WorldWideScience

Sample records for transcriptase inhibitor uc781

  1. In Vitro Evaluation of Nonnucleoside Reverse Transcriptase Inhibitors UC-781 and TMC120-R147681 as Human Immunodeficiency Virus Microbicides†

    Science.gov (United States)

    Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul

    2004-01-01

    The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562

  2. Reverse transcriptase inhibitors as microbicides.

    Science.gov (United States)

    Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido

    2012-01-01

    The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.

  3. Reverse transcriptase inhibitors as potential colorectal microbicides.

    Science.gov (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J

    2009-05-01

    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.

  4. First phase 1 double-blind, placebo-controlled, randomized rectal microbicide trial using UC781 gel with a novel index of ex vivo efficacy.

    Directory of Open Access Journals (Sweden)

    Peter A Anton

    Full Text Available Successful control of the HIV/AIDS pandemic requires reduction of HIV-1 transmission at sexually-exposed mucosae. No prevention studies of the higher-risk rectal compartment exist. We report the first-in-field Phase 1 trial of a rectally-applied, vaginally-formulated microbicide gel with the RT-inhibitor UC781 measuring clinical and mucosal safety, acceptability and plasma drug levels. A first-in-Phase 1 assessment of preliminary pharmacodynamics was included by measuring changes in ex vivo HIV-1 suppression in rectal biopsy tissue after exposure to product in vivo.HIV-1 seronegative, sexually-abstinent men and women (N = 36 were randomized in a double-blind, placebo-controlled trial comparing UC781 gel at two concentrations (0.1%, 0.25% with placebo gel (1∶1∶1. Baseline, single-dose exposure and a separate, 7-day at-home dosing were assessed. Safety and acceptability were primary endpoints. Changes in colorectal mucosal markers and UC781 plasma drug levels were secondary endpoints; ex vivo biopsy infectibility was an ancillary endpoint.All 36 subjects enrolled completed the 7-14 week trial (100% retention including 3 flexible sigmoidoscopies, each with 28 biopsies (14 at 10 cm; 14 at 30 cm. There were 81 Grade 1 adverse events (AEs and 8 Grade 2; no Grade 3, 4 or procedure-related AEs were reported. Acceptability was high, including likelihood of future use. No changes in mucosal immunoinflammatory markers were identified. Plasma levels of UC781 were not detected. Ex vivo infection of biopsies using two titers of HIV-1(BaL showed marked suppression of p24 in tissues exposed in vivo to 0.25% UC781; strong trends of suppression were seen with the lower 0.1% UC781 concentration.Single and 7-day topical rectal exposure to both concentrations of UC781 were safe with no significant AEs, high acceptability, no detected plasma drug levels and no significant mucosal changes. Ex vivo biopsy infections demonstrated marked suppression of HIV

  5. Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †

    Science.gov (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.

    2009-01-01

    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271

  6. Development and Characterization of a Vaginal Film Containing Dapivirine, a Non- nucleoside Reverse Transcriptase Inhibitor (NNRTI), for prevention of HIV-1 sexual transmission.

    Science.gov (United States)

    Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia

    2011-06-01

    Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.

  7. HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors

    DEFF Research Database (Denmark)

    Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran

    2017-01-01

    BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...

  8. Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?

    Science.gov (United States)

    Nolan, David

    2005-01-01

    Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.

  9. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.

    Science.gov (United States)

    Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko

    2011-01-01

    HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

  10. [Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].

    Science.gov (United States)

    Tarasova, O A; Filimonov, D A; Poroikov, V V

    2017-10-01

    Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.

  11. Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.

    Science.gov (United States)

    Sharma, Mamta; Saravolatz, Louis D

    2013-02-01

    Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.

  12. Nonnucleoside Reverse-transcriptase Inhibitor- vs Ritonavir-boosted Protease Inhibitor-based Regimens for Initial Treatment of HIV Infection

    DEFF Research Database (Denmark)

    Borges, Álvaro H; Lundh, Andreas; Tendal, Britta

    2016-01-01

    BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...

  13. Crystal structures of HIV-1 nonnucleoside reverse transcriptase inhibitors: N-benzyl-4-methyl-benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-07-01

    HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.

  14. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients

    DEFF Research Database (Denmark)

    Lundgren, Jens

    2008-01-01

    BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...

  15. Evolving uses of oral reverse transcriptase inhibitors in the HIV-1 epidemic: From treatment to prevention

    NARCIS (Netherlands)

    R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)

    2013-01-01

    textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the

  16. Computational drug design strategies applied to the modelling of human immunodeficiency virus-1 reverse transcriptase inhibitors

    Directory of Open Access Journals (Sweden)

    Lucianna Helene Santos

    2015-11-01

    Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.

  17. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

    OpenAIRE

    Nicolas Sluis-Cremer

    2014-01-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...

  18. Biophysical Insights into the Inhibitory Mechanism of Non-Nucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer

    2013-11-01

    Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.

  19. Structure-based methods to predict mutational resistance to diarylpyrimidine non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M

    2018-01-01

    Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.

  20. Structural investigation of HIV-1 nonnucleoside reverse transcriptase inhibitors: 2-Aryl-substituted benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-11-01

    Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.

  1. Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.

    Directory of Open Access Journals (Sweden)

    Anna Figueiredo

    2006-11-01

    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.

  2. Antitumor effect of combination of the inhibitors of two new oncotargets: proton pumps and reverse transcriptase.

    Science.gov (United States)

    Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano

    2017-01-17

    Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.

  3. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma

    OpenAIRE

    Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

    2018-01-01

    Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...

  4. Polyurethane intravaginal ring for controlled delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1.

    Science.gov (United States)

    Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F

    2008-10-01

    Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

  5. Susceptibility of recombinant porcine endogenous retrovirus reverse transcriptase to nucleoside and non-nucleoside inhibitors.

    Science.gov (United States)

    Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X

    2002-12-01

    Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.

  6. Fragment Based Strategies for Discovery of Novel HIV-1 Reverse Transcriptase and Integrase Inhibitors.

    Science.gov (United States)

    Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda

    2016-01-01

    Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.

  7. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy: the D: A: D study

    NARCIS (Netherlands)

    Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,

    2015-01-01

    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  8. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy : the D: A: D study

    NARCIS (Netherlands)

    Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.

    2015-01-01

    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  9. Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A

    2011-01-01

    We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Evaluation of nevirapine and/or hydroxyurea with nucleoside reverse transcriptase inhibitors in treatment-naive HIV-1-infected subjects

    NARCIS (Netherlands)

    Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.

    2004-01-01

    Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add

  11. The structure of FIV reverse transcriptase and its implications for non-nucleoside inhibitor resistance.

    Directory of Open Access Journals (Sweden)

    Meytal Galilee

    2018-01-01

    Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study

  12. TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats

    Science.gov (United States)

    Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin

    2011-01-01

    In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472

  13. Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report

    Directory of Open Access Journals (Sweden)

    Lapadula Giuseppe

    2007-05-01

    Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.

  14. The emerging profile of cross-resistance among the nonnucleoside HIV-1 reverse transcriptase inhibitors.

    Science.gov (United States)

    Sluis-Cremer, Nicolas

    2014-07-31

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  15. 3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    S. Ganguly

    2008-01-01

    Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.

  16. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer

    2014-07-01

    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  17. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.

    Science.gov (United States)

    Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

    2018-01-01

    Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .

  18. 4'-Ethynyl-2-fluoro-2'-deoxyadenosine, MK-8591: a novel HIV-1 reverse transcriptase translocation inhibitor.

    Science.gov (United States)

    Markowitz, Martin; Sarafianos, Stefan G

    2018-07-01

    4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.

  19. Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M

    2017-12-01

    Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these

  20. Role of the K101E substitution in HIV-1 reverse transcriptase in resistance to rilpivirine and other nonnucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A

    2013-11-01

    Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.

  1. Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.

    Science.gov (United States)

    Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D

    2006-11-15

    TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients

  2. HIV Salvage Therapy Does Not Require Nucleoside Reverse Transcriptase Inhibitors: A Randomized, Controlled Trial.

    Science.gov (United States)

    Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H

    2015-12-15

    Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).

  3. Structural studies of series HIV-1 nonnucleoside reverse transcriptase inhibitors 1-(2,6-difluorobenzyl)-2-(2,6-difluorophenyl)-benzimidazoles with different 4-substituents

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2010-03-01

    Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.

  4. A trypsin inhibitor from rambutan seeds with antitumor, anti-HIV-1 reverse transcriptase, and nitric oxide-inducing properties.

    Science.gov (United States)

    Fang, Evandro Fei; Ng, Tzi Bun

    2015-04-01

    Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.

  5. Novel (2,6-difluorophenyl)(2-(phenylamino)pyrimidin-4-yl) methanones with restricted conformation as potent non-nucleoside reverse transcriptase inhibitors against HIV-1

    Czech Academy of Sciences Publication Activity Database

    Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko

    2016-01-01

    Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016

  6. In vitro cross-resistance profile of nucleoside reverse transcriptase inhibitor (NRTI) BMS-986001 against known NRTI resistance mutations.

    Science.gov (United States)

    Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark

    2013-11-01

    BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.

  7. The development of HEPT-type HIV non-nucleoside reverse transcriptase inhibitors and its implications for DABO family.

    Science.gov (United States)

    Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong

    2012-01-01

    1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.

  8. A randomized trial comparing initial HAART regimens of nelfinavir/nevirapine and ritonavir/saquinavir in combination with two nucleoside reverse transcriptase inhibitors

    DEFF Research Database (Denmark)

    Kirk, Ole; Lundgren, Jens D; Pedersen, Court

    2003-01-01

    BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....

  9. Molecular docking and 3D-QSAR studies on triazolinone and pyridazinone, non-nucleoside inhibitor of HIV-1 reverse transcriptase.

    Science.gov (United States)

    Sivan, Sree Kanth; Manga, Vijjulatha

    2010-06-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.

  10. Naringin Reverses Hepatocyte Apoptosis and Oxidative Stress Associated with HIV-1 Nucleotide Reverse Transcriptase Inhibitors-Induced Metabolic Complications

    Directory of Open Access Journals (Sweden)

    Oluwafeyisetan O. Adebiyi

    2015-12-01

    Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.

  11. Inhibition of human immunodeficiency virus type 1 infection by the candidate microbicide dapivirine, a nonnucleoside reverse transcriptase inhibitor.

    Science.gov (United States)

    Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R

    2009-02-01

    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.

  12. Standardized comparison of the relative impacts of HIV-1 reverse transcriptase (RT) mutations on nucleoside RT inhibitor susceptibility.

    Science.gov (United States)

    Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W

    2012-05-01

    Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.

  13. Computational Analysis of Molecular Interaction Networks Underlying Change of HIV-1 Resistance to Selected Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan

    2010-12-12

    Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.

  14. Structural and Preclinical Studies of Computationally Designed Non-Nucleoside Reverse Transcriptase Inhibitors for Treating HIV infection

    Energy Technology Data Exchange (ETDEWEB)

    Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.

    2017-02-06

    The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.

  15. Development of elvitegravir resistance and linkage of integrase inhibitor mutations with protease and reverse transcriptase resistance mutations.

    Directory of Open Access Journals (Sweden)

    Mark A Winters

    Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.

  16. Pharmacokinetics and tolerability of the new second-generation nonnucleoside reverse- transcriptase inhibitor KM-023 in healthy subjects

    Directory of Open Access Journals (Sweden)

    Cha YJ

    2014-09-01

    Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600

  17. Risk Factors for Incident Diabetes in a Cohort Taking First-Line Nonnucleoside Reverse Transcriptase Inhibitor-Based Antiretroviral Therapy.

    Science.gov (United States)

    Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen

    2016-03-01

    Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.

  18. Synthesis and evaluation of "AZT-HEPT", "AZT-pyridinone", and "ddC-HEPT" conjugates as inhibitors of HIV reverse transcriptase.

    Science.gov (United States)

    Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C

    2000-05-18

    To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.

  19. Efavirenz Has the Highest Anti-Proliferative Effect of Non-Nucleoside Reverse Transcriptase Inhibitors against Pancreatic Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Markus Hecht

    Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic

  20. In Vitro Cross-Resistance Profiles of Rilpivirine, Dapivirine, and MIV-150, Nonnucleoside Reverse Transcriptase Inhibitor Microbicides in Clinical Development for the Prevention of HIV-1 Infection.

    Science.gov (United States)

    Giacobbi, Nicholas S; Sluis-Cremer, Nicolas

    2017-07-01

    Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.

  1. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    International Nuclear Information System (INIS)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

    2015-01-01

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

  2. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)

    2015-10-23

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

  3. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) using pre-steady-state kinetics.

    Science.gov (United States)

    Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S

    2014-06-01

    The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Etravirine and Rilpivirine Drug Resistance Among HIV-1 Subtype C Infected Children Failing Non-Nucleoside Reverse Transcriptase Inhibitor-Based Regimens in South India.

    Science.gov (United States)

    Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami

    2017-06-01

    We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.

  5. Comparison of single and boosted protease inhibitor versus nonnucleoside reverse transcriptase inhibitor-containing cART regimens in antiretroviral-naïve patients starting cART after January 1, 2000

    DEFF Research Database (Denmark)

    Mocroft, A; Horban, A; Clumeck, N

    2006-01-01

    increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)

  6. Synthesis, biological evaluation and molecular modeling of 2-Hydroxyisoquinoline-1,3-dione analogues as inhibitors of HIV reverse transcriptase associated ribonuclease H and polymerase.

    Science.gov (United States)

    Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang

    2017-06-16

    Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  7. Viral resuppression and detection of drug resistance following interruption of a suppressive non-nucleoside reverse transcriptase inhibitor-based regimen

    DEFF Research Database (Denmark)

    Fox, Zoe; Phillips, Andrew; Cohen, Cal

    2008-01-01

    the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...

  8. Nelfinavir and Non-Nucleoside Reverse Transcriptase Inhibitor-Based Salvage Regimes in Heavily Hiv Pretreated Patients

    Directory of Open Access Journals (Sweden)

    Jean-Guy Baril

    2003-01-01

    Full Text Available OBJECTIVE: To assess the efficacy of nelfinavir mesylate (NFV in combination with delavirdine mesylate(DLV or efavirenz (EFV and other antiretroviral agents following virological failure on other protease inhibitor (PI-based regimens.

  9. Design and synthesis of N₁-aryl-benzimidazoles 2-substituted as novel HIV-1 non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Monforte, Anna-Maria; Ferro, Stefania; De Luca, Laura; Lo Surdo, Giuseppa; Morreale, Francesca; Pannecouque, Christophe; Balzarini, Jan; Chimirri, Alba

    2014-02-15

    A series of novel N1-aryl-2-arylthioacetamido-benzimidazoles were synthesized and evaluated as inhibitors of human immunodeficiency virus type-1 (HIV-1). Some of them proved to be effective in inhibiting HIV-1 replication at submicromolar and nanomolar concentration acting as HIV-1 non-nucleoside RT inhibitors (NNRTIs), with low cytotoxicity. The preliminary structure-activity relationship (SAR) of these new derivatives was discussed and rationalized by docking studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase.

    Science.gov (United States)

    Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio

    2016-09-30

    We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

  11. Molecular Docking Studies of Marine Diterpenes as Inhibitors of Wild-Type and Mutants HIV-1 Reverse Transcriptase

    Directory of Open Access Journals (Sweden)

    Alessandra M. T. de Souza

    2013-10-01

    Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.

  12. Design, synthesis and antiviral evaluation of novel heteroarylcarbothioamide derivatives as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and RDDP functions.

    Science.gov (United States)

    Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo

    2017-08-31

    In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Structure-based design, synthesis, and biological evaluation of novel pyrrolyl aryl sulfones: HIV-1 non-nucleoside reverse transcriptase inhibitors active at nanomolar concentrations.

    Science.gov (United States)

    Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P

    2000-05-04

    Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.

  14. Etravirine and rilpivirine resistance in HIV-1 subtype CRF01_AE-infected adults failing non-nucleoside reverse transcriptase inhibitor-based regimens.

    Science.gov (United States)

    Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat

    2011-01-01

    We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.

  15. Imidazo[1,2-a]pyridin-3-amines as potential HIV-1 non-nucleoside reverse transcriptase inhibitors

    CSIR Research Space (South Africa)

    Bode, ML

    2011-06-01

    Full Text Available ? Discovery Studio 2.5.5). The crystal structures of both the wild-type and K103N mutant forms of HIV-1 RT containing the diarylpyrimidine inhibitor rilpivirine (TMC-278) were used (pdb codes MEE and 3MEG, respectively).27 Etravirine (TMC-125... These drugs act by binding to a lipophilic, non-substrate binding pocket located about 10? from the substrate binding site. Binding induces conformational changes in the catalytic site, slowing catalytic activity markedly.3 About fifty structurally diverse...

  16. Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals.

    Science.gov (United States)

    Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L

    2017-11-08

    The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

  17. Design, synthesis and biological evaluations of N-Hydroxy thienopyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated RNase H.

    Science.gov (United States)

    Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang

    2017-12-01

    Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50  = 0.04 μM) with decent antiviral potency (EC 50  = 7.4 μM) and no cytotoxicity (CC 50  > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50  = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  18. Diaryltriazine non-nucleoside reverse transcriptase inhibitors are potent candidates for pre-exposure prophylaxis in the prevention of sexual HIV transmission.

    Science.gov (United States)

    Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido

    2013-09-01

    Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.

  19. Discovery of dapivirine, a nonnucleoside HIV-1 reverse transcriptase inhibitor, as a broad-spectrum antiviral against both influenza A and B viruses.

    Science.gov (United States)

    Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun

    2017-09-01

    The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Active methamphetamine use is associated with transmitted drug resistance to non-nucleoside reverse transcriptase inhibitors in individuals with HIV infection of unknown duration.

    Science.gov (United States)

    Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M

    2007-01-01

    Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.

  1. Active Methamphetamine Use is Associated with Transmitted Drug Resis-tance to Non-Nucleoside Reverse Transcriptase Inhibitors in Individuals with HIV Infection of Unknown Duration

    Science.gov (United States)

    Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M

    2007-01-01

    Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691

  2. Indolylarylsulfones as HIV-1 non-nucleoside reverse transcriptase inhibitors: new cyclic substituents at indole-2-carboxamide.

    Science.gov (United States)

    La Regina, Giuseppe; Coluccia, Antonio; Brancale, Andrea; Piscitelli, Francesco; Gatti, Valerio; Maga, Giovanni; Samuele, Alberta; Pannecouque, Christophe; Schols, Dominique; Balzarini, Jan; Novellino, Ettore; Silvestri, Romano

    2011-03-24

    New indolylarylsulfone derivatives bearing cyclic substituents at indole-2-carboxamide linked through a methylene/ethylene spacer were potent inhibitors of the WT HIV-1 replication in CEM and PBMC cells with inhibitory concentrations in the low nanomolar range. Against the mutant L100I and K103N RT HIV-1 strains in MT-4 cells, compounds 20, 24-26, 36, and 40 showed antiviral potency superior to that of NVP and EFV. Against these mutant strains, derivatives 20, 24-26, and 40 were equipotent to ETV. Molecular docking experiments on this novel series of IAS analogues have also suggested that the H-bond interaction between the nitrogen atom in the carboxamide chain of IAS and Glu138:B is important in the binding of these compounds. These results are in accordance with the experimental data obtained on the WT and on the mutant HIV-1 strains tested.

  3. 3D-QSAR CoMFA of a series of DABO derivatives as HIV-1 reverse transcriptase non-nucleoside inhibitors.

    Science.gov (United States)

    de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão

    2008-08-01

    A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.

  4. Introducing Catastrophe-QSAR. Application on Modeling Molecular Mechanisms of Pyridinone Derivative-Type HIV Non-Nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Marius Lazea

    2011-12-01

    Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.

  5. Application of 3D-QSAR, Pharmacophore, and Molecular Docking in the Molecular Design of Diarylpyrimidine Derivatives as HIV-1 Nonnucleoside Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi

    2018-05-11

    Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.

  6. Adenosine 3',5'-cyclic monophosphate (cAMP)-dependent phosphoregulation of mitochondrial complex I is inhibited by nucleoside reverse transcriptase inhibitors

    International Nuclear Information System (INIS)

    Lund, Kaleb C.; Wallace, Kendall B.

    2008-01-01

    Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug

  7. Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro.

    Science.gov (United States)

    Patick, A K; Boritzki, T J; Bloom, L A

    1997-10-01

    Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.

  8. Safety, tolerability and pharmacokinetics of doravirine, a novel HIV non-nucleoside reverse transcriptase inhibitor, after single and multiple doses in healthy subjects.

    Science.gov (United States)

    Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R

    2015-01-01

    Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once

  9. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

    OpenAIRE

    Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

    2014-01-01

    The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...

  10. High Potency of Indolyl Aryl Sulfone Nonnucleoside Inhibitors towards Drug-Resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutants Is Due to Selective Targeting of Different Mechanistic Forms of the Enzyme

    Science.gov (United States)

    Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni

    2005-01-01

    Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294

  11. Structural optimization of N1-aryl-benzimidazoles for the discovery of new non-nucleoside reverse transcriptase inhibitors active against wild-type and mutant HIV-1 strains.

    Science.gov (United States)

    Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania

    2018-02-01

    Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

    Science.gov (United States)

    Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

    2014-01-01

    The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447

  13. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients enrolled in the D:A:D study: a multi-cohort collaboration

    DEFF Research Database (Denmark)

    Sabin, Caroline A; Worm, Signe W; Weber, Rainer

    2008-01-01

    cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...

  14. 5-Hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as novel dual inhibitors of HIV-1 reverse transcriptase-associated ribonuclease H and integrase.

    Science.gov (United States)

    Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong

    2018-06-18

    We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H  = 1.77 μM, IC 50 IN  = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  15. Towards discovering dual functional inhibitors against both wild type and K103N mutant HIV-1 reverse transcriptases: molecular docking and QSAR studies on 4,1-benzoxazepinone analogues

    Science.gov (United States)

    Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang

    2006-05-01

    To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.

  16. Testing of viscous anti-HIV microbicides using Lactobacillus

    OpenAIRE

    Moncla, B.J.; Pryke, K.; Rohan, L. C.; Yang, H.

    2011-01-01

    The development of topical microbicides for intravaginal use to prevent HIV infection requires that the drugs and formulated products be nontoxic to the endogenous vaginal Lactobacillus. In 30 min exposure tests we found dapivirine, tenofovir and UC781 (reverse transcriptase inhibitor anti-HIV drugs) as pure drugs or formulated as film or gel products were not deleterious to Lactobacillus species; however, PSC-RANTES (a synthetic CCR5 antagonist) killed 2 strains of Lactobacillus jensenii. To...

  17. Long-term analysis of resistance development in HIV-1 positive patients treated with protease and reverse transcriptase inhibitors: Correlation of the genotype and disease progression

    Czech Academy of Sciences Publication Activity Database

    Prejdová, Jana; Weber, Jan; Machala, L.; Reiniš, Milan; Linka, M.; Brůčková, M.; Vandasová, M.; Staňková, M.; Konvalinka, Jan

    2005-01-01

    Roč. 49, č. 1 (2005), 29-36 ISSN 0001-723X R&D Projects: GA MZd(CZ) NI6339 Grant - others:5th Framework(XE) QLK2-CT-2001-02360 Institutional research plan: CEZ:AV0Z4055905 Keywords : HIV * protease inhibitors * resistance development Subject RIV: CE - Biochemistry Impact factor: 0.696, year: 2005

  18. Structural Basis for the Inhibition of RNase H Activity of HIV-1 Reverse Transcriptase by RNase H Active Site-Directed Inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Su, Hua-Poo; Yan, Youwei; Prasad, G. Sridhar; Smith, Robert F.; Daniels, Christopher L.; Abeywickrema, Pravien D.; Reid, John C.; Loughran, H. Marie; Kornienko, Maria; Sharma, Sujata; Grobler, Jay A.; Xu, Bei; Sardana, Vinod; Allison, Timothy J.; Williams, Peter D.; Darke, Paul L.; Hazuda, Daria J.; Munshi, Sanjeev (Merck)

    2010-09-02

    HIV/AIDS continues to be a menace to public health. Several drugs currently on the market have successfully improved the ability to manage the viral burden in infected patients. However, new drugs are needed to combat the rapid emergence of mutated forms of the virus that are resistant to existing therapies. Currently, approved drugs target three of the four major enzyme activities encoded by the virus that are critical to the HIV life cycle. Although a number of inhibitors of HIV RNase H activity have been reported, few inhibit by directly engaging the RNase H active site. Here, we describe structures of naphthyridinone-containing inhibitors bound to the RNase H active site. This class of compounds binds to the active site via two metal ions that are coordinated by catalytic site residues, D443, E478, D498, and D549. The directionality of the naphthyridinone pharmacophore is restricted by the ordering of D549 and H539 in the RNase H domain. In addition, one of the naphthyridinone-based compounds was found to bind at a second site close to the polymerase active site and non-nucleoside/nucleotide inhibitor sites in a metal-independent manner. Further characterization, using fluorescence-based thermal denaturation and a crystal structure of the isolated RNase H domain reveals that this compound can also bind the RNase H site and retains the metal-dependent binding mode of this class of molecules. These structures provide a means for structurally guided design of novel RNase H inhibitors.

  19. Parallel screening of drug-like natural compounds using Caco-2 cell permeability QSAR model with applicability domain, lipophilic ligand efficiency index and shape property: A case study of HIV-1 reverse transcriptase inhibitors

    Science.gov (United States)

    Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.

    2017-10-01

    The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.

  20. Efavirenz or nevirapine in three-drug combination therapy with two nucleoside or nucleotide-reverse transcriptase inhibitors for initial treatment of HIV infection in antiretroviral-naïve individuals.

    Science.gov (United States)

    Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi

    2016-12-10

    The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure

  1. Measuring enzymatic HIV-1 susceptibility to two reverse transcriptase inhibitors as a rapid and simple approach to HIV-1 drug-resistance testing.

    Directory of Open Access Journals (Sweden)

    Dieter Hoffmann

    Full Text Available Simple and cost-effective approaches for HIV drug-resistance testing are highly desirable for managing increasingly expanding HIV-1 infected populations who initiate antiretroviral therapy (ART, particularly in resource-limited settings. Non-nucleoside reverse trancriptase inhibitor (NNRTI-based regimens with an NRTI backbone containing lamivudine (3TC or emtricitabine (FTC are preferred first ART regimens. Failure with these drug combinations typically involves the selection of NNRTI- and/or 3TC/FTC-resistant viruses. Therefore, the availability of simple assays to measure both types of drug resistance is critical. We have developed a high throughput screening test for assessing enzymatic resistance of the HIV-1 RT in plasma to 3TC/FTC and NNRTIs. The test uses the sensitive "Amp-RT" assay with a newly-developed real-time PCR format to screen biochemically for drug resistance in single reactions containing either 3TC-triphosphate (3TC-TP or nevirapine (NVP. Assay cut-offs were defined based on testing a large panel of subtype B and non-subtype B clinical samples with known genotypic profiles. Enzymatic 3TC resistance correlated well with the presence of M184I/V, and reduced NVP susceptibility was strongly associated with the presence of K103N, Y181C/I, Y188L, and G190A/Q. The sensitivity and specificity for detecting resistance were 97.0% and 96.0% in samples with M184V, and 97.4% and 96.2% for samples with NNRTI mutations, respectively. We further demonstrate the utility of an HIV capture method in plasma by using magnetic beads coated with CD44 antibody that eliminates the need for ultracentifugation. Thus our results support the use of this simple approach for distinguishing WT from NNRTI- or 3TC/FTC-resistant viruses in clinical samples. This enzymatic testing is subtype-independent and can assist in the clinical management of diverse populations particularly in resource-limited settings.

  2. Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro.

    OpenAIRE

    Patick, A K; Boritzki, T J; Bloom, L A

    1997-01-01

    Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritona...

  3. Inhibitors

    Science.gov (United States)

    ... JM, and the Hemophilia Inhibitor Research Study Investigators. Validation of Nijmegen-Bethesda assay modifications to allow inhibitor ... webinars on blood disorders Language: English (US) Español (Spanish) File Formats Help: How do I view different ...

  4. Body composition and metabolic outcomes after 96 weeks of treatment with ritonavir-boosted lopinavir plus either nucleoside or nucleotide reverse transcriptase inhibitors or raltegravir in patients with HIV with virological failure of a standard first-line antiretroviral therapy regimen: a substudy of the randomised, open-label, non-inferiority SECOND-LINE study.

    Science.gov (United States)

    Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A

    2017-01-01

    Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with ClinicalTrials.gov, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N

  5. Substrate-induced stable enzyme-inhibitor complex formation allows tight binding of novel 2-aminopyrimidin-4(3H)-ones to drug-resistant HIV-1 reverse transcriptase mutants.

    Science.gov (United States)

    Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni

    2008-09-01

    We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.

  6. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

    2018-01-01

    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  7. Indolyl aryl sulfones as HIV-1 non-nucleoside reverse transcriptase inhibitors: role of two halogen atoms at the indole ring in developing new analogues with improved antiviral activity.

    Science.gov (United States)

    Regina, Giuseppe La; Coluccia, Antonio; Piscitelli, Francesco; Bergamini, Alberto; Sinistro, Anna; Cavazza, Antonella; Maga, Giovanni; Samuele, Alberta; Zanoli, Samantha; Novellino, Ettore; Artico, Marino; Silvestri, Romano

    2007-10-04

    Indolyl aryl sulfones bearing the 4,5-difluoro (10) or 5-chloro-4-fluoro (16) substitution pattern at the indole ring were potent inhibitors of HIV-1 WT and the NNRTI-resistant strains Y181C and K103N-Y181C. These compounds were highly effective against the 112 and the AB1 strains in lymphocytes and inhibited at nanomolar concentration the multiplication of the IIIBBa-L strain in macrophages. Compound 16 was exceptionally potent against RT WT and RTs carrying the K103N, Y181I, and L100I mutations.

  8. Mutation V111I in HIV-2 reverse transcriptase increases the fitness of the nucleoside analogue-resistant K65R and Q151M viruses

    NARCIS (Netherlands)

    I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)

    2015-01-01

    textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have

  9. Natural Plant Alkaloid (Emetine Inhibits HIV-1 Replication by Interfering with Reverse Transcriptase Activity

    Directory of Open Access Journals (Sweden)

    Ana Luiza Chaves Valadão

    2015-06-01

    Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.

  10. Endogenous reverse transcriptase (RT) activity and Chromatin remodeling in normal and transformed cells and early embryos

    International Nuclear Information System (INIS)

    Spadafora, C.; Sciamanna, I.; Misteli, T.

    2009-01-01

    Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma

  11. Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

    OpenAIRE

    Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

    2008-01-01

    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...

  12. A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

    NARCIS (Netherlands)

    Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.

    2011-01-01

    The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who

  13. Immune pressure analysis of protease and reverse transcriptase ...

    African Journals Online (AJOL)

    /dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...

  14. Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.

    Science.gov (United States)

    Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E

    2013-06-18

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  15. Differential Regulation of Telomerase Reverse Transcriptase Promoter Activation and Protein Degradation by Histone Deacetylase Inhibition.

    Science.gov (United States)

    Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis

    2016-06-01

    Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.

  16. Calibrated user-friendly reverse transcriptase-PCR assay

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Rammer, P

    1998-01-01

    We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...

  17. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  18. Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

    Directory of Open Access Journals (Sweden)

    Ajay Kumar

    2010-01-01

    Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

  19. Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

    Science.gov (United States)

    Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

    2014-04-01

    A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

  20. A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome

    Directory of Open Access Journals (Sweden)

    Marcin Kierczak

    2009-10-01

    Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.

  1. Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

    International Nuclear Information System (INIS)

    Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado

    2011-01-01

    LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

  2. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Directory of Open Access Journals (Sweden)

    Ilaria eSciamanna

    2016-02-01

    Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  3. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Science.gov (United States)

    Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado

    2016-02-01

    In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  4. NMR structure of the HIV-1 reverse transcriptase thumb subdomain

    Energy Technology Data Exchange (ETDEWEB)

    Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)

    2016-12-15

    The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

  5. In vitro HIV-1 evolution in response to triple reverse transcriptase inhibitors & in silico phenotypic analysis.

    Directory of Open Access Journals (Sweden)

    Barbara A Rath

    Full Text Available Effectiveness of ART regimens strongly depends upon complex interactions between the selective pressure of drugs and the evolution of mutations that allow or restrict drug resistance.Four clinical isolates from NRTI-exposed, NNRTI-naive subjects were passaged in increasing concentrations of NVP in combination with 1 µM 3 TC and 2 µM ADV to assess selective pressures of multi-drug treatment. A novel parameter inference procedure, based on a stochastic viral growth model, was used to estimate phenotypic resistance and fitness from in vitro combination passage experiments.Newly developed mathematical methods estimated key phenotypic parameters of mutations arising through selective pressure exerted by 3 TC and NVP. Concentrations of 1 µM 3 TC maintained the M184V mutation, which was associated with intrinsic fitness deficits. Increasing NVP concentrations selected major NNRTI resistance mutations. The evolutionary pathway of NVP resistance was highly dependent on the viral genetic background, epistasis as well as stochasticity. Parameter estimation indicated that the previously unrecognized mutation L228Q was associated with NVP resistance in some isolates.Serial passage of viruses in the presence of multiple drugs may resemble the selection of mutations observed among treated individuals and populations in vivo and indicate evolutionary preferences and restrictions. Phenotypic resistance estimated here "in silico" from in vitro passage experiments agreed well with previous knowledge, suggesting that the unique combination of "wet-" and "dry-lab" experimentation may improve our understanding of HIV-1 resistance evolution in the future.

  6. Pyrroloaryls and pyrroloheteroaryls: Inhibitors of the HIV fusion/attachment, reverse transcriptase and integrase

    Czech Academy of Sciences Publication Activity Database

    Patel, Rahul V.; Park, S.W.

    2015-01-01

    Roč. 23, č. 17 (2015), s. 5247-5263 ISSN 0968-0896 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Pyrrole * Arylthiopyrrole * Triciribine Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.923, year: 2015

  7. Cell free phosphorylation method to assess the utility of new nucleotides as nucleoside reserve transcriptase inhibitors

    CSIR Research Space (South Africa)

    Lebea, Phiyani J

    2007-06-01

    Full Text Available .5 2 2.5 3 3.5 4 4.5 5 0 50 100 150 200 250 300 350 400 450 Wavelength (nm) O pt ic a l d e n si ty ATP + NMP NMP kinase (cellular protein mixture) ADP + NDP (1) ADP + NDP + 2PEP...) and tenofovir using the extracted total cytoplasmic kinases as well as utilising membrane bound total proteins was shown to be possible since there was considerable oxidation of β-NADH compared to the control sample (figure 3 and 4). The cytoplasmic reaction...

  8. Suicide Inhibitors of Reverse Transcriptase in the Therapy of AIDS and Other Retroviruses

    Science.gov (United States)

    1989-07-01

    are shown below. One of the first, [N-(L-3-tran carboxyxiran-2-carbonyl)-L-leucyl]-amido (4-guanido) butane was isolated from Asperg /II japonicus and...using uridine nucleosides to enhance the antiviral selectivity. j, Synthesis of Uridine 2’ and 3*-Ribosoiroxr’es 3*-uridine spiroxirane was...system used (Figure 2). Also shown in this figure is the enhanced sensitivity of the vaccif recombinant HIV-RT to Foscarnet when expressed in monkey kidney

  9. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy

    DEFF Research Database (Denmark)

    Bruyand, Mathias; Ryom, Lene; Shepherd, Leah

    2015-01-01

    -AIDS-defining cancers (NADC), AIDS-defining cancers (ADC), and the most frequently occurring ADC (Kaposi sarcoma, non-Hodgkin lymphoma) and NADC (lung, invasive anal, head/neck cancers, and Hodgkin lymphoma). RESULTS: A total of 41,762 persons contributed 241,556 person-years (PY). A total of 1832 cancers were...

  10. Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis

    Directory of Open Access Journals (Sweden)

    Ma Bi

    2017-10-01

    Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.

  11. A second chance for telomerase reverse transcriptase in anticancer immunotherapy.

    Science.gov (United States)

    Zanetti, Maurizio

    2017-02-01

    Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.

  12. 2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase

    International Nuclear Information System (INIS)

    Starnes, M.C.

    1988-01-01

    2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells

  13. Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

    International Nuclear Information System (INIS)

    Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.

    2004-01-01

    Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

  14. Evidence for a relief of repression mechanism for activation of the human telomerase reverse transcriptase promoter.

    Science.gov (United States)

    Wang, Shuwen; Zhu, Jiyue

    2003-05-23

    The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.

  15. Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

    International Nuclear Information System (INIS)

    Bavand, M.R.; Laub, O.

    1988-01-01

    Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

  16. Testing of viscous anti-HIV microbicides using Lactobacillus.

    Science.gov (United States)

    Moncla, B J; Pryke, K; Rohan, L C; Yang, H

    2012-02-01

    The development of topical microbicides for intravaginal use to prevent HIV infection requires that the drugs and formulated products be nontoxic to the endogenous vaginal Lactobacillus. In 30min exposure tests we found dapivirine, tenofovir and UC781 (reverse transcriptase inhibitor anti-HIV drugs) as pure drugs or formulated as film or gel products were not deleterious to Lactobacillus species; however, PSC-RANTES (a synthetic CCR5 antagonist) killed 2 strains of Lactobacillus jensenii. To demonstrate the toxicity of formulated products a new assay was developed for use with viscous and non-viscous samples that we have termed the Lactobacillus toxicity test. We found that the vortex mixing of vaginal Lactobacillus species can lead to reductions in bacterial viability. Lactobacillus can survive briefly, about 2s, but viability declines with increased vortex mixing. The addition of heat inactivated serum or bovine serum albumin, but not glycerol, prevented the decrease in bacterial viability. Bacillus atrophaeus spores also demonstrated loss of viability upon extended mixing. We observed that many of the excipients used in film formulation and the films themselves also afford protection from the killing during vortex mixing. This method is of relevance for toxicity for cidal activities of viscous products. Copyright © 2011 Elsevier B.V. All rights reserved.

  17. A nonlinear QSAR study using oscillating search and SVM as an efficient algorithm to model the inhibition of reverse transcriptase by HEPT derivatives

    International Nuclear Information System (INIS)

    Ferkous, F.; Saihi, Y.

    2018-01-01

    Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)

  18. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  19. A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication.

    Science.gov (United States)

    Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon

    2015-08-01

    completion. We show here for the first time that a single mutation in HIV-1 reverse transcriptase (L92P) selectively abolishes strand transfers without affecting the enzyme's DNA polymerase and RNase H functions. When this mutation was introduced into an infectious HIV-1 clone, viral replication was lost due to an impaired intracellular strand transfer, thus supporting the in vitro data. Therefore, finding novel drugs that target HIV-1 reverse transcriptase Leu92 may be beneficial for developing new potent and selective inhibitors of retroviral reverse transcription that will obstruct HIV-1 infectivity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

    Science.gov (United States)

    Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

    2009-01-01

    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331

  1. MicroRNA Regulation of Telomerase Reverse Transcriptase (TERT: Micro Machines Pull Strings of Papier-Mâché Puppets

    Directory of Open Access Journals (Sweden)

    Ammad Ahmad Farooqi

    2018-04-01

    Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.

  2. A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

    DEFF Research Database (Denmark)

    Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy

    2011-01-01

    Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...

  3. Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity

    Science.gov (United States)

    House, M.L.; Kim, C.H.; Reno, P.W.

    1998-01-01

    Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.

  4. Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory

    Directory of Open Access Journals (Sweden)

    Edward J. Steele

    2017-11-01

    Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.

  5. Anti-HBV treatment induces novel reverse transcriptase mutations with reflective effect on HBV S antigen

    NARCIS (Netherlands)

    Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina

    2013-01-01

    The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences

  6. Deep sequencing analysis of HIV-1 reverse transcriptase at baseline and time of failure in patients receiving rilpivirine in the phase III studies ECHO and THRIVE.

    Science.gov (United States)

    Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan

    2016-05-01

    Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.

  7. The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.

    Science.gov (United States)

    Zhao, Chen; Pyle, Anna Marie

    2017-12-01

    The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase

    OpenAIRE

    DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami

    2012-01-01

    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

  9. Enzyme engineering through evolution: thermostable recombinant group II intron reverse transcriptases provide new tools for RNA research and biotechnology.

    Science.gov (United States)

    Collins, Kathleen; Nilsen, Timothy W

    2013-08-01

    Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.

  10. Prediction of the binding mode and resistance profile for a dual-target pyrrolyl diketo acid scaffold against HIV-1 integrase and reverse-transcriptase-associated ribonuclease H.

    Science.gov (United States)

    Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng

    2018-06-27

    The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.

  11. A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer

    Science.gov (United States)

    Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.

    2007-01-01

    Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

  12. Comparative analysis of drug resistance mutations in the human immunodeficiency virus reverse transcriptase gene in patients who are non-responsive, responsive and naive to antiretroviral therapy.

    Science.gov (United States)

    Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad

    2016-05-01

    Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.

  13. Enhanced activity of carbosilane dendrimers against HIV when combined with reverse transcriptase inhibitor drugs: searching for more potent microbicides

    Directory of Open Access Journals (Sweden)

    Vacas-Córdoba E

    2014-07-01

    Full Text Available Enrique Vacas-Córdoba,1–3 Marta Galán,3,4 Francisco J de la Mata,3,4 Rafael Gómez,3,4 Marjorie Pion,1–3 M Ángeles Muñoz-Fernández1–3 1Laboratorio InmunoBiología Molecular, Hospital General Universitario Gregorio Marañón, Madrid, Spain; 2Instituto de Investigación Sanitaria del Gregorio Marañón, Madrid, Spain; 3Networking Research Center on Bioengineering, Biomaterials and Nanomedicine, (CIBER-BBN, Madrid, Spain; 4Dendrimers for Biomedical Applications Group (BioInDen, University of Alcalá, Madrid, Spain Abstract: Self-administered topical microbicides or oral preexposure prophylaxis could be very helpful tools for all risk groups to decrease the human immunodeficiency virus (HIV-1 infection rates. Up until now, antiretrovirals (ARVs have been the most advanced microbicide candidates. Nevertheless, the majority of clinical trials has failed in HIV-1 patients. Nanotechnology offers suitable approaches to develop novel antiviral agents. Thereby, new nanosystems, such as carbosilane dendrimers, have been shown to be safe and effective compounds against HIV with great potential as topical microbicides. In addition, because most of the attempts to develop effective topical microbicides were unsuccessful, combinatorial strategies could be a valid approach when designing new microbicides. We evaluated various combinations of anionic carbosilane dendrimers with sulfated (G3-S16 and naphthyl sulfonated (G2-NF16 ended groups with different ARVs against HIV-1 infection. The G3-S16 and G2-NF16 dendrimers showed a synergistic or additive activity profile with zidovudine, efavirenz, and tenofovir in the majority of the combinations tested against the X4 and R5 tropic HIV-1 in cell lines, as well as in human primary cells. Therefore, the combination of ARVs and polyanionic carbosilane dendrimers enhances the antiviral potency of the individual compounds, and our findings support further clinical research on combinational approaches as potential microbicides to block the sexual transmission of HIV-1. Keywords: microbicides, HIV, carbosilane dendrimer, antiretroviral, synergy

  14. Compounds acting against HIV: Imidazo[1,2-a]pyridines as non-nucleoside reverse transcriptase inhibitors (NNRTIs)

    CSIR Research Space (South Africa)

    Bode, M

    2010-09-01

    Full Text Available .6 µM N N NH Cl Res Act = 3% IC50 = 2 µM MAGI IC50 = 0.2 µM N N NH Cl Res Act = 5% IC50 = 3.5 µM MAGI IC50 = 0.18 µM N N NH Cl Res Act = 13% IC50 = 8 µM MAGI IC50 = 0.6 µM N N NH Cl Cl Res Act = 4% IC50 = 1.5 µM MAGI IC50... 2010 www.csir.co.za N N NH N N NH Cl N N NH Cl CN IC50= 4.4 uM (RT) IC50= 0.16 uM (PBMC) IC50= 0.41 uM (MAGI) cf . Nevirapine IC50=0.67 uM (RT) IC50=0.033 uM (PBMC) IC50= 29 uM (RT) IC50= 41 uM (PBMC) cf...

  15. Decrease of vitamin D concentration in patients with HIV infection on a non nucleoside reverse transcriptase inhibitor-containing regimen

    Directory of Open Access Journals (Sweden)

    Colebunders Robert

    2010-11-01

    Full Text Available Abstract Background Vitamin D is an important determinant of bone health and also plays a major role in the regulation of the immune system. Interestingly, vitamin D status before the start of highly active antiretroviral therapy (HAART has been recently associated with HIV disease progression and overall mortality in HIV-positive pregnant women. We prospectively studied vitamin D status in HIV individuals on HAART in Belgium. We selected samples from HIV-positive adults starting HAART with a pre-HAART CD4 T-cell count >100 cells/mm3 followed up for at least 12 months without a treatment change. We compared 25-hydroxyvitamin D plasma [25-(OHD] concentration in paired samples before and after 12 months of HAART. 25-(OHD levels are presented using two different cut-offs: Results Vitamin D deficiency was common before HAART, the frequency of plasma 25-(OHD concentrations below 20 ng/ml and 30 below ng/ml was 43.7% and 70.1% respectively. After 12 months on HAART, the frequency increased to 47.1% and 81.6%. HAART for 12 months was associated with a significant decrease of plasma 25-(OHD concentration (p = 0.001. Decreasing plasma 25-(OHD concentration on HAART was associated in the multivariate model with NNRTI-based regimen (p = 0.001 and lower body weight (p = 0.008. Plasma 25-(OHD concentrations decreased significantly in both nevirapine and efavirenz-containing regimens but not in PI-treated patients. Conclusions Vitamin D deficiency is frequent in HIV-positive individuals and NNRTI therapy further decreases 25-(OHD concentrations. Consequently, vitamin D status need to be checked regularly in all HIV-infected patients and vitamin D supplementation should be given when needed.

  16. The safety and pharmacokinetics of a reverse transcriptase inhibitor, 3TC, in patients with HIV infection: a phase I study

    NARCIS (Netherlands)

    van Leeuwen, R.; Lange, J. M.; Hussey, E. K.; Donn, K. H.; Hall, S. T.; Harker, A. J.; Jonker, P.; Danner, S. A.

    1992-01-01

    To determine the safety and pharmacokinetics of the nucleoside analogue, 3TC. A Phase I, open-label, single-centre study. Twenty asymptomatic, HIV-infected male patients with CD4 lymphocyte counts < 500 x 10(6)/l who had not received previous antiretroviral therapy completed the study. Each patient

  17. A comparison of the ability of rilpivirine (TMC278 and selected analogues to inhibit clinically relevant HIV-1 reverse transcriptase mutants

    Directory of Open Access Journals (Sweden)

    Johnson Barry C

    2012-12-01

    Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.

  18. N348I in the connection domain of HIV-1 reverse transcriptase confers zidovudine and nevirapine resistance.

    Directory of Open Access Journals (Sweden)

    Soo-Huey Yap

    2007-12-01

    Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which

  19. Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.

    Science.gov (United States)

    Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao

    2015-10-01

    Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.

  20. AZT as a telomerase inhibitor

    International Nuclear Information System (INIS)

    Gomez, Daniel E.; Armando, Romina G.; Alonso, Daniel F.

    2012-01-01

    Telomerase is a highly specialized reverse transcriptase (RT) and the maintenance of telomeric length is determined by this specific enzyme. The human holoenzyme telomerase is a ribonucleoprotein composed by a catalytic subunit, hTERT, an RNA component, hTR, and a group of associated proteins. Telomerase is normally expressed in embryonic cells and is repressed during adulthood. The enzyme is reexpressed in around 85% of solid tumors. This observation makes it a potential target for developing drugs that could be developed for therapeutic purposes. The identification of the hTERT as a functional catalytic RT prompted studies of inhibiting telomerase with the HIV RT inhibitor azidothymidine (AZT). Previously, we have demonstrated that AZT binds preferentially to telomeres, inhibits telomerase and enhances tumor cell senescence, and apoptosis after AZT treatment in breast mammary adenocarcinoma cells. Since then, several studies have considered AZT for telomerase inhibition and have led to potential clinical strategies for anticancer therapy. This review covers present thinking of the inhibition of telomerase by AZT and future treatment protocols using the drug.

  1. [Syk inhibitors].

    Science.gov (United States)

    Kimura, Yukihiro; Chihara, Kazuyasu; Takeuchi, Kenji; Sada, Kiyonao

    2013-07-01

    Non-receptor type of protein-tyrosine kinase Syk (spleen tyrosine kinase) was isolated in the University of Fukui in 1991. Syk is known to be essential for the various physiological functions, especially in hematopoietic lineage cells. Moreover, ectopic expression of Syk by epigenetic changes is reported to cause retinoblastoma. Recently, novel Syk inhibitors were developed and its usefulness has been evaluated in the treatment of allergic rhinitis, rheumatoid arthritis, and idiopathic thrombocytopenic purpura. In this review, we will summarize the history, structure, and function of Syk, and then describe the novel Syk inhibitors and their current status. Furthermore, we will introduce our findings of the adaptor protein 3BP2 (c-Abl SH3 domain-binding protein-2), as a novel target of Syk.

  2. Syk inhibitors.

    Science.gov (United States)

    Chihara, Kazuyasu; Kimura, Yukihiro; Honjo, Chisato; Takeuchi, Kenji; Sada, Kiyonao

    2013-01-01

    Non-receptor type of protein-tyrosine kinase Syk (spleen tyrosine kinase) was isolated in University of Fukui in 1991. Syk is most highly expressed by haemopoietic cells and known to play crucial roles in the signal transduction through various immunoreceptors of the adaptive immune response. However, recent reports demonstrate that Syk also mediates other biological functions, such as innate immune response, osteoclast maturation, platelet activation and cellular adhesion. Moreover, ectopic expression of Syk by epigenetic changes is reported to cause retinoblastoma. Because of its critical roles on the cellular functions, the development of Syk inhibitors for clinical use has been desired. Although many candidate compounds were produced, none of them had progressed to clinical trials. However, novel Syk inhibitors were finally developed and its usefulness has been evaluated in the treatment of allergic rhinitis, rheumatoid arthritis and idiopathic thrombocytopenic purpura. In this review, we will summarize the history, structure and function of Syk, and then the novel Syk inhibitors and their current status. In addition, we will introduce our research focused on the functions of Syk on Dectin-1-mediated mast cell activation.

  3. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

    Science.gov (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  4. Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa

    Directory of Open Access Journals (Sweden)

    Aline Aki Tanikawa

    2013-08-01

    Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.

  5. Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

    Directory of Open Access Journals (Sweden)

    Elisabeth Humphris-Narayanan

    Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

  6. [Predictive factors of clinically significant drug-drug interactions among regimens based on protease inhibitors, non-nucleoside reverse transcriptase inhibitors and raltegravir].

    Science.gov (United States)

    Cervero, Miguel; Torres, Rafael; Jusdado, Juan José; Pastor, Susana; Agud, Jose Luis

    2016-04-15

    To determine the prevalence and types of clinically significant drug-drug interactions (CSDI) in the drug regimens of HIV-infected patients receiving antiretroviral treatment. retrospective review of database. Centre: Hospital Universitario Severo Ochoa, Infectious Unit. one hundred and forty-two participants followed by one of the authors were selected from January 1985 to December 2014. from their outpatient medical records we reviewed information from the last available visit of the participants, in relation to HIV infection, comorbidities, demographics and the drugs that they were receiving; both antiretroviral drugs and drugs not related to HIV infection. We defined CSDI from the information sheet and/or database on antiretroviral drug interactions of the University of Liverpool (http://www.hiv-druginteractions.org) and we developed a diagnostic tool to predict the possibility of CSDI. By multivariate logistic regression analysis and by estimating the diagnostic performance curve obtained, we identified a quick tool to predict the existence of drug interactions. Of 142 patients, 39 (29.11%) had some type of CSDI and in 11.2% 2 or more interactions were detected. In only one patient the combination of drugs was contraindicated (this patient was receiving darunavir/r and quetiapine). In multivariate analyses, predictors of CSDI were regimen type (PI or NNRTI) and the use of 3 or more non-antiretroviral drugs (AUC 0.886, 95% CI 0.828 to 0.944; P=.0001). The risk was 18.55 times in those receiving NNRTI and 27,95 times in those receiving IP compared to those taking raltegravir. Drug interactions, including those defined as clinically significant, are common in HIV-infected patients treated with antiretroviral drugs, and the risk is greater in IP-based regimens. Raltegravir-based prescribing, especially in patients who receive at least 3 non-HIV drugs could avoid interactions. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

  7. Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex That Confer Multinucleoside Drug Resistance

    Energy Technology Data Exchange (ETDEWEB)

    Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy

    2017-04-10

    HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.

  8. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  9. The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Dolores Bautista-España

    Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

  10. Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.

    Science.gov (United States)

    Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari

    2018-05-03

    Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.

  11. An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

    DEFF Research Database (Denmark)

    Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

    2004-01-01

    Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

  12. Molecular docking of (5E)-3-(2-aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione on HIV-1 reverse transcriptase: novel drug acting on enzyme.

    Science.gov (United States)

    Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan

    2012-01-01

    The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.

  13. Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments.

    Science.gov (United States)

    Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen

    2011-02-01

    Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

  14. The Unstructured Paramyxovirus Nucleocapsid Protein Tail Domain Modulates Viral Pathogenesis through Regulation of Transcriptase Activity.

    Science.gov (United States)

    Thakkar, Vidhi D; Cox, Robert M; Sawatsky, Bevan; da Fontoura Budaszewski, Renata; Sourimant, Julien; Wabbel, Katrin; Makhsous, Negar; Greninger, Alexander L; von Messling, Veronika; Plemper, Richard K

    2018-04-15

    The paramyxovirus replication machinery comprises the viral large (L) protein and phosphoprotein (P-protein) in addition to the nucleocapsid (N) protein, which encapsidates the single-stranded RNA genome. Common to paramyxovirus N proteins is a C-terminal tail (Ntail). The mechanistic role and relevance for virus replication of the structurally disordered central Ntail section are unknown. Focusing initially on members of the Morbillivirus genus, a series of measles virus (MeV) and canine distemper virus (CDV) N proteins were generated with internal deletions in the unstructured tail section. N proteins with large tail truncations remained bioactive in mono- and polycistronic minireplicon assays and supported efficient replication of recombinant viruses. Bioactivity of Ntail mutants extended to N proteins derived from highly pathogenic Nipah virus. To probe an effect of Ntail truncations on viral pathogenesis, recombinant CDVs were analyzed in a lethal CDV/ferret model of morbillivirus disease. The recombinant viruses displayed different stages of attenuation ranging from ameliorated clinical symptoms to complete survival of infected animals, depending on the molecular nature of the Ntail truncation. Reinfection of surviving animals with pathogenic CDV revealed robust protection against a lethal challenge. The highly attenuated virus was genetically stable after ex vivo passaging and recovery from infected animals. Mechanistically, gradual viral attenuation coincided with stepwise altered viral transcriptase activity in infected cells. These results identify the central Ntail section as a determinant for viral pathogenesis and establish a novel platform to engineer gradual virus attenuation for next-generation paramyxovirus vaccine design. IMPORTANCE Investigating the role of the paramyxovirus N protein tail domain (Ntail) in virus replication, we demonstrated in this study that the structurally disordered central Ntail region is a determinant for viral

  15. Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells

    Directory of Open Access Journals (Sweden)

    Yong Teng

    2014-02-01

    Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.

  16. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo

    2016-06-01

    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  17. Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

    Science.gov (United States)

    Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

    2012-08-01

    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

  18. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali

    2015-11-27

    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  19. Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.

    Science.gov (United States)

    Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V

    2011-12-20

    Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.

  20. Reverse transcriptase directs viral evolution in a deep ocean methane seep

    Science.gov (United States)

    Paul, B. G.; Bagby, S. C.

    2013-12-01

    Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

  1. Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer

    International Nuclear Information System (INIS)

    Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen

    2001-01-01

    Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts

  2. Telomerase Activation in Atherosclerosis and Induction of Telomerase Reverse Transcriptase Expression by Inflammatory Stimuli in Macrophages

    Science.gov (United States)

    Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis

    2010-01-01

    Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948

  3. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki

    2015-01-01

    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  4. Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P

    2011-12-08

    RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.

  5. Reverse Transcriptase-Containing Particles Induced in Rous Sarcoma Virus-Transformed Rat Cells by Arginine Deprivation

    Science.gov (United States)

    Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel

    1972-01-01

    Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137

  6. K70Q adds high-level tenofovir resistance to "Q151M complex" HIV reverse transcriptase through the enhanced discrimination mechanism.

    Directory of Open Access Journals (Sweden)

    Atsuko Hachiya

    2011-01-01

    Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.

  7. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  8. Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

    International Nuclear Information System (INIS)

    Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.

    1986-01-01

    The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

  9. Leptin as a critical regulator of hepatocellular carcinoma development through modulation of human telomerase reverse transcriptase

    Directory of Open Access Journals (Sweden)

    Stefanou Nikolaos

    2010-08-01

    Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.

  10. The predictive and prognostic potential of plasma telomerase reverse transcriptase (TERT) RNA in rectal cancer patients

    Science.gov (United States)

    Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita

    2018-01-01

    Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673

  11. New prognostic factor telomerase reverse transcriptase promotor mutation presents without MR imaging biomarkers in primary glioblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)

    2017-12-15

    Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)

  12. Telomerase reverse transcriptase locus polymorphisms and cancer risk: a field synopsis and meta-analysis.

    Science.gov (United States)

    Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato

    2012-06-06

    Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic

  13. [Diagnostic significance of serum free DNA human telomerase reverse transcriptase quantitative determination on spinal cord injury].

    Science.gov (United States)

    Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B

    2018-02-06

    Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.

  14. Characterization of active reverse transcriptase and nucleoprotein complexes of the yeast retrotransposon Ty3 in vitro.

    Science.gov (United States)

    Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L

    1999-12-17

    Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.

  15. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

    Science.gov (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

    2013-10-01

    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  16. APOBEC3DE Inhibits LINE-1 Retrotransposition by Interacting with ORF1p and Influencing LINE Reverse Transcriptase Activity.

    Directory of Open Access Journals (Sweden)

    Weizi Liang

    Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.

  17. Crystallographic Study of a Novel Sub-Nanomolar Inhibitor Provides Insight on the Binding Interactions of Alkenyldiarylmethanes with Human Immunodeficiency Virus-1 (HIV-1) Reverse Transcriptase†

    Science.gov (United States)

    Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark

    2009-01-01

    Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161

  18. Bauhinia variegata var. variegata trypsin inhibitor: From isolation to potential medicinal applications

    Energy Technology Data Exchange (ETDEWEB)

    Fang, Evandro Fei; Wong, Jack Ho [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China); Bah, Clara Shui Fern [Department of Food Science, Division of Sciences, University of Otago (New Zealand); Lin, Peng [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China); Tsao, Sai Wah [Department of Anatomy, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Sassoon Road, Pokfulam, Hong Kong SAR (China); Ng, Tzi Bun, E-mail: b021770@mailserv.cuhk.edu.hk [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China)

    2010-06-11

    Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K{sub i}, 0.1 x 10{sup -9} M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI.

  19. Bauhinia variegata var. variegata trypsin inhibitor: from isolation to potential medicinal applications.

    Science.gov (United States)

    Fang, Evandro Fei; Wong, Jack Ho; Bah, Clara Shui Fern; Lin, Peng; Tsao, Sai Wah; Ng, Tzi Bun

    2010-06-11

    Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K(i), 0.1 x 10(-9)M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI. (c) 2010 Elsevier Inc. All rights reserved.

  20. Bauhinia variegata var. variegata trypsin inhibitor: From isolation to potential medicinal applications

    International Nuclear Information System (INIS)

    Fang, Evandro Fei; Wong, Jack Ho; Bah, Clara Shui Fern; Lin, Peng; Tsao, Sai Wah; Ng, Tzi Bun

    2010-01-01

    Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K i , 0.1 x 10 -9 M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI.

  1. PRACTICE OF USING VIRAL PROTEASE INHIBITORS IN CHILDREN WITH HIV INFECTION

    Directory of Open Access Journals (Sweden)

    V.B. Denisenko

    2010-01-01

    Full Text Available Selection of the most effective and safest high-active antiretroviral therapies is a critical issue faced by modern HIV medicine. Authors studied 28 children with HIV infection aged from 3 to 7 divided into two groups administered a combination of two HIV reverse transcriptase nucleoside inhibitors with viral protease nelfinavir inhibitors (n = 13 and lopinavir/ritonavir (n = 15. The subjects in both groups demonstrated a decreased frequency of HIV-associated symptoms and opportunistic infections, positive dynamics of immunological indicators, suppression of HIV replication. When lopinavir/ritonavir was administered, there was more even better dynamics in clinical, immunological and virologic parameters, which allows this medication to be recommended as a antiretroviral therapy for children. Key words: HIV infection, lopinavir/ritonavir, nelfinavir, children. (Pediatric Pharmacology. – 2010; 7(1:62-67

  2. Early nucleoside reverse transcriptase inhibitors for the treatment of HIV: a brief history of stavudine (D4T) and its comparison with other dideoxynucleosides.

    Science.gov (United States)

    Martin, John C; Hitchcock, Michael J M; De Clercq, Erik; Prusoff, William H

    2010-01-01

    The occasion of this 25th anniversary issue encouraged us to reminisce about the important history of the discovery of the dideoxynucleoside analogues for the treatment of HIV/AIDS and to chronicle our thoughts about a particular exciting and rewarding period of our scientific careers. Following the identification of the anti-HIV activity of zidovudine (AZT), we participated in the urgent quest to discover optimal treatments of HIV infection and AIDS. A number of previously synthesized nucleoside analogues were comparatively evaluated, and stavudine (D4T) emerged as a promising candidate for development. Following clinical evaluation, D4T became a mainstay of the initial antiretroviral combination therapy, prolonging and saving numerous lives. It has only recently been supplanted by better-tolerated treatments. This article forms part of a special issue of Antiviral Research marking the 25th anniversary of antiretroviral drug discovery and development, vol. 85, issue 1, 2010. Copyright 2009 Elsevier B.V. All rights reserved.

  3. Reverse transcriptase and protease inhibitor resistant mutations in art treatment naïve and treated HIV-1 infected children in India A Short Review

    Directory of Open Access Journals (Sweden)

    Dinesh Bure,

    2016-08-01

    Full Text Available Introduction of first line and second line antiretroviral therapy has dramatically improved the quality of life and survival of the HIV-1 infected individuals. Extension of this therapy in children has similar effect. However the emergence of drug selected resistance has hampered the response to the therapy. A database of prevalence of drug resistance mutations in the Indian children both ART naïve and treated will help in deciding the appropriate regimen for the individual patient as well as formulating the policies regarding the composition of drugs included in the fixed dose combinations and its periodic review by analysis of the information that is made available from time to time. This will enable us to utilize our limited resources in most prudent way.

  4. Development and validation of a rapid reversed-phase HPLC method for the determination of the non-nucleoside reverse transcriptase inhibitor dapivirine from polymeric nanoparticles.

    Science.gov (United States)

    das Neves, José; Sarmento, Bruno; Amiji, Mansoor M; Bahia, Maria Fernanda

    2010-06-05

    The objective of this work was to develop and validate a rapid reversed-phase (RP) high-performance liquid chromatography (HPLC) method for the in vitro pharmaceutical characterization of dapivirine-loaded polymeric nanoparticles. Chromatographic runs were performed on a RP C18 column with a mobile phase comprising acetonitrile-0.5% (w/v) triethanolamine solution in isocratic mode (80:20, v/v) at a flow rate of 1 ml/min. Dapivirine was detected at a wavelength of 290 nm. The method was shown to be specific, linear in the range of 1-50 microg/ml (R(2)=0.9998), precise at the intra-day and inter-day levels as reflected by the relative standard deviation values (less than 0.85%), accurate (recovery rate of 100.17+/-0.35%), and robust to changes in the mobile phase and column brand. The detection and quantitation limits were 0.08 and 0.24 microg/ml, respectively. The method was successfully used to determine the loading capacity and association efficiency of dapivirine in poly(lactic-co-glycolic acid)-based nanoparticles and its in vitro release. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  5. Oxidative stress and toxicity induced by the nucleoside reverse transcriptase inhibitor (NRTI)--2',3'-dideoxycytidine (ddC): relevance to HIV-dementia.

    Science.gov (United States)

    Opii, Wycliffe O; Sultana, Rukhsana; Abdul, Hafiz Mohmmad; Ansari, Mubeen Ahmad; Nath, Avindra; Butterfield, D Allan

    2007-03-01

    Human immunodeficiency virus dementia (HIVD) is the most common form of dementia occurring among young adults. In HIVD, neuronal cell loss occurs in the absence of neuronal infection. With the advent of highly active anti-retroviral therapy (HAART), the incidence of HIVD has drastically reduced, though prevalence of milder forms of HIVD continues to rise. Though these agents have been used successfully in suppressing viral production, they have also been associated with a number of side effects. Here we examine the possible role of NRTIs, in particular 2',3'-dideoxycytidine (ddC), in the neuropathology of HIVD. Synaptosomes and isolated mitochondria treated and incubated for 6 h with CSF-achievable concentrations of ddC, i.e., 6-11 ng/ml, were found to show a significant increase in oxidative stress with 40 nM ddC as measured by protein carbonyls and 3-nitrotyrosine (3NT), effects that were not observed in the more tolerable NRTI, 3TC. Protection against protein oxidation induced by ddC was observed when brain mitochondria were isolated from gerbils 1 h after injection i.p. with the brain accessible antioxidant and glutathione mimetic, tricyclodecan-9-yl-xanthogenate (D609). In addition, there is a significant reduction in the levels of anti-apoptotic protein Bcl-2 and a significant increase in cytochrome c release and also a significant increase in the expression of pro-apoptotic protein caspase-3 after mitochondria were treated with 40 nM ddC. The results reported here show that ddC at 40 nM can induce oxidative stress, cause the release of cytochrome c, and in addition, reduce the levels of anti-apoptotic proteins, increase the levels of pro-apoptotic proteins, thereby increasing the possibility for induction of apoptosis. These findings are consistent with the notion of a possible role of the NRTIs, and in particular, ddC, in the mechanisms involved in HIVD.

  6. Structure-Activity Analysis of Vinylogous Urea Inhibitors of Human Immunodeficiency Virus-Encoded Ribonuclease H ▿

    OpenAIRE

    Chung, Suhman; Wendeler, Michaela; Rausch, Jason W.; Beilhartz, Greg; Gotte, Matthias; O'Keefe, Barry R.; Bermingham, Alun; Beutler, John A.; Liu, Shixin; Zhuang, Xiaowei; Le Grice, Stuart F. J.

    2010-01-01

    Vinylogous ureas 2-amino-5,6,7,8-tetrahydro-4H-cyclohepta[b]thiophene-3-carboxamide and N-[3-(aminocarbonyl)-4,5-dimethyl-2-thienyl]-2-furancarboxamide (compounds 1 and 2, respectively) were recently identified to be modestly potent inhibitors of the RNase H activity of HIV-1 and HIV-2 reverse transcriptase (RT). Both compounds shared a 3-CONH2-substituted thiophene ring but were otherwise structurally unrelated, which prevented a precise definition of the pharmacophore. We have therefore exa...

  7. Selective serotonin reuptake inhibitor suppression of HIV infectivity and replication.

    Science.gov (United States)

    Benton, Tami; Lynch, Kevin; Dubé, Benoit; Gettes, David R; Tustin, Nancy B; Ping Lai, Jian; Metzger, David S; Blume, Joshua; Douglas, Steven D; Evans, Dwight L

    2010-11-01

    To test the hypothesis that the selective serotonin reuptake inhibitor (SSRI) citalopram would down-regulate human immunodeficiency virus (HIV) infectivity and that the greatest effects would be seen in people with depression. Depression is a risk factor for morbidity and mortality in HIV/acquired immune deficiency syndrome. Serotonin (5-HT) neurotransmission has been implicated in the pathobiology of depression, and pharmacologic therapies for depression target this system. The 5-HT transporter and 5-HT receptors are widely distributed throughout the central nervous and immune systems. Depression has been associated with suppression of natural killer cells and CD8(+) lymphocytes, key regulators of HIV infection. Ex vivo models for acute and chronic HIV infection were used to study the effects of citalopram on HIV viral infection and replication in 48 depressed and nondepressed women. For both the acute and chronic infection models, HIV reverse transcriptase activity was measured in the citalopram treatment condition and the control condition. The SSRI significantly down-regulated the reverse transcriptase response in both the acute and chronic infection models. Specifically, citalopram significantly decreased the acute HIV infectivity of macrophages. Citalopram also significantly decreased HIV viral replication in the latently infected T-cell line and in the latently infected macrophage cell line. There was no difference in down-regulation by depression status. These studies suggest that an SSRI enhances natural killer/CD8 noncytolytic HIV suppression in HIV/acquired immune deficiency syndrome and decreases HIV viral infectivity of macrophages, ex vivo, suggesting the need for in vivo studies to determine a potential role for agents targeting serotonin in the host defense against HIV.

  8. Postexposure protection of macaques from vaginal SHIV infection by topical integrase inhibitors.

    Science.gov (United States)

    Dobard, Charles; Sharma, Sunita; Parikh, Urvi M; West, Rolieria; Taylor, Andrew; Martin, Amy; Pau, Chou-Pong; Hanson, Debra L; Lipscomb, Jonathan; Smith, James; Novembre, Francis; Hazuda, Daria; Garcia-Lerma, J Gerardo; Heneine, Walid

    2014-03-12

    Coitally delivered microbicide gels containing antiretroviral drugs are important for HIV prevention. However, to date, microbicides have contained entry or reverse transcriptase inhibitors that block early steps in virus infection and thus need to be given as a preexposure dose that interferes with sexual practices and may limit compliance. Integrase inhibitors block late steps after virus infection and therefore are more suitable for post-coital dosing. We first determined the kinetics of strand transfer in vitro and confirmed that integration begins about 6 hours after infection. We then used a repeat-challenge macaque model to assess efficacy of vaginal gels containing integrase strand transfer inhibitors when applied before or after simian/human immunodeficiency virus (SHIV) challenge. We showed that gel containing the strand transfer inhibitor L-870812 protected two of three macaques when applied 30 min before SHIV challenge. We next evaluated the efficacy of 1% raltegravir gel and demonstrated its ability to protect macaques when applied 3 hours after SHIV exposure (five of six protected; P infections showed no evidence of drug resistance in plasma or vaginal secretions despite continued gel dosing after infection. We documented rapid vaginal absorption reflecting a short pharmacological lag time and noted that vaginal, but not plasma, virus load was substantially reduced in the breakthrough infection after raltegravir gel treatment. We provide a proof of concept that topically applied integrase inhibitors protect against vaginal SHIV infection when administered shortly before or 3 hours after virus exposure.

  9. Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)

    2010-03-26

    The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.

  10. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  11. Phylogenetic analysis of HIV-1 reverse transcriptase sequences from 382 patients recruited in JJ Hospital of Mumbai, India, between 2002 and 2008.

    Science.gov (United States)

    Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J

    2009-06-01

    Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.

  12. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

    Science.gov (United States)

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  13. Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

    NARCIS (Netherlands)

    Oude Essink, B. B.; Das, A. T.; Berkhout, B.

    1995-01-01

    Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

  14. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  15. Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

    NARCIS (Netherlands)

    Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.

    2010-01-01

    Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

  16. Monoamine Oxidase Inhibitors (MAOIs)

    Science.gov (United States)

    ... health-medications/index.shtml. Accessed May 16, 2016. Hirsch M, et al. Monoamine oxidase inhibitors (MAOIs) for ... www.uptodate.com/home. Accessed May 16, 2016. Hirsch M, et al. Discontinuing antidepressant medications in adults. ...

  17. Neutralizing antibody and anti-retroviral drug sensitivities of HIV-1 isolates resistant to small molecule CCR5 inhibitors

    International Nuclear Information System (INIS)

    Pugach, Pavel; Ketas, Thomas J.; Michael, Elizabeth; Moore, John P.

    2008-01-01

    The small molecule CCR5 inhibitors are a new class of drugs for treating infection by human immunodeficiency virus type 1 (HIV-1). They act by binding to the CCR5 co-receptor and preventing its use during HIV-1-cell fusion. Escape mutants can be raised against CCR5 inhibitors in vitro and will arise when these drugs are used clinically. Here, we have assessed the responses of CCR5 inhibitor-resistant viruses to other anti-retroviral drugs that act by different mechanisms, and their sensitivities to neutralizing antibodies (NAbs). The rationale for the latter study is that the resistance pathway for CCR5 inhibitors involves changes in the HIV-1 envelope glycoproteins (Env), which are also targets for NAbs. The escape mutants CC101.19 and D1/85.16 were selected for resistance to AD101 and vicriviroc (VVC), respectively, from the primary R5 HIV-1 isolate CC1/85. Each escape mutant was cross-resistant to other small molecule CCR5 inhibitors (aplaviroc, maraviroc, VVC, AD101 and CMPD 167), but sensitive to protein ligands of CCR5: the modified chemokine PSC-RANTES and the humanized MAb PRO-140. The resistant viruses also retained wild-type sensitivity to the nucleoside reverse transcriptase inhibitor (RTI) zidovudine, the non-nucleoside RTI nevirapine, the protease inhibitor atazanavir and other attachment and fusion inhibitors that act independently of CCR5 (BMS-806, PRO-542 and enfuvirtide). Of note is that the escape mutants were more sensitive than the parental CC1/85 isolate to a subset of neutralizing monoclonal antibodies and to some sera from HIV-1-infected people, implying that sequence changes in Env that confer resistance to CCR5 inhibitors can increase the accessibility of some NAb epitopes. The need to preserve NAb resistance may therefore be a constraint upon how escape from CCR5 inhibitors occurs in vivo

  18. SGLT2 inhibitors.

    Science.gov (United States)

    Dardi, I; Kouvatsos, T; Jabbour, S A

    2016-02-01

    Diabetes mellitus is a serious health issue and an economic burden, rising in epidemic proportions over the last few decades worldwide. Although several treatment options are available, only half of the global diabetic population achieves the recommended or individualized glycemic targets. Sodium-glucose cotransporter 2 (SGLT2) inhibitors are a new class of antidiabetic agents with a novel insulin-independent action. SGLT2 is a transporter found in the proximal renal tubules, responsible for the reabsorption of most of the glucose filtered by the kidney. Inhibition of SGLT2 lowers the blood glucose level by promoting the urinary excretion of excess glucose. Due to their insulin-independent action, SGLT2 inhibitors can be used with any degree of beta-cell dysfunction or insulin resistance, related to a very low risk of hypoglycemia. In addition to improving glycemic control, SGLT2 inhibitors have been associated with a reduction in weight and blood pressure when used as monotherapy or in combination with other antidiabetic agents in patients with type 2 diabetes mellitus (T2DM). Treatment with SGLT2 inhibitors is usually well tolerated; however, they have been associated with an increased incidence of urinary tract and genital infections, although these infections are usually mild and easy to treat. SGLT2 inhibitors are a promising new option in the armamentarium of drugs for patients with T2DM. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Aromatase inhibitors in pediatrics.

    Science.gov (United States)

    Wit, Jan M; Hero, Matti; Nunez, Susan B

    2011-10-25

    Aromatase, an enzyme located in the endoplasmic reticulum of estrogen-producing cells, catalyzes the rate-limiting step in the conversion of androgens to estrogens in many tissues. The clinical features of patients with defects in CYP19A1, the gene encoding aromatase, have revealed a major role for this enzyme in epiphyseal plate closure, which has promoted interest in the use of inhibitors of aromatase to improve adult height. The availability of the selective aromatase inhibitors letrozole and anastrozole--currently approved as adjuvant therapy for breast cancer--have stimulated off-label use of aromatase inhibitors in pediatrics for the following conditions: hyperestrogenism, such as aromatase excess syndrome, Peutz-Jeghers syndrome, McCune-Albright syndrome and functional follicular ovarian cysts; hyperandrogenism, for example, testotoxicosis (also known as familial male-limited precocious puberty) and congenital adrenal hyperplasia; pubertal gynecomastia; and short stature and/or pubertal delay in boys. Current data suggest that aromatase inhibitors are probably effective in the treatment of patients with aromatase excess syndrome or testotoxicosis, partially effective in Peutz-Jeghers and McCune-Albright syndrome, but probably ineffective in gynecomastia. Insufficient data are available in patients with congenital adrenal hyperplasia or functional ovarian cysts. Although aromatase inhibitors appear effective in increasing adult height of boys with short stature and/or pubertal delay, safety concerns, including vertebral deformities, a decrease in serum HDL cholesterol levels and increase of erythrocytosis, are reasons for caution.

  20. Autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter suppresses human ovarian carcinoma growth in vitro and in mice.

    Science.gov (United States)

    Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue

    2013-05-01

    To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis

  1. JAK inhibitors in autoinflammation.

    Science.gov (United States)

    Hoffman, Hal M; Broderick, Lori

    2018-06-11

    Interferonopathies are a subset of autoinflammatory disorders with a prominent type I IFN gene signature. Treatment of these patients has been challenging, given the lack of response to common autoinflammatory therapeutics including IL-1 and TNF blockade. JAK inhibitors (Jakinibs) are a family of small-molecule inhibitors that target the JAK/STAT signaling pathway and have shown clinical efficacy, with FDA and European Medicines Agency (EMA) approval for arthritic and myeloproliferative syndromes. Sanchez and colleagues repurposed baricitinib to establish a significant role for JAK inhibition as a novel therapy for patients with interferonopathies, demonstrating the power of translational rare disease research with lifesaving effects.

  2. Cathepsin D inhibitors

    Directory of Open Access Journals (Sweden)

    M. Gacko

    2007-11-01

    Full Text Available Inhibitors of cathepsin D belong to chemical compounds that estrify carboxyl groups of the Asp33 and Asp231residues of its catalytic site, penta-peptides containing statin, i.e. the amino acid similar in structure to the tetraedric indirectproduct, and polypeptides found in the spare organs of many plants and forming permanent noncovalent complexes withcathepsin. Cathepsin D activity is also inhibited by alpha2-macroglobulin and antibodies directed against this enzyme.Methods used to determine the activity and concentration of these inhibitors and their analytical, preparative and therapeuticapplications are discussed.

  3. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

    Science.gov (United States)

    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

    2014-01-01

    Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

  4. In Vitro Antioxidant Properties, HIV-1 Reverse Transcriptase and Acetylcholinesterase Inhibitory Effects of Traditional Herbal Preparations Sold in South Africa

    Directory of Open Access Journals (Sweden)

    Johannes Van Staden

    2010-10-01

    Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.

  5. Probing the communication of deoxythymidine triphosphate in HIV-1 reverse transcriptase by communication maps and interaction energy studies.

    Science.gov (United States)

    Gnanasekaran, Ramachandran

    2017-11-08

    We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.

  6. The brown algae Pl.LSU/2 group II intron-encoded protein has functional reverse transcriptase and maturase activities.

    Directory of Open Access Journals (Sweden)

    Madeleine Zerbato

    Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.

  7. Impact of HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype: results of a global collaboration.

    Directory of Open Access Journals (Sweden)

    Rami Kantor

    2005-04-01

    Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.

  8. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

    Science.gov (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

    2007-10-01

    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  9. Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes.

    Science.gov (United States)

    Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis

    2017-02-01

    Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

  10. The effect of temperature on the in vitro transcriptase reaction of bluetongue virus, epizootic haemorrhagic disease virus and African horsesickness virus

    International Nuclear Information System (INIS)

    Van Dijk, A.A.; Huismans, H.

    1982-01-01

    Virions of bluetongue virus (BTV), epizootic haemorrhagic disease virus (EHDV) and African horsesickness virus (AHSV) can be converted to core particles by treatment with chymotrypsin and magnesium. The conversion is characterized by the removal of the 2 outer capsid polypeptides of the virion. The loss of these 2 proteins results in an increase in density from 1,36 g/ml to 1,40 g/ml on CsCl gradients. The BTV, EHDV and AHSV core particles have an associated double-stranded RNA dependent RNA transcriptase that appears to transcribe mRNA optimally at 28 degrees Celsius. It was found, at least in the case of BTV, that this low temperature preference is not an intrinsic characteristic of the transcriptase, but is due to a temperature-dependent inhibition of transcription at high core concentrations

  11. The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2014-03-01

    Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

  12. Transglutaminase inhibitor from milk

    NARCIS (Netherlands)

    Jong, G.A.H. de; Wijngaards, G.; Koppelman, S.J.

    2003-01-01

    Cross-linking experiments of skimmed bovine milk with bacterial transglutaminase isolated from Streptoverticillium mobaraense showed only some degree of formation of high-molecular-weight casein polymers. Studies on the nature of this phenomenon revealed that bovine milk contains an inhibitor of

  13. Inhibitors of histone demethylases

    DEFF Research Database (Denmark)

    Lohse, Brian; Kristensen, Jesper L; Kristensen, Line H

    2011-01-01

    Methylated lysines are important epigenetic marks. The enzymes involved in demethylation have recently been discovered and found to be involved in cancer development and progression. Despite the relative recent discovery of these enzymes a number of inhibitors have already appeared. Most of the i...

  14. A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method

    OpenAIRE

    Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao

    2015-01-01

    Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

  15. Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice

    Science.gov (United States)

    Li, Runqin; Zhang, Yinglin

    2016-01-01

    Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632

  16. Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR

    OpenAIRE

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2014-01-01

    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

  17. HIV Protease Inhibitor Use During Pregnancy Is Associated With Decreased Progesterone Levels, Suggesting a Potential Mechanism Contributing to Fetal Growth Restriction

    Science.gov (United States)

    Papp, Eszter; Mohammadi, Hakimeh; Loutfy, Mona R.; Yudin, Mark H.; Murphy, Kellie E.; Walmsley, Sharon L.; Shah, Rajiv; MacGillivray, Jay; Silverman, Michael; Serghides, Lena

    2015-01-01

    Background. Protease inhibitor (PI)–based combination antiretroviral therapy (cART) is administered during pregnancy to prevent perinatal human immunodeficiency virus (HIV) transmission. However, PI use has been associated with adverse birth outcomes, including preterm delivery and small-for-gestational-age (SGA) births. The mechanisms underlying these outcomes are unknown. We hypothesized that PIs contribute to these adverse events by altering progesterone levels. Methods. PI effects on trophoblast progesterone production were assessed in vitro. A mouse pregnancy model was used to assess the impact of PI-based cART on pregnancy outcomes and progesterone levels in vivo. Progesterone levels were assessed in plasma specimens from 27 HIV-infected and 17 HIV-uninfected pregnant women. Results. PIs (ritonavir, lopinavir, and atazanavir) but not nucleoside reverse transcriptase inhibitors (NRTIs) or nonnucleoside reverse transcriptase inhibitors reduced trophoblast progesterone production in vitro. In pregnant mice, PI-based cART but not dual-NRTI therapy was associated with significantly lower progesterone levels that directly correlated with fetal weight. Progesterone supplementation resulted in a significant improvement in fetal weight. We observed lower progesterone levels and smaller infants in HIV-infected women receiving PI-based cART, compared with the control group. In HIV-infected women, progesterone levels correlated significantly with birth weight percentile. Conclusions. Our data suggest that PI use in pregnancy may lead to lower progesterone levels that could contribute to adverse birth outcomes. PMID:25030058

  18. HIV protease inhibitor use during pregnancy is associated with decreased progesterone levels, suggesting a potential mechanism contributing to fetal growth restriction.

    Science.gov (United States)

    Papp, Eszter; Mohammadi, Hakimeh; Loutfy, Mona R; Yudin, Mark H; Murphy, Kellie E; Walmsley, Sharon L; Shah, Rajiv; MacGillivray, Jay; Silverman, Michael; Serghides, Lena

    2015-01-01

    Protease inhibitor (PI)-based combination antiretroviral therapy (cART) is administered during pregnancy to prevent perinatal human immunodeficiency virus (HIV) transmission. However, PI use has been associated with adverse birth outcomes, including preterm delivery and small-for-gestational-age (SGA) births. The mechanisms underlying these outcomes are unknown. We hypothesized that PIs contribute to these adverse events by altering progesterone levels. PI effects on trophoblast progesterone production were assessed in vitro. A mouse pregnancy model was used to assess the impact of PI-based cART on pregnancy outcomes and progesterone levels in vivo. Progesterone levels were assessed in plasma specimens from 27 HIV-infected and 17 HIV-uninfected pregnant women. PIs (ritonavir, lopinavir, and atazanavir) but not nucleoside reverse transcriptase inhibitors (NRTIs) or nonnucleoside reverse transcriptase inhibitors reduced trophoblast progesterone production in vitro. In pregnant mice, PI-based cART but not dual-NRTI therapy was associated with significantly lower progesterone levels that directly correlated with fetal weight. Progesterone supplementation resulted in a significant improvement in fetal weight. We observed lower progesterone levels and smaller infants in HIV-infected women receiving PI-based cART, compared with the control group. In HIV-infected women, progesterone levels correlated significantly with birth weight percentile. Our data suggest that PI use in pregnancy may lead to lower progesterone levels that could contribute to adverse birth outcomes. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

  19. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  20. 2-(Alkyl/aryl)amino-6-benzylpyrimidin-4(3H)-ones as inhibitors of wild-type and mutant HIV-1: enantioselectivity studies.

    Science.gov (United States)

    Rotili, Dante; Samuele, Alberta; Tarantino, Domenico; Ragno, Rino; Musmuca, Ira; Ballante, Flavio; Botta, Giorgia; Morera, Ludovica; Pierini, Marco; Cirilli, Roberto; Nawrozkij, Maxim B; Gonzalez, Emmanuel; Clotet, Bonaventura; Artico, Marino; Esté, José A; Maga, Giovanni; Mai, Antonello

    2012-04-12

    The single enantiomers of two pyrimidine-based HIV-1 non-nucleoside reverse transcriptase inhibitors, 1 (MC1501) and 2 (MC2082), were tested in both cellular and enzyme assays. In general, the R forms were more potent than their S counterparts and racemates and (R)-2 was more efficient than (R)-1 and the reference compounds, with some exceptions. Interestingly, (R)-2 displayed a faster binding to K103N RT with respect to WT RT, while (R)-1 showed the opposite behavior. © 2012 American Chemical Society

  1. Telomerase Inhibitors from Natural Products and Their Anticancer Potential

    Directory of Open Access Journals (Sweden)

    Kumar Ganesan

    2017-12-01

    Full Text Available Telomeres and telomerase are nowadays exploring traits on targets for anticancer therapy. Telomerase is a unique reverse transcriptase enzyme, considered as a primary factor in almost all cancer cells, which is mainly responsible to regulate the telomere length. Hence, telomerase ensures the indefinite cell proliferation during malignancy—a hallmark of cancer—and this distinctive feature has provided telomerase as the preferred target for drug development in cancer therapy. Deactivation of telomerase and telomere destabilization by natural products provides an opening to succeed new targets for cancer therapy. This review aims to provide a fundamental knowledge for research on telomere, working regulation of telomerase and its various binding proteins to inhibit the telomere/telomerase complex. In addition, the review summarizes the inhibitors of the enzyme catalytic subunit and RNA component, natural products that target telomeres, and suppression of transcriptional and post-transcriptional levels. This extensive understanding of telomerase biology will provide indispensable information for enhancing the efficiency of rational anti-cancer drug design.

  2. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires.

    Science.gov (United States)

    Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z

    2017-07-11

    Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From

  3. Acid corrosion inhibitor

    Energy Technology Data Exchange (ETDEWEB)

    Chen, N G

    1964-04-28

    An acid corrosion inhibitor is prepared by a 2-stage vacuum evaporation of effluents obtained from the ammonia columns of the coking oven plant. The effluent, leaving a scrubber in which the phenols are removed at a temperature of 98$C, passes through a quartz filter and flows into a heated chamber in which it is used for preheating a solution circulating through a vacuum unit, maintaining the temperature of the solution at 55$ to 60$C. The effluent enters a large tank in which it is boiled at 55$ to 60$C under 635 to 640 mm Hg pressure. Double evaporation of this solution yields a very effective acid corrosion inhibitor. Its corrosion-preventing effect is 97.9% compared with 90.1% for thiourea and 88.5% for urotropin under identical conditions.

  4. Benzoylurea Chitin Synthesis Inhibitors.

    Science.gov (United States)

    Sun, Ranfeng; Liu, Chunjuan; Zhang, Hao; Wang, Qingmin

    2015-08-12

    Benzoylurea chitin synthesis inhibitors are widely used in integrated pest management (IPM) and insecticide resistance management (IRM) programs due to their low toxicity to mammals and predatory insects. In the past decades, a large number of benzoylurea derivatives have been synthesized, and 15 benzoylurea chitin synthesis inhibitors have been commercialized. This review focuses on the history of commercial benzolyphenylureas (BPUs), synthetic methods, structure-activity relationships (SAR), action mechanism research, environmental behaviors, and ecotoxicology. Furthermore, their disadvantages of high risk to aquatic invertebrates and crustaceans are pointed out. Finally, we propose that the para-substituents at anilide of benzoylphenylureas should be the functional groups, and bipartite model BPU analogues are discussed in an attempt to provide new insight for future development of BPUs.

  5. A quantitative reverse-transcriptase PCR assay for the assessment of drug activities against intracellular Theileria annulata schizonts

    Directory of Open Access Journals (Sweden)

    Isabel Hostettler

    2014-12-01

    Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.

  6. Zidovudine (AZT monotherapy selects for the A360V mutation in the connection domain of HIV-1 reverse transcriptase.

    Directory of Open Access Journals (Sweden)

    Jessica H Brehm

    Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.

  7. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires

    Directory of Open Access Journals (Sweden)

    Sukrit Silas

    2017-07-01

    Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.

  8. Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase.

    Science.gov (United States)

    Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S

    2003-05-01

    Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

  9. Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

    International Nuclear Information System (INIS)

    Zhu Hanneng; Chen Wenying; Xiong Sidong

    2000-01-01

    Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

  10. Reptin is required for the transcription of telomerase reverse transcriptase and over-expressed in gastric cancer

    Directory of Open Access Journals (Sweden)

    Liu Tiantian

    2010-05-01

    Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.

  11. Association of telomerase reverse transcriptase promoter mutations with clinicopathological features and prognosis of thyroid cancer: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Su X

    2016-11-01

    Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation

  12. Human Immunodeficiency Virus type-1 reverse transcriptase exists as post-translationally modified forms in virions and cells

    Directory of Open Access Journals (Sweden)

    Warrilow David

    2008-12-01

    Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.

  13. Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

    Directory of Open Access Journals (Sweden)

    Winny Xie

    2013-12-01

    Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

  14. Reverse Transcriptase drug resistance mutations in HIV-1 Subtype C infected patients on ART in Karonga District, Malawi

    LENUS (Irish Health Repository)

    Bansode, Vijay B

    2011-10-13

    Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge

  15. Telomerase activity-independent function of telomerase reverse transcriptase is involved in acrylamide-induced neuron damage.

    Science.gov (United States)

    Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X

    2014-07-01

    Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.

  16. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

    Science.gov (United States)

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

    2017-02-01

    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  17. The reverse transcription inhibitor abacavir shows anticancer activity in prostate cancer cell lines.

    Directory of Open Access Journals (Sweden)

    Francesca Carlini

    Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.

  18. DGAT inhibitors for obesity.

    Science.gov (United States)

    Matsuda, Daisuke; Tomoda, Hiroshi

    2007-10-01

    Obesity is characterized by the accumulation of triacylglycerol in adipocytes. Diacylglycerol acyltransferase (DGAT) catalyzes the final reaction of triacylgycerol synthesis. Two isozymes of DGAT, DGAT1 and DGAT2, have been reported. Increased DGAT2 activity has a role in steatosis, while DGAT1 plays a role in very (V)LDL synthesis; increased plasma VLDL concentrations may promote obesity and thus DGAT1 is considered a potential therapeutic target of inhibition for obesity control. Several DGAT inhibitors of natural and synthetic origin have been reported, and their future prospect as anti-obesity drugs is discussed in this review.

  19. Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

    Directory of Open Access Journals (Sweden)

    Tandale Babasaheb V

    2008-12-01

    Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

  20. Development and customization of a color-coded microbeads-based assay for drug resistance in HIV-1 reverse transcriptase.

    Science.gov (United States)

    Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki

    2014-01-01

    Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.

  1. Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

    Science.gov (United States)

    Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

    2016-04-01

    Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

  2. Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

    Science.gov (United States)

    Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

    2014-01-13

    Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The

  3. Lentin, a novel and potent antifungal protein from shitake mushroom with inhibitory effects on activity of human immunodeficiency virus-1 reverse transcriptase and proliferation of leukemia cells.

    Science.gov (United States)

    Ngai, Patrick H K; Ng, T B

    2003-11-14

    From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.

  4. Pulmonary Toxicity of Cholinesterase Inhibitors

    National Research Council Canada - National Science Library

    Hilmas, Corey; Adler, Michael; Baskin, Steven I; Gupta, Ramesh C

    2006-01-01

    .... Whereas nerve agents were produced primarily for military deployment, other cholinesterase inhibitors were used for treating conditions such as myasthenia gravis and as pretreaunents for nerve agent exposure...

  5. Novel Bifunctional Quinolonyl Diketo Acid Derivatives as HIV-1 Integrase Inhibitors: Design, Synthesis, Biological Activities and Mechanism of Action

    Science.gov (United States)

    Di Santo, Roberto; Costi, Roberta; Roux, Alessandra; Artico, Marino; Lavecchia, Antonio; Marinelli, Luciana; Novellino, Ettore; Palmisano, Lucia; Andreotti, Mauro; Amici, Roberta; Galluzzo, Clementina Maria; Nencioni, Lucia; Palamara, Anna Teresa; Pommier, Yves; Marchand, Christophe

    2008-01-01

    The virally encoded integrase protein is an essential enzyme in the life cycle of the HIV-1 virus and represents an attractive and validated target in the development of therapeutics against HIV infection. Drugs that selectively inhibit this enzyme, when used in combination with inhibitors of reverse transcriptase and protease, are believed to be highly effective in suppressing the viral replication. Among the HIV-1 integrase inhibitors, the β-diketo acids (DKAs) represent a major lead for anti-HIV-1drug development. In this study, novel bifunctional quinolonyl diketo acid derivatives were designed, synthesized and tested for their inhibitory ability against HIV-1 integrase. The compounds are potent inhibitors of integrase activity. Particularly, derivative 8 is a potent IN inhibitor for both steps of the reaction (3′-processing and strand transfer) and exhibits both high antiviral activity against HIV-1 infected cells and low cytotoxicity. Molecular modeling studies provide a plausible mechanism of action, which is consistent with ligand SARs and enzyme photo-crosslinking experiments. PMID:16539381

  6. Biological abatement of cellulase inhibitors

    Science.gov (United States)

    Bio-abatement uses a fungus to metabolize and remove fermentation inhibitors. To determine whether bio-abatement could alleviate enzyme inhibitor effects observed in biomass liquors after pretreatment, corn stover at 10% (w/v) solids was pretreated with either dilute acid or liquid hot water. The ...

  7. Proteinaceous alpha-araylase inhibitors

    DEFF Research Database (Denmark)

    Svensson, Birte; Fukuda, Kenji; Nielsen, P.K.

    2004-01-01

    -amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha...

  8. Corrosion inhibitors. Manufacture and technology

    International Nuclear Information System (INIS)

    Ranney, M.W.

    1976-01-01

    Detailed information is presented relating to corrosion inhibitors. Areas covered include: cooling water, boilers and water supply plants; oil well and refinery operations; fuel and lubricant additives for automotive use; hydraulic fluids and machine tool lubes; grease compositions; metal surface treatments and coatings; and general processes for corrosion inhibitors

  9. Expression of human telomerase reverse transcriptase protein in oral epithelial dysplasia and oral squamous cell carcinoma: An immunohistochemical study

    Science.gov (United States)

    Raghunandan, Bangalore Nagarajachar; Sanjai, Karpagaselvi; Kumaraswamy, Jayalakshmi; Papaiah, Lokesh; Pandey, Bhavna; Jyothi, Bellur MadhavaRao

    2016-01-01

    Background: Telomerase is an RNA-dependent DNA polymerase that synthesizes TTAGGG telomeric DNA sequences and almost universally provides the molecular basis for unlimited proliferative potential. The telomeres become shorter with each cycle of replication and reach a critical limit; most cells die or enter stage of replicative senescence. Telomere length maintenance by telomerase is required for all the cells that exhibit limitless replicative potential. It has been postulated that reactivation of telomerase expression is necessary for the continuous proliferation of neoplastic cells to attain immortality. Use of immunohistochemistry (IHC) is a useful, reliable method of localizing the human telomerase reverse transcriptase (hTERT) protein in tissue sections which permits cellular localization. Although there exists a lot of information on telomerase in oral cancer, little is known about their expression in oral epithelial dysplasia and their progression to oral squamous cell carcinoma (OSCC) compared to normal oral mucosa. This study addresses this lacuna. Aims: To compare the expression of hTERT protein in oral epithelial dysplasia and OSCC with normal oral mucosa by Immunohistochemical method. Subjects and Methods: In this preliminary study, IHC was used to detect the expression of hTERT protein in OSCC (n = 20), oral epithelial dysplasia (n = 21) and normal oral mucosa (n = 10). The tissue localization of immunostain, cellular localization of immunostain, nature of stain, intensity of stain, percentage of cells stained with hTERT protein were studied. A total number of 100 cells were counted in each slide. Statistical Analysis: All the data were analyzed using SPSS software version 16.0. The tissue localization, cellular localization of cytoplasmic/nuclear/both of hTERT stain, staining intensity was compared across the groups using Pearson's Chi-square test. The mean percentage of cells stained for oral epithelial dysplasia, OSCC and normal oral mucosa were

  10. Karakteristik Reverse Transcriptase Gen Polymerase Virus Hepatitis B Pada Penderita Hepatitis B Kronis Asimptomatik Pra-Pengobatan

    Directory of Open Access Journals (Sweden)

    Turyadi Turyadi

    2018-01-01

    Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase.   Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis

  11. Role of hTERT in apoptosis of cervical cancer induced by histone deacetylase inhibitor

    International Nuclear Information System (INIS)

    Wu, Peng; Meng, Li; Wang, Hui; Zhou, Jianfeng; Xu, Gang; Wang, Shixuan; Xi, Ling; Chen, Gang; Wang, Beibei; Zhu, Tao; Lu, Yunping; Ma, Ding

    2005-01-01

    Human telomerase reverse transcriptase (hTERT) is the catalytic subunit of telomerase holoenzyme as well as the rate-limiting component of the telomerase enzyme complex. However, the role of the hTERT in apoptosis induced by histone deacetylase inhibitor has only been marginally addressed. For the first time, our study demonstrated that trichostatin A (TSA) briefly activated the proliferation of cervical cancer cell lines, HeLa and SiHa, within 12 h, but then inhibited cell growth after that time point. In response to TSA, hTERT expression, telomerase activity, and telomere length also underwent similar changes during the same time frame. Furthermore, the data in our study showed that cells transfected with dominant negative hTERT were more likely to undergo apoptosis induced by TSA than cells transfected with wild-type hTERT. The cyclin/cdk inhibitor p21 waf1 was down-regulated by hTERT without changing the expression of p53. Results from this study suggest that the hTERT might be a primary target of TSA and the anti-apoptosis effect of hTERT might be carried out through a p21 waf1 -dependent and p53-independent pathway

  12. ONIOM DFT/PM3 calculations on the interaction between dapivirine and HIV-1 reverse transcriptase, a theoretical study.

    Science.gov (United States)

    Liang, Y H; Chen, F E

    2007-08-01

    Theoretical investigations of the interaction between dapivirine and the HIV-1 RT binding site have been performed by the ONIOM2 (B3LYP/6-31G (d,p): PM3) and B3LYP/6-31G (d,p) methods. The results derived from this study indicate that this inhibitor dapivirine forms two hydrogen bonds with Lys101 and exhibits strong π-π stacking or H…π interaction with Tyr181 and Tyr188. These interactions play a vital role in stabilizing the NNIBP/dapivirine complex. Additionally, the predicted binding energy of the BBF optimized structure for this complex system is -18.20 kcal/mol.

  13. Protease inhibitor associated mutations compromise the efficacy of therapy in human immunodeficiency virus – 1 (HIV-1 infected pediatric patients: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Petrova Anna

    2007-07-01

    Full Text Available Abstract Background Although the introduction of combined therapy with reverse transcriptase and protease inhibitors has resulted in considerable decrease in HIV related mortality; it has also induced the development of multiple drug-resistant HIV-1 variants. The few studies on HIV-1 mutagenesis in HIV infected children have not evaluated the impact of HIV-1 mutations on the clinical, virological and immunological presentation of HIV disease that is fundamental to optimizing the treatment regimens for these patients. Results A cross sectional study was conducted to evaluate the impact of treatment regimens and resistance mutation patterns on the clinical, virological, and immunological presentation of HIV disease in 41 children (25 male and 16 female at the Robert Wood Johnson Pediatric AIDS Program in New Brunswick, New Jersey. The study participants were symptomatic and had preceding treatment history with combined ARV regimens including protease inhibitors (PIs, nucleoside reverse transcriptase inhibitors (NRTIs and non-nucleoside reverse transcriptase inhibitors (NNRTIs. Fifteen (36.6% children were treated with NRTI+NNRTI+ PI, 6 (14.6% with NRTI+NNRTIs, 13 (31.7% with NRTI+PIs, and the remaining 7 (17.1% received NRTIs only. Combined ARV regimens did not significantly influence the incidence of NRTI and NNRTI associated mutations. The duration of ARV therapy and the child's age had no significant impact on the ARV related mutations. The clinico-immunological presentation of the HIV disease was not associated with ARV treatment regimens or number of resistance mutations. However, primary mutations in the protease (PR gene increased the likelihood of plasma viral load (PVL ≥ 10,000 copies/mL irrespective of the child's age, duration of ARV therapy, presence of NRTI and NNRTI mutation. Viremia ≥ 10,000 copies/mL was recorded in almost all the children with primary mutations in the PR region (n = 12/13, 92.3% as compared with only 50.0% (n

  14. Docking and 3-D QSAR studies on indolyl aryl sulfones. Binding mode exploration at the HIV-1 reverse transcriptase non-nucleoside binding site and design of highly active N-(2-hydroxyethyl)carboxamide and N-(2-hydroxyethyl)carbohydrazide derivatives.

    Science.gov (United States)

    Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano

    2005-01-13

    Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.

  15. [The efficacy of autocatalytic casapse-3 driven by human telomerase reverse transcriptase promoter on human ovarian carcinoma].

    Science.gov (United States)

    Song, Yue; Shen, Keng; Yu, Jing-rong

    2007-11-06

    To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp), and investigate its antitumor effect on ovarian cancer in vitro and in vivo. Recombinant adenovirus expressing autocatalytic caspase-3 (rev-csapase-3) driven by hTERTp, AdHT-rev-casp3, was constructed. Ad-rev-casp3 expressing rev-caspase-3 driven by cytomegalovirus promoter (CMVp) was used as a positive control. hTERT positive human ovarian cancer cells of the line AO and hTERT-negative human umbilical venous endothelial cells (HUVECs) were cultured and transfected with AdHT-rev-casp3, Ad-rev-casp3, or Ad-EGFG expressing enhanced green fluorescent protein as control group. Western blotting, Cell Counting Kit (CCK-8), flow cytometry, and TUNEL were used to detect the expression of p17, active subunit of caspase-3, and p85, a poly ADP-ribose polymerase (PARP) cleavage fragment, and they were also used to measure the cell survival rate and apoptotic rate. Western blotting was used to detect the expression of active caspase-3 and its substrate PARP in the AO cells and HUVECs. Twenty nude BALB/c mice were inoculated subcutaneously with AO cells to establish subcutaneous tumor models, when the tumor grew to the volume of 150 mm3 the rats were divided into 4 equal groups to undergo intra-tumor injection of AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, and phosphate-buffered saline (PBS) respectively, the survival rate tumor inhibition rate was observed, 72 days later the mice were killed with their livers and tumors taken out, and Western blotting was used to detect the expression of active caspase-3. Another 40 mice underwent intraperitoneal injection of AO cells to establish intraperitoneal transplanted tumor models, 21 days later the rats were divided into 4 equal groups to be injected intraperitoneally with AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, or PBS, the survival rate was observed, and the blood levels of alanine transaminase

  16. [ACE inhibitors and the kidney].

    Science.gov (United States)

    Hörl, W H

    1996-01-01

    Treatment with ACE inhibitors results in kidney protection due to reduction of systemic blood pressure, intraglomerular pressure, an antiproliferative effect, reduction of proteinuria and a lipid-lowering effect in proteinuric patients (secondary due to reduction of protein excretion). Elderly patients with diabetes melitus, coronary heart disease or peripheral vascular occlusion are at risk for deterioration of kidney function due to a high frequency of renal artery stenosis in these patients. In patients with renal insufficiency dose reduction of ACE inhibitors is necessary (exception: fosinopril) but more important is the risk for development of hyperkalemia. Patients at risk for renal artery stenosis and patients pretreated with diuretics should receive a low ACE inhibitor dosage initially ("start low - go slow"). For compliance reasons once daily ACE inhibitor dosage is recommended.

  17. Synthesis of the highly selective p38 MAPK inhibitor UR-13756 for possible therapeutic use in Werner syndrome.

    Science.gov (United States)

    Bagley, Mark C; Davis, Terence; Rokicki, Michal J; Widdowson, Caroline S; Kipling, David

    2010-02-01

    UR-13756 is a potent and selective p38 mitogen-activated protein kinase (MAPK) inhibitor, reported to have good bioavailability and pharmacokinetic properties and, thus, is of potential use in the treatment of accelerated aging in Werner syndrome. Irradiation of 2-chloroacrylonitrile and methylhydrazine in ethanol at 100 °C gives 1-methyl-3-aminopyrazole, which reacts with 4-fluorobenzaldehyde and a ketone, obtained by Claisen condensation of 4-picoline, in a Hantzsch-type 3-component hereocyclocondensation, to give the pyrazolopyridine UR-13756. UR-13756 shows p38 MAPK inhibitory activity in human telomerase reverse transcriptase-immortalized HCA2 dermal fibroblasts, with an IC(50) of 80 nm, as shown by ELISA, is 100% efficacious for up to 24 h at 1.0 μm and displays excellent kinase selectivity over the related stress-activated c-Jun kinases. In addition, UR-13756 is an effective p38 inhibitor at 1.0 μm in Werner syndrome cells, as shown by immunoblot. The convergent synthesis of UR-13756 is realized using microwave dielectric heating and provides a highly selective inhibitor that shows excellent selectivity for p38 MAPK over c-Jun N-terminal kinase.

  18. A new general method for simultaneous fitting of temperature and concentration dependence of reaction rates yields kinetic and thermodynamic parameters for HIV reverse transcriptase specificity.

    Science.gov (United States)

    Li, An; Ziehr, Jessica L; Johnson, Kenneth A

    2017-04-21

    Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Metal corrosion inhibitors and ecology

    International Nuclear Information System (INIS)

    Krasts, H.; Svarce, J.; Berge, B.

    1999-01-01

    The use of metal corrosion inhibitors in water is one of the cheapest method to protect metals against corrosion. However, the used inhibitors can come to surface water in the course of time and can become as source of environmental pollution. It is important to co-ordinate amount of substances in the elaborated inhibitors not only with demands for metal protection, but also with demands for quality of surface water and drinking water according to normative statements: 3.5 mg/l (as PO 4 ) for hexametaphosphate, tripolyphosphate and phosphonate; 40 mg/l (as SiO 2 for silicate, up to 1 mg/l for CU 2+ ; up to 5 mg/l for Zn 2+ ; up to 1 mg/l for B; up to 0.5 mg/l for Mo 2+ . The examples of the elaborated inhibitors are given. Many organic substances can be used as corrosion inhibitors, but there is shortage of standard methods for their analysis in water in Latvia. Removing of salt's deposits from boilers needs elaboration of a separate normative statement for dispersing waste water which content chloride at high concentration and heavy metals. (authors)

  20. Positron emitter labeled enzyme inhibitors

    International Nuclear Information System (INIS)

    Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.; Langstrom, B.

    1990-01-01

    This invention involves a new strategy for imagining and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide inactivators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography

  1. ROCK inhibitors in ocular disease

    Directory of Open Access Journals (Sweden)

    Eva Halasz

    2016-12-01

    Full Text Available Rho kinases (ROCKs have a crucial role in actin-cytoskeletal reorganization and thus are involved in broad aspects of cell motility, from smooth muscle contraction to neurite outgrowth. The first marketed ROCK inhibitor, called fasudil, has been used safely for treatment of cerebral vasospasm since 1995 in Japan. During the succeeding decades ROCK inhibitors have been applied in many pathological conditions from central nervous system disorders to cardiovascular disease as potential therapeutic agents or experimental tools to help understand the underlying (pathomechanisms. In 2014, a fasudil derivate named ripasudil was accepted for clinical use in glaucoma and ocular hypertension. Since ROCK kinases are widely expressed in ocular tissues, they have been implicated in the pathology of many ocular conditions such as corneal dysfunction, glaucoma, cataract, diabetic retinopathy, age-related macular degeneration, and retinal detachment. This paper aims to provide an overview of the most recent status/application of ROCK inhibitors in the field of eye disease.

  2. Azidoblebbistatin, a photoreactive myosin inhibitor

    Science.gov (United States)

    Képiró, Miklós; Várkuti, Boglárka H.; Bodor, Andrea; Hegyi, György; Drahos, László; Kovács, Mihály; Málnási-Csizmadia, András

    2012-01-01

    Photoreactive compounds are important tools in life sciences that allow precisely timed covalent crosslinking of ligands and targets. Using a unique technique we have synthesized azidoblebbistatin, which is a derivative of blebbistatin, the most widely used myosin inhibitor. Without UV irradiation azidoblebbistatin exhibits identical inhibitory properties to those of blebbistatin. Using UV irradiation, azidoblebbistatin can be covalently crosslinked to myosin, which greatly enhances its in vitro and in vivo effectiveness. Photo-crosslinking also eliminates limitations associated with the relatively low myosin affinity and water solubility of blebbistatin. The wavelength used for photo-crosslinking is not toxic for cells and tissues, which confers a great advantage in in vivo tests. Because the crosslink results in an irreversible association of the inhibitor to myosin and the irradiation eliminates the residual activity of unbound inhibitor molecules, azidoblebbistatin has a great potential to become a highly effective tool in both structural studies of actomyosin contractility and the investigation of cellular and physiological functions of myosin II. We used azidoblebbistatin to identify previously unknown low-affinity targets of the inhibitor (EC50 ≥ 50 μM) in Dictyostelium discoideum, while the strongest interactant was found to be myosin II (EC50 = 5 μM). Our results demonstrate that azidoblebbistatin, and potentially other azidated drugs, can become highly useful tools for the identification of strong- and weak-binding cellular targets and the determination of the apparent binding affinities in in vivo conditions. PMID:22647605

  3. Biological abatement of cellulase inhibitors.

    Science.gov (United States)

    Cao, Guangli; Ximenes, Eduardo; Nichols, Nancy N; Zhang, Leyu; Ladisch, Michael

    2013-10-01

    Removal of enzyme inhibitors released during lignocellulose pretreatment is essential for economically feasible biofuel production. We tested bio-abatement to mitigate enzyme inhibitor effects observed in corn stover liquors after pretreatment with either dilute acid or liquid hot water at 10% (w/v) solids. Bio-abatement of liquors was followed by enzymatic hydrolysis of cellulose. To distinguish between inhibitor effects on enzymes and recalcitrance of the substrate, pretreated corn stover solids were removed and replaced with 1% (w/v) Solka Floc. Cellulose conversion in the presence of bio-abated liquors from dilute acid pretreatment was 8.6% (0.1x enzyme) and 16% (1x enzyme) higher than control (non-abated) samples. In the presence of bio-abated liquor from liquid hot water pretreated corn stover, 10% (0.1x enzyme) and 13% (1x enzyme) higher cellulose conversion was obtained compared to control. Bio-abatement yielded improved enzyme hydrolysis in the same range as that obtained using a chemical (overliming) method for mitigating inhibitors. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Phosphodiesterase inhibitors in clinical urology.

    Science.gov (United States)

    Ückert, Stefan; Kuczyk, Markus A; Oelke, Matthias

    2013-05-01

    To date, benign diseases of the male and female lower urinary and genital tract, such as erectile dysfunction, bladder overactivity, lower urinary tract symptomatology secondary to benign prostatic hyperplasia and symptoms of female sexual dysfunction (including arousal and orgasmic disorders), can be therapeutically approached by influencing the function of the smooth musculature of the respective tissues. The use of isoenzyme-selective phosphodiesterase (PDE) inhibitors is considered a great opportunity to treat various diseases of the human urogenital tract. PDE inhibitors, in particular the PDE5 (cyclic GMP PDE) inhibitors avanafil, lodenafil, sildenafil, tadalafil, udenafil and vardenafil, are regarded as efficacious, having a fast onset of drug action and an improved effect-to-adverse event ratio, combining a high response rate with the advantage of an on-demand intake. The purpose of this review is to summarize recent as well as potential future indications, namely, erectile dysfunction, Peyronie's disease, overactive bladder, urinary stone disease, lower urinary tract symptomatology secondary to benign prostatic hyperplasia and premature ejaculation, for the use of PDE inhibitors in clinical urology.

  5. Inhibitors of mTOR

    NARCIS (Netherlands)

    Klümpen, Heinz-Josef; Beijnen, Jos H.; Gurney, Howard; Schellens, Jan H. M.

    2010-01-01

    Inhibitors of mammalian target of rapamycin (mTOR) have been approved for the treatment of renal cell carcinoma and appear to have a role in the treatment of other malignancies. The primary objective of this drug review is to provide pharmacokinetic and dynamic properties of the commonly used drugs

  6. Retroviral proteinases and their inhibitors

    Czech Academy of Sciences Publication Activity Database

    Sedláček, Juraj

    2000-01-01

    Roč. 3, 3,4 (2000), s. 23-24 [ Proteolytic enzymes and their inhibitors in physiology and pathogenesis. 14.09.2000, Plzen] Institutional research plan: CEZ:AV0Z5052915 Subject RIV: EB - Genetics ; Molecular Biology

  7. Monoamine depletion by reuptake inhibitors

    Directory of Open Access Journals (Sweden)

    Hinz M

    2011-10-01

    Full Text Available Marty Hinz1, Alvin Stein2, Thomas Uncini31Clinical Research, NeuroResearch Clinics Inc, Cape Coral, FL; 2Stein Orthopedic Associates, Plantation, FL; 3DBS Labs Inc, Duluth, MN, USABackground: Disagreement exists regarding the etiology of cessation of the observed clinical results with administration of reuptake inhibitors. Traditionally, when drug effects wane, it is known as tachyphylaxis. With reuptake inhibitors, the placebo effect is significantly greater than the drug effect in the treatment of depression and attention deficit hyperactivity disorder, leading some to assert that waning of drug effects is placebo relapse, not tachyphylaxis.Methods: Two groups were retrospectively evaluated. Group 1 was composed of subjects with depression and Group 2 was composed of bariatric subjects treated with reuptake inhibitors for appetite suppression.Results: In Group 1, 200 subjects with depression were treated with citalopram 20 mg per day. A total of 46.5% (n = 93 achieved relief of symptoms (Hamilton-D rating score ≤ 7, of whom 37 (39.8% of whom experienced recurrence of depression symptoms, at which point an amino acid precursor formula was started. Within 1–5 days, 97.3% (n = 36 experienced relief of depression symptoms. In Group 2, 220 subjects were treated with phentermine 30 mg in the morning and citalopram 20 mg at 4 pm. In this group, 90.0% (n = 198 achieved adequate appetite suppression. The appetite suppression ceased in all 198 subjects within 4–48 days. Administration of an amino acid precursor formula restored appetite suppression in 98.5% (n = 195 of subjects within 1–5 days.Conclusion: Reuptake inhibitors do not increase the total number of monoamine molecules in the central nervous system. Their mechanism of action facilitates redistribution of monoamines from one place to another. In the process, conditions are induced that facilitate depletion of monoamines. The "reuptake inhibitor monoamine depletion theory" of this paper

  8. Serotonin and Norepinephrine Reuptake Inhibitors (SNRIs)

    Science.gov (United States)

    Serotonin and norepinephrine reuptake inhibitors (SNRIs) Antidepressant SNRIs help relieve depression symptoms, such as irritability and sadness, ... effects they may cause. By Mayo Clinic Staff Serotonin and norepinephrine reuptake inhibitors (SNRIs) are a class ...

  9. Contemporary protease inhibitors and cardiovascular risk

    DEFF Research Database (Denmark)

    Lundgren, Jens; Mocroft, Amanda; Ryom, Lene

    2018-01-01

    PURPOSE OF REVIEW: To review the evidence linking use of HIV protease inhibitors with excess risk of cardiovascular disease (CVD) in HIV+ populations. RECENT FINDINGS: For the two contemporary most frequently used protease inhibitors, darunavir and atazanavir [both pharmacologically boosted...

  10. Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

    Science.gov (United States)

    Spackman, Erica; Suarez, David L

    2005-01-01

    Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

  11. Profile of Mutations in the Reverse Transcriptase and Overlapping Surface Genes of Hepatitis B Virus (HBV) in Treatment-Naïve Indonesian HBV Carriers.

    Science.gov (United States)

    Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake

    2017-11-22

    Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.

  12. Incorporation of deoxyribonucleotides and ribonucleotides by a dNTP-binding cleft mutated reverse transcriptase in hepatitis B virus core particles

    International Nuclear Information System (INIS)

    Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin

    2008-01-01

    Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems

  13. Guanidinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymer as siRNA carriers for inhibiting human telomerase reverse transcriptase expression.

    Science.gov (United States)

    Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong

    2013-01-01

    In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.

  14. The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA

    Directory of Open Access Journals (Sweden)

    Niu Meijuan

    2004-10-01

    Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.

  15. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta

    2005-08-01

    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  16. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang

    2010-06-01

    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  17. Generation of thermostable Moloney murine leukemia virus reverse transcriptase variants using site saturation mutagenesis library and cell-free protein expression system.

    Science.gov (United States)

    Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi

    2017-12-01

    We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.

  18. Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda

    Directory of Open Access Journals (Sweden)

    Mengjuan Zhu

    2016-03-01

    Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.

  19. Apoptosis and reduced cell proliferation of HL-60 cell line caused by human telomerase reverse transcriptase inhibition by siRNA.

    Science.gov (United States)

    Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin

    2010-01-01

    The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.

  20. A novel peptide-nucleotide dual vaccine of human telomerase reverse transcriptase induces a potent cytotoxic T-cell response in vivo

    International Nuclear Information System (INIS)

    Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun

    2007-01-01

    Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers

  1. Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

    International Nuclear Information System (INIS)

    Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.

    2006-01-01

    Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

  2. Inhibition of HIV-1 reverse transcriptase-catalyzed synthesis by intercalated DNA Benzo[a]Pyrene 7,8-Dihydrodiol-9,10-Epoxide adducts.

    Directory of Open Access Journals (Sweden)

    Parvathi Chary

    Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.

  3. Maintenance of differentiation potential of human bone marrow mesenchymal stem cells immortalized by human telomerase reverse transcriptase gene despite of extensive proliferation

    International Nuclear Information System (INIS)

    Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha

    2005-01-01

    Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols

  4. Tetrahymena telomerase protein p65 induces conformational changes throughout telomerase RNA (TER) and rescues telomerase reverse transcriptase and TER assembly mutants.

    Science.gov (United States)

    Berman, Andrea J; Gooding, Anne R; Cech, Thomas R

    2010-10-01

    The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.

  5. Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

    Science.gov (United States)

    Amendola, R

    1994-11-01

    The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

  6. Effect of captan on the exonuclease activities of DNA polymerase I from E. coli and reverse transcriptase from avian myeloblastosis virus

    International Nuclear Information System (INIS)

    Freeman-Wittig, M.J.B.

    1986-01-01

    The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan

  7. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

    Science.gov (United States)

    Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang

    2010-01-01

    A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408

  8. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

    Directory of Open Access Journals (Sweden)

    Yanrui Li

    2010-01-01

    Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.

  9. Unique case of oligoastrocytoma with recurrence and grade progression: Exhibiting differential expression of high mobility group-A1 and human telomerase reverse transcriptase

    Science.gov (United States)

    Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni

    2016-01-01

    Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647

  10. Reduction rules for reset/inhibitor nets

    NARCIS (Netherlands)

    Verbeek, H.M.W.; Wynn, M.T.; Aalst, van der W.M.P.; Hofstede, ter A.H.M.

    2010-01-01

    Reset/inhibitor nets are Petri nets extended with reset arcs and inhibitor arcs. These extensions can be used to model cancellation and blocking. A reset arc allows a transition to remove all tokens from a certain place when the transition fires. An inhibitor arc can stop a transition from being

  11. Allosteric small-molecule kinase inhibitors

    DEFF Research Database (Denmark)

    Wu, Peng; Clausen, Mads Hartvig; Nielsen, Thomas E.

    2015-01-01

    current barriers of kinase inhibitors, including poor selectivity and emergence of drug resistance. In spite of the small number of identified allosteric inhibitors in comparison with that of inhibitors targeting the ATP pocket, encouraging results, such as the FDA-approval of the first small...

  12. Resistance Analyses of Integrase Strand Transfer Inhibitors within Phase 3 Clinical Trials of Treatment-Naive Patients

    Directory of Open Access Journals (Sweden)

    Kirsten L. White

    2014-07-01

    Full Text Available The integrase (IN strand transfer inhibitors (INSTIs, raltegravir (RAL, elvitegravir (EVG and dolutegravir (DTG, comprise the newest drug class approved for the treatment of HIV-1 infection, which joins the existing classes of reverse transcriptase, protease and binding/entry inhibitors. The efficacy of first-line regimens has attained remarkably high levels, reaching undetectable viral loads in 90% of patients by Week 48; however, there remain patients who require a change in regimen due to adverse events, virologic failure with emergent resistance or other issues of patient management. Large, randomized clinical trials conducted in antiretroviral treatment-naive individuals are required for drug approval in this population in the US, EU and other countries, with the primary endpoint for virologic success at Week 48. However, there are differences in the definition of virologic failure and the evaluation of drug resistance among the trials. This review focuses on the methodology and tabulation of resistance to INSTIs in phase 3 clinical trials of first-line regimens and discusses case studies of resistance.

  13. In Silico Screening Hepatitis B Virus DNA Polymerase Inhibitors from Medicinal Plants

    Directory of Open Access Journals (Sweden)

    Mokhtar Nosrati

    2017-08-01

    Full Text Available Abstract Background: Hepatitis B virus infection (HBV is a significant global health problem and is a major cause of morbidity and mortality worldwide. Therefore, currently, introducing novel anti Hepatitis B drugs is taken into consideration. This study was planned to in silico screening novel Hepatitis B virus DNA polymerase inhibitors from two medicinal plants Terminalis chebula and Caesalpinia sappan. Materials and Methods: This is a descriptive-analytic study. In the study, three-dimensional structure of the Hepatitis B virus DNA polymerase was predicted using homology modeling method. A set of phytochemicals from mentioned plants were retrieved from Pubchem database in SDF format. In silico screening was carried out using molecular docking between mentioned phytochemicals and modeled polymerase by iGemdock 2.1 software. Results: Results of the study confirmed that all evaluated ligands have appropriate interactions to the polymerase with least toxicity and without genotoxicity potential. Results also showed that most interactions occur in reverse transcriptase domain which located in 354-694 area in the amino acid sequence of tested polymerase. Analysis of energy and amino acids involved in ligand-polymerase interaction revealed that Terchebin, Chebulinic Acid and Terflavin A have more effective interaction with the polymerase in compared to other ligands. Conclusion: Based on the results it can be concluded that evaluated compounds could be good candidates for in vitro and in vivo research in order to develop novel anti- Hepatitis B drugs.

  14. An integrated chemical biology approach reveals the mechanism of action of HIV replication inhibitors.

    Science.gov (United States)

    Pagano, Nicholas; Teriete, Peter; Mattmann, Margrith E; Yang, Li; Snyder, Beth A; Cai, Zhaohui; Heil, Marintha L; Cosford, Nicholas D P

    2017-12-01

    Continuous flow (microfluidic) chemistry was employed to prepare a small focused library of dihydropyrimidinone (DHPM) derivatives. Compounds in this class have been reported to exhibit activity against the human immunodeficiency virus (HIV), but their molecular target had not been identified. We tested the initial set of DHPMs in phenotypic assays providing a hit (1i) that inhibited the replication of the human immunodeficiency virus HIV in cells. Flow chemistry-driven optimization of 1i led to the identification of HIV replication inhibitors such as 1l with cellular potency comparable with the clinical drug nevirapine (NVP). Mechanism of action (MOA) studies using cellular and biochemical assays coupled with 3D fingerprinting and in silico modeling demonstrated that these drug-like probe compounds exert their effects by inhibiting the viral reverse transcriptase polymerase (RT). This led to the design and synthesis of the novel DHPM 1at that inhibits the replication of drug resistant strains of HIV. Our work demonstrates that combining flow chemistry-driven analogue refinement with phenotypic assays, in silico modeling and MOA studies is a highly effective strategy for hit-to-lead optimization applicable to the discovery of future therapeutic agents. Copyright © 2017. Published by Elsevier Ltd.

  15. Identification of a methylated oligoribonucleotide as a potent inhibitor of HIV-1 reverse transcription complex.

    Science.gov (United States)

    Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc

    2011-07-01

    Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.

  16. Extensive Mutagenesis of the Conserved Box E Motif in Duck Hepatitis B Virus P Protein Reveals Multiple Functions in Replication and a Common Structure with the Primer Grip in HIV-1 Reverse Transcriptase

    OpenAIRE

    Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael

    2012-01-01

    Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...

  17. Emergent HIV-1 Drug Resistance Mutations Were Not Present at Low-Frequency at Baseline in Non-Nucleoside Reverse Transcriptase Inhibitor-Treated Subjects in the STaR Study.

    Science.gov (United States)

    Porter, Danielle P; Daeumer, Martin; Thielen, Alexander; Chang, Silvia; Martin, Ross; Cohen, Cal; Miller, Michael D; White, Kirsten L

    2015-12-07

    At Week 96 of the Single-Tablet Regimen (STaR) study, more treatment-naïve subjects that received rilpivirine/emtricitabine/tenofovir DF (RPV/FTC/TDF) developed resistance mutations compared to those treated with efavirenz (EFV)/FTC/TDF by population sequencing. Furthermore, more RPV/FTC/TDF-treated subjects with baseline HIV-1 RNA >100,000 copies/mL developed resistance compared to subjects with baseline HIV-1 RNA ≤100,000 copies/mL. Here, deep sequencing was utilized to assess the presence of pre-existing low-frequency variants in subjects with and without resistance development in the STaR study. Deep sequencing (Illumina MiSeq) was performed on baseline and virologic failure samples for all subjects analyzed for resistance by population sequencing during the clinical study (n = 33), as well as baseline samples from control subjects with virologic response (n = 118). Primary NRTI or NNRTI drug resistance mutations present at low frequency (≥2% to 20%) were detected in 6.6% of baseline samples by deep sequencing, all of which occurred in control subjects. Deep sequencing results were generally consistent with population sequencing but detected additional primary NNRTI and NRTI resistance mutations at virologic failure in seven samples. HIV-1 drug resistance mutations emerging while on RPV/FTC/TDF or EFV/FTC/TDF treatment were not present at low frequency at baseline in the STaR study.

  18. Emergent HIV-1 Drug Resistance Mutations Were Not Present at Low-Frequency at Baseline in Non-Nucleoside Reverse Transcriptase Inhibitor-Treated Subjects in the STaR Study

    Directory of Open Access Journals (Sweden)

    Danielle P. Porter

    2015-12-01

    Full Text Available At Week 96 of the Single-Tablet Regimen (STaR study, more treatment-naïve subjects that received rilpivirine/emtricitabine/tenofovir DF (RPV/FTC/TDF developed resistance mutations compared to those treated with efavirenz (EFV/FTC/TDF by population sequencing. Furthermore, more RPV/FTC/TDF-treated subjects with baseline HIV-1 RNA >100,000 copies/mL developed resistance compared to subjects with baseline HIV-1 RNA ≤100,000 copies/mL. Here, deep sequencing was utilized to assess the presence of pre-existing low-frequency variants in subjects with and without resistance development in the STaR study. Deep sequencing (Illumina MiSeq was performed on baseline and virologic failure samples for all subjects analyzed for resistance by population sequencing during the clinical study (n = 33, as well as baseline samples from control subjects with virologic response (n = 118. Primary NRTI or NNRTI drug resistance mutations present at low frequency (≥2% to 20% were detected in 6.6% of baseline samples by deep sequencing, all of which occurred in control subjects. Deep sequencing results were generally consistent with population sequencing but detected additional primary NNRTI and NRTI resistance mutations at virologic failure in seven samples. HIV-1 drug resistance mutations emerging while on RPV/FTC/TDF or EFV/FTC/TDF treatment were not present at low frequency at baseline in the STaR study.

  19. Stabilization versus inhibition of TAFIa by competitive inhibitors in vitro

    NARCIS (Netherlands)

    Walker, J.B.; Hughes, B.; James, I.; Haddock, P.; Kluft, C.; Bajzar, L.

    2003-01-01

    Two competitive inhibitors of TAFIa (activated thrombin-activable fibrinolysis inhibitor), 2-guanidinoethyl-mercaptosuccinic acid and potato tuber carboxypeptidase inhibitor, variably affect fibrinolysis of clotted human plasma. Depending on their concentration, the inhibitors shortened, prolonged,

  20. High-throughput screening using pseudotyped lentiviral particles: a strategy for the identification of HIV-1 inhibitors in a cell-based assay.

    Science.gov (United States)

    Garcia, Jean-Michel; Gao, Anhui; He, Pei-Lan; Choi, Joyce; Tang, Wei; Bruzzone, Roberto; Schwartz, Olivier; Naya, Hugo; Nan, Fa-Jun; Li, Jia; Altmeyer, Ralf; Zuo, Jian-Ping

    2009-03-01

    Two decades after its discovery the human immunodeficiency virus (HIV) is still spreading worldwide and killing millions. There are 25 drugs formally approved for HIV currently on the market, but side effects as well as the emergence of HIV strains showing single or multiple resistances to current drug-therapy are causes for concern. Furthermore, these drugs target only 4 steps of the viral cycle, hence the urgent need for new drugs and also new targets. In order to tackle this problem, we have devised a cell-based assay using lentiviral particles to look for post-entry inhibitors of HIV-1. We report here the assay development, validation as well as confirmation of the hits using both wild-type and drug-resistant HIV-1 viruses. The screening was performed on an original library, rich in natural compounds and pure molecules from Traditional Chinese Medicine pharmacopoeia, which had never been screened for anti-HIV activity. The identified hits belong to four chemical sub-families that appear to be all non-nucleoside reverse transcriptase inhibitors (NNRTIs). Secondary tests with live viruses showed that there was good agreement with pseudotyped particles, confirming the validity of this approach for high-throughput drug screens. This assay will be a useful tool that can be easily adapted to screen for inhibitors of viral entry.

  1. Design and performance of the CDC real-time reverse transcriptase PCR swine flu panel for detection of 2009 A (H1N1) pandemic influenza virus.

    Science.gov (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

    2011-07-01

    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.

  2. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

    Science.gov (United States)

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

    2018-03-01

    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  3. The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro

    Directory of Open Access Journals (Sweden)

    Gronenborn Angela M

    2010-05-01

    Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.

  4. Frequency of intron loss correlates with processed pseudogene abundance: a novel strategy to test the reverse transcriptase model of intron loss.

    Science.gov (United States)

    Zhu, Tao; Niu, Deng-Ke

    2013-03-05

    Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.

  5. Expression of dopamine receptors in the subthalamic nucleus of the rat: characterization using reverse transcriptase-polymerase chain reaction and autoradiography

    International Nuclear Information System (INIS)

    Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.

    1999-01-01

    We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  6. Prognostic role of a multigene reverse transcriptase-PCR assay in patients with node-negative breast cancer not receiving adjuvant systemic therapy.

    Science.gov (United States)

    Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N

    2005-05-01

    To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.

  7. Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

    Science.gov (United States)

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

    2004-01-01

    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

  8. The Optimization of Molecular Detection of Clinical Isolates of Brucella in Blood Cultures by eryD Transcriptase Gene for Confirmation of Culture-Negative Samples.

    Science.gov (United States)

    Tabibnejad, Mahsa; Alikhani, Mohammad Yousef; Arjomandzadegan, Mohammad; Hashemi, Seyed Hamid; Naseri, Zahra

    2016-04-01

    Brucellosis is a zoonosis disease which is widespread across the world. The aim of the present study is the evaluation of culture-negative blood samples. A total of 100 patients with suspected brucellosis were included in this experimental study and given positive serological tests. Diagnosis was performed on patients with clinical symptoms of the disease, followed by the detection of a titer that was equal to or more than 1:160 (in endemic areas) by the standard tube agglutination method. Blood samples were cultured by a BACTEC 9050 system, and subsequently by Brucella agar. At the same time, DNA from all blood samples was extracted by Qiagen Kit Company (Qia Amp Mini Kit). A molecular assay of blood samples was carried out by detection of eryD transcriptase and bcsp 31 genes in specific double PCR reactions. The specificity of the primers was evaluated by DNA from pure and approved Brucella colonies found in the blood samples, by DNA from other bacteria, and by ordinary PCR. DNA extraction from the pure colonies was carried out by both Qiagen Kit and Chelex 100 methods; the two were compared. 39 cases (39%) had positive results when tested by the BACTEC system, and 61 cases (61%) became negative. 23 culture-positive blood samples were randomly selected for PCR reactions; all showed 491 bp for the eryD gene and 223 bp for the bcsp 31 gene. Interestingly, out of 14 culture-negative blood samples, 13 cases showed positive bonds in PCR. The specificity of the PCR method was equal to 100%. DNA extraction from pure cultures was done by both Chelex 100 and Qiagen Kit; these showed the same results for all samples. The results prove that the presented double PCR method could be used to detect positive cases from culture-negative blood samples. The Chelex 100 method is simpler and safer than the use of Qiagen Kit for DNA extraction.

  9. Pre-existing mutations in reverse transcriptase of hepatitis B virus in treatment-naive Chinese patients with chronic hepatitis B.

    Directory of Open Access Journals (Sweden)

    Jie Xu

    Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.

  10. Molecular cloning of Kuruma shrimp Marsupenaeus japonicus endonuclease-reverse transcriptase and its positive role in white spot syndrome virus and Vibrio alginolyticus infection.

    Science.gov (United States)

    Ma, Xiongchao; Sun, Baozhen; Zhu, Fei

    2018-02-01

    This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR.

    Science.gov (United States)

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2014-06-01

    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  12. Effects of exogenous ATM gene on mRNA expression of human telomerase reverse transcriptase in AT cells induced by irradiation

    International Nuclear Information System (INIS)

    Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong

    2005-01-01

    The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)

  13. Histone deacetylase inhibitors (HDACIs): multitargeted anticancer agents.

    Science.gov (United States)

    Ververis, Katherine; Hiong, Alison; Karagiannis, Tom C; Licciardi, Paul V

    2013-01-01

    Histone deacetylase (HDAC) inhibitors are an emerging class of therapeutics with potential as anticancer drugs. The rationale for developing HDAC inhibitors (and other chromatin-modifying agents) as anticancer therapies arose from the understanding that in addition to genetic mutations, epigenetic changes such as dysregulation of HDAC enzymes can alter phenotype and gene expression, disturb homeostasis, and contribute to neoplastic growth. The family of HDAC inhibitors is large and diverse. It includes a range of naturally occurring and synthetic compounds that differ in terms of structure, function, and specificity. HDAC inhibitors have multiple cell type-specific effects in vitro and in vivo, such as growth arrest, cell differentiation, and apoptosis in malignant cells. HDAC inhibitors have the potential to be used as monotherapies or in combination with other anticancer therapies. Currently, there are two HDAC inhibitors that have received approval from the US FDA for the treatment of cutaneous T-cell lymphoma: vorinostat (suberoylanilide hydroxamic acid, Zolinza) and depsipeptide (romidepsin, Istodax). More recently, depsipeptide has also gained FDA approval for the treatment of peripheral T-cell lymphoma. Many more clinical trials assessing the effects of various HDAC inhibitors on hematological and solid malignancies are currently being conducted. Despite the proven anticancer effects of particular HDAC inhibitors against certain cancers, many aspects of HDAC enzymes and HDAC inhibitors are still not fully understood. Increasing our understanding of the effects of HDAC inhibitors, their targets and mechanisms of action will be critical for the advancement of these drugs, especially to facilitate the rational design of HDAC inhibitors that are effective as antineoplastic agents. This review will discuss the use of HDAC inhibitors as multitargeted therapies for malignancy. Further, we outline the pharmacology and mechanisms of action of HDAC inhibitors while

  14. Calcineurin-inhibitor pain syndrome.

    Science.gov (United States)

    Prommer, Eric

    2012-07-01

    There has been increased recognition of calcineurin, a phosphoprotein serine/threonine phosphatase enzyme, in the regulation of many physiologic systems. Calcineurin mediates activation of lymphocytes, which play a role in immune response. Widely distributed in the central nervous system, calcinuerin also plays an important role in sensory neural function, via its role in the regulation of newly discovered 2-pore potassium channels, which greatly influence neuronal resting membrane potentials. Calcinuerin inhibition is the mechanism of action of immunomodulatory drugs such as cyclosporine and tacrolimus, which are widely used in transplantation medicine to prevent rejection. While important for immunosuppression, the use of calcineurin inhibitors has been associated with the development of a new pain syndrome called the calcineurin pain syndrome, which appears to be an untoward complication of the interruption of the physiologic function of calcineurin. This is a narrative review focusing on the epidemiology, pathophysiology, characterization of a newly recognized pain syndrome associated with the use of calcineurin inhibitors. The use of immunosuppressants however is associated with several well-known toxicities to which the calcineurin pain syndrome can be added. The development of this syndrome most likely involves altered nociceptive processing due to the effect of calcineurin inhibition on neuronal firing, as well as effects of calcineurin on vascular tone. The most striking aspect of the treatment of this syndrome is the response to calcium channel blockers, which suggest that the effects of calcineurin inhibition on vascular tone play an important role in the development of the calcineurin pain syndrome. The calcineurin syndrome is a newly recognized complication associated with the use of calcineurin inhibitors. There is no standard therapy at this time but anecdotal reports suggest the effectiveness of calcium channel blockers.

  15. Crystallization inhibitors for amorphous oxides

    International Nuclear Information System (INIS)

    Reznitskij, L.A.; Filippova, S.E.

    1993-01-01

    Data for the last 10 years, in which experimental results of studying the temperature stabilization of x-ray amorphous oxides (including R 3 Fe 5 O 12 R-rare earths, ZrO 2 , In 2 O 3 , Sc 2 O 3 ) and their solid solution are presented, are generalized. Processes of amorphous oxide crystallization with the production of simple oxides, solid solutions and chemical compounds with different polyhedral structure, are investigated. Energy and crystallochemical criteria for selecting the doping inhibitor-components stabilizing the amorphous state are ascertained, temperatures and enthalpies of amorpous oxide crystallization are determined, examination of certain provisions of iso,orphous miscibility theory is conducted

  16. Inhibitors of plant hormone transport

    Czech Academy of Sciences Publication Activity Database

    Klíma, Petr; Laňková, Martina; Zažímalová, Eva

    2016-01-01

    Roč. 253, č. 6 (2016), s. 1391-1404 ISSN 0033-183X R&D Projects: GA MŠk(CZ) LD15088 Institutional support: RVO:61389030 Keywords : polar auxin transport * acid-binding protein * gnom arf-gef * equilibrative nucleoside transporter * efflux carrier polarity * plasma-membrane-protein * cultured tobacco cells * arabidopsis-thaliana * gravitropic response * brefeldin-a * Plant hormones * Transport * Inhibitors * Auxin * Cytokinins * Strigolactones * Abscisic acid * Cell biology Subject RIV: ED - Physiology Impact factor: 2.870, year: 2016

  17. Effects of treatment with suppressive combination antiretroviral drug therapy and the histone deacetylase inhibitor suberoylanilide hydroxamic acid; (SAHA on SIV-infected Chinese rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Binhua Ling

    Full Text Available Viral reservoirs-persistent residual virus despite combination antiretroviral therapy (cART-remain an obstacle to cure of HIV-1 infection. Difficulty studying reservoirs in patients underscores the need for animal models that mimics HIV infected humans on cART. We studied SIV-infected Chinese-origin rhesus macaques (Ch-RM treated with intensive combination antiretroviral therapy (cART and 3 weeks of treatment with the histone deacetyalse inhibitor, suberoylanilide hydroxamic acid (SAHA.SIVmac251 infected Ch-RM received reverse transcriptase inhibitors PMPA and FTC and integrase inhibitor L-870812 beginning 7 weeks post infection. Integrase inhibitor L-900564 and boosted protease inhibitor treatment with Darunavir and Ritonavir were added later. cART was continued for 45 weeks, with daily SAHA administered for the last 3 weeks, followed by euthanasia/necropsy. Plasma viral RNA and cell/tissue-associated SIV gag RNA and DNA were quantified by qRT-PCR/qPCR, with flow cytometry monitoring changes in immune cell populations.Upon cART initiation, plasma viremia declined, remaining <30 SIV RNA copy Eq/ml during cART, with occasional blips. Decreased viral replication was associated with decreased immune activation and partial restoration of intestinal CD4+ T cells. SAHA was well tolerated but did not result in demonstrable treatment-associated changes in plasma or cell associated viral parameters.The ability to achieve and sustain virological suppression makes cART-suppressed, SIV-infected Ch-RM a potentially useful model to evaluate interventions targeting residual virus. However, despite intensive cART over one year, persistent viral DNA and RNA remained in tissues of all three animals. While well tolerated, three weeks of SAHA treatment did not demonstrably impact viral RNA levels in plasma or tissues; perhaps reflecting dosing, sampling and assay limitations.

  18. Laura: Soybean variety lacking Kunitz trypsin inhibitor

    Directory of Open Access Journals (Sweden)

    Srebrić Mirjana

    2010-01-01

    Full Text Available Grain of conventional soybean varieties requires heat processing to break down trypsin inhibitor's activity before using as food or animal feed. At the same time, protein denaturation and other qualitative changes occur in soybean grain, especially if the temperature of heating is not controlled. Two types of trypsin inhibitor were found in soybean grain the Kunitz trypsin inhibitor and the Bowman-Birk inhibitor. Mature grain of soybean Laura is lacking Kunitz trypsin inhibitor. Grain yield of variety Laura is equal to high yielding varieties from the maturity group I, where it belongs. Lacking of Kunitz-trypsin inhibitor makes soybean grain suitable for direct feeding in adult non ruminant animals without previous thermal processing. Grain of variety Laura can be processed for a shorter period of time than conventional soybeans. This way we save energy, and preserve valuable nutritional composition of soybean grain, which is of interest in industrial processing.

  19. Vanadium Compounds as PTP Inhibitors

    Directory of Open Access Journals (Sweden)

    Elsa Irving

    2017-12-01

    Full Text Available Phosphotyrosine signaling is regulated by the opposing actions of protein tyrosine kinases (PTKs and protein tyrosine phosphatases (PTPs. Here we discuss the potential of vanadium derivatives as PTP enzyme inhibitors and metallotherapeutics. We describe how vanadate in the V oxidized state is thought to inhibit PTPs, thus acting as a pan-inhibitor of this enzyme superfamily. We discuss recent developments in the biological and biochemical actions of more complex vanadium derivatives, including decavanadate and in particular the growing number of oxidovanadium compounds with organic ligands. Pre-clinical studies involving these compounds are discussed in the anti-diabetic and anti-cancer contexts. Although in many cases PTP inhibition has been implicated, it is also clear that many such compounds have further biochemical effects in cells. There also remain concerns surrounding off-target toxicities and long-term use of vanadium compounds in vivo in humans, hindering their progress through clinical trials. Despite these current misgivings, interest in these chemicals continues and many believe they could still have therapeutic potential. If so, we argue that this field would benefit from greater focus on improving the delivery and tissue targeting of vanadium compounds in order to minimize off-target toxicities. This may then harness their full therapeutic potential.

  20. Proton pump inhibitors and osteoporosis

    DEFF Research Database (Denmark)

    Andersen, Bjarne Nesgaard; Johansen, Per Birger; Abrahamsen, Bo

    2016-01-01

    PURPOSE OF REVIEW: The purpose of the review is to provide an update on recent advances in the evidence based on proton pump inhibitors (PPI) as a possible cause of osteoporosis and osteoporotic fractures. This review focuses, in particular, on new studies published in the last 18 months and a di......PURPOSE OF REVIEW: The purpose of the review is to provide an update on recent advances in the evidence based on proton pump inhibitors (PPI) as a possible cause of osteoporosis and osteoporotic fractures. This review focuses, in particular, on new studies published in the last 18 months...... and a discussion of these findings and how this has influenced our understanding of this association, the clinical impact and the underlying pathophysiology. RECENT FINDINGS: New studies have further strengthened existing evidence linking use of PPIs to osteoporosis. Short-term use does not appear to pose a lower...... risk than long-term use. There is a continued lack of conclusive studies identifying the pathogenesis. Direct effects on calcium absorption or on osteoblast or osteoclast action cannot at present plausibly explain the mechanism. SUMMARY: The use of PPIs is a risk factor for development of osteoporosis...

  1. Selective suppression of autocatalytic caspase-3 driven by two-step transcriptional amplified human telomerase reverse transcriptase promoter on ovarian carcinoma growth in vitro and in mice.

    Science.gov (United States)

    Song, Yue; Xin, Xing; Xia, Zhijun; Zhai, Xingyue; Shen, Keng

    2014-07-01

    The objective of our study was to construct recombinant adenovirus (rAd) AdHTVP2G5-rev-casp3, which expresses autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp) with a two-step transcription amplification (TSTA) system and investigate its antitumor effects on ovarian cancer in vitro and in vivo. Fluorescent detection was used to detect EGFP expression in various cells. Cell viabilities were determined using the Cell Counting Kit-8 and flow cytometry. RT-PCR and immunoblotting assays were used to detect cellular apoptotic activities. Tumor growth and survival of tumor-bearing mice were studied. The hTERTp-TSTA system showed the strongest activity in hTERT-positive cancer cells when compared with hTERTp and cytomeglovirus promoter (CMVp). In contrast, it showed no activity in hTERT‑negative HUVECs. AdHTVP2G5‑rev-casp3 markedly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 17.8 ± 3.5% at an MOI of 70, which was significantly lower than that by AdHT-rev-casp3 and Ad-rev-casp3 (rAds which express rev-caspase-3 driven by hTERTp and CMVp, respectively). In contrast, AdHTVP2G5‑rev-casp3 induced little HUVEC death with a viability rate of 92.7 ± 5.2% at the same MOI. Additionally, AdHTVP2G5-rev-casp3 (MOI=70) caused significant apoptosis in AO cells with an apoptotic rate of 42%. The tumor growth suppression rate of AdHTVP2G5-rev-casp3 was 81.52%, significantly higher than that of AdHT-rev-casp3 (54.94%) or Ad-rev-casp3 (21.35%). AdHTVP2G5-rev-casp3 significantly improved the survival of tumor-bearing mice with little liver damage, with a mean survival of 258 ± 28 days. These results showed that AdHTVP2G5-rev-casp3 caused effective apoptosis with significant tumor selectivity, strongly suppressed tumor growth and improved mouse survival with little liver toxicity. It can be a potent therapeutic agent for tumor targeted treatment of ovarian cancer.

  2. Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

    Science.gov (United States)

    Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

    2003-01-01

    Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

  3. Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

    Science.gov (United States)

    Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

    2013-12-23

    At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

  4. A new fluorescence/PET probe for targeting intracellular human telomerase reverse transcriptase (hTERT) using Tat peptide-conjugated IgM

    International Nuclear Information System (INIS)

    Jung, Kyung oh; Youn, Hyewon; Kim, Seung Hoo; Kim, Young-Hwa; Kang, Keon Wook; Chung, June-Key

    2016-01-01

    Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and "6"4Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.

  5. MicroRNA-532 and microRNA-3064 inhibit cell proliferation and invasion by acting as direct regulators of human telomerase reverse transcriptase in ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Lin Bai

    Full Text Available Human telomerase reverse transcriptase (hTERT plays a crucial role in ovarian cancer (OC progression. However, the mechanisms underlying hTERT upregulation in OC, and the specific microRNAs (miRNAs involved in the regulation of hTERT in OC cells, remains unclear. We performed a bioinformatics search to identify potential miRNAs that bind to the 3'-untranslated region (3'-UTR region of the hTERT mRNA. We examined the expression levels of miR-532/miR-3064 in OC tissues and normal ovarian tissues, and analyzed the correlation between miRNA expression and OC patient outcomes. The impacts of miR-532/miR-3064 on hTERT expression were evaluated by western blot analysis and hTERT 3'-UTR reporter assays. We investigated the effects of miR-532/miR-3064 on proliferation and invasion in OC cells. We found that miR-532 and miR-3064 are down-regulated in OC specimens. We observed a significant association between reduced miR-532/miR-3064 expression and poorer survival of patients with OC. We confirmed that in OC cells, these two miRNAs downregulate hTERT levels by directly targeting its 3'-UTR region, and inhibited proliferation, EMT and invasion of OC cells. In addition, the overexpression of the hTERT cDNA lacking the 3'-UTR partially restored miR-532/miR-3064-inhibited OC cell proliferation and invasion. The silencing of hTERT by siRNA oligonucleotides abolished these malignant features, and phenocopied the effects of miR-532/miR-3064 overexpression. Furthermore, overexpression of miR-532/miR-3064 inhibits the growth of OC cells in vivo. Our findings demonstrate a miR-532/miR-3064-mediated mechanism responsible for hTERT upregulation in OC cells, and reveal a possibility of targeting miR-532/miR-3064 for future treatment of OC.

  6. Hypoxia induces telomerase reverse transcriptase (TERT gene expression in non-tumor fish tissues in vivo: the marine medaka (Oryzias melastigma model

    Directory of Open Access Journals (Sweden)

    Mok Helen OL

    2006-09-01

    Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This

  7. Development of a pan-Simbu real-time reverse transcriptase PCR for the detection of Simbu serogroup viruses and comparison with SBV diagnostic PCR systems.

    Science.gov (United States)

    Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd

    2013-11-05

    Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable

  8. Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

    Science.gov (United States)

    Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

    2014-09-01

    Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We

  9. A new fluorescence/PET probe for targeting intracellular human telomerase reverse transcriptase (hTERT) using Tat peptide-conjugated IgM

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Kyung oh [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Youn, Hyewon, E-mail: hwyoun@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Cancer Imaging Center, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, Seung Hoo [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kim, Young-Hwa [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kang, Keon Wook [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Chung, June-Key, E-mail: jkchung@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of)

    2016-08-26

    Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and {sup 64}Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.

  10. TYROSINE KINASE INHIBITORS AND PREGNANCY

    Directory of Open Access Journals (Sweden)

    Elisabetta Abruzzese

    2014-04-01

    Full Text Available The management of patients with chronic myeloid leukemia (CML during pregnancy has became recently a matter of continuous debate.  The introduction of the Tyrosine Kinase Inhibitors (TKIs in clinical practice has dramatically changed the prognosis of CML patients.  Patients diagnosed in chronic phase can reasonably expect many years of excellent disease control and good quality of life, as well as a normal life expectancy.  This fact has come the necessity to address issues relating to fertility and pregnancy. Physicians are not infrequently being asked for advice regarding the need for, and or the appropriateness of, stopping treatment in order to conceive. In this report we will review the data published in terms of fertility, conception, pregnancy, pregnancy outcome and illness control for all the approved TKIs, as well as suggest how to manage a planned and/or unplanned pregnancy.

  11. PARP Inhibitors in Ovarian Cancer.

    Science.gov (United States)

    Mittica, Gloria; Ghisoni, Eleonora; Giannone, Gaia; Genta, Sofia; Aglietta, Massimo; Sapino, Anna; Valabrega, Giorgio

    2018-03-05

    Treatment of Epithelial Ovarian Cancer (EOC), historically based on surgery and platinum doublet chemotherapy, is associated with high risk of relapse and poor prognosis for recurrent disease. In this landscape, the innovative treatment with PARP inhibitors (PARPis) demonstrated an outstanding activity in EOC, and is currently changing clinical practice in BRCA mutant patients. To highlight the mechanism of action, pharmacokinetics, clinical activity, indications and current strategies of development of Olaparib, Niraparib, Rucaparib, Talazoparib and Veliparib, the 5 most relevant PARPis. We performed a review on Pubmed using 'ovarian cancer' and the name of each PARPi (PARP inhibitor) discussed in the review as Medical Subject Headings (MeSH) keywords. The same search was performed on "clinicaltrial.gov" to identify ongoing clinical trials and on "google.com/patents" and "uspto.gov" for recent patents exploring PARPIs in ovarian cancer. Olaparib, Niraparib and Rucaparib are already approved for treatment of recurrent EOC and their indications are partially overlapping. Talazoparib and Veliparib are promising PARPis, but currently under investigation in early phase trials. Several studies are evaluating PARPis in monotherapy or in associations, in a wide range of settings (i.e. first line, neoadjuvant, platinum-sensitive and resistant disease). PARPis are valuable options in patients with recurrent ovarian cancer with promising activity in different stages of this disease. Further studies are required to better define optimal clinical settings, predictors of response beyond BRCA mutations and strategies to overcome secondary resistance of PARPis therapy in EOC. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  12. Effects of the single and combined treatment with dopamine agonist, somatostatin analog and mTOR inhibitors in a human lung carcinoid cell line: an in vitro study.

    Science.gov (United States)

    Pivonello, Claudia; Rousaki, Panagoula; Negri, Mariarosaria; Sarnataro, Maddalena; Napolitano, Maria; Marino, Federica Zito; Patalano, Roberta; De Martino, Maria Cristina; Sciammarella, Concetta; Faggiano, Antongiulio; Rocco, Gaetano; Franco, Renato; Kaltsas, Gregory A; Colao, Annamaria; Pivonello, Rosario

    2017-06-01

    Somatostatin analogues and mTOR inhibitors have been used as medical therapy in lung carcinoids with variable results. No data are available on dopamine agonists as treatment for lung carcinoids. The main aim of the current study was to evaluate the effect of the combined treatment of somatostatin analogue octreotide and the dopamine agonist cabergoline with mTOR inhibitors in an in vitro model of typical lung carcinoids: the NCI-H727 cell line. In NCI-H727 cell line, reverse transcriptase-quantitative polymerase chain reaction and immunofluorescence were assessed to characterize the expression of the somatostatin receptor 2 and 5, dopamine receptor 2 and mTOR pathway components. Fifteen typical lung carcinoids tissue samples have been used for somatostatin receptor 2, dopamine receptor 2, and the main mTOR pathway component p70S6K expression and localization by immunohistochemistry. Cell viability, fluorescence-activated cell sorting analysis and western blot have been assessed to test the pharmacological effects of octreotide, cabergoline and mTOR inhibitors, and to evaluate the activation of specific cell signaling pathways in NCI-H727 cell line. NCI-H727 cell line expressed somatostatin receptor 2, somatostatin receptor 5 and dopamine receptor 2 and all mTOR pathway components at messenger and protein levels. Somatostatin receptor 2, dopamine receptor 2, and p70S6K (non phosphorylated and phosphorylated) proteins were expressed in most typical lung carcinoids tissue samples. Octreotide and cabergoline did not reduce cell viability as single agents but, when combined with mTOR inhibitors, they potentiate mTOR inhibitors effect after long-term exposure, reducing Akt and ERK phosphorylation, mTOR escape mechanisms, and increasing the expression DNA-damage-inducible transcript 4, an mTOR suppressor. In conclusion, the single use of octreotide and cabergoline is not sufficient to block cell viability but the combined approach of these agents with mTOR inhibitors

  13. Discovery and SAR of hydantoin TACE inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Wensheng; Guo, Zhuyan; Orth, Peter; Madison, Vincent; Chen, Lei; Dai, Chaoyang; Feltz, Robert J.; Girijavallabhan, Vinay M.; Kim, Seong Heon; Kozlowski, Joseph A.; Lavey, Brian J.; Li, Dansu; Lundell, Daniel; Niu, Xiaoda; Piwinski, John J.; Popovici-Muller, Janeta; Rizvi, Razia; Rosner, Kristin E.; Shankar, Bandarpalle B.; Shih, Neng-Yang; Siddiqui, M.A.; Sun, J.; Tong, L.; Umland, S.; Wong, M.K.; Yang, D.Y.; Zhou, G. (Merck)

    2010-09-03

    We disclose inhibitors of TNF-{alpha} converting enzyme (TACE) designed around a hydantoin zinc binding moiety. Crystal structures of inhibitors bound to TACE revealed monodentate coordination of the hydantoin to the zinc. SAR, X-ray, and modeling designs are described. To our knowledge, these are the first reported X-ray structures of TACE with a hydantoin zinc ligand.

  14. Does plasminogen activator inhibitor-1 drive lymphangiogenesis?

    DEFF Research Database (Denmark)

    Bruyère, Françoise; Melen-Lamalle, Laurence; Blacher, Silvia

    2010-01-01

    The purpose of this study is to explore the function of plasminogen activator inhibitor-1 (PAI-1) during pathological lymphangiogenesis. PAI-1, the main physiological inhibitor of plasminogen activators is involved in pathological angiogenesis at least by controlling extracellular proteolysis and...

  15. Electrochemical Behaviour of Environmentally Friendly Inhibitor of ...

    African Journals Online (AJOL)

    Electrochemical Behaviour of Environmentally Friendly Inhibitor of Aloe Secundiflora Extract in Corrosion Control of Carbon Steel in Soft Water Media. ... The investigation was performed at different inhibitor concentrations under static and dynamic conditions using a Rotating Disk Electrode (RDE). The impedance and ...

  16. Histone deacetylase inhibitors (HDACIs: multitargeted anticancer agents

    Directory of Open Access Journals (Sweden)

    Ververis K

    2013-02-01

    Full Text Available Katherine Ververis,1 Alison Hiong,1 Tom C Karagiannis,1,* Paul V Licciardi2,*1Epigenomic Medicine, Alfred Medical Research and Education Precinct, 2Allergy and Immune Disorders, Murdoch Childrens Research Institute, Melbourne, VIC, Australia*These authors contributed equally to this workAbstract: Histone deacetylase (HDAC inhibitors are an emerging class of therapeutics with potential as anticancer drugs. The rationale for developing HDAC inhibitors (and other chromatin-modifying agents as anticancer therapies arose from the understanding that in addition to genetic mutations, epigenetic changes such as dysregulation of HDAC enzymes can alter phenotype and gene expression, disturb homeostasis, and contribute to neoplastic growth. The family of HDAC inhibitors is large and diverse. It includes a range of naturally occurring and synthetic compounds that differ in terms of structure, function, and specificity. HDAC inhibitors have multiple cell type-specific effects in vitro and in vivo, such as growth arrest, cell differentiation, and apoptosis in malignant cells. HDAC inhibitors have the potential to be used as monotherapies or in combination with other anticancer therapies. Currently, there are two HDAC inhibitors that have received approval from the US FDA for the treatment of cutaneous T-cell lymphoma: vorinostat (suberoylanilide hydroxamic acid, Zolinza and depsipeptide (romidepsin, Istodax. More recently, depsipeptide has also gained FDA approval for the treatment of peripheral T-cell lymphoma. Many more clinical trials assessing the effects of various HDAC inhibitors on hematological and solid malignancies are currently being conducted. Despite the proven anticancer effects of particular HDAC inhibitors against certain cancers, many aspects of HDAC enzymes and HDAC inhibitors are still not fully understood. Increasing our understanding of the effects of HDAC inhibitors, their targets and mechanisms of action will be critical for the

  17. Potential physiological role of plant glycosidase inhibitors

    DEFF Research Database (Denmark)

    Bellincampi, D.; Carmadella, L.; Delcour, J.A.

    2004-01-01

    Carbohydrate-active enzymes including glycosidases, transglycosidases, glycosyltransferases, polysaccharide lyases and carbohydrate esterases are responsible for the enzymatic processing of carbohydrates in plants. A number of carbohydrate-active enzymes are produced by microbial pathogens...... and insects responsible of severe crop losses. Plants have evolved proteinaceous inhibitors to modulate the activity of several of these enzymes. The continuing discovery of new inhibitors indicates that this research area is still unexplored and may lead to new exciting developments. To date, the role...... of the inhibitors is not completely understood. Here we review recent results obtained on the best characterised inhibitors, pointing to their possible biological role in vivo. Results recently obtained with plant transformation technology indicate that this class of inhibitors has potential biotechnological...

  18. The Wonders of Phosphodiesterase‑5 Inhibitors: A Majestic History

    African Journals Online (AJOL)

    A milestone in drug discovery was the selective inhibitors of. PDE‑5 that ... the pharmacotherapeutics of PDE‑5 inhibitors and the majestic history that led to their discovery. ..... including HIV protease inhibitors, ketoconazole, itraconazole,.

  19. Squash inhibitor family of serine proteinases

    International Nuclear Information System (INIS)

    Otlewski, J.; Krowarsch, D.

    1996-01-01

    Squash inhibitors of serine proteinases form an uniform family of small proteins. They are built of 27-33 amino-acid residues and cross-linked with three disulfide bridges. The reactive site peptide bond (P1-P1') is between residue 5 (Lys, Arg or Leu) and 6 (always Ile). High resolution X-ray structures are available for two squash inhibitors complexed with trypsin. NMR solution structures have also been determined for free inhibitors. The major structural motif is a distorted, triple-stranded antiparallel beta-sheet. A similar folding motif has been recently found in a number of proteins, including: conotoxins from fish-hunting snails, carboxypeptidase inhibitor from potato, kalata B1 polypeptide, and in some growth factors (e.g. nerve growth factor, transforming growth factor β2, platelet-derived growth factor). Squash inhibitors are highly stable and rigid proteins. They inhibit a number of serine proteinases: trypsin, plasmin, kallikrein, blood clotting factors: X a and XII a , cathepsin G. The inhibition spectrum can be much broadened if specific amino-acid substitutions are introduced, especially at residues which contact proteinase. Squash inhibitors inhibit proteinases via the standard mechanism. According to the mechanism, inhibitors are substrates which exhibit at neutral pH a high k cat /K m index for hydrolysis and resynthesis of the reactive site, and a low value of the hydrolysis constant. (author)

  20. Histone Deacetylase Inhibitors as Anticancer Drugs.

    Science.gov (United States)

    Eckschlager, Tomas; Plch, Johana; Stiborova, Marie; Hrabeta, Jan

    2017-07-01

    Carcinogenesis cannot be explained only by genetic alterations, but also involves epigenetic processes. Modification of histones by acetylation plays a key role in epigenetic regulation of gene expression and is controlled by the balance between histone deacetylases (HDAC) and histone acetyltransferases (HAT). HDAC inhibitors induce cancer cell cycle arrest, differentiation and cell death, reduce angiogenesis and modulate immune response. Mechanisms of anticancer effects of HDAC inhibitors are not uniform; they may be different and depend on the cancer type, HDAC inhibitors, doses, etc. HDAC inhibitors seem to be promising anti-cancer drugs particularly in the combination with other anti-cancer drugs and/or radiotherapy. HDAC inhibitors vorinostat, romidepsin and belinostat have been approved for some T-cell lymphoma and panobinostat for multiple myeloma. Other HDAC inhibitors are in clinical trials for the treatment of hematological and solid malignancies. The results of such studies are promising but further larger studies are needed. Because of the reversibility of epigenetic changes during cancer development, the potency of epigenetic therapies seems to be of great importance. Here, we summarize the data on different classes of HDAC inhibitors, mechanisms of their actions and discuss novel results of preclinical and clinical studies, including the combination with other therapeutic modalities.

  1. Histone Deacetylase Inhibitors as Anticancer Drugs

    Directory of Open Access Journals (Sweden)

    Tomas Eckschlager

    2017-07-01

    Full Text Available Carcinogenesis cannot be explained only by genetic alterations, but also involves epigenetic processes. Modification of histones by acetylation plays a key role in epigenetic regulation of gene expression and is controlled by the balance between histone deacetylases (HDAC and histone acetyltransferases (HAT. HDAC inhibitors induce cancer cell cycle arrest, differentiation and cell death, reduce angiogenesis and modulate immune response. Mechanisms of anticancer effects of HDAC inhibitors are not uniform; they may be different and depend on the cancer type, HDAC inhibitors, doses, etc. HDAC inhibitors seem to be promising anti-cancer drugs particularly in the combination with other anti-cancer drugs and/or radiotherapy. HDAC inhibitors vorinostat, romidepsin and belinostat have been approved for some T-cell lymphoma and panobinostat for multiple myeloma. Other HDAC inhibitors are in clinical trials for the treatment of hematological and solid malignancies. The results of such studies are promising but further larger studies are needed. Because of the reversibility of epigenetic changes during cancer development, the potency of epigenetic therapies seems to be of great importance. Here, we summarize the data on different classes of HDAC inhibitors, mechanisms of their actions and discuss novel results of preclinical and clinical studies, including the combination with other therapeutic modalities.

  2. Proton pump inhibitors and gastroenteritis

    International Nuclear Information System (INIS)

    Hassing, Robert-Jan; Verbon, Annelies; Visser, Herman de; Hofman, Albert; Stricker, Bruno H.

    2016-01-01

    An association between proton pump inhibitor (PPI) therapy and bacterial gastroenteritis has been suggested as well as contradicted. The aim of this study was to examine the association between the use of PPIs and occurrence of bacterial gastroenteritis in the prospective Rotterdam Study. The Rotterdam Study is a population-based cohort study among 14,926 subjects aged 45 years and older with up to 24 years of follow-up. Analyses were performed with a generalized estimating equations method in participants who handed-in a diagnostic stool sample. Furthermore, a nested case–control analysis was performed using the total cohort as a reference group. A bacterial microorganism was isolated in 125 samples, whereas 1174 samples were culture negative. In the generalized estimating equations analysis, we found that participants with a bacterial gastroenteritis were more likely than controls to be current users of PPIs (adjusted OR 1.94; 95 % CI 1.15–3.25). Different sensitivity analyses did not change this result. A considerably higher effect was observed (adjusted OR 6.14; 95 % CI 3.81–9.91), using the total cohort as a reference in a nested case–control analysis. Current PPI therapy is associated with an increased risk of bacterial gastroenteritis. However, by reducing the risk of selection and information bias in our study design, we demonstrated that the effect is lower than previously assumed.

  3. ALK inhibitors, a pharmaceutical perspective

    Directory of Open Access Journals (Sweden)

    Arturo eGalvani

    2012-02-01

    Full Text Available In 2007, the ALK tyrosine kinase, already known to be translocated and activated in Anaplastic Large Cell Lymphoma, and a few other rare cancers, was described as a potential therapeutic target for a subset of non small-cell lung cancer (NSCLC patients. Clinical proof of concept, culminating in the recent approval by the FDA of the Pfizer drug Xalkori (crizotinib, formerly known as PF-02341066 followed in record time. The drug was approved together with a companion diagnostic, the Vysis ALK Break Apart FISH Probe Kit (Abbott Molecular, Inc. for detection of eligible patients. This remarkable example of the coming of age of personalized medicine in cancer therapy is hopefully only an auspice of things to come in this rapidly developing field. Perhaps unsurprisingly, however, the appearance of clinical acquired resistance to crizotinib has already been observed early on in clinical testing, with the identification of several ALK secondary point mutations which diminish drug efficacy, and which open the way for development of second-generation inhibitors. It is also emerging that acquired resistance to crizotinib may also occur through ALK-independent mechanisms, which still need to be elucidated in detail.

  4. SGLT2 Inhibitors May Predispose to Ketoacidosis.

    Science.gov (United States)

    Taylor, Simeon I; Blau, Jenny E; Rother, Kristina I

    2015-08-01

    Sodium glucose cotransporter 2 (SGLT2) inhibitors are antidiabetic drugs that increase urinary excretion of glucose, thereby improving glycemic control and promoting weight loss. Since approval of the first-in-class drug in 2013, data have emerged suggesting that these drugs increase the risk of diabetic ketoacidosis. In May 2015, the Food and Drug Administration issued a warning that SGLT2 inhibitors may lead to ketoacidosis. Using PubMed and Google, we conducted Boolean searches including terms related to ketone bodies or ketoacidosis with terms for SGLT2 inhibitors or phlorizin. Priority was assigned to publications that shed light on molecular mechanisms whereby SGLT2 inhibitors could affect ketone body metabolism. SGLT2 inhibitors trigger multiple mechanisms that could predispose to diabetic ketoacidosis. When SGLT2 inhibitors are combined with insulin, it is often necessary to decrease the insulin dose to avoid hypoglycemia. The lower dose of insulin may be insufficient to suppress lipolysis and ketogenesis. Furthermore, SGLT2 is expressed in pancreatic α-cells, and SGLT2 inhibitors promote glucagon secretion. Finally, phlorizin, a nonselective inhibitor of SGLT family transporters decreases urinary excretion of ketone bodies. A decrease in the renal clearance of ketone bodies could also increase the plasma ketone body levels. Based on the physiology of SGLT2 and the pharmacology of SGLT2 inhibitors, there are several biologically plausible mechanisms whereby this class of drugs has the potential to increase the risk of developing diabetic ketoacidosis. Future research should be directed toward identifying which patients are at greatest risk for this side effect and also to optimizing pharmacotherapy to minimize the risk to patients.

  5. Placenta-specific novel splice variants of Rho GDP dissociation inhibitor β are highly expressed in cancerous cells

    Directory of Open Access Journals (Sweden)

    Hatakeyama Keiichi

    2012-12-01

    Full Text Available Abstract Background Alternative splicing of pre-mRNA transcripts not only plays a role in normal molecular processes but is also associated with cancer development. While normal transcripts are ubiquitously expressed in normal tissues, splice variants created through abnormal alternative splicing events are often expressed in cancer cells. Although the Rho GDP dissociation inhibitor β (ARHGDIB gene has been found to be ubiquitously expressed in normal tissues and involved in cancer development, the presence of splice variants of ARHGDIB has not yet been investigated. Results Validation analysis for the presence of and exon structures of splice variants of ARHGDIB, performed using reverse-transcriptase polymerase chain reaction and DNA sequencing, successfully identified novel splice variants of ARHGDIB, that is, 6a, 6b, and 6c, in colon, pancreas, stomach, and breast cancer cell lines. Quantitative real-time polymerase chain reaction analysis showed that these variants were also highly expressed in normal placental tissue but not in other types of normal tissue. Conclusions Expression of ARHGDIB variants 6a, 6b, and 6c appears to be restricted to cancer cells and normal placental tissue, suggesting that these variants possess cancer-specific functions and, as such, are potential cancer-related biomarkers.

  6. Enzyme structure and interaction with inhibitors

    International Nuclear Information System (INIS)

    London, R.E.

    1983-01-01

    This article reviews some of the results of studies on the 13 C-labeled enzyme dihydrofolate reductase (DHFR). Nuclear magnetic resonance (NMR) techniques are used in combination with isotopic labeling to learn about the structure and dynamics of this enzyme. 13 C-labeling is used for the purpose of studying enzyme/substrate and enzyme/inhibitor interactions. A second set of studies with DHFR was designed to investigate the basis for the high affinity between the inhibitor methotrexate and DHFR. The label was placed on the inhibitor, rather than the enzyme

  7. An Updated Review of Tyrosinase Inhibitors

    Directory of Open Access Journals (Sweden)

    Te-Sheng Chang

    2009-05-01

    Full Text Available Tyrosinase is a multifunctional, glycosylated, and copper-containing oxidase, which catalyzes the first two steps in mammalian melanogenesis and is responsible for enzymatic browning reactions in damaged fruits during post-harvest handling and processing. Neither hyperpigmentation in human skin nor enzymatic browning in fruits are desirable. These phenomena have encouraged researchers to seek new potent tyrosinase inhibitors for use in foods and cosmetics. This article surveys tyrosinase inhibitors newly discovered from natural and synthetic sources. The inhibitory strength is compared with that of a standard inhibitor, kojic acid, and their inhibitory mechanisms are discussed.

  8. Strategies for discontinuation of proton pump inhibitors

    DEFF Research Database (Denmark)

    Haastrup, Peter; Paulsen, Maja S; Begtrup, Luise M

    2014-01-01

    PURPOSE: Proton pump inhibitors (PPIs) are considered to be overprescribed. Consensus on how to attempt discontinuation is, however, lacking. We therefore conducted a systematic review of clinical studies on discontinuation of PPIs. METHODS: Systematic review based on clinical studies investigating...

  9. Predicting the Performance of Organic Corrosion Inhibitors

    Directory of Open Access Journals (Sweden)

    David A. Winkler

    2017-12-01

    Full Text Available The withdrawal of effective but toxic corrosion inhibitors has provided an impetus for the discovery of new, benign organic compounds to fill that role. Concurrently, developments in the high-throughput synthesis of organic compounds, the establishment of large libraries of available chemicals, accelerated corrosion inhibition testing technologies, and the increased capability of machine learning methods have made discovery of new corrosion inhibitors much faster and cheaper than it used to be. We summarize these technical developments in the corrosion inhibition field and describe how data-driven machine learning methods can generate models linking molecular properties to corrosion inhibition that can be used to predict the performance of materials not yet synthesized or tested. We briefly summarize the literature on quantitative structure–property relationships models of small organic molecule corrosion inhibitors. The success of these models provides a paradigm for rapid discovery of novel, effective corrosion inhibitors for a range of metals and alloys in diverse environments.

  10. Novel diamide-based inhibitors of IMPDH.

    Science.gov (United States)

    Gu, Henry H; Iwanowicz, Edwin J; Guo, Junqing; Watterson, Scott H; Shen, Zhongqi; Pitts, William J; Dhar, T G Murali; Fleener, Catherine A; Rouleau, Katherine; Sherbina, N Z; Witmer, Mark; Tredup, Jeffrey; Hollenbaugh, Diane

    2002-05-06

    A series of novel amide-based small molecule inhibitors of inosine monophosphate dehydrogenase is described. The synthesis and the structure-activity relationships (SARs) derived from in vitro studies are presented.

  11. Monoamine Oxidase B Inhibitors in Parkinson's Disease.

    Science.gov (United States)

    Dezsi, Livia; Vecsei, Laszlo

    2017-01-01

    Parkinson's disease (PD) is a neurodegenerative disorder with a prevalence increasing with age. Oxidative stress and glutamate toxicity are involved in its pathomechanism. There are still many unmet needs of PD patients, including the alleviation of motor fluctuations and dyskinesias, and the development of therapies with neuroprotective potential. To give an overview of the pharmacological properties, the efficacy and safety of the monoamine oxidase B (MAO-B) inhibitors in the treatment of PD, with special focus on the results of randomized clinical trials. A literature search was conducted in PubMed for 'PD treatment', 'MAO-B inhibitors', 'selegiline', 'rasagiline', 'safinamide' and 'clinical trials' with 'MAO-B inhibitors' in 'Parkinson' disease'. MAO-B inhibitors have a favorable pharmacokinetic profile, improve the dopamine deficient state and may have neuroprotective properties. Safinamide exhibits an anti-glutamatergic effect as well. When applied as monotherapy, MAO-B inhibitors provide a modest, but significant improvement of motor function and delay the need for levodopa. Rasagiline and safinamide were proven safe and effective when added to a dopamine agonist in early PD. As add-on to levodopa, MAO-B inhibitors significantly reduced off-time and were comparable in efficacy to COMT inhibitors. Improvements were achieved as regards certain non-motor symptoms as well. Due to the efficacy shown in clinical trials and their favorable side-effect profile, MAO-B inhibitors are valuable drugs in the treatment of PD. They are recommended as monotherapy in the early stages of the disease and as add-on therapy to levodopa in advanced PD. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  12. The effect of chemical anti-inhibitors on fibrinolytic enzymes and inhibitors

    DEFF Research Database (Denmark)

    Sidelmann, Johannes Jakobsen; Jespersen, J; Kluft, C

    1997-01-01

    proteases. We studied the influence of chemical anti-inhibitors (chloramine T, flufenamate, sodium lauryl sulfate, and methylamine) on fibrinolytic serine proteases and fibrinolytic enzyme inhibitors using the physiological substrate fibrin as plasmin substrate. Low concentrations of chloramine T (0.01 mmol......%) and plasminogen activators (apparent recovery > 200%). Sodium lauryl sulfate eliminates the major fibrinolytic enzyme inhibitors, but increases the activity of plasmin (apparent recovery > 200%) and plasminogen activator, urokinase type (apparent recovery 130%). Methylamine affects only plasmin inhibition. We...

  13. Development of Radiosensitizer using farnesyltransferase inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Jong Seok; Choe, Yong Kyung; Han, Mi Young; Kim, Kwang Dong [Korea Research Institute of Bioscience and Biotechnology, Taejon (Korea)

    1999-03-01

    We selected some compounds that were reported to have an activity of farneyltransferase inhibitor and tested the hypothesis that they might be used to radiosensitize cells transformed by ras oncogenes. The inhibition of ras processing using some, but not all, inhibitors resulted in higher levels of cell death after {gamma}-irradiation and increased radiosensitivity in H-ras-transformed NIH3T3 cells and MCF-10A human tumor cells. They did not induce additional cell death in control cells that doe not have ras mutation. Furthermore, the treatment of inhibitors alone induced a weak G0/G1 block, whereas inhibitors in combination with {gamma}-irradiation induced an additional enrichment in the G2/M phase of the cell cycle that typically represents irradiation-induced growth arrest. At present, the underling mechanism by which the farnesylltransferase inhibitors exert radiosensitizing effect is not known. In summary, our results suggest and lead to the possibility that some of farnesylation inhibitors may prove clinically useful not only as antitumor agents, but also radiosensitizers of tumors whose growth is dependent on ras function. (author). 15 refs., 10 figs., 4 tabs.

  14. Natural inhibitors of tumor-associated proteases

    International Nuclear Information System (INIS)

    Magdolen, U.; Krol, J.; Sato, S.; Schmitt, M.; Magdolen, V.; Krueger, A.; Mueller, M.M.; Sperl, S.

    2002-01-01

    The turnover and remodelling of extracellular matrix (ECM) is an essential part of many normal biological processes including development, morphogenesis, and wound healing. ECM turnover also occurs in severe pathological situations like artherosclerosis, fibrosis, tumor invasion and metastasis. The major proteases involved in this turnover are serine proteases (especially the urokinase-type plasminogen activator/plasmin system), matrix metalloproteases (a family of about 20 zinc-dependent endopeptidases including collagenases, gelatinases, stromelysins, and membrane-type metalloproteases), and cysteine proteases. In vivo, the activity of these proteases is tightly regulated in the extracellular space by zymogen activation and/or controlled inhibition. In the present review, we give an overview on the structure and biochemical properties of important tumor-associated protease inhibitors such as plasminogen activator inhibitor type 1 and type 2 (PAI-1, PAI-2), tissue inhibitors of metalloproteinases (TIMP-1, -2, -3, and -4), and the cysteine protease inhibitor cystatin C. Interestingly, some of these inhibitors of tumor-associated proteases display multiple functions which rather promote than inhibit tumor progression, when the presence of inhibitors in the tumor tissue is not balanced. (author)

  15. Emerging Corrosion Inhibitors for Interfacial Coating

    Directory of Open Access Journals (Sweden)

    Mona Taghavikish

    2017-12-01

    Full Text Available Corrosion is a deterioration of a metal due to reaction with environment. The use of corrosion inhibitors is one of the most effective ways of protecting metal surfaces against corrosion. Their effectiveness is related to the chemical composition, their molecular structures and affinities for adsorption on the metal surface. This review focuses on the potential of ionic liquid, polyionic liquid (PIL and graphene as promising corrosion inhibitors in emerging coatings due to their remarkable properties and various embedment or fabrication strategies. The review begins with a precise description of the synthesis, characterization and structure-property-performance relationship of such inhibitors for anti-corrosion coatings. It establishes a platform for the formation of new generation of PIL based coatings and shows that PIL corrosion inhibitors with various heteroatoms in different form can be employed for corrosion protection with higher barrier properties and protection of metal surface. However, such study is still in its infancy and there is significant scope to further develop new structures of PIL based corrosion inhibitors and coatings and study their behaviour in protection of metals. Besides, it is identified that the combination of ionic liquid, PIL and graphene could possibly contribute to the development of the ultimate corrosion inhibitor based coating.

  16. Discovery of natural mouse serum derived HIV-1 entry inhibitor(s).

    Science.gov (United States)

    Wei, M; Chen, Y; Xi, J; Ru, S; Ji, M; Zhang, D; Fang, Q; Tang, B

    Among rationally designed human immunodeficiency virus 1 (HIV-1) inhibitors, diverse natural factors have showed as potent anti-HIV activity in human blood. We have discovered that the boiled supernatant of healthy mouse serum could suppress HIV-1 entry, and exhibited reduced inhibitory activity after trypsin digestion. Further analysis demonstrated that only the fraction containing 10-25 K proteins could inhibit HIV-1 mediated cell-cell fusion. These results suggest that the 10-25 K protein(s) is novel natural HIV-1 entry inhibitor(s). Our findings provide important information about novel natural HIV entry inhibitors in mouse serum.

  17. Identification of N-phenyl-N'-(2,2,6,6-tetramethyl-piperidin-4-yl)-oxalamides as a new class of HIV-1 entry inhibitors that prevent gp120 binding to CD4

    International Nuclear Information System (INIS)

    Zhao Qian; Ma Liying; Jiang Shibo; Lu Hong; Liu Shuwen; He Yuxian; Strick, Nathan; Neamati, Nouri; Debnath, Asim Kumar

    2005-01-01

    We have identified two N-phenyl-N'-(2,2,6,6-tetramethyl-piperidin-4-yl)-oxalamide analogs as a novel class of human immunodeficiency virus type 1 (HIV-1) entry inhibitors that block the gp120-CD4 interaction, using database screening techniques. The lead compounds, NBD-556 and NBD-557, are small molecule organic compounds with drug-like properties. These compounds showed potent cell fusion and virus-cell fusion inhibitory activity at low micromolar levels. A systematic study showed that these compounds target viral entry by inhibiting the binding of HIV-1 envelope glycoprotein gp120 to the cellular receptor CD4 but did not inhibit reverse transcriptase, integrase, or protease, indicating that they do not target the later stages of the HIV-1 life cycle to inhibit HIV-1 infection. These compounds were equally potent inhibitors of both X4 and R5 viruses tested in CXCR4 and CCR5 expressing cell lines, respectively, indicating that their anti-HIV-1 activity is not dependent on the coreceptor tropism of the virus. A surface plasmon resonance study, which measures binding affinity, clearly demonstrated that these compounds bind to unliganded HIV-1 gp120 but not to the cellular receptor CD4. NBD-556 and NBD-557 were active against HIV-1 laboratory-adapted strains including an AZT-resistant strain and HIV-1 primary isolates, indicating that these compounds can potentially be further modified to become potent HIV-1 entry inhibitors

  18. Inactivation of proteinaceous protease inhibitors of soybeans by isolated fungi

    NARCIS (Netherlands)

    Meijer, M.M.T.; Spekking, W.T.J.; Sijtsma, L.; Bont, de J.A.M.

    1995-01-01

    Proteinaceous protease inhibitors, Kunitz Soybean Trypsin Inhibitor (KSTI) and Bowman Birk Inhibitor (BBI), in legume seeds reduce the digestibility of proteins in feed of monogastric animals. Enzymatic inactivation of these inhibitors will increase the nutritional value of the feed. The aim of this

  19. The Telomerase Inhibitor MST-312 Interferes with Multiple Steps in the Herpes Simplex Virus Life Cycle.

    Science.gov (United States)

    Haberichter, Jarod; Roberts, Scott; Abbasi, Imran; Dedthanou, Phonphanh; Pradhan, Prajakta; Nguyen, Marie L

    2015-10-01

    The life cycle of herpes simplex virus (HSV) has the potential to be further manipulated to yield novel, more effective therapeutic treatments. Recent research has demonstrated that HSV-1 can increase telomerase activity and that expression of the catalytic component of telomerase, telomerase reverse transcriptase (TERT), alters sensitivity to HSV-dependent apoptosis. Telomerase is a cellular enzyme that synthesizes nucleotide repeats at the ends of chromosomes (telomeres), which prevents shortening of the 3' ends of DNA with each cell division. Once telomeres reach a critical length, cells undergo senescence and apoptosis. Here, we used a cell-permeable, reversible inhibitor of the telomerase enzyme, MST-312, to investigate telomerase activity during HSV infection. Human mammary epithelial cells immortalized through TERT expression and human carcinoma HEp-2 cells were infected with the KOS1.1 strain of HSV-1 in the presence of MST-312. MST-312 treatment reduced the number of cells displaying a cytopathic effect and the accumulation of immediate early and late viral proteins. Moreover, the presence of 20 μM to 100 μM MST-312 during infection led to a 2.5- to 5.5-log10 decrease in viral titers. MST-312 also inhibited the replication of HSV-2 and a recent clinical isolate of HSV-1. Additionally, we determined that MST-312 has the largest impact on viral events that take place prior to 5 h postinfection (hpi). Furthermore, MST-312 treatment inhibited virus replication, as measured by adsorption assays and quantification of genome replication. Together, these findings demonstrate that MST-312 interferes with the HSV life cycle. Further investigation into the mechanism for MST-312 is warranted and may provide novel targets for HSV therapies. Herpes simplex virus (HSV) infections can lead to cold sores, blindness, and brain damage. Identification of host factors that are important for the virus life cycle may provide novel targets for HSV antivirals. One such factor

  20. Combined effects of EGFR tyrosine kinase inhibitors and vATPase inhibitors in NSCLC cells

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Hyeon-Ok [KIRAMS Radiation Biobank, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Hong, Sung-Eun [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Kim, Chang Soon [Department of Microbiological Engineering, Kon-Kuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul, 143–701 (Korea, Republic of); Park, Jin-Ah; Kim, Jin-Hee; Kim, Ji-Young; Kim, Bora [KIRAMS Radiation Biobank, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Chang, Yoon Hwan; Hong, Seok-Il; Hong, Young Jun [Department of Laboratory Medicine, Korea Cancer Center Hospital, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Park, In-Chul, E-mail: parkic@kirams.re.kr [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Lee, Jin Kyung, E-mail: jklee@kirams.re.kr [KIRAMS Radiation Biobank, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Department of Laboratory Medicine, Korea Cancer Center Hospital, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of)

    2015-08-15

    Despite excellent initial clinical responses of non-small cell lung cancer (NSCLC) patients to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs), many patients eventually develop resistance. According to a recent report, vacuolar H + ATPase (vATPase) is overexpressed and is associated with chemotherapy drug resistance in NSCLC. We investigated the combined effects of EGFR TKIs and vATPase inhibitors and their underlying mechanisms in the regulation of NSCLC cell death. We found that combined treatment with EGFR TKIs (erlotinib, gefitinib, or lapatinib) and vATPase inhibitors (bafilomycin A1 or concanamycin A) enhanced synergistic cell death compared to treatments with each drug alone. Treatment with bafilomycin A1 or concanamycin A led to the induction of Bnip3 expression in an Hif-1α dependent manner. Knock-down of Hif-1α or Bnip3 by siRNA further enhanced cell death induced by bafilomycin A1, suggesting that Hif-1α/Bnip3 induction promoted resistance to cell death induced by the vATPase inhibitors. EGFR TKIs suppressed Hif-1α and Bnip3 expression induced by the vATPase inhibitors, suggesting that they enhanced the sensitivity of the cells to these inhibitors by decreasing Hif-1α/Bnip3 expression. Taken together, we conclude that EGFR TKIs enhance the sensitivity of NSCLC cells to vATPase inhibitors by decreasing Hif-1α/Bnip3 expression. We suggest that combined treatment with EGFR TKIs and vATPase inhibitors is potentially effective for the treatment of NSCLC. - Highlights: • Co-treatment with EGFR TKIs and vATPase inhibitors induces synergistic cell death • EGFR TKIs enhance cell sensitivity to vATPase inhibitors via Hif-1α downregulation • Co-treatment of these inhibitors is potentially effective for the treatment of NSCLC.

  1. Screening of protein kinase inhibitors identifies PKC inhibitors as inhibitors of osteoclastic acid secretion and bone resorption

    Directory of Open Access Journals (Sweden)

    Boutin Jean A

    2010-10-01

    Full Text Available Abstract Background Bone resorption is initiated by osteoclastic acidification of the resorption lacunae. This process is mediated by secretion of protons through the V-ATPase and chloride through the chloride antiporter ClC-7. To shed light on the intracellular signalling controlling extracellular acidification, we screened a protein kinase inhibitor library in human osteoclasts. Methods Human osteoclasts were generated from CD14+ monocytes. The effect of different kinase inhibitors on lysosomal acidification in human osteoclasts was investigated using acridine orange for different incubation times (45 minutes, 4 and 24 hours. The inhibitors were tested in an acid influx assay using microsomes isolated from human osteoclasts. Bone resorption by human osteoclasts on bone slices was measured by calcium release. Cell viability was measured using AlamarBlue. Results Of the 51 compounds investigated only few inhibitors were positive in both acidification and resorption assays. Rottlerin, GF109203X, Hypericin and Ro31-8220 inhibited acid influx in microsomes and bone resorption, while Sphingosine and Palmitoyl-DL-carnitine-Cl showed low levels of inhibition. Rottlerin inhibited lysosomal acidification in human osteoclasts potently. Conclusions In conclusion, a group of inhibitors all indicated to inhibit PKC reduced acidification in human osteoclasts, and thereby bone resorption, indicating that acid secretion by osteoclasts may be specifically regulated by PKC in osteoclasts.

  2. SGLT2 Inhibitors and the Diabetic Kidney.

    Science.gov (United States)

    Fioretto, Paola; Zambon, Alberto; Rossato, Marco; Busetto, Luca; Vettor, Roberto

    2016-08-01

    Diabetic nephropathy (DN) is the most common cause of end-stage renal disease worldwide. Blood glucose and blood pressure control reduce the risk of developing this complication; however, once DN is established, it is only possible to slow progression. Sodium-glucose cotransporter 2 (SGLT2) inhibitors, the most recent glucose-lowering oral agents, may have the potential to exert nephroprotection not only through improving glycemic control but also through glucose-independent effects, such as blood pressure-lowering and direct renal effects. It is important to consider, however, that in patients with impaired renal function, given their mode of action, SGLT2 inhibitors are less effective in lowering blood glucose. In patients with high cardiovascular risk, the SGLT2 inhibitor empagliflozin lowered the rate of cardiovascular events, especially cardiovascular death, and substantially reduced important renal outcomes. Such benefits on DN could derive from effects beyond glycemia. Glomerular hyperfiltration is a potential risk factor for DN. In addition to the activation of the renin-angiotensin-aldosterone system, renal tubular factors, including SGLT2, contribute to glomerular hyperfiltration in diabetes. SGLT2 inhibitors reduce sodium reabsorption in the proximal tubule, causing, through tubuloglomerular feedback, afferent arteriole vasoconstriction and reduction in hyperfiltration. Experimental studies showed that SGLT2 inhibitors reduced hyperfiltration and decreased inflammatory and fibrotic responses of proximal tubular cells. SGLT2 inhibitors reduced glomerular hyperfiltration in patients with type 1 diabetes, and in patients with type 2 diabetes, they caused transient acute reductions in glomerular filtration rate, followed by a progressive recovery and stabilization of renal function. Interestingly, recent studies consistently demonstrated a reduction in albuminuria. Although these data are promising, only dedicated renal outcome trials will clarify whether

  3. [Construction of autocatalytic caspase-3 driven by amplified human telomerase reverse transcriptase promoter and its enhanced efficacy of inducing apoptosis in human ovarian carcinoma].

    Science.gov (United States)

    Song, Yue; Shen, Keng; He, Chun-Xia

    2007-09-01

    To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter amplified by two-step transcription amplification (hTERTp-TSTA), and investigate its antitumor effect in ovarian cancer in vitro and in vivo. Recombinant adenoviruses expressing autocatalytic caspase-3 (rev-caspase-3) driven by hTERTp-TSTA were prepared, which were named as AdHTVP2G5-rev-casp3. AdHT-rev-casp3, Ad-rev-casp3 and AdHTVP2G5-EGEP, which express rev-caspase-3 driven by hTERTp, cytomegalovirus promoter (CMVp) and enhanced green fluorescent protein (EGFP), respectively, were used as controls. Western blot, cell counting kit (CCK-8), flow cytometry (FCM) and TdT-mediated dUTP-biotin nick end labeling (TUNEL) were used to detect the expression of p17, active subunit of caspase-3, and p85, and to measure cell survival rates, apoptotic rates and cell cycle distribution in ovarian cell line AO and normal human umbilical vein endothelial cell line HUVEC, following treatments of AdHTVP2G5-rev-casp3. subcutaneous tumor models and abdominally spread tumor models of human ovarian carcinoma using AO cells in BALB/c nude mice were established. Following treatments of AdHTVP2G5-rev-casp3, western blot was used to detect the expression of active caspase-3 in abdominally spread tumors and liver tissues, respectively, and the mouse survival rates and the volume of tumor nodules were measured, and the serum level of alanine transaminase (ALT) and aspartate transaminase (AST) were analyzed to monitor liver damages and HE staining was used to detect the histopathological changes of various organs. The levels of p17 expression in AdHTVP2G5-rev-casp3-treated AO cells were significantly higher than that in Ad-rev-casp3 or AdHT-rev-casp3 treated AO cells, while no expression was observed in AdHTVP2G5-rev-casp3-treated HUVEC. There was strong cell killing of AdHTVP2G5-rev-casp3 of hTERT positive AO cells, but not of the hTERT-negative HUVEC cells

  4. Inhibitor chymotrypsynowy nasion wiechliny łąkowej (Poa pratensis [Chymotrypsin inhibitor from Poa pratensis seeds

    Directory of Open Access Journals (Sweden)

    I. Lorenc-Kubis

    2015-01-01

    Full Text Available A chymotrypsin inhibitor was isolated from Poa pratensis seeds. The inhibitor showed also antytriptic activity. It is a termostable protein, soluble in water, sodium chloride, but insoluble in 5% trichloracetic acid and 0.15 M sulphosalicylic acid.

  5. SGLT2 inhibitors: are they safe?

    Science.gov (United States)

    Filippas-Ntekouan, Sebastian; Filippatos, Theodosios D; Elisaf, Moses S

    2018-01-01

    Sodium-glucose linked transporter type 2 (SGLT2) inhibitors are a relatively new class of antidiabetic drugs with positive cardiovascular and kidney effects. The aim of this review is to present the safety issues associated with SGLT2 inhibitors. Urogenital infections are the most frequently encountered adverse events, although tend to be mild to moderate and are easily manageable with standard treatment. Although no increased acute kidney injury risk was evident in the major trials, the mechanism of action of these drugs requires caution when they are administered in patients with extracellular volume depletion or with drugs affecting renal hemodynamics. Canagliflozin raised the risk of amputations and the rate of fractures in the CANVAS trial, although more data are necessary before drawing definite conclusions. The risk of euglycemic diabetic ketoacidosis seems to be minimal when the drugs are prescribed properly. Regarding other adverse events, SGLT2 inhibitors do not increase the risk of hypoglycemia even when co-administered with insulin, but a decrease in the dose of sulphonylureas may be needed. The available data do not point to a causative role of SGLT2 inhibitors on malignancy risk, however, these drugs should be used with caution in patients with known hematuria or history of bladder cancer. SGLT2 inhibitors seem to be safe and effective in the treatment of diabetes but more studies are required to assess their long-term safety.

  6. Aromatase inhibitors and breast cancer prevention.

    Science.gov (United States)

    Litton, Jennifer Keating; Arun, Banu K; Brown, Powel H; Hortobagyi, Gabriel N

    2012-02-01

    Endocrine therapy with selective estrogen receptor modulators (SERMs) has been the mainstay of breast cancer prevention trials to date. The aromatase inhibitors, which inhibit the final chemical conversion of androgens to estrogens, have shown increased disease-free survival benefit over tamoxifen in patients with primary hormone receptor-positive breast cancer, as well as reducing the risk of developing contralateral breast cancers. The aromatase inhibitors are being actively evaluated as prevention agents for women with a history of ductal carcinoma in situ as well as for women who are considered to be at high risk for developing primary invasive breast cancer. This review evaluates the available prevention data, as evidenced by the decrease in contralateral breast cancers, when aromatase inhibitors are used in the adjuvant setting, as well as the emerging data of the aromatase inhibitors specifically tested in the prevention setting for women at high risk. Exemestane is a viable option for breast cancer prevention. We continue to await further follow-up on exemestane as well as other aromatase inhibitors in the prevention setting for women at high risk of developing breast cancer or with a history of ductal carcinoma in situ.

  7. Janus kinase inhibitors: jackpot or potluck?

    Directory of Open Access Journals (Sweden)

    Pavithran Keechilat

    2012-06-01

    Full Text Available The reports of a unique mutation in the Janus kinase-2 gene (JAK2 in polycythemia vera by several independent groups in 2005 quickly spurred the development of the Janus kinase inhibitors. In one of the great victories of translational research in recent times, the first smallmolecule Janus kinase inhibitor ruxolitinib entered a phase I trial in 2007. With the approval of ruxolitinib by the US Federal Drug Administration in November 2011 for high-risk and intermediate-2 risk myelofibrosis, a change in paradigm has occurred in the management of a subset of myeloproliferative neoplasms (MPN: primary myelofibrosis, post-polycythemia vera myelofibrosis, and post-essential thrombocythemia myelofibrosis. Whereas the current evidence for ruxolitinib only covers high-risk and intermediate-2 risk myelofibrosis, inhibitors with greater potency are likely to offer better disease control and survival advantage in patients belonging to these categories, and possibly to the low-risk and intermediate-1 risk categories of MPN as well. But use of the Janus kinase inhibitors also probably has certain disadvantages, such as toxicity, resistance, withdrawal phenomenon, non-reversal of histology, and an implausible goal of disease clone eradication, some of which could offset the gains. In spite of this, Janus kinase inhibitors are here to stay, and for use in more than just myeloproliferative neoplasms.

  8. Long-term treatment with the sodium glucose cotransporter 2 inhibitor, dapagliflozin, ameliorates glucose homeostasis and diabetic nephropathy in db/db mice.

    Directory of Open Access Journals (Sweden)

    Naoto Terami

    Full Text Available Inhibition of sodium glucose cotransporter 2 (SGLT2 has been reported as a new therapeutic strategy for treating diabetes. However, the effect of SGLT2 inhibitors on the kidney is unknown. In addition, whether SGLT2 inhibitors have an anti-inflammatory or antioxidative stress effect is still unclear. In this study, to resolve these issues, we evaluated the effects of the SGLT2 inhibitor, dapagliflozin, using a mouse model of type 2 diabetes and cultured proximal tubular epithelial (mProx24 cells. Male db/db mice were administered 0.1 or 1.0 mg/kg of dapagliflozin for 12 weeks. Body weight, blood pressure, blood glucose, hemoglobin A1c, albuminuria and creatinine clearance were measured. Mesangial matrix accumulation and interstitial fibrosis in the kidney and pancreatic β-cell mass were evaluated by histological analysis. Furthermore, gene expression of inflammatory mediators, such as osteopontin, monocyte chemoattractant protein-1 and transforming growth factor-β, was evaluated by quantitative reverse transcriptase-PCR. In addition, oxidative stress was evaluated by dihydroethidium and NADPH oxidase 4 staining. Administration of 0.1 or 1.0 mg/kg of dapagliflozin ameliorated hyperglycemia, β-cell damage and albuminuria in db/db mice. Serum creatinine, creatinine clearance and blood pressure were not affected by administration of dapagliflozin, but glomerular mesangial expansion and interstitial fibrosis were suppressed in a dose-dependent manner. Dapagliflozin treatment markedly decreased macrophage infiltration and the gene expression of inflammation and oxidative stress in the kidney of db/db mice. Moreover, dapagliflozin suppressed the high-glucose-induced gene expression of inflammatory cytokines and oxidative stress in cultured mProx24 cells. These data suggest that dapagliflozin ameliorates diabetic nephropathy by improving hyperglycemia along with inhibiting inflammation and oxidative stress.

  9. A cyclic peptidic serine protease inhibitor

    DEFF Research Database (Denmark)

    Zhao, Baoyu; Xu, Peng; Jiang, Longguang

    2014-01-01

    Peptides are attracting increasing interest as protease inhibitors. Here, we demonstrate a new inhibitory mechanism and a new type of exosite interactions for a phage-displayed peptide library-derived competitive inhibitor, mupain-1 (CPAYSRYLDC), of the serine protease murine urokinase...... pocket, its carbonyl group aligning improperly relative to Ser195 and the oxyanion hole, explaining why the peptide is an inhibitor rather than a substrate. Substitution of the P1 Arg with novel unnatural Arg analogues with aliphatic or aromatic ring structures led to an increased affinity, depending......, in spite of a less favorable binding entropy and loss of a polar interaction. We conclude that increased flexibility of the peptide allows more favorable exosite interactions, which, in combination with the use of novel Arg analogues as P1 residues, can be used to manipulate the affinity and specificity...

  10. SGLT-2 Inhibitors and Cardiovascular Risk

    DEFF Research Database (Denmark)

    Cavender, Matthew A; Norhammar, Anna; Birkeland, Kåre I

    2018-01-01

    BACKGROUND: Prior studies found patients treated with sodium-glucose co-transporter-2 inhibitors (SGLT-2i) had lower rates of death and heart failure (HF). Whether the benefits of SGLT-2i vary based upon the presence of cardiovascular disease (CVD) is unknown. OBJECTIVES: This study sought...... to determine the association between initiation of SGLT-2i therapy and HF or death in patients with and without CVD. METHODS: The CVD-REAL (Comparative Effectiveness of Cardiovascular Outcomes in New Users of SGLT-2 Inhibitors) study was a multinational, observational study in which adults with type 2 diabetes...... evidence regarding the benefit of SGLT-2i in patients without established CVD. (Comparative Effectiveness of Cardiovascular Outcomes in New Users of SGLT-2 Inhibitors [CVD-REAL]; NCT02993614)....

  11. New halogenated phenylcoumarins as tyrosinase inhibitors.

    Science.gov (United States)

    Matos, Maria João; Santana, Lourdes; Uriarte, Eugenio; Delogu, Giovanna; Corda, Marcella; Fadda, Maria Benedetta; Era, Benedetta; Fais, Antonella

    2011-06-01

    With the aim to find out structural features for the tyrosinase inhibitory activity, in the present communication we report the synthesis and pharmacological evaluation of a new series of phenylcoumarin derivatives with different number of hydroxyl or ether groups and bromo substituent in the scaffold. The synthesized compounds 5-12 were evaluated as mushroom tyrosinase inhibitors showing, two of them, lower IC(50) than the umbelliferone. Compound 12 (IC(50)=215 μM) is the best tyrosinase inhibitor of this series. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Green inhibitors. Rare Earth based systems

    International Nuclear Information System (INIS)

    Aballe, A.; Bethencourt, M.; Botana, F.J.; Perez, J.; Rodriguez, M.A.; Marcos, M.

    1997-01-01

    Lanthanum, Cerium and Samarium chlorides have been investigated as uniform and pitting corrosion inhibitors of AISI 434 and AISI 304 stainless steels and AA 5083 Al-Mg alloy in 3.5% Na Cl aerated aqueous solutions. Their inhibitor power was evaluated by using electrochemical techniques such as Linear and Cyclic Polarisation. In each case, the highest protection degree was found in the solution dropped with 500 ppm of CeCl 3 . Similar results were obtained for additions of 500 ppm of LaCl 3 . Scanning Electron Microscopy and Energy Dispersive Spectroscopy allowed us to confirm the cathodic nature of the inhibition process. (Author) 27 refs

  13. 2-Aminobenzimidazoles as potent Aurora kinase inhibitors.

    Science.gov (United States)

    Zhong, Min; Bui, Minna; Shen, Wang; Baskaran, Subramanian; Allen, Darin A; Elling, Robert A; Flanagan, W Michael; Fung, Amy D; Hanan, Emily J; Harris, Shannon O; Heumann, Stacey A; Hoch, Ute; Ivy, Sheryl N; Jacobs, Jeffrey W; Lam, Stuart; Lee, Heman; McDowell, Robert S; Oslob, Johan D; Purkey, Hans E; Romanowski, Michael J; Silverman, Jeffrey A; Tangonan, Bradley T; Taverna, Pietro; Yang, Wenjin; Yoburn, Josh C; Yu, Chul H; Zimmerman, Kristin M; O'Brien, Tom; Lew, Willard

    2009-09-01

    This Letter describes the discovery and key structure-activity relationship (SAR) of a series of 2-aminobenzimidazoles as potent Aurora kinase inhibitors. 2-Aminobenzimidazole serves as a bioisostere of the biaryl urea residue of SNS-314 (1c), which is a potent Aurora kinase inhibitor and entered clinical testing in patients with solid tumors. Compared to SNS-314, this series of compounds offers better aqueous solubility while retaining comparable in vitro potency in biochemical and cell-based assays; in particular, 6m has also demonstrated a comparable mouse iv PK profile to SNS-314.

  14. Synergistic apoptosis induction in leukemic cells by the phosphatase inhibitor salubrinal and proteasome inhibitors.

    Directory of Open Access Journals (Sweden)

    Hannes C A Drexler

    Full Text Available Cells adapt to endoplasmic reticulum (ER-stress by arresting global protein synthesis while simultaneously activating specific transcription factors and their downstream targets. These processes are mediated in part by the phosphorylation-dependent inactivation of the translation initiation factor eIF2alpha. Following restoration of homeostasis protein synthesis is resumed when the serine/threonine-protein phosphatase PP1 dephosphorylates and reactivates eIF2alpha. Proteasome inhibitors, used to treat multiple myeloma patients evoke ER-stress and apoptosis by blocking the ER-associated degradation of misfolded proteins (ERAD, however, the role of eIF2alpha phosphorylation in leukemic cells under conditions of proteasome inhibitor-mediated ER stress is currently unclear.Bcr-Abl-positive and negative leukemic cell lines were used to investigate the functional implications of PP1-related phosphatase activities on eIF2alpha phosphorylation in proteasome inhibitor-mediated ER stress and apoptosis. Rather unexpectedly, salubrinal, a recently identified PP1 inhibitor capable to protect against ER stress in various model systems, strongly synergized with proteasome inhibitors to augment apoptotic death of different leukemic cell lines. Salubrinal treatment did not affect the phosphorlyation status of eIF2alpha. Furthermore, the proapoptotic effect of salubrinal occurred independently from the chemical nature of the proteasome inhibitor, was recapitulated by a second unrelated phosphatase inhibitor and was unaffected by overexpression of a dominant negative eIF2alpha S51A variant that can not be phosphorylated. Salubrinal further aggravated ER-stress and proteotoxicity inflicted by the proteasome inhibitors on the leukemic cells since characteristic ER stress responses, such as ATF4 and CHOP synthesis, XBP1 splicing, activation of MAP kinases and eventually apoptosis were efficiently abrogated by the translational inhibitor cycloheximide.Although PP1

  15. Geometrically and conformationally restrained cinnamoyl compounds as inhibitors of HIV-1 integrase: synthesis, biological evaluation, and molecular modeling.

    Science.gov (United States)

    Artico, M; Di Santo, R; Costi, R; Novellino, E; Greco, G; Massa, S; Tramontano, E; Marongiu, M E; De Montis, A; La Colla, P

    1998-10-08

    Various cinnammoyl-based structures were synthesized and tested in enzyme assays as inhibitors of the HIV-1 integrase (IN). The majority of compounds were designed as geometrically or conformationally constrained analogues of caffeic acid phenethyl ester (CAPE) and were characterized by a syn disposition of the carbonyl group with respect to the vinylic double bond. Since the cinnamoyl moiety present in flavones such as quercetin (inactive on HIV-1-infected cells) is frozen in an anti arrangement, it was hoped that fixing our compounds in a syn disposition could favor anti-HIV-1 activity in cell-based assays. Geometrical and conformational properties of the designed compounds were taken into account through analysis of X-ray structures available from the Cambridge Structural Database. The polyhydroxylated analogues were prepared by reacting 3,4-bis(tetrahydropyran-2-yloxy)benzaldehyde with various compounds having active methylene groups such as 2-propanone, cyclopentanone, cyclohexanone, 1,3-diacetylbenzene, 2, 4-dihydroxyacetophenone, 2,3-dihydro-1-indanone, 2,3-dihydro-1, 3-indandione, and others. While active against both 3'-processing and strand-transfer reactions, the new compounds, curcumin included, failed to inhibit the HIV-1 multiplication in acutely infected MT-4 cells. Nevertheless, they specifically inhibited the enzymatic reactions associated with IN, being totally inactive against other viral (HIV-1 reverse transcriptase) and cellular (RNA polymerase II) nucleic acid-processing enzymes. On the other hand, title compounds were endowed with remarkable antiproliferative activity, whose potency correlated neither with the presence of catechols (possible source of reactive quinones) nor with inhibition of topoisomerases. The SARs developed for our compounds led to novel findings concerning the molecular determinants of IN inhibitory activity within the class of cinnamoyl-based structures. We hypothesize that these compounds bind to IN featuring the

  16. Structural Characterization of LRRK2 Inhibitors

    NARCIS (Netherlands)

    Gilsbach, Bernd K; Messias, Ana C; Ito, Genta; Sattler, Michael; Alessi, Dario R; Wittinghofer, Alfred; Kortholt, Arjan

    2015-01-01

    Kinase inhibition is considered to be an important therapeutic target for LRRK2 mediated Parkinson's disease (PD). Many LRRK2 kinase inhibitors have been reported but have yet to be optimized in order to qualify as drug candidates for the treatment of the disease. In order to start a

  17. Rational Design of Rho Protein Inhibitors

    National Research Council Canada - National Science Library

    Rojas, Rafael J

    2006-01-01

    ... nucleotide exchange factors (RhoGEFs). We have developed a high throughput screening strategy identify novel inhibitors of Rho activation are currently following up on several compounds which appear to selectively inhibit Rho activation. These compounds may form the basis of future drug development strategies for the treatment of metastatic breast cancer.

  18. Rational Design of Rho Protein Inhibitors

    National Research Council Canada - National Science Library

    Rojas, Rafael J

    2005-01-01

    ... nucleotide exchange factors (RhoGEFs). We have developed a high throughput screening strategy identify novel inhibitors of Rho activation are currently following up on several compounds which appear to selectively inhibit Rho activation. These compounds may form the basis of future drug development strategies for the treatment of metastatic breast cancer.

  19. [Mechanisms and efficacy of SGLT2 inhibitors].

    Science.gov (United States)

    Shiba, Teruo

    2015-03-01

    SGLT2 is a low affinity, high capacity glucose co-transporter, almost exclusively expressed in the kidney cortex. Inhibition of SGLT2 has been shown to increase the daily 50g or more urinary glucose excretion, as compared to placebo, leading to a reduction in blood glucose levels and indicated only for the treatment of type 2 diabetes. In Japan 6 species of SGLT2 inhibitors have already been sold and reported to results in a decrease of FPG by 14.4 to 45.8 (mg/dL), in a reduction of HbA1c by 0.35 to 1.24% and in loss of body weight by 1.29 to 2.50(kg). There is less effect of the SGLT2 inhibitor in diabetic subjects with renal impairment and the reduction in HbA1c and FPG will be approximately half of the average in those with 30 ≤ eGFR ≤ 59. The position of SGLT2 inhibitors would be considered as the drug administered in combination or add-on therapy when the young obese type 2 diabetics without renal impairment has not yet reached to the glycemic target with other drugs although in AACE consensus statement of 2013, it has been shelved for inexperienced use with respect to the positioning of the SGLT2 inhibitors.

  20. Th17 Inhibitors in Active Psoriatic Arthritis

    DEFF Research Database (Denmark)

    Naik, Girish S; Ming, Wai K; Magodoro, Itai M

    2018-01-01

    BACKGROUND: Several biologics targeting the Th17 pathway have been developed for the treatment of psoriatic arthritis (PsA), a disabling disease with moderate response and an increased incidence of serious infections to first-line biologics (TNF-α antagonists). Th17 inhibitors could replace TNF-α...

  1. Vildagliptin: the first innovative DDP-4 inhibitor

    Directory of Open Access Journals (Sweden)

    Edvin Villkhauer

    2010-09-01

    Full Text Available A review of the main stages of investigation undertaken by Novartis Pharmaceuticals in search of a new molecule for the treatment of type 2 diabetesmellitus, dipeptidyl peptidase-4 (DPP-4 inhibitor (Vildaglyptin. The data on specificity and selectivity of the action of this molecule are presentedalong with the results of its comparison with another agent of this group (sitagliptin.

  2. Curcumin derivatives as HIV-1 protease inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R. [Univ. of California, San Francisco, CA (United States)

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  3. Dissolution properties of cerium dibutylphosphate corrosion inhibitors

    NARCIS (Netherlands)

    Soestbergen, van M.; Erich, S.J.F.; Huinink, H.P.; Adan, O.C.G.

    2013-01-01

    The corrosion inhibitor cerium dibutylphosphate, Ce(dbp)3, prevents corrosion by cerium and dbp deposition at the alkaline cathode and acidic anode respectively. The pH dependent Ce(dbp)3 solubility seems to play an essential role in the inhibition degree. We found that Ce(dbp)3 scarcely dissolves

  4. SEARCH OF NEW SYNTHETIC INHIBITORS OF TYROSINASE

    Directory of Open Access Journals (Sweden)

    Yu. Shesterenko

    2017-11-01

    Full Text Available Melanin pigmentation of skin plays the most important role in the protection of organism against UV-irradiation, but the excessive accumulation of melanin brings to toxic melanodermia, melasma, lentigo and other skin lesions. Tyrosinase is the key enzyme of skin melanin pigment biosynthesis. In spite of certain progress in investigation of natural and synthetic tyrosinase inhibitors, actuality of such studies is of a high level, because the existing inhibitors are in some cases unstable, expensive, toxic, requires complex methods of synthesis or isolation from natural sources. The aim of the work is screening of new tyrosinase inhibitors, using the enzyme, isolated from Agaricus bisporus. Tyrosinase was isolated from Agaricus bisporus mushrooms by a modified method. It was found, that the introduction of polyethylene glycol 4000 in the extraction process promotes 3-fold reduction of polyphenol content, which leads to increase purity of enzyme with an increase in its activity by 25%. A search for new tyrosinase inhibitors among a wide range of compounds, including derivatives of 3-chloro-1,4-naphthoquinone, isatin, 3-hydroxy-2-naphthoic acid, etc was conducted. The studied substances did not displayed inhibitory effect at concentration of 0,1-0,5 mmol/dm3.

  5. Peptide aldehyde inhibitors of bacterial peptide deformylases.

    Science.gov (United States)

    Durand, D J; Gordon Green, B; O'Connell, J F; Grant, S K

    1999-07-15

    Bacterial peptide deformylases (PDF, EC 3.5.1.27) are metalloenzymes that cleave the N-formyl groups from N-blocked methionine polypeptides. Peptide aldehydes containing a methional or norleucinal inhibited recombinant peptide deformylase from gram-negative Escherichia coli and gram-positive Bacillus subtilis. The most potent inhibitor was calpeptin, N-CBZ-Leu-norleucinal, which was a competitive inhibitor of the zinc-containing metalloenzymes, E. coli and B. subtilis PDF with Ki values of 26.0 and 55.6 microM, respectively. Cobalt-substituted E. coli and B. subtilis deformylases were also inhibited by these aldehydes with Ki values for calpeptin of 9.5 and 12.4 microM, respectively. Distinct spectral changes were observed upon binding of calpeptin to the Co(II)-deformylases, consistent with the noncovalent binding of the inhibitor rather than the formation of a covalent complex. In contrast, the chelator 1,10-phenanthroline caused the time-dependent inhibition of B. subtilis Co(II)-PDF activity with the loss of the active site metal. The fact that calpeptin was nearly equipotent against deformylases from both gram-negative and gram-positive bacterial sources lends further support to the idea that a single deformylase inhibitor might have broad-spectrum antibacterial activity. Copyright 1999 Academic Press.

  6. Immune checkpoint inhibitors for metastatic bladder cancer.

    Science.gov (United States)

    Massari, Francesco; Di Nunno, Vincenzo; Cubelli, Marta; Santoni, Matteo; Fiorentino, Michelangelo; Montironi, Rodolfo; Cheng, Liang; Lopez-Beltran, Anto; Battelli, Nicola; Ardizzoni, Andrea

    2018-03-01

    Chemotherapy has represented the standard therapy for unresectable or metastatic urothelial carcinoma for more than 20 years. The growing knowledge of the interaction between tumour and immune system has led to the advent of new classes of drugs, the immune-checkpoints inhibitors, which are intended to change the current scenario. To date, immunotherapy is able to improve the overall responses and survival. Moreover, thanks to its safety profile immune-checkpoint inhibitors could be proposed also to patients unfit for standard chemotherapy. No doubts that these agents have started a revolution expected for years, but despite this encouraging results it appears clear that not all subjects respond to these agents and requiring the development of reliable predictive response factors able to isolate patients who can more benefit from these treatments as well as new strategies aimed to improve immunotherapy clinical outcome. In this review we describe the active or ongoing clinical trials involving Programmed Death Ligand 1 (PD-L1), Programmed Death receptor 1 (PD-1) and Cytotoxic-T Lymphocyte Antigen 4 (CTLA 4) inhibitors in urothelial carcinoma focusing our attention on the developing new immune-agents and combination strategies with immune-checkpoint inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Current and Novel Inhibitors of HIV Protease

    Czech Academy of Sciences Publication Activity Database

    Pokorná, Jana; Machala, L.; Řezáčová, Pavlína; Konvalinka, Jan

    2009-01-01

    Roč. 1, č. 3 (2009), s. 1209-1239 ISSN 1999-4915 R&D Projects: GA MŠk 1M0508 Grant - others:GA AV ČR(CZ) IAAX00320901 Program:IA Institutional research plan: CEZ:AV0Z40550506 Keywords : HIV protease * protease inhibitor * HAART Subject RIV: CE - Biochemistry

  8. Proton pump inhibitors affect the gut microbiome

    NARCIS (Netherlands)

    Imhann, Floris; Bonder, Marc Jan; Vich Vila, Arnau; Fu, Jingyuan; Mujagic, Zlatan; Vork, Lisa; Feenstra, Ettje T.; Jankipersadsing, Soesma A; Cenit, Maria Carmen; Harmsen, Hermie J M; Dijkstra, Gerard; Franke, Lude; Xavier, Ramnik J; Jonkers, Daisy; Wijmenga, Cisca; Weersma, Rinse K; Zhernakova, Alexandra

    BACKGROUND AND AIMS: Proton pump inhibitors (PPIs) are among the top 10 most widely used drugs in the world. PPI use has been associated with an increased risk of enteric infections, most notably Clostridium difficile. The gut microbiome plays an important role in enteric infections, by resisting or

  9. Pharmacological caspase inhibitors: Research towards therapeutic perspectives

    Czech Academy of Sciences Publication Activity Database

    Kudělová, J.; Fleischmannová, J.; Adamová, E.; Matalová, Eva

    2015-01-01

    Roč. 66, č. 4 (2015), s. 473-482 ISSN 0867-5910 R&D Projects: GA ČR(CZ) GA14-28254S Institutional support: RVO:68081715 Keywords : caspase * caspase inhibitor * apoptosis Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.804, year: 2015

  10. Pharmacological caspase inhibitors: Research towards therapeutic perspectives

    Czech Academy of Sciences Publication Activity Database

    Kudělová, J.; Fleischmannová, Jana; Adamová, Eva; Matalová, Eva

    2015-01-01

    Roč. 66, č. 4 (2015), s. 473-482 ISSN 0867-5910 R&D Projects: GA ČR GB14-37368G Institutional support: RVO:67985904 Keywords : caspase * caspase inhibitor * apoptosis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.804, year: 2015

  11. Discovery of inhibitors of bacterial histidine kinases

    NARCIS (Netherlands)

    Velikova, N.R.

    2014-01-01

    Discovery of Inhibitors of Bacterial Histidine Kinases Summary

    The thesis is on novel antibacterial drug discovery (http://youtu.be/NRMWOGgeysM). Using structure-based and fragment-based drug discovery approach, we have identified small-molecule histidine-kinase

  12. Novel peptide-based protease inhibitors

    DEFF Research Database (Denmark)

    Roodbeen, Renée

    of novel peptide-based protease inhibitors, efforts were made towards improved methods for peptide synthesis. The coupling of Fmoc-amino acids onto N-methylated peptidyl resins was investigated. These couplings can be low yielding and the effect of the use of microwave heating combined with the coupling...

  13. Oestrogen, testosterone, cytotoxin and cholinesterase inhibitor ...

    African Journals Online (AJOL)

    Oestrogen, testosterone, cytotoxin and cholinesterase inhibitor removal during reclamation of sewage to drinking water. ... Risks associated with sewage effluent and reclaimed sewage should be closely monitored; therefore water at the Gammams Sewage Treatment Plant (GSTP) inlet and outlet, as well as reclaimed water ...

  14. Dry eye syndrome in aromatase inhibitor users.

    Science.gov (United States)

    Turaka, Kiran; Nottage, Jennifer M; Hammersmith, Kristin M; Nagra, Parveen K; Rapuano, Christopher J

    2013-04-01

    Aromatase inhibitors are frequently used as an adjuvant therapy in the treatment of breast cancer. We observed that several patients taking aromatase inhibitors presented with severe dry eye symptoms, and we investigated whether there is a relationship between aromatase inhibitors and dry eyes in these patients. Retrospective chart review. Forty-one women. A computerized search of health records was performed to identify patients using anastrazole, letrozole and exemestane seen by the Cornea Service from August 2008 to March 2011. The results were compared with age-matched controls. Ocular surface changes among aromatase inhibitors users. Of the 41 women, 39 were Caucasians. Thirty-nine patients had breast cancer (95%), one patient had ovarian cancer (2.5%) and one had an unknown primary cancer. Mean age was 68 ± 11.3 years (range 47-95). Most common presenting symptoms were blurred vision in 28 (68%) patients, irritation/foreign body sensation in 12 (29%) patients, redness in 9 (22%) patients, tearing in 6 (22%) patients and photosensitivity in 2 (5%) patients. Mean Schirmer's test measurement was 11 ± 5.8 mm (range 0.5-20 mm). Blepharitis was noted in 68 of 82 eyes (73%), decreased or poor tear function in 24 eyes (29%), conjunctival injection in 18 eyes (22%) and superficial punctate keratitis in 12 eyes (29%). Among an age-matched population (45-95 years), dry eye syndrome was found in only 9.5% of patients. Because the prevalence of ocular surface disease signs and symptoms appears to be higher in study group than control patients, aromatase inhibitors might be a contributing factor to the dry eye symptoms. © 2012 The Authors. Clinical and Experimental Ophthalmology © 2012 Royal Australian and New Zealand College of Ophthalmologists.

  15. RENAL SAFETY OF PROTON PUMP INHIBITORS

    Directory of Open Access Journals (Sweden)

    A. I. Dyadyk

    2017-01-01

    Full Text Available Proton pump inhibitors are a widely used in clinical practice, and are taken by millions of patients around the world for a long time. While proton pump inhibitors are well-tolerated class of drugs, the number of publications has been raised about adverse renal effects, specially their association with acute tubulointerstitial nephritis. It is one of the leading causes of acute renal injury and have catastrophic long-term consequences called chronic kidney disease. In this review, we consider epidemiology, pathogenesis, diagnostic criteria (including biopsy and morphological pattern, clinical manifestations and treatment of proton pump inhibitors-induced acute tubulointerstitial nephritis. A subclinical course without classical manifestations of a cell-mediated hypersensitivity reaction (fever, skin rash, eosinophilia, arthralgia is characteristic of acute tubulointerstitial nephritis. Increased serum creatinine, decreased glomerular filtration rate, electrolyte disorders, pathological changes in urine tests are not highly specific indicators, but allow to suspect the development of acute tubulointerstitial nephritis. The “gold” standard of diagnosis is the intravital morphological examination of the kidney tissue. Timely diagnosis and immediate discontinuation of the potentially causative drug is the mainstay of therapy and the first necessary step in the early management of suspected or biopsy-proven drug-induced acute tubulointerstitial nephritis. The usage of proton pump inhibitors should be performed only on strict indications with optimal duration of treatment and careful monitoring of kidney function. Multiple comorbidities (older age, heart failure, diabetes, cirrhosis, chronic kidney disease, hypovolemia increase potential nephrotoxicity. Awareness of this iatrogenic complication will improve diagnosis of proton pump inhibitors-induced acute tubulointerstitial nephritis by multidisciplinary specialists and increase the possibility

  16. Cost of care of haemophilia with inhibitors.

    Science.gov (United States)

    Di Minno, M N D; Di Minno, G; Di Capua, M; Cerbone, A M; Coppola, A

    2010-01-01

    In Western countries, the treatment of patients with inhibitors is presently the most challenging and serious issue in haemophilia management, direct costs of clotting factor concentrates accounting for >98% of the highest economic burden absorbed for the healthcare of patients in this setting. Being designed to address questions of resource allocation and effectiveness, decision models are the golden standard to reliably assess the overall economic implications of haemophilia with inhibitors in terms of mortality, bleeding-related morbidity, and severity of arthropathy. However, presently, most data analyses stem from retrospective short-term evaluations, that only allow for the analysis of direct health costs. In the setting of chronic diseases, the cost-utility analysis, that takes into account the beneficial effects of a given treatment/healthcare intervention in terms of health-related quality of life, is likely to be the most appropriate approach. To calculate net benefits, the quality adjusted life year, that significantly reflects such health gain, has to be compared with specific economic impacts. Differences in data sources, in medical practice and/or in healthcare systems and costs, imply that most current pharmacoeconomic analyses are confined to a narrow healthcare payer perspective. Long-term/lifetime prospective or observational studies, devoted to a careful definition of when to start a treatment; of regimens (dose and type of product) to employ, and of inhibitor population (children/adults, low-responding/high responding inhibitors) to study, are thus urgently needed to allow for newer insights, based on reliable data sources into resource allocation, effectiveness and cost-utility analysis in the treatment of haemophiliacs with inhibitors.

  17. ROS inhibitor N-acetyl-L-cysteine antagonizes the activity of proteasome inhibitors.

    Science.gov (United States)

    Halasi, Marianna; Wang, Ming; Chavan, Tanmay S; Gaponenko, Vadim; Hay, Nissim; Gartel, Andrei L

    2013-09-01

    NAC (N-acetyl-L-cysteine) is commonly used to identify and test ROS (reactive oxygen species) inducers, and to inhibit ROS. In the present study, we identified inhibition of proteasome inhibitors as a novel activity of NAC. Both NAC and catalase, another known scavenger of ROS, similarly inhibited ROS levels and apoptosis associated with H₂O₂. However, only NAC, and not catalase or another ROS scavenger Trolox, was able to prevent effects linked to proteasome inhibition, such as protein stabilization, apoptosis and accumulation of ubiquitin conjugates. These observations suggest that NAC has a dual activity as an inhibitor of ROS and proteasome inhibitors. Recently, NAC was used as a ROS inhibitor to functionally characterize a novel anticancer compound, piperlongumine, leading to its description as a ROS inducer. In contrast, our own experiments showed that this compound depicts features of proteasome inhibitors including suppression of FOXM1 (Forkhead box protein M1), stabilization of cellular proteins, induction of ROS-independent apoptosis and enhanced accumulation of ubiquitin conjugates. In addition, NAC, but not catalase or Trolox, interfered with the activity of piperlongumine, further supporting that piperlongumine is a proteasome inhibitor. Most importantly, we showed that NAC, but not other ROS scavengers, directly binds to proteasome inhibitors. To our knowledge, NAC is the first known compound that directly interacts with and antagonizes the activity of proteasome inhibitors. Taken together, the findings of the present study suggest that, as a result of the dual nature of NAC, data interpretation might not be straightforward when NAC is utilized as an antioxidant to demonstrate ROS involvement in drug-induced apoptosis.

  18. Cytogenetic study of Ascaris trypsin inhibitor in cultured human ...

    Indian Academy of Sciences (India)

    2009-04-01

    Apr 1, 2009 ... Although the physical and chemical properties of Ascaris trypsin inhibitors ... male of Ascaris suum according to the method of Pudles and. Rola (1967). ..... inhibitor isolated from Ascaris resulted in the appearance of dominant ...

  19. SGLT2 inhibitors: molecular design and potential differences in effect.

    Science.gov (United States)

    Isaji, Masayuki

    2011-03-01

    The physiological and pathological handling of glucose via sodium-glucose cotransporter-2 (SGLT2) in the kidneys has been evolving, and SGLT2 inhibitors have been focused upon as a novel drug for treating diabetes. SGLT2 inhibitors enhance renal glucose excretion by inhibiting renal glucose reabsorption. Consequently, SGLT2 inhibitors reduce plasma glucose insulin independently and improve insulin resistance in diabetes. To date, various SGLT2 inhibitors have been developed and evaluated in clinical studies. The potency and positioning of SGLT2 inhibitors as an antidiabetic drug are dependent on their characteristic profile, which induces selectivity, efficacy, pharmacokinetics, and safety. This profile decides which SGLT2 inhibitors can be expected for application of the theoretical concept of reducing renal glucose reabsorption for the treatment of diabetes. I review the structure and advancing profile of various SGLT2 inhibitors, comparing their similarities and differences, and discuss the expected SGLT2 inhibitors for an emerging category of antidiabetic drugs.

  20. Environmental life cycle analysis of potato sprout inhibitors

    NARCIS (Netherlands)

    Kerstholt, R.P.V.; Ree, C.M.; Moll, H.C.

    Potato sprout inhibitors are generally applied to suppress sprouting during winter storage. This study presents the compared environmental profiles of the two sprout inhibitors available on the Dutch market: A traditional chemical product with isopropyl-3-chlorophenylcarbamate (CIPC) and

  1. [Inhibitors of proteolytic enzymes under abiotic stresses in plants (review)].

    Science.gov (United States)

    Mosolov, V V; Valueva, T A

    2011-01-01

    Data on the role of proteolytic enzyme inhibitors in plant adaptation to various unfavorable environmental abiotic factors--water deficiency, salinization of soil, extreme temperatures, etc.--and also probable functions of proteinases inhibitors in natural plant senescense are considered.

  2. Cellular growth kinetics distinguish a cyclophilin inhibitor from an HSP90 inhibitor as a selective inhibitor of hepatitis C virus.

    Directory of Open Access Journals (Sweden)

    Rudolf K F Beran

    Full Text Available During antiviral drug discovery, it is critical to distinguish molecules that selectively interrupt viral replication from those that reduce virus replication by adversely affecting host cell viability. In this report we investigate the selectivity of inhibitors of the host chaperone proteins cyclophilin A (CypA and heat-shock protein 90 (HSP90 which have each been reported to inhibit replication of hepatitis C virus (HCV. By comparing the toxicity of the HSP90 inhibitor, 17-(Allylamino-17-demethoxygeldanamycin (17-AAG to two known cytostatic compounds, colchicine and gemcitabine, we provide evidence that 17-AAG exerts its antiviral effects indirectly through slowing cell growth. In contrast, a cyclophilin inhibitor, cyclosporin A (CsA, exhibited selective antiviral activity without slowing cell proliferation. Furthermore, we observed that 17-AAG had little antiviral effect in a non-dividing cell-culture model of HCV replication, while CsA reduced HCV titer by more than two orders of magnitude in the same model. The assays we describe here are useful for discriminating selective antivirals from compounds that indirectly affect virus replication by reducing host cell viability or slowing cell growth.

  3. 6-(1-Benzyl-1H-pyrrol-2-yl)-2,4-dioxo-5-hexenoic acids as dual inhibitors of recombinant HIV-1 integrase and ribonuclease H, synthesized by a parallel synthesis approach.

    Science.gov (United States)

    Costi, Roberta; Métifiot, Mathieu; Esposito, Francesca; Cuzzucoli Crucitti, Giuliana; Pescatori, Luca; Messore, Antonella; Scipione, Luigi; Tortorella, Silvano; Zinzula, Luca; Novellino, Ettore; Pommier, Yves; Tramontano, Enzo; Marchand, Christophe; Di Santo, Roberto

    2013-11-14

    The increasing efficiency of HAART has helped to transform HIV/AIDS into a chronic disease. Still, resistance and drug-drug interactions warrant the development of new anti-HIV agents. We previously discovered hit 6, active against HIV-1 replication and targeting RNase H in vitro. Because of its diketo-acid moiety, we speculated that this chemotype could serve to develop dual inhibitors of both RNase H and integrase. Here, we describe a new series of 1-benzyl-pyrrolyl diketohexenoic derivatives, 7a-y and 8a-y, synthesized following a parallel solution-phase approach. Those 50 analogues have been tested on recombinant enzymes (RNase H and integrase) and in cell-based assays. Approximately half (22) exibited inhibition of HIV replication. Compounds 7b, 7u, and 8g were the most active against the RNase H activity of reverse-transcriptase, with IC50 values of 3, 3, and 2.5 μM, respectively. Compound 8g was also the most potent integrase inhibitor with an IC50 value of 26 nM.

  4. SGLT2 Inhibitors: Benefit/Risk Balance.

    Science.gov (United States)

    Scheen, André J

    2016-10-01

    Inhibitors of sodium-glucose cotransporters type 2 (SGLT2) reduce hyperglycemia by increasing urinary glucose excretion. They have been evaluated in patients with type 2 diabetes treated with diet/exercise, metformin, dual oral therapy or insulin. Three agents are available in Europe and the USA (canagliflozin, dapagliflozin, empagliflozin) and others are commercialized in Japan or in clinical development. SGLT2 inhibitors reduce glycated hemoglobin, with a minimal risk of hypoglycemia. They exert favorable effects beyond glucose control with consistent body weight, blood pressure, and serum uric acid reductions. Empagliflozin showed remarkable reductions in cardiovascular/all-cause mortality and in hospitalization for heart failure in patients with previous cardiovascular disease. Positive renal outcomes were also shown with empagliflozin. Mostly reported adverse events are genital mycotic infections, while urinary tract infections and events linked to volume depletion are rather rare. Concern about a risk of ketoacidosis and bone fractures has been recently raised, which deserves caution and further evaluation.

  5. Serine protease inhibitors of parasitic helminths.

    Science.gov (United States)

    Molehin, Adebayo J; Gobert, Geoffrey N; McManus, Donald P

    2012-05-01

    Serine protease inhibitors (serpins) are a superfamily of structurally conserved proteins that inhibit serine proteases and play key physiological roles in numerous biological systems such as blood coagulation, complement activation and inflammation. A number of serpins have now been identified in parasitic helminths with putative involvement in immune regulation and in parasite survival through interference with the host immune response. This review describes the serpins and smapins (small serine protease inhibitors) that have been identified in Ascaris spp., Brugia malayi, Ancylostoma caninum Onchocerca volvulus, Haemonchus contortus, Trichinella spiralis, Trichostrongylus vitrinus, Anisakis simplex, Trichuris suis, Schistosoma spp., Clonorchis sinensis, Paragonimus westermani and Echinococcus spp. and discusses their possible biological functions, including roles in host-parasite interplay and their evolutionary relationships.

  6. Secreted and Transmembrane Wnt Inhibitors and Activators

    Science.gov (United States)

    Cruciat, Cristina-Maria; Niehrs, Christof

    2013-01-01

    Signaling by the Wnt family of secreted glycoproteins plays important roles in embryonic development and adult homeostasis. Wnt signaling is modulated by a number of evolutionarily conserved inhibitors and activators. Wnt inhibitors belong to small protein families, including sFRP, Dkk, WIF, Wise/SOST, Cerberus, IGFBP, Shisa, Waif1, APCDD1, and Tiki1. Their common feature is to antagonize Wnt signaling by preventing ligand–receptor interactions or Wnt receptor maturation. Conversely, the Wnt activators, R-spondin and Norrin, promote Wnt signaling by binding to Wnt receptors or releasing a Wnt-inhibitory step. With few exceptions, these antagonists and agonists are not pure Wnt modulators, but also affect additional signaling pathways, such as TGF-β and FGF signaling. Here we discuss their interactions with Wnt ligands and Wnt receptors, their role in developmental processes, as well as their implication in disease. PMID:23085770

  7. Raltegravir: first in class HIV integrase inhibitor

    Directory of Open Access Journals (Sweden)

    Zelalem Temesgen

    2008-06-01

    Full Text Available Zelalem Temesgen1, Dawd S Siraj21Mayo Clinic, Rochester, MN, USA; 2East Carolina University Greenville, NC, USAAbstract: On October 16, 2007, the US Food and Drug Administration (FDA approved raltegravir for treatment of human immunodeficiency virus (HIV-1 infection in combination with other antiretroviral agents in treatment-experienced adult patients who have evidence of viral replication and HIV-1 strains resistant to multiple antiretroviral agents. Raltegravir is first in a novel class of antiretroviral drugs known as integrase inhibitors. It has demonstrated potent anti HIV activity in both antiretroviral treatment-naïve and experienced patients. The most common adverse events reported with raltegravir during phase 2 and 3 clinical trials were diarrhea, nausea, and headache. Laboratory abnormalities include mild elevations in liver transaminases and creatine phosphokinase.Keywords: raltegravir, HIV, antiretroviral agents, integrase inhibitors

  8. Small molecule inhibitors of anthrax edema factor.

    Science.gov (United States)

    Jiao, Guan-Sheng; Kim, Seongjin; Moayeri, Mahtab; Thai, April; Cregar-Hernandez, Lynne; McKasson, Linda; O'Malley, Sean; Leppla, Stephen H; Johnson, Alan T

    2018-01-15

    Anthrax is a highly lethal disease caused by the Gram-(+) bacteria Bacillus anthracis. Edema toxin (ET) is a major contributor to the pathogenesis of disease in humans exposed to B. anthracis. ET is a bipartite toxin composed of two proteins secreted by the vegetative bacteria, edema factor (EF) and protective antigen (PA). Our work towards identifying a small molecule inhibitor of anthrax edema factor is the subject of this letter. First we demonstrate that the small molecule probe 5'-Fluorosulfonylbenzoyl 5'-adenosine (FSBA) reacts irreversibly with EF and blocks enzymatic activity. We then show that the adenosine portion of FSBA can be replaced to provide more drug-like molecules which are up to 1000-fold more potent against EF relative to FSBA, display low cross reactivity when tested against a panel of kinases, and are nanomolar inhibitors of EF in a cell-based assay of cAMP production. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Novel nonpeptidic inhibitors of peptide deformylase.

    Science.gov (United States)

    Jayasekera, M M; Kendall, A; Shammas, R; Dermyer, M; Tomala, M; Shapiro, M A; Holler, T P

    2000-09-15

    A novel series of nonpeptidic compounds structurally related to the known anticholesteremic thyropropic acid were found to inhibit Escherichia coli peptide deformylase (PDF), with IC50 values in the low-micromolar range. Kinetic analysis of [4-(4-hydroxyphenoxy)-3,5-diiodophenyl]acetic acid reveals competitive inhibition, with a Ki value of 0.66 +/- 0.007 microM. A structure-activity relationship study demonstrates that the carboxylate is required for activity, while the distal phenolic function can be methylated without significant effect. Either decreasing the number of iodine atoms on the molecule to one or increasing the number of iodine atoms to four results in the loss of an order of magnitude in potency. These compounds are the first nonpeptidic inhibitors disclosed and represent a template from which better inhibitors might be designed.

  10. Potent peptidic fusion inhibitors of influenza virus

    Energy Technology Data Exchange (ETDEWEB)

    Kadam, Rameshwar U.; Juraszek, Jarek; Brandenburg, Boerries; Buyck, Christophe; Schepens, Wim B. G.; Kesteleyn, Bart; Stoops, Bart; Vreeken, Rob J.; Vermond, Jan; Goutier, Wouter; Tang, Chan; Vogels, Ronald; Friesen, Robert H. E.; Goudsmit, Jaap; van Dongen, Maria J. P.; Wilson, Ian A.

    2017-09-28

    Influenza therapeutics with new targets and mechanisms of action are urgently needed to combat potential pandemics, emerging viruses, and constantly mutating strains in circulation. We report here on the design and structural characterization of potent peptidic inhibitors of influenza hemagglutinin. The peptide design was based on complementarity-determining region loops of human broadly neutralizing antibodies against the hemagglutinin (FI6v3 and CR9114). The optimized peptides exhibit nanomolar affinity and neutralization against influenza A group 1 viruses, including the 2009 H1N1 pandemic and avian H5N1 strains. The peptide inhibitors bind to the highly conserved stem epitope and block the low pH–induced conformational rearrangements associated with membrane fusion. These peptidic compounds and their advantageous biological properties should accelerate the development of new small molecule– and peptide-based therapeutics against influenza virus.

  11. Corrosion protection with eco-friendly inhibitors

    Science.gov (United States)

    Shahid, Muhammad

    2011-12-01

    Corrosion occurs as a result of the interaction of a metal with its environment. The extent of corrosion depends on the type of metal, the existing conditions in the environment and the type of aggressive ions present in the medium. For example, CO3-2 and NO-3 produce an insoluble deposit on the surface of iron, resulting in the isolation of metal and consequent decrease of corrosion. On the other hand, halide ions are adsorbed selectively on the metal surface and prevent formation of the oxide phase on the metal surface, resulting in continuous corrosion. Iron, aluminum and their alloys are widely used, both domestically and industrially. Linear alkylbenzene and linear alkylbenzene sulfonate are commonly used as detergents. They have also been found together in waste water. It is claimed that these chemicals act as inhibitors for stainless steel and aluminum. Release of toxic gases as a result of corrosion in pipelines may lead in certain cases to air pollution and possible health hazards. Therefore, there are two ways to look at the relationship between corrosion and pollution: (i) corrosion of metals and alloys due to environmental pollution and (ii) environmental pollution as a result of corrosion protection. This paper encompasses the two scenarios and possible remedies for various cases, using 'green' inhibitors obtained either from plant extracts or from pharmaceutical compounds. In the present study, the effect of piperacillin sodium as a corrosion inhibitor for mild steel was investigated using a weight-loss method as well as a three-electrode dc electrochemical technique. It was found that the corrosion rate decreased as the concentration of the inhibitor increased up to 9×10-4 M 93% efficiency was exhibited at this concentration.

  12. Acrosin inhibitor detecting along the boar epididymis

    Czech Academy of Sciences Publication Activity Database

    Maňásková-Postlerová, Pavla; Cozlová, Nina; Dorosh, Andriy; Šulc, Miroslav; Guyonet, B.; Jonáková, Věra

    2016-01-01

    Roč. 82, Jan 2016 (2016), s. 733-739 ISSN 0141-8130 R&D Projects: GA ČR(CZ) GAP503/12/1834; GA MŠk(CZ) ED1.1.00/02.0109; GA ČR GA14-05547S Institutional support: RVO:86652036 ; RVO:61388971 Keywords : Acrosin inhibitor * Boar epididymis * Spermatozoa Subject RIV: CE - Biochemistry Impact factor: 3.671, year: 2016

  13. Cyclooxygenase-2 inhibitors and knee prosthesis surgery

    OpenAIRE

    Meunier, Andreas

    2008-01-01

    Adverse effects of cyclooxygenase (COX) inhibitors on bone healing have previously been demonstrated in diaphyseal fracture models in animals. In spite of that, they are widely used as postoperative analgesics in orthopaedic surgery. After joint replacement, a bone repair process starts at the interface between bone and cement. If this process is disturbed, the prosthesis may never become rigidly fixed to the bone, leading to migration and with time loosening. This thesis investigates the eff...

  14. Aurora kinase inhibitors: Progress towards the clinic

    Czech Academy of Sciences Publication Activity Database

    Kollareddy, M.; Zheleva, D.; Dzubak, P.; Brahmkshatriya, Pathik; Lepšík, Martin; Hajduch, M.

    2012-01-01

    Roč. 30, č. 6 (2012), s. 2411-2432 ISSN 0167-6997 Grant - others:GA ČR(CZ) GA301/08/1649; GA ČR(CZ) GD303/09/H048 Program:GA; GD Institutional research plan: CEZ:AV0Z40550506 Keywords : Aurora kinases * cancer * inhibitors Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.498, year: 2012

  15. GSK-3 inhibitors induce chromosome instability

    Directory of Open Access Journals (Sweden)

    Staples Oliver D

    2007-08-01

    Full Text Available Abstract Background Several mechanisms operate during mitosis to ensure accurate chromosome segregation. However, during tumour evolution these mechanisms go awry resulting in chromosome instability. While several lines of evidence suggest that mutations in adenomatous polyposis coli (APC may promote chromosome instability, at least in colon cancer, the underlying mechanisms remain unclear. Here, we turn our attention to GSK-3 – a protein kinase, which in concert with APC, targets β-catenin for proteolysis – and ask whether GSK-3 is required for accurate chromosome segregation. Results To probe the role of GSK-3 in mitosis, we inhibited GSK-3 kinase activity in cells using a panel of small molecule inhibitors, including SB-415286, AR-A014418, 1-Azakenpaullone and CHIR99021. Analysis of synchronised HeLa cells shows that GSK-3 inhibitors do not prevent G1/S progression or cell division. They do, however, significantly delay mitotic exit, largely because inhibitor-treated cells have difficulty aligning all their chromosomes. Although bipolar spindles form and the majority of chromosomes biorient, one or more chromosomes often remain mono-oriented near the spindle poles. Despite a prolonged mitotic delay, anaphase frequently initiates without the last chromosome aligning, resulting in chromosome non-disjunction. To rule out the possibility of "off-target" effects, we also used RNA interference to selectively repress GSK-3β. Cells deficient for GSK-3β exhibit a similar chromosome alignment defect, with chromosomes clustered near the spindle poles. GSK-3β repression also results in cells accumulating micronuclei, a hallmark of chromosome missegregation. Conclusion Thus, not only do our observations indicate a role for GSK-3 in accurate chromosome segregation, but they also raise the possibility that, if used as therapeutic agents, GSK-3 inhibitors may induce unwanted side effects by inducing chromosome instability.

  16. FAITH - Fast Assembly Inhibitor Test for HIV

    Czech Academy of Sciences Publication Activity Database

    Hadravová, Romana; Rumlová, Michaela; Ruml, T.

    2015-01-01

    Roč. 486, Dec (2015), s. 78-87 ISSN 0042-6822 R&D Projects: GA ČR(CZ) GA14-15326S; GA MŠk LO1302; GA MŠk(CZ) LO1304 Institutional support: RVO:61388963 Keywords : retrovirus * HIV * assembly * assay * inhibitor Subject RIV: EE - Microbiology, Virology Impact factor: 3.200, year: 2015 http://www.sciencedirect.com/science/article/pii/S0042682215003864

  17. Monoamine oxidase inhibitors from Gentiana lutea.

    Science.gov (United States)

    Haraguchi, Hiroyuki; Tanaka, Yasumasa; Kabbash, Amal; Fujioka, Toshihiro; Ishizu, Takashi; Yagi, Akira

    2004-08-01

    Three monoamine oxidase (MAO) inhibitors were isolated from Gentiana lutea. Their structures were elucidated to be 3-3''linked-(2'-hydroxy-4-O-isoprenylchalcone)-(2'''-hydroxy-4''-O-isoprenyldihydrochalcone) (1), 2-methoxy-3-(1,1'-dimethylallyl)-6a,10a-dihydrobenzo(1,2-c)chroman-6-one and 5-hydroxyflavanone. These compounds, and the hydrolysis product of 1, displayed competitive inhibitory properties against MAO-B which was more effective than MAO-A.

  18. Trial Watch: Proteasomal inhibitors for anticancer therapy.

    Science.gov (United States)

    Obrist, Florine; Manic, Gwenola; Kroemer, Guido; Vitale, Ilio; Galluzzi, Lorenzo

    2015-01-01

    The so-called "ubiquitin-proteasome system" (UPS) is a multicomponent molecular apparatus that catalyzes the covalent attachment of several copies of the small protein ubiquitin to other proteins that are generally (but not always) destined to proteasomal degradation. This enzymatic cascade is crucial for the maintenance of intracellular protein homeostasis (both in physiological conditions and in the course of adaptive stress responses), and regulates a wide array of signaling pathways. In line with this notion, defects in the UPS have been associated with aging as well as with several pathological conditions including cardiac, neurodegenerative, and neoplastic disorders. As transformed cells often experience a constant state of stress (as a result of the hyperactivation of oncogenic signaling pathways and/or adverse microenvironmental conditions), their survival and proliferation are highly dependent on the integrity of the UPS. This rationale has driven an intense wave of preclinical and clinical investigation culminating in 2003 with the approval of the proteasomal inhibitor bortezomib by the US Food and Drug Administration for use in multiple myeloma patients. Another proteasomal inhibitor, carfilzomib, is now licensed by international regulatory agencies for use in multiple myeloma patients, and the approved indications for bortezomib have been extended to mantle cell lymphoma. This said, the clinical activity of bortezomib and carfilzomib is often limited by off-target effects, innate/acquired resistance, and the absence of validated predictive biomarkers. Moreover, the antineoplastic activity of proteasome inhibitors against solid tumors is poor. In this Trial Watch we discuss the contribution of the UPS to oncogenesis and tumor progression and summarize the design and/or results of recent clinical studies evaluating the therapeutic profile of proteasome inhibitors in cancer patients.

  19. Adverse Effects of COX-2 Inhibitors

    Directory of Open Access Journals (Sweden)

    Jagdish N. Sharma

    2005-01-01

    Full Text Available Cyclooxygenase-2 selective inhibitors (COXIBs were developed with the prime object of minimizing gastrointestinal adverse effects, which are seen with the use of traditional nonsteroidal anti-inflammatory drugs (NSAIDs. Their long-term use is limited by the development of hypertension, edema, and congestive heart failure in a significant proportion of patients. NSAIDs block the activity of both COX isozymes, COX-1 and COX-2, which mediate the enzymatic conversion of arachidonate to prostaglandin H2 (PGH2 and other prostaglandin (PG metabolites. It is well established that the cardiovascular profile of COX-2 inhibitors can be accounted for by inhibition of COX-dependent PG synthesis. Following the COX-mediated synthesis of PGH2 from arachidonate, PGH2 is metabolized to one of at least five bioactive PGs, including PGE2, PGI2, PGF2, PGD2, or thromboxane A2 (TXA2. These prostanoids have pleiotropic cardiovascular effects, altering platelet function and renal function, and they are acting either as vasodilators or vasoconstrictors. Although COX-1 and COX-2 exhibit similar biochemical activity in converting arachidonate to PGH2in vitro, the ultimate prostanoids they produce in vivo may be different due to differential regulation of COX-1 and COX-2, tissue distribution, and availability of the prostanoid synthases. PGs have been established as being critically involved in mitigating hypertension, helping to maintain medullary blood flow (MBF, promoting urinary salt excretion, and preserving the normal homeostasis of thrombosis, and the researchers found that the use of COX-2 inhibitors caused many serious complications in altering the normal body homeostasis. The purpose of the present research is to explain briefly the side effects of COX-2 inhibitors on the renal and cardiovascular system.

  20. Rust Inhibitor And Fungicide For Cooling Systems

    Science.gov (United States)

    Adams, James F.; Greer, D. Clay

    1988-01-01

    Mixture of benzotriazole, benzoic acid, and fungicide prevents growth of rust and fungus. Water-based cooling mixture made from readily available materials prevents formation of metallic oxides and growth of fungi in metallic pipes. Coolant remains clear and does not develop thick sludge tending to collect in low points in cooling systems with many commercial rust inhibitors. Coolant compatible with iron, copper, aluminum, and stainless steel. Cannot be used with cadmium or cadmium-plated pipes.

  1. Luminometric method for screening retroviral protease inhibitors

    Czech Academy of Sciences Publication Activity Database

    Horáková, D.; Rumlová, Michaela; Pichová, Iva; Ruml, Tomáš

    2005-01-01

    Roč. 345, č. 1 (2005), s. 96-101 ISSN 0003-2697 R&D Projects: GA AV ČR(CZ) IAA4055304; GA MŠk(CZ) 1M0508; GA MŠk(CZ) 1M0520 Institutional research plan: CEZ:AV0Z40550506 Keywords : retroviral protease * inhibitors * luminescent assay Subject RIV: CE - Biochemistry Impact factor: 2.670, year: 2005

  2. Serine proteinases and their inhibitors in fertilization

    Czech Academy of Sciences Publication Activity Database

    Jonáková, Věra

    2000-01-01

    Roč. 3, 3,4 (2000), s. 23 [ Proteolytic enzymes and their inhibitors in physiology and pathogenesis. 14.09.2000, Plzen] R&D Projects: GA ČR GV524/96/K162; GA ČR GA303/99/0357; GA MŠk VS96141 Grant - others:GA UK(CZ) 12/1998 Institutional research plan: CEZ:AV0Z5052915 Subject RIV: EB - Genetics ; Molecular Biology

  3. In vitro and ex vivo evaluations on transdermal delivery of the HIV inhibitor IQP-0410.

    Directory of Open Access Journals (Sweden)

    Anthony S Ham

    Full Text Available The aim of this study was to investigate the physicochemical and in vitro/ex vivo characteristics of the pyrmidinedione IQP-0410 formulated into transdermal films. IQP-0410 is a potent therapeutic anti-HIV nonnucleoside reverse transcriptase inhibitor that would be subjected to extensive first pass metabolism, through conventional oral administration. Therefore, IQP-0410 was formulated into ethyl cellulose/HPMC-based transdermal films via solvent casting. In mano evaluations were performed to evaluate gross physical characteristics. In vitro release studies were performed in both Franz cells and USP-4 dissolution vessels. Ex vivo release and permeability assays were performed on human epidermal tissue models, and the permeated IQP-0410 was collected for in vitro HIV-1 efficacy assays in CEM-SS cells and PBMCs. Film formulation D3 resulted in pliable, strong transdermal films that were loaded with 2% (w/w IQP-0410. Composed of 60% (w/w ethyl cellulose and 20% (w/w HPMC, the films contained < 1.2% (w/w of water and were hygroscopic resulting in significant swelling under humid conditions. The water permeable nature of the film resulted in complete in vitro dissolution and drug release in 26 hours. When applied to ex vivo epidermal tissues, the films were non-toxic to the tissue and also were non-toxic to HIV target cells used in the in vitro efficacy assays. Over a 3 day application, the films delivered IQP-0410 through the skin tissue at a zero-order rate of 0.94 ± 0.06 µg/cm(2/hr with 134 ± 14.7 µM collected in the basal media. The delivered IQP-0410 resulted in in vitro EC50 values against HIV-1 of 2.56 ± 0.40 nM (CEM-SS and 0.58 ± 0.03 nM (PBMC. The film formulation demonstrated no significant deviation from target values when packaged in foil pouches under standard and accelerated environmental conditions. It was concluded that the transdermal film formulation was a potentially viable method of administering IQP-0410 that warrants

  4. Lack of integrase inhibitors associated resistance mutations among HIV-1C isolates.

    Science.gov (United States)

    Mulu, Andargachew; Maier, Melanie; Liebert, Uwe Gerd

    2015-12-01

    Although biochemical analysis of HIV-1 integrase enzyme suggested the use of integrase inhibitors (INIs) against HIV-1C, different viral subtypes may favor different mutational pathways potentially leading to varying levels of drug resistance. Thus, the aim of this study was to search for the occurrence and natural evolution of integrase polymorphisms and/or resistance mutations in HIV-1C Ethiopian clinical isolates prior to the introduction of INIs. Plasma samples from chronically infected drug naïve patients (N = 45), of whom the PR and RT sequence was determined previously, were used to generate population based sequences of HIV-1 integrase. HIV-1 subtype was determined using the REGA HIV-1 subtyping tool. Resistance mutations were interpreted according to the Stanford HIV drug resistance database ( http://hivdb.stanford.edu ) and the updated International Antiviral Society (IAS)-USA mutation lists. Moreover, rates of polymorphisms in the current isolates were compared with South African and global HIV-1C isolates. All subjects were infected with HIV-1C concordant to the protease (PR) and reverse transcriptase (RT) regions. Neither major resistance-associated IN mutations (T66I/A/K, E92Q/G, T97A, Y143HCR, S147G, Q148H/R/K, and N155H) nor silent mutations known to change the genetic barrier were observed. Moreover, the DDE-catalytic motif (D64G/D116G/E152 K) and signature HHCC zinc-binding motifs at codon 12, 16, 40 and 43 were found to be highly conserved. However, compared to other South African subtype C isolates, the rate of polymorphism was variable at various positions. Although the sample size is small, the findings suggest that this drug class could be effective in Ethiopia and other southern African countries where HIV-1C is predominantly circulating. The data will contribute to define the importance of integrase polymorphism and to improve resistance interpretation algorithms in HIV-1C isolates.

  5. Modelling of potentially promising SARS protease inhibitors

    International Nuclear Information System (INIS)

    Plewczynski, Dariusz; Hoffmann, Marcin; Grotthuss, Marcin von; Knizewski, Lukasz; Rychewski, Leszek; Eitner, Krystian; Ginalski, Krzysztof

    2007-01-01

    In many cases, at the beginning of a high throughput screening experiment some information about active molecules is already available. Active compounds (such as substrate analogues, natural products and inhibitors of related proteins) are often identified in low throughput validation studies on a biochemical target. Sometimes the additional structural information is also available from crystallographic studies on protein and ligand complexes. In addition, the structural or sequence similarity of various protein targets yields a novel possibility for drug discovery. Co-crystallized compounds from homologous proteins can be used to design leads for a new target without co-crystallized ligands. In this paper we evaluate how far such an approach can be used in a real drug campaign, with severe acute respiratory syndrome (SARS) coronavirus providing an example. Our method is able to construct small molecules as plausible inhibitors solely on the basis of the set of ligands from crystallized complexes of a protein target, and other proteins from its structurally homologous family. The accuracy and sensitivity of the method are estimated here by the subsequent use of an electronic high throughput screening flexible docking algorithm. The best performing ligands are then used for a very restrictive similarity search for potential inhibitors of the SARS protease within the million compounds from the Ligand.Info small molecule meta-database. The selected molecules can be passed on for further experimental validation

  6. Inhibitors of polyamine metabolism: review article.

    Science.gov (United States)

    Wallace, H M; Fraser, A V

    2004-07-01

    The identification of increased polyamine concentrations in a variety of diseases from cancer and psoriasis to parasitic infections has led to the hypothesis that manipulation of polyamine metabolism is a realistic target for therapeutic or preventative intervention in the treatment of certain diseases. The early development of polyamine biosynthetic single enzyme inhibitors such as alpha-difluoromethylornithine (DFMO) and methylglyoxal bis(guanylhydrazone) showed some interesting early promise as anticancer drugs, but ultimately failed in vivo. Despite this, DFMO is currently in use as an effective anti-parasitic agent and has recently also been shown to have further potential as a chemopreventative agent in colorectal cancer. The initial promise in vitro led to the development and testing of other potential inhibitors of the pathway namely the polyamine analogues. The analogues have met with greater success than the single enzyme inhibitors possibly due to their multiple targets. These include down regulation of polyamine biosynthesis through inhibition of ornithine decarboxylase and S-adenosylmethionine decarboxylase and decreased polyamine uptake. This coupled with increased activity of the catabolic enzymes, polyamine oxidase and spermidine/spermine N1-acetyltransferase, and increased polyamine export has made the analogues more effective in depleting polyamine pools. Recently, the identification of a new oxidase (PAO-h1/SMO) in polyamine catabolism and evidence of induction of both PAO and PAO-h1/SMO in response to polyamine analogue treatment, suggests the analogues may become an important part of future chemotherapeutic and/or chemopreventative regimens.

  7. Recent advances in botulinum neurotoxin inhibitor development.

    Science.gov (United States)

    Kiris, Erkan; Burnett, James C; Kane, Christopher D; Bavari, Sina

    2014-01-01

    Botulinum neurotoxins (BoNTs) are endopeptidases that target motor neurons and block acetylcholine neurotransmitter release. This action results in the muscle paralysis that defines the disease botulism. To date, there are no FDA-approved therapeutics to treat BoNT-mediated paralysis after intoxication of the motor neuron. Importantly, the rationale for pursuing treatments to counter these toxins is driven by their potential misuse. Current drug discovery efforts have mainly focused on small molecules, peptides, and peptidomimetics that can directly and competitively inhibit BoNT light chain proteolytic activity. Although this is a rational approach, direct inhibition of the Zn(2+) metalloprotease activity has been elusive as demonstrated by the dearth of candidates undergoing clinical evaluation. Therefore, broadening the scope of viable targets beyond that of active site protease inhibitors represents an additional strategy that could move the field closer to the clinic. Here we review the rationale, and discuss the outcomes of earlier approaches and highlight potential new targets for BoNT inhibition. These include BoNT uptake and processing inhibitors, enzymatic inhibitors, and modulators of neuronal processes associated with toxin clearance, neurotransmitter potentiation, and other pathways geared towards neuronal recovery and repair.

  8. A porphodimethene chemical inhibitor of uroporphyrinogen decarboxylase.

    Directory of Open Access Journals (Sweden)

    Kenneth W Yip

    Full Text Available Uroporphyrinogen decarboxylase (UROD catalyzes the conversion of uroporphyrinogen to coproporphyrinogen during heme biosynthesis. This enzyme was recently identified as a potential anticancer target; its inhibition leads to an increase in reactive oxygen species, likely mediated by the Fenton reaction, thereby decreasing cancer cell viability and working in cooperation with radiation and/or cisplatin. Because there is no known chemical UROD inhibitor suitable for use in translational studies, we aimed to design, synthesize, and characterize such a compound. Initial in silico-based design and docking analyses identified a potential porphyrin analogue that was subsequently synthesized. This species, a porphodimethene (named PI-16, was found to inhibit UROD in an enzymatic assay (IC50 = 9.9 µM, but did not affect porphobilinogen deaminase (at 62.5 µM, thereby exhibiting specificity. In cellular assays, PI-16 reduced the viability of FaDu and ME-180 cancer cells with half maximal effective concentrations of 22.7 µM and 26.9 µM, respectively, and only minimally affected normal oral epithelial (NOE cells. PI-16 also combined effectively with radiation and cisplatin, with potent synergy being observed in the case of cisplatin in FaDu cells (Chou-Talalay combination index <1. This work presents the first known synthetic UROD inhibitor, and sets the foundation for the design, synthesis, and characterization of higher affinity and more effective UROD inhibitors.

  9. Emicizumab Prophylaxis in Hemophilia A with Inhibitors.

    Science.gov (United States)

    Oldenburg, Johannes; Mahlangu, Johnny N; Kim, Benjamin; Schmitt, Christophe; Callaghan, Michael U; Young, Guy; Santagostino, Elena; Kruse-Jarres, Rebecca; Negrier, Claude; Kessler, Craig; Valente, Nancy; Asikanius, Elina; Levy, Gallia G; Windyga, Jerzy; Shima, Midori

    2017-08-31

    Emicizumab (ACE910) bridges activated factor IX and factor X to restore the function of activated factor VIII, which is deficient in persons with hemophilia A. This phase 3, multicenter trial assessed once-weekly subcutaneous emicizumab prophylaxis in persons with hemophilia A with factor VIII inhibitors. We enrolled participants who were 12 years of age or older. Those who had previously received episodic treatment with bypassing agents were randomly assigned in a 2:1 ratio to emicizumab prophylaxis (group A) or no prophylaxis (group B). The primary end point was the difference in bleeding rates between group A and group B. Participants who had previously received prophylactic treatment with bypassing agents received emicizumab prophylaxis in group C. A total of 109 male participants with hemophilia A with inhibitors were enrolled. The annualized bleeding rate was 2.9 events (95% confidence interval [CI], 1.7 to 5.0) among participants who were randomly assigned to emicizumab prophylaxis (group A, 35 participants) versus 23.3 events (95% CI, 12.3 to 43.9) among those assigned to no prophylaxis (group B, 18 participants), representing a significant difference of 87% in favor of emicizumab prophylaxis (Phemophilia A with inhibitors. (Funded by F. Hoffmann-La Roche and Chugai Pharmaceutical; HAVEN 1 ClinicalTrials.gov number, NCT02622321 .).

  10. Modelling of potentially promising SARS protease inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Plewczynski, Dariusz [Interdisciplinary Centre for Mathematical and Computational Modelling, ICM, Warsaw University, Pawinskiego 5a Street, 02-106 Warsaw (Poland); Hoffmann, Marcin [BioInfoBank Institute, Limanowskiego 24A/16, 60-744 Poznan (Poland); Grotthuss, Marcin von [BioInfoBank Institute, Limanowskiego 24A/16, 60-744 Poznan (Poland); Knizewski, Lukasz [Interdisciplinary Centre for Mathematical and Computational Modelling, ICM, Warsaw University, Pawinskiego 5a Street, 02-106 Warsaw (Poland); Rychewski, Leszek [BioInfoBank Institute, Limanowskiego 24A/16, 60-744 Poznan (Poland); Eitner, Krystian [BioInfoBank Institute, Limanowskiego 24A/16, 60-744 Poznan (Poland); Ginalski, Krzysztof [Interdisciplinary Centre for Mathematical and Computational Modelling, ICM, Warsaw University, Pawinskiego 5a Street, 02-106 Warsaw (Poland)

    2007-07-18

    In many cases, at the beginning of a high throughput screening experiment some information about active molecules is already available. Active compounds (such as substrate analogues, natural products and inhibitors of related proteins) are often identified in low throughput validation studies on a biochemical target. Sometimes the additional structural information is also available from crystallographic studies on protein and ligand complexes. In addition, the structural or sequence similarity of various protein targets yields a novel possibility for drug discovery. Co-crystallized compounds from homologous proteins can be used to design leads for a new target without co-crystallized ligands. In this paper we evaluate how far such an approach can be used in a real drug campaign, with severe acute respiratory syndrome (SARS) coronavirus providing an example. Our method is able to construct small molecules as plausible inhibitors solely on the basis of the set of ligands from crystallized complexes of a protein target, and other proteins from its structurally homologous family. The accuracy and sensitivity of the method are estimated here by the subsequent use of an electronic high throughput screening flexible docking algorithm. The best performing ligands are then used for a very restrictive similarity search for potential inhibitors of the SARS protease within the million compounds from the Ligand.Info small molecule meta-database. The selected molecules can be passed on for further experimental validation.

  11. Structure-Based Search for New Inhibitors of Cholinesterases

    Directory of Open Access Journals (Sweden)

    Barbara Malawska

    2013-03-01

    Full Text Available Cholinesterases are important biological targets responsible for regulation of cholinergic transmission, and their inhibitors are used for the treatment of Alzheimer’s disease. To design new cholinesterase inhibitors, of different structure-based design strategies was followed, including the modification of compounds from a previously developed library and a fragment-based design approach. This led to the selection of heterodimeric structures as potential inhibitors. Synthesis and biological evaluation of selected candidates confirmed that the designed compounds were acetylcholinesterase inhibitors with IC50 values in the mid-nanomolar to low micromolar range, and some of them were also butyrylcholinesterase inhibitors.

  12. Boosted protease inhibitor monotherapy versus boosted protease inhibitor plus lamivudine dual therapy as second-line maintenance treatment for HIV-1-infected patients in sub-Saharan Africa (ANRS12 286/MOBIDIP): a multicentre, randomised, parallel, open-label, superiority trial.

    Science.gov (United States)

    Ciaffi, Laura; Koulla-Shiro, Sinata; Sawadogo, Adrien Bruno; Ndour, Cheik Tidiane; Eymard-Duvernay, Sabrina; Mbouyap, Pretty Rosereine; Ayangma, Liliane; Zoungrana, Jacques; Gueye, Ndeye Fatou Ngom; Diallo, Mohamadou; Izard, Suzanne; Bado, Guillaume; Kane, Coumba Toure; Aghokeng, Avelin Fobang; Peeters, Martine; Girard, Pierre Marie; Le Moing, Vincent; Reynes, Jacques; Delaporte, Eric

    2017-09-01

    Despite satisfactory efficacy of WHO-recommended second-line antiretroviral treatment for patients with HIV in low-income countries, the need for simplified, low-cost, and less-toxic maintenance strategies remains high. We compared boosted protease inhibitor monotherapy with dual therapy with boosted protease inhibitor plus lamivudine in patients on second-line antiretrovial therapy (ART). We did a multicentre, randomised, parallel, open-label, superiority, trial in the HIV services of five hospitals in sub-Saharan Africa (Yaoundé, Cameroon; Dakar, Senegal; and Bobo Dioulasso, Burkina Faso). We recruited patients from the long-term, post-trial cohort of the ANRS 12169/2LADY study that compared the efficacy of three second-line combinations based on boosted protease inhibitors. Participants for our study were HIV-1 infected with multiple mutations including M184V, at first-line failure, aged 18 years and older, on boosted protease inhibitor plus two nucleoside reverse transcriptase inhibitors (NRTI) for at least 48 weeks with at least 48 weeks follow-up in the 2LADY trial, with two viral load measurements of less than 200 copies per mL in the previous 6 months, CD4 counts of more than 100 cells per μL, adherence of at least 90%, and no change to ART in the past 3 months. We randomly assigned participants (1:1) to receive either monotherapy with their boosted protease inhibitor (once-daily darunavir 800 mg [two 400 mg tablets] boosted with ritonavir 100 mg [one tablet] or coformulation of lopinavir 200 mg with ritonavir 50 mg [two tablets taken twice per day]) or to boosted protease inhibitor plus once-daily lamivudine 300 mg (one 300 mg tablet or two 150 mg tablets). Computer-generated randomisation was stratified by study site and viral load at screening (treatment allocation was not masked from clinicians or patients]. Patients had follow-up visits at weeks 4 and 12, and every 3 months until 96 weeks; if viral load exceeded 500 copies per mL at any visit, NRTI

  13. ELISA analysis of soybean trypsin inhibitors in processed foods.

    Science.gov (United States)

    Brandon, D L; Bates, A H; Friedman, M

    1991-01-01

    Soybean proteins are widely used in human foods in a variety of forms, including infant formulas, flour, protein concentrates, protein isolates, soy sauces, textured soy fibers, and tofu. The presence of inhibitors of digestive enzymes in soy proteins impairs the nutritional quality and possibly the safety of soybeans and other legumes. Processing, based on the use of heat or fractionation of protein isolates, does not completely inactivate or remove these inhibitors, so that residual amounts of inhibitors are consumed by animals and humans. New monoclonal antibody-based immunoassays can measure low levels of the soybean Kunitz trypsin inhibitor (KTI) and the Bowman-Birk trypsin and chymotrypsin inhibitor (BBI) and the Bowman-Birk foods. The enzyme-linked immunosorbent assay (ELISA) was used to measure the inhibitor content of soy concentrates, isolates, and flours, both heated and unheated; a commercial soy infant formula; KTI and BBI with rearranged disulfide bonds; browning products derived from heat-treatment of KTI with glucose and starch; and KTI exposed to high pH. The results indicate that even low inhibitor isolates contain significant amounts of specific inhibitors. Thus, infants on soy formula consume about 10 mg of KTI plus BBI per day. The immunoassays complement the established enzymatic assays of trypsin and chymotrypsin inhibitors, and have advantages in (a) measuring low levels of inhibitors in processed foods; and (b) differentiating between the Kunitz and Bowman-Birk inhibitors. The significance of our findings for food safety are discussed.

  14. Tyrosine kinase inhibitors: Multi-targeted or single-targeted?

    Science.gov (United States)

    Broekman, Fleur; Giovannetti, Elisa; Peters, Godefridus J

    2011-02-10

    Since in most tumors multiple signaling pathways are involved, many of the inhibitors in clinical development are designed to affect a wide range of targeted kinases. The most important tyrosine kinase families in the development of tyrosine kinase inhibitors are the ABL, SCR, platelet derived growth factor, vascular endothelial growth factor receptor and epidermal growth factor receptor families. Both multi-kinase inhibitors and single-kinase inhibitors have advantages and disadvantages, which are related to potential resistance mechanisms, pharmacokinetics, selectivity and tumor environment. In different malignancies various tyrosine kinases are mutated or overexpressed and several resistance mechanisms exist. Pharmacokinetics is influenced by interindividual differences and differs for two single targeted inhibitors or between patients treated by the same tyrosine kinase inhibitor. Different tyrosine kinase inhibitors have various mechanisms to achieve selectivity, while differences in gene expression exist between tumor and stromal cells. Considering these aspects, one type of inhibitor can generally not be preferred above the other, but will depend on the specific genetic constitution of the patient and the tumor, allowing personalized therapy. The most effective way of cancer treatment by using tyrosine kinase inhibitors is to consider each patient/tumor individually and to determine the strategy that specifically targets the consequences of altered (epi)genetics of the tumor. This strategy might result in treatment by a single multi kinase inhibitor for one patient, but in treatment by a couple of single kinase inhibitors for other patients.

  15. Highly active antiretroviral therapy including protease inhibitors does not confer a unique CD4 cell benefit. The AVANTI and INCAS Study Groups.

    Science.gov (United States)

    2000-07-07

    To determine if triple combination therapy, particularly including HIV protease inhibitors (PI), confers an unique immunological benefit that is independent of reductions of plasma viral load (pVL). The correlation between changes from baseline in CD4 cell count and pVL was examined at all time points up to 52 weeks in three randomized clinical trials (AVANTI-2, AVANTI-3 and INCAS) that compared dual nucleoside therapy with triple combination therapy. Individual pVL and CD4 cell counts changes from baseline were entered into multivariate linear regression models for patients receiving double therapy and for those receiving triple therapy including a PI and/or a non-nucleoside reverse transcriptase inhibitor (NNRTI), and the null hypothesis was tested. After 52 weeks of therapy, the relationship between changes from baseline CD4 cell count and pVL was independent of whether patients were assigned double or triple therapy (P = 0.23 and 0.69 for intercept and slope, respectively), or whether patients were assigned triple therapy including a PI or triple therapy including an NNRTI (P = 0.92 and 0.95, respectively). Less than 5% of patients ever had 'discordant' increases in both CD4 cell count and pVL compared with baseline, and this proportion was unrelated to the class of therapy used. 'Discordant' decreases from baseline in both parameters were observed in up to 35% of individuals. The correlation between pVL and CD4 cell count changes from baseline improved over time on therapy, regardless of the therapeutic regimen involved. The data provide no evidence for a CD4 cell count benefit of highly active antiretroviral therapy (HAART) unique to triple therapy or PI-containing regimens.

  16. The allosteric HIV-1 integrase inhibitor BI-D affects virion maturation but does not influence packaging of a functional RNA genome.

    Directory of Open Access Journals (Sweden)

    Nikki van Bel

    Full Text Available The viral integrase (IN is an essential protein for HIV-1 replication. IN inserts the viral dsDNA into the host chromosome, thereby aided by the cellular co-factor LEDGF/p75. Recently a new class of integrase inhibitors was described: allosteric IN inhibitors (ALLINIs. Although designed to interfere with the IN-LEDGF/p75 interaction to block HIV DNA integration during the early phase of HIV-1 replication, the major impact was surprisingly found on the process of virus maturation during the late phase, causing a reverse transcription defect upon infection of target cells. Virus particles produced in the presence of an ALLINI are misformed with the ribonucleoprotein located outside the virus core. Virus assembly and maturation are highly orchestrated and regulated processes in which several viral proteins and RNA molecules closely interact. It is therefore of interest to study whether ALLINIs have unpredicted pleiotropic effects on these RNA-related processes. We confirm that the ALLINI BI-D inhibits virus replication and that the produced virus is non-infectious. Furthermore, we show that the wild-type level of HIV-1 genomic RNA is packaged in virions and these genomes are in a dimeric state. The tRNAlys3 primer for reverse transcription was properly placed on this genomic RNA and could be extended ex vivo. In addition, the packaged reverse transcriptase enzyme was fully active when extracted from virions. As the RNA and enzyme components for reverse transcription are properly present in virions produced in the presence of BI-D, the inhibition of reverse transcription is likely to reflect the mislocalization of the components in the aberrant virus particle.

  17. The allosteric HIV-1 integrase inhibitor BI-D affects virion maturation but does not influence packaging of a functional RNA genome.

    Science.gov (United States)

    van Bel, Nikki; van der Velden, Yme; Bonnard, Damien; Le Rouzic, Erwann; Das, Atze T; Benarous, Richard; Berkhout, Ben

    2014-01-01

    The viral integrase (IN) is an essential protein for HIV-1 replication. IN inserts the viral dsDNA into the host chromosome, thereby aided by the cellular co-factor LEDGF/p75. Recently a new class of integrase inhibitors was described: allosteric IN inhibitors (ALLINIs). Although designed to interfere with the IN-LEDGF/p75 interaction to block HIV DNA integration during the early phase of HIV-1 replication, the major impact was surprisingly found on the process of virus maturation during the late phase, causing a reverse transcription defect upon infection of target cells. Virus particles produced in the presence of an ALLINI are misformed with the ribonucleoprotein located outside the virus core. Virus assembly and maturation are highly orchestrated and regulated processes in which several viral proteins and RNA molecules closely interact. It is therefore of interest to study whether ALLINIs have unpredicted pleiotropic effects on these RNA-related processes. We confirm that the ALLINI BI-D inhibits virus replication and that the produced virus is non-infectious. Furthermore, we show that the wild-type level of HIV-1 genomic RNA is packaged in virions and these genomes are in a dimeric state. The tRNAlys3 primer for reverse transcription was properly placed on this genomic RNA and could be extended ex vivo. In addition, the packaged reverse transcriptase enzyme was fully active when extracted from virions. As the RNA and enzyme components for reverse transcription are properly present in virions produced in the presence of BI-D, the inhibition of reverse transcription is likely to reflect the mislocalization of the components in the aberrant virus particle.

  18. Pathophysiological significance and therapeutic applications of snake venom protease inhibitors.

    Science.gov (United States)

    Thakur, Rupamoni; Mukherjee, Ashis K

    2017-06-01

    Protease inhibitors are important constituents of snake venom and play important roles in the pathophysiology of snakebite. Recently, research on snake venom protease inhibitors has provided valuable information to decipher the molecular details of various biological processes and offer insight for the development of some therapeutically important molecules from snake venom. The process of blood coagulation and fibrinolysis, in addition to affecting platelet function, are well known as the major targets of several snake venom protease inhibitors. This review summarizes the structure-functional aspects of snake venom protease inhibitors that have been described to date. Because diverse biological functions have been demonstrated by protease inhibitors, a comparative overview of their pharmacological and pathophysiological properties is also highlighted. In addition, since most snake venom protease inhibitors are non-toxic on their own, this review evaluates the different roles of individual protease inhibitors that could lead to the identification of drug candidates and diagnostic molecules. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Evaluation of Encapsulated Inhibitor for Autonomous Corrosion Protection

    Science.gov (United States)

    Johnsey, M. N.; Li, W.; Buhrow, J. W.; Calle, L. M.; Pearman, B. P.; Zhang, X.

    2015-01-01

    This work concerns the development of smart coating technologies based on microencapsulation for the autonomous control of corrosion. Microencapsulation allows the incorporation of corrosion inhibitors into coating which provides protection through corrosion-controlled release of these inhibitors.One critical aspect of a corrosion protective smart coating is the selection of corrosion inhibitor for encapsulation and comparison of the inhibitor function before and after encapsulation. For this purpose, a systematic approach is being used to evaluate free and encapsulated corrosion inhibitors by salt immersion. Visual, optical microscope, and Scanning Electron Microscope (with low-angle backscatter electron detector) are used to evaluate these inhibitors. It has been found that the combination of different characterization tools provide an effective method for evaluation of early stage localized corrosion and the effectiveness of corrosion inhibitors.

  20. A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus

    Directory of Open Access Journals (Sweden)

    Crumpacker Clyde S

    2011-01-01

    Full Text Available Abstract Background The major hurdle in the treatment of Human Immunodeficiency virus type 1 (HIV-1 includes the development of drug resistance-associated mutations in the target regions of the virus. Since reverse transcriptase (RT is essential for HIV-1 replication, several nucleoside analogues have been developed to target RT of the virus. Clinical studies have shown that mutations at RT codon 65 and 74 which are located in β3-β4 linkage group of finger sub-domain of RT are selected during treatment with several RT inhibitors, including didanosine, deoxycytidine, abacavir and tenofovir. Interestingly, the co-selection of K65R and L74V is rare in clinical settings. We have previously shown that K65R and L74V are incompatible and a R→K reversion occurs at codon 65 during replication of the virus. Analysis of the HIV resistance database has revealed that similar to K65R+L74V, the double mutant K65R+L74I is also rare. We sought to compare the impact of L→V versus L→I change at codon 74 in the background of K65R mutation, on the replication of doubly mutant viruses. Methods Proviral clones containing K65R, L74V, L74I, K65R+L74V and K65R+L74I RT mutations were created in pNL4-3 backbone and viruses were produced in 293T cells. Replication efficiencies of all the viruses were compared in peripheral blood mononuclear (PBM cells in the absence of selection pressure. Replication capacity (RC of mutant viruses in relation to wild type was calculated on the basis of antigen p24 production and RT activity, and paired analysis by student t-test was performed among RCs of doubly mutant viruses. Reversion at RT codons 65 and 74 was monitored during replication in PBM cells. In vitro processivity of mutant RTs was measured to analyze the impact of amino acid changes at RT codon 74. Results Replication kinetics plot showed that all of the mutant viruses were attenuated as compared to wild type (WT virus. Although attenuated in comparison to WT virus

  1. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

    Science.gov (United States)

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2017-09-01

    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  2. In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

    International Nuclear Information System (INIS)

    Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong

    2007-01-01

    The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation

  3. Novel HBV recombinants between genotypes B and C in 3'-terminal reverse transcriptase (RT) sequences are associated with enhanced viral DNA load, higher RT point mutation rates and place of birth among Chinese patients.

    Science.gov (United States)

    Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong

    2018-01-01

    As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.

  4. In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

    Energy Technology Data Exchange (ETDEWEB)

    Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail: machunhong@sdu.edu.cn

    2007-04-06

    The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.

  5. The "SWOT" of BRAF inhibition in melanoma: RAF inhibitors, MEK inhibitors or both?

    Science.gov (United States)

    Nissan, Moriah H; Solit, David B

    2011-12-01

    Activating mutations in the BRAF gene are among the most prevalent kinase mutations in human cancer. BRAF mutations are most frequent in patients with melanoma where they occur in approximately 50% of patients with advanced disease. Remarkable clinical activity has recently been reported with highly selective RAF inhibitors in melanoma patients whose tumors harbor V600E BRAF mutations. The response rates of RAF inhibitors in patients with BRAF-mutant melanomas far exceed the activity level of any prior therapy studied in this disease. The results suggest that we have entered an era of personalized therapy for patients with metastatic melanoma in which treatment selection will be guided by BRAF mutational status. This review will discuss the strengths, weaknesses, opportunities and threats ("SWOT") of developing RAF and MEK selective inhibitors as anti-cancer therapies, recent insights into the mechanisms of intrinsic and acquired resistance to these agents, and current efforts to develop mechanism-based combination therapies.

  6. F8 haplotype and inhibitor risk: results from the Hemophilia Inhibitor Genetics Study (HIGS) Combined Cohort

    Science.gov (United States)

    Schwarz, John; Astermark, Jan; Menius, Erika D.; Carrington, Mary; Donfield, Sharyne M.; Gomperts, Edward D.; Nelson, George W.; Oldenburg, Johannes; Pavlova, Anna; Shapiro, Amy D.; Winkler, Cheryl A.; Berntorp, Erik

    2012-01-01

    Background Ancestral background, specifically African descent, confers higher risk for development of inhibitory antibodies to factor VIII (FVIII) in hemophilia A. It has been suggested that differences in the distribution of factor VIII gene (F8) haplotypes, and mismatch between endogenous F8 haplotypes and those comprising products used for treatment could contribute to risk. Design and Methods Data from the HIGS Combined Cohort were used to determine the association between F8 haplotype 3 (H3) vs. haplotypes 1 and 2 (H1+H2) and inhibitor risk among individuals of genetically-determined African descent. Other variables known to affect inhibitor risk including type of F8 mutation and HLA were included in the analysis. A second research question regarding risk related to mismatch in endogenous F8 haplotype and recombinant FVIII products used for treatment was addressed. Results H3 was associated with higher inhibitor risk among those genetically-identified (N=49) as of African ancestry, but the association did not remain significant after adjustment for F8 mutation type and the HLA variables. Among subjects of all racial ancestries enrolled in HIGS who reported early use of recombinant products (N=223), mismatch in endogenous haplotype and the FVIII proteins constituting the products used did not confer greater risk for inhibitor development. Conclusion H3 was not an independent predictor of inhibitor risk. Further, our findings did not support a higher risk of inhibitors in the presence of a haplotype mismatch between the FVIII molecule infused and that of the individual. PMID:22958194

  7. Sifuvirtide, a potent HIV fusion inhibitor peptide

    International Nuclear Information System (INIS)

    Wang, Rui-Rui; Yang, Liu-Meng; Wang, Yun-Hua; Pang, Wei; Tam, Siu-Cheung; Tien, Po; Zheng, Yong-Tang

    2009-01-01

    Enfuvirtide (ENF) is currently the only FDA approved HIV fusion inhibitor in clinical use. Searching for more drugs in this category with higher efficacy and lower toxicity seems to be a logical next step. In line with this objective, a synthetic peptide with 36 amino acid residues, called Sifuvirtide (SFT), was designed based on the crystal structure of gp41. In this study, we show that SFT is a potent anti-HIV agent with relatively low cytotoxicity. SFT was found to inhibit replication of all tested HIV strains. The effective concentrations that inhibited 50% viral replication (EC 50 ), as determined in all tested strains, were either comparable or lower than benchmark values derived from well-known anti-HIV drugs like ENF or AZT, while the cytotoxic concentrations causing 50% cell death (CC 50 ) were relatively high, rendering it an ideal anti-HIV agent. A GST-pull down assay was performed to confirm that SFT is a fusion inhibitor. Furthermore, the activity of SFT on other targets in the HIV life cycle was also investigated, and all assays showed negative results. To further understand the mechanism of action of HIV peptide inhibitors, resistant variants of HIV-1 IIIB were derived by serial virus passage in the presence of increasing doses of SFT or ENF. The results showed that there was cross-resistance between SFT and ENF. In conclusion, SFT is an ideal anti-HIV agent with high potency and low cytotoxicity, but may exhibit a certain extent of cross-resistance with ENF.

  8. [Cholinesterase inhibitors for treating dementia. Review].

    Science.gov (United States)

    Kremer, Janus

    2010-01-01

    Alzheimer's disease is the most common form of dementia seen in the clinical practice. The principal risk factor is aging. There is not currently any available curative medication. However, there a family of drugs call the cholinesterase inhibitors (donepezile, galantamine and rivastigmine) the enhances cholinergic activity in the CNS. Also, memantine is available is a NMDA receptor modulator. A new transdermal way of administration is available now for rivastigmine. The rivastigmines patches are now a rational alternative focusing in getting more tolerance, better blood levels of the drug and compliance to treatment in Alzheimer's disease patients.

  9. Serine proteinases and their inhibitors in fertilization

    Czech Academy of Sciences Publication Activity Database

    Jonáková, Věra; Jelínková-Slavíčková, Petra

    2004-01-01

    Roč. 8, 3,4 (2004), s. 108-110 ISSN 1211-8869. [Central European Conference on Human Tumor Markers /5./. Praha, 01.10.2004-03.10.2004] R&D Projects: GA ČR GA303/02/0433; GA ČR GP303/02/P069; GA ČR GP303/04/P070; GA MZd NJ7463 Institutional research plan: CEZ:AV0Z5052915 Keywords : serine proteinase * proteinase inhibitors * fertilization Subject RIV: CE - Biochemistry

  10. A New Urease Inhibitor from Viola betonicifolia

    Directory of Open Access Journals (Sweden)

    Naveed Muhammad

    2014-10-01

    Full Text Available Urease has attracted much attention, as it is directly involved in the formation of infection stones and contributes to the pathogenesis of urolithiasis, pyelonephritis, ammonia and hepatic encephalopathy, hepatic coma and urinary catheter encrustation. Moreover, urease is the major cause of pathologies induced by H. pylori, such as gastritis and peptic ulcer. In the present work, the new natural compound, 3-methoxydalbergione, was isolated from Viola betonicifolia. A mechanistic study of this compound as a natural urease inhibitor was performed by using enzyme kinetics and docking studies. 3-Methoxydalbergione could be considered as a lead molecule for drugs useful in the urease associated diseases.

  11. Tetomilast: new promise for phosphodiesterase-4 inhibitors?

    Science.gov (United States)

    Bickston, Stephen J; Snider, Kenneth R; Kappus, Matthew R

    2012-12-01

    Tetomilast is a novel thiazole phosphodiesterase-4 (PDE-4) inhibitor, which may prove useful in both the treatment of inflammatory bowel disease (IBD) and chronic obstructive pulmonary disease (COPD). Here, the authors review the pharmacology of the drug, and offer critical review of the available data for use of tetomilast in the treatment of IBD. Peer-reviewed publications, including Phase I and II clinical trials, all other formats included. Tetomilast may be beneficial in IBD. Small differences in molecules and in recombinant proteins can translate into substantial differences in clinical effects and toxicity in IBD. This is a reasonable approach when exploring new options like tetomilast.

  12. Potential mechanisms of resistance to microtubule inhibitors.

    Science.gov (United States)

    Kavallaris, Maria; Annereau, Jean-Philippe; Barret, Jean-Marc

    2008-06-01

    Antimitotic drugs targeting the microtubules, such as the taxanes and vinca alkaloids, are widely used in the treatment of neoplastic diseases. Development of drug resistance over time, however, limits the efficacy of these agents and poses a clinical challenge to long-term improvement of patient outcomes. Understanding the mechanism(s) of drug resistance becomes paramount to allowing for alternative, if not improved, therapeutic options that might circumvent this challenge. Vinflunine, a novel microtubule inhibitor, has shown superior preclinical antitumor activity, and displays a different pattern of resistance, compared with other agents in the vinca alkaloid class.

  13. Larvicides and acetylcholinesterase inhibitors from Kalanchoe species

    International Nuclear Information System (INIS)

    Trevisan, Maria Teresa Salles; Bezerra, Maria Zeneide Barbosa; Santiago, Gilvandete Maria Pinheiro; Feitosa, Chistiane Mendes; Verpoorte, Robert; Gorlaeus Laboratories, Leiden; Braz Filho, Raimundo

    2006-01-01

    Acetylcholine esterase inhibitors are successfully used to treat the symptoms of Alzheimer's disease. Extracts of three Kalanchoe species (K. brasiliensis, K. pinnata and K. gastonis-bornieri) showed acetylcholine esterase inhibitory effects and a toxic effect on Aedes aegypti larvae. Here we describe the bioassay guided fractionation of extracts of the most active extracts (K. brasiliensis) which resulted in the isolation of an active mixture of three flavonoids: 8-methoxyquercetin, 3,7-di-O-rhamnopyranoside and 8-methoxykaempferol-3,7-di-O-rhamnopyranoside. On TLC these flavonoids showed an acetylcholine esterase inhibitory effect. (author)

  14. Hepatitis C Virus NS3 Inhibitors: Current and Future Perspectives

    Directory of Open Access Journals (Sweden)

    Kazi Abdus Salam

    2013-01-01

    Full Text Available Currently, hepatitis C virus (HCV infection is considered a serious health-care problem all over the world. A good number of direct-acting antivirals (DAAs against HCV infection are in clinical progress including NS3-4A protease inhibitors, RNA-dependent RNA polymerase inhibitors, and NS5A inhibitors as well as host targeted inhibitors. Two NS3-4A protease inhibitors (telaprevir and boceprevir have been recently approved for the treatment of hepatitis C in combination with standard of care (pegylated interferon plus ribavirin. The new therapy has significantly improved sustained virologic response (SVR; however, the adverse effects associated with this therapy are still the main concern. In addition to the emergence of viral resistance, other targets must be continually developed. One such underdeveloped target is the helicase portion of the HCV NS3 protein. This review article summarizes our current understanding of HCV treatment, particularly with those of NS3 inhibitors.

  15. HTCC: Broad Range Inhibitor of Coronavirus Entry.

    Directory of Open Access Journals (Sweden)

    Aleksandra Milewska

    Full Text Available To date, six human coronaviruses have been known, all of which are associated with respiratory infections in humans. With the exception of the highly pathogenic SARS and MERS coronaviruses, human coronaviruses (HCoV-NL63, HCoV-OC43, HCoV-229E, and HCoV-HKU1 circulate worldwide and typically cause the common cold. In most cases, infection with these viruses does not lead to severe disease, although acute infections in infants, the elderly, and immunocompromised patients may progress to severe disease requiring hospitalization. Importantly, no drugs against human coronaviruses exist, and only supportive therapy is available. Previously, we proposed the cationically modified chitosan, N-(2-hydroxypropyl-3-trimethylammonium chitosan chloride (HTCC, and its hydrophobically-modified derivative (HM-HTCC as potent inhibitors of the coronavirus HCoV-NL63. Here, we show that HTCC inhibits interaction of a virus with its receptor and thus blocks the entry. Further, we demonstrate that HTCC polymers with different degrees of substitution act as effective inhibitors of all low-pathogenic human coronaviruses.

  16. Lonafarnib is a potential inhibitor for neovascularization.

    Directory of Open Access Journals (Sweden)

    Linlin Sun

    Full Text Available Atherosclerosis is a common cardiovascular disease that involves the build-up of plaque on the inner walls of the arteries. Intraplaque neovacularization has been shown to be essential in the pathogenesis of atherosclerosis. Previous studies showed that small-molecule compounds targeting farnesyl transferase have the ability to prevent atherosclerosis in apolipoprotein E-deficient mice, but the underlying mechanism remains to be elucidated. In this study, we found that lonafarnib, a specific inhibitor of farnesyl transferase, elicits inhibitory effect on vascular endothelial capillary assembly in vitro in a dose-dependent manner. In addition, we showed that lonafarnib treatment led to a dose-dependent decrease in scratch wound closure in vitro, whereas it had little effect on endothelial cell proliferation. These data indicate that lonafarnib inhibits neovascularization via directly targeting endothelial cells and disturbing their motility. Moreover, we demonstrated that pharmacological inhibition of farnesyl transferase by lonafarnib significantly impaired centrosome reorientation toward the leading edge of endothelial cells. Mechanistically, we found that the catalytic β subunit of farnesyl transferase associated with a cytoskeletal protein important for the establishment and maintenance of cell polarity. Additionally, we showed that lonafarnib remarkably inhibited the expression of the cytoskeletal protein and interrupted its interaction with farnesyl transferase. Our findings thus offer novel mechanistic insight into the protective effect of farnesyl transferase inhibitors on atherosclerosis and provide encouraging evidence for the potential use of this group of agents in inhibiting plaque neovascularization.

  17. Proton Pump Inhibitors and Risk of Rhabdomyolysis.

    Science.gov (United States)

    Duncan, Scott J; Howden, Colin W

    2017-01-01

    Proton pump inhibitors (PPIs) have been associated with a variety of adverse events, although the level of evidence for many of these is weak at best. Recently, one national regulatory authority has mandated a change to the labeling of one PPI based on reports of possible associated rhabdomyolysis. Thus, in this review we summarize the available evidence linking PPI use with rhabdomyolysis. The level of evidence is insufficient to establish a causal relationship and is largely based on sporadic case reports. In general, patients with suspected PPI-associated rhabdomyolysis have not been re-challenged with a PPI after recovery. The mechanism whereby PPIs might have been associated with rhabdomyolysis is unclear but possibly related to interaction with concomitantly administered drugs such as HMG-CoA reductase inhibitors (statins). For patients with rhabdomyolysis, a careful search must be made for possible etiological factors. In patients who recover from an episode of possible PPI-related rhabdomyolysis but do not have a genuine requirement for PPI treatment, the PPI should not be re-introduced. For those with a definite indication for ongoing PPI treatment, the PPI can be re-introduced but should preferably not be administered with a statin.

  18. Polyphenol Compound as a Transcription Factor Inhibitor

    Directory of Open Access Journals (Sweden)

    Seyeon Park

    2015-10-01

    Full Text Available A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor–DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein–protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1, c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB and β-catenin/T cell factor (Tcf.

  19. Polyphenol Compound as a Transcription Factor Inhibitor.

    Science.gov (United States)

    Park, Seyeon

    2015-10-30

    A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor-DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein-protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1), c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and β-catenin/T cell factor (Tcf)).

  20. PD-1 Checkpoint Inhibitor Associated Autoimmune Encephalitis

    Directory of Open Access Journals (Sweden)

    Stephanie Schneider

    2017-05-01

    Full Text Available Objective: To report first-hand narrative experience of autoimmune encephalitis and to briefly review currently available evidence of autoimmune encephalitis in cancer patients treated with immune checkpoint inhibitors. Setting: A case study is presented on the management of a patient who developed autoimmune encephalitis during nivolumab monotherapy occurring after 28 weeks on anti-PD-1 monotherapy (nivolumab 3 mg/kg every 2 weeks for non-small cell lung cancer. Results: No substantial improvement was observed by antiepileptic treatment. After administration of 80 mg methylprednisolone, neurologic symptoms disappeared within 24 h and the patient fully recovered. Conclusions: Immune checkpoint inhibitor treatment can lead to autoimmune encephalitis. Clinical trial data indicate a frequency of autoimmune encephalitis of ≥0.1 to <1% with a higher probability during combined or sequential anti-CTLA-4/anti-PD-1 therapy than during anti-PD-1 or anti-PD-L1 monotherapy. Further collection of evidence and translational research is warranted.

  1. Synthesis of Novel Chalcones as Acetylcholinesterase Inhibitors

    Directory of Open Access Journals (Sweden)

    Thanh-Dao Tran

    2016-07-01

    Full Text Available A new series of benzylaminochalcone derivatives with different substituents on ring B were synthesized and evaluated as inhibitors of acetylcholinesterase. The study is aimed at identification of novel benzylaminochalcones capable of blocking acetylcholinesterase activity for further development of an approach to Alzheimer’s disease treatment. These compounds were produced in moderate to good yields via Claisen-Schmidt condensation and subjected to an in vitro acetylcholinesterase inhibition assay, using Ellman’s method. The in silico docking procedure was also employed to identify molecular interactions between the chalcone compounds and the enzyme. Compounds with ring B bearing pyridin-4-yl, 4-nitrophenyl, 4-chlorophenyl and 3,4-dimethoxyphenyl moieties were discovered to exhibit significant inhibitory activities against acetylcholinesterase, with IC50 values ranging from 23 to 39 µM. The molecular modeling studies are consistent with the hypothesis that benzylaminochalcones could exert their effects as dual-binding-site acetylcholinesterase inhibitors, which might simultaneously enhance cholinergic neurotransmission and inhibit β-amyloid aggregation through binding to both catalytic and peripheral sites of the enzyme. These derivatives could be further developed to provide novel leads for the discovery of new anti-Alzheimer drugs in the future.

  2. Replication and Inhibitors of Enteroviruses and Parechoviruses

    Directory of Open Access Journals (Sweden)

    Lonneke van der Linden

    2015-08-01

    Full Text Available The Enterovirus (EV and Parechovirus genera of the picornavirus family include many important human pathogens, including poliovirus, rhinovirus, EV-A71, EV-D68, and human parechoviruses (HPeV. They cause a wide variety of diseases, ranging from a simple common cold to life-threatening diseases such as encephalitis and myocarditis. At the moment, no antiviral therapy is available against these viruses and it is not feasible to develop vaccines against all EVs and HPeVs due to the great number of serotypes. Therefore, a lot of effort is being invested in the development of antiviral drugs. Both viral proteins and host proteins essential for virus replication can be used as targets for virus inhibitors. As such, a good understanding of the complex process of virus replication is pivotal in the design of antiviral strategies goes hand in hand with a good understanding of the complex process of virus replication. In this review, we will give an overview of the current state of knowledge of EV and HPeV replication and how this can be inhibited by small-molecule inhibitors.

  3. Flavonoids as Inhibitors of Human Butyrylcholinesterase Variants

    Directory of Open Access Journals (Sweden)

    Maja Katalinić

    2014-01-01

    Full Text Available The inhibition of butyrylcholinesterase (BChE, EC 3.1.1.8 appears to be of interest in treating diseases with symptoms of reduced neurotransmitter levels, such as Alzheimer’s disease. However, BCHE gene polymorphism should not be neglected in research since it could have an effect on the expected outcome. Several well-known cholinergic drugs (e.g. galantamine, huperzine and rivastigmine originating from plants, or synthesised as derivatives of plant compounds, have shown that herbs could serve as a source of novel target-directed compounds. We focused our research on flavonoids, biologically active polyphenolic compounds found in many plants and plant-derived products, as BChE inhibitors. All of the tested flavonoids: galangin, quercetin, fisetin and luteolin reversibly inhibited usual, atypical, and fluoride-resistant variants of human BChE. The inhibition potency increased in the following order, identically for all three BChE variants: luteolininhibitor dissociation constants (Ki ranged from 10 to 170 mmol/L. We showed that no significant change in the inhibition potency of selected flavonoids exists in view of BChE polymorphism. Our results suggested that flavonoids could assist the further development of new BChE-targeted drugs for treating symptoms of neurodegenerative diseases and dementia.

  4. Matrix Metalloproteinase Responsive Delivery of Myostatin Inhibitors.

    Science.gov (United States)

    Braun, Alexandra C; Gutmann, Marcus; Ebert, Regina; Jakob, Franz; Gieseler, Henning; Lühmann, Tessa; Meinel, Lorenz

    2017-01-01

    The inhibition of myostatin - a member of the transforming growth factor (TGF-β) family - drives regeneration of functional skeletal muscle tissue. We developed a bioresponsive drug delivery system (DDS) linking release of a myostatin inhibitor (MI) to inflammatory flares of myositis to provide self-regulated MI concentration gradients within tissues of need. A protease cleavable linker (PCL) - responding to MMP upregulation - is attached to the MI and site-specifically immobilized on microparticle surfaces. The PCL disintegrated in a matrix metalloproteinase (MMP) 1, 8, and particularly MMP-9 concentration dependent manner, with MMP-9 being an effective surrogate biomarker correlating with the activity of myositis. The bioactivity of particle-surface bound as well as released MI was confirmed by luciferase suppression in stably transfected HEK293 cells responding to myostatin induced SMAD phosphorylation. We developed a MMP-responsive DDS for MI delivery responding to inflammatory flare of a diseased muscle matching the kinetics of MMP-9 upregulation, with MMP-9 kinetics matching (patho-) physiological myostatin levels. ᅟ: Graphical Abstract Schematic illustration of the matrix metalloproteinase responsive delivery system responding to inflammatory flares of muscle disease. The protease cleavable linker readily disintegrates upon entry into the diseased tissue, therby releasing the mystatin inhibitor.

  5. Nontoxic corrosion inhibitors for N80 steel in hydrochloric acid

    OpenAIRE

    M. Yadav; Debasis Behera; Usha Sharma

    2016-01-01

    The purpose of this paper is to evaluate the protective ability of 1-(2-aminoethyl)-2-oleylimidazoline (AEOI) and 1-(2-oleylamidoethyl)-2-oleylimidazoline (OAEOI) as corrosion inhibitors for N80 steel in 15% hydrochloric acid, which may find application as eco-friendly corrosion inhibitors in acidizing processes in petroleum industry. Different concentrations of synthesized inhibitors AEOI and OAEOI were added to the test solution (15% HCl) and the corrosion inhibition of N80 steel in hydroch...

  6. Aromatase inhibitors in men: effects and therapeutic options

    Directory of Open Access Journals (Sweden)

    de Jong Frank H

    2011-06-01

    Full Text Available Abstract Aromatase inhibitors effectively delay epiphysial maturation in boys and improve testosterone levels in adult men Therefore, aromatase inhibitors may be used to increase adult height in boys with gonadotropin-independent precocious puberty, idiopathic short stature and constitutional delay of puberty. Long-term efficacy and safety of the use of aromatase inhibitors has not yet been established in males, however, and their routine use is therefore not yet recommended.

  7. Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision

    Science.gov (United States)

    2013-05-01

    acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for

  8. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    Science.gov (United States)

    2012-05-01

    compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR

  9. Natural compounds as corrosion inhibitors for highly cycled systems

    Energy Technology Data Exchange (ETDEWEB)

    Quraishi, M.A.; Farooqi, I.H.; Saini, P.A. [Corrosion Research Lab., Aligarh (India)

    1999-11-01

    Strict environmental legislations have led to the development of green inhibitors in recent years. In continuation of the authors` research work on development of green inhibitors, they have investigated the aqueous extracts of three plants namely: Azadirachta indica, Punica Granatum and Momordica charantia as corrosion inhibitors for mild steel in 3% NaCl using weight loss and electrochemical methods. All the investigated compounds exhibited excellent corrosion inhibition properties comparable to that of HEDP. Azadirachta showed better scale inhibition effect than HEDP.

  10. Invertase proteinaceous inhibitor of Cyphomandra betacea Sendt fruits.

    Science.gov (United States)

    Ordóñez, R M; Isla, M I; Vattuone, M A; Sampietro, A R

    2000-01-01

    This work describes a new invertase proteinaceous inhibitor from Cyphomandra betacea Sendt. (tomate de arbol) fruits. The proteinaceous inhibitor was isolated and purified from a cell wall preparation. The pH stability, kinetics of the inhibition of the C. betacea invertase, inhibition of several higher plant invertases and lectin nature of the inhibitor were studied. The inhibitor structure involves a single polypeptide (Mr = 19000), as shown by gel filtration and SDS-PAGE determinations. N-terminal aminoacid sequence was determined. The properties and some structural features of the inhibitor are compared with the proteinaceous inhibitors from several plant species (Beta vulgaris L., Ipomoea batatas L. and Lycopersicon esculentum Mill.). All these inhibitors share lectinic properties, some common epitopes, some aminoacid sequences and a certain lack of specificity towards invertases of different species, genera and even plant family. In consequence, the inhibitors appear to belong to the same lectin family. It is now known that some lectins are part of the defence mechanism of higher plants against fungi and bacteria and this is a probable role of the proteinaceous inhibitors.

  11. Predicting DPP-IV inhibitors with machine learning approaches

    Science.gov (United States)

    Cai, Jie; Li, Chanjuan; Liu, Zhihong; Du, Jiewen; Ye, Jiming; Gu, Qiong; Xu, Jun

    2017-04-01

    Dipeptidyl peptidase IV (DPP-IV) is a promising Type 2 diabetes mellitus (T2DM) drug target. DPP-IV inhibitors prolong the action of glucagon-like peptide-1 (GLP-1) and gastric inhibitory peptide (GIP), improve glucose homeostasis without weight gain, edema, and hypoglycemia. However, the marketed DPP-IV inhibitors have adverse effects such as nasopharyngitis, headache, nausea, hypersensitivity, skin reactions and pancreatitis. Therefore, it is still expected for novel DPP-IV inhibitors with minimal adverse effects. The scaffolds of existing DPP-IV inhibitors are structurally diversified. This makes it difficult to build virtual screening models based upon the known DPP-IV inhibitor libraries using conventional QSAR approaches. In this paper, we report a new strategy to predict DPP-IV inhibitors with machine learning approaches involving naïve Bayesian (NB) and recursive partitioning (RP) methods. We built 247 machine learning models based on 1307 known DPP-IV inhibitors with optimized molecular properties and topological fingerprints as descriptors. The overall predictive accuracies of the optimized models were greater than 80%. An external test set, composed of 65 recently reported compounds, was employed to validate the optimized models. The results demonstrated that both NB and RP models have a good predictive ability based on different combinations of descriptors. Twenty "good" and twenty "bad" structural fragments for DPP-IV inhibitors can also be derived from these models for inspiring the new DPP-IV inhibitor scaffold design.

  12. Experimental and theoretical studies of benzoxazines corrosion inhibitors

    Directory of Open Access Journals (Sweden)

    Abdulhadi Kadhim

    Full Text Available 2-Methyl-4H-benzo[d][1,3]oxazin-4-one (BZ1 and 3-amino-2-methylquinazolin-4(3H-one (BZ2 were evaluated for their corrosion inhibition properties on mild steel (MS in hydrochloric acid solution by weight loss technique and scanning electron microscopy. Results show the inhibition efficiency values depend on the amount of nitrogen in the inhibitor, the inhibitor concentration and the inhibitor molecular weight with maximum inhibition efficiency of 89% and 65% for BZ2 and BZ1 at highest concentration of the compounds. Keywords: Methylquinazoline, Benzoxazines, Corrosion, Inhibitors

  13. Cysteine peptidases and their inhibitors in breast and genital cancer.

    Directory of Open Access Journals (Sweden)

    Magdalena Milan

    2010-11-01

    Full Text Available Cysteine proteinases and their inhibitors probably play the main role in carcinogenesis and metastasis. The metastasis process need external proteolytic activities that pass several barriers which are membranous structures of the connective tissue which includes, the basement membrane of blood vessels. Activities of the proteinases are regulated by endogenous inhibitors and activators. The imbalance between cysteine proteinases and cystatins seems to be associated with an increase in metastatic potential in some tumors. It has also been reported that proteinase inhibitors, specific antibodies for these enzymes and inhibition of the urokinase receptor may prevent cancer cell invasion. Some proteinase inhibitor could serve as agents for cancer treatment.

  14. Insights into the molecular evolution of peptidase inhibitors in arthropods.

    Science.gov (United States)

    Alonso, Joaquin; Martinez, Manuel

    2017-01-01

    Peptidase inhibitors are key proteins involved in the control of peptidases. In arthropods, peptidase inhibitors modulate the activity of peptidases involved in endogenous physiological processes and peptidases of the organisms with which they interact. Exploring available arthropod genomic sequences is a powerful way to obtain the repertoire of peptidase inhibitors in every arthropod species and to understand the evolutionary mechanisms involved in the diversification of this kind of proteins. A genomic comparative analysis of peptidase inhibitors in species belonging to different arthropod taxonomic groups was performed. The results point out: i) species or clade-specific presence is shown for several families of peptidase inhibitors; ii) multidomain peptidase inhibitors are commonly found in many peptidase inhibitor families; iii) several families have a wide range of members in different arthropod species; iv) several peptidase inhibitor families show species-specific (or clade-specific) gene family expansions; v) functional divergence may be assumed for particular clades; vi) passive expansions may be used by natural selection to fix adaptations. In conclusion, conservation and divergence of duplicated genes and the potential recruitment as peptidase inhibitors of proteins from other families are the main mechanisms used by arthropods to fix diversity. This diversity would be associated to the control of target peptidases and, as consequence, to adapt to specific environments.

  15. The safety of proton pump inhibitors in pregnancy

    DEFF Research Database (Denmark)

    Nielsen, Gunnar Lauge; Sørensen, Henrik Toft; Thulstrup, Ane Marie

    1999-01-01

    AIM: To assess the safety of proton pump inhibitors during pregnancy. METHODS: Fifty-one pregnant women exposed to proton pump inhibitors around the time of conception or during pregnancy were compared with 13 327 controls without exposure to any prescribed drug in a population-based study based...... birth weight or number of preterm deliveries in pregnancies exposed to proton pump inhibitors. However, further monitoring is warranted in order to establish or rule out a potential association between the use of proton pump inhibitors and increased risk of either cardiac malformations or preterm birth....

  16. Inhibitory Effects of Respiration Inhibitors on Aflatoxin Production

    Directory of Open Access Journals (Sweden)

    Shohei Sakuda

    2014-03-01

    Full Text Available Aflatoxin production inhibitors, which do not inhibit the growth of aflatoxigenic fungi, may be used to control aflatoxin without incurring a rapid spread of resistant strains. A respiration inhibitor that inhibits aflatoxin production was identified during a screening process for natural, aflatoxin-production inhibitors. This prompted us to evaluate respiration inhibitors as potential aflatoxin control agents. The inhibitory activities of four natural inhibitors, seven synthetic miticides, and nine synthetic fungicides were evaluated on aflatoxin production in Aspergillus parasiticus. All of the natural inhibitors (rotenone, siccanin, aptenin A5, and antimycin A inhibited fungal aflatoxin production with IC50 values around 10 µM. Among the synthetic miticides, pyridaben, fluacrypyrim, and tolfenpyrad exhibited strong inhibitory activities with IC50 values less than 0.2 µM, whereas cyflumetofen did not show significant inhibitory activity. Of the synthetic fungicides, boscalid, pyribencarb, azoxystrobin, pyraclostrobin, and kresoxim-methyl demonstrated strong inhibitory activities, with IC50 values less than 0.5 µM. Fungal growth was not significantly affected by any of the inhibitors tested at concentrations used. There was no correlation observed between the targets of respiration inhibitors (complexes I, II, and III and their IC50 values for aflatoxin-production inhibitory activity. This study suggests that respiration inhibitors, including commonly used pesticides, are useful for aflatoxin control.

  17. Inhibitory Effects of Respiration Inhibitors on Aflatoxin Production

    Science.gov (United States)

    Sakuda, Shohei; Prabowo, Diyan Febri; Takagi, Keiko; Shiomi, Kazuro; Mori, Mihoko; Ōmura, Satoshi; Nagasawa, Hiromichi

    2014-01-01

    Aflatoxin production inhibitors, which do not inhibit the growth of aflatoxigenic fungi, may be used to control aflatoxin without incurring a rapid spread of resistant strains. A respiration inhibitor that inhibits aflatoxin production was identified during a screening process for natural, aflatoxin-production inhibitors. This prompted us to evaluate respiration inhibitors as potential aflatoxin control agents. The inhibitory activities of four natural inhibitors, seven synthetic miticides, and nine synthetic fungicides were evaluated on aflatoxin production in Aspergillus parasiticus. All of the natural inhibitors (rotenone, siccanin, aptenin A5, and antimycin A) inhibited fungal aflatoxin production with IC50 values around 10 µM. Among the synthetic miticides, pyridaben, fluacrypyrim, and tolfenpyrad exhibited strong inhibitory activities with IC50 values less than 0.2 µM, whereas cyflumetofen did not show significant inhibitory activity. Of the synthetic fungicides, boscalid, pyribencarb, azoxystrobin, pyraclostrobin, and kresoxim-methyl demonstrated strong inhibitory activities, with IC50 values less than 0.5 µM. Fungal growth was not significantly affected by any of the inhibitors tested at concentrations used. There was no correlation observed between the targets of respiration inhibitors (complexes I, II, and III) and their IC50 values for aflatoxin-production inhibitory activity. This study suggests that respiration inhibitors, including commonly used pesticides, are useful for aflatoxin control. PMID:24674936

  18. Design and Performance of the CDC Real-Time Reverse Transcriptase PCR Swine Flu Panel for Detection of 2009 A (H1N1) Pandemic Influenza Virus▿†‡

    Science.gov (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

    2011-01-01

    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260

  19. Evaluation of a Multiplex Real-Time Reverse Transcriptase PCR Assay for Detection and Differentiation of Influenza Viruses A and B during the 2001-2002 Influenza Season in Israel

    Science.gov (United States)

    Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella

    2005-01-01

    The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650

  20. Role of the functional MNS16A VNTR-243 variant of the human telomerase reverse transcriptase gene in progression and response to therapy of patients with non-Hodgkin's B-cell lymphomas.

    Science.gov (United States)

    Wysoczanska, B; Wrobel, T; Dobrzynska, O; Mazur, G; Bogunia-Kubik, K

    2015-04-01

    MNS16A is a functional polymorphic tandem repeat within the human telomerase reverse transcriptase (hTERT) gene. To investigate whether any of the MNS16A repeats represents a genetic risk factor for NHL susceptibility, progression of or response to therapy in 75 patients with non-Hodgkin's lymphomas (NHLs) and 126 healthy individuals were genotyped using the PCR-VNTR technique. A slightly higher frequency of the MNS16A VNTR-243 variant was detected among patients who did not respond to treatment (NR) as compared to patients with complete or partial remission (0.83 vs. 0.51, P = 0.055). NR patients more frequently developed aggressive than indolent type of the disease (0.92 vs. 0.41, P = 0.001). The VNTR-243 allele was more frequently detected among patients with an intermediate-high/high International Prognostic Index (IPI 3-4) score (P = 0.063), especially in patients with advanced age and IPI 3-4 (P = 0.040). In multivariate analysis, higher IPI 3-4 score (OR = 11.364, P = 0.051) and aggressive type of the disease (OR = 18.182, P = 0.012) were found to be independent genetic markers associated with nonresponse to treatment. Presence of the MNS16A VNTR-243 variant also strongly tended to affect the risk of a less favourable response to therapy and was more frequently present among nonresponders (OR = 5.848, P = 0.059). Genetic variation within the hTERT gene may affect the progression and treatment of lymphoproliferative disorders. © 2015 John Wiley & Sons Ltd.