Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul
2004-01-01
The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562
Reverse transcriptase inhibitors as microbicides.
Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido
2012-01-01
The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.
Reverse transcriptase inhibitors as potential colorectal microbicides.
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J
2009-05-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.
Directory of Open Access Journals (Sweden)
Peter A Anton
Full Text Available Successful control of the HIV/AIDS pandemic requires reduction of HIV-1 transmission at sexually-exposed mucosae. No prevention studies of the higher-risk rectal compartment exist. We report the first-in-field Phase 1 trial of a rectally-applied, vaginally-formulated microbicide gel with the RT-inhibitor UC781 measuring clinical and mucosal safety, acceptability and plasma drug levels. A first-in-Phase 1 assessment of preliminary pharmacodynamics was included by measuring changes in ex vivo HIV-1 suppression in rectal biopsy tissue after exposure to product in vivo.HIV-1 seronegative, sexually-abstinent men and women (N = 36 were randomized in a double-blind, placebo-controlled trial comparing UC781 gel at two concentrations (0.1%, 0.25% with placebo gel (1∶1∶1. Baseline, single-dose exposure and a separate, 7-day at-home dosing were assessed. Safety and acceptability were primary endpoints. Changes in colorectal mucosal markers and UC781 plasma drug levels were secondary endpoints; ex vivo biopsy infectibility was an ancillary endpoint.All 36 subjects enrolled completed the 7-14 week trial (100% retention including 3 flexible sigmoidoscopies, each with 28 biopsies (14 at 10 cm; 14 at 30 cm. There were 81 Grade 1 adverse events (AEs and 8 Grade 2; no Grade 3, 4 or procedure-related AEs were reported. Acceptability was high, including likelihood of future use. No changes in mucosal immunoinflammatory markers were identified. Plasma levels of UC781 were not detected. Ex vivo infection of biopsies using two titers of HIV-1(BaL showed marked suppression of p24 in tissues exposed in vivo to 0.25% UC781; strong trends of suppression were seen with the lower 0.1% UC781 concentration.Single and 7-day topical rectal exposure to both concentrations of UC781 were safe with no significant AEs, high acceptability, no detected plasma drug levels and no significant mucosal changes. Ex vivo biopsy infections demonstrated marked suppression of HIV
Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.
2009-01-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271
HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors
DEFF Research Database (Denmark)
Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran
2017-01-01
BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...
Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.
Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko
2011-01-01
HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.
Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia
2011-06-01
Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.
Testing of viscous anti-HIV microbicides using Lactobacillus
Moncla, B.J.; Pryke, K.; Rohan, L. C.; Yang, H.
2011-01-01
The development of topical microbicides for intravaginal use to prevent HIV infection requires that the drugs and formulated products be nontoxic to the endogenous vaginal Lactobacillus. In 30 min exposure tests we found dapivirine, tenofovir and UC781 (reverse transcriptase inhibitor anti-HIV drugs) as pure drugs or formulated as film or gel products were not deleterious to Lactobacillus species; however, PSC-RANTES (a synthetic CCR5 antagonist) killed 2 strains of Lactobacillus jensenii. To...
DEFF Research Database (Denmark)
Borges, Álvaro H; Lundh, Andreas; Tendal, Britta
2016-01-01
BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...
Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?
Nolan, David
2005-01-01
Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-07-01
HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.
Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.
Directory of Open Access Journals (Sweden)
Anna Figueiredo
2006-11-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.
Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.
Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao
2015-10-01
Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Lucianna Helene Santos
2015-11-01
Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.
DEFF Research Database (Denmark)
Lundgren, Jens
2008-01-01
BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-11-01
Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.
DEFF Research Database (Denmark)
Kirk, Ole; Lundgren, Jens D; Pedersen, Court
2003-01-01
BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....
Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M
2018-01-01
Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2013-11-01
Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.
Sivan, Sree Kanth; Manga, Vijjulatha
2010-06-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2010-03-01
Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.
R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)
2013-01-01
textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma
Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...
Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.
Sharma, Mamta; Saravolatz, Louis D
2013-02-01
Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.
Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano
2017-01-17
Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.
Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F
2008-10-01
Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association
Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.
2004-01-01
Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add
Nicolas Sluis-Cremer
2014-01-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...
Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C
2000-05-18
To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.
Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X
2002-12-01
Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.
2010-01-01
... 10 Energy 4 2010-01-01 2010-01-01 false Definitions. 781.3 Section 781.3 Energy DEPARTMENT OF ENERGY DOE PATENT LICENSING REGULATIONS General Provisions § 781.3 Definitions. (a) Board means the... applicant means an applicant who, in the discretion of the Department, has the intention, plans, and ability...
[Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].
Tarasova, O A; Filimonov, D A; Poroikov, V V
2017-10-01
Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.
Czech Academy of Sciences Publication Activity Database
Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko
2016-01-01
Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016
DEFF Research Database (Denmark)
Mocroft, A; Horban, A; Clumeck, N
2006-01-01
increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)
Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.
Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A
2011-01-01
We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Lapadula Giuseppe
2007-05-01
Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.
Fang, Evandro Fei; Ng, Tzi Bun
2015-04-01
Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.
TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats
Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin
2011-01-01
In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472
Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda
2016-01-01
Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.
Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A
2013-11-01
Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.
Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.
Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M
2017-12-01
Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these
Directory of Open Access Journals (Sweden)
Meytal Galilee
2018-01-01
Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study
Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong
2012-01-01
1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.
Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami
2017-06-01
We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.
DEFF Research Database (Denmark)
Fox, Zoe; Phillips, Andrew; Cohen, Cal
2008-01-01
the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...
Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni
2005-01-01
Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294
Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S
2014-06-01
The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Sluis-Cremer, Nicolas
2014-07-31
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.
Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .
2010-10-01
... INSURANCE AND HAZARD MITIGATION National Flood Insurance Program FLOOD MITIGATION ASSISTANCE § 78.1 Purpose... of the Flood Mitigation Assistance (FMA) program, authorized by Sections 1366 and 1367 of the... eliminate claims under the National Flood Insurance Program (NFIP) through mitigation activities. The...
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2014-07-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
Implementing Cisco UCS solutions
Ahmed, Farhan
2013-01-01
A tutorial-based approach which will help you understand the practical methodologies and deploying of Cisco UCS components.If you are a professional such as a system, network, or storage administrator who is responsible for Cisco UCS deployments, this is the perfect book for you. You should have some basic knowledge of the server's architecture, network, and storage technologies. Familiarity with virtualization technologies is also recommended (though not necessary) as the majority of real-world UCS deployments run virtualized loads. Knowledge of Nexus OS is not necessary as the majority of th
International Nuclear Information System (INIS)
Creissen, D.M.; Hill, C.K.
1991-01-01
Studies of repair enzyme activities in a uv-sensitive cell line (V79/UC) derived from Chinese hamster V79 cells have revealed levels of total DNA polymerase that are about 50% of the levels in the parental cell line. There are a number of DNA polymerase inhibitors available which allow us to distinguish between the major forms of DNA polymerase (alpha, beta, gamma, and delta) identified in mammalian cells. Enzyme assays with these inhibitors indicate that the aphidicolin-sensitive DNA polymerase is defective in the V79/UC cell line. This could be either polymerase alpha or delta, or both. The V79/UC cells do not express resistance to aphidicolin in standard toxicity studies. However, when aphidicolin is added postirradiation in survival assays designed to measure the extent of inhibitable repair, V79/UC cells do not respond with the further decrease in survival seen in the parental line. Further evidence of a polymerase-dependent repair defect is evident from alkaline elution data. In this case the V79/UC cells show the appearance of single-strand breaks following uv irradiation in the absence of any added inhibitor. Cells of the V79/M12G parental line, on the other hand, show the appearance of single-strand breaks only when aphidicolin is present
Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania
2018-02-01
Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.
3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors
Directory of Open Access Journals (Sweden)
S. Ganguly
2008-01-01
Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...
Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark
2013-11-01
BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.
Unified communications forensics anatomy of common UC attacks
Grant, Nicholas Mr
2013-01-01
Unified Communications Forensics: Anatomy of Common UC Attacks is the first book to explain the issues and vulnerabilities and demonstrate the attacks, forensic artifacts, and countermeasures required to establish a secure (UC) environment. This book is written by leading UC experts Nicholas Grant and Joseph W. Shaw II and provides material never before found on the market, including: analysis of forensic artifacts in common UC attacks an in-depth look at established UC technologies and attack exploits hands-on understanding of UC attack vectors and associated countermeasures
Directory of Open Access Journals (Sweden)
Mark A Winters
Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.
Markowitz, Martin; Sarafianos, Stefan G
2018-07-01
4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.
Energy Technology Data Exchange (ETDEWEB)
Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.
2017-02-06
The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.
Patick, A K; Boritzki, T J; Bloom, L A
1997-10-01
Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.
Directory of Open Access Journals (Sweden)
Cha YJ
2014-09-01
Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600
Giacobbi, Nicholas S; Sluis-Cremer, Nicolas
2017-07-01
Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.
Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo
2017-08-31
In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong
2018-06-18
We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H = 1.77 μM, IC 50 IN = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Testing of viscous anti-HIV microbicides using Lactobacillus.
Moncla, B J; Pryke, K; Rohan, L C; Yang, H
2012-02-01
The development of topical microbicides for intravaginal use to prevent HIV infection requires that the drugs and formulated products be nontoxic to the endogenous vaginal Lactobacillus. In 30min exposure tests we found dapivirine, tenofovir and UC781 (reverse transcriptase inhibitor anti-HIV drugs) as pure drugs or formulated as film or gel products were not deleterious to Lactobacillus species; however, PSC-RANTES (a synthetic CCR5 antagonist) killed 2 strains of Lactobacillus jensenii. To demonstrate the toxicity of formulated products a new assay was developed for use with viscous and non-viscous samples that we have termed the Lactobacillus toxicity test. We found that the vortex mixing of vaginal Lactobacillus species can lead to reductions in bacterial viability. Lactobacillus can survive briefly, about 2s, but viability declines with increased vortex mixing. The addition of heat inactivated serum or bovine serum albumin, but not glycerol, prevented the decrease in bacterial viability. Bacillus atrophaeus spores also demonstrated loss of viability upon extended mixing. We observed that many of the excipients used in film formulation and the films themselves also afford protection from the killing during vortex mixing. This method is of relevance for toxicity for cidal activities of viscous products. Copyright © 2011 Elsevier B.V. All rights reserved.
I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)
2015-01-01
textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have
International Nuclear Information System (INIS)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki
2015-01-01
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol
Energy Technology Data Exchange (ETDEWEB)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)
2015-10-23
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.
Reduced risk of UC in families affected by appendicitis
DEFF Research Database (Denmark)
Nyboe Andersen, Nynne; Gørtz, Sanne; Frisch, Morten
2017-01-01
OBJECTIVE: The possible aetiological link between appendicitis and UC remains unclear. In order to investigate the hereditary component of the association, we studied the risk of UC in family members of individuals with appendicitis. DESIGN: A cohort of 7.1 million individuals was established...... million person-years of follow-up between 1977 and 2011, a total of 190 004 cohort members developed appendicitis and 45 202 developed UC. Individuals having a first-degree relative with appendicitis before age 20 years had significantly reduced risk of UC (RR 0.90; 95% CI 0.86 to 0.95); this association...... was stronger in individuals with a family predisposition to UC (RR 0.66; 95% CI 0.51 to 0.83). CONCLUSIONS: Individuals with a first-degree relative diagnosed with appendicitis before age 20 years are at reduced risk of UC, particularly when there is a family predisposition to UC. Our findings question...
African Journals Online (AJOL)
Nduka, UC. Vol 19, No 1 (2014) - Articles The use of social media in combating the ebola virus in Nigeria- a review. Abstract. ISSN: 1118-2601. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use ...
Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat
2011-01-01
We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.
On the Necessary and Sufficient Assumptions for UC Computation
DEFF Research Database (Denmark)
Damgård, Ivan Bjerre; Nielsen, Jesper Buus; Orlandi, Claudio
2010-01-01
for all of them. Perhaps most interestingly we show that: • For even the minimal meaningful KRA, where we only assume that the secret key is a value which is hard to compute from the public key, one can UC securely compute any poly-time functionality if there exists a passive secure oblivious...... that in the KRA model one-way functions are sufficient for UC commitment and UC zero-knowledge. These are the first examples of UC secure protocols for non-trivial tasks which do not assume the existence of public-key primitives. In particular, the protocols show that non-trivial UC computation is possible...
Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang
2006-05-01
To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.
Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R
2009-02-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.
Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang
2017-06-16
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.
Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D
2006-11-15
TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients
Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H
2015-12-15
Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.
2011-01-01
The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who
Hanna, Kirollos S
2017-11-01
Urothelial carcinoma (UC) is the second most common malignancy of the genitourinary system and the sixth most common cancer in the United States. The overall incidence of UC appears to be on the decline, but death rates have remained stable. Stage IV metastatic disease is associated with only a 5% survival rate at 5 years. Gemcitabine and cisplatin combinations or dose-dense methotrexate, vinblastine, doxorubicin, and cisplatin are the preferred regimens for individuals with advance, metastatic disease and a good performance status and organ function. Second-line therapies in this setting are limited. During the course of 1 year, five immune checkpoint inhibitors were approved for treatment of cancers in the locally advanced or metastatic setting: atezolizumab, nivolumab, durvalumab, avelumab, and pembrolizumab. Immunotherapies have played a significant role in the treatment of various cancers and have continued to expand. It is of utmost importance that practitioners include checkpoint inhibitors as treatment options for UC. Based on the limited data, pembrolizumab and atezolizumab may be the drugs of choice, as they are supported by the most influential data to date; however, further research is warranted. Ongoing clinical trials will further assess the benefits of inducing cellular immunity in the treatment of UC. These therapies mark a new landscape in the treatment of UC. In this article, the available data on immune checkpoint inhibitors for the treatment of locally advanced or metastatic UC and their place in therapy are reviewed. © 2017 Pharmacotherapy Publications, Inc.
Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido
2013-09-01
Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.
DEFF Research Database (Denmark)
Sabin, Caroline A; Worm, Signe W; Weber, Rainer
2008-01-01
cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...
Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P
2000-05-04
Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.
Directory of Open Access Journals (Sweden)
Ajay Kumar
2010-01-01
Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.
Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan
2010-12-12
Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.
Directory of Open Access Journals (Sweden)
Ana Luiza Chaves Valadão
2015-06-01
Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.
GE781: a Monte Carlo package for fixed target experiments
Davidenko, G.; Funk, M. A.; Kim, V.; Kuropatkin, N.; Kurshetsov, V.; Molchanov, V.; Rud, S.; Stutte, L.; Verebryusov, V.; Zukanovich Funchal, R.
The Monte Carlo package for the fixed target experiment B781 at Fermilab, a third generation charmed baryon experiment, is described. This package is based on GEANT 3.21, ADAMO database and DAFT input/output routines.
About preparation and properties of UC based fuel materials
International Nuclear Information System (INIS)
Vooght, D. de; Timmermans, W.; Batist, R. de.
1978-07-01
The sintering behaviour and the effect of a numer of production parameters on the properties of sintered UC materials have been studied. Materials investigated include slightly hyperstoichiometric UC(UCsub(1+x)), oxygen containing UC[U(CO)] and UC containing both oxygen and nitrogen [U(CON)]. The materials have been characterized in terms of grain size distribution for the pre-sintering powder, of porosity distribution for the powdered material and for the green and sintered pellets and of the density of the green and sintered pellets. Carbothermic reaction temperature, milling time, and to some extent sintering temperature have been varied. The report discusses the possible correlations between several parameters such as milling time, powder fineness, density, grain size of the sintered product, composition (O,N content), etc. (author)
Phenotype-gene: 781 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 781 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u3ria224u957i abnormal for trait of morph...ology in organ named seed for AT5G18410 Li Yunhai et al. 2004 Nov. Plant Physiol. 136(3):3616-27.... http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u15516496i abnormal for trait of morphology in or
Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang
2017-12-01
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50 = 0.04 μM) with decent antiviral potency (EC 50 = 7.4 μM) and no cytotoxicity (CC 50 > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50 = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.
Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E
2013-06-18
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Oluwafeyisetan O. Adebiyi
2015-12-01
Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.
Jakubowska, Katarzyna; Pryczynicz, Anna; Iwanowicz, Piotr; Niewiński, Andrzej; Maciorkowska, Elżbieta; Hapanowicz, Jerzy; Jagodzińska, Dorota; Kemona, Andrzej; Guzińska-Ustymowicz, Katarzyna
2016-01-01
Crohn's disease (CD) and ulcerative colitis (UC) belong to a group of inflammatory bowel diseases (IBD). The aim of our study was to evaluate the expression of MMP-2, MMP-7, MMP-9, TIMP-1, and TIMP-2 in ulcerative colitis and Crohn's disease. The study group comprised 34 patients with UC and 10 patients with CD. Evaluation of MMP-2, MMP-7, MMP-9, TIMP-1, and TIMP-2 expression in tissue samples was performed using immunohistochemistry. The overexpression of MMP-9 and TIMP-1 was dominant in both the glandular epithelium and inflammatory infiltration in UC patients. In contrast, in CD subjects the positive expression of MMP-2 and TIMP-1 was in glandular tubes while mainly MMP-7 and TIMP-2 expression was in inflammatory infiltration. Metalloproteinases' expression was associated with the presence of erosions, architectural tissue changes, and inflammatory infiltration in the lamina propria of UC patients. The expression of metalloproteinase inhibitors correlated with the presence of eosinophils and neutrophils in UC and granulomas in CD patients. Our studies indicate that the overexpression of metalloproteinases and weaker expression of their inhibitors may determine the development of IBD. It appears that MMP-2, MMP-7, and MMP-9 may be a potential therapeutic target and the use of their inhibitors may significantly reduce UC progression.
Directory of Open Access Journals (Sweden)
Katarzyna Jakubowska
2016-01-01
Full Text Available Crohn’s disease (CD and ulcerative colitis (UC belong to a group of inflammatory bowel diseases (IBD. The aim of our study was to evaluate the expression of MMP-2, MMP-7, MMP-9, TIMP-1, and TIMP-2 in ulcerative colitis and Crohn’s disease. The study group comprised 34 patients with UC and 10 patients with CD. Evaluation of MMP-2, MMP-7, MMP-9, TIMP-1, and TIMP-2 expression in tissue samples was performed using immunohistochemistry. The overexpression of MMP-9 and TIMP-1 was dominant in both the glandular epithelium and inflammatory infiltration in UC patients. In contrast, in CD subjects the positive expression of MMP-2 and TIMP-1 was in glandular tubes while mainly MMP-7 and TIMP-2 expression was in inflammatory infiltration. Metalloproteinases’ expression was associated with the presence of erosions, architectural tissue changes, and inflammatory infiltration in the lamina propria of UC patients. The expression of metalloproteinase inhibitors correlated with the presence of eosinophils and neutrophils in UC and granulomas in CD patients. Our studies indicate that the overexpression of metalloproteinases and weaker expression of their inhibitors may determine the development of IBD. It appears that MMP-2, MMP-7, and MMP-9 may be a potential therapeutic target and the use of their inhibitors may significantly reduce UC progression.
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2008-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...
Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun
2017-09-01
The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.
Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L
2017-11-08
The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.
Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen
2016-03-01
Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.
Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W
2012-05-01
Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.
Directory of Open Access Journals (Sweden)
Jixia Li
2013-01-01
Full Text Available Context: The epidermal growth factor receptor (EGFR family is reportedly overexpressed in bladder cancer, and tyrosine kinaseinhibitors (TKIs have been suggested as treatment. Gefitinib is a selective inhibitor of the EGFR and lapatinib is a dual inhibitor of both the EGFR and HER2 (human EGFR type 2 receptor. Both compounds compete with the binding of adenosine triphosphate (ATP to the tyrosine kinase domain of the respective receptors to inhibit receptor autophosphorylation causing suppression of signal transduction. Unfortunately, resistance to these inhibitors is a major clinical problem. Aims: To compare the apoptosis signaling pathway(s induced by gefitinib and lapatinib, in UM-UC-5 (drug-sensitive and UM-UC-14 (drug-resistant bladder cancer cells and to identify molecular differences that might be useful predictors of their efficacy. Materials and Methods: Cell proliferation, cell cycle and apoptosis assay were used to detect the effect of TKIs on UM-UC-5 and UM-UC-14 cells. Molecular differences for response to TKIs were examined by protein array. Results: TKIs strongly inhibited cell proliferation and induced cell cycle G1 arrest and apoptosis in UM-UC-5 cells. Most notable apoptosis molecular differences included decreased claspin, trail, and survivin by TKIs in the sensitive cells. In contrast, TKIs had no effect on resistant cells. Conclusions: Claspin, trail, and survivin might be used to determine the sensitivity of bladder cancers to TKIs.
Directory of Open Access Journals (Sweden)
Marius Lazea
2011-12-01
Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.
de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão
2008-08-01
A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.
Reduced risk of UC in families affected by appendicitis: a Danish national cohort study.
Nyboe Andersen, Nynne; Gørtz, Sanne; Frisch, Morten; Jess, Tine
2017-08-01
The possible aetiological link between appendicitis and UC remains unclear. In order to investigate the hereditary component of the association, we studied the risk of UC in family members of individuals with appendicitis. A cohort of 7.1 million individuals was established by linkage of national registers in Denmark with data on kinship and diagnoses of appendicitis and UC. Poisson regression models were used to calculate first hospital contact rate ratios (RR) for UC with 95% CIs between individuals with or without relatives with a history of appendicitis. During 174 million person-years of follow-up between 1977 and 2011, a total of 190 004 cohort members developed appendicitis and 45 202 developed UC. Individuals having a first-degree relative with appendicitis before age 20 years had significantly reduced risk of UC (RR 0.90; 95% CI 0.86 to 0.95); this association was stronger in individuals with a family predisposition to UC (RR 0.66; 95% CI 0.51 to 0.83). Individuals with a first-degree relative diagnosed with appendicitis before age 20 years are at reduced risk of UC, particularly when there is a family predisposition to UC. Our findings question a previously hypothesised direct protective influence of appendicitis on inflammation of the large bowel. Rather, genetic or environmental factors linked to an increased risk of appendicitis while being protective against UC may explain the repeatedly reported reduced relative risk of UC in individuals with a history of appendicitis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Directory of Open Access Journals (Sweden)
Catalina García
2007-05-01
Full Text Available Se evaluaron procesos y resultados obtenidos durante la implementación de un nuevo modelo de perfeccionamiento docente, Pasantía PENTA UC, que propone que profesores asistan como alumnos, durante un semestre, a un curso dictado por académicos universitarios para escolares con talentos académicos, y así profundicen en contenidos de sus disciplinas y en herramientas metodológicas, y elaboren un proyecto de transferencia de lo aprendido al aula regular. Los resultados muestran que los profesores aumentan sus conocimientos, aprenden herramientas metodológicas, reflexionan sobre el proceso de aprendizaje y desarrollan proyectos de calidad y viables. Así, la Pasantía PENTA UC se vislumbra como una opción potencialmente efectiva de perfeccionamiento.Procedures and outcomes obtained during the implementation of a new teacher professional development model, Pasantía PENTA UC, were evaluated, this internship proposes that teachers attend, as students, during a semester, to a course dictated by university professors to gifted students, and thus getting in-depth knowledge in their areas of expertise and acquiring new methodological tools, and to create a transference project from the internship to the regular classroom. The results show that the teachers increase their knowledge, learn methodological tools, reflect over the learning process, and develop quality and viable projects. Thus, Pasantía PENTA UC outstands as a potentially effective improvement option.
Countering Fear Renewal : changes in the UCS representation generalize across contexts
Leer, Arne|info:eu-repo/dai/nl/381059650; Engelhard, Iris|info:eu-repo/dai/nl/239681533
After treatment of anxiety disorders, fear often returns. Analogue studies show that outside the extinction context the conditional stimulus (CS) activates the acquisition memory (CS predicts unconditional stimulus; UCS), rather than the extinction memory (CS does not predict UCS). Conditioning
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M
2007-01-01
Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.
The UC Davis/NIH NeuroMab Facility
Federal Laboratory Consortium — The mission of the UC Davis/NIH NeuroMab facility is to generate and distribute high quality, validated mouse monoclonal antibodies against molecular targets found...
17 CFR 247.781 - Exemption from the definition of “broker” for banks for a limited period of time.
2010-04-01
... “broker” for banks for a limited period of time. A bank is exempt from the definition of the term “broker... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Exemption from the definition of âbrokerâ for banks for a limited period of time. 247.781 Section 247.781 Commodity and Securities...
International Nuclear Information System (INIS)
Lund, Kaleb C.; Wallace, Kendall B.
2008-01-01
Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug
12 CFR 218.781 - Exemption from the definition of “broker” for banks for a limited period of time.
2010-01-01
...” for banks for a limited period of time. A bank is exempt from the definition of the term “broker... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Exemption from the definition of âbrokerâ for banks for a limited period of time. 218.781 Section 218.781 Banks and Banking FEDERAL RESERVE SYSTEM...
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M
2007-01-01
Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691
International Nuclear Information System (INIS)
Spadafora, C.; Sciamanna, I.; Misteli, T.
2009-01-01
Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma
Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark
2009-01-01
Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161
A Comprehensive Review of US FDA-Approved Immune Checkpoint Inhibitors in Urothelial Carcinoma
Directory of Open Access Journals (Sweden)
Fu-Shun Hsu
2017-01-01
Full Text Available Few effective treatment options are available for patients with advanced or metastatic urothelial carcinoma (UC after unsuccessful first-line platinum-based chemotherapy. To date, immune checkpoint inhibitors are novel therapeutic agents for UC treatment. From May 2016 to May 2017, five anti-PD-1/PD-L1 monoclonal antibodies received accelerated or regular approval from the US Food and Drug Administration (FDA for the treatment of patients with locally advanced or metastatic UC. The present comprehensive review presents the background information of these five US FDA-approved anticancer agents to provide a basic but concise understanding of these agents for advanced studies. We summarize their immune checkpoint mechanisms, clinical efficacy, recommended usage protocols, adverse events, and the limitations of the PD-L1 biomarker assays.
GSK2586184, a JAK1 selective inhibitor, in two patients with ulcerative colitis
de Vries, Leonie C. S.; Ludbrook, Valerie J.; Hicks, Kirsty J.; D'Haens, Geert R.
2017-01-01
Tofacitinib, a non-selective Janus kinase (JAK) inhibitor, is effective in inducing clinical and endoscopic remission in patients with active ulcerative colitis (UC). Tofacitinib inhibits cytokine signalling through blockade of JAK1, JAK2, JAK3 and tyrosine kinase 2 (TYK2). Adverse events including
Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles
International Nuclear Information System (INIS)
Bavand, M.R.; Laub, O.
1988-01-01
Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein
Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis
2016-06-01
Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.
Umbilical cord mesenchymal stem cell (UC-MSC) transplantations for cerebral palsy
Dong, Huajiang; Li, Gang; Shang, Chongzhi; Yin, Huijuan; Luo, Yuechen; Meng, Huipeng; Li, Xiaohong; Wang, Yali; Lin, Ling; Zhao, Mingliang
2018-01-01
This study reports a case of a 4-year-old boy patient with abnormalities of muscle tone, movement and motor skills, as well as unstable gait leading to frequent falls. The results of the electroencephalogram (EEG) indicate moderately abnormal EEG, accompanied by irregular seizures. Based on these clinical characteristics, the patient was diagnosed with cerebral palsy (CP) in our hospital. In this study, the patient was treated with umbilical cord mesenchymal stem cell (UC-MSC) transplantation therapy. This patient received UC-MSC transplantation 3 times (5.3*107) in total. After three successive cell transplantations, the patient recovered well and showed obvious improvements in EEG and limb strength, motor function, and language expression. However, the improvement in intelligence quotient (IQ) was less obvious. These results indicate that UC-MSC transplantation is a promising treatment for cerebral palsy. PMID:29636880
Directory of Open Access Journals (Sweden)
Markus Hecht
Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic
UC Merced Center for Computational Biology Final Report
Energy Technology Data Exchange (ETDEWEB)
Colvin, Michael; Watanabe, Masakatsu
2010-11-30
Final report for the UC Merced Center for Computational Biology. The Center for Computational Biology (CCB) was established to support multidisciplinary scientific research and academic programs in computational biology at the new University of California campus in Merced. In 2003, the growing gap between biology research and education was documented in a report from the National Academy of Sciences, Bio2010 Transforming Undergraduate Education for Future Research Biologists. We believed that a new type of biological sciences undergraduate and graduate programs that emphasized biological concepts and considered biology as an information science would have a dramatic impact in enabling the transformation of biology. UC Merced as newest UC campus and the first new U.S. research university of the 21st century was ideally suited to adopt an alternate strategy - to create a new Biological Sciences majors and graduate group that incorporated the strong computational and mathematical vision articulated in the Bio2010 report. CCB aimed to leverage this strong commitment at UC Merced to develop a new educational program based on the principle of biology as a quantitative, model-driven science. Also we expected that the center would be enable the dissemination of computational biology course materials to other university and feeder institutions, and foster research projects that exemplify a mathematical and computations-based approach to the life sciences. As this report describes, the CCB has been successful in achieving these goals, and multidisciplinary computational biology is now an integral part of UC Merced undergraduate, graduate and research programs in the life sciences. The CCB began in fall 2004 with the aid of an award from U.S. Department of Energy (DOE), under its Genomes to Life program of support for the development of research and educational infrastructure in the modern biological sciences. This report to DOE describes the research and academic programs
Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi
2016-12-10
The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure
A novel UCS memory retrieval-extinction procedure to inhibit relapse to drug seeking
Luo, Yi-xiao; Xue, Yan-xue; Liu, Jian-feng; Shi, Hai-shui; Jian, Min; Han, Ying; Zhu, Wei-li; Bao, Yan-ping; Wu, Ping; Ding, Zeng-bo; Shen, Hao-wei; Shi, Jie; Shaham, Yavin; Lu, Lin
2015-01-01
We recently reported that a conditioned stimulus (CS) memory retrieval-extinction procedure decreases reinstatement of cocaine and heroin seeking in rats and heroin craving in humans. Here we show that non-contingent cocaine or methylphenidate injections (UCS retrieval) 1 h before the extinction sessions decreases cocaine-priming-induced reinstatement, spontaneous recovery, and renewal of cocaine seeking in rats. Unlike the CS-based memory retrieval-extinction procedure, the UCS memory retrieval manipulation decreases renewal and reinstatement of cocaine seeking in the presence of cocaine cues that were not present during extinction training and also decreases cocaine seeking when the procedure commences after 28 days of abstinence. The inhibitory effect of the UCS retrieval manipulation on cocaine-priming-induced reinstatement is mediated by regulation of AMPA-receptor endocytosis in the basolateral amygdala. The UCS memory retrieval-extinction procedure has superior relapse prevention characteristics than the CS memory retrieval-extinction procedure and could be a promising method for decreasing relapse in human addicts. PMID:26169171
A novel UCS memory retrieval-extinction procedure to inhibit relapse to drug seeking.
Luo, Yi-xiao; Xue, Yan-xue; Liu, Jian-feng; Shi, Hai-shui; Jian, Min; Han, Ying; Zhu, Wei-li; Bao, Yan-ping; Wu, Ping; Ding, Zeng-bo; Shen, Hao-wei; Shi, Jie; Shaham, Yavin; Lu, Lin
2015-07-14
We recently reported that a conditioned stimulus (CS) memory retrieval-extinction procedure decreases reinstatement of cocaine and heroin seeking in rats and heroin craving in humans. Here we show that non-contingent cocaine or methylphenidate injections (UCS retrieval) 1 h before the extinction sessions decreases cocaine-priming-induced reinstatement, spontaneous recovery, and renewal of cocaine seeking in rats. Unlike the CS-based memory retrieval-extinction procedure, the UCS memory retrieval manipulation decreases renewal and reinstatement of cocaine seeking in the presence of cocaine cues that were not present during extinction training and also decreases cocaine seeking when the procedure commences after 28 days of abstinence. The inhibitory effect of the UCS retrieval manipulation on cocaine-priming-induced reinstatement is mediated by regulation of AMPA-receptor endocytosis in the basolateral amygdala. The UCS memory retrieval-extinction procedure has superior relapse prevention characteristics than the CS memory retrieval-extinction procedure and could be a promising method for decreasing relapse in human addicts.
International Nuclear Information System (INIS)
Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.
2004-01-01
Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies
Energy Technology Data Exchange (ETDEWEB)
Dubuisson, J; Houyvet, A; Le Boulbin, E; Lucas, R; Moranville, C [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1958-07-01
High density fuels, either in uranium monocarbide or in U-UC cermets have been prepared on laboratory-scale, by hot pressing of mixtures of uranium powder and graphite in suitable proportions. Uranium powder is prepared by calcium reduction of UO{sub 2} followed by an acetic leaching at low temperature. An adequate protection-treatment permits the manipulation of the powder in the open air. Uranium and Graphite powders are intimately mixed and then hot pressed in a double effect graphite die at a temperature of 900-1000 deg. C under a charge of 200 kg/cm{sup 2} during 3 hours. A special design of the die avoids the breaking of the graphite during the sintering. In this way, samples are prepared, the characteristics of which are: 1) {+-} 5 pour cent of homogeneity for a ratio height/diameter = 2. 2) almost theoretical density (98 pour cent) 3) low concentration of unreacted carbon (heat treatment of stoichiometric monocarbide can be useful for completion of reaction) 4) the micrographic examination shows: - a network of monocarbide surrounding uranium in the case of low concentration cermets (<2,5 per cent C) - two networks intimately mixed for high concentration cermets (<2,5 per cent C) - a fine grain structure for the monocarbide (10 u). 5) In every case, the X rays examinations show a fine grain structure without any orientation, and no UC{sub 2}. Some indications are given on the physical (thermal cycling, conductibility) and chemical properties (corrosion, reaction with cladding materials). (author)Fren. [French] Une methode de preparation de combustibles de haute densite, soit en monocarbure d'uranium, soit en cermets U-UC, a ete mise au point au laboratoire. Il s'agit du frittage sous charge de melanges de poudres d'uranium et de graphite en proportion convenable. La poudre d'uranium est elaboree par calciothermie de l'oxyde UO{sub 2} suivie d'un lavage acetique a basse temperature. Un traitement de protection adequat pe sa manipulation a l'air. Les poudres
Experimental study of UC polycrystals in the prospect of improving the as-fabricated sample purity
Energy Technology Data Exchange (ETDEWEB)
Raveu, Gaëlle, E-mail: gaelle.raveu@cea.fr [CEA, DEC, 13108 Saint-Paul-Lez-Durance (France); Martin, Guillaume; Fiquet, Olivier; Garcia, Philippe; Carlot, Gaëlle; Palancher, Hervé [CEA, DEC, 13108 Saint-Paul-Lez-Durance (France); Bonnin, Anne [ESRF, 6, rue J. Horowitz, 38500 Grenoble Cedex (France); Khodja, Hicham [CEA, DEC, 13108 Saint-Paul-Lez-Durance (France); Raepsaet, Caroline [CEA, IRAMIS, LEEL, 91191 Gif-Sur-Yvette (France); Sauvage, Thierry; Barthe, Marie-France [CNRS – CEMHTI, 3a Rue de la Férolerie, 45071 Orleans (France)
2014-12-15
Uranium and plutonium carbides are candidate fuels for Generation IV nuclear reactors. This study is focused on the characterization of uranium monocarbide samples. The successive fabrication steps were carried out under atmospheres containing low oxygen and moisture concentrations (typically less than 100 ppm) but sample transfers occurred in air. Six samples were sliced from four pellets elaborated by carbothermic reaction under vacuum. Little presence of UC{sub 2} is expected in these samples. The α-UC{sub 2} phase was indeed detected within one of these UC samples during an XRD experiment performed with synchrotron radiation. Moreover, oxygen content at the surface of these samples was depth profiled using a recently developed nuclear reaction analysis method. Large oxygen concentrations were measured in the first micron below the sample surface and particularly in the first 100–150 nm. UC{sub 2} inclusions were found to be more oxidized than the surrounding matrix. This work points out to the fact that more care must be given at each step of UC fabrication since the material readily reacts with oxygen and moisture. A new glovebox facility using a highly purified atmosphere is currently being built in order to obtain single phase UC samples of better purity.
UCS-PROMOVE: The Engineer of the Future
Villas-Boas, V.
2010-01-01
The Universidade de Caxias do Sul (UCS) elaborated the cooperative project called "The engineer of the future", with the objective of promoting science and engineering among high school teachers and students. This project aims to improve the quality of the teaching and to increase the interest of students in technological areas, leading…
Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A
2017-01-01
Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with ClinicalTrials.gov, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N
Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi
2018-05-11
Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.
Resveratrol promotes hUC-MSCs engraftment and neural repair in a mouse model of Alzheimer's disease.
Wang, Xinxin; Ma, Shanshan; Yang, Bo; Huang, Tuanjie; Meng, Nan; Xu, Ling; Xing, Qu; Zhang, Yanting; Zhang, Kun; Li, Qinghua; Zhang, Tao; Wu, Junwei; Yang, Greta Luyuan; Guan, Fangxia; Wang, Jian
2018-02-26
Mesenchymal stem cell transplantation is a promising therapeutic approach for Alzheimer's disease (AD). However, poor engraftment and limited survival rates are major obstacles for its clinical application. Resveratrol, an activator of silent information regulator 2, homolog 1 (SIRT1), regulates cell destiny and is beneficial for neurodegenerative disorders. The present study is designed to explore whether resveratrol regulates the fate of human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) and whether hUC-MSCs combined with resveratrol would be efficacious in the treatment of neurodegeneration in a mouse model of AD through SIRT1 signaling. Herein, we report that resveratrol facilitates hUC-MSCs engraftment in the hippocampus of AD mice and resveratrol enhances the therapeutic effects of hUC-MSCs in this model as demonstrated by improved learning and memory in the Morris water maze, enhanced neurogenesis and alleviated neural apoptosis in the hippocampus of the AD mice. Moreover, hUC-MSCs and resveratrol jointly regulate expression of hippocampal SIRT1, PCNA, p53, ac-p53, p21, and p16. These data strongly suggests that hUC-MSCs transplantation combined with resveratrol may be an effective therapy for AD. Copyright © 2017. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Ferkous, F.; Saihi, Y.
2018-01-01
Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)
Immune pressure analysis of protease and reverse transcriptase ...
African Journals Online (AJOL)
/dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...
Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity
House, M.L.; Kim, C.H.; Reno, P.W.
1998-01-01
Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.
Calibrated user-friendly reverse transcriptase-PCR assay
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Rammer, P
1998-01-01
We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
DEFF Research Database (Denmark)
Gibbon, Timothy Braidwood; Yu, Xianbin; Tafur Monroy, Idelfonso
2009-01-01
The generation of photonic ultra-wideband (UWB) impulse signals using an uncooled distributed-feedback laser is proposed. For the first time, we experimentally demonstrate bit-for-bit digital signal processing (DSP) bit-error-rate measurements for transmission of a 781.25-Mb/s photonic UWB signal...
Czepiel, Jacek; Biesiada, Grażyna; Dróżdż, Mirosław; Gdula-Argasińska, Joanna; Żurańska, Justyna; Marchewka, Jakub; Perucki, William; Wołkow, Paweł; Garlicki, Aleksander
2018-01-01
There is large variation in the clinical manifestations of Clostridium difficile infection (CDI). We also still can not predict which patients are more susceptible to reinfection with CDI. The aim of our study was to evaluate the effect of gene single nucleotide polymorphisms (SNP) of proinflammatory cytokines, specifically IL-1β, IL-8 on the development, clinical course and recurrence of CDI. We performed a prospective study of adults (130 people ≥ 18 years) including 65 patients with CDI treated in tertiary hospital and 65 healthy persons. The following 3 variants were analyzed for the occurrence of gene polymorphisms in patients with CDI versus the control group: IL-1β +3953 A/G (rs1143634), IL-1β -31 A/G (rs1143627), and IL-8 +781 T/C (rs2227306). Then, we assessed the correlation between these genetic polymorphisms and biochemical parameters important in CDI course, CDI severity as well as CDI recurrence. The presence of genetic polymorphisms of IL-1β +3953 A/G, -31 A/G and IL-8 +781 T/C did not have an effect on the development or recurrence of CDI. The presence of IL-8 +781 T/C polymorphism is associated with the severe CDI. Copyright © 2017 Elsevier Ltd. All rights reserved.
The UC Softhand: Light Weight Adaptive Bionic Hand with a Compact Twisted String Actuation System
Directory of Open Access Journals (Sweden)
Mahmoud Tavakoli
2015-12-01
Full Text Available In this paper, we present the design and development of the UC-Softhand. The UC Softhand is a low cost, Bionic and adaptive hand that takes advantage of compliant joints. By optimization of the actuation strategy as well as the actuation mechanism, we could develop an anthropomorphic hand that embeds three actuators, transmission mechanisms, controllers and drivers in the palm of the hand, and weighs only 280 g, making it one of the lightest bionic hands that has been created so far. The key aspect of the UC Softhand is utilization of a novel compact twisted string actuation mechanism, that allows a considerable weight and cost reduction compared to its predecessor.
Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind
2014-04-01
A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.
International Nuclear Information System (INIS)
Fang, Evandro Fei; Wong, Jack Ho; Bah, Clara Shui Fern; Lin, Peng; Tsao, Sai Wah; Ng, Tzi Bun
2010-01-01
Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K i , 0.1 x 10 -9 M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI.
Gisbert, Javier P; Barreiro-de Acosta, Manuel; Esteve, María; García-Sánchez, Valle; Gomollón, Fernando; Guardiola, Jordi; Hinojosa, Joaquin; Martín Arranz, Maria-Dolores; Minguez, Miguel; Taxonera, Carlos; Vera, Isabel
2016-03-01
There is still uncertainty about what constitutes the best therapeutic practice in ulcerative colitis (UC). The purpose of the "UC Horizons Project" was to raise a series of questions regarding the management of UC to provide responses based on the best scientific evidence available. The 11 members of the scientific committee prepared draft answers to the 10 questions from available evidence after a literature search. A total of 48 Spanish gastroenterology specialists nationwide participated in the project. The national meeting discussed the 10 issues in working groups and reached consensus regarding the recommendations by anonymous, interactive vote following the Delphi methodology. Final answers were developed, based on evidence and clinical experience of the participants. All the recommendations achieved a high level of agreement in the plenary vote, although the quality of the evidence was markedly heterogeneous. The lowest percentage of agreement corresponded to the questions with the weakest level of evidence, highlighting the necessity of conducting further studies in these areas. The recommendations focused on (1) aminosalicylates therapy (regarding dose and appropriateness of coadministration with thiopurines), (2) corticosteroid therapy (regarding dose and route of administration), (3) thiopurine treatment (regarding indications and possibility of withdrawal), (4) anti-tumor necrosis factor therapy (regarding appropriateness of combination with thiopurines, intensification, or discontinuation of treatment), and (5) colorectal cancer (regarding risk and time trends). The UC Horizons Project raised a series of eminently practical questions about the management of UC and provided responses based on the best scientific evidence available.
The UC{sub 2−x} – Carbon eutectic: A laser heating study
Energy Technology Data Exchange (ETDEWEB)
Manara, D., E-mail: dario.manara@ec.europa.eu; Boboridis, K.; Morel, S.; De Bruycker, F.
2015-11-15
The UC{sub 2−x} – carbon eutectic has been studied by laser heating and fast multi-wavelength pyrometry under inert atmosphere. The study has been carried out on three compositions, two of which close to the phase boundary of the UC{sub 2−x} – C miscibility gap (with C/U atomic ratios 2 and 2.1), and one, more crucial, with a large excess of carbon (C/U = 2.82). The first two compositions were synthesised by arc-melting. This synthesis method could not be applied to the last composition, which was therefore completed directly by laser irradiation. The U – C – O composition of the samples was checked by using a combustion method in an ELTRA{sup ®} analyser. The eutectic temperature, established to be 2737 K ± 20 K, was used as a radiance reference together with the cubic – tetragonal (α → β) solid state transition, fixed at 2050 K ± 20 K. The normal spectral emissivity of the carbon-richer compounds increases up to 0.7, whereas the value 0.53 was established for pure hypostoichiometric uranium dicarbide at the limit of the eutectic region. This increase is analysed in the light of the demixing of excess carbon, and used for the determination of the liquidus temperature (3220 K ± 50 K for UC{sub 2.82}). Due to fast solid state diffusion, also fostered by the cubic – tetragonal transition, no obvious signs of a lamellar eutectic structure could be observed after quenching to room temperature. The eutectic surface C/UC{sub 2−x} composition could be qualitatively, but consistently, followed during the cooling process with the help of the recorded radiance spectra. Whereas the external liquid surface is almost entirely constituted by uranium dicarbide, it gets rapidly enriched in demixed carbon upon freezing. Demixed carbon seems to quickly migrate towards the inner bulk during further cooling. At the α → β transition, uranium dicarbide covers again the almost entire external surface. - Highlights: • The melting behaviour
UC/Los Alamos Entrepreneurial Postdoctoral Fellowship Pilot Program
Energy Technology Data Exchange (ETDEWEB)
Johnston, Mariann R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Clow, Shandra Deann [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-03-06
The UC/Los Alamos Entrepreneurial Postdoctoral Fellowship Pilot Program (Pilot) for existing postdoctoral researchers at Los Alamos National Laboratory (Los Alamos) to gain skills in entrepreneurship and commercializing technology as part of their postdoctoral experience. This program will incorporate training and mentoring during the first 6-month period, culminating in a focused 6-month Fellowship aimed at creating a new business in Northern New Mexico.
Thermodynamic Factors Affecting UC1-xNxIrradiation and Synthesis
Energy Technology Data Exchange (ETDEWEB)
Lindemer, T.B.
2005-04-22
There is interest in attempting to synthesize nearly pure uranium nitride (UN) kernels for high-temperature gas-cooled reactor (HTGR) fuel. Because the proposed process involves carbothermic conversion of a urania-carbon mixture in nitrogen and because there is a complete ideal solution of uranium carbide (UC) and UN, which is written as UC{sub 1-x}N{sub x}, the practical value of x for fuel irradiation needs to be determined. Insight is to be gained by relevant thermodynamic calculations of carbide-nitride equilibria for the fuel and fission product systems. The equilibria are readily compared on the nitrogen-based Ellingham diagram, which, in turn, provides guidance in interpreting past irradiations and in synthesis of the UC{sub 1-x}N{sub x} kernels.
DEFF Research Database (Denmark)
Yu, Xianbin; Gibbon, Timothy Braidwood; Tafur Monroy, Idelfonso
2009-01-01
the requirements of Federal Communications Commission regulations. We experimentally demonstrated a 781.25-Mb/s UWB-over-fiber transmission system. A digital-signal-processing-based receiver is employed to calculate the bit-error rate. Our proposed system has potential application in future high-speed UWB impulse...
Energy Technology Data Exchange (ETDEWEB)
Yeh, Bi-Wen [Department of Medical Laboratory Science and Biotechnology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); Department of Urology, Kaohsiung Medical University Hospital, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Department of Urology, School of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Li, Wei-Ming [Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Department of Urology, Kaohsiung Medical University Hospital, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Department of Urology, School of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Li, Ching-Chia [Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Department of Urology, Kaohsiung Medical University Hospital, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Department of Urology, School of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Department of Urology, Kaohsiung Municipal Ta-Tung Hospital, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Kang, Wan-Yi [Department of Pathology, Kuo General Hospital, Tainan 701, Taiwan (China); Huang, Chun-Nung [Department of Urology, Kaohsiung Medical University Hospital, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Department of Urology, School of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Hour, Tzyh-Chyuan [Institute of Biochemistry, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Liu, Zi-Miao [Department of Medical Laboratory Science and Biotechnology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); and others
2016-01-01
Gemcitabine and cisplatin (GC) has been widely used for advanced and metastatic urothelial carcinoma (UC). However, resistance to this remedy has been noticed. We have demonstrated that increase of TG-interacting factor (TGIF) in specimens is associated with worse prognosis of upper tract UC (UTUC) patients. The roles of TGIF in the gemcitabine resistance of UC were explored. Specimens of 23 locally advanced/advanced stage UTUC patients who received GC systemic chemotherapy after radical nephroureterectomy were collected to evaluate the alterations of TGIF in the resistance to the remedy by using immunohistochemistry. In vitro characterizations of mechanisms mediating TGIF in gemcitabine resistance were conducted by analyzing NTUB1 cells and their gemcitabine-resistant subline, NGR cells. Our results show that increased TGIF is significantly associated with chemo-resistance, poor progression-free survival, and higher cancer-related deaths of UTUC patients. Higher increases of TGIF, p-AKT{sup Ser473} and invasive ability were demonstrated in NGR cells. Overexpression of TGIF in NTUB1 cells upregulated p-AKT{sup Ser473} activation, enhanced migration ability, and attenuated cellular sensitivity to gemcitabine. Knockdown of TGIF in NGR cells downregulated p-AKT{sup Ser473} activation, declined migration ability, and enhanced cellular sensitivity to gemcitabine. In addition, histone deacetylases inhibitor trichostatin A (TSA) inhibited TGIF, p-AKT{sup Ser473} expression and migration ability. Synergistic effects of gemcitabine and TSA on NGR cells were also demonstrated. Collectively, TGIF contributes to the gemcitabine resistance of UC via AKT activation. Combined treatment with gemcitabine and TSA might be a promising therapeutic remedy to improve the gemcitabine resistance of UC. - Highlights: • TGIF expression in UC cells is associated with chemoresistance to gemcitabine. • TGIF-regulated AKT activation contributes to the gemcitabine resistance. • Increased
International Nuclear Information System (INIS)
Yeh, Bi-Wen; Li, Wei-Ming; Li, Ching-Chia; Kang, Wan-Yi; Huang, Chun-Nung; Hour, Tzyh-Chyuan; Liu, Zi-Miao
2016-01-01
Gemcitabine and cisplatin (GC) has been widely used for advanced and metastatic urothelial carcinoma (UC). However, resistance to this remedy has been noticed. We have demonstrated that increase of TG-interacting factor (TGIF) in specimens is associated with worse prognosis of upper tract UC (UTUC) patients. The roles of TGIF in the gemcitabine resistance of UC were explored. Specimens of 23 locally advanced/advanced stage UTUC patients who received GC systemic chemotherapy after radical nephroureterectomy were collected to evaluate the alterations of TGIF in the resistance to the remedy by using immunohistochemistry. In vitro characterizations of mechanisms mediating TGIF in gemcitabine resistance were conducted by analyzing NTUB1 cells and their gemcitabine-resistant subline, NGR cells. Our results show that increased TGIF is significantly associated with chemo-resistance, poor progression-free survival, and higher cancer-related deaths of UTUC patients. Higher increases of TGIF, p-AKT Ser473 and invasive ability were demonstrated in NGR cells. Overexpression of TGIF in NTUB1 cells upregulated p-AKT Ser473 activation, enhanced migration ability, and attenuated cellular sensitivity to gemcitabine. Knockdown of TGIF in NGR cells downregulated p-AKT Ser473 activation, declined migration ability, and enhanced cellular sensitivity to gemcitabine. In addition, histone deacetylases inhibitor trichostatin A (TSA) inhibited TGIF, p-AKT Ser473 expression and migration ability. Synergistic effects of gemcitabine and TSA on NGR cells were also demonstrated. Collectively, TGIF contributes to the gemcitabine resistance of UC via AKT activation. Combined treatment with gemcitabine and TSA might be a promising therapeutic remedy to improve the gemcitabine resistance of UC. - Highlights: • TGIF expression in UC cells is associated with chemoresistance to gemcitabine. • TGIF-regulated AKT activation contributes to the gemcitabine resistance. • Increased TGIF is significantly
Release properties of UC sub x and molten U targets
Roussière, B; Sauvage, J; Bajeat, O; Barre, N; Clapier, F; Cottereau, E; Donzaud, C; Ducourtieux, M; Essabaa, S; Guillemaud-Müller, D; Lau, C; Lefort, H; Liang, C F; Le Blanc, F; Müller, A C; Obert, J; Pauwels, N; Potier, J C; Pougheon, F; Proust, J; Sorlin, O; Verney, D; Wojtasiewicz, A
2002-01-01
The release properties of UC sub x and molten U thick targets associated with a Nier-Bernas ion source have been studied. Two experimental methods are used to extract the release time. Results are presented and discussed for Kr, Cd, I and Xe.
Two-stage robust UC including a novel scenario-based uncertainty model for wind power applications
International Nuclear Information System (INIS)
Álvarez-Miranda, Eduardo; Campos-Valdés, Camilo; Rahmann, Claudia
2015-01-01
Highlights: • Methodological framework for obtaining Robust Unit Commitment (UC) policies. • Wind-power forecast using a revisited bootstrap predictive inference approach. • Novel scenario-based model for wind-power uncertainty. • Efficient modeling framework for obtaining nearly optimal UC policies in reasonable time. • Effective incorporation of wind-power uncertainty in the UC modeling. - Abstract: The complex processes involved in the determination of the availability of power from renewable energy sources, such as wind power, impose great challenges in the forecasting processes carried out by transmission system operators (TSOs). Nowadays, many of these TSOs use operation planning tools that take into account the uncertainty of the wind-power. However, most of these methods typically require strict assumptions about the probabilistic behavior of the forecast error, and usually ignore the dynamic nature of the forecasting process. In this paper a methodological framework to obtain Robust Unit Commitment (UC) policies is presented; such methodology considers a novel scenario-based uncertainty model for wind power applications. The proposed method is composed by three main phases. The first two phases generate a sound wind-power forecast using a bootstrap predictive inference approach. The third phase corresponds to modeling and solving a one-day ahead Robust UC considering the output of the first phase. The performance of proposed approach is evaluated using as case study a new wind farm to be incorporated into the Northern Interconnected System (NIS) of Chile. A projection of wind-based power installation, as well as different characteristic of the uncertain data, are considered in this study
Directory of Open Access Journals (Sweden)
Jean-Guy Baril
2003-01-01
Full Text Available OBJECTIVE: To assess the efficacy of nelfinavir mesylate (NFV in combination with delavirdine mesylate(DLV or efavirenz (EFV and other antiretroviral agents following virological failure on other protease inhibitor (PI-based regimens.
Energy Technology Data Exchange (ETDEWEB)
Lindemer, T.B. [MPi Business Solutions, Inc., Knoxville, TN 37915 (United States); Silva, C.M.; Henry, J.J. [Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6063 (United States); McMurray, J.W., E-mail: mcmurrayjw1@ornl.gov [Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6063 (United States); Voit, S.L.; Collins, J.L.; Hunt, R.D. [Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6063 (United States)
2017-01-15
This report details the continued investigation of process variables involved in converting sol-gel-derived, urania-carbon microspheres to ∼820-μm-dia. UC{sub 1-x}N{sub x} fuel kernels in flow-through, vertical Mo and W crucibles at temperatures up to 2123 K. Experiments included calcining of air-dried UO{sub 3}-H{sub 2}O-C microspheres in Ar and H{sub 2}-containing gases, conversion of the resulting UO{sub 2}-C kernels to dense UO{sub 2}:2UC in the same gases and vacuum, and its conversion in N{sub 2} to UC{sub 1-x}N{sub x} (x = ∼0.85). The thermodynamics of the relevant reactions were applied extensively to interpret and control the process variables. Producing the precursor UO{sub 2}:2UC kernel of ∼96% theoretical density was required, but its subsequent conversion to UC{sub 1-x}N{sub x} at 2123 K was not accompanied by sintering and resulted in ∼83–86% of theoretical density. Increasing the UC{sub 1-x}N{sub x} kernel nitride component to ∼0.98 in flowing N{sub 2}-H{sub 2} mixtures to evolve HCN was shown to be quantitatively consistent with present and past experiments and the only useful application of H{sub 2} in the entire process. - Highlights: • Sol-gel feedstock conversion to UN through carbothermic reduction. • Investigation of process gas effect on final kernel quality and density. • Recommended process for consistent kernel production.
Directory of Open Access Journals (Sweden)
Meg Coffin Murray
2017-05-01
Findings\tUC was found to increase personal productivity, remove communication barriers, and create a more positive work environment. Recommendations for Practitioners\t: The findings of this study will aid organizations in making investment decisions as they evolve their business communications strategy. Impact on Society: Unified Communications will play an increasingly important role as people adapt to the evolving digital world through which they communicate and collaborate. Future Research: Little research exists that examines the impact of UC within an organization. Additional research investigating the use of UC in a variety of business sectors is needed.
Safety analysis report on Model UC-609 shipping package
International Nuclear Information System (INIS)
Sandberg, R.R.
1977-08-01
This Safety Analysis Report for Packaging demonstrates that model UC-609 shipping package can safely transport tritium in any of its forms. The package and its contents are described. The package when subjected to the transport conditions specified in the Code of Federal Regulations, Title 10, Part 71 is evaluated. Finally, compliance with these regulations is discussed
Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.
2017-10-01
The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.
Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio
2016-09-30
We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.
International Nuclear Information System (INIS)
Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.
1986-01-01
The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)
Energy Technology Data Exchange (ETDEWEB)
Fang, Evandro Fei; Wong, Jack Ho [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China); Bah, Clara Shui Fern [Department of Food Science, Division of Sciences, University of Otago (New Zealand); Lin, Peng [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China); Tsao, Sai Wah [Department of Anatomy, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Sassoon Road, Pokfulam, Hong Kong SAR (China); Ng, Tzi Bun, E-mail: b021770@mailserv.cuhk.edu.hk [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China)
2010-06-11
Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K{sub i}, 0.1 x 10{sup -9} M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI.
Fang, Evandro Fei; Wong, Jack Ho; Bah, Clara Shui Fern; Lin, Peng; Tsao, Sai Wah; Ng, Tzi Bun
2010-06-11
Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K(i), 0.1 x 10(-9)M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI. (c) 2010 Elsevier Inc. All rights reserved.
Additively Homomorphic UC commitments with Optimal Amortized Overhead
DEFF Research Database (Denmark)
Cascudo Pueyo, Ignacio; Damgård, Ivan Bjerre; David, Bernardo Machado
2015-01-01
We propose the first UC secure commitment scheme with (amortized) computational complexity linear in the size of the string committed to. After a preprocessing phase based on oblivious transfer, that only needs to be done once and for all, our scheme only requires a pseudorandom generator and a l......, our basic scheme has amortised concrete efficiency comparable with previous protocols in the Random Oracle Model even though it is constructed in the plain model....
PRACTICE OF USING VIRAL PROTEASE INHIBITORS IN CHILDREN WITH HIV INFECTION
Directory of Open Access Journals (Sweden)
V.B. Denisenko
2010-01-01
Full Text Available Selection of the most effective and safest high-active antiretroviral therapies is a critical issue faced by modern HIV medicine. Authors studied 28 children with HIV infection aged from 3 to 7 divided into two groups administered a combination of two HIV reverse transcriptase nucleoside inhibitors with viral protease nelfinavir inhibitors (n = 13 and lopinavir/ritonavir (n = 15. The subjects in both groups demonstrated a decreased frequency of HIV-associated symptoms and opportunistic infections, positive dynamics of immunological indicators, suppression of HIV replication. When lopinavir/ritonavir was administered, there was more even better dynamics in clinical, immunological and virologic parameters, which allows this medication to be recommended as a antiretroviral therapy for children. Key words: HIV infection, lopinavir/ritonavir, nelfinavir, children. (Pediatric Pharmacology. – 2010; 7(1:62-67
Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan
2012-01-01
The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.
UC@MOOC: A pedagogical innovation to face the challenges of ...
African Journals Online (AJOL)
Log in or Register to get access to full text downloads. ... This work presents the UC@MOOC project as a pedagogical innovation to ... Audiovisual digital contents also help us to save time, and go to a hybrid teaching or even flipped classrooms in some ... Keywords: MOOC, e-Learning, Blended learning, flipped classroom, ...
Lugo, James P; Saiyed, Zainulabedin M; Lau, Francis C; Molina, Jhanna Pamela L; Pakdaman, Michael N; Shamie, Arya Nick; Udani, Jay K
2013-10-24
UC-II contains a patented form of undenatured type II collagen derived from chicken sternum. Previous preclinical and clinical studies support the safety and efficacy of UC-II in modulating joint discomfort in osteoarthritis and rheumatoid arthritis. The purpose of this study was to assess the efficacy and tolerability of UC-II in moderating joint function and joint pain due to strenuous exercise in healthy subjects. This randomized, double-blind, placebo-controlled study was conducted in healthy subjects who had no prior history of arthritic disease or joint pain at rest but experienced joint discomfort with physical activity. Fifty-five subjects who reported knee pain after participating in a standardized stepmill performance test were randomized to receive placebo (n = 28) or the UC-II (40 mg daily, n = 27) product for 120 days. Joint function was assessed by changes in degree of knee flexion and knee extension as well as measuring the time to experiencing and recovering from joint pain following strenuous stepmill exertion. After 120 days of supplementation, subjects in the UC-II group exhibited a statistically significant improvement in average knee extension compared to placebo (81.0 ± 1.3º vs 74.0 ± 2.2º; p = 0.011) and to baseline (81.0 ± 1.3º vs 73.2 ± 1.9º; p = 0.002). The UC-II cohort also demonstrated a statistically significant change in average knee extension at day 90 (78.8 ± 1.9º vs 73.2 ± 1.9º; p = 0.045) versus baseline. No significant change in knee extension was observed in the placebo group at any time. It was also noted that the UC-II group exercised longer before experiencing any initial joint discomfort at day 120 (2.8 ± 0.5 min, p = 0.019), compared to baseline (1.4 ± 0.2 min). By contrast, no significant changes were seen in the placebo group. No product related adverse events were observed during the study. At study conclusion, five individuals in the UC-II cohort
Review of the thermodynamics of the U--C, Pu--C, and U--Pu--C systems
International Nuclear Information System (INIS)
Tetenbaum, M.; Sheth, A.; Olson, W.
1975-06-01
Thermodynamic properties such as enthalpy, heat capacity, entropy, heat and free energy of formation, and vaporization behavior are presented for the U--C, Pu--C, and U--Pu--C systems. These properties are of interest to scientists and engineers involved in the expanding field of advanced fuel LMFBR systems. The information on these systems has been derived largely from the discussions of the IAEA Panel on the assessment of thermodynamic properties of the U--C, Pu--C, and U--Pu--C systems. (U.S.)
DEFF Research Database (Denmark)
Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin
2013-01-01
Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...
NEW DRUGS NEW TARGETS AND NOVEL ANTIRETROVIRALS
African Journals Online (AJOL)
2005-11-02
Nov 2, 2005 ... Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs).
DEFF Research Database (Denmark)
Bastos, Renan F.; Dragicevic, Tomislav; Guerrero, Josep M.
2016-01-01
(UC) are used as SD and the common DC-link is fed by alternative sources such as photovoltaic panels, wind turbines and fuel cells as well. The batteries are used to supply/absorb extra power in steady-state regime while the UC absorbs the power transients caused by variations on the power production......In this paper we propose a new decentralized control strategy applied to a DC Microgrid in order to manage the power delivery of storage devices into a common DC-link, avoiding high-bandwidth communication (HBC) between the storage devices (SD) and alternative sources. Batteries and Ultracapacitors...... or load connections. The proposed strategy uses as input for the batteries control only the DC-link voltage and state of charge (SOC), while for the UC only the DC-link voltage and UC terminal voltage are used to achieve the power sharing among the storage devices, equalization of the batteries...
EOP and SAA Undergraduates Who Left UC Davis without a Degree.
Rasor, Marianne
Undergraduate students enrolled in the Educational Opportunity Program (EOP) or the Student Affirmative Action (SAA) program at the University of California (UC), Davis, who withdrew before graduation were surveyed in 1981. Attention was directed to the respondents' educational experiences after leaving, their current employment, and their…
UC Davis Fuel Cell, Hydrogen, and Hybrid Vehicle (FCH2V) GATE Center of Excellence
Energy Technology Data Exchange (ETDEWEB)
Erickson, Paul
2012-05-31
This is the final report of the UC Davis Fuel Cell, Hydrogen, and Hybrid Vehicle (FCH2V) GATE Center of Excellence which spanned from 2005-2012. The U.S. Department of Energy (DOE) established the Graduate Automotive Technology Education (GATE) Program, to provide a new generation of engineers and scientists with knowledge and skills to create advanced automotive technologies. The UC Davis Fuel Cell, Hydrogen, and Hybrid Vehicle (FCH2V) GATE Center of Excellence established in 2005 is focused on research, education, industrial collaboration and outreach within automotive technology. UC Davis has had two independent GATE centers with separate well-defined objectives and research programs from 1998. The Fuel Cell Center, administered by ITS-Davis, has focused on fuel cell technology. The Hybrid-Electric Vehicle Design Center (HEV Center), administered by the Department of Mechanical and Aeronautical Engineering, has focused on the development of plug-in hybrid technology using internal combustion engines. The merger of these two centers in 2005 has broadened the scope of research and lead to higher visibility of the activity. UC Davis's existing GATE centers have become the campus's research focal points on fuel cells and hybrid-electric vehicles, and the home for graduate students who are studying advanced automotive technologies. The centers have been highly successful in attracting, training, and placing top-notch students into fuel cell and hybrid programs in both industry and government.
Monforte, Anna-Maria; Ferro, Stefania; De Luca, Laura; Lo Surdo, Giuseppa; Morreale, Francesca; Pannecouque, Christophe; Balzarini, Jan; Chimirri, Alba
2014-02-15
A series of novel N1-aryl-2-arylthioacetamido-benzimidazoles were synthesized and evaluated as inhibitors of human immunodeficiency virus type-1 (HIV-1). Some of them proved to be effective in inhibiting HIV-1 replication at submicromolar and nanomolar concentration acting as HIV-1 non-nucleoside RT inhibitors (NNRTIs), with low cytotoxicity. The preliminary structure-activity relationship (SAR) of these new derivatives was discussed and rationalized by docking studies. Copyright © 2014 Elsevier Ltd. All rights reserved.
New targets and novel antiretrovirals | Wood | Southern African ...
African Journals Online (AJOL)
Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs). These ARV classes ...
Metabolism of UC-labelled urea in conventional, germ-free and mono-associated rats
Energy Technology Data Exchange (ETDEWEB)
Juhr, N.C.; Franke, J.
1987-01-01
This report deals with the utilization of UC-labelled urea in conventional, defined associated and germ-free rats. With conventional animals 71.44% of the administered UC dose can be demonstrated in the exhaled air, 0.47% in organs and 27.35% in the urine. 1.04% was found in the intestinal and fecal contents. Animals mono-associated with Proteus mirabilis have nearly the same utilization rate (59.15, 0.34, 35.98, 2% resp.). In germ-free animals 1.21% of the activity appeared in the exhaled air and showed a small part of non-enzymatic hydrolysis of urea. The excretion of 97.70% in the urine shows that urea is absorbed from the intestine in germ-free animals.
International Nuclear Information System (INIS)
Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado
2011-01-01
LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy
Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R
2015-01-01
Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once
Chung, Suhman; Wendeler, Michaela; Rausch, Jason W.; Beilhartz, Greg; Gotte, Matthias; O'Keefe, Barry R.; Bermingham, Alun; Beutler, John A.; Liu, Shixin; Zhuang, Xiaowei; Le Grice, Stuart F. J.
2010-01-01
Vinylogous ureas 2-amino-5,6,7,8-tetrahydro-4H-cyclohepta[b]thiophene-3-carboxamide and N-[3-(aminocarbonyl)-4,5-dimethyl-2-thienyl]-2-furancarboxamide (compounds 1 and 2, respectively) were recently identified to be modestly potent inhibitors of the RNase H activity of HIV-1 and HIV-2 reverse transcriptase (RT). Both compounds shared a 3-CONH2-substituted thiophene ring but were otherwise structurally unrelated, which prevented a precise definition of the pharmacophore. We have therefore exa...
Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan
2016-05-01
Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.
Chen, Ke; Wang, Ding; Du, Wei Ting; Han, Zhi-Bo; Ren, He; Chi, Ying; Yang, Shao Guang; Zhu, Delin; Bayard, Francis; Han, Zhong Chao
2010-06-01
Human umbilical-cord-derived mesenchymal stem cells (hUC-MSCs) constitute an attractive alternative to bone-marrow-derived MSCs for potential clinical applications because of easy preparation and lower risk of viral contamination. In this study, both proliferation of human peripheral blood mononuclear cells (hPBMCs) and their IFN-gamma production in response to mitogenic or allogeneic stimulus were effectively inhibited by hUC-MSCs. Co-culture experiments in transwell systems indicated that the suppression was largely mediated by soluble factor(s). Blocking experiments identified prostaglandin E(2) (PGE(2)) as the major factor, because inhibition of PGE(2) synthesis almost completely mitigated the immunosuppressive effects, whereas neutralization of TGF-beta, IDO, and NO activities had little effects. Moreover, the inflammatory cytokines, IFN-gamma and IL-1beta, produced by hPBMCs upon activation notably upregulated the expression of cyclooxygenase-2 (COX-2) and the production of PGE(2) by hUC-MSCs. In conclusion, our data have demonstrated for the first time the PGE(2)-mediated mechanism by which hUC-MSCs exert their immunomodulatory effects. Copyright 2010 Elsevier Inc. All rights reserved.
Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.
2007-01-01
Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225
Bista, Rajan K.; Brentnall, Teresa A.; Bronner, Mary P.; Langmead, Christopher J.; Brand, Randall E.; Liu, Yang
2011-01-01
BACKGROUND Current surveillance guidelines for patients with long-standing ulcerative colitis (UC) recommend repeated colonoscopy with random biopsies, which is time-consuming, discomforting and expensive. A less invasive strategy is to identify neoplasia by analyzing biomarkers from the more accessible rectum to predict the need for a full colonoscopy. The goal of this pilot study is to evaluate whether optical markers of rectal mucosa derived from a novel optical technique – partial-wave spectroscopic microscopy (PWS) could identify UC patients with high-grade dysplasia (HGD) or cancer (CA) present anywhere in their colon. METHODS Banked frozen non-dysplastic mucosal rectal biopsies were used from 28 UC patients (15 without dysplasia and 13 with concurrent HGD or CA). The specimen slides were made using a touch prep method and underwent PWS analysis. We divided the patients into two groups: 13 as a training set and an independent 15 as a validation set. RESULTS We identified six optical markers, ranked by measuring the information gain with respect to the outcome of cancer. The most effective markers were selected by maximizing the cross validated training accuracy of a Naive Bayes classifier. The optimal classifier was applied to the validation data yielding 100% sensitivity and 75% specificity. CONCLUSIONS Our results indicate that the PWS-derived optical markers can accurately predict UC patients with HGD/CA through assessment of rectal epithelial cells. By aiming for a high sensitivity, our approach could potentially simplify the surveillance of UC patients and improve overall resource utilization by identifying patients with HGD/CA who should proceed with colonoscopy. PMID:21351200
DEFF Research Database (Denmark)
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy
2011-01-01
Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...
Kim, Hyun-Jung; Kim, Jin-Hee; Song, Yeo-Ju; Seo, Young-Kwon; Park, Jung-Keug; Kim, Chan-Wha
2015-09-01
In this study, we used proteomics to investigate the effects of sonic vibration (SV) on mesenchymal stem cells derived from human umbilical cords (hUC-MSCs) during neural differentiation to understand how SV enhances neural differentiation of hUC-MSCs. We investigated the levels of gene and protein related to neural differentiation after 3 or 5 days in a group treated with 40-Hz SV. In addition, protein expression patterns were compared between the control and the 40-Hz SV-treated hUC-MSC groups via a proteomic approach. Among these proteins, calponin3 (CNN3) was confirmed to have 299 % higher expression in the 40-Hz SV stimulated hUC-MSCs group than that in the control by Western blotting. Notably, overexpression of CNN3-GFP in Chinese hamster ovary (CHO)-K1 cells had positive effects on the stability and reorganization of F-actin compared with that in GFP-transfected cells. Moreover, CNN3 changed the morphology of the cells by making a neurite-like form. After being subjected to SV, messenger RNA (mRNA) levels of glutamate receptors such as PSD95, GluR1, and NR1 as well as intracellular calcium levels were upregulated. These results suggest that the activity of glutamate receptors increased because of CNN3 characteristics. Taken together, these results demonstrate that overexpressed CNN3 during SV increases expression of glutamate receptors and promotes functional neural differentiation of hUC-MSCs.
Papp, Eszter; Mohammadi, Hakimeh; Loutfy, Mona R.; Yudin, Mark H.; Murphy, Kellie E.; Walmsley, Sharon L.; Shah, Rajiv; MacGillivray, Jay; Silverman, Michael; Serghides, Lena
2015-01-01
Background. Protease inhibitor (PI)–based combination antiretroviral therapy (cART) is administered during pregnancy to prevent perinatal human immunodeficiency virus (HIV) transmission. However, PI use has been associated with adverse birth outcomes, including preterm delivery and small-for-gestational-age (SGA) births. The mechanisms underlying these outcomes are unknown. We hypothesized that PIs contribute to these adverse events by altering progesterone levels. Methods. PI effects on trophoblast progesterone production were assessed in vitro. A mouse pregnancy model was used to assess the impact of PI-based cART on pregnancy outcomes and progesterone levels in vivo. Progesterone levels were assessed in plasma specimens from 27 HIV-infected and 17 HIV-uninfected pregnant women. Results. PIs (ritonavir, lopinavir, and atazanavir) but not nucleoside reverse transcriptase inhibitors (NRTIs) or nonnucleoside reverse transcriptase inhibitors reduced trophoblast progesterone production in vitro. In pregnant mice, PI-based cART but not dual-NRTI therapy was associated with significantly lower progesterone levels that directly correlated with fetal weight. Progesterone supplementation resulted in a significant improvement in fetal weight. We observed lower progesterone levels and smaller infants in HIV-infected women receiving PI-based cART, compared with the control group. In HIV-infected women, progesterone levels correlated significantly with birth weight percentile. Conclusions. Our data suggest that PI use in pregnancy may lead to lower progesterone levels that could contribute to adverse birth outcomes. PMID:25030058
Papp, Eszter; Mohammadi, Hakimeh; Loutfy, Mona R; Yudin, Mark H; Murphy, Kellie E; Walmsley, Sharon L; Shah, Rajiv; MacGillivray, Jay; Silverman, Michael; Serghides, Lena
2015-01-01
Protease inhibitor (PI)-based combination antiretroviral therapy (cART) is administered during pregnancy to prevent perinatal human immunodeficiency virus (HIV) transmission. However, PI use has been associated with adverse birth outcomes, including preterm delivery and small-for-gestational-age (SGA) births. The mechanisms underlying these outcomes are unknown. We hypothesized that PIs contribute to these adverse events by altering progesterone levels. PI effects on trophoblast progesterone production were assessed in vitro. A mouse pregnancy model was used to assess the impact of PI-based cART on pregnancy outcomes and progesterone levels in vivo. Progesterone levels were assessed in plasma specimens from 27 HIV-infected and 17 HIV-uninfected pregnant women. PIs (ritonavir, lopinavir, and atazanavir) but not nucleoside reverse transcriptase inhibitors (NRTIs) or nonnucleoside reverse transcriptase inhibitors reduced trophoblast progesterone production in vitro. In pregnant mice, PI-based cART but not dual-NRTI therapy was associated with significantly lower progesterone levels that directly correlated with fetal weight. Progesterone supplementation resulted in a significant improvement in fetal weight. We observed lower progesterone levels and smaller infants in HIV-infected women receiving PI-based cART, compared with the control group. In HIV-infected women, progesterone levels correlated significantly with birth weight percentile. Our data suggest that PI use in pregnancy may lead to lower progesterone levels that could contribute to adverse birth outcomes. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.
A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome
Directory of Open Access Journals (Sweden)
Marcin Kierczak
2009-10-01
Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.
46 CFR 54.25-8 - Radiography (modifies UW-11(a), UCS-57, UNF-57, UHA-33, and UHT-57).
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false Radiography (modifies UW-11(a), UCS-57, UNF-57, UHA-33, and UHT-57). 54.25-8 Section 54.25-8 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... Radiography (modifies UW-11(a), UCS-57, UNF-57, UHA-33, and UHT-57). (a) Full radiography is required for all...
Directory of Open Access Journals (Sweden)
Ilaria eSciamanna
2016-02-01
Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado
2016-02-01
In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Cloning of cellulase genes using pUC18 and lambda 2001 vectors
International Nuclear Information System (INIS)
Bashir, A.; Ashfaq, S.R.; Rajoka, M.I.; Malik, K.A.; Batt, C.A.
1991-01-01
Chromosomal DNA from cellulomonas biazotea NIAB 442 was used for isolation and cloning of cellulase genes. For this purpose plasmid pUC18 was used for cloning fragments in the range of 109 Kb and phase vector lambda 2001 for cloning fragments in the range of 15-20 Kb respectively. Three restriction enzymes BamHI, Sau3AI and SaII were used for partial restriction of chromosomal DNA to obtain fragment size in the range of 0.5 - 20 Kb. BamHI and SaII were used to linearize pUC18 to obtain compatible ends against the three enzymes used in chromosomal DNA restriction. Linearized pUC18 was then ligated to respective compatible chromosomal DNA fragments and transformed to JM109 competent cells. A total of 6781 recombinants were tested for the production of B-glucosidase and carboxy methyl cellulase (CMC-ase) production. Only one of the recombinants was found to be positive for B-glucosidase production in solid culture. One of the recombinants was found positive for CMC-ase production in solid culture and is being verified and characterized. Larger DNA fragments in the range of 15-20 Kilobase were obtained by partial restriction of chromosomal DNA with BamHI, SaII and Xhol. Lambda 2001 was double digested with BamHI/EcoRI and Xhol/EcoRI for removal of stuffer fragment. Ligation of respective compatible ends was performed between Lambda DNA and chromosomal DNA. Ligation mixture was used for packaging and infection of P2 lysogen. No plaques could be obtained on P2 lysogen due to inefficient packaging. (author)
Directory of Open Access Journals (Sweden)
Francesca Carlini
Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.
Directory of Open Access Journals (Sweden)
Alessandra M. T. de Souza
2013-10-01
Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.
Directory of Open Access Journals (Sweden)
Petrova Anna
2007-07-01
Full Text Available Abstract Background Although the introduction of combined therapy with reverse transcriptase and protease inhibitors has resulted in considerable decrease in HIV related mortality; it has also induced the development of multiple drug-resistant HIV-1 variants. The few studies on HIV-1 mutagenesis in HIV infected children have not evaluated the impact of HIV-1 mutations on the clinical, virological and immunological presentation of HIV disease that is fundamental to optimizing the treatment regimens for these patients. Results A cross sectional study was conducted to evaluate the impact of treatment regimens and resistance mutation patterns on the clinical, virological, and immunological presentation of HIV disease in 41 children (25 male and 16 female at the Robert Wood Johnson Pediatric AIDS Program in New Brunswick, New Jersey. The study participants were symptomatic and had preceding treatment history with combined ARV regimens including protease inhibitors (PIs, nucleoside reverse transcriptase inhibitors (NRTIs and non-nucleoside reverse transcriptase inhibitors (NNRTIs. Fifteen (36.6% children were treated with NRTI+NNRTI+ PI, 6 (14.6% with NRTI+NNRTIs, 13 (31.7% with NRTI+PIs, and the remaining 7 (17.1% received NRTIs only. Combined ARV regimens did not significantly influence the incidence of NRTI and NNRTI associated mutations. The duration of ARV therapy and the child's age had no significant impact on the ARV related mutations. The clinico-immunological presentation of the HIV disease was not associated with ARV treatment regimens or number of resistance mutations. However, primary mutations in the protease (PR gene increased the likelihood of plasma viral load (PVL ≥ 10,000 copies/mL irrespective of the child's age, duration of ARV therapy, presence of NRTI and NNRTI mutation. Viremia ≥ 10,000 copies/mL was recorded in almost all the children with primary mutations in the PR region (n = 12/13, 92.3% as compared with only 50.0% (n
Results of the Fall 2007 UC Davis Campus Travel Assessment
Congleton, Christopher
2009-01-01
Our collective transportation choices have far-reaching effects both locally and globally, from traffic congestion to global warming. While the concerted actions of many travelers working together could make significant inroads into solving these problems, a single traveler working alone could not. This report presents a snapshot of campus travel at the outset of the 2007-2008 academic year, measures campus mode split and average vehicle ridership, collects UC Davis travelers' opinions about ...
Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory
Directory of Open Access Journals (Sweden)
Edward J. Steele
2017-11-01
Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.
The history of antiretrovirals: key discoveries over the past 25 years.
De Clercq, Erik
2009-09-01
Within 25 years after zidovudine (3'-azido-2',3'-dideoxythymidine, AZT) was first described as an inhibitor of HIV replication, 25 anti-HIV drugs have been formally approved for clinical use in the treatment of HIV infections: seven nucleoside reverse transcriptase inhibitors (NRTIs): zidovudine, didanosine, zalcitabine, stavudine, lamivudine, abacavir and emtricitabine; one nucleotide reverse transcriptase inhibitor (NtRTI): tenofovir [in its oral prodrug form: tenofovir disoproxil fumarate (TDF)]; four non-nucleoside reverse transcriptase inhibitors (NNRTIs): nevirapine, delavirdine, efavirenz and etravirine; ten protease inhibitors (PIs): saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir, atazanavir, fosamprenavir, tipranavir and darunavir; one fusion inhibitor (FI): enfuvirtide; one co-receptor inhibitor (CRI): maraviroc and one integrase inhibitor (INI): raltegravir. These compounds are used in various drug combination (some at fixed dose) regimens so as to achieve the highest possible benefit and tolerability, and to diminish the risk of virus-drug resistance development. (c) 2009 John Wiley & Sons, Ltd.
DEFF Research Database (Denmark)
Hansen, Carl Frederik; Vassiliadis, Efstathios; Vrang, Niels
2014-01-01
To investigate the short-term effect of ileal interposition (IT) surgery on gut morphology and enteroendocrine cell numbers in the pre-diabetic UC Davis type 2 diabetes mellitus (UCD-T2DM) rat.......To investigate the short-term effect of ileal interposition (IT) surgery on gut morphology and enteroendocrine cell numbers in the pre-diabetic UC Davis type 2 diabetes mellitus (UCD-T2DM) rat....
Initial source and site characterization studies for the U.C. Santa Barbara campus
Energy Technology Data Exchange (ETDEWEB)
Archuleta, R.; Nicholson, C.; Steidl, J.; Gurrola, L.; Alex, C.; Cochran, E.; Ely, G.; Tyler, T. [University of California, Santa Barbara (United States)
1997-12-01
The University of California Campus-Laboratory Collaboration (CLC) project is an integrated 3 year effort involving Lawrence Livermore National Laboratory (LLNL) and four UC campuses - Los Angeles (UCLA), Riverside (UCR), Santa Barbara (UCSB), and San Diego (UCSD) - plus additional collaborators at San Diego State University (SDSU), at Los Alamos National Laboratory and in industry. The primary purpose of the project is to estimate potential ground motions from large earthquakes and to predict site-specific ground motions for one critical structure on each campus. This project thus combines the disciplines of geology, seismology, geodesy, soil dynamics, and earthquake engineering into a fully integrated approach. Once completed, the CLC project will provide a template to evaluate other buildings at each of the four UC campuses, as well as provide a methodology for evaluating seismic hazards at other critical sites in California, including other UC locations at risk from large earthquakes. Another important objective of the CLC project is the education of students and other professional in the application of this integrated, multidisciplinary, state-of-the-art approach to the assessment of earthquake hazard. For each campus targeted by the CLC project, the seismic hazard study will consist of four phases: Phase I - Initial source and site characterization, Phase II - Drilling, logging, seismic monitoring, and laboratory dynamic soil testing, Phase III - Modeling of predicted site-specific earthquake ground motions, and Phase IV - Calculations of 3D building response. This report cover Phase I for the UCSB campus and incudes results up through March 1997.
UC Berkeley's Celebration of the International Year of Astronomy 2009
Cobb, B. E.; Croft, S.; Silverman, J. M.; Klein, C.; Modjaz, M.
2010-08-01
We present the astronomy outreach efforts undertaken for the International Year of Astronomy 2009 at the University of California, Berkeley. Our department-wide endeavors included a monthly public lecture series by UC Berkeley astronomers and a major astronomy outreach event during a campus-wide university "open house," which included solar observing and a Starlab Planetarium. In addition to sharing our outreach techniques and outcomes, we discuss some of our unique strategies for advertising our events to the local community.
Lin, Chuan-ming; Gu, Jian; Zhang, Yu; Shen, Lian-jun; Ma, Li; Ni, Jun; Wang, Zhong-qiang; Wu, Wei
2012-03-01
To investigate the immunoregulation effects of umbilical cord mesenchymal stem cells (UC-MSCs) on the rats with collagen II induced arthritis (CIA). The rats were first immunized by intradermal injection of chicken collagen type II emulsified with complete Freund's adjuvant (CFA) to monitor their swelling of foot, hair color and action state. After injected UC-MSC by caudal vein, the rats were scored with the arthritis index (AI) once a week. Then, the concentration of interleukin (IL-6), tumor necrosis factor-α (TNF-α) in serum and D-dimer (D-D), antithrombin-III (AT-III), thrombomodulin (TM) in plasma were detected by ELISA. Obvious swellings of the feet were found in the experiment group compared with normal one. ELISA analysis showed that the concentrations of IL-6, TNF-α, D-D and TM in plasma of the experiment group as of (200.48 ± 15.04) ng/L, (450.25 ± 45.39) ng/L, (274.26 ± 67.93) ng/L and (9.18 ± 0.84) µg/L, respectively were higher than of(167.62 ± 0.97) ng/L, (371.44 ± 21.26) ng/L, (193.95 ± 8.22) ng/L and (6.30 ± 0.32) µg/L respectively in normal group (P < 0.05), but the concentration of AT-III \\[(89.57 ± 6.40) ng/L\\] was lower than normal group \\[(112.82 ± 1.74) ng/L\\] (P < 0.05). The levels of cytokines through the UC-MSCs treatment were significantly different from the model group (P < 0.05). After 9 weeks, these cytokines in the UC-MSCs group were mostly the same as the normal group. The thrombophilia status of the CIA rats was caused by immune injury. The UC-MSCs reduced the production of inflammatory cytokines and regulated and repaired the balance of coagulation and anticoagulation system of the body to cure the immune-related thrombophilia.
Production yields of noble-gas isotopes from ISOLDE UC$_{x}$/graphite targets
Bergmann, U C; Catherall, R; Cederkäll, J; Diget, C A; Fraile-Prieto, L M; Franchoo, S; Fynbo, H O U; Gausemel, H; Georg, U; Giles, T; Hagebø, E; Jeppesen, H B; Jonsson, O C; Köster, U; Lettry, Jacques; Nilsson, T; Peräjärvi, K; Ravn, H L; Riisager, K; Weissman, L; Äystö, J
2003-01-01
Yields of He, Ne, Ar, Kr and Xe isotopic chains were measured from UC$_{x}$/graphite and ThC$_{x}$/graphite targets at the PSB-ISOLDE facility at CERN using isobaric selectivity achieved by the combination of a plasma-discharge ion source with a water-cooled transfer line. %The measured half-lives allowed %to calculate the decay losses of neutron-rich isotopes in the %target and ion-source system, and thus to obtain information on the in-target %productions from the measured yields. The delay times measured for a UC$_x$/graphite target allow for an extrapolation to the expected yields of very neutron-rich noble gas isotopes, in particular for the ``NuPECC reference elements'' Ar and Kr, at the next-generation radioactive ion-beam facility EURISOL. \\end{abstract} \\begin{keyword} % keywords here, in the form: keyword \\sep keyword radioactive ion beams \\sep release \\sep ion yields \\sep ISOL (Isotope Separation On-Line) \\sep uranium and thorium carbide targets. % PACS codes here, in the form: \\PACS code \\sep code...
Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon
2015-08-01
completion. We show here for the first time that a single mutation in HIV-1 reverse transcriptase (L92P) selectively abolishes strand transfers without affecting the enzyme's DNA polymerase and RNase H functions. When this mutation was introduced into an infectious HIV-1 clone, viral replication was lost due to an impaired intracellular strand transfer, thus supporting the in vitro data. Therefore, finding novel drugs that target HIV-1 reverse transcriptase Leu92 may be beneficial for developing new potent and selective inhibitors of retroviral reverse transcription that will obstruct HIV-1 infectivity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
van Overveld, Mark; de Jong, Peter J.; Huijding, Jorg; Peters, Madelon L.
2010-01-01
Phobic individuals expect aversive UCS's following encounters with phobic stimuli. Previous research using a thought-experiment procedure showed that contamination rather than harm-related outcome expectancies differentiated best between high and low spider fearful undergraduates. This study
Examination of electromagnetic powers with the example of a uc(Faraday) disc dynamo
Reich, Felix A.; Müller, Wolfgang H.
2018-03-01
This paper studies the mathematical form of electromagnetic powers and their influence on the balance of energy by using the example of a uc(Faraday) disc. First, two forms of energy (and balances thereof) are discussed. These employ different forms of powers, which can be distinguished w.r.t. their physical origins and their interpretations in context with the notions of supply and production. The stationary uc(Faraday) disc experiment is modeled following the description by Kovetz (Electromagnetic theory, Oxford University Press, Oxford, 2000). Concepts for formulating the electromagnetic field equations for the rotating disc are discussed, and the corresponding approximate analytical solutions are presented. Based on the obtained electromagnetic fields, the powers of the disc are analyzed for a stationary process. The conversion of mechanical power to heating and electromagnetic powering of an external resistor is explained. The paper concludes with the computation of the time evolution of the angular velocity for a magnetically induced breaking process of the disc.
Collins, Kathleen; Nilsen, Timothy W
2013-08-01
Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.
Postexposure protection of macaques from vaginal SHIV infection by topical integrase inhibitors.
Dobard, Charles; Sharma, Sunita; Parikh, Urvi M; West, Rolieria; Taylor, Andrew; Martin, Amy; Pau, Chou-Pong; Hanson, Debra L; Lipscomb, Jonathan; Smith, James; Novembre, Francis; Hazuda, Daria; Garcia-Lerma, J Gerardo; Heneine, Walid
2014-03-12
Coitally delivered microbicide gels containing antiretroviral drugs are important for HIV prevention. However, to date, microbicides have contained entry or reverse transcriptase inhibitors that block early steps in virus infection and thus need to be given as a preexposure dose that interferes with sexual practices and may limit compliance. Integrase inhibitors block late steps after virus infection and therefore are more suitable for post-coital dosing. We first determined the kinetics of strand transfer in vitro and confirmed that integration begins about 6 hours after infection. We then used a repeat-challenge macaque model to assess efficacy of vaginal gels containing integrase strand transfer inhibitors when applied before or after simian/human immunodeficiency virus (SHIV) challenge. We showed that gel containing the strand transfer inhibitor L-870812 protected two of three macaques when applied 30 min before SHIV challenge. We next evaluated the efficacy of 1% raltegravir gel and demonstrated its ability to protect macaques when applied 3 hours after SHIV exposure (five of six protected; P infections showed no evidence of drug resistance in plasma or vaginal secretions despite continued gel dosing after infection. We documented rapid vaginal absorption reflecting a short pharmacological lag time and noted that vaginal, but not plasma, virus load was substantially reduced in the breakthrough infection after raltegravir gel treatment. We provide a proof of concept that topically applied integrase inhibitors protect against vaginal SHIV infection when administered shortly before or 3 hours after virus exposure.
Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel
1972-01-01
Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137
20 CFR 603.4 - What is the confidentiality requirement of Federal UC law?
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What is the confidentiality requirement of Federal UC law? 603.4 Section 603.4 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT....C. 502(a)), State law must include provision for such methods of administration as are found by the...
Strong Earthquake Motion Estimates for Three Sites on the U.C. Riverside Campus; TOPICAL
International Nuclear Information System (INIS)
Archuleta, R.; Elgamal, A.; Heuze, F.; Lai, T.; Lavalle, D.; Lawrence, B.; Liu, P.C.; Matesic, L.; Park, S.; Riemar, M.; Steidl, J.; Vucetic, M.; Wagoner, J.; Yang, Z.
2000-01-01
The approach of the Campus Earthquake Program (CEP) is to combine the substantial expertise that exists within the UC system in geology, seismology, and geotechnical engineering, to estimate the earthquake strong motion exposure of UC facilities. These estimates draw upon recent advances in hazard assessment, seismic wave propagation modeling in rocks and soils, and dynamic soil testing. The UC campuses currently chosen for application of our integrated methodology are Riverside, San Diego, and Santa Barbara. The procedure starts with the identification of possible earthquake sources in the region and the determination of the most critical fault(s) related to earthquake exposure of the campus. Combined geological, geophysical, and geotechnical studies are then conducted to characterize each campus with specific focus on the location of particular target buildings of special interest to the campus administrators. We drill and geophysically log deep boreholes next to the target structure, to provide direct in-situ measurements of subsurface material properties, and to install uphole and downhole 3-component seismic sensors capable of recording both weak and strong motions. The boreholes provide access below the soil layers, to deeper materials that have relatively high seismic shear-wave velocities. Analyses of conjugate downhole and uphole records provide a basis for optimizing the representation of the low-strain response of the sites. Earthquake rupture scenarios of identified causative faults are combined with the earthquake records and with nonlinear soil models to provide site-specific estimates of strong motions at the selected target locations. The predicted ground motions are shared with the UC consultants, so that they can be used as input to the dynamic analysis of the buildings. Thus, for each campus targeted by the CEP project, the strong motion studies consist of two phases, Phase 1-initial source and site characterization, drilling, geophysical logging
Production of Cs and Fr isotopes from a high-density UC targets with different grain dimensions
Energy Technology Data Exchange (ETDEWEB)
Panteleev, V.N.; Barzakh, A.E.; Fedorov, D.V.; Ivanov, V.S.; Mezilev, K.A.; Molkanov, P.L.; Moroz, F.V.; Orlov, S.Yu.; Volkov, Yu.M. [Petersburg Nuclear Physics Institute RAS, Gatchina (Russian Federation); Alyakrinskiy, O.; Barbui, M.; Stroe, L.; Tecchio, L.B.; Tonezzer, M. [Laboratori Nationali di Legnaro, Legnaro (Padova) (Italy); Lhersonneau, G. [GANIL, Caen Cedex 5 (France)
2009-12-15
A UC target material of 11.3{+-}0.5 g/cm{sup 3} uranium density with the grain size of 20 and 5{mu}m manufactured in a form of pills by the method of powder metallurgy has been tested on-line within the temperature range of 1800-2100 C. The mass of uranium exposed to the beam was 4-7g. The yields and release rates of Cs and Fr isotopes produced by fission and spallation reactions of {sup 238}U by 1GeV protons have been measured. The yields of Cs and Fr isotopes obtained from the tested target materials have been compared, including yields of very short-lived Fr isotopes with half-lives down to 1ms. Temperature-resistant materials (porous graphite and tantalum foil) have been used for the internal-container construction, which holds the UC target pills inside a tungsten external container heated by the resistant heating. The fastest release and the highest efficiency for short-lived isotopes have been obtained for the targets with the internal container manufactured from the tantalum foil. Results of on-line tests of a big mass target (730g of 5{mu}m grain UC target material) have been discussed. (orig.)
Production of Cs and Fr isotopes from a high-density UC targets with different grain dimensions
International Nuclear Information System (INIS)
Panteleev, V.N.; Barzakh, A.E.; Fedorov, D.V.; Ivanov, V.S.; Mezilev, K.A.; Molkanov, P.L.; Moroz, F.V.; Orlov, S.Yu.; Volkov, Yu.M.; Alyakrinskiy, O.; Barbui, M.; Stroe, L.; Tecchio, L.B.; Tonezzer, M.; Lhersonneau, G.
2009-01-01
A UC target material of 11.3±0.5 g/cm 3 uranium density with the grain size of 20 and 5μm manufactured in a form of pills by the method of powder metallurgy has been tested on-line within the temperature range of 1800-2100 C. The mass of uranium exposed to the beam was 4-7g. The yields and release rates of Cs and Fr isotopes produced by fission and spallation reactions of 238 U by 1GeV protons have been measured. The yields of Cs and Fr isotopes obtained from the tested target materials have been compared, including yields of very short-lived Fr isotopes with half-lives down to 1ms. Temperature-resistant materials (porous graphite and tantalum foil) have been used for the internal-container construction, which holds the UC target pills inside a tungsten external container heated by the resistant heating. The fastest release and the highest efficiency for short-lived isotopes have been obtained for the targets with the internal container manufactured from the tantalum foil. Results of on-line tests of a big mass target (730g of 5μm grain UC target material) have been discussed. (orig.)
Imidazo[1,2-a]pyridin-3-amines as potential HIV-1 non-nucleoside reverse transcriptase inhibitors
CSIR Research Space (South Africa)
Bode, ML
2011-06-01
Full Text Available ? Discovery Studio 2.5.5). The crystal structures of both the wild-type and K103N mutant forms of HIV-1 RT containing the diarylpyrimidine inhibitor rilpivirine (TMC-278) were used (pdb codes MEE and 3MEG, respectively).27 Etravirine (TMC-125... These drugs act by binding to a lipophilic, non-substrate binding pocket located about 10? from the substrate binding site. Binding induces conformational changes in the catalytic site, slowing catalytic activity markedly.3 About fifty structurally diverse...
Di Santo, Roberto; Costi, Roberta; Roux, Alessandra; Artico, Marino; Lavecchia, Antonio; Marinelli, Luciana; Novellino, Ettore; Palmisano, Lucia; Andreotti, Mauro; Amici, Roberta; Galluzzo, Clementina Maria; Nencioni, Lucia; Palamara, Anna Teresa; Pommier, Yves; Marchand, Christophe
2008-01-01
The virally encoded integrase protein is an essential enzyme in the life cycle of the HIV-1 virus and represents an attractive and validated target in the development of therapeutics against HIV infection. Drugs that selectively inhibit this enzyme, when used in combination with inhibitors of reverse transcriptase and protease, are believed to be highly effective in suppressing the viral replication. Among the HIV-1 integrase inhibitors, the β-diketo acids (DKAs) represent a major lead for anti-HIV-1drug development. In this study, novel bifunctional quinolonyl diketo acid derivatives were designed, synthesized and tested for their inhibitory ability against HIV-1 integrase. The compounds are potent inhibitors of integrase activity. Particularly, derivative 8 is a potent IN inhibitor for both steps of the reaction (3′-processing and strand transfer) and exhibits both high antiviral activity against HIV-1 infected cells and low cytotoxicity. Molecular modeling studies provide a plausible mechanism of action, which is consistent with ligand SARs and enzyme photo-crosslinking experiments. PMID:16539381
Creating an Engaging Library Orientation: First Year Experience Courses at UC San Diego
Goldman, Crystal; Turnbow, Dominique; Roth, Amanda; Friedman, Lia; Heskett, Karen
2016-01-01
This article focuses on the development of an engaging library orientation module for UC San Diego First Year Experience (FYE) courses. The library module included a brief in-class presentation about research concepts and library services, an online interactive library scavenger hunt given as an in-class activity, and a homework assignment where…
Yan, Beibei; Wang, Yancai; Wang, Lulu; Zhou, Yuqi; Shang, Xueyun; Zhao, Juan; Liu, Yangyang; Du, Juan
2018-05-01
The present study aimed to prepare stable uc(dl)-tetrahydropalmatine (uc(dl)-THP) nanosuspensions of optimized formulation with PEGylated chitosan as a multifunctional stabilizer using the antisolvent precipitation method. A central composite design project of three factors and five-level full factorial (53) was applied to design the experimental program, and response surface methodology analysis was used to optimize the experimental conditions. The effects of critical influencing factors such as PEGylated chitosan concentration, operational temperature, and ultrasonic energy on particle size and zeta potential were investigated. Under the optimization nanosuspension formulation, the particle size was 269 nm and zeta potential was at 37.4 mV. Also, the uc(dl)-THP nanosuspensions maintained good physical stability after 2 months, indicating the potential ability of the multifunctional stabilizer for stable nanosuspension formulation. Hence, the present findings indicated that PEGylated chitosan could be used as the ideal stabilizer to form a physically stable nanosuspension formulation.
U.S. Environmental Protection Agency — The Cumulative Impacts (CI) screening method is jointly being developed by Manuel Pastor, Jim Sadd (Occidental College), and Rachel Morello-Frosch (UC Berkeley) ....
Theoretical study of actinide monocarbides (ThC, UC, PuC, and AmC)
Pogány, Peter; Kovács, Attila; Visscher, Lucas; Konings, Rudy J. M.
2016-12-01
A study of four representative actinide monocarbides, ThC, UC, PuC, and AmC, has been performed with relativistic quantum chemical calculations. The two applied methods were multireference complete active space second-order perturbation theory (CASPT2) including the Douglas-Kroll-Hess Hamiltonian with all-electron basis sets and density functional theory with the B3LYP exchange-correlation functional in conjunction with relativistic pseudopotentials. Beside the ground electronic states, the excited states up to 17 000 cm-1 have been determined. The molecular properties explored included the ground-state geometries, bonding properties, and the electronic absorption spectra. According to the occupation of the bonding orbitals, the calculated electronic states were classified into three groups, each leading to a characteristic bond distance range for the equilibrium geometry. The ground states of ThC, UC, and PuC have two doubly occupied π orbitals resulting in short bond distances between 1.8 and 2.0 Å, whereas the ground state of AmC has significant occupation of the antibonding orbitals, causing a bond distance of 2.15 Å.
Ainsworth, Stuart; Mahony, Jennifer
2014-01-01
Lactococcus lactis subsp. cremoris strains are used globally for the production of fermented dairy products, particularly hard cheeses. Believed to be of plant origin, L. lactis strains that are used as starter cultures have undergone extensive adaptation to the dairy environment, partially through the acquisition of extrachromosomal DNA in the form of plasmids that specify technologically important phenotypic traits. Here, we present a detailed analysis of the eight plasmids of L. lactis UC509.9, an Irish dairy starter strain. Key industrial phenotypes were mapped, and genes that are typically associated with lactococcal plasmids were identified. Four distinct, plasmid-borne bacteriophage resistance systems were identified, including two abortive infection systems, AbiB and AbiD1, thereby supporting the observed phage resistance of L. lactis UC509.9. AbiB escape mutants were generated for phage sk1, which were found to carry mutations in orf6, which encodes the major capsid protein of this phage. PMID:24814781
Całościowa ocena przewlekłej obturacyjnej choroby płuc według raportu GOLD 2011
Directory of Open Access Journals (Sweden)
Iwona Grzelewska-Rzymowska
2013-06-01
Full Text Available Autorzy omawiają nowe podejście do przewlekłej obturacyjnej choroby płuc, przedstawione w raporcie GOLD 2011. Przewlekła obturacyjna choroba płuc jest ogólnoświatowym problemem zdrowotnym. Badanie BOLD ujawniło, że rozpowszechnienie choroby jest różne w poszczególnych krajach i będzie czwartą przy‑ czyną zgonów w 2030 roku. Główną przyczyną przewlekłej obturacyjnej choroby płuc jest nałóg palenia tytoniu. Raport GOLD 2011 zaleca, aby postawienie diagnozy rozważyć, jeśli pacjent prezentuje takie obja‑ wy, jak: duszność, kaszel i odkrztuszanie wydzieliny z ekspozycją na czynniki ryzyka oraz z obecnością obtu‑ racji potwierdzonej wartością FEV1/ FVC < 0,70. Wskaźnik FEV1 okazał się niedostatecznym deskryptorem wpływu przewlekłej obturacyjnej choroby płuc na pacjenta. Jest to choroba złożona i różnorodna, zbadanie jej wpływu na zdrowie pacjenta wymaga walidowanych testów, takich jak BODE, ADO, DOSE. Raport GOLD 2011 zaleca stosowanie dwóch walidowanych testów: mMRC i CAT. Wskaźniki wentylacyjne są skla‑ syfikowane jako GOLD 1 i 2 (zaburzenia łagodne i umiarkowane oraz GOLD 3 i 4 (zaburzenia ciężkie i bar‑ dzo ciężkie. Zaostrzenia przewlekłej obturacyjnej choroby płuc są ustalane na podstawie wywiadu lub war‑ tości FEV1. Ostatecznie pacjentów można zakwalifikować do kategorii A, B, C lub D. Leczenie farmakologiczne powinno być ustalane po dokonaniu zindywidualizowanej oceny.
International Nuclear Information System (INIS)
Gomez, Daniel E.; Armando, Romina G.; Alonso, Daniel F.
2012-01-01
Telomerase is a highly specialized reverse transcriptase (RT) and the maintenance of telomeric length is determined by this specific enzyme. The human holoenzyme telomerase is a ribonucleoprotein composed by a catalytic subunit, hTERT, an RNA component, hTR, and a group of associated proteins. Telomerase is normally expressed in embryonic cells and is repressed during adulthood. The enzyme is reexpressed in around 85% of solid tumors. This observation makes it a potential target for developing drugs that could be developed for therapeutic purposes. The identification of the hTERT as a functional catalytic RT prompted studies of inhibiting telomerase with the HIV RT inhibitor azidothymidine (AZT). Previously, we have demonstrated that AZT binds preferentially to telomeres, inhibits telomerase and enhances tumor cell senescence, and apoptosis after AZT treatment in breast mammary adenocarcinoma cells. Since then, several studies have considered AZT for telomerase inhibition and have led to potential clinical strategies for anticancer therapy. This review covers present thinking of the inhibition of telomerase by AZT and future treatment protocols using the drug.
ARQUITECTURA DE LA RED VIRTUAL DE APRENDIZAJE PARA EL CICLO BÁSICO (FACES-UC
Directory of Open Access Journals (Sweden)
Neyda Ibañez
2011-11-01
Full Text Available La sociedad del siglo XXI demanda una universidad adaptada a la nueva realidad que ofrece el desarrollo de la comunicación basada en la tecnología digital computarizada. En virtud de ello, la investigación tuvo como objetivo el diseñar la red virtual de aprendizaje para facilitadores y estudiantes del Ciclo Básico de la Facultad de Ciencias Económicas y Sociales de la Universidad de Carabobo (FaCES-UC, siendo este uno de los objetivos del proyecto LOCTI titulado Formación, capacitación y fortalecimiento a facilitadores del Ciclo Básico y de las Escuelas de FaCES-UC, en el manejo de entornos virtuales como herramientas de aprendizaje. Metodológicamente, el estudio se ubicó en el paradigma positivista de tipo descriptivo, con una población de 72 profesores, calculándose una muestra de 237 estudiantes, con muestreo aleatorio simple, utilizando la técnica de observación directa y aplicando como instrumento el cuestionario simple con 27 preguntas cerradas y dicotómicas. Los resultados arrojaron que más del 95 por ciento de los estudiantes y más del 37 por ciento de los profesores aportaron al diseño de la red virtual de aprendizaje. Se concluye la arquitectura del sitio Web a través de la clasificación de tres criterios que persiguen brindar a la comunidad tanto interna como externa a la Universidad de Carabobo, un portal que ofrezca y difunda información y servicios del Ciclo Básico de FaCES-UC y de sus diversas Cátedras que lo conforman.
Management of HIV During Pregnancy
Chamma JP; Monteleone VF; V dos Reis L; Bonafe SM; Panão M
2016-01-01
According to UNAIDS, in 2015, one hundred and fifty thousand children were infected by HIV worldwide, therefore the use of antiretroviral therapy (ARV) during pregnancy is an important development for the reduction of maternal-fetal transmission. The treatment of a pregnant woman is done by combining two different ARV classes. The combination of two nucleoside reverse transcriptase inhibitors (NRTIs) with one non-nucleoside reverse transcriptase inhibitor (NNRTI) or protease inhibitor (PI) is...
Resch, Irene; Shariat, Shahrokh F; Gust, Kilian M
2018-01-01
Until recently, there were no true innovations in the management of locally advanced (aUC) and metastatic urothelial cancer (mUC) in the last three decades. Vinflunine has been approved by the EMA (European Medicines Agency) with only limited improvement compared to best supportive care in second line treatment. In addition, gemcitabine/cisplatin has been established as an alternative to methotrexate, vinblastine, doxorubicin, and cisplatin (MVAC). The advent of checkpoint inhibitors (CPI) revolutionized the care of these patients, transforming a unanimously deadly disease into one with hope through sustained disease control. Five immune CPI have recently been approved for aUC/mUC by the US Food and Drug Administration (FDA) including atezolizumab, nivolumab, pembrolizumab, durvalumab and avelumab. All five CPI are FDA-approved as second-line therapy with atezolizumab and pembrolizumab also being approved for first-line therapy in cisplatin-ineligible patients. The rapid acceptance in the treatment algorithm of UC is based on the impressive clinical efficacy of these agents in some patients, combined with their excellent safety profile. These new agents are indeed the most important advancement in UC care. However, the challenge in the age of precision medicine is to identify the patients who are most likely to benefit from CPIs, as the majority of patients do not respond to CPI. Toward this goal, validation of clinical, molecular and imaging biomarkers that serve for prediction and monitoring of treatment response are of central necessity.
Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Kumar, Lalit; Luthra, Kalpana; Agarwal, Sanjay Kumar; Sreenivas, Vishnubhatla
2013-01-01
Pneumocystis jirovecii is an opportunistic pathogen that causes severe pneumonia in immunocompromised patients. To study the genetic diversity of P. jirovecii in India the upstream conserved sequence (UCS) region of Pneumocystis genome was amplified, sequenced and genotyped from a set of respiratory specimens obtained from 50 patients with a positive result for nested mitochondrial large subunit ribosomal RNA (mtLSU rRNA) PCR during the years 2005-2008. Of these 50 cases, 45 showed a positive PCR for UCS region. Variations in the tandem repeats in UCS region were characterized by sequencing all the positive cases. Of the 45 cases, one case showed five repeats, 11 cases showed four repeats, 29 cases showed three repeats and four cases showed two repeats. By running amplified DNA from all these cases on a high-resolution gel, mixed infection was observed in 12 cases (26.7%, 12/45). Forty three of 45 cases included in this study had previously been typed at mtLSU rRNA and internal transcribed spacer (ITS) region by our group. In the present study, the genotypes at those two regions were combined with UCS repeat patterns to construct allelic profiles of 43 cases. A total of 36 allelic profiles were observed in 43 isolates indicating high genetic variability. A statistically significant association was observed between mtLSU rRNA genotype 1, ITS type Ea and UCS repeat pattern 4. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Johnson Barry C
2012-12-01
Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.
Bryant, Ruth R M; McGrann, Graham R D; Mitchell, Alice R; Schoonbeek, Henk-Jan; Boyd, Lesley A; Uauy, Cristobal; Dorling, Steve; Ridout, Christopher J
2014-01-08
Rust diseases are of major importance in wheat production worldwide. With the constant evolution of new rust strains and their adaptation to higher temperatures, consistent and durable disease resistance is a key challenge. Environmental conditions affect resistance gene performance, but the basis for this is poorly understood. Here we show that a change in day temperature affects wheat resistance to Puccinia striiformis f. sp tritici (Pst), the causal agent of yellow (or stripe) rust. Using adult plants of near-isogenic lines UC1041 +/- Yr36, there was no significant difference between Pst percentage uredia coverage in plants grown at day temperatures of 18°C or 25°C in adult UC1041 + Yr36 plants. However, when plants were transferred to the lower day temperature at the time of Pst inoculation, infection increased up to two fold. Interestingly, this response was independent of Yr36, which has previously been reported as a temperature-responsive resistance gene as Pst development in adult UC1041 -Yr36 plants was similarly affected by the plants experiencing a temperature reduction. In addition, UC1041 -Yr36 plants grown at the lower temperature then transferred to the higher temperature were effectively resistant and a temperature change in either direction was shown to affect Pst development up to 8 days prior to inoculation. Results for seedlings were similar, but more variable compared to adult plants. Enhanced resistance to Pst was observed in seedlings of UC1041 and the cultivar Shamrock when transferred to the higher temperature. Resistance was not affected in seedlings of cultivar Solstice by a temperature change in either direction. Yr36 is effective at 18°C, refining the lower range of temperature at which resistance against Pst is conferred compared to previous studies. Results reveal previously uncharacterised defence temperature sensitivity in the UC1041 background which is caused by a change in temperature and independently of Yr36. This novel
The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.
Zhao, Chen; Pyle, Anna Marie
2017-12-01
The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.
Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa
Directory of Open Access Journals (Sweden)
Aline Aki Tanikawa
2013-08-01
Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.
Prevalence of genotypic HIV-1 drug resistance in Thailand, 2002
Directory of Open Access Journals (Sweden)
Watitpun Chotip
2003-03-01
Full Text Available Abstract Background The prices of reverse transcriptase (RT inhibitors in Thailand have been reduced since December 1, 2001. It is expected that reduction in the price of these inhibitors may influence the drug resistance mutation pattern of HIV-1 among infected people. This study reports the frequency of HIV-1 genetic mutation associated with drug resistance in antiretroviral-treated patients from Thailand. Methods Genotypic resistance testing was performed on samples collected in 2002 from 88 HIV-1 infected individuals. Automated DNA sequencing was used to genotype the HIV-1 polymerase gene isolated from patients' plasma. Results Resistance to protease inhibitors, nucleoside and non-nucleoside reverse transcriptase inhibitors were found in 10 (12%, 42 (48% and 19 (21% patients, respectively. The most common drug resistance mutations in the protease gene were at codon 82 (8%, 90 (7% and 54 (6%, whereas resistant mutations at codon 215 (45%, 67 (40%, 41 (38% and 184 (27% were commonly found in the RT gene. This finding indicates that genotypic resistance to nucleoside reverse transcriptase inhibitors was prevalent in 2002. The frequency of resistant mutations corresponding to non-nucleoside reverse transcriptase inhibitors was three times higher-, while resistant mutation corresponding to protease inhibitors was two times lower than those frequencies determined in 2001. Conclusion This study shows that the frequencies of RT inhibitor resistance mutations have been increased after the reduction in the price of RT inhibitors since December 2001. We believe that this was an important factor that influenced the mutation patterns of HIV-1 protease and RT genes in Thailand.
Characterization of HGF/Met Signaling in Cell Lines Derived From Urothelial Carcinoma of the Bladder
Energy Technology Data Exchange (ETDEWEB)
Lee, Young H. [Urologic Oncology Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892 (United States); Apolo, Andrea B. [Genitourinary Malignancies Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892 (United States); Agarwal, Piyush K.; Bottaro, Donald P., E-mail: dbottaro@helix.nih.gov [Urologic Oncology Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892 (United States)
2014-11-25
There is mounting evidence of oncogenic hepatocyte growth factor (HGF)/Met signaling in urothelial carcinoma (UC) of the bladder. The effects of three kinase inhibitors, cabozantinib, crizotinib and EMD1214063, on HGF-driven signaling and cell growth, invasion and tumorigenicity were analyzed in cultured UC cell lines. SW780 xenograft growth in SCID and human HGF knock-in SCID (hHGF/SCID) mice treated with cabozantinib or vehicle, as well as tumor levels of Met and pMet, were also determined. Met content was robust in most UC-derived cell lines. Basal pMet content and effector activation state in quiescent cells were low, but significantly enhanced by added HGF, as were cell invasion, proliferation and anchorage independent growth. These HGF-driven effects were reversed by Met inhibitor treatment. Tumor xenograft growth was significantly higher in hHGF/SCID mice vs. SCID mice and significantly inhibited by cabozantinib, as was tumor phospho-Met content. These studies indicate the prevalence and functionality of the HGF/Met signaling pathway in UC cells, suggest that paracrine HGF may contribute to UC tumor growth and progression, and that support further preclinical investigation of Met inhibitors for the treatment of UC is warranted.
Chahorm, Kanchana; Prakitchaiwattana, Cheunjit
2018-01-02
The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004
LAUE lens development at UC Berkeley: status and prospects
Barrière, Nicolas M.; Tomsick, John A.; Ackermann, Marcelo D.; Bastie, Pierre; Boggs, Steven E.; Hanlon, Lorraine; Jentschel, Michael; Lowell, Alexander; Roudil, Gilles; von Ballmoos, Peter; Wade, Colin
2013-09-01
We report on the status of the Laue lens development effort led by UC Berkeley, where a dedicated X-ray beamline and a Laue lens assembly station were built. This allowed the realization of a first lens prototype in June 2012. Based on this achievement, and thanks to a new NASA APRA grant, we are moving forward to enable Laue lenses. Several parallel activities are in progress. Firstly, we are refining the method to glue quickly and accurately crystals on a lens substrate. Secondly, we are conducting a study of high-Z crystals to diffract energies up to 900 keV efficiently. And thirdly, we are exploring new concepts of Si-based lenses that could further improve the focusing capabilities, and thus the sensitivity of Laue lenses.
Energy Technology Data Exchange (ETDEWEB)
Su, Hua-Poo; Yan, Youwei; Prasad, G. Sridhar; Smith, Robert F.; Daniels, Christopher L.; Abeywickrema, Pravien D.; Reid, John C.; Loughran, H. Marie; Kornienko, Maria; Sharma, Sujata; Grobler, Jay A.; Xu, Bei; Sardana, Vinod; Allison, Timothy J.; Williams, Peter D.; Darke, Paul L.; Hazuda, Daria J.; Munshi, Sanjeev (Merck)
2010-09-02
HIV/AIDS continues to be a menace to public health. Several drugs currently on the market have successfully improved the ability to manage the viral burden in infected patients. However, new drugs are needed to combat the rapid emergence of mutated forms of the virus that are resistant to existing therapies. Currently, approved drugs target three of the four major enzyme activities encoded by the virus that are critical to the HIV life cycle. Although a number of inhibitors of HIV RNase H activity have been reported, few inhibit by directly engaging the RNase H active site. Here, we describe structures of naphthyridinone-containing inhibitors bound to the RNase H active site. This class of compounds binds to the active site via two metal ions that are coordinated by catalytic site residues, D443, E478, D498, and D549. The directionality of the naphthyridinone pharmacophore is restricted by the ordering of D549 and H539 in the RNase H domain. In addition, one of the naphthyridinone-based compounds was found to bind at a second site close to the polymerase active site and non-nucleoside/nucleotide inhibitor sites in a metal-independent manner. Further characterization, using fluorescence-based thermal denaturation and a crystal structure of the isolated RNase H domain reveals that this compound can also bind the RNase H site and retains the metal-dependent binding mode of this class of molecules. These structures provide a means for structurally guided design of novel RNase H inhibitors.
Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase
DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami
2012-01-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...
Rotili, Dante; Samuele, Alberta; Tarantino, Domenico; Ragno, Rino; Musmuca, Ira; Ballante, Flavio; Botta, Giorgia; Morera, Ludovica; Pierini, Marco; Cirilli, Roberto; Nawrozkij, Maxim B; Gonzalez, Emmanuel; Clotet, Bonaventura; Artico, Marino; Esté, José A; Maga, Giovanni; Mai, Antonello
2012-04-12
The single enantiomers of two pyrimidine-based HIV-1 non-nucleoside reverse transcriptase inhibitors, 1 (MC1501) and 2 (MC2082), were tested in both cellular and enzyme assays. In general, the R forms were more potent than their S counterparts and racemates and (R)-2 was more efficient than (R)-1 and the reference compounds, with some exceptions. Interestingly, (R)-2 displayed a faster binding to K103N RT with respect to WT RT, while (R)-1 showed the opposite behavior. © 2012 American Chemical Society
On the Complexity of Additively Homomorphic UC Commitments
DEFF Research Database (Denmark)
Trifiletti, Roberto; Nielsen, Jesper Buus; Frederiksen, Tore Kasper
2016-01-01
as the commitment protocol by Garay \\emph{et al.} from Eurocrypt 2014. A main technical improvement over the scheme mentioned above, and other schemes based on using error correcting codes for UC commitment, we develop a new technique which allows to based the extraction property on erasure decoding as opposed...... to error correction. This allows to use a code with significantly smaller minimal distance and allows to use codes without efficient decoding. Our scheme only relies on standard assumptions. Specifically we require a pseudorandom number generator, a linear error correcting code and an ideal oblivious......, we manage to add the additive homo- morphic property, while at the same time reducing the constants. In fact, when opening a large enough batch of commitments we achieve an amor- tized communication complexity converging to the length of the message committed to, i.e., we achieve close to rate 1...
Energy Technology Data Exchange (ETDEWEB)
Devaraj, Arun [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Environmental Molecular Sciences Lab. (EMSL); Prabhakaran, Ramprashad [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Environmental Molecular Sciences Lab. (EMSL); Joshi, Vineet V. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Environmental Molecular Sciences Lab. (EMSL); Hu, Shenyang Y. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Environmental Molecular Sciences Lab. (EMSL); McGarrah, Eric J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Environmental Molecular Sciences Lab. (EMSL); Lavender, Curt A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Environmental Molecular Sciences Lab. (EMSL)
2016-04-12
The purpose of this document is to provide a theoretical framework for (1) estimating uranium carbide (UC) volume fraction in a final alloy of uranium with 10 weight percent molybdenum (U-10Mo) as a function of final alloy carbon concentration, and (2) estimating effective 235U enrichment in the U-10Mo matrix after accounting for loss of 235U in forming UC. This report will also serve as a theoretical baseline for effective density of as-cast low-enriched U-10Mo alloy. Therefore, this report will serve as the baseline for quality control of final alloy carbon content
U.S. Environmental Protection Agency — This data set is based on a three year study by the UC Davis Center for Regional Change, in affiliation with the Environmental Justice Project of the John Muir...
UC Riverside physicists contribute to state-of-the-art detector installed in Switzerland
2008-01-01
UC Riverside scientists led by Gail Hanson, a distinguished professor of physics, are part of a collaboration of approximately 2300 international physicists who announced Dec. 19 that the world's largest silicon tracking detector at CERN in Geneva, Switzerland, had been successfully installed (see also ). Called the CMS (Compact Muon Solenoid) Silicon Strip Tracking Detector, the six-ton instrument has a total surface area of 205 square meters, about the same as a singles tennis court.
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2009-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331
Directory of Open Access Journals (Sweden)
Ammad Ahmad Farooqi
2018-04-01
Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.
Follow the Money: Engineering at Stanford and UC Berkeley during the Rise of Silicon Valley
Adams, Stephen B.
2009-01-01
A comparison of the engineering schools at UC Berkeley and Stanford during the 1940s and 1950s shows that having an excellent academic program is necessary but not sufficient to make a university entrepreneurial (an engine of economic development). Key factors that made Stanford more entrepreneurial than Cal during this period were superior…
Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina
2013-01-01
The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences
Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad
2016-05-01
Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.
EdSource, Inc., Palo Alto, CA.
This parent/student guide describes recent changes in admissions policies at the University of California (UC). Traditionally, UC admitted the top 12.5% of high school graduating seniors, but beginning in 2001, the top 4% of students in the graduating class of every high school are eligible if they have completed 11 specific "a-f"…
Production of Cs and Fr isotopes from a high density UC targets with different grain dimensions
Panteleev, V. N; Barzakh, A. E; Fedorov, D. V; Ivanov, V. S; Mezilev, K. A; Moroz, F. V; Molkanov, P. L; Alyakrinskiy, O; Barbui, M; Tonezzer, M; Stroe, L; Orlov, S. Yu; Tecchio, L. B; Lhersonneau, G
A UC target material of 12 g/cm3 density with the grain size of 20 and 5 μm manufactured in a form of pills by the method of powder metallurgy has been tested on-line within the temperature range of (1800-2000) °C. Abstract to ENAM2008
Bagley, Mark C; Davis, Terence; Rokicki, Michal J; Widdowson, Caroline S; Kipling, David
2010-02-01
UR-13756 is a potent and selective p38 mitogen-activated protein kinase (MAPK) inhibitor, reported to have good bioavailability and pharmacokinetic properties and, thus, is of potential use in the treatment of accelerated aging in Werner syndrome. Irradiation of 2-chloroacrylonitrile and methylhydrazine in ethanol at 100 °C gives 1-methyl-3-aminopyrazole, which reacts with 4-fluorobenzaldehyde and a ketone, obtained by Claisen condensation of 4-picoline, in a Hantzsch-type 3-component hereocyclocondensation, to give the pyrazolopyridine UR-13756. UR-13756 shows p38 MAPK inhibitory activity in human telomerase reverse transcriptase-immortalized HCA2 dermal fibroblasts, with an IC(50) of 80 nm, as shown by ELISA, is 100% efficacious for up to 24 h at 1.0 μm and displays excellent kinase selectivity over the related stress-activated c-Jun kinases. In addition, UR-13756 is an effective p38 inhibitor at 1.0 μm in Werner syndrome cells, as shown by immunoblot. The convergent synthesis of UR-13756 is realized using microwave dielectric heating and provides a highly selective inhibitor that shows excellent selectivity for p38 MAPK over c-Jun N-terminal kinase.
Telomerase Inhibitors from Natural Products and Their Anticancer Potential
Directory of Open Access Journals (Sweden)
Kumar Ganesan
2017-12-01
Full Text Available Telomeres and telomerase are nowadays exploring traits on targets for anticancer therapy. Telomerase is a unique reverse transcriptase enzyme, considered as a primary factor in almost all cancer cells, which is mainly responsible to regulate the telomere length. Hence, telomerase ensures the indefinite cell proliferation during malignancy—a hallmark of cancer—and this distinctive feature has provided telomerase as the preferred target for drug development in cancer therapy. Deactivation of telomerase and telomere destabilization by natural products provides an opening to succeed new targets for cancer therapy. This review aims to provide a fundamental knowledge for research on telomere, working regulation of telomerase and its various binding proteins to inhibit the telomere/telomerase complex. In addition, the review summarizes the inhibitors of the enzyme catalytic subunit and RNA component, natural products that target telomeres, and suppression of transcriptional and post-transcriptional levels. This extensive understanding of telomerase biology will provide indispensable information for enhancing the efficiency of rational anti-cancer drug design.
Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification
Energy Technology Data Exchange (ETDEWEB)
Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P
2011-12-08
RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.
Puviani, Luca; Rama, Sidita
2016-07-20
Despite growing scientific interest in the placebo effect and increasing understanding of neurobiological mechanisms, theoretical modeling of the placebo response remains poorly developed. The most extensively accepted theories are expectation and conditioning, involving both conscious and unconscious information processing. However, it is not completely understood how these mechanisms can shape the placebo response. We focus here on neural processes which can account for key properties of the response to substance intake. It is shown that placebo response can be conceptualized as a reaction of a distributed neural system within the central nervous system. Such a reaction represents an integrated component of the response to open substance administration (or to substance intake) and is updated through "unconditioned stimulus (UCS) revaluation learning". The analysis leads to a theorem, which proves the existence of two distinct quantities coded within the brain, these are the expected or prediction outcome and the reactive response. We show that the reactive response is updated automatically by implicit revaluation learning, while the expected outcome can also be modulated through conscious information processing. Conceptualizing the response to substance intake in terms of UCS revaluation learning leads to the theoretical formulation of a potential neuropharmacological treatment for increasing unlimitedly the effectiveness of a given drug.
La Regina, Giuseppe; Coluccia, Antonio; Brancale, Andrea; Piscitelli, Francesco; Gatti, Valerio; Maga, Giovanni; Samuele, Alberta; Pannecouque, Christophe; Schols, Dominique; Balzarini, Jan; Novellino, Ettore; Silvestri, Romano
2011-03-24
New indolylarylsulfone derivatives bearing cyclic substituents at indole-2-carboxamide linked through a methylene/ethylene spacer were potent inhibitors of the WT HIV-1 replication in CEM and PBMC cells with inhibitory concentrations in the low nanomolar range. Against the mutant L100I and K103N RT HIV-1 strains in MT-4 cells, compounds 20, 24-26, 36, and 40 showed antiviral potency superior to that of NVP and EFV. Against these mutant strains, derivatives 20, 24-26, and 40 were equipotent to ETV. Molecular docking experiments on this novel series of IAS analogues have also suggested that the H-bond interaction between the nitrogen atom in the carboxamide chain of IAS and Glu138:B is important in the binding of these compounds. These results are in accordance with the experimental data obtained on the WT and on the mutant HIV-1 strains tested.
Ntombela, Thandokuhle; Fakhar, Zeynab; Ibeji, Collins U.; Govender, Thavendran; Maguire, Glenn E. M.; Lamichhane, Gyanu; Kruger, Hendrik G.; Honarparvar, Bahareh
2018-05-01
Tuberculosis remains a dreadful disease that has claimed many human lives worldwide and elimination of the causative agent Mycobacterium tuberculosis also remains elusive. Multidrug-resistant TB is rapidly increasing worldwide; therefore, there is an urgent need for improving the current antibiotics and novel drug targets to successfully curb the TB burden. uc(l,d)-Transpeptidase 2 is an essential protein in Mtb that is responsible for virulence and growth during the chronic stage of the disease. Both uc(d,d)- and uc(l,d)-transpeptidases are inhibited concurrently to eradicate the bacterium. It was recently discovered that classic penicillins only inhibit uc(d,d)-transpeptidases, while uc(l,d)-transpeptidases are blocked by carbapenems. This has contributed to drug resistance and persistence of tuberculosis. Herein, a hybrid two-layered ONIOM (B3LYP/6-31G+(d): AMBER) model was used to extensively investigate the binding interactions of LdtMt2 complexed with four carbapenems (biapenem, imipenem, meropenem, and tebipenem) to ascertain molecular insight of the drug-enzyme complexation event. In the studied complexes, the carbapenems together with catalytic triad active site residues of LdtMt2 (His187, Ser188 and Cys205) were treated at with QM [B3LYP/6-31+G(d)], while the remaining part of the complexes were treated at MM level (AMBER force field). The resulting Gibbs free energy (ΔG), enthalpy (ΔH) and entropy (ΔS) for all complexes showed that the carbapenems exhibit reasonable binding interactions towards LdtMt2. Increasing the number of amino acid residues that form hydrogen bond interactions in the QM layer showed significant impact in binding interaction energy differences and the stabilities of the carbapenems inside the active pocket of LdtMt2. The theoretical binding free energies obtained in this study reflect the same trend of the experimental observations. The electrostatic, hydrogen bonding and Van der Waals interactions between the carbapenems and Ldt
van Overveld, M; de Jong, PJ; Peters, ML
Recently, differential UCS expectancies were found for high- and low-predatory fear-relevant animals [Davey, G. C. L., Cavanagh, K., & Lamb, A. (2003). Differential aversive outcome expectancies for high- and low-predation fear-relevant animals. Journal of Behavior Therapy and Experimental
Directory of Open Access Journals (Sweden)
Kirsten L. White
2014-07-01
Full Text Available The integrase (IN strand transfer inhibitors (INSTIs, raltegravir (RAL, elvitegravir (EVG and dolutegravir (DTG, comprise the newest drug class approved for the treatment of HIV-1 infection, which joins the existing classes of reverse transcriptase, protease and binding/entry inhibitors. The efficacy of first-line regimens has attained remarkably high levels, reaching undetectable viral loads in 90% of patients by Week 48; however, there remain patients who require a change in regimen due to adverse events, virologic failure with emergent resistance or other issues of patient management. Large, randomized clinical trials conducted in antiretroviral treatment-naive individuals are required for drug approval in this population in the US, EU and other countries, with the primary endpoint for virologic success at Week 48. However, there are differences in the definition of virologic failure and the evaluation of drug resistance among the trials. This review focuses on the methodology and tabulation of resistance to INSTIs in phase 3 clinical trials of first-line regimens and discusses case studies of resistance.
Bagi, C M; Berryman, E R; Teo, S; Lane, N E
2017-12-01
The aim of this study was to determine the ability of undenatured native chicken type II collagen (UC-II) to prevent excessive articular cartilage deterioration in a rat model of osteoarthritis (OA). Twenty male rats were subjected to partial medial meniscectomy tear (PMMT) surgery to induce OA. Immediately after the surgery 10 rats received vehicle and another 10 rats oral daily dose of UC-II at 0.66 mg/kg for a period of 8 weeks. In addition 10 naïve rats were used as an intact control and another 10 rats received sham surgery. Study endpoints included a weight-bearing capacity of front and hind legs, serum biomarkers of bone and cartilage metabolism, analyses of subchondral and cancellous bone at the tibial epiphysis and metaphysis, and cartilage pathology at the medial tibial plateau using histological methods. PMMT surgery produced moderate OA at the medial tibial plateau. Specifically, the deterioration of articular cartilage negatively impacted the weight bearing capacity of the operated limb. Immediate treatment with the UC-II preserved the weight-bearing capacity of the injured leg, preserved integrity of the cancellous bone at tibial metaphysis and limited the excessive osteophyte formation and deterioration of articular cartilage. Study results demonstrate that a clinically relevant daily dose of UC-II when applied immediately after injury can improve the mechanical function of the injured knee and prevent excessive deterioration of articular cartilage. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Selective serotonin reuptake inhibitor suppression of HIV infectivity and replication.
Benton, Tami; Lynch, Kevin; Dubé, Benoit; Gettes, David R; Tustin, Nancy B; Ping Lai, Jian; Metzger, David S; Blume, Joshua; Douglas, Steven D; Evans, Dwight L
2010-11-01
To test the hypothesis that the selective serotonin reuptake inhibitor (SSRI) citalopram would down-regulate human immunodeficiency virus (HIV) infectivity and that the greatest effects would be seen in people with depression. Depression is a risk factor for morbidity and mortality in HIV/acquired immune deficiency syndrome. Serotonin (5-HT) neurotransmission has been implicated in the pathobiology of depression, and pharmacologic therapies for depression target this system. The 5-HT transporter and 5-HT receptors are widely distributed throughout the central nervous and immune systems. Depression has been associated with suppression of natural killer cells and CD8(+) lymphocytes, key regulators of HIV infection. Ex vivo models for acute and chronic HIV infection were used to study the effects of citalopram on HIV viral infection and replication in 48 depressed and nondepressed women. For both the acute and chronic infection models, HIV reverse transcriptase activity was measured in the citalopram treatment condition and the control condition. The SSRI significantly down-regulated the reverse transcriptase response in both the acute and chronic infection models. Specifically, citalopram significantly decreased the acute HIV infectivity of macrophages. Citalopram also significantly decreased HIV viral replication in the latently infected T-cell line and in the latently infected macrophage cell line. There was no difference in down-regulation by depression status. These studies suggest that an SSRI enhances natural killer/CD8 noncytolytic HIV suppression in HIV/acquired immune deficiency syndrome and decreases HIV viral infectivity of macrophages, ex vivo, suggesting the need for in vivo studies to determine a potential role for agents targeting serotonin in the host defense against HIV.
Li, Runqin; Zhang, Yinglin
2016-01-01
Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632
Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng
2018-06-27
The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.
Role of hTERT in apoptosis of cervical cancer induced by histone deacetylase inhibitor
International Nuclear Information System (INIS)
Wu, Peng; Meng, Li; Wang, Hui; Zhou, Jianfeng; Xu, Gang; Wang, Shixuan; Xi, Ling; Chen, Gang; Wang, Beibei; Zhu, Tao; Lu, Yunping; Ma, Ding
2005-01-01
Human telomerase reverse transcriptase (hTERT) is the catalytic subunit of telomerase holoenzyme as well as the rate-limiting component of the telomerase enzyme complex. However, the role of the hTERT in apoptosis induced by histone deacetylase inhibitor has only been marginally addressed. For the first time, our study demonstrated that trichostatin A (TSA) briefly activated the proliferation of cervical cancer cell lines, HeLa and SiHa, within 12 h, but then inhibited cell growth after that time point. In response to TSA, hTERT expression, telomerase activity, and telomere length also underwent similar changes during the same time frame. Furthermore, the data in our study showed that cells transfected with dominant negative hTERT were more likely to undergo apoptosis induced by TSA than cells transfected with wild-type hTERT. The cyclin/cdk inhibitor p21 waf1 was down-regulated by hTERT without changing the expression of p53. Results from this study suggest that the hTERT might be a primary target of TSA and the anti-apoptosis effect of hTERT might be carried out through a p21 waf1 -dependent and p53-independent pathway
Argüelles-Arias, Federico; Carpio, Daniel; Calvet, Xavier; Romero, Cristina; Cea-Calvo, Luis; Juliá, Berta; López-Sanromán, Antonio
2017-06-01
Education of patients with ulcerative colitis (UC) about their disease and access to a specialist are important to improve health outcomes. Our objective was to determine, by collecting information directly from the patients, their information sources and knowledge of the disease, and the options for access to the gastroenterologist. The information was collected using a printed survey handed out by 39 gastroenterologists to 15 consecutive adult patients with UC. Patients answered anonymously from their home. The responses were stratified by hospital size (> 900; 500-900; < 500 beds). A total of 585 patients received the survey and 436 responded (74.5%; mean age of 46 years [13.5], 53% men). The main information source was the specialist physician (89.2%). Between 32% and 80% of patients had areas of improvement regarding knowledge of their disease. Knowledge of the disease was better in patients from small hospitals (< 500 beds). The frequency of routine visits was also higher in small hospitals. In case of a flare-up, 60% stated they were able to contact their doctor by phone and 37%, that they could get an appointment on the same day. The percentage stating that they had to ask for an appointment and wait until their physician was available was lower in small hospitals. There are areas of improvement with regard to knowledge of their disease in patients with UC followed in hospital clinics. Patients followed in small hospitals seem to know their disease better, are followed more frequently in the clinic, and have better access in case of a flare-up.
UC$_{x}$ prototype target tests for ActiLab-ENSAR
Targets based on uranium and thorium refractory compounds have been at the heart of the isotope mass-separation online (ISOL) technique since its first pioneer experiment in 1951. Different developments took place along the years in the various facilities, and today porous uranium carbides with excess graphite phase are used throughout the different operating facilities. However little is known about the influence of their microstructure, crystallography, porosity and chemistry on the isotope release properties. Recently submicron, porous SiC carbide materials with improved exotic sodium and magnesium yields could be used without significant degradation over extended periods at ISOLDE, providing the first direct evidence that such kind of matrices can be used to improve the ISOL beam performance for exotic alkali and earth-alkali beams. Within the framework of ActiLab in FP7-ENSAR: Integrating R&D on ISOL UC targets, several uranium carbide target materials are now under development with the objective to ...
(3,4-dihydroisoquinolin-2(1H)-yl)
Indian Academy of Sciences (India)
Administrator
HIV-1 reverse transcriptase (HIV-1 RT); non-nucleoside reverse transcriptase inhibitor. (NNRTI); docking; autodock; 1,2,3,4-tetrahydroisoquinoline. 1. Introduction. Acquired immuno deficiency syndrome (AIDS) is one of the most serious pandemic public health chal- lenges since 1981. 1. Human immuno deficiency virus.
International Nuclear Information System (INIS)
Pugach, Pavel; Ketas, Thomas J.; Michael, Elizabeth; Moore, John P.
2008-01-01
The small molecule CCR5 inhibitors are a new class of drugs for treating infection by human immunodeficiency virus type 1 (HIV-1). They act by binding to the CCR5 co-receptor and preventing its use during HIV-1-cell fusion. Escape mutants can be raised against CCR5 inhibitors in vitro and will arise when these drugs are used clinically. Here, we have assessed the responses of CCR5 inhibitor-resistant viruses to other anti-retroviral drugs that act by different mechanisms, and their sensitivities to neutralizing antibodies (NAbs). The rationale for the latter study is that the resistance pathway for CCR5 inhibitors involves changes in the HIV-1 envelope glycoproteins (Env), which are also targets for NAbs. The escape mutants CC101.19 and D1/85.16 were selected for resistance to AD101 and vicriviroc (VVC), respectively, from the primary R5 HIV-1 isolate CC1/85. Each escape mutant was cross-resistant to other small molecule CCR5 inhibitors (aplaviroc, maraviroc, VVC, AD101 and CMPD 167), but sensitive to protein ligands of CCR5: the modified chemokine PSC-RANTES and the humanized MAb PRO-140. The resistant viruses also retained wild-type sensitivity to the nucleoside reverse transcriptase inhibitor (RTI) zidovudine, the non-nucleoside RTI nevirapine, the protease inhibitor atazanavir and other attachment and fusion inhibitors that act independently of CCR5 (BMS-806, PRO-542 and enfuvirtide). Of note is that the escape mutants were more sensitive than the parental CC1/85 isolate to a subset of neutralizing monoclonal antibodies and to some sera from HIV-1-infected people, implying that sequence changes in Env that confer resistance to CCR5 inhibitors can increase the accessibility of some NAb epitopes. The need to preserve NAb resistance may therefore be a constraint upon how escape from CCR5 inhibitors occurs in vivo
Directory of Open Access Journals (Sweden)
Elisabeth Humphris-Narayanan
Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.
Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna
2013-10-01
High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.
International Nuclear Information System (INIS)
Strait, S.R.; Spane, F.A. Jr.
1982-11-01
This report presents preliminary results and description of hydrologic test activities for the composite Umtanum basalt flow top (3,568--3,781 feet) at Borehole RRL-2. Hydrologic tests conducted include two constant discharge air-lift and four slug tests. Preliminary results indicate an observed hydraulic head for the test interval of 405.7 feet above mean sea level. Transmissivity values determined from hydrologic tests performed, range between 244 to 481 ft 2 /day, with an assigned best estimate of 480 ft 2 /day. The best estimate of equivalent hydraulic conductivity, based on an effective test thickness of 157 feet, is 3.1 ft/day. 7 refs., 9 figs., 3 tabs
Directory of Open Access Journals (Sweden)
Federico Argüelles-Arias
Full Text Available Background and aim: Education of patients with ulcerative colitis (UC about their disease and access to a specialist are important to improve health outcomes. Our objective was to determine, by collecting information directly from the patients, their information sources and knowledge of the disease, and the options for access to the gastroenterologist. Methods: The information was collected using a printed survey handed out by 39 gastroenterologists to 15 consecutive adult patients with UC. Patients answered anonymously from their home. The responses were stratified by hospital size (> 900; 500-900; < 500 beds. Results: A total of 585 patients received the survey and 436 responded (74.5%; mean age of 46 years [13.5], 53% men. The main information source was the specialist physician (89.2%. Between 32% and 80% of patients had areas of improvement regarding knowledge of their disease. Knowledge of the disease was better in patients from small hospitals (< 500 beds. The frequency of routine visits was also higher in small hospitals. In case of a flare-up, 60% stated they were able to contact their doctor by phone and 37%, that they could get an appointment on the same day. The percentage stating that they had to ask for an appointment and wait until their physician was available was lower in small hospitals. Conclusions: There are areas of improvement with regard to knowledge of their disease in patients with UC followed in hospital clinics. Patients followed in small hospitals seem to know their disease better, are followed more frequently in the clinic, and have better access in case of a flare-up.
Yamada, Takahiro; Ueda, Takashi; Shibata, Yasuhiro; Ikegami, Yosuke; Saito, Masaki; Ishida, Yusuke; Ugawa, Shinya; Kohri, Kenjiro; Shimada, Shoichi
2010-08-01
To investigate the functional expression of the transient receptor potential vanilloid 2 (TRPV2) channel protein in human urothelial carcinoma (UC) cells and to determine whether calcium influx into UC cells through TRPV2 is involved in apoptotic cell death. The expression of TRPV2 mRNA in bladder cancer cell lines (T24, a poorly differentiated UC cell line and RT4, a well-differentiated UC cell line) was analyzed using reverse transcriptase-polymerase chain reaction. The calcium permeability of TRPV2 channels in T24 cells was investigated using a calcium imaging assay that used cannabidiol (CBD), a relatively selective TRPV2 agonist, and ruthenium red (RuR), a nonselective TRPV channel antagonist. The death of T24 or RT4 cells in the presence of CBD was evaluated using a cellular viability assay. Apoptosis of T24 cells caused by CBD was confirmed using an annexin-V assay and small interfering RNA (siRNA) silencing of TRPV2. TRPV2 mRNA was abundantly expressed in T24 cells. The expression level in UC cells was correlated with high-grade disease. The administration of CBD increased intracellular calcium concentrations in T24 cells. In addition, the viability of T24 cells progressively decreased with increasing concentrations of CBD, whereas RT4 cells were mostly unaffected. Cell death occurred via apoptosis caused by continuous influx of calcium through TRPV2. TRPV2 channels in UC cells are calcium-permeable and the regulation of calcium influx through these channels leads directly to the death of UC cells. TRPV2 channels in UC cells may be a potential new therapeutic target, especially in higher-grade UC cells. Copyright 2010 Elsevier Inc. All rights reserved.
Wang, Shuwen; Zhu, Jiyue
2003-05-23
The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.
Site Monitoring at the U.C. Observatory of Santa Martina
Gatica, C.; Vanzi, L.; Toledo, I.; Lombardi, G.
2011-11-01
This work presents an astroclimatologic analysis of the UC Santa Martina Observatory site. This site is located near Santiago at latitude 33.3°S, longitude 70.5°W and an altitude of 1492 meters above sea level. The analysis was performed using data of temperature, pressure, humidity, and wind collected with a Davis Net Vantage Pro 2 meteo station in a period from December 2007 to January 2011. We estimated average values for the parameters monitored on different time scales and examined daily as well as seasonal variations. We also estimated the downtime due to clouds average with an 37.23% of nights in 2010, humidity, wind over the period examined. The average relative humidity is 49%, wind is predominantly (24% of time) from southsouthwest with an average speed of 0.6 m/s. Finally, we describe Seeing measurements obtained with a DIMM monitor recently installed in the site.
Hoffman, Brett; Li, Zhubing; Liu, Qiang
2015-08-01
Hepatitis C virus (HCV) non-structural protein 5A (NS5A) is essential for viral replication; however, its effect on HCV RNA translation remains controversial partially due to the use of reporters lacking the 3' UTR, where NS5A binds to the poly(U/UC) sequence. We investigated the role of NS5A in HCV translation using a monocistronic RNA containing a Renilla luciferase gene flanked by the HCV UTRs. We found that NS5A downregulated viral RNA translation in a dose-dependent manner. This downregulation required both the 5' and 3' UTRs of HCV because substitution of either sequence with the 5' and 3' UTRs of enterovirus 71 or a cap structure at the 5' end eliminated the effects of NS5A on translation. Translation of the HCV genomic RNA was also downregulated by NS5A. The inhibition of HCV translation by NS5A required the poly(U/UC) sequence in the 3' UTR as NS5A did not affect translation when it was deleted. In addition, we showed that, whilst the amphipathic α-helix of NS5A has no effect on viral translation, the three domains of NS5A can inhibit translation independently, also dependent on the presence of the poly(U/UC) sequence in the 3' UTR. These results suggested that NS5A downregulated HCV RNA translation through a mechanism involving the poly(U/UC) sequence in the 3' UTR.
Directory of Open Access Journals (Sweden)
Maia Hightower
Full Text Available Human immunodeficiency virus type 1 (HIV-1 and type 2 (HIV-2 are the causative agents of AIDS. HIV-2 is prevalent at moderate to high rates in West African countries, such as Senegal, Guinea, Gambia, and Cape Verde. Diagnosis of HIV-2 is made with a positive HIV-1/HIV-2 ELISA or simple/rapid assay, followed by one or two confirmatory tests specific for HIV-2. Following CD4+ T cell counts, HIV-2 viral burden and clinical signs and symptoms of immunodeficiency are beneficial in monitoring HIV-2 disease progression. Although non-nucleoside reverse transcriptase inhibitors are ineffective in treating HIV-2, nucleoside reverse transcriptase inhibitors and protease inhibitors can be effective in dual and triple antiretroviral regimens. Their use can decrease HIV-2 viral load, increase CD4+ T cell counts and improve AIDS-related symptoms. HIV-2 resistance to various nucleoside reverse transcriptase inhibitors and protease inhibitors, including zidovudine, lamivudine, ritonavir and indinavir, has been identified in some HIV-2 infected patients on antiretroviral therapy. The knowledge of HIV-2 peculiarities, when compared to HIV-1, is crucial to helping diagnose and guide the clinician in the choice of the initial antiretroviral regimen and for monitoring therapy success.
NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Energy Technology Data Exchange (ETDEWEB)
Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)
2016-12-15
The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.
Energy Technology Data Exchange (ETDEWEB)
Prausnitz, John
2005-06-01
In the middle of the UC Berkeley campus, next to the Main Library, South Hall is the last surviving building from the original campus, founded about 135 years ago. A tiny tree-shaded appendix to this venerated classical building houses Berkeley's Center for Studies in Higher Education, directed by C. Judson King, former Provost and Senior Vice President--Academic Affairs of the ten-campus University of California and long-time Professor of Chemical Engineering at Berkeley. Jud came to Berkeley in 1963 as assistant professor of chemical engineering, following receipt of a doctor's degree from MIT and a subsequent short appointment as director of the MIT chemical engineering practice school station at what was then Esso (now Exxon) in New Jersey. His undergraduate degree is from Yale. Starting with his MIT doctoral dissertation on gas absorption, Jud has devoted much of his professional career to separation processes. His teaching and research activities have been primarily concerned with separation of mixtures with emphasis on liquid-liquid extraction and drying. As a consultant to Procter and Gamble, he contributed to the technology of making instant coffee. His life-long activities in hiking and camping stimulated Jud's interest in the manufacture of freeze-dried foods (e.g. turkey meat) to minimize the weight of his hiking back-pack. Jud is internationally known not only for his many research publications but even more, for his acclaimed textbook ''Separation Processses'' (McGraw-Hill, second edition 1980) that is used in standard chemical engineering courses in the US and abroad.
Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.
2016-01-01
Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030
Update on HIV-1 acquired and transmitted drug resistance in Africa.
Ssemwanga, Deogratius; Lihana, Raphael W; Ugoji, Chinenye; Abimiku, Alash'le; Nkengasong, John; Dakum, Patrick; Ndembi, Nicaise
2015-01-01
The last ten years have witnessed a significant scale-up and access to antiretroviral therapy in Africa, which has improved patient quality of life and survival. One major challenge associated with increased access to antiretroviral therapy is the development of antiretroviral resistance due to inconsistent drug supply and/or poor patient adherence. We review the current state of both acquired and transmitted drug resistance in Africa over the past ten years (2001-2011) to identify drug resistance associated with the different drug regimens used on the continent and to help guide affordable strategies for drug resistance surveillance. A total of 161 references (153 articles, six reports and two conference abstracts) were reviewed. Antiretroviral resistance data was available for 40 of 53 African countries. A total of 5,541 adult patients from 99 studies in Africa were included in this analysis. The pooled prevalence of drug resistance mutations in Africa was 10.6%, and Central Africa had the highest prevalence of 54.9%. The highest prevalence of nucleoside reverse transcriptase inhibitor mutations was in the west (55.3%) and central (54.8%) areas; nonnucleoside reverse transcriptase inhibitor mutations were highest in East Africa (57.0%) and protease inhibitors mutations highest in Southern Africa (16.3%). The major nucleoside reverse transcriptase inhibitor mutation in all four African regions was M184V. Major nonnucleoside reverse transcriptase inhibitor as well as protease inhibitor mutations varied by region. The prevalence of drug resistance has remained low in several African countries although the emergence of drug resistance mutations varied across countries. Continued surveillance of antiretroviral therapy resistance remains crucial in gauging the effectiveness of country antiretroviral therapy programs and strategizing on effective and affordable strategies for successful treatment.
International Nuclear Information System (INIS)
Strait, S.R.; Spane, F.A. Jr.
1983-02-01
This report presents preliminary results and description of hydrologic test activities for the Umtanum Basalt Fracture Zone at Borehole RRL-2, within the test interval 3,781 to 3,827 feet. Hydrologic tests conducted include two short-term, constant discharge pumping tests and two slug tests. Preliminary results indicate an observed hydraulic head for the test interval of 406.7 feet above mean sea level. Transmissivity values determined from hydrologic tests performed range between 205 and 881 ft 2 /day. The best estimate of equivalent hydraulic conductivity, based on an effective test thickness of 6 feet, is 147 ft/day. 8 refs., 6 figs., 3 tabs
Bassi, D; Cappa, F; Gazzola, S; Orrù, L; Cocconcelli, P S
2017-04-15
In Streptococcus thermophilus , gene transfer events and loss of ancestral traits over the years contribute to its high level of adaptation to milk environments. Biofilm formation capacity, a phenotype that is lost in the majority of strains, plays a role in persistence in dairy environments, such as milk pasteurization and cheese manufacturing plants. To investigate this property, we have studied S. thermophilus UC8547, a fast-acidifying dairy starter culture selected for its high capacity to form biofilm on stainless steel under environmental conditions resembling the dairy environment. Using a dynamic flow cell apparatus, it was shown that S. thermophilus UC8547 biofilm formation on stainless steel depends on the presence of milk proteins. From this strain, which harbors the prtS gene for the cell wall protease and shows an aggregative phenotype, spontaneous mutants with impaired biofilm capacity can be isolated at high frequency. These mutants lack the PrtS expendable island, as confirmed by comparison of the genome sequence of UC8547Δ3 with that of the parent strain. The prtS island excision occurs between two 26-bp direct repeats located in the two copies of the IS Sth1 flanking this genomic island. The central role of PrtS was confirmed by analyzing the derivative strain UC8547Δ16, whose prtS gene was interrupted by an insertional mutation, thereby making it incapable of biofilm formation. PrtS, acting as a binding substance between the milk proteins adhered to stainless steel and S. thermophilus cell envelopes, mediates biofilm formation in dairy environments. This feature provides S. thermophilus with an ecological benefit for its survival and persistence in this environment. IMPORTANCE The increased persistence of S. thermophilus biofilm has consequences in the dairy environment: if, on the one hand, the release of this microorganism from biofilm can promote the fermentation of artisanal cheeses, under industrial conditions it may lead to undesirable
Patick, A K; Boritzki, T J; Bloom, L A
1997-01-01
Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritona...
DEFF Research Database (Denmark)
Bracher, Linda; Valerius, Niels Henrik; Rosenfeldt, Vibeke
2007-01-01
children treated with HAART. Initial HAART included 2 nucleoside reverse-transcriptase inhibitors in combination with either a protease inhibitor (n =38) or a non-nucleoside reverse-transcriptase inhibitor (n =12). 19 (39%) patients were previously treated with mono- or dual therapy. Baseline......The long-term impact of highly active antiretroviral therapy (HAART) on HIV-1 infected children is not well known. The Danish Paediatric HIV Cohort Study includes all patients ... characteristics were median CD4 percentage 14% and HIV-RNA viral load 4.9 log(10). Within the first 12 weeks of therapy approximately 60% achieved HIV-RNA viral load children changed the components of HAART. The proportion of children with CD4...
Moreno, Karla; Farias, Javier
2016-01-01
Hacia el año 2010, la UC constató que en la admisión de pregrado había una muy baja proporción de estudiantes de establecimientos municipales y particulares subvencionados. Esta observación, sumada a las barreras económicas, académicas y culturales que impiden atraer y seleccionar las diversas formas de talentos existentes, llevó a que se creara el programa Talento e Inclusión UC. En el presente artículo se describe el camino recorrido por la Universidad Católica de Chile en su búsqueda por c...
Fogel, Jessica M; Clarke, William; Kulich, Michal; Piwowar-Manning, Estelle; Breaud, Autumn; Olson, Matthew T; Marzinke, Mark A; Laeyendecker, Oliver; Fiamma, Agnès; Donnell, Deborah; Mbwambo, Jessie K K; Richter, Linda; Gray, Glenda; Sweat, Michael; Coates, Thomas J; Eshleman, Susan H
2017-02-01
Antiretroviral (ARV) drug treatment benefits the treated individual and can prevent HIV transmission. We assessed ARV drug use in a community-randomized trial that evaluated the impact of behavioral interventions on HIV incidence. Samples were collected in a cross-sectional survey after a 3-year intervention period. ARV drug testing was performed using samples from HIV-infected adults at 4 study sites (Zimbabwe; Tanzania; KwaZulu-Natal and Soweto, South Africa; survey period 2009-2011) using an assay that detects 20 ARV drugs (6 nucleoside/nucleotide reverse transcriptase inhibitors, 3 nonnucleoside reverse transcriptase inhibitors, and 9 protease inhibitors; maraviroc; raltegravir). ARV drugs were detected in 2011 (27.4%) of 7347 samples; 88.1% had 1 nonnucleoside reverse transcriptase inhibitors ± 1-2 nucleoside/nucleotide reverse transcriptase inhibitors. ARV drug detection was associated with sex (women>men), pregnancy, older age (>24 years), and study site (P < 0.0001 for all 4 variables). ARV drugs were also more frequently detected in adults who were widowed (P = 0.006) or unemployed (P = 0.02). ARV drug use was more frequent in intervention versus control communities early in the survey (P = 0.01), with a significant increase in control (P = 0.004) but not in intervention communities during the survey period. In KwaZulu-Natal, a 1% increase in ARV drug use was associated with a 0.14% absolute decrease in HIV incidence (P = 0.018). This study used an objective, biomedical approach to assess ARV drug use on a population level. This analysis identified factors associated with ARV drug use and provided information on ARV drug use over time. ARV drug use was associated with lower HIV incidence at 1 study site.
International Nuclear Information System (INIS)
Van Dijk, A.A.; Huismans, H.
1982-01-01
Virions of bluetongue virus (BTV), epizootic haemorrhagic disease virus (EHDV) and African horsesickness virus (AHSV) can be converted to core particles by treatment with chymotrypsin and magnesium. The conversion is characterized by the removal of the 2 outer capsid polypeptides of the virion. The loss of these 2 proteins results in an increase in density from 1,36 g/ml to 1,40 g/ml on CsCl gradients. The BTV, EHDV and AHSV core particles have an associated double-stranded RNA dependent RNA transcriptase that appears to transcribe mRNA optimally at 28 degrees Celsius. It was found, at least in the case of BTV, that this low temperature preference is not an intrinsic characteristic of the transcriptase, but is due to a temperature-dependent inhibition of transcription at high core concentrations
Directory of Open Access Journals (Sweden)
Wei Qi
Full Text Available The proteasome inhibitor bortezomib (Velcade is a promising new agent for bladder cancer therapy, but inducible cytoprotective mechanisms may limit its potential efficacy. We used whole genome mRNA expression profiling to study the effects of bortezomib on stress-induced gene expression in a panel of human bladder cancer cell lines. Bortezomib induced strong upregulation of the inducible HSP70 isoforms HSPA1A and HSPA1B isoforms of Hsp72 in 253J B-V and SW780 (HSPA1A(high cells, but only induced the HSPA1B isoform in UM-UC10 and UM-UC13 (HSPA1A(low cells. Bortezomib stimulated the binding of heat shock factor-1 (HSF1 to the HSPA1A promoter in 253JB-V but not in UM-UC13 cells. Methylation-specific PCR revealed that the HSPA1A promoter was methylated in the HSPA1A(low cell lines (UM-UC10 and UM-UC13, and exposure to the chromatin demethylating agent 5-aza-2'-deoxycytidine restored HSPA1A expression. Overexpression of Hsp72 promoted bortezomib resistance in the UM-UC10 and UM-UC13 cells, whereas transient knockdown of HSPA1B further sensitized these cells to bortezomib, and exposure to the chemical HSF1 inhibitor KNK-437 promoted bortezomib sensitivity in the 253J B-V cells. Finally, shRNA-mediated stable knockdown of Hsp72 in 253J B-V promoted sensitivity to bortezomib in vitro and in tumor xenografts in vivo. Together, our results provide proof-of-concept for using Hsp72 inhibitors to promote bortezomib sensitivity in bladder cancers and suggest that selective targeting of HSPA1B could produce synthetic lethality in tumors that display HSPA1A promoter methylation.
Prevalence and effects of functional vitamin K insufficiency
Riphagen, Ineke J.; Keyzer, Charlotte A.; Drummen, Nadja E.A.; Borst, de Martin H.; Beulens, Joline W.J.; Gansevoort, Ron T.; Geleijnse, Johanna M.; Muskiet, Frits A.J.; Navis, Gerjan; Visser, Sipke T.; Vermeer, Cees; Kema, Ido P.; Bakker, Stephan J.L.
2017-01-01
Matrix Gla Protein (MGP) is a strong vitamin K-dependent inhibitor of soft tissue calcification. We assessed the prevalence of functional vitamin K insufficiency, as derived from plasma desphospho-uncarboxylated MGP (dp-ucMGP), and investigated whether plasma dp-ucMGP is associated with all-cause
Prevalence and Effects of Functional Vitamin K Insufficiency : The PREVEND Study
Riphagen, Ineke J; Keyzer, Charlotte A; Drummen, Nadja E A; de Borst, Martin H; Beulens, Joline W J; Gansevoort, Ron T; Geleijnse, Johanna M; Muskiet, Frits A J; Navis, Gerjan; Visser, Sipke T; Vermeer, Cees; Kema, Ido P; Bakker, Stephan J L
2017-01-01
Matrix Gla Protein (MGP) is a strong vitamin K-dependent inhibitor of soft tissue calcification. We assessed the prevalence of functional vitamin K insufficiency, as derived from plasma desphospho-uncarboxylated MGP (dp-ucMGP), and investigated whether plasma dp-ucMGP is associated with all-cause
Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M
2014-01-13
Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The
Ramaswami, Rama
2011-01-01
In this article, the author talks about the challenges faced by two schools that lie, coincidentally, just 110 miles apart in the vast spaces of North Dakota. Both schools, members of the North Dakota University System, decided to forge ahead with a unified communications (UC) implementation. And while their final solutions differ, how the two…
Else, Laura J; Taylor, Stephen; Back, David J; Khoo, Saye H
2011-01-01
HIV resides within anatomical 'sanctuary sites', where local drug exposure and viral dynamics may differ significantly from the systemic compartment. Suboptimal antiretroviral concentrations in the genital tract may result in compartmentalized viral replication, selection of resistant mutations and possible re-entry of wild-type/resistant virus into the systemic circulation. Therefore, achieving adequate antiretroviral exposure in the genital tract has implications for the prevention of sexual and vertical transmission of HIV. Penetration of antiretrovirals in the genital tract is expressed by accumulation ratios derived from the measurement of drug concentrations in time-matched seminal plasma/cervicovaginal fluid and plasma samples. Penetration varies by gender and may be drug (as opposed to class) specific with high interindividual variability. Concentrations in seminal plasma are highest for nucleoside analogues and lowest for protease inhibitors and efavirenz. Seminal accumulation of newer agents, raltegravir and maraviroc, is moderate (rank order of accumulation is nucleoside/nucleotide reverse transcriptase inhibitors [lamivudine/zidovudine/tenofovir/didanosine > stavudine/abacavir] > raltegravir > indinavir/maraviroc/nevirapine > efavirenz/protease inhibitors [amprenavir/atazanavir/darunavir > lopinavir/ritonavir > saquinavir] > enfuvirtide). In the female genital tract, the nucleoside analogues exhibit high accumulation ratios, whereas protease inhibitors have limited penetration; however, substantial variability exists between individuals and study centres. Second generation non-nucleoside reverse transcriptase inhibitor etravirine, and maraviroc and raltegravir, demonstrate effective accumulation in cervicovaginal secretions (rank order of accumulation is nucleoside/nucleotide reverse transcriptase inhibitor [zidovudine/lamivudine/didanosine > emtricitabine/tenofovir] > indinavir > maraviroc/raltegravir/darunavir/etravirine > nevirapine
Rosa Lissi; Soledad Zuzulich; Marcela Salinas; Consuelo Achiardi; Ana M. Hojas; Nuria Pedrals
2009-01-01
The article presents the issue of inclusion of students with disabilities in higher education and describes the existing barriers preventing their successful inclusion. It also presents a model including conditions to be met for a university is considered inclusive. Moreover, it describes the PIANE-UC Program developed at Pontificia Universidad Católica de Chile to facilitate inclusion of students with disabilities and points at its achievements and main intervention areas. Finall...
Tenofovir-related nephrotoxicity: case report and review of the literature.
James, Christopher W; Steinhaus, Mary C; Szabo, Susan; Dressier, Robert M
2004-03-01
Tenofovir is a nucleotide reverse transcriptase inhibitor for treatment of human immunodeficiency virus (HIV) infection. Several cases of renal failure associated with tenofovir therapy recently have been reported. A 54-year-old man with HIV experienced decreasing renal function and Fanconi's syndrome secondary to tenofovir therapy. His condition gradually improved after discontinuation of the drug. The available medical literature for reported cases of tenofovir-related nephrotoxicity indicates that this complication is apparently rare. However, our case report and literature review underscore the importance of monitoring renal function when treating patients with any nucleotide reverse transcriptase inhibitor.
Wang, Xiao Li; Hu, Pei; Guo, Xing Rong; Yan, Ding; Yuan, Yahong; Yan, Shi Rong; Li, Dong Sheng
2014-11-01
Human umbilical cord mesenchymal stromal cells (hUC-MSCs) hold great potential as a therapeutic candidate to treat diabetes, owing to their unlimited source and ready availability. In this study, we differentiated hUC-MSCs with in vitro-synthesized pancreatic-duodenal homebox 1 (PDX1) messenger (m)RNA into islet-like cell clusters. hUC-MSCs were confirmed by both biomarker detection and functional differentiation. In vitro-synthesized PDX1 messenger RNA can be transfected into hUC-MSCs efficiently. The upregulated expression of PDX1 protein can be detected 4 h after transfection and remains detectable for 36 h. The induction of islet-like structures was confirmed by means of morphology and dithizone staining. Reverse transcriptase-polymerase chain reaction results revealed the expression of some key pancreatic transcription factors, such as PDX1, NeuroD, NKX6.1, Glut-2 and insulin in islet-like cell clusters. Immunofluorescence analysis showed that differentiated cells express both insulin and C-peptide. Enzyme-linked immunosorbent assay analysis validated the insulin secretion of islet-like cell clusters in response to the glucose stimulation. Our results demonstrate the use of in vitro-synthesized PDX1 messenger RNA to differentiate hUC-MSCs into islet-like cells and pave the way toward the development of reprogramming and directed-differentiation methods for the expression of encoded proteins. Copyright © 2014 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
Botes, D P; Qobose, M D; Corfield, V A
1991-09-15
A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.
Directory of Open Access Journals (Sweden)
Dyah Ayu Hewajuli
2014-03-01
Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.
2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase
International Nuclear Information System (INIS)
Starnes, M.C.
1988-01-01
2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells
Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.
2010-01-01
Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved
Directory of Open Access Journals (Sweden)
Lei Lv
2017-01-01
Full Text Available Recent studies indicate important roles for long noncoding RNAs (lncRNAs as essential regulators of gene expression. However, the specific roles of lncRNAs in stenotic lesions of arteriovenous fistula (AVF failure are still largely unknown. We first analyzed the expression profiles of lncRNAs in human stenosed and nonstenotic uremic veins using RNA-sequencing methodology. A total of 19 lncRNAs were found to be differentially expressed in stenotic lesions. Among these, uc001pwg.1 was one of the most significantly downregulated lncRNAs and enriched in both control vein segments and human umbilical vein endothelial cells (HUVECs. Further studies revealed that uc001pwg.1 overexpression could increase nitric oxide synthase (eNOS phosphorylation and nitric oxide (NO production in endothelial cells (ECs derived from human-induced pluripotent stem cells (HiPSCs. Mechanistically, uc001pwg.1 improves endothelial function via mediating MCAM expression. This study represents the first effort of identifying a novel candidate lncRNA for modulating the function of iPSC-ECs, which may facilitate the improvement of stem cell-based therapies for AVF failure.
Analysis, Design, and Evaluation of the UC-Berkeley Wave-Energy Extractor
Yeung, Ronald W.; Peiffer, Antoine; Tom, Nathan; Matlak, Tomasz
2010-01-01
This paper evaluates the technical feasibility and performance characteristics of an ocean-wave energy to electrical energy conversion device that is based on a moving linear generator. The UC-Berkeley design consists of a cylindrical floater, acting as a rotor, which drives a stator consisting of two banks of wound coils. The performance of such a device in waves depends on the hydrodynamics of the floater, the motion of which is strongly coupled to the electromagnetic properties of the generator. Mathematical models are developed to reveal the critical hurdles that can affect the efficiency of the design. A working physical unit is also constructed. The linear generator is first tested in a dry environment to quantify its performance. The complete physical floater and generator system is then tested in a wave tank with a computer-controlled wavemaker. Measurements are compared with theoretical predictions to allow an assessment of the viability of the design and future directions for improvements. Copyright © 2010 by ASME.
Design, Analysis, and Evaluation of the UC-Berkeley Wave-Energy Extractor
Yeung, Ronald W.; Peiffer, Antoine; Tom, Nathan; Matlak, Tomasz
2012-01-01
This paper evaluates the technical feasibility and performance characteristics of an ocean-wave energy to electrical energy conversion device that is based on a moving linear generator. The UC-Berkeley design consists of a cylindrical floater, acting as a rotor, which drives a stator consisting of two banks of wound coils. The performance of such a device in waves depends on the hydrodynamics of the floater, the motion of which is strongly coupled to the electromagnetic properties of the generator. Mathematical models are developed to reveal the critical hurdles that can affect the efficiency of the design. A working physical unit is also constructed. The linear generator is first tested in a dry environment to quantify its performance. The complete physical floater and generator system is then tested in a wave tank with a computer-controlled wavemaker. Measurements are compared with theoretical predictions to allow an assessment of the viability of the design and the future directions for improvements. © 2012 American Society of Mechanical Engineers.
Hosseini, Seyed H.; Kohler, James J.; Haase, Chad P.; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William
2007-01-01
Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-γ. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK...
Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.
Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari
2018-05-03
Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.
Ethnic variations in ulcerative colitis: Experience of an international hospital in Thailand.
Permpoon, Vibhakorn; Pongpirul, Krit; Anuras, Sinn
2016-08-06
To investigate the clinical characteristics, treatment, medication use, and treatment response in patients with ulcerative colitis (UC) across ethnic groups. This study retrospectively analyzed medical records of all 268465 patients who visited the Bumrungrad International Digestive Disease Center during 2005-2010. The demographics, clinical characteristics, medication use, results of investigations, and medical and surgical management for patients with UC were evaluated. Evaluation included sigmoidoscopy and colonoscopy performed in compliance with the American Society of Gastrointestinal Endoscopy practice guidelines. Patient ethnicities were categorized into seven groups: Thai, Oriental, South Asian (SA), Middle Eastern (ME), Caucasian, African, and Hispanic. UC pathological severity was classified into inactive, mild, moderate, and severe. Associations between categorical variables were analyzed using the χ(2) or Fischer's exact test. Associations between categorical and interval variables were analyzed using Student's t-test and/or analysis of covariance. UC was diagnosed in 371 of the 268465 patients: male 56.33%; ME 42%, Caucasian 23%, and Thai 19%. Annual incidence of UC was 82 cases per 100000 with wide ethnic variation, ranging from 29 to 206 cases per 100000 in Oriental and ME patients, respectively. Of the patients with UC, 16.71% had severe UC with highest incidence among the patients from ME (20.39%) and lowest among the Caucasian population (11.90%). ME had highest proportion of pancolitis (52.90%), followed by Caucasian (45.35%) and Asian (34.40%). Only 20.93% of Caucasian patients received steroid, compared with 26.40% and 27.10% of Asian and Middle Eastern, respectively (P = 0.732). Overall, 13.72% of UC patients did not respond to steroid therapy, with non-significantly higher proportions of non-responders among Asian and Middle Eastern patients (15.22% and 15.04%, respectively) (P = 0.781). On average, 5.93% underwent surgical management with
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
Oude Essink, B. B.; Das, A. T.; Berkhout, B.
1995-01-01
Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA
Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni
2008-09-01
We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.
Garcia, Jean-Michel; Gao, Anhui; He, Pei-Lan; Choi, Joyce; Tang, Wei; Bruzzone, Roberto; Schwartz, Olivier; Naya, Hugo; Nan, Fa-Jun; Li, Jia; Altmeyer, Ralf; Zuo, Jian-Ping
2009-03-01
Two decades after its discovery the human immunodeficiency virus (HIV) is still spreading worldwide and killing millions. There are 25 drugs formally approved for HIV currently on the market, but side effects as well as the emergence of HIV strains showing single or multiple resistances to current drug-therapy are causes for concern. Furthermore, these drugs target only 4 steps of the viral cycle, hence the urgent need for new drugs and also new targets. In order to tackle this problem, we have devised a cell-based assay using lentiviral particles to look for post-entry inhibitors of HIV-1. We report here the assay development, validation as well as confirmation of the hits using both wild-type and drug-resistant HIV-1 viruses. The screening was performed on an original library, rich in natural compounds and pure molecules from Traditional Chinese Medicine pharmacopoeia, which had never been screened for anti-HIV activity. The identified hits belong to four chemical sub-families that appear to be all non-nucleoside reverse transcriptase inhibitors (NNRTIs). Secondary tests with live viruses showed that there was good agreement with pseudotyped particles, confirming the validity of this approach for high-throughput drug screens. This assay will be a useful tool that can be easily adapted to screen for inhibitors of viral entry.
Directory of Open Access Journals (Sweden)
Sota Iwatani
2017-01-01
Full Text Available Mesenchymal stem cells (MSCs are a heterogeneous cell population that is isolated initially from the bone marrow (BM and subsequently almost all tissues including umbilical cord (UC. UC-derived MSCs (UC-MSCs have attracted an increasing attention as a source for cell therapy against various degenerative diseases due to their vigorous proliferation and differentiation. Although the cell proliferation and differentiation of BM-derived MSCs is known to decline with age, the functional difference between preterm and term UC-MSCs is poorly characterized. In the present study, we isolated UC-MSCs from 23 infants delivered at 22–40 weeks of gestation and analyzed their gene expression and cell proliferation. Microarray analysis revealed that global gene expression in preterm UC-MSCs was distinct from term UC-MSCs. WNT signaling impacts on a variety of tissue stem cell proliferation and differentiation, and its pathway genes were enriched in differentially expressed genes between preterm and term UC-MSCs. Cell proliferation of preterm UC-MSCs was significantly enhanced compared to term UC-MSCs and counteracted by WNT signaling inhibitor XAV939. Furthermore, WNT2B expression in UC-MSCs showed a significant negative correlation with gestational age (GA. These results suggest that WNT signaling is involved in the regulation of GA-dependent UC-MSC proliferation.
Shono, Akemi; Yoshida, Makiko; Yamana, Keiji; Thwin, Khin Kyae Mon; Kuroda, Jumpei; Kurokawa, Daisuke; Koda, Tsubasa; Nishida, Kosuke; Ikuta, Toshihiko; Mizobuchi, Masami; Taniguchi-Ikeda, Mariko
2017-01-01
Mesenchymal stem cells (MSCs) are a heterogeneous cell population that is isolated initially from the bone marrow (BM) and subsequently almost all tissues including umbilical cord (UC). UC-derived MSCs (UC-MSCs) have attracted an increasing attention as a source for cell therapy against various degenerative diseases due to their vigorous proliferation and differentiation. Although the cell proliferation and differentiation of BM-derived MSCs is known to decline with age, the functional difference between preterm and term UC-MSCs is poorly characterized. In the present study, we isolated UC-MSCs from 23 infants delivered at 22–40 weeks of gestation and analyzed their gene expression and cell proliferation. Microarray analysis revealed that global gene expression in preterm UC-MSCs was distinct from term UC-MSCs. WNT signaling impacts on a variety of tissue stem cell proliferation and differentiation, and its pathway genes were enriched in differentially expressed genes between preterm and term UC-MSCs. Cell proliferation of preterm UC-MSCs was significantly enhanced compared to term UC-MSCs and counteracted by WNT signaling inhibitor XAV939. Furthermore, WNT2B expression in UC-MSCs showed a significant negative correlation with gestational age (GA). These results suggest that WNT signaling is involved in the regulation of GA-dependent UC-MSC proliferation. PMID:29138639
The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.
Directory of Open Access Journals (Sweden)
Dolores Bautista-España
Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.
Directory of Open Access Journals (Sweden)
Soo-Huey Yap
2007-12-01
Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which
Gomez-Escalante, Susana; Piper, Peter W; Millson, Stefan H
2017-01-01
Folding of the myosin head often requires the joint actions of Hsp90 and a dedicated UNC45, Cro1, She4 (UCS) domain-containing cochaperone protein. Relatively weak sequence conservation exists between the single UCS protein of simple eukaryotes (She4 in budding yeast) and the two UCS proteins of higher organisms (the general cell and smooth muscle UNC45s; UNC45-GC and UNC45-SM respectively). In vertebrates, UNC45-GC facilitates cytoskeletal function whereas the 55% identical UNC45-SM assists in the assembly of the contractile apparatus of cardiac and skeletal muscles. UNC45-SM, unlike UNC45-GC, shares with yeast She4 an IDSL sequence motif known to be a site of in vivo serine phosphorylation in yeast. Investigating this further, we found that both a non-phosphorylatable (S18A) and a phosphomimetic (S18E) mutant form of She4 could rescue the type 1 myosin localisation and endocytosis defects of the yeast she4Δ mutant at 39 °C. Nevertheless, at higher temperature (45 °C), only She4 (S18A), not She4(S18E), could substantially rescue the cell lysis defect of she4Δ mutant cells. In the yeast two-hybrid system, the non-phosphorylatable S18A and S251A mutant forms of She4 and UNC45-SM still displayed the stress-enhanced in vivo interaction with Hsp90 seen with the wild-type She4 and UNC45-SM. Such high-temperature enforcement to interaction was though lost with the phosphomimetic mutant forms (She4(S18E) and UNC45-SM (S251E)), an indication that phosphorylation might suppress these increases in She4/Hsp90 and UNC45-SM/Hsp90 interaction with stress.
Risk of triple-class virological failure in children with HIV: a retrospective cohort study
DEFF Research Database (Denmark)
Castro, Hannah; Judd, Ali; Gibb, Diana M
2011-01-01
In adults with HIV treated with antiretroviral drug regimens from within the three original drug classes (nucleoside or nucleotide reverse transcriptase inhibitors [NRTIs], non-NRTIs [NNRTIs], and protease inhibitors), virological failure occurs slowly, suggesting that long-term virological...... failure to the three original drugs classes in children....
Class of Antiretroviral Drugs and the Risk of Myocardial Infarction
DEFF Research Database (Denmark)
Friis-Møller, Nina; Reiss, P.; Sabin, C.A.
2007-01-01
of myocardial infarction, which is partly explained by dyslipidemia. We found no evidence of such an association for nonnucleoside reverse-transcriptase inhibitors; however, the number of person-years of observation for exposure to this class of drug was less than that for exposure to protease inhibitors...
A study on the expression levels of matrix metalloproteinases and ...
African Journals Online (AJOL)
Conclusion: MMP-2, MMP-7, and MMP-9 are potential targets for therapeutic control of UC. Keywords: Glandular epithelium, Inflammatory cells, Inhibitors, Matrix metalloproteinases (MMPs),. Tissue inhibitors of metalloproteinases, Ulcerative colitis. Tropical Journal of Pharmaceutical Research is indexed by Science ...
Investigations on UCS-CS mediation in radiation-induced conditioned taste aversion
International Nuclear Information System (INIS)
Burns, T.C.
1974-01-01
Groups of 8 male Sprague-Dawley rats were used in an investigation of procaine and dimenhydrinate effects on radiation-induced taste aversion learning. Neither the local anesthetic procaine, administered intraperitoneally, nor the antinausea drug dimenhydrinate, administered intramuscularly, blocked acquisition of aversion to saccharin flavored water. Control animals confirmed that saccharin preferences appeared normally in non-irradiated animals, and that the drugs produced no aversion in the absence of radiation. Another investigation, using groups of 5 female Sprague-Dawley rats, showed a failure of dimenhydrinate in blocking the acquisition of a rotation-induced conditioned taste aversion. Two dose levels of the drug were used, 1 mg/kg and 2 mg/kg. At the dimenhydrinate dosage used in the study involving radiation (1.75 mg/kg) and at the higher dosage used in the study involving rotation, there appeared to be a potentiation of the effects of radiation and rotation, respectively. Results of these studies seem to favor a model for UCS-CS mediation as being diffuse and perhaps redundant. The possibility that nausea-producing stimuli may work synergistically was also discussed. (U.S.)
International Nuclear Information System (INIS)
Stinton, D.P.; Tiegs, S.M.; Lackey, W.J.; Lindemer, T.B.
1979-01-01
Rate controlling factors in the conversion of UO 2 + C microspheres to UC 2 + C were investigated using a 13-cm-dia fluidized bed furnace. X-ray diffraction, ion microprobe, and microstructural examination revealed that the conversion of UO 2 to UC 2 began at the surface of the microsphere and progressed toward the central unreacted core. Kinetic models for solid state reactions in spheres were evaluated by using quantitative mass spectrometric data on the rae of evolution of carbon monoxide during conversion. This analysis revealed that the rate of conversion was controlled by reaction at the outer surface of the microsphere. Also, decreased partial pressures of carbon monoxide were found to accelerate the rate of reaction
DEFF Research Database (Denmark)
Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels
2011-01-01
Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...
DEFF Research Database (Denmark)
Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels
2011-01-01
Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...
Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M
2016-04-01
Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.
Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J
2009-06-01
Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.
Eltze, Tobias; Boer, Rainer; Wagner, Thomas; Weinbrenner, Steffen; McDonald, Michelle C; Thiemermann, Christoph; Bürkle, Alexander; Klein, Thomas
2008-12-01
We have identified three novel structures for inhibitors of the poly(ADP-ribose) polymerase (PARP), a nuclear enzyme activated by strand breaks in DNA and implicated in DNA repair, apoptosis, organ dysfunction or necrosis. 2-[4-(5-Methyl-1H-imidazol-4-yl)-piperidin-1-yl]-4,5-dihydro-imidazo[4,5,1-i,j]quinolin-6-one (BYK49187), 2-(4-pyridin-2-yl-phenyl)-4,5-dihydro-imidazo[4,5,1-i,j]quinolin-6-one (BYK236864), 6-chloro-8-hydroxy-2,3-dimethyl-imidazo-[1,2-alpha]-pyridine (BYK20370), and 4-(1-methyl-1H-pyrrol-2-ylmethylene)-4H-isoquinolin-1,3-dione (BYK204165) inhibited cell-free recombinant human PARP-1 with pIC(50) values of 8.36, 7.81, 6.40, and 7.35 (pK(i) 7.97, 7.43, 5.90, and 7.05), and murine PARP-2 with pIC(50) values of 7.50, 7.55, 5.71, and 5.38, respectively. BYK49187, BYK236864, and BYK20370 displayed no selectivity for PARP-1/2, whereas BYK204165 displayed 100-fold selectivity for PARP-1. The IC(50) values for inhibition of poly(ADP-ribose) synthesis in human lung epithelial A549 and cervical carcinoma C4I cells as well in rat cardiac myoblast H9c2 cells after PARP activation by H(2)O(2) were highly significantly correlated with those at cell-free PARP-1 (r(2) = 0.89-0.96, P < 0.001) but less with those at PARP-2 (r(2) = 0.78-0.84, P < 0.01). The infarct size caused by coronary artery occlusion and reperfusion in the anesthetized rat was reduced by 22% (P < 0.05) by treatment with BYK49187 (3 mg/kg i.v. bolus and 3 mg/kg/h i.v. during 2-h reperfusion), whereas the weaker PARP inhibitors, BYK236864 and BYK20370, were not cardioprotective. In conclusion, the imidazoquinolinone BYK49187 is a potent inhibitor of human PARP-1 activity in cell-free and cellular assays in vitro and reduces myocardial infarct size in vivo. The isoquinolindione BYK204165 was found to be 100-fold more selective for PARP-1. Thus, both compounds might be novel and valuable tools for investigating PARP-1-mediated effects.
Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis
Directory of Open Access Journals (Sweden)
Ma Bi
2017-10-01
Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.
Directory of Open Access Journals (Sweden)
Weizi Liang
Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.
Czech Academy of Sciences Publication Activity Database
Prejdová, Jana; Weber, Jan; Machala, L.; Reiniš, Milan; Linka, M.; Brůčková, M.; Vandasová, M.; Staňková, M.; Konvalinka, Jan
2005-01-01
Roč. 49, č. 1 (2005), 29-36 ISSN 0001-723X R&D Projects: GA MZd(CZ) NI6339 Grant - others:5th Framework(XE) QLK2-CT-2001-02360 Institutional research plan: CEZ:AV0Z4055905 Keywords : HIV * protease inhibitors * resistance development Subject RIV: CE - Biochemistry Impact factor: 0.696, year: 2005
A second chance for telomerase reverse transcriptase in anticancer immunotherapy.
Zanetti, Maurizio
2017-02-01
Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.
An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo
DEFF Research Database (Denmark)
Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas
2004-01-01
Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...
[Anti-TNF-alpha therapy in ulcerative colitis].
Lakatos, Péter László; Lakatos, László
2008-05-18
The most important factors that determine treatment strategy in ulcerative colitis (UC) are disease extent and severity. Orally-topically administered 5-aminosalicylates (5-ASA) remain the treatment of choice in mild-to-moderate UC. In contrast, the treatment of refractory (to steroids, azathioprine or 5-ASA) and fulminant cases is still demanding. New evidence supports a role for infliximab induction and/or maintenance therapy in these subgroup of patients leading to increased remission and decreased colectomy rates. The aim of this paper is to review the rationale for the use of TNF-alpha inhibitors in the treatment of UC.
Directory of Open Access Journals (Sweden)
Binhua Ling
Full Text Available Viral reservoirs-persistent residual virus despite combination antiretroviral therapy (cART-remain an obstacle to cure of HIV-1 infection. Difficulty studying reservoirs in patients underscores the need for animal models that mimics HIV infected humans on cART. We studied SIV-infected Chinese-origin rhesus macaques (Ch-RM treated with intensive combination antiretroviral therapy (cART and 3 weeks of treatment with the histone deacetyalse inhibitor, suberoylanilide hydroxamic acid (SAHA.SIVmac251 infected Ch-RM received reverse transcriptase inhibitors PMPA and FTC and integrase inhibitor L-870812 beginning 7 weeks post infection. Integrase inhibitor L-900564 and boosted protease inhibitor treatment with Darunavir and Ritonavir were added later. cART was continued for 45 weeks, with daily SAHA administered for the last 3 weeks, followed by euthanasia/necropsy. Plasma viral RNA and cell/tissue-associated SIV gag RNA and DNA were quantified by qRT-PCR/qPCR, with flow cytometry monitoring changes in immune cell populations.Upon cART initiation, plasma viremia declined, remaining <30 SIV RNA copy Eq/ml during cART, with occasional blips. Decreased viral replication was associated with decreased immune activation and partial restoration of intestinal CD4+ T cells. SAHA was well tolerated but did not result in demonstrable treatment-associated changes in plasma or cell associated viral parameters.The ability to achieve and sustain virological suppression makes cART-suppressed, SIV-infected Ch-RM a potentially useful model to evaluate interventions targeting residual virus. However, despite intensive cART over one year, persistent viral DNA and RNA remained in tissues of all three animals. While well tolerated, three weeks of SAHA treatment did not demonstrably impact viral RNA levels in plasma or tissues; perhaps reflecting dosing, sampling and assay limitations.
Berenguer, Juan; Polo, Rosa; Lozano, Fernando; López Aldeguer, José; Antela, Antonio; Arribas, José Ramón; Asensi, Víctor; Blanco, José Ramón; Clotet, Bonaventura; Domingo, Pere; Galindo, María José; Gatell, José María; González-García, Juan; Iribarren, José Antonio; Locutura, Jaime; López, Juan Carlos; Mallolas, Josep; Martínez, Esteban; Miralles, Celia; Miró, José M; Moreno, Santiago; Palacios, Rosario; Pérez Elías, María Jesús; Pineda, Juan Antonio; Podzamczer, Daniel; Portilla, Joaquín; Pulido, Federico; Ribera, Esteban; Riera, Melchor; Rubio, Rafael; Santos, Jesús; Sanz, Jesús; Tuset, Montserrat; Vidal, Francesc; Rivero, Antonio
2014-01-01
In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and grade of the recommendation varies with clinical circumstances, number of CD4 cells, comorbid conditions and prevention of transmission of HIV. The objective of ART is to achieve an undetectable plasma viral load. Initial ART should always comprise a combination of 3 drugs, including 2 nucleoside reverse transcriptase inhibitors and a third drug from a different family (non-nucleoside reverse transcriptase inhibitor, protease inhibitor, or integrase inhibitor). This update presents the causes and criteria for switching ART in patients with undetectable plasma viral load and in cases of virological failure. An update is also provided for the specific criteria for ART in special situations (acute infection, HIV-2 infection, and pregnancy) and with comorbid conditions (tuberculosis or other opportunistic infections, kidney disease, liver disease, and cancer). Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
Bassi, D.; Cappa, F.; Gazzola, S.; Orrù, L.; Cocconcelli, P. S.
2017-01-01
In Streptococcus thermophilus, gene transfer events and loss of ancestral traits over the years contribute to its high level of adaptation to milk environments. Biofilm formation capacity, a phenotype that is lost in the majority of strains, plays a role in persistence in dairy environments, such as milk pasteurization and cheese manufacturing plants. To investigate this property, we have studied S. thermophilus UC8547, a fast-acidifying dairy starter culture selected for its high capacity to...
pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.
Gu, Jingsong; Ye, Chunjiang
2011-03-01
A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.
Deshpande, Alake; Karki, Surendra; Recordon-Pinson, Patricia; Fleury, Herve J
2011-12-01
More than 50 HIV-1-infected patients, naive of antiretroviral therapy (ART) but eligible for first line ART in JJ Hospital, Mumbai, India were investigated for surveillance drug resistance mutations (SDRMs); all but one virus belonged to subtype C; we could observe SDRMs to nonnucleoside reverse transcriptase inhibitors and protease inhibitors in 9.6% of the patients.
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Backup_of_7. The Prevalence of Kidney Dysfunction and ...
African Journals Online (AJOL)
user
3University of Zambia, School of Public Health, Lusaka, Zambia. 176 .... Nucleoside Reverse Transcriptase Inhibitors. (NRTIs), and a ... Multivariate logistic regression was used to determine ... the Ethics Committee of ERES Converge approval.
Costi, Roberta; Métifiot, Mathieu; Esposito, Francesca; Cuzzucoli Crucitti, Giuliana; Pescatori, Luca; Messore, Antonella; Scipione, Luigi; Tortorella, Silvano; Zinzula, Luca; Novellino, Ettore; Pommier, Yves; Tramontano, Enzo; Marchand, Christophe; Di Santo, Roberto
2013-11-14
The increasing efficiency of HAART has helped to transform HIV/AIDS into a chronic disease. Still, resistance and drug-drug interactions warrant the development of new anti-HIV agents. We previously discovered hit 6, active against HIV-1 replication and targeting RNase H in vitro. Because of its diketo-acid moiety, we speculated that this chemotype could serve to develop dual inhibitors of both RNase H and integrase. Here, we describe a new series of 1-benzyl-pyrrolyl diketohexenoic derivatives, 7a-y and 8a-y, synthesized following a parallel solution-phase approach. Those 50 analogues have been tested on recombinant enzymes (RNase H and integrase) and in cell-based assays. Approximately half (22) exibited inhibition of HIV replication. Compounds 7b, 7u, and 8g were the most active against the RNase H activity of reverse-transcriptase, with IC50 values of 3, 3, and 2.5 μM, respectively. Compound 8g was also the most potent integrase inhibitor with an IC50 value of 26 nM.
Challenges in Initiating Antiretroviral Therapy in 2010
Directory of Open Access Journals (Sweden)
Cécile L Tremblay
2010-01-01
Full Text Available Many clinical trials have shown that initiating antiretroviral therapy (ART at higher rather than lower CD4 T cell-positive counts results in survival benefit. Early treatment can help prevent end-organ damage associated with HIV replication and can decrease infectivity. The mainstay of treatment is either a non-nucleoside reverse transcriptase inhibitor or a ritonavir-boosted protease inhibitor in combination with two nucleoside reverse transcriptase inhibitors. While effective at combating HIV, ART can produce adverse alterations of lipid parameters, with some studies suggesting a relationship between some anti-retroviral agents and cardiovascular disease. As the HIV-positive population ages, issues such as hypertension and diabetes must be taken into account when initiating ART. Adhering to ART can be difficult; however, nonoptimal adherence to ART can result in the development of resistance; thus, drug characteristics and the patient’s preparedness to begin therapy must be considered. Reducing the pill burden through the use of fixed-dose antiretroviral drug combinations can facilitate adherence.
The future of pre-exposure prophylaxis (PrEP) for human immunodeficiency virus (HIV) infection.
Özdener, Ayşe Elif; Park, Tae Eun; Kalabalik, Julie; Gupta, Rachna
2017-05-01
People at high risk for HIV acquisition should be offered pre-exposure prophylaxis (PrEP). Tenofovir disoproxil fumarate (TDF)/emtricitabine (FTC) is currently the only medication recommended for pre-exposure prophylaxis (PrEP) by the Centers for Disease Control and Prevention (CDC) in people at high risk for HIV acquisition. This article will review medications currently under investigation and the future landscape of PrEP therapy. Areas covered: This article will review clinical trials that have investigated nontraditional regimens of TDF/FTC, antiretroviral agents from different drug classes such as integrase strand transfer inhibitors (INSTI), nucleoside reverse transcriptase inhibitors (NRTI), and non-nucleoside reverse transcriptase inhibitors (NNRTI) as potential PrEP therapies. Expert commentary: Currently, there are several investigational drugs in the pipeline for PrEP against HIV infection. Increased utilization of PrEP therapy depends on provider identification of people at high risk for HIV transmission. Advances in PrEP development will expand options and access for people and reduce the risk of HIV acquisition.
Machado, Luiz Fernando Almeida; Costa, Iran Barros; Folha, Maria Nazaré; da Luz, Anderson Levy Bessa; Vallinoto, Antonio Carlos Rosário; Ishak, Ricardo; Ishak, Marluisa Oliveira Guimarães
2017-04-12
The present study aimed to describe the genetic diversity of HIV-1, as well as the resistance profile of the viruses identified in HIV-1 infected pregnant women under antiretroviral therapy in the state of Pará, Northern Brazil. Blood samples were collected from 45 HIV-1 infected pregnant to determine the virus subtypes according to the HIV-1 protease (PR) gene and part of the HIV-1 reverse transcriptase (RT) gene by sequencing the nucleotides of these regions. Drug resistance mutations and susceptibility to antiretroviral drugs were analyzed by the Stanford HIV Drug Resistance Database. Out of 45 samples, only 34 could be amplified for PR and 30 for RT. Regarding the PR gene, subtypes B (97.1%) and C (2.9%) were identified; for the RT gene, subtypes B (90.0%), F (6.7%), and C (3.3%) were detected. Resistance to protease inhibitors (PI) was identified in 5.8% of the pregnant, and mutations conferring resistance to nucleoside reverse transcriptase inhibitors were found in 3.3%, while mutations conferring resistance to non-nucleoside reverse transcriptase inhibitors were found in 3.3%. These results showed a low frequency of strains resistant to antiretroviral drugs, the prevalence of subtypes B and F, and the persistent low transmission of subtype C in pregnant of the state of Pará, Brazil.
A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...
Lactic acidosis, risk factors and predictive laboratory markers: a ...
African Journals Online (AJOL)
2013-12-21
Dec 21, 2013 ... due to nucleoside reverse transcriptase inhibitors (NRTIs) ... of Public Health Medicine, School of Nursing and Public Health, University of KwaZulu-Natal, Durban ... Conditional logistic regression modelling was used to.
Diabetes mellitus in HIV-infected patients receiving antiretroviral ...
African Journals Online (AJOL)
Primary analysis using conditional logistic regression was employed to estimate univariate .... Refers to first-line regimen in Botswana – either non-nucleoside reverse transcriptase inhibitor-based regimen (NVP or. EFV) or .... Public Health.
ORIGINAL ARTICLES Symptomatic hyperlactataemia in adults on ...
African Journals Online (AJOL)
2008-09-29
Sep 29, 2008 ... in combination with other antiretroviral drugs in a schedule .... males developed gynaecomastia without other symptoms of ..... nucleoside reverse transcriptase inhibitor (NRTI)-induced lactic acidosis in HIV-infected patients in ...
Zespół nakładania astmy i przewlekłej obturacyjnej choroby płuc
Jadwiga Kroczyńska-Bednarek; Paweł Górski; Iwona Grzelewska-Rzymowska
2011-01-01
Astma i przewlekła obturacyjna choroba płuc (POChP) to zapalne choroby dróg oddechowych, które łączy obecność ograniczenia przepływu powierza przez drogi oddechowe podkreślane w ich definicji. Zapalenie, które leży u podłoża obu chorób, różni się jakościowo rodzajem przeważających komórek i głównych mediatorów zapalnych. Inna jest też na ogół odpowiedź na leki rozszerzające oskrzela w astmie i POChP. Pomimo tych różnic i znaczących odrębności naturalnego przebiegu, rokowania i pat...
International Nuclear Information System (INIS)
Venter, S.
1978-05-01
Slightly hyperstoichiometric (U,Pu)C is a potential nuclear fuel for fast breeder reactors. The excess carbon above the stoichiometric amount results in a higher carbon activity in the fuel, and carbon is transferred to the stainless steel cladding, resulting in embrittlement of the cladding. It is with this problem of carbon transfer from the fuel to the cladding that this thesis is concerned. For practical reasons, UC and not (U,Pu)C was used as the fuel. The theory of decarburisation of carbide fuel and the carburisation of stainless steel, the facilities constructed for the project at the Atomic Energy Board, and the experimental techniques used, including preparation of the fuels, are discussed. The effect of a number of variables of uranium carbide fuel on its compatibility behaviour with stainless steels was investigated, as well as the effect om microstructure and type of stainless steel (304, 304 L and 316) on the rate of carburisation. These studies can be briefly summarised under the following headings: powder-particle size; surface oxidation of uranium carbide; preparation temperature of uranium carbide; low sulfur UCS fuels; uranium sulfide and the microstructure and type of steel. The author concludes that: the effect of surface oxidation and particle size must be taken into account when evaluating out-of-pile tests; the possible effects of surface oxidation must be taken into account when considering vibro-compacted carbide fuels; there is no advantage in replacing a fraction of the carbon atoms by sulphur atoms in slightly hyperstoichiometric carbide fuels, and the type and thermo-mechanical treatment of the stainless steel used as cladding material in a fuel pin is not important as far as the rate of carburisation by the fuel is concerned
Self-reported adverse effects as barriers to adherence to ...
African Journals Online (AJOL)
School of Public Health, University of Limpopo, Medunsa Campus. Correspondence to: Dr .... variables were performed using logistic regression. The findings .... non-reverse transcriptase inhibitors.11 The implication of this finding is that the ...
Directory of Open Access Journals (Sweden)
Andra Nicoli
2016-04-01
Full Text Available UC ANR Cooperative Extension (UCCE conducted six focus groups in 2013 with CalFresh-eligible adults to determine how to improve the existing evaluation method for the Plan, Shop, Save, Cook nutrition education classes. Focus group participants (n = 54 cited many behavior changes that are captured by the existing method. During the focus groups, changes in cooking practices and types of food purchased emerged as two domains that are not currently captured. A small pilot study conducted on 22 of the 54 focus group participants suggests that using a telephone interview to survey participants is a feasible and practical approach to collect follow-up data on long-term behavior changes. More rigorous follow-up studies may guide the development of policies aimed at increasing diet quality and food security of adult CalFresh participants.
THE NASA-UC ETA-EARTH PROGRAM. I. A SUPER-EARTH ORBITING HD 7924
International Nuclear Information System (INIS)
Howard, Andrew W.; Marcy, Geoffrey W.; Johnson, John Asher; Fischer, Debra A.; Giguere, Matthew J.; Isaacson, Howard; Wright, Jason T.; Henry, Gregory W.; Valenti, Jeff A.; Anderson, Jay; Piskunov, Nikolai E.
2009-01-01
We report the discovery of the first low-mass planet to emerge from the NASA-UC Eta-Earth Program, a super-Earth orbiting the K0 dwarf HD 7924. Keplerian modeling of precise Doppler radial velocities reveals a planet with minimum mass M P sin i = 9.26 M + in a P = 5.398 d orbit. Based on Keck-HIRES measurements from 2001 to 2008, the planet is robustly detected with an estimated false alarm probability of less than 0.001. Photometric observations using the Automated Photometric Telescopes at Fairborn Observatory show that HD 7924 is photometrically constant over the radial velocity period to 0.19 mmag, supporting the existence of the planetary companion. No transits were detected down to a photometric limit of ∼0.5 mmag, eliminating transiting planets with a variety of compositions. HD 7924b is one of only eight planets detected by the radial velocity technique with M P sin i + and as such is a member of an emerging family of low-mass planets that together constrain theories of planet formation.
UC Cooperative Extension sensory analysis panel enhances the quality of California olive oil
Directory of Open Access Journals (Sweden)
Paul Vossen
2008-05-01
Full Text Available California's olive oil industry has evolved from primarily a salvage operation of the table olive industry to a producer of world-class, premium, extra-virgin olive oil. In 1997, UC Cooperative Extension started the first California olive oil taste panel, which was officially recognized by the International Olive Council in 2001. Specific protocols were used to screen potential panelists and train them to identify defects and positive characteristics, identical to 43 other world taste panels. The UCCE panel helped the California Olive Oil Council develop a seal certification program using sensory analysis. Certification provides consumers with assurance that labeled oils are free of defects and warrant the "extra virgin" grade. Sensory evaluation using a unique UCCE profile sheet provides complete and detailed information about specific positive flavor characteristics of olive cultivars grown in California. The UCCE sensory panel has also contributed to a better understanding of the qualities of California olive oil and advancement of the industry by participating in research on pest management, cultural practices and processing.
Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells
Directory of Open Access Journals (Sweden)
Yong Teng
2014-02-01
Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.
Who Or What Is Werethekau ‘Great of Magic’? A Problematic Inscription (UC 16639
Directory of Open Access Journals (Sweden)
Ahmed Mekawy Ouda
2013-08-01
Full Text Available In this paper, I investigate the identity of Werethekau through a previously unpublished limestone block at the Petrie Museum (UC 16639. It is not recorded when or where this block was found; the context, a central and identifying feature for the archaeological discipline, is lost (Johnson 1999: 107. The Petrie Museum records do not include the method or date of acquisition. I will focus here on the following questions: What does this object represent? Who is Werethekau? Is it an epithet for a goddess, or a name for a material object, or for a goddess frequently associated with the coronation of the king? The discussion also introduces the approach on which I rely for the identification of the object and its chronology. A further aim in this publication is to bring the object to the attention of a wider readership of scholars of Egyptian archaeology in an attempt to find the missing parts.
Docking mode of delvardine and its analogues into the p66 domain ...
Indian Academy of Sciences (India)
SEARCHU
Delvardine and its structural derivatives are important non-nucleoside HIV-1 reverse transcriptase inhibitors (NNRTIs). .... [PDB ID:1REV] was taken from the Protein Data Bank ... Water molecules were removed and H atoms were added.
International Nuclear Information System (INIS)
Karow, H.U.; Bober, M.
1979-01-01
Fast reactor safety research requires knowledge of emissivity data of nuclear fuel materials up to temperatures of the liquid state. A special integrating sphere laser reflectometer has been used to measure the normal reflectivity and emissivity of UO 2 , UC, ThO 2 , and in addition of Nd 2 O 3 in the solid state (premolten, refrozen material) and in the liquid state up to temperatures of 4000 to 4800 K. The measuring wavelengths have been 0.63 μm and 10.6 μm. The emissivity curves of the oxidic specimens measured at 0.63 μm show the same characteristic course: little temperature dependence below the melting point, distinct increase in the liquid state. In the case of UO 2 the emissivity at the melting point (3120 K) is 0.84, at 4100 K it is 0.92. At 10.6 μm, a decrease has been measured for the liquid state of UO 2 and ThO 2 . UC shows in the solid and in the liquid state only a small temperature dependence with a marked drop, however, at the melting point (2780 K) from 0.54 to 0.45. The measuring results are presented by diagrams and by fit equations related to the true and the black temperature, respectively. (orig./HP) [de
Measurement of the enthalpy and specific heat of a Be2C-graphite-UC2 reactor fuel material to 19800K
International Nuclear Information System (INIS)
Roth, E.P.
1980-01-01
The enthalpy and specific heat of a Be 2 C-graphite-UC 2 composite nuclear fuel material were measured over the temperature range 300 to 1980 0 K using differential scanning calorimetry and liquid argon vaporization calorimetry. The fuel material measured was developed at Sandia National Laboratories for use in pulsed test reactors. The material is a hot-pressed composite consisting of 40 vol % Be 2 C, 49.5 vol % graphite, 3.5 vol % UC 2 and 7.0 vol % void. The specific heat was measured with the differential scanning calorimeter over the temperature range 300 to 950 0 K while the enthalpy was measured over the range 1185 to 1980 0 K with the liquid argon vaporization calorimeter. The normal spectral emittance at a wavelength of 6.5 x 10 -5 cm was measured over the experimental temperature range. The combined experimental enthalpy data were fit using a spline routine and differentiated to give the specific heat. Comparison of the measured specific heat of the composite to the specific heat calculated by summing the contributions of the individual components indicates that the specific heat of the Be 2 C component differs significantly from literature values and is approximately 0.6 cal/g-K (2.5 x 10 3 J/Kg-K) for temperatures above 1000 0 K
Eshleman, Susan H; Laeyendecker, Oliver; Parkin, Neil; Huang, Wei; Chappey, Colombe; Paquet, Agnes C; Serwadda, David; Reynolds, Steven J; Kiwanuka, Noah; Quinn, Thomas C; Gray, Ronald; Wawer, Maria
2009-04-27
To analyze antiretroviral drug susceptibility in HIV from recently infected adults in Rakai, Uganda, prior to the availability of antiretroviral drug treatment. Samples obtained at the time of HIV seroconversion (1998-2003) were analyzed using the GeneSeq HIV and PhenoSense HIV assays (Monogram Biosciences, Inc., South San Francisco, California, USA). Test results were obtained for 104 samples (subtypes: 26A, 1C, 66D, 9A/D, 1C/D, 1 intersubtype recombinant). Mutations used for genotypic surveillance of transmitted antiretroviral drug resistance were identified in six samples: three had nucleoside reverse transcriptase inhibitor (NRTI) surveillance mutations (two had M41L, one had K219R), and three had protease inhibitor surveillance mutations (I47V, F53L, N88D); none had nonnucleoside reverse transcriptase inhibitor (NNRTI) surveillance mutations. Other resistance-associated mutations were identified in some samples. However, none of the samples had a sufficient number of mutations to predict reduced antiretroviral drug susceptibility. Ten (9.6%) of the samples had reduced phenotypic susceptibility to at least one drug (one had partial susceptibility to didanosine, one had nevirapine resistance, and eight had resistance or partial susceptibility to at least one protease inhibitor). Fifty-three (51%) of the samples had hypersusceptibility to at least one drug (seven had zidovudine hypersusceptibility, 28 had NNRTI hypersusceptibility, 34 had protease inhibitor hypersusceptibility). Delavirdine hypersusceptibility was more frequent in subtype A than D. In subtype D, efavirenz hypersusceptibility was associated with substitutions at codon 11 in HIV-reverse transcriptase. Phenotyping detected reduced antiretroviral drug susceptibility and hypersusceptibility in HIV from some antiretroviral-naive Ugandan adults that was not predicted by genotyping. Phenotyping may complement genotyping for analysis of antiretroviral drug susceptibility in populations with nonsubtype B
Lescot, Magali
2015-11-27
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki
2015-01-01
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
... JM, and the Hemophilia Inhibitor Research Study Investigators. Validation of Nijmegen-Bethesda assay modifications to allow inhibitor ... webinars on blood disorders Language: English (US) Español (Spanish) File Formats Help: How do I view different ...
Mucosal healing in ulcerative colitis
DEFF Research Database (Denmark)
Seidelin, Jakob Benedict; Coskun, Mehmet; Nielsen, Ole Haagen
2013-01-01
. With the introduction of the tumor necrosis factor-alpha inhibitors for the treatment of UC, it has become increasingly evident that the disease course is influenced by whether or not the patient achieves mucosal healing. Thus, patients with mucosal healing have fewer flare-ups, a decreased risk of colectomy......, and a lower probability of developing colorectal cancer. Understanding the mechanisms of mucosal wound formation and wound healing in UC, and how they are affected therapeutically is therefore of importance for obtaining efficient treatment strategies holding the potential of changing the disease course of UC....... This review is focused on the pathophysiological mechanism of mucosal wound formation in UC as well as the known mechanisms of intestinal wound healing. Regarding the latter topic, pathways of both wound healing intrinsic to epithelial cells and the wound-healing mechanisms involving interaction between...
Pivonello, Claudia; Rousaki, Panagoula; Negri, Mariarosaria; Sarnataro, Maddalena; Napolitano, Maria; Marino, Federica Zito; Patalano, Roberta; De Martino, Maria Cristina; Sciammarella, Concetta; Faggiano, Antongiulio; Rocco, Gaetano; Franco, Renato; Kaltsas, Gregory A; Colao, Annamaria; Pivonello, Rosario
2017-06-01
Somatostatin analogues and mTOR inhibitors have been used as medical therapy in lung carcinoids with variable results. No data are available on dopamine agonists as treatment for lung carcinoids. The main aim of the current study was to evaluate the effect of the combined treatment of somatostatin analogue octreotide and the dopamine agonist cabergoline with mTOR inhibitors in an in vitro model of typical lung carcinoids: the NCI-H727 cell line. In NCI-H727 cell line, reverse transcriptase-quantitative polymerase chain reaction and immunofluorescence were assessed to characterize the expression of the somatostatin receptor 2 and 5, dopamine receptor 2 and mTOR pathway components. Fifteen typical lung carcinoids tissue samples have been used for somatostatin receptor 2, dopamine receptor 2, and the main mTOR pathway component p70S6K expression and localization by immunohistochemistry. Cell viability, fluorescence-activated cell sorting analysis and western blot have been assessed to test the pharmacological effects of octreotide, cabergoline and mTOR inhibitors, and to evaluate the activation of specific cell signaling pathways in NCI-H727 cell line. NCI-H727 cell line expressed somatostatin receptor 2, somatostatin receptor 5 and dopamine receptor 2 and all mTOR pathway components at messenger and protein levels. Somatostatin receptor 2, dopamine receptor 2, and p70S6K (non phosphorylated and phosphorylated) proteins were expressed in most typical lung carcinoids tissue samples. Octreotide and cabergoline did not reduce cell viability as single agents but, when combined with mTOR inhibitors, they potentiate mTOR inhibitors effect after long-term exposure, reducing Akt and ERK phosphorylation, mTOR escape mechanisms, and increasing the expression DNA-damage-inducible transcript 4, an mTOR suppressor. In conclusion, the single use of octreotide and cabergoline is not sufficient to block cell viability but the combined approach of these agents with mTOR inhibitors
A study on expression levels of matrix metalloproteinases and their ...
African Journals Online (AJOL)
Keywords: Ulcerative colitis, Matrix metalloproteinases, Tissue inhibitors of metalloproteinases, Lamina propria ... The symptoms of UC include diarrhea with blood, fever ..... Eisen A, Jeffrey J, Gross J. Human skin collagenase. Isolation and ...
Directory of Open Access Journals (Sweden)
Atsuko Hachiya
2011-01-01
Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.
A. Phillips (Andrew); V. Cambiano (Valentina); F. Nakagawa (Fumiyo); P. Revill (Paul); M.R. Jordan (Michael); T.B. Hallett (Timothy); M.C. Doherty (Meg); A. de Luca (Andrea); Lundgren, J.D. (Jens D.); Mhangara, M. (Mutsa); Apollo, T. (Tsitsi); J.W. Mellors (John W.); B.E. Nichols (Brooke); Parikh, U. (Urvi); D. Pillay (Deenan); T.F. Rinke de Wit (Tobias); K.C. Sigaloff (Kim); Havlir, D. (Diane); D.R. Kuritzkes (Daniel); A. Pozniak (Anton); D.A.M.C. van de Vijver (David); M. Vitoria (Marco); Wainberg, M.A. (Mark A.); E. Raizes (Elliot); S. Bertagnolio (Silvia)
2017-01-01
textabstractBackground: There is concern over increasing prevalence of non-nucleoside reverse-transcriptase inhibitor (NNRTI) resistance in people initiating antiretroviral therapy (ART) in low-income and middle-income countries. We assessed the effectiveness and cost-effectiveness of alternative
Bienczak, A.; Denti, P.; Cook, A.; Wiesner, L.; Mulenga, V.; Kityo, C.; Kekitiinwa, A.; Gibb, D.M.; Burger, D.M.; Walker, A.S.; McIlleron, H.
2017-01-01
BACKGROUND: Nevirapine is the only nonnucleoside reverse transcriptase inhibitor currently available as a paediatric fixed-dose-combination tablet and is widely used in African children. Nonetheless, the number of investigations into pharmacokinetic determinants of virological suppression in African
Collaboration, H.-C.; Koopmans †, P.P.; Brouwer, A.M.; Dofferhoff, A.S.M.; Flier, M. van der; Groot, R. de; Hofstede, H.J.M. ter; Keuter, M.; Ven, A.J.A.M. van der; et al.,
2012-01-01
OBJECTIVE: To compare regimens consisting of either efavirenz or nevirapine and two or more nucleoside reverse transcriptase inhibitors (NRTIs) among HIV-infected, antiretroviral-naive, and AIDS-free individuals with respect to clinical, immunologic, and virologic outcomes. DESIGN: Prospective
Energy Technology Data Exchange (ETDEWEB)
Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)
2010-03-26
The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.
DEFF Research Database (Denmark)
Bannister, Wendy P; Ruiz, Lidia; Cozzi-Lepri, Alessandro
2008-01-01
OBJECTIVE: To compare virological outcome and genotypic resistance profiles in HIV-1-infected patients starting non-nucleoside reverse transcriptase inhibitor (NNRTI)-containing regimens. METHODS: NNRTI-naive patients were included who started treatment with nevirapine (NVP) or efavirenz (EFV) wi...
Szeto, Matthew Chak Hin; Yalçın, Metin Devrim; Khan, Abdul; Piotrowicz, Andrzej
2016-01-01
Tocilizumab is an interleukin-6 receptor inhibitor licensed for moderate to severe rheumatoid arthritis (RA). We report a case of Tocilizumab monotherapy for severe active RA in a patient with coexisting ulcerative colitis (UC). The patient was intolerant to multiple disease-modifying drugs, so Tocilizumab monotherapy was commenced. We found clinical improvement in both RA and UC. There was no major adverse event after 2 years. Manufacturer advised caution in using Tocilizumab in patient with gastrointestinal ulceration due to an increased risk of bowel perforation. However, alternative treatments such as glucocorticoid and nonsteroidal anti-inflammatory drugs may carry a higher bowel perforation risk. The presence of gastrointestinal ulceration therefore should not constitute an absolute contraindication for Tocilizumab therapy. Future studies of registry data will inform clinician of the Tocilizumab-related risk of gastrointestinal toxicity in "real-life" settings. Contrary to previous case report, we found Tocilizumab therapy to have a positive effect on UC. Laboratory studies supported a role for interleukin-6 in the pathophysiology of UC. Further clinical trial to evaluate the therapeutic role of Tocilizumab in UC would be warranted.
Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.
Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V
2011-12-20
Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.
Pagano, Nicholas; Teriete, Peter; Mattmann, Margrith E; Yang, Li; Snyder, Beth A; Cai, Zhaohui; Heil, Marintha L; Cosford, Nicholas D P
2017-12-01
Continuous flow (microfluidic) chemistry was employed to prepare a small focused library of dihydropyrimidinone (DHPM) derivatives. Compounds in this class have been reported to exhibit activity against the human immunodeficiency virus (HIV), but their molecular target had not been identified. We tested the initial set of DHPMs in phenotypic assays providing a hit (1i) that inhibited the replication of the human immunodeficiency virus HIV in cells. Flow chemistry-driven optimization of 1i led to the identification of HIV replication inhibitors such as 1l with cellular potency comparable with the clinical drug nevirapine (NVP). Mechanism of action (MOA) studies using cellular and biochemical assays coupled with 3D fingerprinting and in silico modeling demonstrated that these drug-like probe compounds exert their effects by inhibiting the viral reverse transcriptase polymerase (RT). This led to the design and synthesis of the novel DHPM 1at that inhibits the replication of drug resistant strains of HIV. Our work demonstrates that combining flow chemistry-driven analogue refinement with phenotypic assays, in silico modeling and MOA studies is a highly effective strategy for hit-to-lead optimization applicable to the discovery of future therapeutic agents. Copyright © 2017. Published by Elsevier Ltd.
Civini, Sara; Pacelli, Consiglia; Dieng, Mame Massar; Lemieux, William; Jin, Ping; Bazin, Renée; Patey, Natacha; Marincola, Francesco M.; Moldovan, Florina; Zaouter, Charlotte; Trudeau, Louis-Eric; Benabdhalla, Basma; Louis, Isabelle; Beauséjour, Christian; Stroncek, David; Le Deist, Françoise; Haddad, Elie
2016-01-01
Human mesenchymal stromal cells (MSC) have been shown to dampen immune response and promote tissue repair, but the underlying mechanisms are still under investigation. Herein, we demonstrate that umbilical cord-derived MSC (UC-MSC) alter the phenotype and function of monocyte-derived dendritic cells (DC) through lactate-mediated metabolic reprogramming. UC-MSC can secrete large quantities of lactate and, when present during monocyte-to-DC differentiation, induce instead the acquisition of M2-macrophage features in terms of morphology, surface markers, migratory properties and antigen presentation capacity. Microarray expression profiling indicates that UC-MSC modify the expression of metabolic-related genes and induce a M2-macrophage expression signature. Importantly, monocyte-derived DC obtained in presence of UC-MSC, polarize naïve allogeneic CD4+ T-cells into Th2 cells. Treatment of UC-MSC with an inhibitor of lactate dehydrogenase strongly decreases lactate concentration in culture supernatant and abrogates the effect on monocyte-to-DC differentiation. Metabolic analysis further revealed that UC-MSC decrease oxidative phosphorylation in differentiating monocytes while strongly increasing the spare respiratory capacity proportional to the amount of secreted lactate. Because both MSC and monocytes are recruited in vivo at the site of tissue damage and inflammation, we propose the local increase of lactate concentration induced by UC-MSC and the consequent enrichment in M2-macrophage generation as a mechanism to achieve immunomodulation. PMID:27070086
Directory of Open Access Journals (Sweden)
Xuzhu Lin
2017-11-01
Full Text Available Emerging evidence suggests that undercarboxylated osteocalcin (ucOC improves muscle glucose uptake in rodents. However, whether ucOC can directly increase glucose uptake in both glycolytic and oxidative muscles and the possible mechanisms of action still need further exploration. We tested the hypothesis that ucOC per se stimulates muscle glucose uptake via extracellular signal-regulated kinase (ERK, adenosine monophosphate-activated protein kinase (AMPK, and/or the mechanistic target of rapamycin complex 2 (mTORC2-protein kinase B (AKT-AKT substrate of 160 kDa (AS160 signaling cascade. Extensor digitorum longus (EDL and soleus muscles from male C57BL/6 mice were isolated, divided into halves, and then incubated with ucOC with or without the pretreatment of ERK inhibitor U0126. ucOC increased muscle glucose uptake in both EDL and soleus. It also enhanced phosphorylation of ERK2 (Thr202/Tyr204 and AS160 (Thr642 in both muscle types and increased mTOR phosphorylation (Ser2481 in EDL only. ucOC had no significant effect on the phosphorylation of AMPKα (Thr172. The inhibition of ucOC-induced ERK phosphorylation had limited effect on ucOC-stimulated glucose uptake and AS160 phosphorylation in both muscle types, but appeared to inhibit the elevation in AKT phosphorylation only in EDL. Taken together, ucOC at the physiological range directly increased glucose uptake in both EDL and soleus muscles in mouse. The molecular mechanisms behind this ucOC effect on muscle glucose uptake seem to be muscle type-specific, involving enhanced phosphorylation of AS160 but limitedly modulated by ERK phosphorylation. Our study suggests that, since ucOC increases muscle glucose uptake without insulin, it could be considered as a potential agent to improve muscle glucose uptake in insulin resistant conditions.
Directory of Open Access Journals (Sweden)
Naoto Terami
Full Text Available Inhibition of sodium glucose cotransporter 2 (SGLT2 has been reported as a new therapeutic strategy for treating diabetes. However, the effect of SGLT2 inhibitors on the kidney is unknown. In addition, whether SGLT2 inhibitors have an anti-inflammatory or antioxidative stress effect is still unclear. In this study, to resolve these issues, we evaluated the effects of the SGLT2 inhibitor, dapagliflozin, using a mouse model of type 2 diabetes and cultured proximal tubular epithelial (mProx24 cells. Male db/db mice were administered 0.1 or 1.0 mg/kg of dapagliflozin for 12 weeks. Body weight, blood pressure, blood glucose, hemoglobin A1c, albuminuria and creatinine clearance were measured. Mesangial matrix accumulation and interstitial fibrosis in the kidney and pancreatic β-cell mass were evaluated by histological analysis. Furthermore, gene expression of inflammatory mediators, such as osteopontin, monocyte chemoattractant protein-1 and transforming growth factor-β, was evaluated by quantitative reverse transcriptase-PCR. In addition, oxidative stress was evaluated by dihydroethidium and NADPH oxidase 4 staining. Administration of 0.1 or 1.0 mg/kg of dapagliflozin ameliorated hyperglycemia, β-cell damage and albuminuria in db/db mice. Serum creatinine, creatinine clearance and blood pressure were not affected by administration of dapagliflozin, but glomerular mesangial expansion and interstitial fibrosis were suppressed in a dose-dependent manner. Dapagliflozin treatment markedly decreased macrophage infiltration and the gene expression of inflammation and oxidative stress in the kidney of db/db mice. Moreover, dapagliflozin suppressed the high-glucose-induced gene expression of inflammatory cytokines and oxidative stress in cultured mProx24 cells. These data suggest that dapagliflozin ameliorates diabetic nephropathy by improving hyperglycemia along with inhibiting inflammation and oxidative stress.
Gupta, Ravindra K.; Gregson, John; Parkin, Neil; Haile-Selassie, Hiwot; Tanuri, Amilcar; Andrade Forero, Liliana; Kaleebu, Pontiano; Watera, Christine; Aghokeng, Avelin; Mutenda, Nicholus; Dzangare, Janet; Hone, San; Hang, Zaw Zaw; Garcia, Judith; Garcia, Zully; Marchorro, Paola; Beteta, Enrique; Giron, Amalia; Hamers, Raph; Inzaule, Seth; Frenkel, Lisa M.; Chung, Michael H.; de Oliveira, Tulio; Pillay, Deenan; Naidoo, Kogie; Kharsany, Ayesha; Kugathasan, Ruthiran; Cutino, Teresa; Hunt, Gillian; Avila Rios, Santiago; Doherty, Meg; Jordan, Michael R.; Bertagnolio, Silvia
2018-01-01
Pretreatment drug resistance in people initiating or re-initiating antiretroviral therapy (ART) containing non-nucleoside reverse transcriptase inhibitors (NNRTIs) might compromise HIV control in low-income and middle-income countries (LMICs). We aimed to assess the scale of this problem and whether
Energy Technology Data Exchange (ETDEWEB)
Buschinelli, A. J.A.
1974-06-01
This work is a contribution to the study of the mechanism and of the kinetics of the U$_2$C$_3$ formation by the synthetic reaction. The influences of a mechanical and a thermical pre-treatment of the samples on the reaction kinetics were investigated and discussed taking into account other information from the literature. The relative increasing of the U$_2$C$_3$ nucleation rate due to the pulverization corresponds approximately to the surface enlargement of the pulverized material. The activation energy for the synthetic reaction in powder was found to be 94 +- 7 kcal/mol. The negative influence of nitrogen, oxygen and tungsten on the U$_2$C$_3$ formation was reported. In the decomposition of UC$_2$ to U$_2$C$_3$ and graphite, the influences of the morphology of the graphite precipitate and the fast neutron irradiation on the beginning of the U$_2$C$_3$ formation were also investigated.
2016-01-01
In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The objective of ART is to achieve an undetectable plasma viral load (PVL). Initial ART should comprise 3 drugs, namely, 2 nucleoside reverse transcriptase inhibitors (NRTI), and 1 drug from another family. Four of the recommended regimens, all of which have an integrase strand transfer inhibitor (INSTI) as the third drug, are considered a preferred regimen; a further 6 regimens, which are based on an INSTI, a non-nucleoside reverse transcriptase inhibitor (NNRTI), or a protease inhibitor boosted with cobicistat or ritonavir (PI/COBI, PI/r), are considered alternatives. The reasons and criteria for switching ART are presented both for patients with an undetectable PVL and for patients who experience virological failure, in which case the rescue regimen should include 3 (or at least 2) drugs that are fully active against HIV. The specific criteria for ART in special situations (acute infection, HIV-2 infection, pregnancy) and comorbid conditions (tuberculosis and other opportunistic infections, kidney disease, liver disease, and cancer) are updated. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
High Levels of Transmitted HIV Drug Resistance in a Study in Papua New Guinea.
Lavu, Evelyn; Kave, Ellan; Mosoro, Euodia; Markby, Jessica; Aleksic, Eman; Gare, Janet; Elsum, Imogen A; Nano, Gideon; Kaima, Petronia; Dala, Nick; Gurung, Anup; Bertagnolio, Silvia; Crowe, Suzanne M; Myatt, Mark; Hearps, Anna C; Jordan, Michael R
2017-01-01
Papua New Guinea is a Pacific Island nation of 7.3 million people with an estimated HIV prevalence of 0.8%. ART initiation and monitoring are guided by clinical staging and CD4 cell counts, when available. Little is known about levels of transmitted HIV drug resistance in recently infected individuals in Papua New Guinea. Surveillance of transmitted HIV drug resistance in a total of 123 individuals recently infected with HIV and aged less than 30 years was implemented in Port Moresby (n = 62) and Mount Hagen (n = 61) during the period May 2013-April 2014. HIV drug resistance testing was performed using dried blood spots. Transmitted HIV drug resistance was defined by the presence of one or more drug resistance mutations as defined by the World Health Organization surveillance drug resistance mutations list. The prevalence of non-nucleoside reverse transcriptase inhibitor transmitted HIV drug resistance was 16.1% (95% CI 8.8%-27.4%) and 8.2% (95% CI 3.2%-18.2%) in Port Moresby and Mount Hagen, respectively. The prevalence of nucleoside reverse transcriptase inhibitor transmitted HIV drug resistance was 3.2% (95% CI 0.2%-11.7%) and 3.3% (95% CI 0.2%-11.8%) in Port Moresby and Mount Hagen, respectively. No protease inhibitor transmitted HIV drug resistance was observed. The level of non-nucleoside reverse transcriptase inhibitor drug resistance in antiretroviral drug naïve individuals recently infected with HIV in Port Moresby is amongst the highest reported globally. This alarming level of transmitted HIV drug resistance in a young sexually active population threatens to limit the on-going effective use of NNRTIs as a component of first-line ART in Papua New Guinea. To support the choice of nationally recommended first-line antiretroviral therapy, representative surveillance of HIV drug resistance among antiretroviral therapy initiators in Papua New Guinea should be urgently implemented.
International Nuclear Information System (INIS)
Zhao Qian; Ma Liying; Jiang Shibo; Lu Hong; Liu Shuwen; He Yuxian; Strick, Nathan; Neamati, Nouri; Debnath, Asim Kumar
2005-01-01
We have identified two N-phenyl-N'-(2,2,6,6-tetramethyl-piperidin-4-yl)-oxalamide analogs as a novel class of human immunodeficiency virus type 1 (HIV-1) entry inhibitors that block the gp120-CD4 interaction, using database screening techniques. The lead compounds, NBD-556 and NBD-557, are small molecule organic compounds with drug-like properties. These compounds showed potent cell fusion and virus-cell fusion inhibitory activity at low micromolar levels. A systematic study showed that these compounds target viral entry by inhibiting the binding of HIV-1 envelope glycoprotein gp120 to the cellular receptor CD4 but did not inhibit reverse transcriptase, integrase, or protease, indicating that they do not target the later stages of the HIV-1 life cycle to inhibit HIV-1 infection. These compounds were equally potent inhibitors of both X4 and R5 viruses tested in CXCR4 and CCR5 expressing cell lines, respectively, indicating that their anti-HIV-1 activity is not dependent on the coreceptor tropism of the virus. A surface plasmon resonance study, which measures binding affinity, clearly demonstrated that these compounds bind to unliganded HIV-1 gp120 but not to the cellular receptor CD4. NBD-556 and NBD-557 were active against HIV-1 laboratory-adapted strains including an AZT-resistant strain and HIV-1 primary isolates, indicating that these compounds can potentially be further modified to become potent HIV-1 entry inhibitors
Pruden, Amy; Suidan, Makram
2004-08-01
The effect of a BTEX mixture on the biodegradation of methyl tert-butyl ether (MTBE) and its degradation intermediate, tert-butyl alcohol (TBA) was investigated in the pure bacterial culture UC1, which has been identified to be a strain of the known MTBE-degrader PM1 based on greater than 99% 16S rDNA similarity. Several degradation studies were carried out on UC1 at three initial concentration levels of MTBE or TBA: 6-7; 15-17; and 40-45 mg/l, both with and without BTEX present cumulatively at about half of the MTBE or TBA molar mass in the system. The BTEX mixture was observed not to affect either the rate or the degradation lag period of MTBE or TBA degradation, except that the TBA degradation rate actually increased when BTEX was present initially in the highest concentration studies. When serving as the sole substrate, the MTBE degradation rate ranged from 48 +/- 1.2 to 200 +/- 7.0 mg(MTBE)/g(dw) h, and the TBA degradation rate from 140 +/- 18 to 530 +/- 70 mg(TBA)/g(dw) h. When present with BTEX, MTBE and TBA rates ranged from 46 +/- 2.2 to 210 +/- 14 and 170 +/- 28 to 780 +/- 43 mg(TBA)/g(dw) h, respectively. In studies where varying concentrations of TBA were present with 5 mg/l MTBE, both compounds were degraded simultaneously with no obvious preference for either substrate. In the highest concentration study of TBA with 5 mg/l MTBE, BTEX was also observed to increase the ultimate rate of TBA degradation. In addition to exploring the affect of BTEX, this study also provides general insight into the metabolism of MTBE and TBA by pure culture UC1.
Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc
2011-07-01
Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.
Raffi, François; Babiker, Abdel G.; Richert, Laura; Molina, Jean-Michel; George, Elizabeth C.; Antinori, Andrea; Arribas, Jose R.; Grarup, Jesper; Hudson, Fleur; Schwimmer, Christine; Saillard, Juliette; Wallet, Cédrick; Jansson, Per O.; Allavena, Clotilde; van Leeuwen, Remko; Delfraissy, Jean-François; Vella, Stefano; Chêne, Geneviève; Pozniak, Anton; Dedes, Nikos; Autran, Brigitte; Bucciardini, Raffaella; Horban, Andrzej; Arribas, José; Boffito, Marta; Pillay, Deenan; Franquet, Xavier; Schwarze, Siegfried; Fischer, Aurélie; Diallo, Alpha; Moecklinghoff, Christiane; Stellbrink, Hans-Jürgen; Gatell, José; Sandström, Eric; Flepp, Markus; Ewings, Fiona; Pearce, Gillian; Quercia, Romina; Rogatto, Felipe; Leavitt, Randi; Nguyen, Bach-Yen; Goebel, Frank; Marcotullio, Simone; Kaur, Navrup; Sasieni, Peter; Spencer-Drake, Christina; Peto, Tim; Miller, Veronica; Arnault, Fabien; Boucherie, Céline; Jean, Delphine; Paniego, Virginie; Paraina, Felasoa; Rouch, Elodie; Soussi, Malika; Taieb, Audrey; Touzeau, Guillaume; Cursley, Adam; Dodds, Wendy; Hoppe, Anne; Kummeling, Ischa; Pacciarini, Filippo; Paton, Nick; Russell, Charlotte; Taylor, Kay; Ward, Denise; Aagaard, Bitten; Eid, Marius; Gey, Daniela; Jensen, Birgitte Gram; Jakobsen, Marie-Louise; Jensen, Karoline; Joensen, Zillah Maria; Larsen, Ellen Moseholm; Pahl, Christiane; Pearson, Mary; Nielsen, Birgit Riis; Reilev, Søren Stentoft; Christ, Ilse; Lathouwers, Desiree; Manting, Corry; Mendy, Bienvenu Yves; Metro, Annie; Couffin-Cadiergues, Sandrine; Knellwolf, Anne-Laure; Palmisano, Lucia; Aznar, Esther; Barea, Cristina; Cotarelo, Manuel; Esteban, Herminia; Girbau, Iciar; Moyano, Beatriz; Ramirez, Miriam; Saiz, Carmen; Sanchez, Isabel; Yllescas, Maria; Binelli, Andrea; Colasanti, Valentina; Massella, Maurizio; Anagnostou, Olga; Gioukari, Vicky; Touloumi, Giota; Schmied, Brigitte; Rieger, Armin; Vetter, Norbert; de Wit, Stephane; Florence, Eric; Vandekerckhove, Linos; Gerstoft, Jan; Mathiesen, Lars; Katlama, Christine; Cabie, André; Cheret, Antoine; Dupon, Michel; Ghosn, Jade; Girard, Pierre-Marie; Goujard, Cécile; Lévy, Yves; Morlat, Philippe; Neau, Didier; Obadia, Martine; Perre, Philippe; Piroth, Lionel; Reynes, Jacques; Tattevin, Pierre; Raffi, Francois; Ragnaud, Jean Marie; Weiss, Laurence; Yazdanpanah, Yazdan; Yeni, Patrick; Zucman, David; Behrens, Georg; Esser, Stefan; Fätkenheuer, Gerd; Hoffmann, Christian; Jessen, Heiko; Rockstroh, Jürgen; Schmidt, Reinhold; Stephan, Christoph; Unger, Stefan; Hatzakis, Angelos; Daikos, George L.; Papadopoulos, Antonios; Skoutelis, Athamasios; Banhegyi, Denes; Mallon, Paddy; Mulcahy, Fiona; Andreoni, Massimo; Bonora, Stefano; Castelli, Francesco; Monforte, Antonella D.'Arminio; Galli, Massimo; Lazzarin, Adriano; Mazzotta, Francesco; Vullo, Vincenzo; Prins, Jan; Richter, Clemens; Verhagen, Dominique; Eeden, Van; Doroana, Manuela; Antunes, Francisco; Maltez, Fernando; Sarmento-Castro, Rui; Gonzalez Garcia, Juan; López Aldeguer, José; Clotet, Bonaventura; Domingo, Pere; Gatell, Jose M.; Knobel, Hernando; Marquez, Manuel; Pilar Miralles, Martin; Portilla, Joaquin; Soriano, Vicente; Tellez, Maria-Jesus; Thalme, Anders; Blaxhult, Anders; Gisslen, Magnus; Winston, Alan; Fox, Julie; Gompels, Mark; Herieka, Elbushra; Johnson, Margaret; Leen, Clifford; Teague, Alastair; Williams, Ian; Boyd, Mark Alastair; Møller, Nina Friis; Larsen, Ellen Frøsig Moseholm; Le Moing, Vincent; Wit, Ferdinand W. N. M.; Kowalska, Justyna; Berenguer, Juan; Moreno, Santiago; Müller, Nicolas J.; Török, Estée; Post, Frank; Angus, Brian; Boucher, Charles; Calvez, Vincent; Collins, Simon; Dunn, David; Fox, Zoe; Perno, Carlo Federico; Ammassari, Adriana; Stoehr, Wolgang; Schmidt, Reinhold Ernst; Odermarsky, Michal; Smith, Colette; Thiébaut, Rodolphe; Arribas, Jose; de La Serna, Jose Ignacio Bernardino; Castagna, Antonella; Furrer, Hans-Jackob; Mocroft, Amanda; Reiss, Peter; Fragola, Vincenzo; Lauriola, Marco; Murri, Rita; Nieuwkerk, Pythia; Spire, Bruno; Volny-Anne, Alain; West, Brian; Amieva, Hélène; Llibre Codina, Josep Maria
2014-01-01
Standard first-line antiretroviral therapy for HIV-1 infection includes two nucleoside or nucleotide reverse transcriptase inhibitors (NtRTIs), but these drugs have limitations. We assessed the 96 week efficacy and safety of an NtRTI-sparing regimen. Between August, 2010, and September, 2011, we
Efficacy and durability of nevirapine in antiretroviral drug naive patients
Lange, Joep M. A.
2003-01-01
Nevirapine is a non-nucleoside reverse transcriptase inhibitor (NNRTI) that was first reported in the scientific literature in 1990. Varying doses of nevirapine (NVP) and a number of regimens containing this NNRTI have been studied in antiretroviral (ARV) naive patients. Four key studies have
Bernardino, Jose I.; Mocroft, Amanda; Mallon, Patrick W.; Wallet, Cedrick; Gerstoft, Jan; Russell, Charlotte; Reiss, Peter; Katlama, Christine; de Wit, Stephane; Richert, Laura; Babiker, Abdel; Buño, Antonio; Castagna, Antonella; Girard, Pierre-Marie; Chene, Genevieve; Raffi, Francois; Arribas, Jose R.; Dedes, Nikos; Allavena, Clotilde; Autran, Brigitte; Antinori, Andrea; Bucciardini, Raffaella; Vella, Stefano; Horban, Andrzej; Arribas, Jose; Babiker, Abdel G.; Boffito, Marta; Pillay, Deenan; Pozniak, Anton; Franquet, Xavier; Schwarze, Siegfried; Grarup, Jesper; Fischer, Aurelie; Diallo, Alpha; Molina, Jean-Michel; Saillard, Juliette; Moecklinghoff, Christiane; Stellbrink, Hans-Jurgen; van Leeuwen, Remko; Gatell, Jose; Sandstrom, Eric; Flepp, Markus; Ewings, Fiona; George, Elizabeth C.; Hudson, Fleur; Pearce, Gillian; Quercia, Romina; Prins, Jan; Wit, Ferdinand W. N. M.; Nieuwkerk, Pythia
2015-01-01
Osteopenia, osteoporosis, and low bone mineral density are frequent in patients with HIV. We assessed the 96 week loss of bone mineral density associated with a nucleoside or nucleotide reverse transcriptase inhibitor (NtRTI)-sparing regimen. Antiretroviral-naive adults with HIV were enrolled in 78
DEFF Research Database (Denmark)
Nelson, Mark; Amaya, Gerardo; Clumeck, Nathan
2012-01-01
OBJECTIVES: The efficacy and hepatic safety of the non-nucleoside reverse transcriptase inhibitors rilpivirine (TMC278) and efavirenz were compared in treatment-naive, HIV-infected adults with concurrent hepatitis B virus (HBV) and/or hepatitis C virus (HCV) infection in the pooled week 48 analys...
Energy Technology Data Exchange (ETDEWEB)
Barth, F.; Von der Decken, C. B.; Schifferstein, K. [Brown Boveri/Krupp Reaktorbau G.M.B.H., Duesseldorf (Germany); Clauss, A.; Reichel, H.; Rygaert, J.; Ruston, W. R. [Societe d' Etudes de Recherches et d' Applications pour l' Industrie (S.E.R.A.I.), Brussels (Belgium)
1963-11-15
The release of fission products from pellets of the approximate composition UC + 20 ZrC has been investigated in a loop during irradiation. The purpose was to check the possibility to use these pellets as inserts for the spherical fuel elements of the high temperature reactor presently being built at Juelich by Brown-Boveri/Krupp Reaktorbau G.m.b.H. The tests were carried out on free pellets and on pellets enclosed in graphite capsules. Some pellets had a 1- to 2-mm thick border zone consisting of pure zirconium carbide. The samples were placed in electric resistance furnaces reaching a maximum temperature of 1600{sup o}C. The neutron fluxes during the irradiation were 3 to 4 x 10{sup 10} n/cm{sup 2}s. The loop permitted the measurement of the release of the rare gas isotopes Kr{sup 85m}, Kr{sup 87}, Kr{sup 88}, Xe{sup 133} and Xe{sup 135} during irradiation and the indirect determination of I{sup 133} and I{sup 135} after shut-down of the reactor. The minimum release of I{sup 131}, Sr{sup 89}, Ba{sup 140} and Ce{sup 141} was radiochemically determined after withdrawal of the specimen. It was also possible to measure the recoil fraction {epsilon}{sub R} alone when the fuel insert was suspended within a furnace of larger diameter. The measured values of {epsilon}{sub R} were only slightly higher than the calculated ones. At higher sample temperatures the diffusion fraction {epsilon}{sub D} could be calculated by subtraction of the recoil fraction from the total release. From {epsilon}{sub D} it was possible to calculate D/r{sub 0}{sup 2}s{sup -1} using the approximation equations of Fliigge and Zimens where D = diffusion constant and r{sub 0} = mathematically defined mean particle radius. The logarithmic plot of these values against 1/T yielded the activation energies (T = sample temperature in {sup o}K). The activation energies for the diffusion of krypton and xenon did not show significant differences. There were likewise no big differences in the activation
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-01-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Directory of Open Access Journals (Sweden)
Matthew Chak Hin Szeto
2016-01-01
Full Text Available Tocilizumab is an interleukin-6 receptor inhibitor licensed for moderate to severe rheumatoid arthritis (RA. We report a case of Tocilizumab monotherapy for severe active RA in a patient with coexisting ulcerative colitis (UC. The patient was intolerant to multiple disease-modifying drugs, so Tocilizumab monotherapy was commenced. We found clinical improvement in both RA and UC. There was no major adverse event after 2 years. Manufacturer advised caution in using Tocilizumab in patient with gastrointestinal ulceration due to an increased risk of bowel perforation. However, alternative treatments such as glucocorticoid and nonsteroidal anti-inflammatory drugs may carry a higher bowel perforation risk. The presence of gastrointestinal ulceration therefore should not constitute an absolute contraindication for Tocilizumab therapy. Future studies of registry data will inform clinician of the Tocilizumab-related risk of gastrointestinal toxicity in “real-life” settings. Contrary to previous case report, we found Tocilizumab therapy to have a positive effect on UC. Laboratory studies supported a role for interleukin-6 in the pathophysiology of UC. Further clinical trial to evaluate the therapeutic role of Tocilizumab in UC would be warranted.
Polytarchou, Christos; Hommes, Daniel W; Palumbo, Tiziana; Hatziapostolou, Maria; Koutsioumpa, Marina; Koukos, Georgios; van der Meulen-de Jong, Andrea E; Oikonomopoulos, Angelos; van Deen, Welmoed K; Vorvis, Christina; Serebrennikova, Oksana B; Birli, Eleni; Choi, Jennifer; Chang, Lin; Anton, Peter A; Tsichlis, Philip N; Pothoulakis, Charalabos; Verspaget, Hein W; Iliopoulos, Dimitrios
2015-10-01
Persistent activation of the inflammatory response contributes to the development of inflammatory bowel diseases, which increase the risk of colorectal cancer. We aimed to identify microRNAs that regulate inflammation during the development of ulcerative colitis (UC) and progression to colitis-associated colon cancer (CAC). We performed a quantitative polymerase chain reaction analysis to measure microRNAs in 401 colon specimens from patients with UC, Crohn's disease, irritable bowel syndrome, sporadic colorectal cancer, or CAC, as well as subjects without these disorders (controls); levels were correlated with clinical features and disease activity of patients. Colitis was induced in mice by administration of dextran sodium sulfate (DSS), and carcinogenesis was induced by addition of azoxymethane; some mice also were given an inhibitor of microRNA214 (miR214). A high-throughput functional screen of the human microRNAome found that miR214 regulated the activity of nuclear factor-κB. Higher levels of miR214 were detected in colon tissues from patients with active UC or CAC than from patients with other disorders or controls and correlated with disease progression. Bioinformatic and genome-wide profile analyses showed that miR214 activates an inflammatory response and is amplified through a feedback loop circuit mediated by phosphatase and tensin homolog (PTEN) and PDZ and LIM domain 2 (PDLIM2). Interleukin-6 induced signal transducer and activator of transcription 3 (STAT3)-mediated transcription of miR214. A miR214 chemical inhibitor blocked this circuit and reduced the severity of DSS-induced colitis in mice, as well as the number and size of tumors that formed in mice given azoxymethane and DSS. In fresh colonic biopsy specimens from patients with active UC, the miR214 inhibitor reduced inflammation by increasing levels of PDLIM2 and PTEN. Interleukin-6 up-regulates STAT3-mediated transcription of miR214 in colon tissues, which reduces levels of PDLIM2 and PTEN
Discovery of natural mouse serum derived HIV-1 entry inhibitor(s).
Wei, M; Chen, Y; Xi, J; Ru, S; Ji, M; Zhang, D; Fang, Q; Tang, B
Among rationally designed human immunodeficiency virus 1 (HIV-1) inhibitors, diverse natural factors have showed as potent anti-HIV activity in human blood. We have discovered that the boiled supernatant of healthy mouse serum could suppress HIV-1 entry, and exhibited reduced inhibitory activity after trypsin digestion. Further analysis demonstrated that only the fraction containing 10-25 K proteins could inhibit HIV-1 mediated cell-cell fusion. These results suggest that the 10-25 K protein(s) is novel natural HIV-1 entry inhibitor(s). Our findings provide important information about novel natural HIV entry inhibitors in mouse serum.
Adipocytes Impair Efficacy of Antiretroviral Therapy
Couturier, Jacob; Winchester, Lee C.; Suliburk, James W.; Wilkerson, Gregory K.; Podany, Anthony T.; Agarwal, Neeti; Chua, Corrine Ying Xuan; Nehete, Pramod N.; Nehete, Bharti P.; Grattoni, Alessandro; Sastry, K. Jagannadha; Fletcher, Courtney V.; Lake, Jordan E.; Balasubramanyan, Ashok; Lewis, Dorothy E.
2018-01-01
Adequate distribution of antiretroviral drugs to infected cells in HIV patients is critical for viral suppression. In humans and primates, HIV- and SIV-infected CD4 T cells in adipose tissues have recently been identified as reservoirs for infectious virus. To better characterize adipose tissue as a pharmacological sanctuary for HIV-infected cells, in vitro experiments were conducted to assess antiretroviral drug efficacy in the presence of adipocytes, and drug penetration in adipose tissue cells (stromal-vascular-fraction cells and mature adipocytes) was examined in treated humans and monkeys. Co-culture experiments between HIV-1-infected CD4 T cells and primary human adipocytes showed that adipocytes consistently reduced the antiviral efficacy of the nucleotide reverse transcriptase inhibitor tenofovir and its prodrug forms tenofovir disoproxil fumarate (TDF) and tenofovir alafenamide (TAF). In HIV-infected persons, LC-MS/MS analysis of intracellular lysates derived from adipose tissue stromal-vascular-fraction cells or mature adipocytes suggested that integrase inhibitors penetrate adipose tissue, whereas penetration of nucleoside/nucleotide reverse transcriptase inhibitors such as TDF, emtricitabine, abacavir, and lamivudine is restricted. The limited distribution and functions of key antiretroviral drugs within fat depots may contribute to viral persistence in adipose tissue. PMID:29630975
Rethinking the risk-benefit ratio of efavirenz in HIV-infected children
Wijer, L van de; Schellekens, A.F.A.; Burger, D.M.; Homberg, J.R.; Mast, Q. de; Ven, A.J.A.M. van der
2016-01-01
The non-nucleoside reverse transcriptase inhibitor efavirenz is part of the WHO guidelines for preferred first-line treatment of HIV-1-infected adults, pregnant and lactating women, and children. Efavirenz is well known to cause CNS toxicity. Although good data for CNS toxicity are available for
Arnaiz, J.A.; Mallolas, J.; Podzamczer, D.; Gerstoft, J.; Lundgren, J.D.; Cahn, P.; Fatkenheuer, G.; D'Arminio-Monforte, A.; Casiro, A.; Reiss, P.; Burger, D.M.; Stek Jr, M.; Gatell, J.M.
2003-01-01
OBJECTIVE: To compare continued indinavir (IDV) 8-hourly (q8h) with switching to indinavir/ritonavir (IDV/RTV) 12-hourly (q12h) in HIV-positive patients having suppressed viral load with IDV q8h plus two nucleoside reverse transcriptase inhibitors (NRTI). DESIGN: Multicentre, international,
Arnaiz, Juan A.; Mallolas, Josep; Podzamczer, Daniel; Gerstoft, Jan; Lundgren, Jens D.; Cahn, Pedro; Fätkenheuer, Gerd; D'Arminio-Monforte, Antonella; Casiró, Arnaldo; Reiss, Peter; Burger, David M.; Stek, Michael; Gatell, José M.
2003-01-01
Objective: To compare continued indinavir (IDV) 8-hourly (q8h) with switching to indinavir/ritonavir (IDV/RTV) 12-hourly (q12h) in HIV-positive patients having suppressed viral load with IDV q8h plus two nucleoside reverse transcriptase inhibitors (NRTI). Design: Multicentre, international,
CD14+ monocytes promote the immunosuppressive effect of human umbilical cord matrix stem cells
International Nuclear Information System (INIS)
Wang, Ding; Chen, Ke; Du, Wei Ting; Han, Zhi-Bo; Ren, He; Chi, Ying
2010-01-01
Here, the effect of CD14 + monocytes on human umbilical cord matrix stem cell (hUC-MSC)-mediated immunosuppression was studied in vitro. hUC-MSCs exerted a potent inhibitory effect on the proliferation and interferon-γ (IFN-γ) secretion capacities of CD4 + and CD8 + T cells in response to anti-CD3/CD28 stimulation. Transwell co-culture system revealed that the suppressive effect was primarily mediated by soluble factors. Addition of prostaglandin synthesis inhibitors (indomethacin or NS-398) almost completely abrogated the immunosuppression activity of hUC-MSCs, identifying prostaglandin E 2 (PGE 2 ) as an important soluble mediator. CD14 + monocytes were found to be able to enhance significantly the immunosuppressive effect of hUC-MSCs in a dose-dependent fashion. Moreover, the inflammatory cytokine IL-1β, either exogenously added or produced by CD14 + monocytes in culture, could trigger expression of high levels of PGE 2 by hUC-MSCs, whereas inclusion of the IL-1 receptor antagonist (IL-1RA) in the culture down-regulated not only PGE 2 expression, but also reversed the promotional effect of CD14 + monocytes and partially restored CD4 + and CD8 + T cell proliferation and IFN-γ secretion. Our data demonstrate an important role of monocytes in the hUC-MSC-induced immunomodulation, which may have important implications in future efforts to explore the clinical potentials of hUC-MSCs.
CD14{sup +} monocytes promote the immunosuppressive effect of human umbilical cord matrix stem cells
Energy Technology Data Exchange (ETDEWEB)
Wang, Ding, E-mail: qqhewd@gmail.com [The State Key Laboratory of Experimental Hematology, Institute of Hematology and Hospital of Blood Diseases, Chinese Academy of Medical Sciences and Peking Union of Medical College, 288 Nanjing Road, Tianjin 300020 (China); TEDA Life and Technology Research Center, Institute of Hematology, Chinese Academy of Medical Sciences, TEDA, Tianjin (China); Chen, Ke, E-mail: chenke_59@hotmail.com [The State Key Laboratory of Experimental Hematology, Institute of Hematology and Hospital of Blood Diseases, Chinese Academy of Medical Sciences and Peking Union of Medical College, 288 Nanjing Road, Tianjin 300020 (China); TEDA Life and Technology Research Center, Institute of Hematology, Chinese Academy of Medical Sciences, TEDA, Tianjin (China); Du, Wei Ting, E-mail: duwtpumc@yahoo.com.cn [The State Key Laboratory of Experimental Hematology, Institute of Hematology and Hospital of Blood Diseases, Chinese Academy of Medical Sciences and Peking Union of Medical College, 288 Nanjing Road, Tianjin 300020 (China); Han, Zhi-Bo, E-mail: zhibohan@hotmail.com [The State Key Laboratory of Experimental Hematology, Institute of Hematology and Hospital of Blood Diseases, Chinese Academy of Medical Sciences and Peking Union of Medical College, 288 Nanjing Road, Tianjin 300020 (China); TEDA Life and Technology Research Center, Institute of Hematology, Chinese Academy of Medical Sciences, TEDA, Tianjin (China); Ren, He, E-mail: knifesharp2000@hotmail.com [National Engineering Research Center of Cell Products, AmCellGene Co. Ltd, TEDA, Tianjin (China); Chi, Ying, E-mail: caizhuying@hotmail.com [The State Key Laboratory of Experimental Hematology, Institute of Hematology and Hospital of Blood Diseases, Chinese Academy of Medical Sciences and Peking Union of Medical College, 288 Nanjing Road, Tianjin 300020 (China); TEDA Life and Technology Research Center, Institute of Hematology, Chinese Academy of Medical Sciences, TEDA, Tianjin (China); and others
2010-09-10
Here, the effect of CD14{sup +} monocytes on human umbilical cord matrix stem cell (hUC-MSC)-mediated immunosuppression was studied in vitro. hUC-MSCs exerted a potent inhibitory effect on the proliferation and interferon-{gamma} (IFN-{gamma}) secretion capacities of CD4{sup +} and CD8{sup +} T cells in response to anti-CD3/CD28 stimulation. Transwell co-culture system revealed that the suppressive effect was primarily mediated by soluble factors. Addition of prostaglandin synthesis inhibitors (indomethacin or NS-398) almost completely abrogated the immunosuppression activity of hUC-MSCs, identifying prostaglandin E{sub 2} (PGE{sub 2}) as an important soluble mediator. CD14{sup +} monocytes were found to be able to enhance significantly the immunosuppressive effect of hUC-MSCs in a dose-dependent fashion. Moreover, the inflammatory cytokine IL-1{beta}, either exogenously added or produced by CD14{sup +} monocytes in culture, could trigger expression of high levels of PGE{sub 2} by hUC-MSCs, whereas inclusion of the IL-1 receptor antagonist (IL-1RA) in the culture down-regulated not only PGE{sub 2} expression, but also reversed the promotional effect of CD14{sup +} monocytes and partially restored CD4{sup +} and CD8{sup +} T cell proliferation and IFN-{gamma} secretion. Our data demonstrate an important role of monocytes in the hUC-MSC-induced immunomodulation, which may have important implications in future efforts to explore the clinical potentials of hUC-MSCs.
Differentiation of isolated human umbilical cord mesenchymal stem cells into neural stem cells
Chen, Song; Zhang, Wei; Wang, Ji-Ming; Duan, Hong-Tao; Kong, Jia-Hui; Wang, Yue-Xin; Dong, Meng; Bi, Xue; Song, Jian
2016-01-01
AIM To investigate whether umbilical cord human mesenchymal stem cell (UC-MSC) was able to differentiate into neural stem cell and neuron in vitro. METHODS The umbilical cords were obtained from pregnant women with their written consent and the approval of the Clinic Ethnics Committee. UC-MSC were isolated by adherent culture in the medium contains 20% fetal bovine serum (FBS), then they were maintained in the medium contain 10% FBS and induced to neural cells in neural differentiation medium. We investigated whether UC-MSC was able to differentiate into neural stem cell and neuron in vitro by using flow cytometry, reverse transcriptase-polymerase chain reaction (RT-PCR) and immunofluorescence (IF) analyzes. RESULTS A substantial number of UC-MSC was harvested using the tissue explants adherent method at about 2wk. Flow cytometric study revealed that these cells expressed common markers of MSCs, such as CD105 (SH2), CD73 (SH3) and CD90. After induction of differentiation of neural stem cells, the cells began to form clusters; RT-PCR and IF showed that the neuron specific enolase (NSE) and neurogenic differentiation 1-positive cells reached 87.3%±14.7% and 72.6%±11.8%, respectively. Cells showed neuronal cell differentiation after induced, including neuron-like protrusions, plump cell body, obviously and stronger refraction. RT-PCR and IF analysis showed that microtubule-associated protein 2 (MAP2) and nuclear factor-M-positive cells reached 43.1%±10.3% and 69.4%±19.5%, respectively. CONCLUSION Human umbilical cord derived MSCs can be cultured and proliferated in vitro and differentiate into neural stem cells, which may be a valuable source for cell therapy of neurodegenerative eye diseases. PMID:26949608
Differentiation of isolated human umbilical cord mesenchymal stem cells into neural stem cells
Directory of Open Access Journals (Sweden)
Song Chen
2016-01-01
Full Text Available AIM: To investigate whether umbilical cord human mesenchymal stem cell (UC-MSC was able to differentiate into neural stem cell and neuron in vitro. METHODS: The umbilical cords were obtained from pregnant women with their written consent and the approval of the Clinic Ethnics Committee. UC-MSC were isolated by adherent culture in the medium contains 20% fetal bovine serum (FBS, then they were maintained in the medium contain 10% FBS and induced to neural cells in neural differentiation medium. We investigated whether UC-MSC was able to differentiate into neural stem cell and neuron in vitro by using flow cytometry, reverse transcriptase-polymerase chain reaction (RT-PCR and immunofluorescence (IF analyzes. RESULTS: A substantial number of UC-MSC was harvested using the tissue explants adherent method at about 2wk. Flow cytometric study revealed that these cells expressed common markers of MSCs, such as CD105 (SH2, CD73 (SH3 and CD90. After induction of differentiation of neural stem cells, the cells began to form clusters; RT-PCR and IF showed that the neuron specific enolase (NSE and neurogenic differentiation 1-positive cells reached 87.3%±14.7% and 72.6%±11.8%, respectively. Cells showed neuronal cell differentiation after induced, including neuron-like protrusions, plump cell body, obviously and stronger refraction. RT-PCR and IF analysis showed that microtubule-associated protein 2 (MAP2 and nuclear factor-M-positive cells reached 43.1%±10.3% and 69.4%±19.5%, respectively. CONCLUSION: Human umbilical cord derived MSCs can be cultured and proliferated in vitro and differentiate into neural stem cells, which may be a valuable source for cell therapy of neurodegenerative eye diseases.
Directory of Open Access Journals (Sweden)
Elsa Piedad Cabrera-Murcia
2011-12-01
Full Text Available ResumenEl presente artículo da cuenta de un estudio realizado con el objeto de conocer la reflexión de tres profesores que recibieron formación en las pasantías PENTA UC e hicieron la posterior transferencia a su práctica pedagógica. La me- todología utilizada fue cualitativa y se usó el estudio de caso como método que permitió describir el alcance del progra- ma y la interconexión de los significados compartidos por los tres actores observados y entrevistados. Aunque estos trabajan en diferentes campos disciplinarios y con estu- diantes no diagnosticados como talentosos, todos ellos coinciden en dar relevancia a los cambios y aprendizajes significativos incorporados a su formación y transferidos a su práctica pedagógica en el aula regular, luego de cursar este perfeccionamiento, en (a concepción de docencia, (b conocimientos de base, (c planificación y, (d ele- mentos clave para una educación diferenciada. Estos con- forman los saberes y saberes hacer transferidos desde la educación de talentos al aula regular.AbstractThis paper gives account of a study on the expe- riences of three teachers that participated in the PENTA UC trainee program and afterwards applied their knowledge in the education practice. A qua- litative case study method was used in order to describe the scope of the program and the charac- teristics that the three teachers' experiences had in common, as found by interviews and observation. Although the three works in different fields and with non-gifted students, all of them agreed that the changes and significant learning experience as transferred to teaching practice were relevant. The teaching improvements were said to be related to (a concepts in education, (b basic knowledge, (c planning and (d key elements for differentiated education. This is the knowledge transferred from gifted education to regular classrooms.RésuméLe présent article fait un bilan d'une étude réali- sée avec l'objectif de
Thakkar, Vidhi D; Cox, Robert M; Sawatsky, Bevan; da Fontoura Budaszewski, Renata; Sourimant, Julien; Wabbel, Katrin; Makhsous, Negar; Greninger, Alexander L; von Messling, Veronika; Plemper, Richard K
2018-04-15
The paramyxovirus replication machinery comprises the viral large (L) protein and phosphoprotein (P-protein) in addition to the nucleocapsid (N) protein, which encapsidates the single-stranded RNA genome. Common to paramyxovirus N proteins is a C-terminal tail (Ntail). The mechanistic role and relevance for virus replication of the structurally disordered central Ntail section are unknown. Focusing initially on members of the Morbillivirus genus, a series of measles virus (MeV) and canine distemper virus (CDV) N proteins were generated with internal deletions in the unstructured tail section. N proteins with large tail truncations remained bioactive in mono- and polycistronic minireplicon assays and supported efficient replication of recombinant viruses. Bioactivity of Ntail mutants extended to N proteins derived from highly pathogenic Nipah virus. To probe an effect of Ntail truncations on viral pathogenesis, recombinant CDVs were analyzed in a lethal CDV/ferret model of morbillivirus disease. The recombinant viruses displayed different stages of attenuation ranging from ameliorated clinical symptoms to complete survival of infected animals, depending on the molecular nature of the Ntail truncation. Reinfection of surviving animals with pathogenic CDV revealed robust protection against a lethal challenge. The highly attenuated virus was genetically stable after ex vivo passaging and recovery from infected animals. Mechanistically, gradual viral attenuation coincided with stepwise altered viral transcriptase activity in infected cells. These results identify the central Ntail section as a determinant for viral pathogenesis and establish a novel platform to engineer gradual virus attenuation for next-generation paramyxovirus vaccine design. IMPORTANCE Investigating the role of the paramyxovirus N protein tail domain (Ntail) in virus replication, we demonstrated in this study that the structurally disordered central Ntail region is a determinant for viral
DEFF Research Database (Denmark)
Bruyand, Mathias; Ryom, Lene; Shepherd, Leah
2015-01-01
-AIDS-defining cancers (NADC), AIDS-defining cancers (ADC), and the most frequently occurring ADC (Kaposi sarcoma, non-Hodgkin lymphoma) and NADC (lung, invasive anal, head/neck cancers, and Hodgkin lymphoma). RESULTS: A total of 41,762 persons contributed 241,556 person-years (PY). A total of 1832 cancers were...
Convergence of exterior solutions to radial Cauchy solutions for $\\partial_t^2U-c^2\\Delta U=0$
Directory of Open Access Journals (Sweden)
Helge Kristian Jenssen
2016-09-01
Full Text Available Consider the Cauchy problem for the 3-D linear wave equation $\\partial_t^2U-c^2\\Delta U=0$ with radial initial data $U(0,x=\\Phi(x=\\varphi(|x|$, $U_t(0,x=\\Psi(x=\\psi(|x|$. A standard result states that $U$ belongs to $C([0,T];H^s(\\mathbb{R}^3$ whenever $(\\Phi,\\Psi\\in H^s\\times H^{s-1}(\\mathbb{R}^3$. In this article we are interested in the question of how U can be realized as a limit of solutions to initial-boundary value problems on the exterior of vanishing balls $B_\\varepsilon$ about the origin. We note that, as the solutions we compare are defined on different domains, the answer is not an immediate consequence of $H^s$ well-posedness for the wave equation.
Investigation of pUC19 DNA damage induced by direct and indirect effect of 7Li ions radiation
International Nuclear Information System (INIS)
Sui Li; Zhao Kui; Guo Jiyu; Ni Meinan; Kong Fuquan; Cai Minghui; Yang Mingjian
2006-01-01
The effect of direct and indirect action on DNA damage in 7 Li ions radiation is investigated. Using 7 Li ions generated by HI-13 tandem accelerator, three conditions of pUC19 plasmid DNA samples including dry, with or without mannitol are irradiated at different doses in air. These irradiated DNA samples are analyzed with atomic force microscopy (AFM) in nanometer-scale. The changes of DNA forms as the dose increases are observed. The results show that free radical is the main factor in DNA strand breaks induced by 7 Li ions radiation under condition of aqueous solution. The mannitol can effectively scavenge free radical and reduce the yields of DNA strand breaks. The experimental results of this report can offered valuable basal data for cancer therapy by boron neutron capture therapy (BNCT) or heavy ion radiation method, etc. (author)
In Silico Screening Hepatitis B Virus DNA Polymerase Inhibitors from Medicinal Plants
Directory of Open Access Journals (Sweden)
Mokhtar Nosrati
2017-08-01
Full Text Available Abstract Background: Hepatitis B virus infection (HBV is a significant global health problem and is a major cause of morbidity and mortality worldwide. Therefore, currently, introducing novel anti Hepatitis B drugs is taken into consideration. This study was planned to in silico screening novel Hepatitis B virus DNA polymerase inhibitors from two medicinal plants Terminalis chebula and Caesalpinia sappan. Materials and Methods: This is a descriptive-analytic study. In the study, three-dimensional structure of the Hepatitis B virus DNA polymerase was predicted using homology modeling method. A set of phytochemicals from mentioned plants were retrieved from Pubchem database in SDF format. In silico screening was carried out using molecular docking between mentioned phytochemicals and modeled polymerase by iGemdock 2.1 software. Results: Results of the study confirmed that all evaluated ligands have appropriate interactions to the polymerase with least toxicity and without genotoxicity potential. Results also showed that most interactions occur in reverse transcriptase domain which located in 354-694 area in the amino acid sequence of tested polymerase. Analysis of energy and amino acids involved in ligand-polymerase interaction revealed that Terchebin, Chebulinic Acid and Terflavin A have more effective interaction with the polymerase in compared to other ligands. Conclusion: Based on the results it can be concluded that evaluated compounds could be good candidates for in vitro and in vivo research in order to develop novel anti- Hepatitis B drugs.
Avelumab for the treatment of urothelial cancer.
Rodriguez-Vida, Alejo; Bellmunt, Joaquim
2018-05-01
Metastatic urothelial carcinoma (UC) remains an aggressive disease associated with limited treatment options and a reduced survival. In spite of this, the first-line treatment based on platinum-based combinations has remained virtually unchanged for the last 20-30 years. Similarly, before the advent of the immune checkpoint inhibitors, there were no FDA-approved drugs for second-line therapy. In the last few years, impressive signs of anti-tumor activity have been reported with several immunotherapy agents targeting the programmed cell death-1 (PD-1) pathway. Avelumab, a PD-1 ligand (PD-L1) inhibitor, is currently being investigated for the treatment of UC. Areas covered: This article will review the pharmacological characteristics of avelumab, the efficacy studies which led to its approval, its safety profile, as well as its place within the management of urothelial carcinoma with immunotherapy. For that matter, we undertook a literature review of all the studies assessing the pharmacology of avelumab and its efficacy within clinical trials. Expert commentary: Avelumab has shown promising antitumor activity and a manageable safety profile in patients with UC. Its dual mechanism of action, blocking the interaction between PD-L1 and PD-1 and promoting antibody-dependent cell-mediated cytotoxicity could potentially be of great interest since it could produce synergistic clinical efficacy.
TMC125 exerts similar initial antiviral potency as a five-drug, triple class antiretroviral regimen
Sankatsing, Sanjay U. C.; Weverling, Gerrit J.; Peeters, Monika; van't Klooster, Gerben; Gruzdev, Boris; Rakhmanova, Aza; Danner, Sven A.; Jurriaans, Suzanne; Prins, Jan M.; Lange, Joep M. A.
2003-01-01
Objective: TMC125, a next generation, non-nucleoside reverse transcriptase inhibitor (NNRTI), demonstrated a remarkable decline of plasma HIV-1 RNA during a phase IIa study. We compared the initial rate of decline of plasma HIV-1 RNA achieved by TMC125 monotherapy with that of a triple class,
Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen
2011-02-01
Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection
Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano
2005-01-13
Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.
Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer
International Nuclear Information System (INIS)
Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen
2001-01-01
Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts
Lipid profile of HIV-infected patients in relation to antiretroviral therapy: a review.
Souza, Suelen Jorge; Luzia, Liania Alves; Santos, Sigrid Sousa; Rondó, Patrícia Helen Carvalho
2013-01-01
This study reviewed the lipid profile of human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS) patients in relation to use of antiretroviral therapy (ART), and its different classes of drugs. A total of 190 articles published in peer-reviewed journals were retrieved from PubMed and LILACS databases; 88 of them met the selection criteria and were included in the review. Patients with HIV/AIDS without ART presented an increase of triglycerides and decreases of total cholesterol, low density lipoprotein (LDL-c), and high density lipoprotein (HDL-c) levels. Distinct ART regimens appear to promote different alterations in lipid metabolism. Protease inhibitors, particularly indinavir and lopinavir, were commonly associated with hypercholesterolemia, high LDL-c, low HDL-c, and hypertriglyceridemia. The protease inhibitor atazanavir is apparently associated with a more advantageous lipid profile. Some nucleoside reverse-transcriptase inhibitors (didanosine, stavudine, and zidovudine) induced lipoatrophy and hypertriglyceridemia, whereas abacavir increased the risk of cardiovascular diseases even in the absence of apparent lipid disorders, and tenofovir resulted in lower levels of cholesterol and triglycerides. Although non-nucleoside reverse-transcriptase inhibitors predisposed to hypertriglyceridemia and hypercholesterolemia, nevirapine was particularly associated with high HDL-c levels, a protective factor against cardiovascular diseases. Therefore, the infection itself, different classes of drugs, and some drugs from the same class of ART appear to exert distinct alterations in lipid metabolism. Copyright © 2013 Elsevier Editora Ltda. All rights reserved.
Directory of Open Access Journals (Sweden)
Sota Iwatani
2017-09-01
Full Text Available BackgroundSpinal muscular atrophy (SMA is the most common genetic neurological disease leading to infant death. It is caused by loss of survival motor neuron (SMN 1 gene and subsequent reduction of SMN protein in motor neurons. Because SMN is ubiquitously expressed and functionally linked to general RNA metabolism pathway, fibroblasts (FBs are most widely used for the assessment of SMN expression in SMA patients but usually isolated from skin biopsy samples after the onset of overt symptoms. Although recent translational studies of SMN-targeted therapies have revealed the very limited time window for effective SMA therapies during perinatal period, the exact time point when SMN shortage became evident is unknown in human samples. In this study, we analyzed SMN mRNA and protein expression during perinatal period by using umbilical cord-derived mesenchymal stem cells (UC-MSCs obtained from preterm and term infants.MethodsUC-MSCs were isolated from 16 control infants delivered at 22–40 weeks of gestation and SMA fetus aborted at 19 weeks of gestation (UC-MSC-Control and UC-MSC-SMA. FBs were isolated from control volunteer and SMA patient (FB-Control and FB-SMA. SMN mRNA and protein expression in UC-MSCs and FBs was determined by RT-qPCR and Western blot.ResultsUC-MSC-Control and UC-MSC-SMA expressed the comparable level of MSC markers on their cell surface and were able to differentiate into adipocytes, osteocytes, and chondrocytes. At steady state, SMN mRNA and protein expression was decreased in UC-MSC-SMA compared to UC-MSC-Control, as observed in FB-SMA and FB-Control. In response to histone deacetylase inhibitor valproic acid, SMN mRNA and protein expression in UC-MSC-SMA and FB-SMA was increased. During perinatal development from 22 to 40 weeks of gestation, SMN mRNA and protein expression in UC-MSC-Control was positively correlated with gestational age.ConclusionUC-MSCs isolated from 17 fetus/infant of 19–40 weeks of gestation
Directory of Open Access Journals (Sweden)
Hatakeyama Keiichi
2012-12-01
Full Text Available Abstract Background Alternative splicing of pre-mRNA transcripts not only plays a role in normal molecular processes but is also associated with cancer development. While normal transcripts are ubiquitously expressed in normal tissues, splice variants created through abnormal alternative splicing events are often expressed in cancer cells. Although the Rho GDP dissociation inhibitor β (ARHGDIB gene has been found to be ubiquitously expressed in normal tissues and involved in cancer development, the presence of splice variants of ARHGDIB has not yet been investigated. Results Validation analysis for the presence of and exon structures of splice variants of ARHGDIB, performed using reverse-transcriptase polymerase chain reaction and DNA sequencing, successfully identified novel splice variants of ARHGDIB, that is, 6a, 6b, and 6c, in colon, pancreas, stomach, and breast cancer cell lines. Quantitative real-time polymerase chain reaction analysis showed that these variants were also highly expressed in normal placental tissue but not in other types of normal tissue. Conclusions Expression of ARHGDIB variants 6a, 6b, and 6c appears to be restricted to cancer cells and normal placental tissue, suggesting that these variants possess cancer-specific functions and, as such, are potential cancer-related biomarkers.
The effect of chemical anti-inhibitors on fibrinolytic enzymes and inhibitors
DEFF Research Database (Denmark)
Sidelmann, Johannes Jakobsen; Jespersen, J; Kluft, C
1997-01-01
proteases. We studied the influence of chemical anti-inhibitors (chloramine T, flufenamate, sodium lauryl sulfate, and methylamine) on fibrinolytic serine proteases and fibrinolytic enzyme inhibitors using the physiological substrate fibrin as plasmin substrate. Low concentrations of chloramine T (0.01 mmol......%) and plasminogen activators (apparent recovery > 200%). Sodium lauryl sulfate eliminates the major fibrinolytic enzyme inhibitors, but increases the activity of plasmin (apparent recovery > 200%) and plasminogen activator, urokinase type (apparent recovery 130%). Methylamine affects only plasmin inhibition. We...
Combined effects of EGFR tyrosine kinase inhibitors and vATPase inhibitors in NSCLC cells
Energy Technology Data Exchange (ETDEWEB)
Jin, Hyeon-Ok [KIRAMS Radiation Biobank, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Hong, Sung-Eun [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Kim, Chang Soon [Department of Microbiological Engineering, Kon-Kuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul, 143–701 (Korea, Republic of); Park, Jin-Ah; Kim, Jin-Hee; Kim, Ji-Young; Kim, Bora [KIRAMS Radiation Biobank, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Chang, Yoon Hwan; Hong, Seok-Il; Hong, Young Jun [Department of Laboratory Medicine, Korea Cancer Center Hospital, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Park, In-Chul, E-mail: parkic@kirams.re.kr [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Lee, Jin Kyung, E-mail: jklee@kirams.re.kr [KIRAMS Radiation Biobank, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Department of Laboratory Medicine, Korea Cancer Center Hospital, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of)
2015-08-15
Despite excellent initial clinical responses of non-small cell lung cancer (NSCLC) patients to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs), many patients eventually develop resistance. According to a recent report, vacuolar H + ATPase (vATPase) is overexpressed and is associated with chemotherapy drug resistance in NSCLC. We investigated the combined effects of EGFR TKIs and vATPase inhibitors and their underlying mechanisms in the regulation of NSCLC cell death. We found that combined treatment with EGFR TKIs (erlotinib, gefitinib, or lapatinib) and vATPase inhibitors (bafilomycin A1 or concanamycin A) enhanced synergistic cell death compared to treatments with each drug alone. Treatment with bafilomycin A1 or concanamycin A led to the induction of Bnip3 expression in an Hif-1α dependent manner. Knock-down of Hif-1α or Bnip3 by siRNA further enhanced cell death induced by bafilomycin A1, suggesting that Hif-1α/Bnip3 induction promoted resistance to cell death induced by the vATPase inhibitors. EGFR TKIs suppressed Hif-1α and Bnip3 expression induced by the vATPase inhibitors, suggesting that they enhanced the sensitivity of the cells to these inhibitors by decreasing Hif-1α/Bnip3 expression. Taken together, we conclude that EGFR TKIs enhance the sensitivity of NSCLC cells to vATPase inhibitors by decreasing Hif-1α/Bnip3 expression. We suggest that combined treatment with EGFR TKIs and vATPase inhibitors is potentially effective for the treatment of NSCLC. - Highlights: • Co-treatment with EGFR TKIs and vATPase inhibitors induces synergistic cell death • EGFR TKIs enhance cell sensitivity to vATPase inhibitors via Hif-1α downregulation • Co-treatment of these inhibitors is potentially effective for the treatment of NSCLC.
ROS inhibitor N-acetyl-L-cysteine antagonizes the activity of proteasome inhibitors.
Halasi, Marianna; Wang, Ming; Chavan, Tanmay S; Gaponenko, Vadim; Hay, Nissim; Gartel, Andrei L
2013-09-01
NAC (N-acetyl-L-cysteine) is commonly used to identify and test ROS (reactive oxygen species) inducers, and to inhibit ROS. In the present study, we identified inhibition of proteasome inhibitors as a novel activity of NAC. Both NAC and catalase, another known scavenger of ROS, similarly inhibited ROS levels and apoptosis associated with H₂O₂. However, only NAC, and not catalase or another ROS scavenger Trolox, was able to prevent effects linked to proteasome inhibition, such as protein stabilization, apoptosis and accumulation of ubiquitin conjugates. These observations suggest that NAC has a dual activity as an inhibitor of ROS and proteasome inhibitors. Recently, NAC was used as a ROS inhibitor to functionally characterize a novel anticancer compound, piperlongumine, leading to its description as a ROS inducer. In contrast, our own experiments showed that this compound depicts features of proteasome inhibitors including suppression of FOXM1 (Forkhead box protein M1), stabilization of cellular proteins, induction of ROS-independent apoptosis and enhanced accumulation of ubiquitin conjugates. In addition, NAC, but not catalase or Trolox, interfered with the activity of piperlongumine, further supporting that piperlongumine is a proteasome inhibitor. Most importantly, we showed that NAC, but not other ROS scavengers, directly binds to proteasome inhibitors. To our knowledge, NAC is the first known compound that directly interacts with and antagonizes the activity of proteasome inhibitors. Taken together, the findings of the present study suggest that, as a result of the dual nature of NAC, data interpretation might not be straightforward when NAC is utilized as an antioxidant to demonstrate ROS involvement in drug-induced apoptosis.
Directory of Open Access Journals (Sweden)
Hannes C A Drexler
Full Text Available Cells adapt to endoplasmic reticulum (ER-stress by arresting global protein synthesis while simultaneously activating specific transcription factors and their downstream targets. These processes are mediated in part by the phosphorylation-dependent inactivation of the translation initiation factor eIF2alpha. Following restoration of homeostasis protein synthesis is resumed when the serine/threonine-protein phosphatase PP1 dephosphorylates and reactivates eIF2alpha. Proteasome inhibitors, used to treat multiple myeloma patients evoke ER-stress and apoptosis by blocking the ER-associated degradation of misfolded proteins (ERAD, however, the role of eIF2alpha phosphorylation in leukemic cells under conditions of proteasome inhibitor-mediated ER stress is currently unclear.Bcr-Abl-positive and negative leukemic cell lines were used to investigate the functional implications of PP1-related phosphatase activities on eIF2alpha phosphorylation in proteasome inhibitor-mediated ER stress and apoptosis. Rather unexpectedly, salubrinal, a recently identified PP1 inhibitor capable to protect against ER stress in various model systems, strongly synergized with proteasome inhibitors to augment apoptotic death of different leukemic cell lines. Salubrinal treatment did not affect the phosphorlyation status of eIF2alpha. Furthermore, the proapoptotic effect of salubrinal occurred independently from the chemical nature of the proteasome inhibitor, was recapitulated by a second unrelated phosphatase inhibitor and was unaffected by overexpression of a dominant negative eIF2alpha S51A variant that can not be phosphorylated. Salubrinal further aggravated ER-stress and proteotoxicity inflicted by the proteasome inhibitors on the leukemic cells since characteristic ER stress responses, such as ATF4 and CHOP synthesis, XBP1 splicing, activation of MAP kinases and eventually apoptosis were efficiently abrogated by the translational inhibitor cycloheximide.Although PP1
MODERN POSSIBILITIES OF THERAPY WITH INHIBITORS OF CONTROL POINTS IN METASTATIC UROTHELIAL CANCER
Directory of Open Access Journals (Sweden)
R. A. Gafanov
2018-01-01
Full Text Available For a long time, chemotherapy remained the main treatment option for metastatic urothelial carcinoma (mUC. Over the past year, there have been revolutionary changes associated with the approval of five new drugs aimed at blocking the interaction between the surface protein of T-lymphocytes PD-1 and its ligands PD-L1 and PD-L2, resulting in the activation of the immune response. It is noteworthy that the anti-PD-1 antibody pembrolizumab demonstrated an increase in overall survival relative to chemotherapy in a randomized phase III trial in the second line with mUC. Based on this level 1 evidence pembrolizumab was approved by the US Food and Drug Administration (FDA. Nivolumab (antibody PD-1 also demonstrated an increase in overall survival compared to historical control and was approved by FDA. Likewise, antibodies targeting PD-L1, including atezolizumab, durvalumab and avelumab, received accelerated approval from the FDA as the second line of treatment for mUC. Some of these agents are approved in the first line by the results of phase II study (atezolizumab and pembolizumab received accelerated approval for first-line treatment in patients not receiving cisplatin. Despite these many endorsements, clinical development of new biomarkers for selection of patients, who can get maximum advantages of immunotherapy and also for development the optimal therapy sequencing still are biggest and critical question for future investigation. The clinical introduction of biomarkers to determine optimal treatment of patients remains extremely important.
Reverse transcriptase directs viral evolution in a deep ocean methane seep
Paul, B. G.; Bagby, S. C.
2013-12-01
Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.
Directory of Open Access Journals (Sweden)
Boutin Jean A
2010-10-01
Full Text Available Abstract Background Bone resorption is initiated by osteoclastic acidification of the resorption lacunae. This process is mediated by secretion of protons through the V-ATPase and chloride through the chloride antiporter ClC-7. To shed light on the intracellular signalling controlling extracellular acidification, we screened a protein kinase inhibitor library in human osteoclasts. Methods Human osteoclasts were generated from CD14+ monocytes. The effect of different kinase inhibitors on lysosomal acidification in human osteoclasts was investigated using acridine orange for different incubation times (45 minutes, 4 and 24 hours. The inhibitors were tested in an acid influx assay using microsomes isolated from human osteoclasts. Bone resorption by human osteoclasts on bone slices was measured by calcium release. Cell viability was measured using AlamarBlue. Results Of the 51 compounds investigated only few inhibitors were positive in both acidification and resorption assays. Rottlerin, GF109203X, Hypericin and Ro31-8220 inhibited acid influx in microsomes and bone resorption, while Sphingosine and Palmitoyl-DL-carnitine-Cl showed low levels of inhibition. Rottlerin inhibited lysosomal acidification in human osteoclasts potently. Conclusions In conclusion, a group of inhibitors all indicated to inhibit PKC reduced acidification in human osteoclasts, and thereby bone resorption, indicating that acid secretion by osteoclasts may be specifically regulated by PKC in osteoclasts.
Directory of Open Access Journals (Sweden)
Mojgan Masoodi
Full Text Available Ulcerative colitis (UC is a relapsing inflammatory disorder of unconfirmed aetiology, variable severity and clinical course, characterised by progressive histological inflammation and with elevation of eicosanoids which have a known pathophysiological role in inflammation. Therapeutic interventions targetting eicosanoids (5-aminosalicylates (ASA are effective first line and adjunctive treatments in mild-moderate UC for achieving and sustaining clinical remission. However, the variable clinical response to 5-ASA and frequent deterioration in response to cyclo-oxygenase (COX inhibitors, has prompted an in depth simultaneous evaluation of multiple lipid mediators (including eicosanoids within the inflammatory milieu in UC. We hypothesised that severity of inflammation is associated with alteration of lipid mediators, in relapsing UC.Study was case-control design. Mucosal lipid mediators were determined by LC-MS/MS lipidomics analysis on mucosal biopsies taken from patients attending outpatients with relapsing UC. Univariate and multivariate statistical analyses were used to investigate the association of mucosal lipid mediators, with the disease state and severity graded histologically.Levels of PGE2, PGD2, TXB2, 5-HETE, 11-HETE, 12-HETE and 15-HETE are significantly elevated in inflamed mucosa and correlate with severity of inflammation, determined using validated histological scoring systems.Our approach of capturing inflammatory mediator signature at different stages of UC by combining comprehensive lipidomics analysis and computational modelling could be used to classify and predict mild-moderate inflammation; however, predictive index is diminished in severe inflammation. This new technical approach could be developed to tailor drug treatments to patients with active UC, based on the mucosal lipid mediator profile.
Ciaffi, Laura; Koulla-Shiro, Sinata; Sawadogo, Adrien Bruno; Ndour, Cheik Tidiane; Eymard-Duvernay, Sabrina; Mbouyap, Pretty Rosereine; Ayangma, Liliane; Zoungrana, Jacques; Gueye, Ndeye Fatou Ngom; Diallo, Mohamadou; Izard, Suzanne; Bado, Guillaume; Kane, Coumba Toure; Aghokeng, Avelin Fobang; Peeters, Martine; Girard, Pierre Marie; Le Moing, Vincent; Reynes, Jacques; Delaporte, Eric
2017-09-01
Despite satisfactory efficacy of WHO-recommended second-line antiretroviral treatment for patients with HIV in low-income countries, the need for simplified, low-cost, and less-toxic maintenance strategies remains high. We compared boosted protease inhibitor monotherapy with dual therapy with boosted protease inhibitor plus lamivudine in patients on second-line antiretrovial therapy (ART). We did a multicentre, randomised, parallel, open-label, superiority, trial in the HIV services of five hospitals in sub-Saharan Africa (Yaoundé, Cameroon; Dakar, Senegal; and Bobo Dioulasso, Burkina Faso). We recruited patients from the long-term, post-trial cohort of the ANRS 12169/2LADY study that compared the efficacy of three second-line combinations based on boosted protease inhibitors. Participants for our study were HIV-1 infected with multiple mutations including M184V, at first-line failure, aged 18 years and older, on boosted protease inhibitor plus two nucleoside reverse transcriptase inhibitors (NRTI) for at least 48 weeks with at least 48 weeks follow-up in the 2LADY trial, with two viral load measurements of less than 200 copies per mL in the previous 6 months, CD4 counts of more than 100 cells per μL, adherence of at least 90%, and no change to ART in the past 3 months. We randomly assigned participants (1:1) to receive either monotherapy with their boosted protease inhibitor (once-daily darunavir 800 mg [two 400 mg tablets] boosted with ritonavir 100 mg [one tablet] or coformulation of lopinavir 200 mg with ritonavir 50 mg [two tablets taken twice per day]) or to boosted protease inhibitor plus once-daily lamivudine 300 mg (one 300 mg tablet or two 150 mg tablets). Computer-generated randomisation was stratified by study site and viral load at screening (treatment allocation was not masked from clinicians or patients]. Patients had follow-up visits at weeks 4 and 12, and every 3 months until 96 weeks; if viral load exceeded 500 copies per mL at any visit, NRTI
Current status of topical antiretroviral chemoprophylaxis.
Van Damme, Lut; Szpir, Michael
2012-11-01
Recent studies suggest that the vaginal delivery of antiretroviral (ARV) agents - such as tenofovir, dapivirine and UC781 - may be a promising way to reduce the high rates of HIV infection among women in developing countries. This review examines these developments. The Microbicide Trials Network 003 study, a large phase IIb trial, was unable to show that daily dosing with 1% tenofovir vaginal gel was effective for HIV prevention. Nevertheless, preclinical and early-phase clinical trials suggest that ARV drugs - formulated in vaginal gels, rings, films, tablets and diaphragms - could be effective for HIV chemoprophylaxis. Investigations of topical chemoprophylaxis methods have seen mixed results in the past 12-18 months. Product adherence may prove to be one of the field's greatest challenges. Phase II and III trials continue to explore different dosing strategies for topical products that contain one or more ARV agents.
Regina, Giuseppe La; Coluccia, Antonio; Piscitelli, Francesco; Bergamini, Alberto; Sinistro, Anna; Cavazza, Antonella; Maga, Giovanni; Samuele, Alberta; Zanoli, Samantha; Novellino, Ettore; Artico, Marino; Silvestri, Romano
2007-10-04
Indolyl aryl sulfones bearing the 4,5-difluoro (10) or 5-chloro-4-fluoro (16) substitution pattern at the indole ring were potent inhibitors of HIV-1 WT and the NNRTI-resistant strains Y181C and K103N-Y181C. These compounds were highly effective against the 112 and the AB1 strains in lymphocytes and inhibited at nanomolar concentration the multiplication of the IIIBBa-L strain in macrophages. Compound 16 was exceptionally potent against RT WT and RTs carrying the K103N, Y181I, and L100I mutations.
Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao
2015-01-01
Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...
Gruźlica płuc u 27-letniej kobiety
Directory of Open Access Journals (Sweden)
Kamilla Tymińska
2009-09-01
Full Text Available Rozstrzenie oskrzeli to utrwalone, nieodwracalne, różnokształtne nieprawidłowe rozszerzenia oskrzeli – oskrzela są pogrubione i poszerzone oraz mają zmiany zapalne. U około 50% chorych przyczyna rozstrzeni oskrzeli pozostaje nieznana. Mukowiscydoza jest chorobą uwarunkowaną genetycznie, dziedziczoną autosomalnie recesywnie. W większości jej przypadków dochodzi do zajęcia układów pokarmowego i oddechowego. Chlamydophila pneumoniae to bakteria przenoszona drogą kropelkową, wywołująca głównie ostre infekcje górnych i dolnych dróg oddechowych. Następstwem zakażenia mogą być uszkodzenie nabłonka rzęskowego w oskrzelach i zmiany sprzyjające rozwojowi astmy, nawracających katarów nosa, przewlekłego zapalenia gardła i zapalenia zatok. Według raportu WHO w roku 2006 zanotowano 9,2 miliona nowo rozpoznanych przypadków gruźlicy, z czego 7,7% dotyczyło chorych zakażonych wirusem HIV. Głównym celem światowego programu kontroli gruźlicy jest zmniejszenie zachorowalności i umieralności z powodu tej choroby do 2015 roku. DOTS (Directly Observed Treatment Short-course, czyli strategię krótkich kursów nadzorowanego leczenia, uważa się za najbardziej wydajną ekonomicznie w zwalczaniu gruźlicy. Opis przypadku dotyczy 27-letniej kobiety z astmą oskrzelową, która do końca nigdy nie została zdiagnozowana – pacjentkę przyjęto do szpitala z powodu nawracających napadów duszności. Pomimo wdrożonego leczenia antybiotykami i glikokortykosteroidami stan kliniczny chorej, a także obraz radiologiczny uległy pogorszeniu. Na podstawie wykonywanych badań podejrzewano chlamydiowe zapalenie płuc, idiopatyczne rozstrzenie oskrzeli oraz późną postać mukowiscydozy. W badaniach plwociny początkowo nie stwierdzono żadnych patogenów. Ostatecznie badanie bronchoaspiratu metodą BACTEC wykazało obecność prątków gruźlicy. Stan chorej po 6 miesią- cach leczenia przeciwprątkowego według zalecanego przez
Incidence of nevirapine-associated hepatitis in an antenatal clinic
African Journals Online (AJOL)
2008-01-22
Jan 22, 2008 ... together with a non-nucleoside reverse transcriptase inhibitor, either efavirenz or nevirapine.1 As efavirenz is thought to be a teratogen and is classified as a Food and Drug Administration. (FDA) category D drug, nevirapine is the preferred agent for use in pregnant women, for women planning a pregnancy ...
Efavirenz poisoning in a 12 year old HIV negative African boy ...
African Journals Online (AJOL)
Efavirenz is an oral antiretroviral drug in the class of non nucleoside reverse transcriptase inhibitors. Toxicity at therapeutic doses has been documented but there is scarcity of data on presentation and management of Efavirenz overdose. We describe a case of Efavirenz poisoning in a 12-year old HIV Negative African boy ...
Energy Technology Data Exchange (ETDEWEB)
Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy
2017-04-10
HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.
Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.
Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami
2012-08-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.
Prevalence and patterns of HIV transmitted drug resistance in Guatemala.
Avila-Ríos, Santiago; Mejía-Villatoro, Carlos R; García-Morales, Claudia; Soto-Nava, Maribel; Escobar, Ingrid; Mendizabal, Ricardo; Girón, Amalia; García, Leticia; Reyes-Terán, Gustavo
2011-12-01
To assess human immunodeficiency virus (HIV) diversity and the prevalence of transmitted drug resistance (TDR) in Guatemala. One hundred forty-five antiretroviral treatment-naïve patients referred to the Roosevelt Hospital in Guatemala City were enrolled from October 2010 to March 2011. Plasma HIV pol sequences were obtained and TDR was assessed with the Stanford algorithm and the World Health Organization (WHO) TDR surveillance mutation list. HIV subtype B was highly prevalent in Guatemala (96.6%, 140/145), and a 2.8% (4/145) prevalence of BF1 recombinants and 0.7% (1/145) prevalence of subtype C viruses were found. TDR prevalence for the study period was 8.3% (12/145) with the Stanford database algorithm (score > 15) and the WHO TDR surveillance mutation list. Most TDR cases were associated with non-nucleoside reverse transcriptase inhibitors (NNRTIs) (83.3%, 10/12); a low prevalence of nucleoside reverse transcriptase inhibitors and protease inhibitors was observed in the cohort (Guatemala. TDR prevalence in Guatemala was at the intermediate level. Most TDR cases were associated with NNRTIs. Further and continuous TDR surveillance is necessary to gain more indepth knowledge about TDR spread and trends in Guatemala and to optimize treatment outcomes in the country.
Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P
2017-01-01
Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.
Scaffold hopping: exploration of acetanilide-containing uracil analogues as potential NNRTIs.
Babkov, Denis A; Valuev-Elliston, Vladimir T; Paramonova, Maria P; Ozerov, Alexander A; Ivanov, Alexander V; Chizhov, Alexander O; Khandazhinskaya, Anastasia L; Kochetkov, Sergey N; Balzarini, Jan; Daelemans, Dirk; Pannecouque, Christophe; Seley-Radtke, Katherine L; Novikov, Mikhail S
2015-03-01
In order to identify novel nonnucleoside inhibitors of HIV-1 reverse transcriptase two series of amide-containing uracil derivatives were designed as hybrids of two scaffolds of previously reported inhibitors. Subsequent biological evaluation confirmed acetamide uracil derivatives 15a-k as selective micromolar NNRTIs with a first generation-like resistance profile. Molecular modeling of the most active compounds 15c and 15i was employed to provide insight on their inhibitory properties and direct future design efforts. Copyright © 2015 Elsevier Ltd. All rights reserved.
Preparation of UC0.07-0.10N0.90-0.93 spheres for TRISO coated fuel particles
Hunt, R. D.; Silva, C. M.; Lindemer, T. B.; Johnson, J. A.; Collins, J. L.
2014-05-01
The US Department of Energy is considering a new nuclear fuel that would be less susceptible to ruptures during a loss-of-coolant accident. The fuel would consist of tristructural isotropic coated particles with dense uranium nitride (UN) kernels with diameters of 650 or 800 μm. The objectives of this effort are to make uranium oxide microspheres with adequately dispersed carbon nanoparticles and to convert these microspheres into UN spheres, which could be then sintered into kernels. Recent improvements to the internal gelation process were successfully applied to the production of uranium gel spheres with different concentrations of carbon black. After the spheres were washed and dried, a simple two-step heat profile was used to produce porous microspheres with a chemical composition of UC0.07-0.10N0.90-0.93. The first step involved heating the microspheres to 2023 K in a vacuum, and in the second step, the microspheres were held at 1873 K for 6 h in flowing nitrogen.
Directory of Open Access Journals (Sweden)
Nikki van Bel
Full Text Available The viral integrase (IN is an essential protein for HIV-1 replication. IN inserts the viral dsDNA into the host chromosome, thereby aided by the cellular co-factor LEDGF/p75. Recently a new class of integrase inhibitors was described: allosteric IN inhibitors (ALLINIs. Although designed to interfere with the IN-LEDGF/p75 interaction to block HIV DNA integration during the early phase of HIV-1 replication, the major impact was surprisingly found on the process of virus maturation during the late phase, causing a reverse transcription defect upon infection of target cells. Virus particles produced in the presence of an ALLINI are misformed with the ribonucleoprotein located outside the virus core. Virus assembly and maturation are highly orchestrated and regulated processes in which several viral proteins and RNA molecules closely interact. It is therefore of interest to study whether ALLINIs have unpredicted pleiotropic effects on these RNA-related processes. We confirm that the ALLINI BI-D inhibits virus replication and that the produced virus is non-infectious. Furthermore, we show that the wild-type level of HIV-1 genomic RNA is packaged in virions and these genomes are in a dimeric state. The tRNAlys3 primer for reverse transcription was properly placed on this genomic RNA and could be extended ex vivo. In addition, the packaged reverse transcriptase enzyme was fully active when extracted from virions. As the RNA and enzyme components for reverse transcription are properly present in virions produced in the presence of BI-D, the inhibition of reverse transcription is likely to reflect the mislocalization of the components in the aberrant virus particle.
van Bel, Nikki; van der Velden, Yme; Bonnard, Damien; Le Rouzic, Erwann; Das, Atze T; Benarous, Richard; Berkhout, Ben
2014-01-01
The viral integrase (IN) is an essential protein for HIV-1 replication. IN inserts the viral dsDNA into the host chromosome, thereby aided by the cellular co-factor LEDGF/p75. Recently a new class of integrase inhibitors was described: allosteric IN inhibitors (ALLINIs). Although designed to interfere with the IN-LEDGF/p75 interaction to block HIV DNA integration during the early phase of HIV-1 replication, the major impact was surprisingly found on the process of virus maturation during the late phase, causing a reverse transcription defect upon infection of target cells. Virus particles produced in the presence of an ALLINI are misformed with the ribonucleoprotein located outside the virus core. Virus assembly and maturation are highly orchestrated and regulated processes in which several viral proteins and RNA molecules closely interact. It is therefore of interest to study whether ALLINIs have unpredicted pleiotropic effects on these RNA-related processes. We confirm that the ALLINI BI-D inhibits virus replication and that the produced virus is non-infectious. Furthermore, we show that the wild-type level of HIV-1 genomic RNA is packaged in virions and these genomes are in a dimeric state. The tRNAlys3 primer for reverse transcription was properly placed on this genomic RNA and could be extended ex vivo. In addition, the packaged reverse transcriptase enzyme was fully active when extracted from virions. As the RNA and enzyme components for reverse transcription are properly present in virions produced in the presence of BI-D, the inhibition of reverse transcription is likely to reflect the mislocalization of the components in the aberrant virus particle.
Grgic, Ivana; Lunar, Maja M.; Poljak, Mario; Vince, Adriana; Vrakela, Ivana Baca; Planinic, Ana; Seme, Katja; Begovac, Josip
2013-01-01
Abstract The aim of this study was to determine the prevalence of transmitted drug resistance (TDR) in newly diagnosed and treatment-naive HIV-infected patients from Croatia and evaluate a possible contribution of transmission clusters to the spread of resistant virus. The study enrolled treatment-naive HIV-infected patients that entered clinical care at the Croatian Reference Center for HIV/AIDS between 2006 and 2008. The protease gene and a part of the reverse transcriptase gene of the HIV-1 genome were sequenced by using the Trugene HIV-1 Genotyping System. The prevalence of transmitted drug resistance was analyzed by using the surveillance drug resistance mutations (SDRM) list recommended by the WHO in 2009. We report findings for 118 of 180 eligible patients (65.6% coverage). SDRM were detected in 26 of 118 patients (22.0%) who were infected with subtype B and belonged mostly to the men having sex with men (MSM). The majority of patients with primary resistance carried SDRM associated with resistance to nucleoside analogues reverse transcriptase inhibitors (NRTIs, 23 of 118 patients, 19.5%). The most frequently found NRTI SDRM was T215S (17 of 118 patients, 14.4%). SDRM associated with resistance to nonnucleoside reverse transcriptase inhibitors were detected in three (2.5%) patients and primary resistance to protease inhibitors was not detected. Non-B subtypes were detected in 13/118 patients (11%). A total of 12 transmission pairs and eight distinct transmission clusters were identified with the largest cluster harboring sequences from 19 patients; among them all but two were carrying the T215S mutation. This study showed a high prevalence of TDR in newly diagnosed MSM from Croatia and is an important contribution concerning the relationship between local transmission clusters and the spread of resistant virus. PMID:22906365
1-Benzyl-2-(1H-indol-3-yl-5-oxopyrrolidine-2-carbonitrile
Directory of Open Access Journals (Sweden)
Raymond Schinazi
2008-02-01
Full Text Available In the title compound, C20H17N3O, a potential anti-human immunodeficiency virus type 1 (HIV-1 non-nucleoside reverse-transcriptase inhibitor, the pyrrolidine ring has an envelope conformation. In the crystal structure, adjacent molecules are connected into infinite chains via an N—H...O hydrogen bond.
Systemic Immunotherapy for Urothelial Cancer: Current Trends and Future Directions
Directory of Open Access Journals (Sweden)
Shilpa Gupta
2017-01-01
Full Text Available Urothelial cancer of the bladder, renal pelvis, ureter, and other urinary organs is the fifth most common cancer in the United States, and systemic platinum-based chemotherapy remains the standard of care for first-line treatment of advanced/metastatic urothelial carcinoma (UC. Until recently, there were very limited options for patients who are refractory to chemotherapy, or do not tolerate chemotherapy due to toxicities and overall outcomes have remained very poor. While the role of immunotherapy was first established in non-muscle invasive bladder cancer in the 1970s, no systemic immunotherapy was approved for advanced disease until the recent approval of a programmed death ligand-1 (PD-L1 inhibitor, atezolizumab, in patients with advanced/metastatic UC who have progressed on platinum-containing regimens. This represents a significant milestone in this disease after a void of over 30 years. In addition to atezolizumab, a variety of checkpoint inhibitors have shown a significant activity in advanced/metastatic urothelial carcinoma and are expected to gain Food and Drug Administration (FDA approval in the near future. The introduction of novel immunotherapy agents has led to rapid changes in the field of urothelial carcinoma. Numerous checkpoint inhibitors are being tested alone or in combination in the first and subsequent-line therapies of metastatic disease, as well as neoadjuvant and adjuvant settings. They are also being studied in combination with radiation therapy and for non-muscle invasive bladder cancer refractory to BCG. Furthermore, immunotherapy is being utilized for those ineligible for firstline platinum-based chemotherapy. This review outlines the novel immunotherapy agents which have either been approved, or are currently being investigated in clinical trials in UC.
Sokal-Gutierrez, Karen; Ivey, Susan L; Garcia, Roxanna M; Azzam, Amin
2015-01-01
Medical educators, clinicians, and health policy experts widely acknowledge the need to increase the diversity of our healthcare workforce and build our capacity to care for medically underserved populations and reduce health disparities. The Program in Medical Education for the Urban Underserved (PRIME-US) is part of a family of programs across the University of California (UC) medical schools aiming to recruit and train physicians to care for underserved populations, expand the healthcare workforce to serve diverse populations, and promote health equity. PRIME-US selects medical students from diverse backgrounds who are committed to caring for underserved populations and provides a 5-year curriculum including a summer orientation, a longitudinal seminar series with community engagement and leadership-development activities, preclerkship clinical immersion in an underserved setting, a master's degree, and a capstone rotation in the final year of medical school. This is a mixed-methods evaluation of the first 4 years of the PRIME-US at the UC Berkeley-UC San Francisco Joint Medical Program (JMP). From 2006 to 2010, focus groups were conducted each year with classes of JMP PRIME-US students, for a total of 11 focus groups; major themes were identified using content analysis. In addition, 4 yearly anonymous, online surveys of all JMP students, faculty and staff were conducted and analyzed. Most PRIME-US students came from socioeconomically disadvantaged backgrounds and ethnic backgrounds underrepresented in medicine, and all were committed to caring for underserved populations. The PRIME-US students experienced many program benefits including peer support, professional role models and mentorship, and curricular enrichment activities that developed their knowledge, skills, and sustained commitment to care for underserved populations. Non-PRIME students, faculty, and staff also benefited from participating in PRIME-sponsored seminars and community-based activities
Karade, Santosh; Chaturbhuj, Devidas N; Sen, Sourav; Joshi, Rajneesh K; Kulkarni, Smita S; Shankar, Subramanian; Gangakhedkar, Raman R
2018-01-01
The objective of this review was to assess the burden of HIV drug resistance mutations (DRM) in Indian adults exposed to first-line antiretroviral therapy (ART) as per national guidelines. An advanced search of the published literature on HIV drug resistance in India was performed in the PubMed and Scopus databases. Data pertaining to age, sex, CD4 count, viral load, and prevalence of nucleoside reverse transcriptase inhibitor (NRTI)/non-nucleoside reverse transcriptase inhibitor (NNRTI) DRM were extracted from each publication. Year-wise Indian HIV-1 reverse transcriptase (RT) sequences were retrieved from the Los Alamos HIV database and mutation analyses were performed. A time trend analysis of the proportion of sequences showing NRTI resistance mutations among individuals exposed to first-line ART was conducted. Overall, 23 studies (1046 unique RT sequences) were identified indicating a prevalence of drug resistance to NRTI and NNRTI. The proportion of RT sequences with any DRM, any NRTI DRM, and any NNRTI DRM was 78.39%, 68.83%, and 73.13%, respectively. The temporal trend analysis of individual DRM from sequences retrieved during 2004-2014 indicated a rising trend in K65R mutations (p=0.013). Although the overall burden of resistance against first-line ART agents remained steady over the study decade, periodic monitoring is essential. There is the need to develop an HIV-1 subtype C-specific resistance database in India. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Poppe, Lisa K; Chunda-Liyoka, Catherine; Kwon, Eun H; Gondwe, Clement; West, John T; Kankasa, Chipepo; Ndongmo, Clement B; Wood, Charles
2017-08-24
The objectives of this study were to determine HIV drug resistance (HIVDR) prevalence in Zambian infants upon diagnosis, and to determine how changing prevention of mother-to-child transmission (PMTCT) drug regimens affect drug resistance. Dried blood spot (DBS) samples from infants in the Lusaka District of Zambia, obtained during routine diagnostic screening, were collected during four different years representing three different PMTCT drug treatment regimens. DNA extracted from dried blood spot samples was used to sequence a 1493 bp region of the reverse transcriptase gene. Sequences were analyzed via the Stanford HIVDRdatabase (http://hivdb.standford.edu) to screen for resistance mutations. HIVDR in infants increased from 21.5 in 2007/2009 to 40.2% in 2014. Nonnucleoside reverse transcriptase inhibitor resistance increased steadily over the sampling period, whereas nucleoside reverse transcriptase inhibitor resistance and dual class resistance both increased more than threefold in 2014. Analysis of drug resistance scores in each group revealed increasing strength of resistance over time. In 2014, children with reported PMTCT exposure, defined as infant prophylaxis and/or maternal treatment, showed a higher prevalence and strength of resistance compared to those with no reported exposure. HIVDR is on the rise in Zambia and presents a serious problem for the successful lifelong treatment of HIV-infected children. PMTCT affects both the prevalence and strength of resistance and further research is needed to determine how to mitigate its role leading to resistance.
Allosteric small-molecule kinase inhibitors
DEFF Research Database (Denmark)
Wu, Peng; Clausen, Mads Hartvig; Nielsen, Thomas E.
2015-01-01
current barriers of kinase inhibitors, including poor selectivity and emergence of drug resistance. In spite of the small number of identified allosteric inhibitors in comparison with that of inhibitors targeting the ATP pocket, encouraging results, such as the FDA-approval of the first small...
Berenguer, Juan; Polo, Rosa; Aldeguer, José López; Lozano, Fernando; Aguirrebengoa, Koldo; Arribas, José Ramón; Blanco, José Ramón; Boix, Vicente; Casado, José Luis; Clotet, Bonaventura; Crespo, Manuel; Domingo, Pere; Estrada, Vicente; García, Federico; Gatell, José María; González-García, Juan; Gutiérrez, Félix; Iribarren, José Antonio; Knobel, Hernando; Llibre, Josep María; Locutura, Jaime; López, Juan Carlos; Miró, José M; Moreno, Santiago; Podzamczer, Daniel; Portilla, Joaquín; Pulido, Federico; Ribera, Esteban; Riera, Melchor; Rubio, Rafael; Santos, Jesús; Sanz-Moreno, José; Sanz, Jesús; Téllez, María Jesús; Tuset, Montserrat; Rivero, Antonio
2015-10-01
In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and grade of the recommendation vary depending on the CD4+ T-lymphocyte count, the presence of opportunistic infections or comorbid conditions, age, and the efforts to prevent the transmission of HIV. The objective of ART is to achieve an undetectable plasma viral load (PVL). Initial ART should comprise three drugs, namely, two nucleoside reverse transcriptase inhibitors (NRTI) and one drug from another family. Three of the recommended regimens, all of which have an integrase strand transfer inhibitor (INSTI) as the third drug, are considered a preferred regimen; a further seven regimens, which are based on an INSTI, an non-nucleoside reverse transcriptase inhibitor (NNRTI), or a protease inhibitor boosted with ritonavir (PI/r), are considered alternatives. The reasons and criteria for switching ART are presented both for patients with an undetectable PVL and for patients who experience virological failure, in which case the rescue regimen should include three (or at least two) drugs that are fully active against HIV. The specific criteria for ART in special situations (acute infection, HIV-2 infection, pregnancy) and comorbid conditions (tuberculosis and other opportunistic infections, kidney disease, liver disease, and cancer) are updated. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
Expanding the Graduate Education Experience at Scripps Institution of Oceanography, UC San Diego
Peach, C. L.; Kilb, D. L.; Zmarzly, D.; Abeyta, E.
2016-02-01
Emerging career pathways for graduate students in earth, ocean and climate sciences increasingly require skills in teaching and communication. This is true of academic careers, in which demonstrated teaching skills make applicants for faculty positions far more competitive, and traditionally less conventional careers outside of academia that require cross-disciplinary collaboration and/or communication to audiences not directly involved in science research (e.g. policy makers, educators, the public). Yet most graduate education programs provide little to no opportunity or incentive for young investigators to develop and hone these skills, and graduate students are often discouraged from deviating from the traditional "research apprenticeship" model during their graduate education. At Scripps, the Birch Aquarium at Scripps, and UC San Diego Extension, we are developing new ways to integrate teaching, communication, and outreach into our graduate education program, thus broadening the scope of graduate training and better serving the needs and evolving career aspirations of our graduate students. This effort is an integral part of our overall outreach strategy a Scripps in which we seek to combine high quality STEM outreach and teaching with opportunities for Scripps graduate students to put their teaching and communications training into practice. The overall effort is a "win-win" both for our students and for the highly diverse K-16 community in San Diego County. In this talk we will summarize the programmatic efforts currently underway at Scripps, our strategic collaboration with UCSD Extension, which is expanding the capacity and reach of our integrated program, and our plans for sustaining these efforts for the long term.
Lim, Jezamine; Razi, Zainul Rashid Mohamad; Law, Jiaxian; Nawi, Azmawati Mohammed; Idrus, Ruszymah Binti Haji; Ng, Min Hwei
2016-12-01
Human Wharton's jelly-derived mesenchymal stromal cells (hWJMSCs) are possibly the most suitable allogeneic cell source for stromal cell therapy and tissue engineering applications because of their hypo-immunogenic and non-tumorigenic properties, easy availability and minimal ethical concerns. Furthermore, hWJMSCs possess unique properties of both adult mesenchymal stromal cells and embryonic stromal cells. The human umbilical cord (UC) is approximately 50-60 cm long and the existing studies in the literature have not provided information on which segment of the UC was studied. In this study, hWJMSCs derived from three anatomical segments of the UC are compared. Three segments of the whole UC, each 3 cm in length, were identified anatomically as the maternal, middle and fetal segments. The hWJMSCs from the different segments were analyzed via trypan blue exclusion assay to determine the growth kinetics and cell viability, flow cytometry for immunophenotyping and immunofluorescence and reverse transcriptase polymerase chain reaction (RT-PCR) for expression of stromal cell transcriptional factors. Furthermore, the trilineage differentiation potential (osteogenic, adipogenic and chondrogenic) of these cells was also assessed. hWJMSCs isolated from the maternal and fetal segments displayed greater viability and possessed a significantly higher proliferation rate compared with cells from the middle segment. Immunophenotyping revealed that hWJMSCs derived from all three segments expressed the MSC markers CD105, CD73, CD90, CD44, CD13 and CD29, as well as HLA-ABC and HLA-DR, but were negative for hematopoietic markers CD14, CD34 and CD45. Analysis of the embryonic markers showed that all three segments expressed Nanog and Oct 3/4, but only the maternal and fetal segments expressed SSEA 4 and TRA-160. Cells from all three segments were able to differentiate into chondrogenic, osteogenic and adipogenic lineages with the middle segments showing much lower differentiation
2000-07-07
To determine if triple combination therapy, particularly including HIV protease inhibitors (PI), confers an unique immunological benefit that is independent of reductions of plasma viral load (pVL). The correlation between changes from baseline in CD4 cell count and pVL was examined at all time points up to 52 weeks in three randomized clinical trials (AVANTI-2, AVANTI-3 and INCAS) that compared dual nucleoside therapy with triple combination therapy. Individual pVL and CD4 cell counts changes from baseline were entered into multivariate linear regression models for patients receiving double therapy and for those receiving triple therapy including a PI and/or a non-nucleoside reverse transcriptase inhibitor (NNRTI), and the null hypothesis was tested. After 52 weeks of therapy, the relationship between changes from baseline CD4 cell count and pVL was independent of whether patients were assigned double or triple therapy (P = 0.23 and 0.69 for intercept and slope, respectively), or whether patients were assigned triple therapy including a PI or triple therapy including an NNRTI (P = 0.92 and 0.95, respectively). Less than 5% of patients ever had 'discordant' increases in both CD4 cell count and pVL compared with baseline, and this proportion was unrelated to the class of therapy used. 'Discordant' decreases from baseline in both parameters were observed in up to 35% of individuals. The correlation between pVL and CD4 cell count changes from baseline improved over time on therapy, regardless of the therapeutic regimen involved. The data provide no evidence for a CD4 cell count benefit of highly active antiretroviral therapy (HAART) unique to triple therapy or PI-containing regimens.
Sylwia Kwiatkowska; Agnieszka Urbania; Urszula Szkudlarek; Marek Zięba
2008-01-01
Wstęp: Przewlekłą obturacyjną chorobę płuc (POChP) charakteryzuje ograniczenie przepływu powietrza przez drogi oddechowe będące wynikiem nadmiernej reakcji zapalnej na wdychane pyły i gazy, głównie dym tytoniowy. W patogenezie tej choroby odgrywają rolę trzy czynniki: proces zapalny, stres oksydacyjny oraz zaburzenia równowagi pomiędzy proteinazami i antyproteinazami. W ostatnich latach coraz więcej danych wskazuje na obecność u chorych na POChP zmian pozapłucnych, takich jak wyni...
Dardi, I; Kouvatsos, T; Jabbour, S A
2016-02-01
Diabetes mellitus is a serious health issue and an economic burden, rising in epidemic proportions over the last few decades worldwide. Although several treatment options are available, only half of the global diabetic population achieves the recommended or individualized glycemic targets. Sodium-glucose cotransporter 2 (SGLT2) inhibitors are a new class of antidiabetic agents with a novel insulin-independent action. SGLT2 is a transporter found in the proximal renal tubules, responsible for the reabsorption of most of the glucose filtered by the kidney. Inhibition of SGLT2 lowers the blood glucose level by promoting the urinary excretion of excess glucose. Due to their insulin-independent action, SGLT2 inhibitors can be used with any degree of beta-cell dysfunction or insulin resistance, related to a very low risk of hypoglycemia. In addition to improving glycemic control, SGLT2 inhibitors have been associated with a reduction in weight and blood pressure when used as monotherapy or in combination with other antidiabetic agents in patients with type 2 diabetes mellitus (T2DM). Treatment with SGLT2 inhibitors is usually well tolerated; however, they have been associated with an increased incidence of urinary tract and genital infections, although these infections are usually mild and easy to treat. SGLT2 inhibitors are a promising new option in the armamentarium of drugs for patients with T2DM. Copyright © 2015 Elsevier Inc. All rights reserved.
Pearce, Peter; Sewell, Ros; Cooper, Mick; Osman, Sarah; Fugard, Andrew J B; Pybis, Joanne
2017-06-01
The aim of this study was to pilot a test of the effectiveness of school-based humanistic counselling (SBHC) in an ethnically diverse group of young people (aged 11-18 years old), with follow-up assessments at 6 and 9 months. Pilot randomized controlled trial, using linear-mixed effect modelling and intention-to-treat analysis to compare changes in levels of psychological distress for participants in SBHC against usual care (UC). ISRCTN44253140. In total, 64 young people were randomized to either SBHC or UC. Participants were aged between 11 and 18 (M = 14.2, SD = 1.8), with 78.1% of a non-white ethnicity. The primary outcome was psychological distress at 6 weeks (mid-therapy), 12 weeks (end of therapy), 6-month follow-up and 9-month follow-up. Secondary measures included emotional symptoms, self-esteem and attainment of personal goals. Recruitment and retention rates for the study were acceptable. Participants in the SBHC condition, as compared with participants in the UC condition, showed greater reductions in psychological distress and emotional symptoms, and greater improvements in self-esteem, over time. However, at follow-up, only emotional symptoms showed significant differences across groups. The study adds to the pool of evidence suggesting that SBHC can be tested and that it brings about short-term reductions in psychological and emotional distress in young people, across ethnicities. However, there is no evidence of longer-term effects. School-based humanistic counselling can be an effective means of reducing the psychological distress experienced by young people with emotional symptoms in the short term. The short-term effectiveness of school-based humanistic counselling is not limited to young people of a White ethnicity. There is no evidence that school-based humanistic counselling has effects beyond the end of therapy. © 2016 The British Psychological Society.
Energy Technology Data Exchange (ETDEWEB)
Fichorova, Raina N., E-mail: rfichorova@rics.bwh.harvard.edu [Laboratory of Genital Tract Biology, Department of Obstetrics, Gynecology and Reproductive Biology, Brigham and Women' s Hospital and Harvard Medical School, Boston, MA (United States); Mendonca, Kevin; Yamamoto, Hidemi S.; Murray, Ryan [Laboratory of Genital Tract Biology, Department of Obstetrics, Gynecology and Reproductive Biology, Brigham and Women' s Hospital and Harvard Medical School, Boston, MA (United States); Chandra, Neelima; Doncel, Gustavo F. [CONRAD, Department of Obstetrics and Gynecology, Eastern Virginia Medical School, Norfolk, VA (United States)
2015-06-15
Any vaginal product that alters the mucosal environment and impairs the immune barrier increases the risk of sexually transmitted infections, especially HIV infection, which thrives on mucosal damage and inflammation. The FDA-recommended rabbit vaginal irritation (RVI) model serves as a first line selection tool for vaginal products; however, for decades it has been limited to histopathology scoring, insufficient to select safe anti-HIV microbicides. In this study we incorporate to the RVI model a novel quantitative nuclease protection assay (qNPA) to quantify mRNA levels of 25 genes representing leukocyte differentiation markers, toll-like receptors (TLR), cytokines, chemokines, epithelial repair, microbicidal and vascular markers, by designing two multiplex arrays. Tissue sections were obtained from 36 rabbits (6 per treatment arm) after 14 daily applications of a placebo gel, saline, 4% nonoxynol-9 (N-9), and three combinations of the anti-HIV microbicides tenofovir (TFV) and UC781 in escalating concentrations (highest: 10% TFV + 2.5%UC781). Results showed that increased expression levels of toll-like receptor (TLR)-4, interleukin (IL)-1β, CXCL8, epithelial membrane protein (EMP)-1 (P < 0.05), and decreased levels of TLR2 (P < 0.05), TLR3 and bactericidal permeability increasing protein (BPI) (P < 0.001) were associated with cervicovaginal mucosal alteration (histopathology). Seven markers showed a significant linear trend predicting epithelial damage (up with CD4, IL-1β, CXCL8, CCL2, CCL21, EMP1 and down with BPI). Despite the low tissue damage RVI scores, the high-dose microbicide combination gel caused activation of HIV host cells (SLC and CD4) while N-9 caused proinflammatory gene upregulation (IL-8 and TLR4) suggesting a potential for increasing risk of HIV via different mechanisms depending on the chemical nature of the test product. - Highlights: • A transcriptome nuclease protection assay assessed microbicides for vaginal safety. • Biomarkers were
International Nuclear Information System (INIS)
Fichorova, Raina N.; Mendonca, Kevin; Yamamoto, Hidemi S.; Murray, Ryan; Chandra, Neelima; Doncel, Gustavo F.
2015-01-01
Any vaginal product that alters the mucosal environment and impairs the immune barrier increases the risk of sexually transmitted infections, especially HIV infection, which thrives on mucosal damage and inflammation. The FDA-recommended rabbit vaginal irritation (RVI) model serves as a first line selection tool for vaginal products; however, for decades it has been limited to histopathology scoring, insufficient to select safe anti-HIV microbicides. In this study we incorporate to the RVI model a novel quantitative nuclease protection assay (qNPA) to quantify mRNA levels of 25 genes representing leukocyte differentiation markers, toll-like receptors (TLR), cytokines, chemokines, epithelial repair, microbicidal and vascular markers, by designing two multiplex arrays. Tissue sections were obtained from 36 rabbits (6 per treatment arm) after 14 daily applications of a placebo gel, saline, 4% nonoxynol-9 (N-9), and three combinations of the anti-HIV microbicides tenofovir (TFV) and UC781 in escalating concentrations (highest: 10% TFV + 2.5%UC781). Results showed that increased expression levels of toll-like receptor (TLR)-4, interleukin (IL)-1β, CXCL8, epithelial membrane protein (EMP)-1 (P < 0.05), and decreased levels of TLR2 (P < 0.05), TLR3 and bactericidal permeability increasing protein (BPI) (P < 0.001) were associated with cervicovaginal mucosal alteration (histopathology). Seven markers showed a significant linear trend predicting epithelial damage (up with CD4, IL-1β, CXCL8, CCL2, CCL21, EMP1 and down with BPI). Despite the low tissue damage RVI scores, the high-dose microbicide combination gel caused activation of HIV host cells (SLC and CD4) while N-9 caused proinflammatory gene upregulation (IL-8 and TLR4) suggesting a potential for increasing risk of HIV via different mechanisms depending on the chemical nature of the test product. - Highlights: • A transcriptome nuclease protection assay assessed microbicides for vaginal safety. • Biomarkers were
Directory of Open Access Journals (Sweden)
Wei Gao
2014-01-01
Full Text Available Background/Aims: Na+/H+ exchanger 1 (NHE1 is an important regulator of intracellular pH (pHi. High pHi is required for cell proliferation and differentiation. Our previous study has proven that the pHi of mesenchymal stem cells is higher than that of normal differentiated cells and similar to tumor cells. NHE1 is highly expressed in both mesenchymal stem cells and tumor cells. Targeted inhibition of NHE1 could induce differentiation of K562 leukemia cells. In the present paper we explored whether inhibition of NHE1 could induce differentiation of mesenchymal stem cells. Methods: MSCs were obtained from human umbilical cord and both the surface phenotype and functional characteristics were analyzed. Selective NHE1 inhibitor cariporide was used to treat human umbilical cord-derived mesenchymal stem cells (hUC-MSCs. The pHi and the differentiation of hUC-MSCs were compared upon cariporide treatment. The putative signaling pathway involved was also explored. Results: The pHi of hUC-MSCs was decreased upon cariporide treatment. Cariporide up-regulated the osteogenic differentiation of hUC-MSCs while the adipogenic differentiation was not affected. For osteogenic differentiation, β-catenin expression was up-regulated upon cariporide treatment. Conclusion: Decreased pHi induced by cariporide differentially contributes to hUC-MSCs differentiation.
Directory of Open Access Journals (Sweden)
Bourn J
2018-06-01
Full Text Available Jennifer Bourn,1,2 Maria Cekanova1,2 1Department of Small Animal Clinical Sciences, College of Veterinary Medicine, The University of Tennessee, Knoxville, TN, USA; 2UT-ORNL Graduate School of Genome Science and Technology, The University of Tennessee, Knoxville, TN, USA Purpose: Receptor tyrosine kinase inhibitors (RTKIs are used as targeted therapies for patients diagnosed with cancer with highly expressed receptor tyrosine kinases (RTKs, including the platelet-derived growth factor receptor (PDGFR and c-Kit receptor. Resistance to targeted therapies is partially due to the activation of alternative pro-survival signaling pathways, including cyclooxygenase (COX-2. In this study, we validated the effects of two RTKIs, axitinib and AB1010, in combination with COX inhibitors on the V-akt murine thymoma oncogene homolog 1 (Akt and COX-2 signaling pathways in bladder cancer cells.Methods: The expression of several RTKs and their downstream signaling targets was analyzed by Western blot (WB analysis in human and canine bladder transitional cell carcinoma (TCC cell lines. The effects of RTKIs and COX inhibitors in bladder TCC cells were assessed by MTS for cell viability, by Caspase-3/7 and Annexin V assay for apoptosis, by WB analysis for detection of COX-2 and Akt signaling pathways, and by enzyme-linked immunosorbent assay for detection of prostaglandin E2 (PGE2 levels.Results: All tested TCC cells expressed the c-Kit and PDGFRα receptors, except human 5637 cells that had low RTKs expression. In addition, all tested cells expressed COX-1, COX-2, Akt, extracellular signal regulated kinases 1/2, and nuclear factor kappa-light-chain-enhance of activated B cells proteins, except human UM-UC-3 cells, where no COX-2 expression was detected by WB analysis. Both RTKIs inhibited cell viability and increased apoptosis in a dose-dependent manner in tested bladder TCC cells, which positively correlated with their expression levels of the PDGFRα and c
Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino
2007-10-01
Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.
Proteinaceous alpha-araylase inhibitors
DEFF Research Database (Denmark)
Svensson, Birte; Fukuda, Kenji; Nielsen, P.K.
2004-01-01
-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha...
Chihara, Kazuyasu; Kimura, Yukihiro; Honjo, Chisato; Takeuchi, Kenji; Sada, Kiyonao
2013-01-01
Non-receptor type of protein-tyrosine kinase Syk (spleen tyrosine kinase) was isolated in University of Fukui in 1991. Syk is most highly expressed by haemopoietic cells and known to play crucial roles in the signal transduction through various immunoreceptors of the adaptive immune response. However, recent reports demonstrate that Syk also mediates other biological functions, such as innate immune response, osteoclast maturation, platelet activation and cellular adhesion. Moreover, ectopic expression of Syk by epigenetic changes is reported to cause retinoblastoma. Because of its critical roles on the cellular functions, the development of Syk inhibitors for clinical use has been desired. Although many candidate compounds were produced, none of them had progressed to clinical trials. However, novel Syk inhibitors were finally developed and its usefulness has been evaluated in the treatment of allergic rhinitis, rheumatoid arthritis and idiopathic thrombocytopenic purpura. In this review, we will summarize the history, structure and function of Syk, and then the novel Syk inhibitors and their current status. In addition, we will introduce our research focused on the functions of Syk on Dectin-1-mediated mast cell activation.
Energy Technology Data Exchange (ETDEWEB)
Vural, B.; Erdinc, O.; Uzunoglu, M. [Department of Electrical Engineering, Yildiz Technical University, Istanbul 34349 (Turkey)
2010-12-15
Fuel cells (FC) are widely recognized as one of the most promising technologies to meet future power requirements of vehicular applications. However, a FC system combined with an energy storage system (ESS) can perform better for vehicle propulsion as considering several points. As the additional ESS can fulfill the transient power demand fluctuations, the FC system can be downsized to fit the base power demand without facing peak loads. Besides, braking energy can be recovered by the ESS. Interfacing of traction drive requirements with characteristics and modes of operation of on-board generation units and ESSs calls for suitable power electronic converter configuration. In this paper, a FC/UC hybrid vehicular power system using a multi-input converter-based power interface is proposed. The applied power interface topology ensures the active power sharing and DC link voltage stabilization for the hybrid vehicular system. The mathematical and electrical models of the hybrid vehicular system are developed in detail and simulated using MATLAB registered, Simulink registered and SimPowerSystems registered environments. (author)
International Nuclear Information System (INIS)
Vural, B.; Erdinc, O.; Uzunoglu, M.
2010-01-01
Fuel cells (FC) are widely recognized as one of the most promising technologies to meet future power requirements of vehicular applications. However, a FC system combined with an energy storage system (ESS) can perform better for vehicle propulsion as considering several points. As the additional ESS can fulfill the transient power demand fluctuations, the FC system can be downsized to fit the base power demand without facing peak loads. Besides, braking energy can be recovered by the ESS. Interfacing of traction drive requirements with characteristics and modes of operation of on-board generation units and ESSs calls for suitable power electronic converter configuration. In this paper, a FC/UC hybrid vehicular power system using a multi-input converter-based power interface is proposed. The applied power interface topology ensures the active power sharing and DC link voltage stabilization for the hybrid vehicular system. The mathematical and electrical models of the hybrid vehicular system are developed in detail and simulated using MATLAB (registered) , Simulink (registered) and SimPowerSystems (registered) environments.
Directory of Open Access Journals (Sweden)
Marlien Pieters
Full Text Available Due to controversial evidence in the literature pertaining to the activity of plasminogen activator inhibitor-1 in platelets, we examined the effects of residual platelets present in plasma (a potential pre-analytical variable on various plasminogen activator inhibitor-1 and plasminogen activator inhibitor-1-related assays. Blood samples were collected from 151 individuals and centrifuged at 352 and 1500 g to obtain plasma with varying numbers of platelet. In a follow-up study, blood samples were collected from an additional 23 individuals, from whom platelet-poor (2000 g, platelet-containing (352 g and platelet-rich plasma (200 g were prepared and analysed as fresh-frozen and after five defrost-refreeze cycles (to determine the contribution of in vitro platelet degradation. Plasminogen activator inhibitor-1 activity, plasminogen activator inhibitor-1 antigen, tissue plasminogen activator/plasminogen activator inhibitor-1 complex, plasma clot lysis time, β-thromboglobulin and plasma platelet count were analysed. Platelet α-granule release (plasma β-thromboglobulin showed a significant association with plasminogen activator inhibitor-1 antigen levels but weak associations with plasminogen activator inhibitor-1 activity and a functional marker of fibrinolysis, clot lysis time. Upon dividing the study population into quartiles based on β-thromboglobulin levels, plasminogen activator inhibitor-1 antigen increased significantly across the quartiles while plasminogen activator inhibitor-1 activity and clot lysis time tended to increase in the 4th quartile only. In the follow-up study, plasma plasminogen activator inhibitor-1 antigen was also significantly influenced by platelet count in a concentration-dependent manner. Plasma plasminogen activator inhibitor-1 antigen levels increased further after complete platelet degradation. Residual platelets in plasma significantly influence plasma plasminogen activator inhibitor-1 antigen levels mainly
Directory of Open Access Journals (Sweden)
Costanza Bogani
Full Text Available BACKGROUND: Dysregulated signaling of the JAK/STAT pathway is a common feature of chronic myeloproliferative neoplasms (MPN, usually associated with JAK2V617F mutation. Recent clinical trials with JAK2 inhibitors showed significant improvements in splenomegaly and constitutional symptoms in patients with myelofibrosis but meaningful molecular responses were not documented. Accordingly, there remains a need for exploring new treatment strategies of MPN. A potential additional target for treatment is represented by the PI3K/AKT/mammalian target of rapamycin (mTOR pathway that has been found constitutively activated in MPN cells; proof-of-evidence of efficacy of the mTOR inhibitor RAD001 has been obtained recently in a Phase I/II trial in patients with myelofibrosis. The aim of the study was to characterize the effects in vitro of mTOR inhibitors, used alone and in combination with JAK2 inhibitors, against MPN cells. FINDINGS: Mouse and human JAK2V617F mutated cell lines and primary hematopoietic progenitors from MPN patients were challenged with an allosteric (RAD001 and an ATP-competitive (PP242 mTOR inhibitor and two JAK2 inhibitors (AZD1480 and ruxolitinib. mTOR inhibitors effectively reduced proliferation and colony formation of cell lines through a slowed cell division mediated by changes in cell cycle transition to the S-phase. mTOR inhibitors also impaired the proliferation and prevented colony formation from MPN hematopoietic progenitors at doses significantly lower than healthy controls. JAK2 inhibitors produced similar antiproliferative effects in MPN cell lines and primary cells but were more potent inducers of apoptosis, as also supported by differential effects on cyclinD1, PIM1 and BcLxL expression levels. Co-treatment of mTOR inhibitor with JAK2 inhibitor resulted in synergistic activity against the proliferation of JAK2V617F mutated cell lines and significantly reduced erythropoietin-independent colony growth in patients with
Herpes Zoster Infection in Patients With Ulcerative Colitis Receiving Tofacitinib.
Winthrop, Kevin L; Melmed, Gil Y; Vermeire, Séverine; Long, Millie D; Chan, Gary; Pedersen, Ronald D; Lawendy, Nervin; Thorpe, Andrew J; Nduaka, Chudy I; Su, Chinyu
2018-05-30
Tofacitinib is an oral, small molecule Janus kinase inhibitor that is being investigated for ulcerative colitis (UC). Tofacitinib is approved for rheumatoid arthritis and psoriatic arthritis, where it has been shown to increase herpes zoster (HZ) risk. We evaluated HZ risk among UC patients using tofacitinib. HZ cases were identified in tofacitinib phase II/III/ongoing, open-label, long-term extension (OLE) UC trials. We calculated HZ incidence rates (IRs) per 100 patient-years of tofacitinib exposure within phase III maintenance (Maintenance Cohort) and phase II/III/OLE (Overall Cohort) studies, stratified by baseline demographics and other factors. HZ risk factors were evaluated in the Overall Cohort using Cox proportional hazard models. Overall, 65 (5.6%) patients developed HZ. Eleven patients had multidermatomal involvement (2 nonadjacent or 3-6 adjacent dermatomes), and 1 developed encephalitis (resolved upon standard treatment). Five (7.7%) events led to treatment discontinuation. HZ IR (95% confidence interval [CI]) in the Overall Cohort was 4.07 (3.14-5.19) over a mean (range) of 509.1 (1-1606) days, with no increased risk observed with increasing tofacitinib exposure. IRs (95% CI) were highest in patients age ≥65 years, 9.55 (4.77-17.08); Asian patients, 6.49 (3.55-10.89); patients with prior tumor necrosis factor inhibitor (TNFi) failure, 5.38 (3.86-7.29); and patients using tofacitinib 10 mg twice daily, 4.25 (3.18-5.56). Multivariate analysis identified older age and prior TNFi failure as independent risk factors. In tofacitinib-treated UC patients, there was an elevated risk of HZ, although complicated HZ was infrequent. Increased HZ rates occurred in patients who were older, Asian, or had prior TNFi failure (NCT00787202, NCT01465763, NCT01458951, NCT01458574, NCT01470612).
Exploiting the anti-HIV 6-desfluoroquinolones to design multiple ligands.
Sancineto, Luca; Iraci, Nunzio; Barreca, Maria Letizia; Massari, Serena; Manfroni, Giuseppe; Corazza, Gianmarco; Cecchetti, Violetta; Marcello, Alessandro; Daelemans, Dirk; Pannecouque, Christophe; Tabarrini, Oriana
2014-09-01
It is getting clearer that many drugs effective in different therapeutic areas act on multiple rather than single targets. The application of polypharmacology concepts might have numerous advantages especially for disease such as HIV/AIDS, where the rapid emergence of resistance requires a complex combination of more than one drug. In this paper, we have designed three hybrid molecules combining WM5, a quinolone derivative we previously identified as HIV Tat-mediated transcription (TMT) inhibitor, with the tricyclic core of nevirapine and BILR 355BS (BILR) non-nucleoside reverse transcriptase inhibitors (NNRTIs) to investigate whether it could be possible to obtain molecules acting on both transcription steps of the HIV replicative cycle. One among the three designed multiple ligands, reached this goal. Indeed, compound 1 inhibited both TMT and reverse transcriptase (RT) activity. Unexpectedly, while the anti-TMT activity exerted by compound 1 resulted into a selective inhibition of HIV-1 reactivation from latently infected OM10.1 cells, the anti-RT properties shown by all of the synthesized compounds did not translate into an anti-HIV activity in acutely infected cells. Thus, we have herein produced the proof of concept that the design of dual TMT-RT inhibitors is indeed possible, but optimization efforts are needed to obtain more potent derivatives. Copyright © 2014 Elsevier Ltd. All rights reserved.
Karchava, Marine; Pulver, Wendy; Smith, Lou; Philpott, Sean; Sullivan, Timothy J.; Wethers, Judith; Parker, Monica M.
2010-01-01
Summary Prevalence studies indicate that transmission of drug-resistant HIV has been rising in the adult population, but data from the perinatally infected pediatric population are limited. In this retrospective study, we sequenced the pol region of HIV from perinatally infected infants diagnosed in New York State in 2001–2002. Analyses of drug resistance, subtype diversity, and perinatal antiretroviral exposure were conducted, and the results were compared with those from a previous study of HIV-infected infants identified in 1998–1999. Eight of 42 infants (19.1%) had provirus carrying at least 1 drug-resistance mutation, an increase of 58% over the 1998–1999 results. Mutations conferring resistance to nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors, and protease inhibitors were detected in 7.1%, 11.9%, and 2.4% of specimens, respectively. Consistent with previous results, perinatal antiretroviral exposure was not associated with drug resistance (P = 0.70). Phylogenetic analysis indicated that 16.7% of infants were infected with a non–subtype B strain of HIV. It seems that drug-resistant and non–subtype B strains of HIV are becoming increasingly common in the perinatally infected population. Our results highlight the value of resistance testing for all HIV-infected infants upon diagnosis and the need to consider subtype diversity in diagnostic and treatment strategies. PMID:16868498
Low prevalence of primary HIV resistance in western Massachusetts.
Iarikov, Dmitri E; Irizarry-Acosta, Melina; Martorell, Claudia; Hoffman, Robert P; Skiest, Daniel J
2010-01-01
Most studies of primary antiretroviral (ARV) resistance have been conducted in large metropolitan areas with reported rates of 8% to 25%. We collected data on 99 HIV-1-infected antiretroviral-naive patients from several sites in Springfield, MA, who underwent genotypic resistance assay between 2004 and 2008. Only major resistance mutations per International AIDS Society-USA (IAS-USA) drug resistance mutations list were considered. The prevalence of resistance was 5% (5 of 99). Three patients had one nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation: 103N, 103N, and 190A, 1 patient had a protease inhibitor (PI) mutation: 90M; and 1 patient had 3-class resistance with NNRTI: 181C, 190A, PI: 90M, and nucleoside analogue reverse transcriptase inhibitor (NRTI): 41L, 210W. Mean time from HIV diagnosis to resistance testing was shorter in patients with resistance versus those without: 9 (range 0.3-42 months) versus 27 (range 0.1-418 months), P = .11. There was a trend to lower mean CD4 count in those with resistance, 170 versus 318 cells/mm(3), P = .06. No differences were noted in gender, age, HIV risk category, or HIV RNA level. The low prevalence of primary resistance may be explained by differences in demographic and risk factors or may reflect the time from infection to resistance testing. Our findings emphasize the importance of continued resistance surveillance.
Vitamin E concentrations in adults with HIV/AIDS on highly active antiretroviral therapy.
Itinoseki Kaio, Daniella J Itinoseki; Rondó, Patricia Helen C; Luzia, Liania Alves; Souza, José Maria P; Firmino, Aline Vale; Santos, Sigrid Sousa
2014-09-15
HIV/AIDS patients are probably more predisposed to vitamin E deficiency, considering that they are more exposed to oxidative stress. Additionally, there are an extensive number of drugs in the highly active antiretroviral therapy (HAART) regimens that may interfere with vitamin E concentrations. The objective of this study was to compare serum concentrations of alpha-tocopherol in 182 HIV/AIDS patients receiving different HAART regimens. The patients were divided into three groups according to regimen: nucleoside analog reverse-transcriptase inhibitors (NRTIs) + non-nucleoside analog reverse-transcriptase inhibitors (NNRTIs); NRTIs + protease inhibitors + ritonavir; NRTIs + other classes. Alpha-tocopherol was assessed by high-performance liquid chromatography. Multiple linear regression analysis was used to evaluate the effects of HAART regimen, time of use, and compliance with the regimen on alpha-tocopherol concentrations. Alpha-tocopherol concentrations were on average 4.12 μmol/L lower for the NRTIs + other classes regimen when compared to the NRTIs + NNRTIs regimen (p = 0.037). A positive association (p < 0.001) was observed between alpha-tocopherol and cholesterol concentrations, a finding due, in part, to the relationship between liposoluble vitamins and lipid profile. This study demonstrated differences in alpha-tocopherol concentrations between patients using different HAART regimens, especially regimens involving the use of new drugs. Long-term prospective cohort studies are needed to monitor vitamin E status in HIV/AIDS patients since the beginning of treatment.
Histone deacetylase inhibitors (HDACIs): multitargeted anticancer agents.
Ververis, Katherine; Hiong, Alison; Karagiannis, Tom C; Licciardi, Paul V
2013-01-01
Histone deacetylase (HDAC) inhibitors are an emerging class of therapeutics with potential as anticancer drugs. The rationale for developing HDAC inhibitors (and other chromatin-modifying agents) as anticancer therapies arose from the understanding that in addition to genetic mutations, epigenetic changes such as dysregulation of HDAC enzymes can alter phenotype and gene expression, disturb homeostasis, and contribute to neoplastic growth. The family of HDAC inhibitors is large and diverse. It includes a range of naturally occurring and synthetic compounds that differ in terms of structure, function, and specificity. HDAC inhibitors have multiple cell type-specific effects in vitro and in vivo, such as growth arrest, cell differentiation, and apoptosis in malignant cells. HDAC inhibitors have the potential to be used as monotherapies or in combination with other anticancer therapies. Currently, there are two HDAC inhibitors that have received approval from the US FDA for the treatment of cutaneous T-cell lymphoma: vorinostat (suberoylanilide hydroxamic acid, Zolinza) and depsipeptide (romidepsin, Istodax). More recently, depsipeptide has also gained FDA approval for the treatment of peripheral T-cell lymphoma. Many more clinical trials assessing the effects of various HDAC inhibitors on hematological and solid malignancies are currently being conducted. Despite the proven anticancer effects of particular HDAC inhibitors against certain cancers, many aspects of HDAC enzymes and HDAC inhibitors are still not fully understood. Increasing our understanding of the effects of HDAC inhibitors, their targets and mechanisms of action will be critical for the advancement of these drugs, especially to facilitate the rational design of HDAC inhibitors that are effective as antineoplastic agents. This review will discuss the use of HDAC inhibitors as multitargeted therapies for malignancy. Further, we outline the pharmacology and mechanisms of action of HDAC inhibitors while
1-(4-Bromobenzoyl-2-phenylpyrrolidine-2-carboxamide
Directory of Open Access Journals (Sweden)
Vahan Martirosyan
2008-03-01
Full Text Available In the title compound, C18H17BrN2O2, which is a potential human immunodeficiency virus type 1 (HIV-1 non-nucleoside reverse transcriptase inhibitor, the pyrrolidine ring exhibits an envelope conformation. In the crystal structure, intermolecular N—H...O hydrogen bonds [N...O = 2.861 (3 Å] link the molecules into centrosymmetric dimers.
7-Chloro-11a-phenyl-2,3,5,10,11,11a-hexahydro-1H-pyrrolo[2,1-c][1,4]benzodiazepine-5,11-dione
Directory of Open Access Journals (Sweden)
Vahan Martirosyan
2008-03-01
Full Text Available The title compound, C18H15ClN2O2, is a potential human immunodeficiency virus type-1 (HIV-1 non-nucleoside reverse transcriptase inhibitor. The pyrrolidine ring adopts an envelope and the diazepine ring a boat conformation. In the crystal structure, two isomers (R and S form centrosymmetric dimers via N—H...O hydrogen bonds.
McCormack, Shelley A; Best, Brookie M
2014-11-01
Maternal-to-fetal transfer of antiretroviral drugs contributes to prevention of vertical transmission of HIV. This systematic review discusses published studies containing data pertaining to the pharmacokinetics of placental transfer of antiretrovirals in humans, including paired cord and maternal plasma samples collected at the time of delivery as well as ex vivo placental perfusion models. Articles pertaining to placental transfer of antiretrovirals were identified from PubMed, from references of included articles, and from US Department of Health and Human Services Panel on Treatment of HIV-infected Pregnant Women and Prevention of Perinatal Transmission guidelines. Articles from non-human animal models or that had no original maternal-to-fetal transfer data were excluded. PRISMA guidelines were followed. A total of 103 published studies were identified. Data across studies appeared relatively consistent for the nucleoside reverse transcriptase inhibitors (NRTIs) and the non-nucleotide reverse transcriptase inhibitors (NNRTIs), with cord to maternal ratios approaching 1 for many of these agents. The protease inhibitors atazanavir and lopinavir exhibited consistent maternal-to-fetal transfer across studies, although the transfer may be influenced by variations in drug-binding proteins. The protease inhibitors indinavir, nelfinavir, and saquinavir exhibited unreliable placental transport, with cord blood concentrations that were frequently undetectable. Limited data, primarily from case reports, indicate that darunavir and raltegravir provide detectable placental transfer. These findings appear consistent with current guidelines of using two NRTIs plus an NNRTI, atazanavir/ritonavir, or lopinavir/ritonavir to maximize placental transfer as well as to optimally suppress maternal viral load. Darunavir/ritonavir and raltegravir may reasonably serve as second-line agents.
Ngai, Patrick H K; Ng, T B
2003-11-14
From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.
Luo, Caidian
1998-12-01
Common methods employed in the ethanol production from biomass consist of chemical or enzymatic degradation of biomass into sugars and then fermentation of sugars into ethanol or other chemicals. However, some degradation products severely inhibit the fermentation processes and substantially reduce the efficiency of ethanol production. How to remove inhibitors from the reaction product mixture and increase the production efficiency are critical in the commercialization of any processes of energy from biomass. The present study has investigated anion exchange and liquid-liquid extraction as potential methods for inhibitor removal. An analytical method has been developed to identify the fermentation inhibitors in a hydrolyzate. The majority of inhibitors present in hybrid poplar hydrolyzate have positively been identified. Ion exchange with weak basic Dowex-MWA-1 resin has been proved to be an effective mean to remove fermentation inhibitors from hybrid poplar hydrolyzate and significantly increase the fermentation productivity. Extraction with n-butanol might be a preferred way to remove inhibitors from wood hydrolyzates and improve the fermentability of sugars in the hydrolyzates. n-Butanol also removes some glucose, mannose and xylose from the hydrolyzate. Inhibitor identification reveals that lignin and sugar degradation compounds including both aromatic and aliphatic aldehydes and carboxylic acids formed in hydrolysis, plus fatty acids and other components from wood extractives are major fermentation inhibitors in Sacchromyces cerevisiae fermentation. There are 35 components identified as fermentation inhibitors. Among them, 4-hydroxy benzoic acid, 3,4-dihydroxy benzoic acid, syringic acid, syringaldehyde, and ferulic acid are among the most abundant aromatic inhibitors in hybrid poplar hydrolyzate. The conversion of aldehyde groups into carboxylic acid groups in the nitric acid catalyzed hydrolysis reduces the toxicity of the hydrolyzate. A wide spectrum of
Machado, Suzy Wider; de Oliveira, Caio Fernando Ramalho; Zério, Neide Graciano; Parra, José Roberto Postali; Macedo, Maria Lígia Rodrigues
2017-08-01
Plant protease inhibitors (PIs) are elements of a common plant defense mechanism induced in response to herbivores. The fall armyworm, Spodoptera frugiperda, a highly polyphagous lepidopteran pest, responds to various PIs in its diet by expressing genes encoding trypsins. This raises the question of whether the PI-induced trypsins are also inhibited by other PIs, which we posed as the hypothesis that Inga laurina trypsin inhibitor (ILTI) inhibits PI-induced trypsins in S. frugiperda. In the process of testing our hypothesis, we compared its properties with those of selected PIs, soybean Kunitz trypsin inhibitor (SKTI), Inga vera trypsin inhibitor (IVTI), Adenanthera pavonina trypsin inhibitor (ApTI), and Entada acaciifolia trypsin inhibitor (EATI). We report that ILTI is more effective in inhibiting the induced S. frugiperda trypsins than SKTI and the other PIs, which supports our hypothesis. ILTI may be more appropriate than SKTI for studies regarding adaptive mechanisms to dietary PIs. © 2017 Wiley Periodicals, Inc.
Reduction rules for reset/inhibitor nets
Verbeek, H.M.W.; Wynn, M.T.; Aalst, van der W.M.P.; Hofstede, ter A.H.M.
2010-01-01
Reset/inhibitor nets are Petri nets extended with reset arcs and inhibitor arcs. These extensions can be used to model cancellation and blocking. A reset arc allows a transition to remove all tokens from a certain place when the transition fires. An inhibitor arc can stop a transition from being
Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z
2017-07-11
Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From
Histone deacetylase inhibitors (HDACIs: multitargeted anticancer agents
Directory of Open Access Journals (Sweden)
Ververis K
2013-02-01
Full Text Available Katherine Ververis,1 Alison Hiong,1 Tom C Karagiannis,1,* Paul V Licciardi2,*1Epigenomic Medicine, Alfred Medical Research and Education Precinct, 2Allergy and Immune Disorders, Murdoch Childrens Research Institute, Melbourne, VIC, Australia*These authors contributed equally to this workAbstract: Histone deacetylase (HDAC inhibitors are an emerging class of therapeutics with potential as anticancer drugs. The rationale for developing HDAC inhibitors (and other chromatin-modifying agents as anticancer therapies arose from the understanding that in addition to genetic mutations, epigenetic changes such as dysregulation of HDAC enzymes can alter phenotype and gene expression, disturb homeostasis, and contribute to neoplastic growth. The family of HDAC inhibitors is large and diverse. It includes a range of naturally occurring and synthetic compounds that differ in terms of structure, function, and specificity. HDAC inhibitors have multiple cell type-specific effects in vitro and in vivo, such as growth arrest, cell differentiation, and apoptosis in malignant cells. HDAC inhibitors have the potential to be used as monotherapies or in combination with other anticancer therapies. Currently, there are two HDAC inhibitors that have received approval from the US FDA for the treatment of cutaneous T-cell lymphoma: vorinostat (suberoylanilide hydroxamic acid, Zolinza and depsipeptide (romidepsin, Istodax. More recently, depsipeptide has also gained FDA approval for the treatment of peripheral T-cell lymphoma. Many more clinical trials assessing the effects of various HDAC inhibitors on hematological and solid malignancies are currently being conducted. Despite the proven anticancer effects of particular HDAC inhibitors against certain cancers, many aspects of HDAC enzymes and HDAC inhibitors are still not fully understood. Increasing our understanding of the effects of HDAC inhibitors, their targets and mechanisms of action will be critical for the
Current concepts of metabolic abnormalities in HIV patients: focus on lipodystrophy.
Kolter, Donald P
2003-12-01
HIV infection is associated with a number of metabolic abnormalities, including lipodystrophy, a difficult-to-define disorder whose characteristics include hyperlipidemia, insulin resistance, and fat redistribution. Current data suggest that lipodystrophy is caused by multiple factors. Dual-nucleoside reverse transcriptase inhibitor therapy combined with protease inhibitor therapy has been shown to increase the risk of metabolic abnormalities, but susceptibility independent of drug effects has also been shown. While many of the treatments for the broad range of signs and symptoms of lipodystrophy bring about improvements in patient status, none have been demonstrated to bring about a return to baseline levels.
High pressure behaviour of uranium dicarbide (UC{sub 2}): Ab-initio study
Energy Technology Data Exchange (ETDEWEB)
Sahoo, B. D., E-mail: bdsahoo@barc.gov.in; Mukherjee, D.; Joshi, K. D.; Kaushik, T. C. [Applied Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)
2016-08-28
The structural stability of uranium dicarbide has been examined under hydrostatic compression employing evolutionary structure search algorithm implemented in the universal structure predictor: evolutionary Xtallography (USPEX) code in conjunction with ab-initio electronic band structure calculation method. The ab-initio total energy calculations involved for this purpose have been carried out within both generalized gradient approximations (GGA) and GGA + U approximations. Our calculations under GGA approximation predict the high pressure structural sequence of tetragonal → monoclinic → orthorhombic for this material with transition pressures of ∼8 GPa and 42 GPa, respectively. The same transition sequence is predicted by calculations within GGA + U also with transition pressures placed at ∼24 GPa and ∼50 GPa, respectively. Further, on the basis of comparison of zero pressure equilibrium volume and equation of state with available experimental data, we find that GGA + U approximation with U = 2.5 eV describes this material better than the simple GGA approximation. The theoretically predicted high pressure structural phase transitions are in disagreement with the only high experimental study by Dancausse et al. [J. Alloys. Compd. 191, 309 (1993)] on this compound which reports a tetragonal to hexagonal phase transition at a pressure of ∼17.6 GPa. Interestingly, during lowest enthalpy structure search using USPEX, we do not see any hexagonal phase to be closer to the predicted monoclinic phase even within 0.2 eV/f. unit. More experiments with varying carbon contents in UC{sub 2} sample are required to resolve this discrepancy. The existence of these high pressure phases predicted by static lattice calculations has been further substantiated by analyzing the elastic and lattice dynamic stability of these structures in the pressure regimes of their structural stability. Additionally, various thermo-physical quantities such as
Artico, M; Di Santo, R; Costi, R; Novellino, E; Greco, G; Massa, S; Tramontano, E; Marongiu, M E; De Montis, A; La Colla, P
1998-10-08
Various cinnammoyl-based structures were synthesized and tested in enzyme assays as inhibitors of the HIV-1 integrase (IN). The majority of compounds were designed as geometrically or conformationally constrained analogues of caffeic acid phenethyl ester (CAPE) and were characterized by a syn disposition of the carbonyl group with respect to the vinylic double bond. Since the cinnamoyl moiety present in flavones such as quercetin (inactive on HIV-1-infected cells) is frozen in an anti arrangement, it was hoped that fixing our compounds in a syn disposition could favor anti-HIV-1 activity in cell-based assays. Geometrical and conformational properties of the designed compounds were taken into account through analysis of X-ray structures available from the Cambridge Structural Database. The polyhydroxylated analogues were prepared by reacting 3,4-bis(tetrahydropyran-2-yloxy)benzaldehyde with various compounds having active methylene groups such as 2-propanone, cyclopentanone, cyclohexanone, 1,3-diacetylbenzene, 2, 4-dihydroxyacetophenone, 2,3-dihydro-1-indanone, 2,3-dihydro-1, 3-indandione, and others. While active against both 3'-processing and strand-transfer reactions, the new compounds, curcumin included, failed to inhibit the HIV-1 multiplication in acutely infected MT-4 cells. Nevertheless, they specifically inhibited the enzymatic reactions associated with IN, being totally inactive against other viral (HIV-1 reverse transcriptase) and cellular (RNA polymerase II) nucleic acid-processing enzymes. On the other hand, title compounds were endowed with remarkable antiproliferative activity, whose potency correlated neither with the presence of catechols (possible source of reactive quinones) nor with inhibition of topoisomerases. The SARs developed for our compounds led to novel findings concerning the molecular determinants of IN inhibitory activity within the class of cinnamoyl-based structures. We hypothesize that these compounds bind to IN featuring the
Histone Deacetylase Inhibitors as Anticancer Drugs.
Eckschlager, Tomas; Plch, Johana; Stiborova, Marie; Hrabeta, Jan
2017-07-01
Carcinogenesis cannot be explained only by genetic alterations, but also involves epigenetic processes. Modification of histones by acetylation plays a key role in epigenetic regulation of gene expression and is controlled by the balance between histone deacetylases (HDAC) and histone acetyltransferases (HAT). HDAC inhibitors induce cancer cell cycle arrest, differentiation and cell death, reduce angiogenesis and modulate immune response. Mechanisms of anticancer effects of HDAC inhibitors are not uniform; they may be different and depend on the cancer type, HDAC inhibitors, doses, etc. HDAC inhibitors seem to be promising anti-cancer drugs particularly in the combination with other anti-cancer drugs and/or radiotherapy. HDAC inhibitors vorinostat, romidepsin and belinostat have been approved for some T-cell lymphoma and panobinostat for multiple myeloma. Other HDAC inhibitors are in clinical trials for the treatment of hematological and solid malignancies. The results of such studies are promising but further larger studies are needed. Because of the reversibility of epigenetic changes during cancer development, the potency of epigenetic therapies seems to be of great importance. Here, we summarize the data on different classes of HDAC inhibitors, mechanisms of their actions and discuss novel results of preclinical and clinical studies, including the combination with other therapeutic modalities.
Histone Deacetylase Inhibitors as Anticancer Drugs
Directory of Open Access Journals (Sweden)
Tomas Eckschlager
2017-07-01
Full Text Available Carcinogenesis cannot be explained only by genetic alterations, but also involves epigenetic processes. Modification of histones by acetylation plays a key role in epigenetic regulation of gene expression and is controlled by the balance between histone deacetylases (HDAC and histone acetyltransferases (HAT. HDAC inhibitors induce cancer cell cycle arrest, differentiation and cell death, reduce angiogenesis and modulate immune response. Mechanisms of anticancer effects of HDAC inhibitors are not uniform; they may be different and depend on the cancer type, HDAC inhibitors, doses, etc. HDAC inhibitors seem to be promising anti-cancer drugs particularly in the combination with other anti-cancer drugs and/or radiotherapy. HDAC inhibitors vorinostat, romidepsin and belinostat have been approved for some T-cell lymphoma and panobinostat for multiple myeloma. Other HDAC inhibitors are in clinical trials for the treatment of hematological and solid malignancies. The results of such studies are promising but further larger studies are needed. Because of the reversibility of epigenetic changes during cancer development, the potency of epigenetic therapies seems to be of great importance. Here, we summarize the data on different classes of HDAC inhibitors, mechanisms of their actions and discuss novel results of preclinical and clinical studies, including the combination with other therapeutic modalities.
Directory of Open Access Journals (Sweden)
Xiuying Li
2016-01-01
Full Text Available It has been reported that human mesenchymal stem cells are able to inhibit T lymphocyte activation; however, the discrepancy among different sources of MSCs is not well documented. In this study, we have compared the MSCs from bone marrow (BM, adipose tissue (AT, placenta (PL, and umbilical cord (UC to determine which one displayed the most efficient immunosuppressive effects on phytohemagglutinin-induced T cell proliferation. Among them we found that hUC-MSC has the strongest effects on inhibiting T cell proliferation and is chosen to do the further study. We observed that T lymphocyte spontaneously released abundant IFN-γ. And IFN-γ secreted by T lymphocyte could induce the expression of indoleamine 2, 3-dioxygenase (IDO in hUC-MSCs. IDO was previously reported to induce T lymphocyte apoptosis and cell cycle arrest in S phase. When cocultured with hUC-MSCs, T lymphocyte expression of caspase 3 was significantly increased, while Bcl2 and CDK4 mRNA expression decreased dramatically. Addition of 1-methyl tryptophan (1-MT, an IDO inhibitor, restored T lymphocyte proliferation, reduced apoptosis, and induced resumption of the cell cycle. In addition, the changes in caspase 3, CDK4, and Bcl2 expression were reversed by 1-MT. These findings demonstrate that hUC-MSCs induce T lymphocyte apoptosis and cell cycle arrest by expressing abundant IDO and provide an explanation for some of the immunomodulatory effects of MSCs.
Li, An; Ziehr, Jessica L; Johnson, Kenneth A
2017-04-21
Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Howard, Andrew W.; Marcy, Geoffrey W.; Isaacson, Howard; Johnson, John Asher; Fischer, Debra A.; Wright, Jason T.; Henry, Gregory W.; Valenti, Jeff A.; Anderson, Jay; Piskunov, Nikolai E.
2011-01-01
We report the discovery of planets orbiting two bright, nearby early K dwarf stars, HD 97658 and Gl 785. These planets were detected by Keplerian modeling of radial velocities measured with Keck-HIRES for the NASA-UC Eta-Earth Survey. HD 97658 b is a close-in super-Earth with minimum mass Msin i = 8.2 ± 1.2 M + , orbital period P = 9.494 ± 0.005 days, and an orbit that is consistent with circular. Gl 785 b is a Neptune-mass planet with Msin i = 21.6 ± 2.0 M + , P = 74.39 ± 0.12 days, and orbital eccentricity e = 0.30 ± 0.09. Photometric observations with the T12 0.8 m automatic photometric telescope at Fairborn Observatory show that HD 97658 is photometrically constant at the radial velocity period to 0.09 mmag, supporting the existence of the planet.
[ACE inhibitors and the kidney].
Hörl, W H
1996-01-01
Treatment with ACE inhibitors results in kidney protection due to reduction of systemic blood pressure, intraglomerular pressure, an antiproliferative effect, reduction of proteinuria and a lipid-lowering effect in proteinuric patients (secondary due to reduction of protein excretion). Elderly patients with diabetes melitus, coronary heart disease or peripheral vascular occlusion are at risk for deterioration of kidney function due to a high frequency of renal artery stenosis in these patients. In patients with renal insufficiency dose reduction of ACE inhibitors is necessary (exception: fosinopril) but more important is the risk for development of hyperkalemia. Patients at risk for renal artery stenosis and patients pretreated with diuretics should receive a low ACE inhibitor dosage initially ("start low - go slow"). For compliance reasons once daily ACE inhibitor dosage is recommended.
Novel immunotherapy approaches for metastatic urothelial and renal cell carcinoma
Directory of Open Access Journals (Sweden)
Zhiying Shao
2016-10-01
Full Text Available The treatment of metastatic renal cell carcinoma (RCC and urothelial carcinoma (UC remains a major challenge. Past research has implicated the immune system in tumor surveillance of both malignancies, leading to the application of immunotherapy agents for both cancers. Among them, the most promising agents are the checkpoint blockade drugs, such as antibodies targeting the cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4, programmed death receptor 1 (PD-1, and PD-1 ligand (PD-L1. In normal physiology, these immune checkpoints act as inhibitory signals to fine-tune the duration and strength of immune reactions, which is pivotal for maintaining self-tolerance. However, tumor cells also utilize immune checkpoint pathways to evade anti-tumor immune response, leading to disease progression and metastasis. Thus, there has been intense preclinical and clinical effort focused on the application of checkpoint inhibitors in metastatic RCC and UC. To date, nivolumab (anti-PD-1 and atezolizumab (anti-PD-L1 have been approved for the treatment of metastatic RCC and UC, respectively. Despite these successes, challenges remain in how to further improve response rates to immunotherapy and how to select patients that will benefit from this approach. In this report, we review existing data and research on immunotherapy in metastatic RCC and UC.
Natural inhibitors of tumor-associated proteases
International Nuclear Information System (INIS)
Magdolen, U.; Krol, J.; Sato, S.; Schmitt, M.; Magdolen, V.; Krueger, A.; Mueller, M.M.; Sperl, S.
2002-01-01
The turnover and remodelling of extracellular matrix (ECM) is an essential part of many normal biological processes including development, morphogenesis, and wound healing. ECM turnover also occurs in severe pathological situations like artherosclerosis, fibrosis, tumor invasion and metastasis. The major proteases involved in this turnover are serine proteases (especially the urokinase-type plasminogen activator/plasmin system), matrix metalloproteases (a family of about 20 zinc-dependent endopeptidases including collagenases, gelatinases, stromelysins, and membrane-type metalloproteases), and cysteine proteases. In vivo, the activity of these proteases is tightly regulated in the extracellular space by zymogen activation and/or controlled inhibition. In the present review, we give an overview on the structure and biochemical properties of important tumor-associated protease inhibitors such as plasminogen activator inhibitor type 1 and type 2 (PAI-1, PAI-2), tissue inhibitors of metalloproteinases (TIMP-1, -2, -3, and -4), and the cysteine protease inhibitor cystatin C. Interestingly, some of these inhibitors of tumor-associated proteases display multiple functions which rather promote than inhibit tumor progression, when the presence of inhibitors in the tumor tissue is not balanced. (author)
Schuster, W; Brennicke, A
1987-01-01
We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433
Aromatase inhibitors in pediatrics.
Wit, Jan M; Hero, Matti; Nunez, Susan B
2011-10-25
Aromatase, an enzyme located in the endoplasmic reticulum of estrogen-producing cells, catalyzes the rate-limiting step in the conversion of androgens to estrogens in many tissues. The clinical features of patients with defects in CYP19A1, the gene encoding aromatase, have revealed a major role for this enzyme in epiphyseal plate closure, which has promoted interest in the use of inhibitors of aromatase to improve adult height. The availability of the selective aromatase inhibitors letrozole and anastrozole--currently approved as adjuvant therapy for breast cancer--have stimulated off-label use of aromatase inhibitors in pediatrics for the following conditions: hyperestrogenism, such as aromatase excess syndrome, Peutz-Jeghers syndrome, McCune-Albright syndrome and functional follicular ovarian cysts; hyperandrogenism, for example, testotoxicosis (also known as familial male-limited precocious puberty) and congenital adrenal hyperplasia; pubertal gynecomastia; and short stature and/or pubertal delay in boys. Current data suggest that aromatase inhibitors are probably effective in the treatment of patients with aromatase excess syndrome or testotoxicosis, partially effective in Peutz-Jeghers and McCune-Albright syndrome, but probably ineffective in gynecomastia. Insufficient data are available in patients with congenital adrenal hyperplasia or functional ovarian cysts. Although aromatase inhibitors appear effective in increasing adult height of boys with short stature and/or pubertal delay, safety concerns, including vertebral deformities, a decrease in serum HDL cholesterol levels and increase of erythrocytosis, are reasons for caution.
Gibbs, J E; Thomas, S A
2002-02-01
The brain and CSF distribution of the HIV reverse transcriptase inhibitor, 2'3'-dideoxycytidine (ddC), was investigated by the in situ brain perfusion and isolated incubated choroid plexus methods in the guinea pig. Multiple-time brain perfusions indicated that the distribution of [3H]ddC to the brain and CSF was low and the unidirectional rate constant (K(in)) for the brain uptake of this nucleoside analogue (0.52 +/- 0.10 microL/min/g) was not significantly different to that for the vascular marker, [14C]mannitol (0.44 +/- 0.09 microL/min/g). The influence of unlabelled ddC, six organic anion transport inhibitors and 3'-azido 3'-deoxythymidine (AZT) on the CNS uptake of [3H]ddC was examined in situ and in vitro. ddC, probenecid and 2,4-dichlorophenoxyacetic acid altered the distribution of [3H]ddC into the brain and choroid plexuses, indicating that the limited distribution of [3H]ddC was a result of an organic anion efflux transporter, in addition to the low lipophilicity of this drug (octanol-saline partition coefficient, 0.047 +/- 0.001). The CNS distribution was also sensitive to p-aminohippurate and deltorphin II, but not digoxin, suggesting the involvement of organic anion transporters (OAT1/OAT3-like) and organic anion transporting polypeptides (OATP1/OATPA-like). AZT did not effect the accumulation of [3H]ddC, indicating that when these nucleoside analogues are used in anti-HIV combination therapy, the CNS distribution of ddC is unchanged.
Aschauer, H; Vértesy, L; Nesemann, G; Braunitzer, G
1983-10-01
The native or modified alpha-amylase inhibitor Hoe 467A - isolated from the culture medium of Streptomyces tendae 4158 - and overlapping peptides were degraded by the automatic Edman technique. The oxidized or aminoethylated or oxidized and maleoylated inhibitor was digested with trypsin and the native inhibitor with pepsin. Further digestion with Staphylococcus aureus proteinase was also carried out. After peptic digestion two cystin peptides were isolated, which allowed the establishment of the disulfide bonds. The alpha-amylase inhibitor is a polypeptid consisting of 74 amino-acid residues with a molecular mass of 7958 Da. The inhibitor is composed of all naturally occurring amino acids except methionine and phenylalanine and shows no sequence homology to known inhibitors. The clinical and pharmacological importance in respect to the inhibitors ability for inactivation of human salivary and pancreatic alpha-amylase is discussed. Especially the proteinase resistance of the inhibitor enables a clinical application in human (e.g. Diabetes mellitus) per os.
Squash inhibitor family of serine proteinases
International Nuclear Information System (INIS)
Otlewski, J.; Krowarsch, D.
1996-01-01
Squash inhibitors of serine proteinases form an uniform family of small proteins. They are built of 27-33 amino-acid residues and cross-linked with three disulfide bridges. The reactive site peptide bond (P1-P1') is between residue 5 (Lys, Arg or Leu) and 6 (always Ile). High resolution X-ray structures are available for two squash inhibitors complexed with trypsin. NMR solution structures have also been determined for free inhibitors. The major structural motif is a distorted, triple-stranded antiparallel beta-sheet. A similar folding motif has been recently found in a number of proteins, including: conotoxins from fish-hunting snails, carboxypeptidase inhibitor from potato, kalata B1 polypeptide, and in some growth factors (e.g. nerve growth factor, transforming growth factor β2, platelet-derived growth factor). Squash inhibitors are highly stable and rigid proteins. They inhibit a number of serine proteinases: trypsin, plasmin, kallikrein, blood clotting factors: X a and XII a , cathepsin G. The inhibition spectrum can be much broadened if specific amino-acid substitutions are introduced, especially at residues which contact proteinase. Squash inhibitors inhibit proteinases via the standard mechanism. According to the mechanism, inhibitors are substrates which exhibit at neutral pH a high k cat /K m index for hydrolysis and resynthesis of the reactive site, and a low value of the hydrolysis constant. (author)
Bovine viral diarrhea virus: molecular cloning of genomic RNA and its diagnostic application
International Nuclear Information System (INIS)
Brock, K.V.
1987-01-01
Molecular cloning of a field isolate of bovine viral diarrhea virus (BVDV) strain 72 RNA was done in this study. The sensitivity and specificity of cloned cDNA sequences in hybridization assays with various BVDV strains were determined. cDNA was synthesized from polyadenylated BVDV RNA templates with oligo-dT primers, reverse transcriptase, and DNA polymerase I. The newly synthesized double-stranded BVDV cDNA was C-tailed with terminal deoxytransferase and annealed into G-tailed, Pst-1-cut pUC9 plasmid. Escherichia coli was transformed with the recombinant plasmids and a library of approximately 200 BVDV specific cDNA clones varying in length from 0.5 to 2.6 kilobases were isolated. The sensitivity and specificity of hybridization between the labelled cDNA and BVDV target sequences were determined. Cloned BVDV sequences were isolated from pUC9 plasmid DNA and labelled with 32 P by nick translation. The detection limit by dot blot hybridization assay was 20 pg of purified genomic BVDV RNA. cDNA hybridization probes were specific for all strains of BVDV tested, regardless of whether they were noncytopathic and cytopathic, but did not hybridize with heterologous bovine viruses tested. Probes did not hybridize with uninfected cell culture or cellular RNA. Hybridization probes were at least as sensitive as infectivity assays in detecting homologous virus
DEFF Research Database (Denmark)
Kristensen, Ida B; Christensen, Jacob Haaber; Lyng, Maria Bibi
2014-01-01
Multiple myeloma (MM) lytic bone disease (LBD) is caused by osteoclast activation and osteoblast inhibition. RANK/RANKL/OPG play central roles in osteoclast activation and Wnt inhibitor DKK1 in osteoblast inhibition. The role of other Wnt inhibitors is less clear. We evaluated gene expression...... of osteoclast regulators (RANK, RANKL, OPG, TRAIL, MIP1A), Wnt inhibitors (DKK1, SFRP2, SFRP3, sclerostin, WIF1) and osteoblast transcription factors (RUNX2, osterix) by quantitative reverse transcriptase polymerase chain reaction (RT-PCR) in the bone marrow (BM) microenvironment using snap-frozen BM biopsies...... radiographs and the bone resorption marker CTX-1. Protein levels were evaluated by enzyme-linked immunosorbent assay (ELISA) and immunohistochemistry. Among Wnt inhibitors, only SFRP3 and DKK1 were significantly overexpressed in advanced LBD, correlating with protein levels. SFRP3 correlated with CTX-1. Our...
Metal corrosion inhibitors and ecology
International Nuclear Information System (INIS)
Krasts, H.; Svarce, J.; Berge, B.
1999-01-01
The use of metal corrosion inhibitors in water is one of the cheapest method to protect metals against corrosion. However, the used inhibitors can come to surface water in the course of time and can become as source of environmental pollution. It is important to co-ordinate amount of substances in the elaborated inhibitors not only with demands for metal protection, but also with demands for quality of surface water and drinking water according to normative statements: 3.5 mg/l (as PO 4 ) for hexametaphosphate, tripolyphosphate and phosphonate; 40 mg/l (as SiO 2 for silicate, up to 1 mg/l for CU 2+ ; up to 5 mg/l for Zn 2+ ; up to 1 mg/l for B; up to 0.5 mg/l for Mo 2+ . The examples of the elaborated inhibitors are given. Many organic substances can be used as corrosion inhibitors, but there is shortage of standard methods for their analysis in water in Latvia. Removing of salt's deposits from boilers needs elaboration of a separate normative statement for dispersing waste water which content chloride at high concentration and heavy metals. (authors)
Directory of Open Access Journals (Sweden)
Dieter Hoffmann
Full Text Available Simple and cost-effective approaches for HIV drug-resistance testing are highly desirable for managing increasingly expanding HIV-1 infected populations who initiate antiretroviral therapy (ART, particularly in resource-limited settings. Non-nucleoside reverse trancriptase inhibitor (NNRTI-based regimens with an NRTI backbone containing lamivudine (3TC or emtricitabine (FTC are preferred first ART regimens. Failure with these drug combinations typically involves the selection of NNRTI- and/or 3TC/FTC-resistant viruses. Therefore, the availability of simple assays to measure both types of drug resistance is critical. We have developed a high throughput screening test for assessing enzymatic resistance of the HIV-1 RT in plasma to 3TC/FTC and NNRTIs. The test uses the sensitive "Amp-RT" assay with a newly-developed real-time PCR format to screen biochemically for drug resistance in single reactions containing either 3TC-triphosphate (3TC-TP or nevirapine (NVP. Assay cut-offs were defined based on testing a large panel of subtype B and non-subtype B clinical samples with known genotypic profiles. Enzymatic 3TC resistance correlated well with the presence of M184I/V, and reduced NVP susceptibility was strongly associated with the presence of K103N, Y181C/I, Y188L, and G190A/Q. The sensitivity and specificity for detecting resistance were 97.0% and 96.0% in samples with M184V, and 97.4% and 96.2% for samples with NNRTI mutations, respectively. We further demonstrate the utility of an HIV capture method in plasma by using magnetic beads coated with CD44 antibody that eliminates the need for ultracentifugation. Thus our results support the use of this simple approach for distinguishing WT from NNRTI- or 3TC/FTC-resistant viruses in clinical samples. This enzymatic testing is subtype-independent and can assist in the clinical management of diverse populations particularly in resource-limited settings.
Invertase proteinaceous inhibitor of Cyphomandra betacea Sendt fruits.
Ordóñez, R M; Isla, M I; Vattuone, M A; Sampietro, A R
2000-01-01
This work describes a new invertase proteinaceous inhibitor from Cyphomandra betacea Sendt. (tomate de arbol) fruits. The proteinaceous inhibitor was isolated and purified from a cell wall preparation. The pH stability, kinetics of the inhibition of the C. betacea invertase, inhibition of several higher plant invertases and lectin nature of the inhibitor were studied. The inhibitor structure involves a single polypeptide (Mr = 19000), as shown by gel filtration and SDS-PAGE determinations. N-terminal aminoacid sequence was determined. The properties and some structural features of the inhibitor are compared with the proteinaceous inhibitors from several plant species (Beta vulgaris L., Ipomoea batatas L. and Lycopersicon esculentum Mill.). All these inhibitors share lectinic properties, some common epitopes, some aminoacid sequences and a certain lack of specificity towards invertases of different species, genera and even plant family. In consequence, the inhibitors appear to belong to the same lectin family. It is now known that some lectins are part of the defence mechanism of higher plants against fungi and bacteria and this is a probable role of the proteinaceous inhibitors.
Directory of Open Access Journals (Sweden)
Serge C Billong
Full Text Available BACKGROUND: Scale-up of antiretroviral therapy (ART in resource-limited settings has drastically reduced HIV-related morbidity and mortality. However, challenges in long-term ART, adherence and HIV drug resistance (HIVDR itself, require monitoring to limit HIVDR emergence among ART-experienced populations, in order to ensure regimen efficacy. METHODS: A longitudinal study was conducted from 2009-2011 in a cohort of 141 HIV-infected adult patients (aged >21 at the national social insurance centre hospital in Yaounde, Cameroon. As per-WHO HIVDR protocol, HIV-1 protease-reverse transcriptase genotyping was performed at baseline and at endpoint (12 months on first-line ART using ViroSeq™ Genotyping kit. RESULTS: At baseline, a prevalence of 3.6% (5/139 HIVDR was observed [protease inhibitors M46I (1/5, G73A (1/5, L90LM (1/5; nucleoside reverse transcriptase inhibitors: M184V (1/5, T215F (1/5; non-nucleoside reverse transcriptase inhibitors: K103N (1/5, Y181Y/C (2/5, M230ML (1/5]. At endpoint, 54.0% (76 patients were followed-up, 9.2% (13 died, and 3.5% (5 transferred, 38.5% (47 lost to follow-up (LTFU. 69.7% (53/76 of those followed-up had viremia <40 copies/ml and 90.8% (69/76 <1000 copies/ml. 4/7 patients with viremia ≥1000 copies/ml harbored HIVDR (prevalence: 5.3%; 4/76, with M184V/I (4/4 and K103K/N (3/4 being the most prevalent mutations. LTFU was favored by costs for consultation/laboratory tests, drug shortages, workload (physician/patient ratio: 1/180 and community disengagement. CONCLUSIONS: Low levels of HIVDR at baseline and at endpoint suggest a probable effectiveness of ART regimens used in Cameroon. However the possible high rate of HIVDR among LTFUs limited the strengths of our findings. Evaluating HIVDR among LTFU, improving adherence, task shifting, subsidizing/harmonizing costs for routine follow-up, are urgent measures to ensure an improved success of the country ART performance.