. However, the in-house urease test and the culture were the most specific (100%, followed by PCR (75%. In conclusion, this study showed that, in comparison with the combination of histology and rapid urease test, the in-house urease test and the PCR presented 100% of sensitivity in the diagnosis of gastric infection by H. pylori, while the in-house urease test and the culture reached 100% of specificity. These finding suggest that the combination of two or more methods may improve the accuracy of the H. pylori detection.

  12. Characterization of the Goubau line for testing beam diagnostic instruments

    Science.gov (United States)

    Kim, S. Y.; Stulle, F.; Sung, C. K.; Yoo, K. H.; Seok, J.; Moon, K. J.; Choi, C. U.; Chung, Y.; Kim, G.; Woo, H. J.; Kwon, J.; Lee, I. G.; Choi, E. M.; Chung, M.

    2017-12-01

    One of the main characteristics of the Goubau line is that it supports a low-loss, non-radiated surface wave guided by a dielectric-coated metal wire. The dominant mode of the surface wave along the Goubau line is a TM01 mode, which resembles the pattern of the electromagnetic fields induced in the metallic beam pipe when the charged particle beam passes through it. Therefore, the Goubau line can be used for the preliminary bench test and performance optimization of the beam diagnostic instruments without requiring charged particle beams from the accelerators. In this paper, we discuss the basic properties of the Goubau line for testing beam diagnostic instruments and present the initial test results for button-type beam position monitors (BPMs). The experimental results are consistent with the theoretical estimations, which indicates that Goubau line allows effective testing of beam diagnostic equipment.

  13. Better Tests, Better Care: Improved Diagnostics for Infectious Diseases

    Science.gov (United States)

    Caliendo, Angela M.; Gilbert, David N.; Ginocchio, Christine C.; Hanson, Kimberly E.; May, Larissa; Quinn, Thomas C.; Tenover, Fred C.; Alland, David; Blaschke, Anne J.; Bonomo, Robert A.; Carroll, Karen C.; Ferraro, Mary Jane; Hirschhorn, Lisa R.; Joseph, W. Patrick; Karchmer, Tobi; MacIntyre, Ann T.; Reller, L. Barth; Jackson, Audrey F.

    2013-01-01

    In this IDSA policy paper, we review the current diagnostic landscape, including unmet needs and emerging technologies, and assess the challenges to the development and clinical integration of improved tests. To fulfill the promise of emerging diagnostics, IDSA presents recommendations that address a host of identified barriers. Achieving these goals will require the engagement and coordination of a number of stakeholders, including Congress, funding and regulatory bodies, public health agencies, the diagnostics industry, healthcare systems, professional societies, and individual clinicians. PMID:24200831

  14. Evaluation of PCR for cutaneous leishmaniasis diagnosis and species identification using filter paper samples in Panama, Central America.

    Science.gov (United States)

    Miranda, A; Saldaña, A; González, K; Paz, H; Santamaría, G; Samudio, F; Calzada, J E

    2012-09-01

    Cutaneous leishmaniasis (CL) is a major vectorborne disease in Panama. In this study, the diagnostic performance and usefulness of two DNA extraction procedures from skin scraping samples collected on FTA filter paper for subsequent PCR diagnosis of CL was evaluated. A positive CL laboratory diagnosis was based on a positive parasitological test (Giemsa-stained smears or in vitro culture) and/or positive PCR test performed from skin scrapings collected in TE buffer (PCR-TE). Of 100 patients with skin lesions suggestive of CL, 82 (82%) were confirmed as CL positive. The sensitivity was calculated for each of the PCR approaches from samples collected on filter paper. The highest sensitivity was achieved by PCR-FTA processed by Chelex 100 (PCR-Chelex) (0.94). PCR-FTA extracted using the FTA purification reagent presented a lower sensitivity (0.60). Good concordance between routine PCR-TE and PCR-Chelex was observed (percent agreement=0.88, κ index=0.65). In conclusion, use of FTA filter paper for skin scraping collection combined with PCR is a reliable and convenient method for CL diagnosis in Panama, with comparable performance to the routine PCR method and with improved sensitivity compared with those of conventional parasitological methods. Copyright © 2012 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

  15. Susceptibility Testing by Polymerase Chain Reaction DNA Quantitation: A Method to Measure Drug Resistance of Human Immunodeficiency Virus Type 1 Isolates

    Science.gov (United States)

    Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.

    1992-04-01

    Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.

  16. Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

    International Nuclear Information System (INIS)

    Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.

    1986-01-01

    The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

  17. Real-time PCR in virology.

    Science.gov (United States)

    Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas

    2002-03-15

    The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.

  18. Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †

    Science.gov (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.

    2009-01-01

    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271

  19. Mixed Portmanteau Test for Diagnostic Checking of Time Series Models

    Directory of Open Access Journals (Sweden)

    Sohail Chand

    2014-01-01

    Full Text Available Model criticism is an important stage of model building and thus goodness of fit tests provides a set of tools for diagnostic checking of the fitted model. Several tests are suggested in literature for diagnostic checking. These tests use autocorrelation or partial autocorrelation in the residuals to criticize the adequacy of fitted model. The main idea underlying these portmanteau tests is to identify if there is any dependence structure which is yet unexplained by the fitted model. In this paper, we suggest mixed portmanteau tests based on autocorrelation and partial autocorrelation functions of the residuals. We derived the asymptotic distribution of the mixture test and studied its size and power using Monte Carlo simulations.

  20. Nasal PCR assay for the detection of Mycobacterium leprae pra gene to study subclinical infection in a community.

    Science.gov (United States)

    Arunagiri, Kamalanathan; Sangeetha, Gopalakrishnan; Sugashini, Padmavathy Krishnan; Balaraman, Sekar; Showkath Ali, M K

    2017-03-01

    Leprosy is a chronic infectious disease caused by Mycobacterium leprae. Identification of Mycobacterium leprae is difficult in part due to the inability of the leprosy bacillus to grow in vitro. A number of diagnostic methods for leprosy diagnosis have been proposed. Both serological tests and molecular probes have shown certain potential for detection and identification of Mycobacterium leprae in patients. In this study, we have investigated whether Mycobacterium leprae DNA from the nasal secretion of healthy household contacts and the non contacts could be detected through PCR amplification as a method to study the sub clinical infection in a community. A total of 200 samples, 100 each from contacts and non contacts representing all age groups and sex were included in this study. The M. leprae specific primer (proline-rich region) of pra gene was selected and PCR was performed using extracted DNA from the sample. A total of 13 samples were found to be positive for nasal PCR for pra gene among the male and female contacts out of which 7% were males and 6% were females. Even though several diagnostic tools are available to detect the cases of leprosy, they lack the specificity and sensitivity. PCR technology has demonstrated the improved diagnostic accuracy for epidemiological studies and requires minimal time. Although nasal PCR studies have been reported from many countries it is not usually recommended due to the high percentage of negative results in the contact. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. RT-PCR for confirmation of echovirus 30 isolated in Belém, Brazil

    Directory of Open Access Journals (Sweden)

    Maria de Lourdes C. Gomes

    Full Text Available Echovirus (Echo 30 or human enterovirus B is the most frequent enterovirus associated with meningitis cases. Epidemics and outbreaks of this disease caused by Echo 30 have occurred in several countries. In Brazil, Echo 30 has been isolated from sporadic cases and outbreaks that occurred mainly in the south and southeast regions. We used RT-PCR to examine Echo 30 isolates from meningitis cases detected from March 2002 to December 2003 in Belém, state of Pará, in northern Brazil. The patients were attended in a Basic Health Unit (State Health Secretary of Pará, where cerebrospinal fluid (CSF was collected and stored in liquid nitrogen. Weekly visits were made by technicians from Evandro Chagas Institute to the health unit and samples were stored at -70ºC in the laboratory until use. HEp-2 and RD cell lines were used for viral isolation and neutralization with specific antisera for viral identification. RNA extraction was made using Trizol reagent. The RT-PCR was made in one step, and the total mixture (50 µL was composed of: RNA, reaction buffer, dNTP, primers, Rnase inhibitor, reverse transcriptase, Taq polymerase and water. The products were visualized in agarose gel stained with ethidium bromide, visualized under UV light. Among the 279 CSF samples examined, 30 (10.7% were EV positive, 29 being Echo 30 and one was Cox B. Nineteen Echo 30 were examined with RT-PCR; 18 tested positive (762 and 494 base pairs. The use of this technique permitted viral identification in less time than usual, which benefits the patient and is of importance for public-health interventions.

  2. Cutaneous and visceral leishmaniasis co-infection in dogs from Rio de Janeiro, Brazil: evaluation by specific PCR and RFLP-PCR assays

    Directory of Open Access Journals (Sweden)

    Marize Quinhones Pires

    2014-04-01

    Full Text Available Introduction During a diagnostic evaluation of canine visceral leishmaniasis (VL, two of seventeen dogs were found to be co-infected by Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi. Methods Specific polymerase chain reaction (PCR and restriction fragment length polymorphism-PCR (RFLP-PCR assays were performed. Results PCR assays for Leishmania subgenus identification followed by RFLP-PCR analysis in biopsies from cutaneous lesions and the spleen confirmed the presence of Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi in those fragments. Conclusions This report reinforces the importance of using serological and molecular techniques in the epidemiological surveillance of canine populations in endemic areas in which both diseases are known to co-exist. In such cases, a reassessment of the control measures is required.

  3. Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

    Science.gov (United States)

    Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

    2016-10-19

    Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

  4. PCR analysis is superior to histology for diagnosis of Whipple's disease mimicking seronegative rheumatic diseases.

    Science.gov (United States)

    Lehmann, P; Ehrenstein, B; Hartung, W; Dragonas, C; Reischl, U; Fleck, M

    2017-03-01

    The diagnosis of Whipple's disease (WD) is commonly confirmed by histology demonstrating Periodic Acid Schiff (PAS)-positive macrophages in the duodenal mucosa. Analysis of intestinal tissue or other specimens using polymerase chain reaction (PCR) is a more sensitive method. However, the relevance of positive PCR findings is still controversial. Therefore, we evaluated the relevance of histology and PCR findings to establishing the diagnosis of WD in a series of WD patients initially presenting with suspected rheumatic diseases. Between 2006 and 2014, 20 patients with seronegative rheumatic diseases tested positive for Tropheryma whipplei (Tw) by PCR and/or histology and were enrolled in a retrospective analysis of the diagnostic value of both procedures. Seven of the 20 cases (35%) were diagnosed with 'classic' WD as indicated by PAS-positive macrophages. In the remaining 13 patients, the presence of Tw was detected by intestinal (n = 10) or synovial PCR analysis (n = 3). Two of the 20 patients (10%) with evidence of Tw did not respond to antibiotic therapy. They were not considered to suffer from WD. Therefore, relying only on histological findings of intestinal biopsies would have missed 11 (61%) of the 18 patients with WD in our cohort. In comparison, PCR of intestinal biopsies detected Tw-DNA in 14 (93%) of the 15 WD patients evaluated. Patients with a positive histology did not differ from PCR-positive patients with regard to sex, age, or duration of disease, but more often presented with gastrointestinal symptoms. A substantial number of WD patients present without typical intestinal histology findings. Additional PCR analysis of intestinal tissue or synovial fluid increased the sensitivity of the diagnostic evaluation and should be considered particularly in patients presenting with atypical seronegative rheumatic diseases and a high-risk profile for WD.

  5. Comparison of Nested-PCR technique and culture method in ...

    African Journals Online (AJOL)

    USER

    2010-04-05

    Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.

  6. Evaluation of PCR electrospray-ionization mass spectrometry for rapid molecular diagnosis of bovine mastitis.

    Science.gov (United States)

    Perreten, Vincent; Endimiani, Andrea; Thomann, Andreas; Wipf, Juliette R K; Rossano, Alexandra; Bodmer, Michèle; Raemy, Andreas; Sannes-Lowery, Kristin A; Ecker, David J; Sampath, Rangarajan; Bonomo, Robert A; Washington, Cicely

    2013-06-01

    Bovine mastitis, an inflammatory disease of the mammary gland, is one of the most costly diseases affecting the dairy industry. The treatment and prevention of this disease is linked heavily to the use of antibiotics in agriculture and early detection of the primary pathogen is essential to control the disease. Milk samples (n=67) from cows suffering from mastitis were analyzed for the presence of pathogens using PCR electrospray-ionization mass spectrometry (PCR/ESI-MS) and were compared with standard culture diagnostic methods. Concurrent identification of the primary mastitis pathogens was obtained for 64% of the tested milk samples, whereas divergent results were obtained for 27% of the samples. The PCR/ESI-MS failed to identify some of the primary pathogens in 18% of the samples, but identified other pathogens as well as microorganisms in samples that were negative by culture. The PCR/ESI-MS identified bacteria to the species level as well as yeasts and molds in samples that contained a mixed bacterial culture (9%). The sensitivity of the PCR/ESI-MS for the most common pathogens ranged from 57.1 to 100% and the specificity ranged from 69.8 to 100% using culture as gold standard. The PCR/ESI-MS also revealed the presence of the methicillin-resistant gene mecA in 16.2% of the milk samples, which correlated with the simultaneous detection of staphylococci including Staphylococcus aureus. We demonstrated that PCR/ESI-MS, a more rapid diagnostic platform compared with bacterial culture, has the significant potential to serve as an important screening method in the diagnosis of bovine clinical mastitis and has the capacity to be used in infection control programs for both subclinical and clinical disease. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. Development of diagnostic test instruments to reveal level student conception in kinematic and dynamics

    Science.gov (United States)

    Handhika, J.; Cari, C.; Suparmi, A.; Sunarno, W.; Purwandari, P.

    2018-03-01

    The purpose of this research was to develop a diagnostic test instrument to reveal students' conceptions in kinematics and dynamics. The diagnostic test was developed based on the content indicator the concept of (1) displacement and distance, (2) instantaneous and average velocity, (3) zero and constant acceleration, (4) gravitational acceleration (5) Newton's first Law, (6) and Newton's third Law. The diagnostic test development model includes: Diagnostic test requirement analysis, formulating test-making objectives, developing tests, checking the validity of the content and the performance of reliability, and application of tests. The Content Validation Index (CVI) results in the category are highly relevant, with a value of 0.85. Three questions get negative Content Validation Ratio CVR) (-0.6), after revised distractors and clarify visual presentation; the CVR become 1 (highly relevant). This test was applied, obtained 16 valid test items, with Cronbach Alpha value of 0.80. It can conclude that diagnostic test can be used to reveal the level of students conception in kinematics and dynamics.

  8. Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

    Science.gov (United States)

    Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

    2015-01-01

    Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100

  9. Informed decision-making before changing to RDT: a comparison of microscopy, rapid diagnostic test and molecular techniques for the diagnosis and identification of malaria parasites in Kassala, eastern Sudan.

    Science.gov (United States)

    Osman, Mamoun M M; Nour, Bakri Y M; Sedig, Mohamed F; De Bes, Laura; Babikir, Adil M; Mohamedani, Ahmed A; Mens, Petra F

    2010-12-01

    Rapid diagnostic tests (RDTs) are promoted for the diagnosis of malaria in many countries. The question arises whether laboratories where the current method of diagnosis is microscopy should also switch to RDT. This problem was studied in Kassala, Sudan where the issue of switching to RDT is under discussion. Two hundred and three blood samples were collected from febrile patients suspected of having malaria. These were subsequently analysed with microscopy, RDT (SD Bioline P.f/P.v) and PCR for the detection and identification of Plasmodium parasites. Malaria parasites were detected in 36 blood samples when examined microscopically, 54 (26.6%) samples were found positive for malaria parasites by RDT, and 44 samples were positive by PCR. Further analysis showed that the RDT used in our study resulted in a relatively high number of false positive samples. When microscopy was compared with PCR, an agreement of 96.1% and k = 0.88 (sensitivity 85.7% and specificity 100%) was found. However, when RDT was compared with PCR, an agreement of only 81.2 and k = 0.48 (sensitivity 69% and specificity 84%) was found. PCR has proven to be one of the most specific and sensitive diagnostic methods, particularly for malaria cases with low parasitaemia. However, this technique has limitations in its routine use under resource-limited conditions, such as our study location. At present, based on these results, microscopy remains the best option for routine diagnosis of malaria in Kassala, eastern Sudan. © 2010 Blackwell Publishing Ltd.

  10. Rapid diagnostic tests for typhoid and paratyphoid (enteric) fever

    Science.gov (United States)

    Wijedoru, Lalith; Mallett, Sue; Parry, Christopher M

    2017-01-01

    Background Differentiating both typhoid (Salmonella Typhi) and paratyphoid (Salmonella Paratyphi A) infection from other causes of fever in endemic areas is a diagnostic challenge. Although commercial point-of-care rapid diagnostic tests (RDTs) for enteric fever are available as alternatives to the current reference standard test of blood or bone marrow culture, or to the widely used Widal Test, their diagnostic accuracy is unclear. If accurate, they could potentially replace blood culture as the World Health Organization (WHO)-recommended main diagnostic test for enteric fever. Objectives To assess the diagnostic accuracy of commercially available rapid diagnostic tests (RDTs) and prototypes for detecting Salmonella Typhi or Paratyphi A infection in symptomatic persons living in endemic areas. Search methods We searched the Cochrane Infectious Diseases Group Specialized Register, MEDLINE, Embase, Science Citation Index, IndMED, African Index Medicus, LILACS, ClinicalTrials.gov, and the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) up to 4 March 2016. We manually searched WHO reports, and papers from international conferences on Salmonella infections. We also contacted test manufacturers to identify studies. Selection criteria We included diagnostic accuracy studies of enteric fever RDTs in patients with fever or with symptoms suggestive of enteric fever living in endemic areas. We classified the reference standard used as either Grade 1 (result from a blood culture and a bone marrow culture) or Grade 2 (result from blood culture and blood polymerase chain reaction, or from blood culture alone). Data collection and analysis Two review authors independently extracted the test result data. We used a modified QUADAS-2 extraction form to assess methodological quality. We performed a meta-analysis when there were sufficient studies for the test and heterogeneity was reasonable. Main results Thirty-seven studies met the inclusion

  11. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages

    OpenAIRE

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

    2017-01-01

    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, inc...

  12. Diagnostic value of serologic tests in celiac screening

    Directory of Open Access Journals (Sweden)

    Hosein Saneian

    2012-01-01

    Conclusions: According to our study results, there is no correlation between gastrointestinal symptoms such as vomiting diarrhea, anorexia, bulimia, and failure to thrive (FFT with celiac. TTG was the best screening test method to diagnose celiac disease and other tests such as AGA and EMA do not have high diagnostic value.

  13. Compare diagnostic tests using transformation-invariant smoothed ROC curves⋆

    Science.gov (United States)

    Tang, Liansheng; Du, Pang; Wu, Chengqing

    2012-01-01

    Receiver operating characteristic (ROC) curve, plotting true positive rates against false positive rates as threshold varies, is an important tool for evaluating biomarkers in diagnostic medicine studies. By definition, ROC curve is monotone increasing from 0 to 1 and is invariant to any monotone transformation of test results. And it is often a curve with certain level of smoothness when test results from the diseased and non-diseased subjects follow continuous distributions. Most existing ROC curve estimation methods do not guarantee all of these properties. One of the exceptions is Du and Tang (2009) which applies certain monotone spline regression procedure to empirical ROC estimates. However, their method does not consider the inherent correlations between empirical ROC estimates. This makes the derivation of the asymptotic properties very difficult. In this paper we propose a penalized weighted least square estimation method, which incorporates the covariance between empirical ROC estimates as a weight matrix. The resulting estimator satisfies all the aforementioned properties, and we show that it is also consistent. Then a resampling approach is used to extend our method for comparisons of two or more diagnostic tests. Our simulations show a significantly improved performance over the existing method, especially for steep ROC curves. We then apply the proposed method to a cancer diagnostic study that compares several newly developed diagnostic biomarkers to a traditional one. PMID:22639484

  14. The diagnostic odds ratio: a single indicator of test performance

    NARCIS (Netherlands)

    Glas, Afina S.; Lijmer, Jeroen G.; Prins, Martin H.; Bonsel, Gouke J.; Bossuyt, Patrick M. M.

    2003-01-01

    Diagnostic testing can be used to discriminate subjects with a target disorder from subjects without it. Several indicators of diagnostic performance have been proposed, such as sensitivity and specificity. Using paired indicators can be a disadvantage in comparing the performance of competing

  15. Diagnostic accuracy of temporomandibular disorder pain tests: a multicenter study

    NARCIS (Netherlands)

    Visscher, C.M.; Naeije, M.; de Laat, A.; Michelotti, A.; Nilner, M.; Craane, B.; Ekberg, E.; Farella, M.; Lobbezoo, F.

    2009-01-01

    AIMS: To estimate the diagnostic accuracy of the Research Diagnostic Criteria for Temporomandibular Disorders (RDC/TMD) clinical examination and of the dynamic/static tests for the recognition of TMD pain. Since the diagnosis of TMD pain is especially complicated in persistent orofacial pain

  16. Pre-Clinical Testing of Real-Time PCR Assays for Diarrheal Disease Agents of Genera Escherichia and Shigella

    Science.gov (United States)

    2014-05-16

    FOR DIARRHEAL DISEASE AGENTS OF GENERA ESCHERICHIA AND SHIGELLA May 16, 2014 Reporting Period: October 1, 2010 to September 30, 2013...10-2010 - 30-09-2013 PRE-CLINICAL TESTING OF REAL-TIME PCR ASSAYS FOR DIARRHEAL DISEASE AGENTS OF GENERA ESCHERICHIA AND SHIGELLA ...Texas (MOA 2007 - 2013. Agreement No.: DODI 4000.19; AFI 25-201). Pre-clinical test results qualify ETEC and Shigella real-time PCR assays as lead

  17. Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis.

    Science.gov (United States)

    Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A

    2014-01-01

    Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.

  18. A naked-eye colorimetric "PCR developer"

    Science.gov (United States)

    Valentini, Paola; Pompa, Pier Paolo

    2016-04-01

    Despite several advances in molecular biology and diagnostics, Polymerase Chain Reaction (PCR) is currently the gold standard for nucleic acids amplification and detection, due to its versatility, low-cost and universality, with estimated genetically modified organisms, and pathogens). The PCR developer proved to be highly specific and ultra-sensitive, discriminating down to few copies of HIV viral DNA, diluted in an excess of interfering human genomic DNA, which is a clinically relevant viral load. Hence, it could be a valuable tool for both academic research and clinical applications.

  19. Optimal Sequential Diagnostic Strategy Generation Considering Test Placement Cost for Multimode Systems

    Directory of Open Access Journals (Sweden)

    Shigang Zhang

    2015-10-01

    Full Text Available Sequential fault diagnosis is an approach that realizes fault isolation by executing the optimal test step by step. The strategy used, i.e., the sequential diagnostic strategy, has great influence on diagnostic accuracy and cost. Optimal sequential diagnostic strategy generation is an important step in the process of diagnosis system construction, which has been studied extensively in the literature. However, previous algorithms either are designed for single mode systems or do not consider test placement cost. They are not suitable to solve the sequential diagnostic strategy generation problem considering test placement cost for multimode systems. Therefore, this problem is studied in this paper. A formulation is presented. Two algorithms are proposed, one of which is realized by system transformation and the other is newly designed. Extensive simulations are carried out to test the effectiveness of the algorithms. A real-world system is also presented. All the results show that both of them have the ability to solve the diagnostic strategy generation problem, and they have different characteristics.

  20. Optimal Sequential Diagnostic Strategy Generation Considering Test Placement Cost for Multimode Systems

    Science.gov (United States)

    Zhang, Shigang; Song, Lijun; Zhang, Wei; Hu, Zheng; Yang, Yongmin

    2015-01-01

    Sequential fault diagnosis is an approach that realizes fault isolation by executing the optimal test step by step. The strategy used, i.e., the sequential diagnostic strategy, has great influence on diagnostic accuracy and cost. Optimal sequential diagnostic strategy generation is an important step in the process of diagnosis system construction, which has been studied extensively in the literature. However, previous algorithms either are designed for single mode systems or do not consider test placement cost. They are not suitable to solve the sequential diagnostic strategy generation problem considering test placement cost for multimode systems. Therefore, this problem is studied in this paper. A formulation is presented. Two algorithms are proposed, one of which is realized by system transformation and the other is newly designed. Extensive simulations are carried out to test the effectiveness of the algorithms. A real-world system is also presented. All the results show that both of them have the ability to solve the diagnostic strategy generation problem, and they have different characteristics. PMID:26457709

  1. Real-Time Remote Diagnostic Monitoring Test-bed in JET

    Energy Technology Data Exchange (ETDEWEB)

    Castro, R. [Asociation Euratom/CIEMAT para Fusion, Madrid (Spain); Kneupner, K.; Purahoo, K. [EURATOM/UKAEA Fusion Association, Abingdon (United Kingdom); Vega, J.; Pereira, A.; Portas, A. [Association EuratomCIEMAT para Fusion, Madrid (Spain); De Arcas, G.; Lopez, J.M. [Universidad Politecnica de Madrid (Spain); Murari, A. [Consorzio RFX, Padova (Italy); Fonseca, A. [Associacao URATOM/IST, Lisboa (Portugal); Contributors, J.E. [JET-EFDA, Abingdon (United Kingdom)

    2009-07-01

    Based on the remote experimentation concept oriented to long pulse shots, a test-bed system has been implemented in JET. It integrates 2 functionalities. The first one is the real-time monitoring, on remote, of a reflectometer diagnostic, to visualize different data outputs and status information. The second one is the integration of dotJET (Diagnostic Overview Tool for JET), which internally provides at JET an overview about the current diagnostic systems state, in order to monitor, on remote, JET diagnostics status. The architecture of the system is formed by: the data generator components, the data distribution system, an access control service, and the client applications. In the test-bed there are two data generators: the acquisition equipment associated with the reflectometer diagnostic that generates data and status information, and dotJET server that centralize the access to the status information of JET diagnostics. The data distribution system has been implemented using a publishing-subscribing technology that receives data from data generators and redistributes them to client applications. And finally, for monitoring, a client application based on Java Web Start technology, and a dotJET client application have been used. There are 3 interesting results from this project. The first one is the analysis of different aspects (data formats, data frame rate, data resolution, etc) related with remote real-time diagnostic monitoring oriented to long pulse experiments. The second one is the definition and implementation of a flexible enough architecture, to be applied to different types of data generated from other diagnostics, and that fits with remote access requirements; and the third one is to have achieved a secure system, taking into account internal networks and firewalls aspects in JET, and securing the access from remote users. For this last issue, PAPI technology has been used, enabling access control based on user attributes, enabling mobile users to

  2. Diagnostic assays for active infection with human herpesvirus 6 (HHV-6).

    Science.gov (United States)

    Caserta, Mary T; Hall, Caroline Breese; Schnabel, Kenneth; Lofthus, Geraldine; Marino, Andrea; Shelley, Lynne; Yoo, Christina; Carnahan, Jennifer; Anderson, Linda; Wang, Hongyue

    2010-05-01

    Human herpesvirus 6 (HHV-6) causes ubiquitous infection in early childhood with lifelong latency or persistence. Reactivation of HHV-6 has been associated with multiple diseases including encephalitis. Chromosomal integration of HHV-6 also occurs. Previous studies have suggested that the detection of HHV-6 DNA in plasma is an accurate marker of active viral replication. We sought to determine whether PCR assays on plasma could correctly differentiate between primary HHV-6 infection, chromosomal integration of HHV-6 and latent HHV-6 infection. We performed qualitative PCR, real-time quantitative PCR (RQ-PCR), and reverse-transcriptase PCR (RT-PCR) assays on samples of peripheral and cord blood mononuclear cells, as well as plasma, from groups of subjects with well defined HHV-6 infection, including subjects with chromosomally integrated HHV-6. The detection of HHV-6 DNA in plasma was 92% sensitive compared to viral isolation for the identification of primary infection with HHV-6. All plasma samples from infants with chromosomally integrated HHV-6 had HHV-6 DNA detectable in plasma while only 5.6% were positive by RT-PCR. The specificity of plasma PCR for active replication of HHV-6 was 84% compared to viral culture while the specificity of RT-PCR was 98%. Our results demonstrate that qualitative or quantitative PCR of plasma is insufficient to distinguish between active viral replication and chromosomal integration with HHV-6. We found a higher specificity of RT-PCR performed on PBMC samples compared to PCR or RQ-PCR performed on plasma when evaluating samples for active HHV-6 replication. Copyright 2010 Elsevier B.V. All rights reserved.

  3. Comparative evaluation of a laboratory developed real-time PCR assay and the RealStar® HHV-6 PCR Kit for quantitative detection of human herpesvirus 6.

    Science.gov (United States)

    Yip, Cyril C Y; Sridhar, Siddharth; Cheng, Andrew K W; Fung, Ami M Y; Cheng, Vincent C C; Chan, Kwok-Hung; Yuen, Kwok-Yung

    2017-08-01

    HHV-6 reactivation in immunocompromised patients is common and may be associated with serious morbidity and mortality; therefore, early detection and initiation of therapy might be of benefit. Real-time PCR assays allow for early identification of HHV-6 reactivation to assist in providing a timely response. Thus, we compared the performance of an in-house developed HHV-6 quantitative PCR assay with a commercially available kit, the RealStar ® HHV-6 PCR Kit. The analytical sensitivity, analytical specificity, linearity, precision and accuracy of the in-house developed HHV-6 qPCR assay were evaluated. The diagnostic performance of the in-house HHV-6 qPCR assay was compared with the RealStar ® HHV-6 PCR Kit, using 72 clinical specimens and 17 proficiency testing samples. Linear regression analysis of the quantitative results showed a dynamic range from 2 to 10 log 10 copies/ml and a coefficient of determination (R 2 ) of 0.999 for the in-house assay. A dilution series demonstrated a limit of detection and a limit of quantification of 1.7 log 10 and 2 log 10 copies/ml, respectively. The precision of the assay was highly reproducible among runs with coefficients of variance (CV) ranging from 0.27% to 4.37%. A comparison of 27 matched samples showed an excellent correlation between the quantitative viral loads measured by the in-house HHV-6 qPCR assay and the RealStar ® HHV-6 PCR Kit (R 2 =0.926; PPCR Kit. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Background review for diagnostic test development for Zika virus infection.

    Science.gov (United States)

    Charrel, Rémi N; Leparc-Goffart, Isabelle; Pas, Suzan; de Lamballerie, Xavier; Koopmans, Marion; Reusken, Chantal

    2016-08-01

    To review the state of knowledge about diagnostic testing for Zika virus infection and identify areas of research needed to address the current gaps in knowledge. We made a non-systematic review of the published literature about Zika virus and supplemented this with information from commercial diagnostic test kits and personal communications with researchers in European preparedness networks. The review covered current knowledge about the geographical spread, pathogen characteristics, life cycle and infection kinetics of the virus. The available molecular and serological tests and biosafety issues are described and discussed in the context of the current outbreak strain. We identified the following areas of research to address current knowledge gaps: (i) an urgent assessment of the laboratory capacity and capability of countries to detect Zika virus; (ii) rapid and extensive field validation of the available molecular and serological tests in areas with and without Zika virus transmission, with a focus on pregnant women; (iii) monitoring the genomic diversity of circulating Zika virus strains; (iv) prospective studies into the virus infection kinetics, focusing on diagnostic sampling (specimen types, combinations and timings); and (v) developing external quality assessments for molecular and serological testing, including differential diagnosis for similar viruses and symptom clusters. The availability of reagents for diagnostic development (virus strains and antigens, quantified viral ribonucleic acid) needs to be facilitated. An international laboratory response is needed, including preparation of protocols for prospective studies to address the most pressing information needs.

  5. Establishment of a 10-Plex Quantitative Fluorescent-PCR Assay for rapid diagnosis of sex chromosome aneuploidies.

    Directory of Open Access Journals (Sweden)

    Xingmei Xie

    Full Text Available Sex chromosome aneuploidies occur commonly in the general population, with an incidence of 1 in 400 newborns. However, no tests specifically targeting sex chromosomes have been carried out in prenatal diagnosis or newborn screening, resulting in late recognition of these diseases. In this study, a rapid diagnostic method for sex chromosome aneuploidies was established using Quantitative Fluorescent-PCR (QF-PCR. Ten markers were included in one multiplex QF-PCR assay, including two sex determination genes (AMXY and SRY, five X-linked short tandem repeats (STRs; DXS1053, DXS981, DXS6809, DXS1187, and DXS8377, one X/Y-common STR (X22, and two autosomal STRs (D13S305 and D21S11. Retrospective tests of 70 cases with known cytogenetic results indicated that the 10-plex QF-PCR assay could well determine sex chromosome copy numbers by both allelic peak numbers and a sex chromosome dosage calculation with the autosomal STRs as internal controls. Prospective comparison with cytogenetic karyotyping on 534 cases confirmed that the 10-plex QF-PCR assay could be well employed for sex chromosome aneuploidy diagnosis in at least the Chinese Han population. This is the first QF-PCR test for the diagnosis of sex chromosome aneuploidies in the Chinese population. This test is superior to previous designs by including up to 8 sex-linked markers covering different parts of sex chromosomes as well as employing internal controls for copy number dosage calculation in a single PCR reaction. Due to simple technique and data analysis, as well as easy implementation within routine clinical services, this method is of great clinical application value and could be widely applied.

  6. Can Emergency Medicine Residents Predict Cost of Diagnostic Testing?

    Directory of Open Access Journals (Sweden)

    Tainter, Christopher R

    2017-01-01

    Full Text Available Diagnostic testing represents a significant portion of healthcare spending, and cost should be considered when ordering such tests. Needless and excessive spending may occur without an appreciation of the impact on the larger healthcare system. Knowledge regarding the cost of diagnostic testing among emergency medicine (EM residents has not previously been studied. A survey was administered to 20 EM residents from a single ACGME-accredited three-year EM residency program, asking for an estimation of patient charges for 20 commonly ordered laboratory tests and seven radiological exams. We compared responses between residency classes to evaluate whether there was a difference based on level of training. The survey completion rate was 100% (20/20 residents. We noted significant discrepancies between the median resident estimates and actual charge to patient for both laboratory and radiological exams. Nearly all responses were an underestimate of the actual cost. The group median underestimation for laboratory testing was $114, for radiographs $57, and for computed tomography exams was $1,058. There was improvement in accuracy with increasing level of training. This pilot study demonstrates that EM residents have a poor understanding of the charges burdening patients and health insurance providers. In order to make balanced decisions with regard to diagnostic testing, providers must appreciate these factors. Education regarding the cost of providing emergency care is a potential area for improvement of EM residency curricula, and warrants further attention and investigation.

  7. Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

    Science.gov (United States)

    Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

    2003-01-01

    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom had no other laboratory evidence of S. pneumoniae infection). Buffy coat samples from two control patients (neither having evidence of S. pneumoniae infection), but no control plasma samples, were PCR positive. Although pneumococcal antigen was detected in the urine from 120 of 420 (29%) patients, only 4 of 227 (2%) urine samples tested were PCR positive. Overall, 256 of 318 (81%) patients had PCR-positive sputum samples, including 58 of 59 samples from which S. pneumoniae was cultured. Throat swab samples from 229 of 417 (55%) patients were PCR positive and, in those who produced sputum, 96% also had positive PCR results from sputum. Throat swabs from 73 of 126 (58%) control patients were also PCR positive. We conclude that the pneumolysin PCR assay adds little to existing diagnostic tests for S. pneumoniae and is unable to distinguish colonization from infection when respiratory samples are tested. PMID:12517826

  8. Optimization and Evaluation of a PCR Assay for Detecting Toxoplasmic Encephalitis in Patients with AIDS

    Science.gov (United States)

    Joseph, Priya; Calderón, Maritza M.; Gilman, Robert H.; Quispe, Monica L.; Cok, Jaime; Ticona, Eduardo; Chavez, Victor; Jimenez, Juan A.; Chang, Maria C.; Lopez, Martín J.; Evans, Carlton A.

    2002-01-01

    Toxoplasma gondii is a common life-threatening opportunistic infection. We used experimental murine T. gondii infection to optimize the PCR for diagnostic use, define its sensitivity, and characterize the time course and tissue distribution of experimental toxoplasmosis. PCR conditions were adjusted until the assay reliably detected quantities of DNA derived from less than a single parasite. Forty-two mice were inoculated intraperitoneally with T. gondii tachyzoites and sacrificed from 6 to 72 h later. Examination of tissues with PCR and histology revealed progression of infection from blood to lung, heart, liver, and brain, with PCR consistently detecting parasites earlier than microscopy and with no false-positive results. We then evaluated the diagnostic value of this PCR assay in human patients. We studied cerebrospinal fluid and serum samples from 12 patients with AIDS and confirmed toxoplasmic encephalitis (defined as positive mouse inoculation and/or all of the Centers for Disease Control clinical diagnostic criteria), 12 human immunodeficiency virus-infected patients with suspected cerebral toxoplasmosis who had neither CDC diagnostic criteria nor positive mouse inoculation, 26 human immunodeficiency virus-infected patients with other opportunistic infections and no signs of cerebral toxoplasmosis, and 18 immunocompetent patients with neurocysticercosis. Eleven of the 12 patients with confirmed toxoplasmosis had positive PCR results in either blood or cerebrospinal fluid samples (6 of 9 blood samples and 8 of 12 cerebrospinal fluid samples). All samples from control patients were negative. This study demonstrates the high sensitivity, specificity, and clinical utility of PCR in the diagnosis of toxoplasmic encephalitis in a resource-poor setting. PMID:12454142

  9. Laboratory development and testing of spacecraft diagnostics

    Science.gov (United States)

    Amatucci, William; Tejero, Erik; Blackwell, Dave; Walker, Dave; Gatling, George; Enloe, Lon; Gillman, Eric

    2017-10-01

    The Naval Research Laboratory's Space Chamber experiment is a large-scale laboratory device dedicated to the creation of large-volume plasmas with parameters scaled to realistic space plasmas. Such devices make valuable contributions to the investigation of space plasma phenomena under controlled, reproducible conditions, allowing for the validation of theoretical models being applied to space data. However, in addition to investigations such as plasma wave and instability studies, such devices can also make valuable contributions to the development and testing of space plasma diagnostics. One example is the plasma impedance probe developed at NRL. Originally developed as a laboratory diagnostic, the sensor has now been flown on a sounding rocket, is included on a CubeSat experiment, and will be included on the DoD Space Test Program's STP-H6 experiment on the International Space Station. In this talk, we will describe how the laboratory simulation of space plasmas made this development path possible. Work sponsored by the US Naval Research Laboratory Base Program.

  10. 30 CFR 250.523 - How long do I keep records of casing pressure and diagnostic tests?

    Science.gov (United States)

    2010-07-01

    ... and diagnostic tests? 250.523 Section 250.523 Mineral Resources MINERALS MANAGEMENT SERVICE... casing pressure and diagnostic tests? Records of casing pressure and diagnostic tests must be kept at the field office nearest the well for a minimum of 2 years. The last casing diagnostic test for each casing...

  11. Development and customization of a color-coded microbeads-based assay for drug resistance in HIV-1 reverse transcriptase.

    Science.gov (United States)

    Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki

    2014-01-01

    Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.

  12. Helicobacter pylori diagnostic tests in children: review of the literature from 1999 to 2009.

    Science.gov (United States)

    Guarner, Jeannette; Kalach, Nicolas; Elitsur, Yoram; Koletzko, Sibylle

    2010-01-01

    The array of tests that can be used for diagnosis of Helicobacter pylori infection is large, and it can be confusing to define which test to use particularly in children where results may not be comparable to those obtained in adult patients. Using PubMed, we reviewed the English literature from January 1999 to May 2009 to identify articles that determined sensitivity and specificity of H. pylori invasive and non-invasive diagnostic tests in children. We excluded articles that presented a review of the literature, abstracts, case reports, or series where children's results could not be separated from adult populations. Of the tissue based methods, rapid urease tests have better sensitivity than histology to detect presence of H. pylori; however, histology can detect the pathology associated with disease including gastritis, intestinal metaplasia, and other conditions that could be the cause of the child's symptoms. Culture of gastric tissues or stool has 100% specificity but sensitivity is low. Of the serologic tests, immunoblot has the best sensitivity. The urea breath tests have >75% sensitivity for detection of H. pylori before and after treatment. Immunoassays in stool using monoclonal antibodies have >95% sensitivity for detection of H. pylori before and after treatment. PCR testing can be performed in tissue and stool samples and can detect genes associated to antibiotic resistance. In summary, the current commercial non-invasive tests have adequate sensitivity and specificity for detecting the presence of H. pylori; however, endoscopy with histopathology is the only method that can detect H. pylori and lesions associated with the infection.

  13. PCR testing can be as accurate as culture for diagnosis of Ichthyophonus hoferi in Yukon River Chinook salmon Oncorhynchus tshawytscha .

    Science.gov (United States)

    Hamazaki, Toshihide; Kahler, Eryn; Borba, Bonnie M; Burton, Tamara

    2013-07-09

    We evaluated the comparability of culture and PCR tests for detecting Ichthyophonus in Yukon River Chinook salmon Oncorhynchus tshawytscha from field samples collected at 3 locations (Emmonak, Chena, and Salcha, Alaska, USA) in 2004, 2005, and 2006. Assuming diagnosis by culture as the 'true' infection status, we calculated the sensitivity (correctly identifying fish positive for Ichthyophonus), specificity (correctly identifying fish negative for Ichthyophonus), and accuracy (correctly identifying both positive and negative fish) of PCR. Regardless of sampling locations and years, sensitivity, specificity, and accuracy exceeded 90%. Estimates of infection prevalence by PCR were similar to those by culture, except for Salcha 2005, where prevalence by PCR was significantly higher than that by culture (p < 0.0001). These results show that the PCR test is comparable to the culture test for diagnosing Ichthyophonus infection.

  14. Evaluation and comparison of multiple test methods, including real-time PCR, for Legionella detection in clinical specimens.

    Directory of Open Access Journals (Sweden)

    Adriana Peci

    2016-08-01

    Full Text Available Legionella is a gram-negative bacterium that can cause Pontiac fever, a mild upper respiratory infection and Legionnaire’s disease, a more severe illness. We aimed to compare the performance of urine antigen, culture and PCR test methods and to determine if sputum is an alternative to the use of more invasive bronchoalveolar lavage (BAL. Data for this study included specimens tested for Legionella at PHOL from January 1, 2010 to April 30, 2014, as part of routine clinical testing. We found sensitivity of UAT compared to culture to be 87%, specificity 94.7%, positive predictive value (PPV 63.8% and negative predictive value (NPV 98.5%. Sensitivity of UAT compared to PCR was 74.7%, specificity 98.3%, PPV 77.7% and NPV 98.1%. Of 146 patients who had a Legionella positive result by PCR, only 66(45.2% also had a positive result by culture. Sensitivity for culture was the same using either sputum or BAL (13.6%; sensitivity for PCR was 10.3% for sputum and 12.8% for BAL. Both sputum and BAL yield similar results despite testing methods (Fisher Exact p-values=1.0, for each test. In summary, all test methods have inherent weaknesses in identifying Legionella; thereforemore than one testing method should be used. Obtaining a single specimen type from patients with pneumonia limits the ability to diagnose Legionella, particularly when urine is the specimen type submitted. Given ease of collection, and similar sensitivity to BAL, clinicians are encouraged to submit sputum in addition to urine when BAL submission is not practical, from patients being tested for Legionella.

  15. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa.

    Science.gov (United States)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R; Wadsworth, Jemma; Mioulet, Valerie; Sallu, Raphael; Belsham, Graham J; Kasanga, Christopher J; Knowles, Nick J; King, Donald P

    2016-11-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce C T values comparable to the pan-diagnostic test detecting the 3D-coding region. These assays were evaluated alongside the established pan-specific molecular test using field samples and virus isolates collected from Tanzania, Kenya and Ethiopia that had been previously characterised by nucleotide sequencing. Samples (n=71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Aquifer test interpretation using derivative analysis and diagnostic plots

    Science.gov (United States)

    Hernández-Espriú, Antonio; Real-Rangel, Roberto; Cortés-Salazar, Iván; Castro-Herrera, Israel; Luna-Izazaga, Gabriela; Sánchez-León, Emilio

    2017-04-01

    Pumping tests remain a method of choice to deduce fundamental aquifer properties and to assess well condition. In the oil and gas (O&G) industry, well testing has been the core technique in examining reservoir behavior over the last 50 years. The pressure derivative by Bourdet, it is perhaps, the most significant single development in the history of well test analysis. Recently, the so-called diagnostics plots (e.g. drawdown and drawdown derivative in a log-log plot) have been successfully tested in aquifers. However, this procedure is still underutilized by groundwater professionals. This research illustrates the applicability range, advantages and drawbacks (e.g. smoothing procedures) of diagnostic plots using field examples from a wide spectrum of tests (short/long tests, constant/variable flow rates, drawdown/buildup stages, pumping well/observation well) in dissimilar geological conditions. We analyze new and pre-existent aquifer tests in Mexico, USA, Canada, Germany, France and Saudi Arabia. In constant flow rate tests, our results show that derivative analysis is an easy, robust and powerful tool to assess near-borehole damage effects, formation heterogeneity, boundaries, flow regimes, infinite-acting radial stages, i.e., valid Theisian framework, and fracture-driven flow. In step tests, the effectiveness relies on high-frequency drawdown measurements. Moreover, we adapt O&G analytical solutions to cater for the conditions in groundwater systems. In this context, further parameters can be computed analytically from the plots, such as skin factor, head losses, wellbore storage, distance to the boundary, channel-aquifer and/or fracture zone width, among others. Therefore, diagnostic plots should be considered a mandatory tool for pumping tests analysis among hydrogeologists. This project has been supported by DGAPA (UNAM) under the research project PAPIIT IN-112815.

  17. Validation of the multiplex PCR for identification of Brucella spp.

    Directory of Open Access Journals (Sweden)

    Lívia de Lima Orzil

    2016-05-01

    Full Text Available ABSTRACT: A multiplex PCR technique for detection of Brucella spp. in samples of bacterial suspension was validated as a complementary tool in the diagnosis of the disease. This technique allows the characterization of the agent without performing biochemical tests, which greatly reduces the time for a final diagnosis, and provides more security for the analyst by reducing the time of exposure to microorganisms. The validation was performed in accordance with the Manual of Diagnostic Tests from OIE (2008 and following the requirements present in the ABNT NBR ISO/IEC 17025:2005. The mPCR validated in this study identified the different species of Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis of bacterial suspension obtained from the slaughterhouse samples, as well as distinguished the biovars (1, 2 e 4; 3b, 5, 6 e 9 of B. abortus in grouped form and differentiated the field strains from vaccine strains, as a quick, useful and less expensive technique in diagnosis of brucellosis in Brazil.

  18. Latent class analysis of the diagnostic characteristics of PCR and conventional bacteriological culture in diagnosing intramammary infections caused by Staphylococcus aureus in dairy cows at dry off

    Directory of Open Access Journals (Sweden)

    Cederlöf Sara Ellinor

    2012-11-01

    Full Text Available Abstract Background Staphylococcus aureus is one of the most common causes of intramammary infections in dairy cows at dry off. Reliable identification is important for disease management on herd level and for antimicrobial treatment of infected animals. Our objective was to evaluate the test characteristics of PathoProof ™ Mastitis PCR Assay and bacteriological culture (BC in diagnosing bovine intramammary infections caused by S. aureus at dry off at different PCR cycle threshold (Ct-value cut-offs. Methods Sterile quarter samples and non-sterile composite samples from 140 animals in seven herds were collected in connection with the dairy herd improvement (DHI milk recording. All quarter samples were analyzed using BC whereas all composite samples were analyzed with PathoProof ™ Mastitis PCR Assay. Latent class analysis was used to estimate test properties for PCR and BC in the absence of a perfect reference test. The population was divided into two geographically divided subpopulations and the Hui-Walter 2-test 2-populations model applied to estimate Se, Sp for the two tests, and prevalence for the two subpopulations. Results The Se for PCR increased with increasing Ct-value cut-off, accompanied by a small decrease in Sp. For BC the Se decreased and Sp increased with increasing Ct-value cut-off. Most optimal test estimates for the real-time PCR assay were at a Ct-value cut-off of 37; 0.93 [95% posterior probability interval (PPI 0.60-0.99] for Se and 0.95 [95% PPI 0.95-0.99] for Sp. At the same Ct-value cut-off, Se and Sp for BC were 0.83 [95% PPI 0.66-0.99] and 0.97 [95% PPI 0.91-0.99] respectively. Depending on the chosen PCR Ct-value cut-off, the prevalence in the subpopulations varied; the prevalence increased with increasing PCR Ct-value cut-offs. Conclusion Neither BC nor real-time PCR is a perfect test in detecting IMI in dairy cows at dry off. The changes in sensitivity and prevalence at different Ct-value cut-offs for both PCR and

  19. Assessing Old and New Diagnostic Tests for Gastroesophageal Reflux Disease.

    Science.gov (United States)

    Vaezi, Michael F; Sifrim, Daniel

    2018-01-01

    A detailed critique of objective measurements of gastroesophageal reflux disease (GERD) would improve management of patients suspecting of having reflux, leading to rational selection of treatment and better outcomes. Many diagnostic tests for GERD have been developed over the past decades. We analyze their development, positive- and negative-predictive values, and ability to predict response to treatment. These features are important for development of medical, surgical, and endoscopic therapies for GERD. We discuss the value of available diagnostic tests and review their role in management of patients with persistent reflux symptoms despite adequate medical or surgical treatment. This is becoming a significant health economic problem, due to the widespread use of proton pump inhibitors. GERD is believed to cause nonesophageal symptoms, such as those provoked by ear, nose, throat, or respiratory disorders. We analyze the value of GERD diagnostic tests in evaluation of these troublesome, nonesophageal symptoms. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

  20. A multiplexed reverse transcriptase PCR assay for identification of viral respiratory pathogens at point-of-care

    Energy Technology Data Exchange (ETDEWEB)

    Letant, S E; .Ortiz, J I; Tammero, L; Birch, J M; Derlet, R W; Cohen, S; Manning, D; McBride, M T

    2007-04-11

    We have developed a nucleic acid-based assay that is rapid, sensitive, specific, and can be used for the simultaneous detection of 5 common human respiratory pathogens including influenza A, influenza B, parainfluenza type 1 and 3, respiratory syncytial virus, and adenovirus group B, C, and E. Typically, diagnosis on an un-extracted clinical sample can be provided in less than 3 hours, including sample collection, preparation, and processing, as well as data analysis. Such a multiplexed panel would enable rapid broad-spectrum pathogen testing on nasal swabs, and therefore allow implementation of infection control measures, and timely administration of antiviral therapies. This article presents a summary of the assay performance in terms of sensitivity and specificity. Limits of detection are provided for each targeted respiratory pathogen, and result comparisons are performed on clinical samples, our goal being to compare the sensitivity and specificity of the multiplexed assay to the combination of immunofluorescence and shell vial culture currently implemented at the UCDMC hospital. Overall, the use of the multiplexed RT-PCR assay reduced the rate of false negatives by 4% and reduced the rate of false positives by up to 10%. The assay correctly identified 99.3% of the clinical negatives, 97% of adenovirus, 95% of RSV, 92% of influenza B, and 77% of influenza A without any extraction performed on the clinical samples. The data also showed that extraction will be needed for parainfluenza virus, which was only identified correctly 24% of the time on un-extracted samples.

  1. Evaluation of Legionella real-time PCR against traditional culture for routine and public health testing of water samples.

    Science.gov (United States)

    Collins, S; Stevenson, D; Walker, J; Bennett, A

    2017-06-01

    To evaluate the usefulness of Legionella qPCR alongside traditional culture for enumeration of Legionella from water samples as part of both routine and public health investigation testing. Routine water samples (n = 2002) and samples from public health investigations (n = 215) were analysed by culture and qPCR for Legionella spp., Legionella pneumophila and L. pneumophila sg-1. A negative qPCR result was highly predictive of a negative culture result for all water systems (negative predictive values, NPV from 97·4 to 100%). Positive predictive values (PPV) were lower (0-50%). Results for qPCR were generally larger than culture with average log 10 differences of 1·1 for Legionella spp. and 1·2 for L. pneumophila. Alert and action levels of 1000 and 10 000 GU per litre, respectively, are proposed for Legionella qPCR for hot and cold water systems (HCWS). The use of qPCR significantly reduced the time to results for public health investigations by rapidly identifying potential sources and ruling out others, thus enabling a more rapid and efficient response. The high NPV of qPCR supports its use to rapidly screen out negative samples without culture. Alert and action levels for Legionella qPCR for HCWS are proposed. Quantitative PCR will be a valuable tool for both routine and public health testing. This study generated comparative data of >2000 water samples by qPCR and culture. Action and alert levels have been recommended that could enable duty holders to interpret qPCR results to facilitate timely Legionella control and public health protection. © 2017 Crown copyright. Journal of Applied Microbiology © 2017 The Society for Applied Microbiology.

  2. A Simple, High-Throughput Assay for Fragile X Expanded Alleles Using Triple Repeat Primed PCR and Capillary Electrophoresis

    Science.gov (United States)

    Lyon, Elaine; Laver, Thomas; Yu, Ping; Jama, Mohamed; Young, Keith; Zoccoli, Michael; Marlowe, Natalia

    2010-01-01

    Population screening has been proposed for Fragile X syndrome to identify premutation carrier females and affected newborns. We developed a PCR-based assay capable of quickly detecting the presence or absence of an expanded FMR1 allele with high sensitivity and specificity. This assay combines a triplet repeat primed PCR with high-throughput automated capillary electrophoresis. We evaluated assay performance using archived samples sent for Fragile X diagnostic testing representing a range of Fragile X CGG-repeat expansions. Two hundred five previously genotyped samples were tested with the new assay. Data were analyzed for the presence of a trinucleotide “ladder” extending beyond 55 repeats, which was set as a cut-off to identify expanded FMR1 alleles. We identified expanded FMR1 alleles in 132 samples (59 premutation, 71 full mutation, 2 mosaics) and normal FMR1 alleles in 73 samples. We found 100% concordance with previous results from PCR and Southern blot analyses. In addition, we show feasibility of using this assay with DNA extracted from dried-blood spots. Using a single PCR combined with high-throughput fragment analysis on the automated capillary electrophoresis instrument, we developed a rapid and reproducible PCR-based laboratory assay that meets many of the requirements for a first-tier test for population screening. PMID:20431035

  3. Introduction of a dermatophyte polymerase chain reaction assay to the diagnostic mycology service in Scotland.

    Science.gov (United States)

    Alexander, C L; Shankland, G S; Carman, W; Williams, C

    2011-05-01

    Dermatophytes are the major cause of superficial mycoses in samples submitted to Clinical Mycology, Glasgow. The most prevalent species is Trichophyton rubrum as identified classically by microscopy and culture. Recent advances in polymerase chain reaction (PCR) technology were examined for the feasibility of introducing a T. rubrum real-time PCR assay into a routine diagnostic service. To improve the diagnostic mycology service by the introduction of a real-time PCR test for T. rubrum. The DNA from 4972 nail and skin samples was obtained using the Qiagen QIAsymphony automated extractor. This DNA was subjected to real-time PCR using T. rubrum-specific primers and a probe. During phase 1 of the study, 862 samples were analysed; 446 of 470 specimens that grew T. rubrum were detected by PCR. Out of 4110 samples analysed during phase 2, 753 T. rubrum infections were diagnosed and reported within 72 h. A total of 3357 samples were negative for a fungal infection by PCR and microscopy; these were also reported within 72 h. A vast reduction in the turnaround times can be achieved using this technique as opposed to classical methods. Samples which are PCR negative but microscopy positive are still subjected to culture. Screening samples for their suitability for PCR prior to processing eliminates the application of PCR for T. rubrum on inappropriate samples such those from the scalp or pityriasis versicolor. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.

  4. Evaluation and Comparison of Multiple Test Methods, Including Real-time PCR, for Legionella Detection in Clinical Specimens

    Science.gov (United States)

    Peci, Adriana; Winter, Anne-Luise; Gubbay, Jonathan B.

    2016-01-01

    Legionella is a Gram-negative bacterium that can cause Pontiac fever, a mild upper respiratory infection and Legionnaire’s disease, a more severe illness. We aimed to compare the performance of urine antigen, culture, and polymerase chain reaction (PCR) test methods and to determine if sputum is an acceptable alternative to the use of more invasive bronchoalveolar lavage (BAL). Data for this study included specimens tested for Legionella at Public Health Ontario Laboratories from 1st January, 2010 to 30th April, 2014, as part of routine clinical testing. We found sensitivity of urinary antigen test (UAT) compared to culture to be 87%, specificity 94.7%, positive predictive value (PPV) 63.8%, and negative predictive value (NPV) 98.5%. Sensitivity of UAT compared to PCR was 74.7%, specificity 98.3%, PPV 77.7%, and NPV 98.1%. Out of 146 patients who had a Legionella-positive result by PCR, only 66 (45.2%) also had a positive result by culture. Sensitivity for culture was the same using either sputum or BAL (13.6%); sensitivity for PCR was 10.3% for sputum and 12.8% for BAL. Both sputum and BAL yield similar results regardless testing methods (Fisher Exact p-values = 1.0, for each test). In summary, all test methods have inherent weaknesses in identifying Legionella; therefore, more than one testing method should be used. Obtaining a single specimen type from patients with pneumonia limits the ability to diagnose Legionella, particularly when urine is the specimen type submitted. Given ease of collection and similar sensitivity to BAL, clinicians are encouraged to submit sputum in addition to urine when BAL submission is not practical from patients being tested for Legionella. PMID:27630979

  5. Molecular docking and 3D-QSAR studies on triazolinone and pyridazinone, non-nucleoside inhibitor of HIV-1 reverse transcriptase.

    Science.gov (United States)

    Sivan, Sree Kanth; Manga, Vijjulatha

    2010-06-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.

  6. Dry Eye Disease: Concordance Between the Diagnostic Tests in African Eyes.

    Science.gov (United States)

    Onwubiko, Stella N; Eze, Boniface I; Udeh, Nnenma N; Onwasigwe, Ernest N; Umeh, Rich E

    2016-11-01

    To assess the concordance between the diagnostic tests for dry eye disease (DED) in a Nigerian hospital population. The study was a hospital-based cross-sectional survey of adults (≥18 years) presenting at the eye clinic of the University of Nigeria Teaching Hospital (UNTH), Enugu; September-December, 2011. Participants' socio-demographic data were collected. Each subject was assessed for DED using the "Ocular Surface Disease Index" (OSDI) questionnaire, tear-film breakup time (TBUT), and Schirmer test. The intertest concordance was assessed using kappa statistic, correlation, and regression coefficients. The participants (n=402; men: 193) were aged 50.1±19.1 standard deviation years (range: 18-94 years). Dry eye disease was diagnosed in 203 by TBUT, 170 by Schirmer test, and 295 by OSDI; the concordance between the tests were OSDI versus TBUT (Kappa, κ=-0.194); OSDI versus Schirmer (κ=-0.276); and TBUT versus Schirmer (κ=0.082). Ocular Surface Disease Index was inversely correlated with Schirmer test (Spearman ρ=-0.231, P<0.001) and TBUT (ρ=-0.237, P<0.001). In the linear regression model, OSDI was poorly predicted by TBUT (β=-0.09; 95% confidence interval (CI): -0.26 to -0.03, P=0.14) and Schirmer test (β=-0.35, 95% CI: -0.53 to -0.18, P=0.18). At UNTH, there is poor agreement, and almost equal correlation, between the subjective and objective tests for DED. Therefore, the selection of diagnostic test for DED should be informed by cost-effectiveness and diagnostic resource availability, not diagnostic efficiency or utility.

  7. qPCR-High resolution melt analysis for drug susceptibility testing of Mycobacterium leprae directly from clinical specimens of leprosy patients.

    Science.gov (United States)

    Araujo, Sergio; Goulart, Luiz Ricardo; Truman, Richard W; Goulart, Isabela Maria B; Vissa, Varalakshmi; Li, Wei; Matsuoka, Masanori; Suffys, Philip; Fontes, Amanda B; Rosa, Patricia S; Scollard, David M; Williams, Diana L

    2017-06-01

    Real-Time PCR-High Resolution Melting (qPCR-HRM) analysis has been recently described for rapid drug susceptibility testing (DST) of Mycobacterium leprae. The purpose of the current study was to further evaluate the validity, reliability, and accuracy of this assay for M. leprae DST in clinical specimens. The specificity and sensitivity for determining the presence and susceptibility of M. leprae to dapsone based on the folP1 drug resistance determining region (DRDR), rifampin (rpoB DRDR) and ofloxacin (gyrA DRDR) was evaluated using 211 clinical specimens from leprosy patients, including 156 multibacillary (MB) and 55 paucibacillary (PB) cases. When comparing the results of qPCR-HRM DST and PCR/direct DNA sequencing, 100% concordance was obtained. The effects of in-house phenol/chloroform extraction versus column-based DNA purification protocols, and that of storage and fixation protocols of specimens for qPCR-HRM DST, were also evaluated. qPCR-HRM results for all DRDR gene assays (folP1, rpoB, and gyrA) were obtained from both MB (154/156; 98.7%) and PB (35/55; 63.3%) patients. All PCR negative specimens were from patients with low numbers of bacilli enumerated by an M. leprae-specific qPCR. We observed that frozen and formalin-fixed paraffin embedded (FFPE) tissues or archival Fite's stained slides were suitable for HRM analysis. Among 20 mycobacterial and other skin bacterial species tested, only M. lepromatosis, highly related to M. leprae, generated amplicons in the qPCR-HRM DST assay for folP1 and rpoB DRDR targets. Both DNA purification protocols tested were efficient in recovering DNA suitable for HRM analysis. However, 3% of clinical specimens purified using the phenol/chloroform DNA purification protocol gave false drug resistant data. DNA obtained from freshly frozen (n = 172), formalin-fixed paraffin embedded (FFPE) tissues (n = 36) or archival Fite's stained slides (n = 3) were suitable for qPCR-HRM DST analysis. The HRM-based assay was also able to

  8. PCR-based clonality analysis of B-cell lymphomas in paraffin-embedded tissues: diagnostic value of immunoglobulin kappa and lambda light chain gene rearrangement investigation.

    Science.gov (United States)

    Amara, Khaled; Trimeche, Mounir; Ziadi, Sonia; Sriha, Badreddine; Mokni, Moncef; Korbi, Sadok

    2006-01-01

    Polymerase chain reaction (PCR)-based analysis, employed for detecting immunoglobulin heavy chain (IgH) gene rearrangements, has become a diagnostic tool widely used in the investigation of B-cell lymphomas, but the overall sensitivity of these methods does not exceed 80%, notably in germinal center (GC) and post-GC B-cell origin lymphomas. Many PCR strategies devised for detecting immunoglobulin light chain (IgL) gene rearrangements have been developed to enhance the clonality detection rates. However, the feasibility of these methods in routine clinical diagnosis using paraffin-embedded tissues has not yet been investigated sufficiently. We studied a large series of 108 cases of B-cell lymphomas, as well as 20 reactive lymphoid tissues using degenerate primers to amplify immunoglobulin kappa (Igkappa) and lambda (Iglambda) light chain genes. B-cell clonality was further investigated using semi-nested PCR for IgH gene rearrangements. B-cell clonality was detected in 74%, 56.5%, and 43.5% of cases using IgH, Igkappa, and Iglambda PCR, respectively. By combining these methods, the clonality detection rate increased to 93.5%. Only polyclonal patterns were noted in reactive lymphoid samples. We concluded that in addition to the established methods for IgH analysis, a PCR-based approach for IgL gene rearrangements analysis improves the clonality detection rate in over 90% of B-cell lymphoma cases using routine histological specimens with poor preservation of the genomic DNA.

  9. Genetic test utilization and diagnostic yield in adult patients with neurological disorders.

    Science.gov (United States)

    Bardakjian, Tanya M; Helbig, Ingo; Quinn, Colin; Elman, Lauren B; McCluskey, Leo F; Scherer, Steven S; Gonzalez-Alegre, Pedro

    2018-03-28

    To determine the diagnostic yield of different genetic test modalities in adult patients with neurological disorders, we evaluated all adult patients seen for genetic diagnostic evaluation in the outpatient neurology practice at the University of Pennsylvania between January 2016 and April 2017 as part of the newly created Penn Neurogenetics Program. Subjects were identified through our electronic medical system as those evaluated by the Program's single clinical genetic counselor in that period. A total of 377 patients were evaluated by the Penn Neurogenetics Program in different settings and genetic testing recommended. Of those, 182 (48%) were seen in subspecialty clinic setting and 195 (52%) in a General Neurogenetics Clinic. Genetic testing was completed in over 80% of patients in whom it was recommended. The diagnostic yield was 32% across disease groups. Stratified by testing modality, the yield was highest with directed testing (50%) and array comparative genomic hybridization (45%), followed by gene panels and exome testing (25% each). In conclusion, genetic testing can be successfully requested in clinic in a large majority of adult patients. Age is not a limiting factor for a genetic diagnostic evaluation and the yield of clinical testing across phenotypes (almost 30%) is consistent with previous phenotype-focused or research-based studies. These results should inform the development of specific guidelines for clinical testing and serve as evidence to improve reimbursement by insurance payers.

  10. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  11. Efficient Noninferiority Testing Procedures for Simultaneously Assessing Sensitivity and Specificity of Two Diagnostic Tests

    Directory of Open Access Journals (Sweden)

    Guogen Shan

    2015-01-01

    Full Text Available Sensitivity and specificity are often used to assess the performance of a diagnostic test with binary outcomes. Wald-type test statistics have been proposed for testing sensitivity and specificity individually. In the presence of a gold standard, simultaneous comparison between two diagnostic tests for noninferiority of sensitivity and specificity based on an asymptotic approach has been studied by Chen et al. (2003. However, the asymptotic approach may suffer from unsatisfactory type I error control as observed from many studies, especially in small to medium sample settings. In this paper, we compare three unconditional approaches for simultaneously testing sensitivity and specificity. They are approaches based on estimation, maximization, and a combination of estimation and maximization. Although the estimation approach does not guarantee type I error, it has satisfactory performance with regard to type I error control. The other two unconditional approaches are exact. The approach based on estimation and maximization is generally more powerful than the approach based on maximization.

  12. Development of a diagnostic kit for Tamiflu-resistant influenze A (H1N1)

    Energy Technology Data Exchange (ETDEWEB)

    Jung, I. L.

    2012-12-15

    Using by pre-developed multiplex RT-PCR kit that is able to diagnosis Tamiflu-sensitive and -resistant Swine Influenza A (H1N1) in the 1st research year, reproducibility and sentitivity of the kit has been investigated in this year. The optimum concentration of reverse transcriptase has also been determined and the economic evaluation has been carried out in this year. Based on the results, a international patent has been applied and a domestic patent has been registered in this year.

  13. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR

    Science.gov (United States)

    Droplet digital Polymerase chain reaction (ddPCR) is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. It is a promising DNA quantification technology for medical diagnostics but there are only a few reports of its use for plant pat...

  14. Compounding diagnostic delays: a qualitative study of point-of-care testing in South Africa.

    Science.gov (United States)

    Engel, Nora; Davids, Malika; Blankvoort, Nadine; Pai, Nitika Pant; Dheda, Keertan; Pai, Madhukar

    2015-04-01

    Successful point-of-care (POC) testing (completion of test-and-treat cycle in one patient encounter) has immense potential to reduce diagnostic and treatment delays, and improve patient and public health outcomes. We explored what tests are done and how in public/private, rural/urban hospitals and clinics in South Africa and whether they can ensure successful POC testing. This qualitative research study examined POC testing across major diseases in Cape Town, Durban and Eastern Cape. We conducted 101 semi-structured interviews and seven focus group discussions with doctors, nurses, community health workers, patients, laboratory technicians, policymakers, hospital managers and diagnostic manufacturers. In South Africa, diagnostics are characterised by a centralised system. Most tests conducted on the spot can be made to work successfully as POC tests. The majority of public/private clinics and smaller hospitals send samples via couriers to centralised laboratories and retrieve results the same way, via internet, fax or phone. The main challenge to POC testing lies in transporting samples and results, while delays risk patient loss from diagnostic/treatment pathways. Strategies to deal with associated delays create new problems, such as artificially prolonged turnaround times, strains on human resources and quality of testing, compounding additional diagnostic and treatment delays. For POC testing to succeed, particular characteristics of diagnostic ecosystems and adaptations of professional practices to overcome associated challenges must be taken into account. © 2014 John Wiley & Sons Ltd.

  15. Development of a highly sensitive one-tube nested real-time PCR for detecting Mycobacterium tuberculosis.

    Science.gov (United States)

    Choi, Yeonim; Jeon, Bo-Young; Shim, Tae Sun; Jin, Hyunwoo; Cho, Sang-Nae; Lee, Hyeyoung

    2014-12-01

    Rapid, accurate detection of Mycobacterium tuberculosis is crucial in the diagnosis of tuberculosis (TB), but conventional diagnostic methods have limited sensitivity and specificity or are time consuming. A new highly sensitive nucleic acid amplification test, combined nested and real-time polymerase chain reaction (PCR) in a single tube (one-tube nested real-time PCR), was developed for detecting M. tuberculosis, which takes advantage of two PCR techniques, i.e., nested PCR and real-time PCR. One-tube nested real-time PCR was designed to have two sequential reactions with two sets of primers and dual probes for the insertion sequence (IS) 6110 sequence of M. tuberculosis in a single closed tube. The minimum limits of detection of IS6110 real-time PCR and IS6110 one-tube nested real-time PCR were 100 fg/μL and 1 fg/μL of M. tuberculosis DNA, respectively. AdvanSure TB/non-tuberculous mycobacteria (NTM) real-time PCR, IS6110 real-time PCR, and two-tube nested real-time PCR showed 100% sensitivity and 100% specificity for clinical M. tuberculosis isolates and NTM isolates. In comparison, the sensitivities of AdvanSure TB/NTM real-time PCR, single IS6110 real-time PCR, and one-tube nested real-time PCR were 91% (152/167), 94.6% (158/167), and 100% (167/167) for sputum specimens, respectively. In conclusion, IS6110 one-tube nested real-time PCR is useful for detecting M. tuberculosis due to its high sensitivity and simple manipulation. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Latent class analysis of real time qPCR and bacteriological culturing for the diagnosis of Streptococcus agalactiae in cow composite milk samples

    DEFF Research Database (Denmark)

    Holmøy, Ingrid H.; Toft, Nils; Jørgensen, Hannah J.

    2018-01-01

    Streptococcus agalactiae (S. agalactiae) has re-emerged as a mastitis pathogen among Norwegian dairy cows. The Norwegian cattle health services recommend that infected herds implement measures to eradicate S. agalactiae, this includes a screening of milk samples from all lactating cows....... The performance of the qPCR-test currently in use for this purpose has not been evaluated under field conditions. The objective of this study was to estimate the sensitivity and specificity of the real-time qPCR assay in use in Norway (Mastitis 4 qPCR, DNA Diagnostics A/S, Risskov, Denmark) and compare...... it to conventional bacteriological culturing for detection of S. agalactiae in milk samples. Because none of these tests are considered a perfect reference test, the evaluation was performed using latent class models in a Bayesian analysis. Aseptically collected cow-composite milk samples from 578 cows belonging...

  17. Utility of a rapid immunochromatographic strip test in detecting canine parvovirus infection compared with polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sundaran S. Tinky

    2015-04-01

    Full Text Available Aim: The present study was undertaken to detect the presence of canine parvovirus (CPV in fecal samples of diarrheic dogs by conventional polymerase chain reaction (PCR and immunochromatographic (IC strip test and to compare the diagnostic potential of these tests. Materials and Methods: A total of 50 fecal samples collected from diarrheic dogs suspected for CPV infection were subjected to PCR using CPV-555 primer amplifying the gene coding for the VP1 protein. These samples were also tested by IC strip test using a commercial rapid Ag test kit. The results were statistically analyzed using McNemar test. Results: A total of 22 samples (44% were detected as positive by PCR, which yielded a specific amplicon of 583 bp. In IC strip test, 18 (36% samples were found to be positive. The sensitivity of the test as compared to PCR was found to be 72.22% and specificity was 92.86%. Positive predictive value and negative predictive value of IC strip test was found to be 88.89% and 81.25%, respectively. Statistical analysis of the results of PCR and IC assay using McNemar test revealed no significant difference (p>0.05. Conclusion: The IC strip test could be employed as a rapid field level diagnostic tool for the diagnosis of canine parvoviral diarrhea.

  18. A comparison of rapid diagnostic testing (by plasmodium lactate ...

    African Journals Online (AJOL)

    Background: The World Health Organization (WHO) considers early and rapid diagnosis as one of the strategies to control malaria. This study compared the performance of Quantitative Buffy Coat (QBC) test and the Plasmodium lactate dehydrogenase (pLDH) rapid diagnostic test (RDT) with microscopy as the gold ...

  19. The diagnostic accuracy of serologic and molecular methods for detecting visceral leishmaniasis in HIV infected patients: meta-analysis.

    Directory of Open Access Journals (Sweden)

    Gláucia Fernandes Cota

    Full Text Available BACKGROUND: Human visceral leishmaniasis (VL, a potentially fatal disease, has emerged as an important opportunistic condition in HIV infected patients. In immunocompromised patients, serological investigation is considered not an accurate diagnostic method for VL diagnosis and molecular techniques seem especially promising. OBJECTIVE: This work is a comprehensive systematic review and meta-analysis to evaluate the accuracy of serologic and molecular tests for VL diagnosis specifically in HIV-infected patients. METHODS: Two independent reviewers searched PubMed and LILACS databases. The quality of studies was assessed by QUADAS score. Sensitivity and specificity were pooled separately and compared with overall accuracy measures: diagnostic odds ratio (DOR and symmetric summary receiver operating characteristic (sROC. RESULTS: Thirty three studies recruiting 1,489 patients were included. The following tests were evaluated: Immunofluorescence Antibody Test (IFAT, Enzyme linked immunosorbent assay (ELISA, immunoblotting (Blot, direct agglutination test (DAT and polimerase chain reaction (PCR in whole blood and bone marrow. Most studies were carried out in Europe. Serological tests varied widely in performance, but with overall limited sensitivity. IFAT had poor sensitivity ranging from 11% to 82%. DOR (95% confidence interval was higher for DAT 36.01 (9.95-130.29 and Blot 27.51 (9.27-81.66 than for IFAT 7.43 (3.08-1791 and ELISA 3.06 (0.71-13.10. PCR in whole blood had the highest DOR: 400.35 (58.47-2741.42. The accuracy of PCR based on Q-point was 0.95; 95%CI 0.92-0.97, which means good overall performance. CONCLUSION: Based mainly on evidence gained by infection with Leishmania infantum chagasi, serological tests should not be used to rule out a diagnosis of VL among the HIV-infected, but a positive test at even low titers has diagnostic value when combined with the clinical case definition. Considering the available evidence, tests based on DNA

  20. Technology diffusion and diagnostic testing for prostate cancer

    Science.gov (United States)

    Schroeck, Florian R.; Kaufman, Samuel R.; Jacobs, Bruce L.; Skolarus, Ted A.; Miller, David C.; Weizer, Alon Z.; Montgomery, Jeffrey S.; Wei, John T.; Shahinian, Vahakn B.; Hollenbeck, Brent K.

    2013-01-01

    Purpose While the dissemination of robotic prostatectomy and intensity-modulated radiotherapy (IMRT) may fuel increased use of prostatectomy and radiotherapy, these new technologies may also have spillover effects related to diagnostic testing for prostate cancer. Therefore, we examined the association of regional technology penetration with receipt of prostate specific antigen (PSA) testing and prostate biopsy. Methods In this retrospective cohort study, we included 117,857 men age 66 and older from the 5% sample of Medicare beneficiaries living in the Surveillance Epidemiology and End Results (SEER) areas from 2003 – 2007. Regional technology penetration was measured as the number of providers performing robotic prostatectomy or IMRT per population in a healthcare market (i.e., hospital referral region). We assessed the association of technology penetration with rates of PSA testing and prostate biopsy with generalized estimating equations. Results High technology penetration was associated with increased rates of PSA testing (442 versus 425 per 1,000 person-years, pimpact of technology penetration on PSA testing and prostate biopsy was much smaller than the effect of age, race, and comorbidity (e.g., PSA testing rate per 1,000 person-years: 485 versus 373 for men with only one versus 3+ co-morbid conditions, ppenetration was associated with slightly higher rates of PSA testing and no change in prostate biopsy rates. Collectively, our findings temper concerns that adoption of new technology accelerates diagnostic testing for prostate cancer. PMID:23669564