WorldWideScience

Sample records for transcriptase coding sequences

  1. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

    Science.gov (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  2. Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase

    OpenAIRE

    DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami

    2012-01-01

    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

  3. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  4. Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

    Science.gov (United States)

    Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

    2014-01-13

    high processivity and fidelity of group II intron reverse transcriptases along with their novel template-switching activity, which can directly link RNA-seq adaptor sequences to cDNAs during reverse transcription, open new approaches for RNA-seq and the identification and profiling of non-coding RNAs, with potentially wide applications in research and biotechnology.

  5. Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

    Science.gov (United States)

    Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

    2012-08-01

    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

  6. Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis

    Directory of Open Access Journals (Sweden)

    Ma Bi

    2017-10-01

    Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.

  7. Phylogenetic analysis of HIV-1 reverse transcriptase sequences from 382 patients recruited in JJ Hospital of Mumbai, India, between 2002 and 2008.

    Science.gov (United States)

    Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J

    2009-06-01

    Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.

  8. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

    Science.gov (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

    2013-10-01

    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  9. Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

    Energy Technology Data Exchange (ETDEWEB)

    Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

    2007-02-21

    Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

  10. Immune pressure analysis of protease and reverse transcriptase ...

    African Journals Online (AJOL)

    /dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...

  11. Purifying selection acts on coding and non-coding sequences of paralogous genes in Arabidopsis thaliana.

    Science.gov (United States)

    Hoffmann, Robert D; Palmgren, Michael

    2016-06-13

    Whole-genome duplications in the ancestors of many diverse species provided the genetic material for evolutionary novelty. Several models explain the retention of paralogous genes. However, how these models are reflected in the evolution of coding and non-coding sequences of paralogous genes is unknown. Here, we analyzed the coding and non-coding sequences of paralogous genes in Arabidopsis thaliana and compared these sequences with those of orthologous genes in Arabidopsis lyrata. Paralogs with lower expression than their duplicate had more nonsynonymous substitutions, were more likely to fractionate, and exhibited less similar expression patterns with their orthologs in the other species. Also, lower-expressed genes had greater tissue specificity. Orthologous conserved non-coding sequences in the promoters, introns, and 3' untranslated regions were less abundant at lower-expressed genes compared to their higher-expressed paralogs. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to ribosomes, whereas paralogs with different expression levels were enriched in terms associated with stress responses. Loss of conserved non-coding sequences in one gene of a paralogous gene pair correlates with reduced expression levels that are more tissue specific. Together with increased mutation rates in the coding sequences, this suggests that similar forces of purifying selection act on coding and non-coding sequences. We propose that coding and non-coding sequences evolve concurrently following gene duplication.

  12. Some Algebraic Aspects of MorseCode Sequences

    OpenAIRE

    Johann Cigler

    2003-01-01

    Morse code sequences are very useful to give combinatorial interpretations of various properties of Fibonacci numbers. In this note we study some algebraic and combinatorial aspects of Morse code sequences and obtain several q-analogues of Fibonacci numbers and Fibonacci polynomials and their generalizations.

  13. Some Algebraic Aspects of MorseCode Sequences

    Directory of Open Access Journals (Sweden)

    Johann Cigler

    2003-06-01

    Full Text Available Morse code sequences are very useful to give combinatorial interpretations of various properties of Fibonacci numbers. In this note we study some algebraic and combinatorial aspects of Morse code sequences and obtain several q-analogues of Fibonacci numbers and Fibonacci polynomials and their generalizations.

  14. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  15. Genetic Code Analysis Toolkit: A novel tool to explore the coding properties of the genetic code and DNA sequences

    Science.gov (United States)

    Kraljić, K.; Strüngmann, L.; Fimmel, E.; Gumbel, M.

    2018-01-01

    The genetic code is degenerated and it is assumed that redundancy provides error detection and correction mechanisms in the translation process. However, the biological meaning of the code's structure is still under current research. This paper presents a Genetic Code Analysis Toolkit (GCAT) which provides workflows and algorithms for the analysis of the structure of nucleotide sequences. In particular, sets or sequences of codons can be transformed and tested for circularity, comma-freeness, dichotomic partitions and others. GCAT comes with a fertile editor custom-built to work with the genetic code and a batch mode for multi-sequence processing. With the ability to read FASTA files or load sequences from GenBank, the tool can be used for the mathematical and statistical analysis of existing sequence data. GCAT is Java-based and provides a plug-in concept for extensibility. Availability: Open source Homepage:http://www.gcat.bio/

  16. Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

    International Nuclear Information System (INIS)

    Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.

    1986-01-01

    The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

  17. Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

    International Nuclear Information System (INIS)

    Bavand, M.R.; Laub, O.

    1988-01-01

    Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

  18. Highly conserved non-coding sequences are associated with vertebrate development.

    Directory of Open Access Journals (Sweden)

    Adam Woolfe

    2005-01-01

    Full Text Available In addition to protein coding sequence, the human genome contains a significant amount of regulatory DNA, the identification of which is proving somewhat recalcitrant to both in silico and functional methods. An approach that has been used with some success is comparative sequence analysis, whereby equivalent genomic regions from different organisms are compared in order to identify both similarities and differences. In general, similarities in sequence between highly divergent organisms imply functional constraint. We have used a whole-genome comparison between humans and the pufferfish, Fugu rubripes, to identify nearly 1,400 highly conserved non-coding sequences. Given the evolutionary divergence between these species, it is likely that these sequences are found in, and furthermore are essential to, all vertebrates. Most, and possibly all, of these sequences are located in and around genes that act as developmental regulators. Some of these sequences are over 90% identical across more than 500 bases, being more highly conserved than coding sequence between these two species. Despite this, we cannot find any similar sequences in invertebrate genomes. In order to begin to functionally test this set of sequences, we have used a rapid in vivo assay system using zebrafish embryos that allows tissue-specific enhancer activity to be identified. Functional data is presented for highly conserved non-coding sequences associated with four unrelated developmental regulators (SOX21, PAX6, HLXB9, and SHH, in order to demonstrate the suitability of this screen to a wide range of genes and expression patterns. Of 25 sequence elements tested around these four genes, 23 show significant enhancer activity in one or more tissues. We have identified a set of non-coding sequences that are highly conserved throughout vertebrates. They are found in clusters across the human genome, principally around genes that are implicated in the regulation of development

  19. An Auto sequence Code to Integrate a Neutron Unfolding Code with thePC-MCA Accuspec

    International Nuclear Information System (INIS)

    Darsono

    2000-01-01

    In a neutron spectrometry using proton recoil method, the neutronunfolding code is needed to unfold the measured proton spectrum to become theneutron spectrum. The process of the unfolding neutron in the existingneutron spectrometry which was successfully installed last year was doneseparately. This manuscript reports that the auto sequence code to integratethe neutron unfolding code UNFSPEC.EXE with the software facility of thePC-MCA Accuspec has been made and run successfully so that the new neutronspectrometry become compact. The auto sequence code was written based on therules in application program facility of PC-MCA Accuspec and then it wascompiled using AC-EXE. Result of the test of the auto sequence code showedthat for binning width 20, 30, and 40 giving a little different spectrumshape. The binning width around 30 gives a better spectrum in mean of givingsmall error compared to the others. (author)

  20. Genome-wide identification of coding and non-coding conserved sequence tags in human and mouse genomes

    Directory of Open Access Journals (Sweden)

    Maggi Giorgio P

    2008-06-01

    Full Text Available Abstract Background The accurate detection of genes and the identification of functional regions is still an open issue in the annotation of genomic sequences. This problem affects new genomes but also those of very well studied organisms such as human and mouse where, despite the great efforts, the inventory of genes and regulatory regions is far from complete. Comparative genomics is an effective approach to address this problem. Unfortunately it is limited by the computational requirements needed to perform genome-wide comparisons and by the problem of discriminating between conserved coding and non-coding sequences. This discrimination is often based (thus dependent on the availability of annotated proteins. Results In this paper we present the results of a comprehensive comparison of human and mouse genomes performed with a new high throughput grid-based system which allows the rapid detection of conserved sequences and accurate assessment of their coding potential. By detecting clusters of coding conserved sequences the system is also suitable to accurately identify potential gene loci. Following this analysis we created a collection of human-mouse conserved sequence tags and carefully compared our results to reliable annotations in order to benchmark the reliability of our classifications. Strikingly we were able to detect several potential gene loci supported by EST sequences but not corresponding to as yet annotated genes. Conclusion Here we present a new system which allows comprehensive comparison of genomes to detect conserved coding and non-coding sequences and the identification of potential gene loci. Our system does not require the availability of any annotated sequence thus is suitable for the analysis of new or poorly annotated genomes.

  1. Performance Analysis for Cooperative Communication System with QC-LDPC Codes Constructed with Integer Sequences

    Directory of Open Access Journals (Sweden)

    Yan Zhang

    2015-01-01

    Full Text Available This paper presents four different integer sequences to construct quasi-cyclic low-density parity-check (QC-LDPC codes with mathematical theory. The paper introduces the procedure of the coding principle and coding. Four different integer sequences constructing QC-LDPC code are compared with LDPC codes by using PEG algorithm, array codes, and the Mackey codes, respectively. Then, the integer sequence QC-LDPC codes are used in coded cooperative communication. Simulation results show that the integer sequence constructed QC-LDPC codes are effective, and overall performance is better than that of other types of LDPC codes in the coded cooperative communication. The performance of Dayan integer sequence constructed QC-LDPC is the most excellent performance.

  2. Coding visual features extracted from video sequences.

    Science.gov (United States)

    Baroffio, Luca; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2014-05-01

    Visual features are successfully exploited in several applications (e.g., visual search, object recognition and tracking, etc.) due to their ability to efficiently represent image content. Several visual analysis tasks require features to be transmitted over a bandwidth-limited network, thus calling for coding techniques to reduce the required bit budget, while attaining a target level of efficiency. In this paper, we propose, for the first time, a coding architecture designed for local features (e.g., SIFT, SURF) extracted from video sequences. To achieve high coding efficiency, we exploit both spatial and temporal redundancy by means of intraframe and interframe coding modes. In addition, we propose a coding mode decision based on rate-distortion optimization. The proposed coding scheme can be conveniently adopted to implement the analyze-then-compress (ATC) paradigm in the context of visual sensor networks. That is, sets of visual features are extracted from video frames, encoded at remote nodes, and finally transmitted to a central controller that performs visual analysis. This is in contrast to the traditional compress-then-analyze (CTA) paradigm, in which video sequences acquired at a node are compressed and then sent to a central unit for further processing. In this paper, we compare these coding paradigms using metrics that are routinely adopted to evaluate the suitability of visual features in the context of content-based retrieval, object recognition, and tracking. Experimental results demonstrate that, thanks to the significant coding gains achieved by the proposed coding scheme, ATC outperforms CTA with respect to all evaluation metrics.

  3. Machine-Checked Sequencer for Critical Embedded Code Generator

    Science.gov (United States)

    Izerrouken, Nassima; Pantel, Marc; Thirioux, Xavier

    This paper presents the development of a correct-by-construction block sequencer for GeneAuto a qualifiable (according to DO178B/ED12B recommendation) automatic code generator. It transforms Simulink models to MISRA C code for safety critical systems. Our approach which combines classical development process and formal specification and verification using proof-assistants, led to preliminary fruitful exchanges with certification authorities. We present parts of the classical user and tools requirements and derived formal specifications, implementation and verification for the correctness and termination of the block sequencer. This sequencer has been successfully applied to real-size industrial use cases from various transportation domain partners and led to requirement errors detection and a correct-by-construction implementation.

  4. Algebraic solution of the synthesis problem for coded sequences

    International Nuclear Information System (INIS)

    Leukhin, Anatolii N

    2005-01-01

    The algebraic solution of a 'complex' problem of synthesis of phase-coded (PC) sequences with the zero level of side lobes of the cyclic autocorrelation function (ACF) is proposed. It is shown that the solution of the synthesis problem is connected with the existence of difference sets for a given code dimension. The problem of estimating the number of possible code combinations for a given code dimension is solved. It is pointed out that the problem of synthesis of PC sequences is related to the fundamental problems of discrete mathematics and, first of all, to a number of combinatorial problems, which can be solved, as the number factorisation problem, by algebraic methods by using the theory of Galois fields and groups. (fourth seminar to the memory of d.n. klyshko)

  5. DNA watermarks in non-coding regulatory sequences

    Directory of Open Access Journals (Sweden)

    Pyka Martin

    2009-07-01

    Full Text Available Abstract Background DNA watermarks can be applied to identify the unauthorized use of genetically modified organisms. It has been shown that coding regions can be used to encrypt information into living organisms by using the DNA-Crypt algorithm. Yet, if the sequence of interest presents a non-coding DNA sequence, either the function of a resulting functional RNA molecule or a regulatory sequence, such as a promoter, could be affected. For our studies we used the small cytoplasmic RNA 1 in yeast and the lac promoter region of Escherichia coli. Findings The lac promoter was deactivated by the integrated watermark. In addition, the RNA molecules displayed altered configurations after introducing a watermark, but surprisingly were functionally intact, which has been verified by analyzing the growth characteristics of both wild type and watermarked scR1 transformed yeast cells. In a third approach we introduced a second overlapping watermark into the lac promoter, which did not affect the promoter activity. Conclusion Even though the watermarked RNA and one of the watermarked promoters did not show any significant differences compared to the wild type RNA and wild type promoter region, respectively, it cannot be generalized that other RNA molecules or regulatory sequences behave accordingly. Therefore, we do not recommend integrating watermark sequences into regulatory regions.

  6. Golay sequences coded coherent optical OFDM for long-haul transmission

    Science.gov (United States)

    Qin, Cui; Ma, Xiangrong; Hua, Tao; Zhao, Jing; Yu, Huilong; Zhang, Jian

    2017-09-01

    We propose to use binary Golay sequences in coherent optical orthogonal frequency division multiplexing (CO-OFDM) to improve the long-haul transmission performance. The Golay sequences are generated by binary Reed-Muller codes, which have low peak-to-average power ratio and certain error correction capability. A low-complexity decoding algorithm for the Golay sequences is then proposed to recover the signal. Under same spectral efficiency, the QPSK modulated OFDM with binary Golay sequences coding with and without discrete Fourier transform (DFT) spreading (DFTS-QPSK-GOFDM and QPSK-GOFDM) are compared with the normal BPSK modulated OFDM with and without DFT spreading (DFTS-BPSK-OFDM and BPSK-OFDM) after long-haul transmission. At a 7% forward error correction code threshold (Q2 factor of 8.5 dB), it is shown that DFTS-QPSK-GOFDM outperforms DFTS-BPSK-OFDM by extending the transmission distance by 29% and 18%, in non-dispersion managed and dispersion managed links, respectively.

  7. Fast comparison of IS radar code sequences for lag profile inversion

    Directory of Open Access Journals (Sweden)

    M. S. Lehtinen

    2008-08-01

    Full Text Available A fast method for theoretically comparing the posteriori variances produced by different phase code sequences in incoherent scatter radar (ISR experiments is introduced. Alternating codes of types 1 and 2 are known to be optimal for selected range resolutions, but the code sets are inconveniently long for many purposes like ground clutter estimation and in cases where coherent echoes from lower ionospheric layers are to be analyzed in addition to standard F-layer spectra.

    The method is used in practice for searching binary code quads that have estimation accuracy almost equal to that of much longer alternating code sets. Though the code sequences can consist of as few as four different transmission envelopes, the lag profile estimation variances are near to the theoretical minimum. Thus the short code sequence is equally good as a full cycle of alternating codes with the same pulse length and bit length. The short code groups cannot be directly decoded, but the decoding is done in connection with more computationally expensive lag profile inversion in data analysis.

    The actual code searches as well as the analysis and real data results from the found short code searches are explained in other papers sent to the same issue of this journal. We also discuss interesting subtle differences found between the different alternating codes by this method. We assume that thermal noise dominates the incoherent scatter signal.

  8. Sequence Coding and Search System for licensee event reports: code listings. Volume 2

    International Nuclear Information System (INIS)

    Gallaher, R.B.; Guymon, R.H.; Mays, G.T.; Poore, W.P.; Cagle, R.J.; Harrington, K.H.; Johnson, M.P.

    1985-04-01

    Operating experience data from nuclear power plants are essential for safety and reliability analyses, especially analyses of trends and patterns. The licensee event reports (LERs) that are submitted to the Nuclear Regulatory Commission (NRC) by the nuclear power plant utilities contain much of this data. The NRC's Office for Analysis and Evaluation of Operational Data (AEOD) has developed, under contract with NSIC, a system for codifying the events reported in the LERs. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the LERs to coded sequences that are both computer-readable and computer-searchable. This system provides a structured format for detailed coding of component, system, and unit effects as well as personnel errors. The database contains all current LERs submitted by nuclear power plant utilities for events occurring since 1981 and is updated on a continual basis. Volume 2 contains all valid and acceptable codes used for searching and encoding the LER data. This volume contains updated material through amendment 1 to revision 1 of the working version of ORNL/NSIC-223, Vol. 2

  9. Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

    Directory of Open Access Journals (Sweden)

    Elisabeth Humphris-Narayanan

    Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

  10. Development and customization of a color-coded microbeads-based assay for drug resistance in HIV-1 reverse transcriptase.

    Science.gov (United States)

    Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki

    2014-01-01

    Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.

  11. Anti-HBV treatment induces novel reverse transcriptase mutations with reflective effect on HBV S antigen

    NARCIS (Netherlands)

    Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina

    2013-01-01

    The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences

  12. Sub-grouping of Plasmodium falciparum 3D7 var genes based on sequence analysis of coding and non-coding regions

    DEFF Research Database (Denmark)

    Lavstsen, Thomas; Salanti, Ali; Jensen, Anja T R

    2003-01-01

    and organization of the 3D7 PfEMP1 repertoire was investigated on the basis of the complete genome sequence. METHODS: Using two tree-building methods we analysed the coding and non-coding sequences of 3D7 var and rif genes as well as var genes of other parasite strains. RESULTS: var genes can be sub...

  13. Blackout sequence modeling for Atucha-I with MARCH3 code

    International Nuclear Information System (INIS)

    Baron, J.; Bastianelli, B.

    1997-01-01

    The modeling of a blackout sequence in Atucha I nuclear power plant is presented in this paper, as a preliminary phase for a level II probabilistic safety assessment. Such sequence is analyzed with the code MARCH3 from STCP (Source Term Code Package), based on a specific model developed for Atucha, that takes into accounts it peculiarities. The analysis includes all the severe accident phases, from the initial transient (loss of heat sink), loss of coolant through the safety valves, core uncovered, heatup, metal-water reaction, melting and relocation, heatup and failure of the pressure vessel, core-concrete interaction in the reactor cavity, heatup and failure of the containment building (multi-compartmented) due to quasi-static overpressurization. The results obtained permit to visualize the time sequence of these events, as well as provide the basis for source term studies. (author) [es

  14. Simultaneous sequencing of coding and noncoding RNA reveals a human transcriptome dominated by a small number of highly expressed noncoding genes.

    Science.gov (United States)

    Boivin, Vincent; Deschamps-Francoeur, Gabrielle; Couture, Sonia; Nottingham, Ryan M; Bouchard-Bourelle, Philia; Lambowitz, Alan M; Scott, Michelle S; Abou-Elela, Sherif

    2018-07-01

    Comparing the abundance of one RNA molecule to another is crucial for understanding cellular functions but most sequencing techniques can target only specific subsets of RNA. In this study, we used a new fragmented ribodepleted TGIRT sequencing method that uses a thermostable group II intron reverse transcriptase (TGIRT) to generate a portrait of the human transcriptome depicting the quantitative relationship of all classes of nonribosomal RNA longer than 60 nt. Comparison between different sequencing methods indicated that FRT is more accurate in ranking both mRNA and noncoding RNA than viral reverse transcriptase-based sequencing methods, even those that specifically target these species. Measurements of RNA abundance in different cell lines using this method correlate with biochemical estimates, confirming tRNA as the most abundant nonribosomal RNA biotype. However, the single most abundant transcript is 7SL RNA, a component of the signal recognition particle. S tructured n on c oding RNAs (sncRNAs) associated with the same biological process are expressed at similar levels, with the exception of RNAs with multiple functions like U1 snRNA. In general, sncRNAs forming RNPs are hundreds to thousands of times more abundant than their mRNA counterparts. Surprisingly, only 50 sncRNA genes produce half of the non-rRNA transcripts detected in two different cell lines. Together the results indicate that the human transcriptome is dominated by a small number of highly expressed sncRNAs specializing in functions related to translation and splicing. © 2018 Boivin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  15. Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

    Science.gov (United States)

    Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

  16. Coding patient emotional cues and concerns in medical consultations: the Verona coding definitions of emotional sequences (VR-CoDES).

    NARCIS (Netherlands)

    Zimmermann, C.; Piccolo, L. del; Bensing, J.; Bergvik, S.; Haes, H. de; Eide, H.; Fletcher, I.; Goss, C.; Heaven, C.; Humphris, G.; Young-Mi, K.; Langewitz, W.; Meeuwesen, L.; Nuebling, M.; Rimondini, M.; Salmon, P.; Dulmen, S. van; Wissow, L.; Zandbelt, L.; Finset, A.

    2011-01-01

    Objective: To present the Verona Coding Definitions of Emotional Sequences (VR-CoDES CC), a consensus based system for coding patient expressions of emotional distress in medical consultations, defined as Cues or Concerns. Methods: The system was developed by an international group of communication

  17. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  18. Deep sequencing analysis of HIV-1 reverse transcriptase at baseline and time of failure in patients receiving rilpivirine in the phase III studies ECHO and THRIVE.

    Science.gov (United States)

    Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan

    2016-05-01

    Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.

  19. PATACSDB—the database of polyA translational attenuators in coding sequences

    Directory of Open Access Journals (Sweden)

    Malgorzata Habich

    2016-02-01

    Full Text Available Recent additions to the repertoire of gene expression regulatory mechanisms are polyadenylate (polyA tracks encoding for poly-lysine runs in protein sequences. Such tracks stall the translation apparatus and induce frameshifting independently of the effects of charged nascent poly-lysine sequence on the ribosome exit channel. As such, they substantially influence the stability of mRNA and the amount of protein produced from a given transcript. Single base changes in these regions are enough to exert a measurable response on both protein and mRNA abundance; this makes each of these sequences a potentially interesting case study for the effects of synonymous mutation, gene dosage balance and natural frameshifting. Here we present PATACSDB, a resource that contain a comprehensive list of polyA tracks from over 250 eukaryotic genomes. Our data is based on the Ensembl genomic database of coding sequences and filtered with algorithm of 12A-1 which selects sequences of polyA tracks with a minimal length of 12 A’s allowing for one mismatched base. The PATACSDB database is accessible at: http://sysbio.ibb.waw.pl/patacsdb. The source code is available at http://github.com/habich/PATACSDB, and it includes the scripts with which the database can be recreated.

  20. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    KAUST Repository

    Zhang, Zhang

    2010-11-08

    Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

  1. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    KAUST Repository

    Zhang, Zhang; Yu, Jun

    2010-01-01

    Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

  2. Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

    Science.gov (United States)

    Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

    2010-02-01

    Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

  3. Optical orthogonal code-division multiple-access system - Part 2: Multibits/sequence-period OOCDMA

    Science.gov (United States)

    Kwon, Hyuck M.

    1994-08-01

    In a recently proposed optical orthogonal code division multiple-access (OOCDMA) system, one bit of user's data is transmitted per sequence-period, and a threshold is employed for the final bit decision. In this paper, a system that can transmit multibits per sequence-period is introduced, and avalanche photodiode (APD) noise, thermal noise, and interference, are included. This system, derived by exploiting orthogonal properties of the OOCDMA code sequence and using a maximum search (instead of a threshold) in the final decision, is log(sub 2) F times higher in throughput, where F is sequence-period. For example, four orders of magnitude are better in bit error probability at - 56 dBW received laser power, with F = 1000 chips, 10 'marks' in a sequence, and 10 users of 30 Mb/s data rate for one-bit/sequence-period and 270 Mb/s data rate for multibits/sequence-period system. Furthermore, an exact analysis is performed for the log(sub 2)F bits/sequence-period system with a hard-limiter placed before the receiver, and its performance is compared to the performance without hard-limiter, for the chip-synchronous case. The improvement from using a hard-limiter is significant in the log(sub 2)F bits/sequence-period OCCDMA system.

  4. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.

    Science.gov (United States)

    Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko

    2011-01-01

    HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

  5. SEAPATH: A microcomputer code for evaluating physical security effectiveness using adversary sequence diagrams

    International Nuclear Information System (INIS)

    Darby, J.L.

    1986-01-01

    The Adversary Sequence Diagram (ASD) concept was developed by Sandia National Laboratories (SNL) to examine physical security system effectiveness. Sandia also developed a mainframe computer code, PANL, to analyze the ASD. The authors have developed a microcomputer code, SEAPATH, which also analyzes ASD's. The Authors are supporting SNL in software development of the SAVI code; SAVI utilizes the SEAPATH algorithm to identify and quantify paths

  6. The Evolution of Bony Vertebrate Enhancers at Odds with Their Coding Sequence Landscape.

    Science.gov (United States)

    Yousaf, Aisha; Sohail Raza, Muhammad; Ali Abbasi, Amir

    2015-08-06

    Enhancers lie at the heart of transcriptional and developmental gene regulation. Therefore, changes in enhancer sequences usually disrupt the target gene expression and result in disease phenotypes. Despite the well-established role of enhancers in development and disease, evolutionary sequence studies are lacking. The current study attempts to unravel the puzzle of bony vertebrates' conserved noncoding elements (CNE) enhancer evolution. Bayesian phylogenetics of enhancer sequences spotlights promising interordinal relationships among placental mammals, proposing a closer relationship between humans and laurasiatherians while placing rodents at the basal position. Clock-based estimates of enhancer evolution provided a dynamic picture of interspecific rate changes across the bony vertebrate lineage. Moreover, coelacanth in the study augmented our appreciation of the vertebrate cis-regulatory evolution during water-land transition. Intriguingly, we observed a pronounced upsurge in enhancer evolution in land-dwelling vertebrates. These novel findings triggered us to further investigate the evolutionary trend of coding as well as CNE nonenhancer repertoires, to highlight the relative evolutionary dynamics of diverse genomic landscapes. Surprisingly, the evolutionary rates of enhancer sequences were clearly at odds with those of the coding and the CNE nonenhancer sequences during vertebrate adaptation to land, with land vertebrates exhibiting significantly reduced rates of coding sequence evolution in comparison to their fast evolving regulatory landscape. The observed variation in tetrapod cis-regulatory elements caused the fine-tuning of associated gene regulatory networks. Therefore, the increased evolutionary rate of tetrapods' enhancer sequences might be responsible for the variation in developmental regulatory circuits during the process of vertebrate adaptation to land. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for

  7. SRComp: short read sequence compression using burstsort and Elias omega coding.

    Directory of Open Access Journals (Sweden)

    Jeremy John Selva

    Full Text Available Next-generation sequencing (NGS technologies permit the rapid production of vast amounts of data at low cost. Economical data storage and transmission hence becomes an increasingly important challenge for NGS experiments. In this paper, we introduce a new non-reference based read sequence compression tool called SRComp. It works by first employing a fast string-sorting algorithm called burstsort to sort read sequences in lexicographical order and then Elias omega-based integer coding to encode the sorted read sequences. SRComp has been benchmarked on four large NGS datasets, where experimental results show that it can run 5-35 times faster than current state-of-the-art read sequence compression tools such as BEETL and SCALCE, while retaining comparable compression efficiency for large collections of short read sequences. SRComp is a read sequence compression tool that is particularly valuable in certain applications where compression time is of major concern.

  8. HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors

    DEFF Research Database (Denmark)

    Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran

    2017-01-01

    BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...

  9. Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.

    Directory of Open Access Journals (Sweden)

    Anna Figueiredo

    2006-11-01

    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.

  10. Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.

    Science.gov (United States)

    Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao

    2015-10-01

    Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.

  11. Multiple Access Interference Reduction Using Received Response Code Sequence for DS-CDMA UWB System

    Science.gov (United States)

    Toh, Keat Beng; Tachikawa, Shin'ichi

    This paper proposes a combination of novel Received Response (RR) sequence at the transmitter and a Matched Filter-RAKE (MF-RAKE) combining scheme receiver system for the Direct Sequence-Code Division Multiple Access Ultra Wideband (DS-CDMA UWB) multipath channel model. This paper also demonstrates the effectiveness of the RR sequence in Multiple Access Interference (MAI) reduction for the DS-CDMA UWB system. It suggests that by using conventional binary code sequence such as the M sequence or the Gold sequence, there is a possibility of generating extra MAI in the UWB system. Therefore, it is quite difficult to collect the energy efficiently although the RAKE reception method is applied at the receiver. The main purpose of the proposed system is to overcome the performance degradation for UWB transmission due to the occurrence of MAI during multiple accessing in the DS-CDMA UWB system. The proposed system improves the system performance by improving the RAKE reception performance using the RR sequence which can reduce the MAI effect significantly. Simulation results verify that significant improvement can be obtained by the proposed system in the UWB multipath channel models.

  12. Identification of evolutionarily conserved non-AUG-initiated N-terminal extensions in human coding sequences.

    LENUS (Irish Health Repository)

    Ivanov, Ivaylo P

    2011-05-01

    In eukaryotes, it is generally assumed that translation initiation occurs at the AUG codon closest to the messenger RNA 5\\' cap. However, in certain cases, initiation can occur at codons differing from AUG by a single nucleotide, especially the codons CUG, UUG, GUG, ACG, AUA and AUU. While non-AUG initiation has been experimentally verified for a handful of human genes, the full extent to which this phenomenon is utilized--both for increased coding capacity and potentially also for novel regulatory mechanisms--remains unclear. To address this issue, and hence to improve the quality of existing coding sequence annotations, we developed a methodology based on phylogenetic analysis of predicted 5\\' untranslated regions from orthologous genes. We use evolutionary signatures of protein-coding sequences as an indicator of translation initiation upstream of annotated coding sequences. Our search identified novel conserved potential non-AUG-initiated N-terminal extensions in 42 human genes including VANGL2, FGFR1, KCNN4, TRPV6, HDGF, CITED2, EIF4G3 and NTF3, and also affirmed the conservation of known non-AUG-initiated extensions in 17 other genes. In several instances, we have been able to obtain independent experimental evidence of the expression of non-AUG-initiated products from the previously published literature and ribosome profiling data.

  13. An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

    DEFF Research Database (Denmark)

    Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

    2004-01-01

    Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

  14. [Transposition errors during learning to reproduce a sequence by the right- and the left-hand movements: simulation of positional and movement coding].

    Science.gov (United States)

    Liakhovetskiĭ, V A; Bobrova, E V; Skopin, G N

    2012-01-01

    Transposition errors during the reproduction of a hand movement sequence make it possible to receive important information on the internal representation of this sequence in the motor working memory. Analysis of such errors showed that learning to reproduce sequences of the left-hand movements improves the system of positional coding (coding ofpositions), while learning of the right-hand movements improves the system of vector coding (coding of movements). Learning of the right-hand movements after the left-hand performance involved the system of positional coding "imposed" by the left hand. Learning of the left-hand movements after the right-hand performance activated the system of vector coding. Transposition errors during learning to reproduce movement sequences can be explained by neural network using either vector coding or both vector and positional coding.

  15. Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

    International Nuclear Information System (INIS)

    Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.

    2004-01-01

    Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

  16. Analysis of the AD sequence in Zion plant using the March 1.1 code

    International Nuclear Information System (INIS)

    Oriolo, F.; Paci, S.

    1985-01-01

    The analyses of the AD sequences for the Zion power plant, made at the Pisa University, in the framework of the participation in the Source Tern Working Group. After a short description of the plant and the sequence under analysis, the model used for the reference computation and the results obtained using the March 1.1 code are shown. Together with the reference computation a series of parametric tests have been also made, concerning some input code variables, in order to ascertain their influence on the transient trend. The results of these analyses are shown in Appendix

  17. Sequence Coding and Search System for licensee event reports: coder's manual. Volume 4

    International Nuclear Information System (INIS)

    Gallaher, R.B.; Guymon, R.H.; Mays, G.T.; Poore, W.P.; Cagle, R.J.; Harrington, K.H.; Johnson, M.P.

    1985-04-01

    Operating experience data from nuclear power plants are essential for safety and reliability analyses, especially analyses of trends and patterns. The licensee event reports (LERs) that are submitted to the Nuclear Regulatory Commission (NRC) by the nuclear power plant utilities contain much of this data. The NRC's Office for Analysis and Evaluation of Operational Data (AEOD) has developed, under contract with NSIC, a system for codifying the events reported in the LERs. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the LERs to coded sequences that are both computer-readable and computer-searchable. This four volume report documents and describes SCSS in detail. Volume 3 and 4 provide a technical processor, new to SCSS, the information and methodology necessary to capture descriptive data from the LER and to codify that data into a structured format and serve as reference material for the more experienced technical processor, and contains information that is essential for the more advanced user who needs to be familiar with the intricate coding techniques in order to retrieve specific details in a sequence. This volume contains updated material through amendment 1 to revision 1 of the working version of ORNL/NSIC-223, Vol. 4

  18. Sequence Coding and Search System for licensee event reports: coder's manual. Volume 3

    International Nuclear Information System (INIS)

    Gallaher, R.B.; Guymon, R.H.; Mays, G.T.; Poore, W.P.; Cagle, R.J.; Harrington, K.H.; Johnson, M.P.

    1985-04-01

    Operating experience data from nuclear power plants are essential for safety and reliability analyses, especially analyses of trends and patterns. The licensee event reports (LERs) that are submitted to the Nuclear Regulatory Commission (NRC) by the nuclear power plant utilities contain much of this data. The NRC's Office for Analysis and Evaluation of Operational Data (AEOD) has developed, under contract with NSIC, a system for codifying the events reported in the LERs. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the LERs to coded sequences that are both computer-readable and computer-searchable. This four volume report documents and describes SCSS in detail. Volumes 3 and 4 provide a technical processor, new to SCSS, the information and methodology necessary to capture descriptive data from the LER and to codify that data into a structured format and serve as reference material for the more experienced technical processor, and contains information is essential for the more advanced user who needs to be familiar with the intricate coding techniques in order to retrieve specific details in a sequence. This volume contains updated material through amendment 1 to revision 1 of the working version of ORNL/NSIC-223, Vol. 3

  19. Sequence Coding and Search System Backfit Quality Assurance Program Plan

    International Nuclear Information System (INIS)

    Lovell, C.J.; Stepina, P.L.

    1985-03-01

    The Sequence Coding and Search System is a computer-based encoding system for events described in Licensee Event Reports. This data system contains LERs from 1981 to present. Backfit of the data system to include LERs prior to 1981 is required. This report documents the Quality Assurance Program Plan that EG and G Idaho, Inc. will follow while encoding 1980 LERs

  20. Modelling of blackout sequence at Atucha-1 using the MARCH3 code

    International Nuclear Information System (INIS)

    Baron, J.; Bastianelli, B.

    1997-01-01

    This paper presents the modelling of a complete blackout at the Atucha-1 NPP as preliminary phase for a Level II safety probabilistic analysis. The MARCH3 code of the STCP (Source Term Code Package) is used, based on a plant model made in accordance with particularities of the plant design. The analysis covers all the severe accident phases. The results allow to view the time sequence of the events, and provide the basis for source term studies. (author). 6 refs., 2 figs

  1. Complete coding sequence of Zika virus from Martinique outbreak in 2015

    Directory of Open Access Journals (Sweden)

    G. Piorkowski

    2016-05-01

    Full Text Available Zika virus is an Aedes-borne Flavivirus causing fever, arthralgia, myalgia rash, associated with Guillain–Barré syndrome and suspected to induce microcephaly in the fetus. We report here the complete coding sequence of the first characterized Caribbean Zika virus strain, isolated from a patient from Martinique in December, 2015.

  2. Source coherence impairments in a direct detection direct sequence optical code-division multiple-access system.

    Science.gov (United States)

    Fsaifes, Ihsan; Lepers, Catherine; Lourdiane, Mounia; Gallion, Philippe; Beugin, Vincent; Guignard, Philippe

    2007-02-01

    We demonstrate that direct sequence optical code- division multiple-access (DS-OCDMA) encoders and decoders using sampled fiber Bragg gratings (S-FBGs) behave as multipath interferometers. In that case, chip pulses of the prime sequence codes generated by spreading in time-coherent data pulses can result from multiple reflections in the interferometers that can superimpose within a chip time duration. We show that the autocorrelation function has to be considered as the sum of complex amplitudes of the combined chip as the laser source coherence time is much greater than the integration time of the photodetector. To reduce the sensitivity of the DS-OCDMA system to the coherence time of the laser source, we analyze the use of sparse and nonperiodic quadratic congruence and extended quadratic congruence codes.

  3. Source coherence impairments in a direct detection direct sequence optical code-division multiple-access system

    Science.gov (United States)

    Fsaifes, Ihsan; Lepers, Catherine; Lourdiane, Mounia; Gallion, Philippe; Beugin, Vincent; Guignard, Philippe

    2007-02-01

    We demonstrate that direct sequence optical code- division multiple-access (DS-OCDMA) encoders and decoders using sampled fiber Bragg gratings (S-FBGs) behave as multipath interferometers. In that case, chip pulses of the prime sequence codes generated by spreading in time-coherent data pulses can result from multiple reflections in the interferometers that can superimpose within a chip time duration. We show that the autocorrelation function has to be considered as the sum of complex amplitudes of the combined chip as the laser source coherence time is much greater than the integration time of the photodetector. To reduce the sensitivity of the DS-OCDMA system to the coherence time of the laser source, we analyze the use of sparse and nonperiodic quadratic congruence and extended quadratic congruence codes.

  4. IdentiCS – Identification of coding sequence and in silico reconstruction of the metabolic network directly from unannotated low-coverage bacterial genome sequence

    Directory of Open Access Journals (Sweden)

    Zeng An-Ping

    2004-08-01

    Full Text Available Abstract Background A necessary step for a genome level analysis of the cellular metabolism is the in silico reconstruction of the metabolic network from genome sequences. The available methods are mainly based on the annotation of genome sequences including two successive steps, the prediction of coding sequences (CDS and their function assignment. The annotation process takes time. The available methods often encounter difficulties when dealing with unfinished error-containing genomic sequence. Results In this work a fast method is proposed to use unannotated genome sequence for predicting CDSs and for an in silico reconstruction of metabolic networks. Instead of using predicted genes or CDSs to query public databases, entries from public DNA or protein databases are used as queries to search a local database of the unannotated genome sequence to predict CDSs. Functions are assigned to the predicted CDSs simultaneously. The well-annotated genome of Salmonella typhimurium LT2 is used as an example to demonstrate the applicability of the method. 97.7% of the CDSs in the original annotation are correctly identified. The use of SWISS-PROT-TrEMBL databases resulted in an identification of 98.9% of CDSs that have EC-numbers in the published annotation. Furthermore, two versions of sequences of the bacterium Klebsiella pneumoniae with different genome coverage (3.9 and 7.9 fold, respectively are examined. The results suggest that a 3.9-fold coverage of the bacterial genome could be sufficiently used for the in silico reconstruction of the metabolic network. Compared to other gene finding methods such as CRITICA our method is more suitable for exploiting sequences of low genome coverage. Based on the new method, a program called IdentiCS (Identification of Coding Sequences from Unfinished Genome Sequences is delivered that combines the identification of CDSs with the reconstruction, comparison and visualization of metabolic networks (free to download

  5. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    Science.gov (United States)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  6. Licensee Event Report sequence coding and search procedure workshop

    International Nuclear Information System (INIS)

    Cottrell, W.B.; Gallaher, R.B.

    1981-01-01

    Since mid-1980, the Office for Analysis and Evaluation of Operational Data (AEOD) of the Nuclear Regulatory Commission (NRC) has been developing procedures for the systematic review and analysis of Licensee Event Reports (LERs). These procedures generally address several areas of concern, including identification of significant trends and patterns, event sequence of occurrences, component failures, and system and plant effects. The AEOD and NSIC conducted a workshop on the new coding procedure at the American Museum of Science and Energy in Oak Ridge, TN, on November 24, 1980

  7. [Influence of "prehistory" of sequential movements of the right and the left hand on reproduction: coding of positions, movements and sequence structure].

    Science.gov (United States)

    Bobrova, E V; Liakhovetskiĭ, V A; Borshchevskaia, E R

    2011-01-01

    The dependence of errors during reproduction of a sequence of hand movements without visual feedback on the previous right- and left-hand performance ("prehistory") and on positions in space of sequence elements (random or ordered by the explicit rule) was analyzed. It was shown that the preceding information about the ordered positions of the sequence elements was used during right-hand movements, whereas left-hand movements were performed with involvement of the information about the random sequence. The data testify to a central mechanism of the analysis of spatial structure of sequence elements. This mechanism activates movement coding specific for the left hemisphere (vector coding) in case of an ordered sequence structure and positional coding specific for the right hemisphere in case of a random sequence structure.

  8. Two-terminal video coding.

    Science.gov (United States)

    Yang, Yang; Stanković, Vladimir; Xiong, Zixiang; Zhao, Wei

    2009-03-01

    Following recent works on the rate region of the quadratic Gaussian two-terminal source coding problem and limit-approaching code designs, this paper examines multiterminal source coding of two correlated, i.e., stereo, video sequences to save the sum rate over independent coding of both sequences. Two multiterminal video coding schemes are proposed. In the first scheme, the left sequence of the stereo pair is coded by H.264/AVC and used at the joint decoder to facilitate Wyner-Ziv coding of the right video sequence. The first I-frame of the right sequence is successively coded by H.264/AVC Intracoding and Wyner-Ziv coding. An efficient stereo matching algorithm based on loopy belief propagation is then adopted at the decoder to produce pixel-level disparity maps between the corresponding frames of the two decoded video sequences on the fly. Based on the disparity maps, side information for both motion vectors and motion-compensated residual frames of the right sequence are generated at the decoder before Wyner-Ziv encoding. In the second scheme, source splitting is employed on top of classic and Wyner-Ziv coding for compression of both I-frames to allow flexible rate allocation between the two sequences. Experiments with both schemes on stereo video sequences using H.264/AVC, LDPC codes for Slepian-Wolf coding of the motion vectors, and scalar quantization in conjunction with LDPC codes for Wyner-Ziv coding of the residual coefficients give a slightly lower sum rate than separate H.264/AVC coding of both sequences at the same video quality.

  9. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.

    2011-01-01

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

  10. Enhanced Protein Production in Escherichia coli by Optimization of Cloning Scars at the Vector-Coding Sequence Junction

    DEFF Research Database (Denmark)

    Mirzadeh, Kiavash; Martinez, Virginia; Toddo, Stephen

    2015-01-01

    are poorly expressed even when they are codon-optimized and expressed from vectors with powerful genetic elements. In this study, we show that poor expression can be caused by certain nucleotide sequences (e.g., cloning scars) at the junction between the vector and the coding sequence. Since these sequences...

  11. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali

    2015-11-27

    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  12. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki

    2015-01-01

    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  13. FOURTH SEMINAR TO THE MEMORY OF D.N. KLYSHKO: Algebraic solution of the synthesis problem for coded sequences

    Science.gov (United States)

    Leukhin, Anatolii N.

    2005-08-01

    The algebraic solution of a 'complex' problem of synthesis of phase-coded (PC) sequences with the zero level of side lobes of the cyclic autocorrelation function (ACF) is proposed. It is shown that the solution of the synthesis problem is connected with the existence of difference sets for a given code dimension. The problem of estimating the number of possible code combinations for a given code dimension is solved. It is pointed out that the problem of synthesis of PC sequences is related to the fundamental problems of discrete mathematics and, first of all, to a number of combinatorial problems, which can be solved, as the number factorisation problem, by algebraic methods by using the theory of Galois fields and groups.

  14. Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.

    Science.gov (United States)

    Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari

    2018-05-03

    Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.

  15. SinEx DB: a database for single exon coding sequences in mammalian genomes.

    Science.gov (United States)

    Jorquera, Roddy; Ortiz, Rodrigo; Ossandon, F; Cárdenas, Juan Pablo; Sepúlveda, Rene; González, Carolina; Holmes, David S

    2016-01-01

    Eukaryotic genes are typically interrupted by intragenic, noncoding sequences termed introns. However, some genes lack introns in their coding sequence (CDS) and are generally known as 'single exon genes' (SEGs). In this work, a SEG is defined as a nuclear, protein-coding gene that lacks introns in its CDS. Whereas, many public databases of Eukaryotic multi-exon genes are available, there are only two specialized databases for SEGs. The present work addresses the need for a more extensive and diverse database by creating SinEx DB, a publicly available, searchable database of predicted SEGs from 10 completely sequenced mammalian genomes including human. SinEx DB houses the DNA and protein sequence information of these SEGs and includes their functional predictions (KOG) and the relative distribution of these functions within species. The information is stored in a relational database built with My SQL Server 5.1.33 and the complete dataset of SEG sequences and their functional predictions are available for downloading. SinEx DB can be interrogated by: (i) a browsable phylogenetic schema, (ii) carrying out BLAST searches to the in-house SinEx DB of SEGs and (iii) via an advanced search mode in which the database can be searched by key words and any combination of searches by species and predicted functions. SinEx DB provides a rich source of information for advancing our understanding of the evolution and function of SEGs.Database URL: www.sinex.cl. © The Author(s) 2016. Published by Oxford University Press.

  16. RevTrans: multiple alignment of coding DNA from aligned amino acid sequences

    DEFF Research Database (Denmark)

    Wernersson, Rasmus; Pedersen, Anders Gorm

    2003-01-01

    The simple fact that proteins are built from 20 amino acids while DNA only contains four different bases, means that the 'signal-to-noise ratio' in protein sequence alignments is much better than in alignments of DNA. Besides this information-theoretical advantage, protein alignments also benefit...... proteins. It is therefore preferable to align coding DNA at the amino acid level and it is for this purpose we have constructed the program RevTrans. RevTrans constructs a multiple DNA alignment by: (i) translating the DNA; (ii) aligning the resulting peptide sequences; and (iii) building a multiple DNA...

  17. Diagnostic and prognostic signatures from the small non-coding RNA transcriptome in prostate cancer

    DEFF Research Database (Denmark)

    Martens-Uzunova, E S; Jalava, S E; Dits, N F

    2011-01-01

    Prostate cancer (PCa) is the most frequent male malignancy and the second most common cause of cancer-related death in Western countries. Current clinical and pathological methods are limited in the prediction of postoperative outcome. It is becoming increasingly evident that small non-coding RNA...... signatures of 102 fresh-frozen patient samples during PCa progression by miRNA microarrays. Both platforms were cross-validated by quantitative reverse transcriptase-PCR. Besides the altered expression of several miRNAs, our deep sequencing analyses revealed strong differential expression of small nucleolar...... RNAs (snoRNAs) and transfer RNAs (tRNAs). From microarray analysis, we derived a miRNA diagnostic classifier that accurately distinguishes normal from cancer samples. Furthermore, we were able to construct a PCa prognostic predictor that independently forecasts postoperative outcome. Importantly...

  18. SHARAKU: an algorithm for aligning and clustering read mapping profiles of deep sequencing in non-coding RNA processing.

    Science.gov (United States)

    Tsuchiya, Mariko; Amano, Kojiro; Abe, Masaya; Seki, Misato; Hase, Sumitaka; Sato, Kengo; Sakakibara, Yasubumi

    2016-06-15

    Deep sequencing of the transcripts of regulatory non-coding RNA generates footprints of post-transcriptional processes. After obtaining sequence reads, the short reads are mapped to a reference genome, and specific mapping patterns can be detected called read mapping profiles, which are distinct from random non-functional degradation patterns. These patterns reflect the maturation processes that lead to the production of shorter RNA sequences. Recent next-generation sequencing studies have revealed not only the typical maturation process of miRNAs but also the various processing mechanisms of small RNAs derived from tRNAs and snoRNAs. We developed an algorithm termed SHARAKU to align two read mapping profiles of next-generation sequencing outputs for non-coding RNAs. In contrast with previous work, SHARAKU incorporates the primary and secondary sequence structures into an alignment of read mapping profiles to allow for the detection of common processing patterns. Using a benchmark simulated dataset, SHARAKU exhibited superior performance to previous methods for correctly clustering the read mapping profiles with respect to 5'-end processing and 3'-end processing from degradation patterns and in detecting similar processing patterns in deriving the shorter RNAs. Further, using experimental data of small RNA sequencing for the common marmoset brain, SHARAKU succeeded in identifying the significant clusters of read mapping profiles for similar processing patterns of small derived RNA families expressed in the brain. The source code of our program SHARAKU is available at http://www.dna.bio.keio.ac.jp/sharaku/, and the simulated dataset used in this work is available at the same link. Accession code: The sequence data from the whole RNA transcripts in the hippocampus of the left brain used in this work is available from the DNA DataBank of Japan (DDBJ) Sequence Read Archive (DRA) under the accession number DRA004502. yasu@bio.keio.ac.jp Supplementary data are available

  19. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  20. Coding and decoding libraries of sequence-defined functional copolymers synthesized via photoligation.

    Science.gov (United States)

    Zydziak, Nicolas; Konrad, Waldemar; Feist, Florian; Afonin, Sergii; Weidner, Steffen; Barner-Kowollik, Christopher

    2016-11-30

    Designing artificial macromolecules with absolute sequence order represents a considerable challenge. Here we report an advanced light-induced avenue to monodisperse sequence-defined functional linear macromolecules up to decamers via a unique photochemical approach. The versatility of the synthetic strategy-combining sequential and modular concepts-enables the synthesis of perfect macromolecules varying in chemical constitution and topology. Specific functions are placed at arbitrary positions along the chain via the successive addition of monomer units and blocks, leading to a library of functional homopolymers, alternating copolymers and block copolymers. The in-depth characterization of each sequence-defined chain confirms the precision nature of the macromolecules. Decoding of the functional information contained in the molecular structure is achieved via tandem mass spectrometry without recourse to their synthetic history, showing that the sequence information can be read. We submit that the presented photochemical strategy is a viable and advanced concept for coding individual monomer units along a macromolecular chain.

  1. Comparisons between Arabidopsis thaliana and Drosophila melanogaster in relation to Coding and Noncoding Sequence Length and Gene Expression

    Directory of Open Access Journals (Sweden)

    Rachel Caldwell

    2015-01-01

    Full Text Available There is a continuing interest in the analysis of gene architecture and gene expression to determine the relationship that may exist. Advances in high-quality sequencing technologies and large-scale resource datasets have increased the understanding of relationships and cross-referencing of expression data to the large genome data. Although a negative correlation between expression level and gene (especially transcript length has been generally accepted, there have been some conflicting results arising from the literature concerning the impacts of different regions of genes, and the underlying reason is not well understood. The research aims to apply quantile regression techniques for statistical analysis of coding and noncoding sequence length and gene expression data in the plant, Arabidopsis thaliana, and fruit fly, Drosophila melanogaster, to determine if a relationship exists and if there is any variation or similarities between these species. The quantile regression analysis found that the coding sequence length and gene expression correlations varied, and similarities emerged for the noncoding sequence length (5′ and 3′ UTRs between animal and plant species. In conclusion, the information described in this study provides the basis for further exploration into gene regulation with regard to coding and noncoding sequence length.

  2. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  3. An Explicit Construction of a sequence of codes attaining the Tsfasman-Vladut-Zink Bound:The first steps

    DEFF Research Database (Denmark)

    Høholdt, Tom; Voss, Cornelia

    1997-01-01

    We present a sequence of codes attaining the Tsfasman-Vladut-Zink bound. The construction is based on the tower of Artin-Schreier extensions described by Garcia and Stichtenoth (1995). We also determine the dual codes. The first steps of the constructions are explicitly given as generator matrices...

  4. Coding sequence of human rho cDNAs clone 6 and clone 9

    Energy Technology Data Exchange (ETDEWEB)

    Chardin, P; Madaule, P; Tavitian, A

    1988-03-25

    The authors have isolated human cDNAs including the complete coding sequence for two rho proteins corresponding to the incomplete isolates previously described as clone 6 and clone 9. The deduced a.a. sequences, when compared to the a.a. sequence deduced from clone 12 cDNA, show that there are in human at least three highly homologous rho genes. They suggest that clone 12 be named rhoA, clone 6 : rhoB and clone 9 : rhoC. RhoA, B and C proteins display approx. 30% a.a. identity with ras proteins,. mainly clustered in four highly homologous internal regions corresponding to the GTP binding site; however at least one significant difference is found; the 3 rho proteins have an Alanine in position corresponding to ras Glycine 13, suggesting that rho and ras proteins might have slightly different biochemical properties.

  5. Application of Melcor code for the calculo of TMLB sequence in PWR with natural circulating into the vessel

    International Nuclear Information System (INIS)

    Marten-Fuertes, F.

    1995-01-01

    The use of computer codes to analyze the phenomena of severe accidents is very important to take decisions in Nuclear Safety. This paper presents the MELCOR code used to calculate the TMLB sequence of PWR with natural circulation into the vessels. The main goal of this code is its application for the PSA (probabilistic safety analysis)

  6. The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2014-03-01

    Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

  7. Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity

    Science.gov (United States)

    House, M.L.; Kim, C.H.; Reno, P.W.

    1998-01-01

    Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.

  8. Calibrated user-friendly reverse transcriptase-PCR assay

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Rammer, P

    1998-01-01

    We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...

  9. Episodic sequence memory is supported by a theta-gamma phase code

    OpenAIRE

    Heusser, Andrew C.; Poeppel, David; Ezzyat, Youssef; Davachi, Lila

    2016-01-01

    The meaning we derive from our experiences is not a simple static extraction of the elements, but is largely based on the order in which those elements occur. Models propose that sequence encoding is supported by interactions between high and low frequency oscillations, such that elements within an experience are represented by neural cell assemblies firing at higher frequencies (i.e. gamma) and sequential order is coded by the specific timing of firing with respect to a lower frequency oscil...

  10. Code-Switching to Know a TL Equivalent of an L1 Word: Request-Provision-Acknowledgement (RPA) Sequence

    Science.gov (United States)

    Lucero, Edgar

    2011-01-01

    This article focuses on the learner's use of Code-switching to learn the TL (Target Language) equivalent of an L1 word. The interactional pattern that this situation creates defines the Request-Provision-Acknowledgement (RPA) sequence. The article explains each of the turns of the sequence under the combination of the Ethnomethodological…

  11. Sequence-based heuristics for faster annotation of non-coding RNA families.

    Science.gov (United States)

    Weinberg, Zasha; Ruzzo, Walter L

    2006-01-01

    Non-coding RNAs (ncRNAs) are functional RNA molecules that do not code for proteins. Covariance Models (CMs) are a useful statistical tool to find new members of an ncRNA gene family in a large genome database, using both sequence and, importantly, RNA secondary structure information. Unfortunately, CM searches are extremely slow. Previously, we created rigorous filters, which provably sacrifice none of a CM's accuracy, while making searches significantly faster for virtually all ncRNA families. However, these rigorous filters make searches slower than heuristics could be. In this paper we introduce profile HMM-based heuristic filters. We show that their accuracy is usually superior to heuristics based on BLAST. Moreover, we compared our heuristics with those used in tRNAscan-SE, whose heuristics incorporate a significant amount of work specific to tRNAs, where our heuristics are generic to any ncRNA. Performance was roughly comparable, so we expect that our heuristics provide a high-quality solution that--unlike family-specific solutions--can scale to hundreds of ncRNA families. The source code is available under GNU Public License at the supplementary web site.

  12. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  13. Transduplication resulted in the incorporation of two protein-coding sequences into the Turmoil-1 transposable element of C. elegans

    Directory of Open Access Journals (Sweden)

    Pupko Tal

    2008-10-01

    Full Text Available Abstract Transposable elements may acquire unrelated gene fragments into their sequences in a process called transduplication. Transduplication of protein-coding genes is common in plants, but is unknown of in animals. Here, we report that the Turmoil-1 transposable element in C. elegans has incorporated two protein-coding sequences into its inverted terminal repeat (ITR sequences. The ITRs of Turmoil-1 contain a conserved RNA recognition motif (RRM that originated from the rsp-2 gene and a fragment from the protein-coding region of the cpg-3 gene. We further report that an open reading frame specific to C. elegans may have been created as a result of a Turmoil-1 insertion. Mutations at the 5' splice site of this open reading frame may have reactivated the transduplicated RRM motif. Reviewers This article was reviewed by Dan Graur and William Martin. For the full reviews, please go to the Reviewers' Reports section.

  14. Sequence Coding and Search System for licensee event reports: user's guide. Volume 1, Revision 1

    International Nuclear Information System (INIS)

    Greene, N.M.; Mays, G.T.; Johnson, M.P.

    1985-04-01

    Operating experience data from nuclear power plants are essential for safety and reliability analyses, especially analyses of trends and patterns. The licensee event reports (LERs) that are submitted to the Nuclear Regulatory Commission (NRC) by the nuclear power plant utilities contain much of this data. The NRC's Office for Analysis and Evaluation of Operational Data (AEOD) has developed, under contract with NSIC, a system for codifying the events reported in the LERs. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the LERs to coded sequences that are both computer-readable and computer-searchable. This system provides a structured format for detailed coding of component, system, and unit effects as well as personnel errors. The database contains all current LERs submitted by nuclear power plant utilities for events occurring since 1981 and is updated on a continual basis. This four volume report documents and describes SCSS in detail. Volume 1 is a User's Guide for searching the SCSS database. This volume contains updated material through February 1985 of the working version of ORNL/NSIC-223, Vol. 1

  15. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

    Science.gov (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

    2007-10-01

    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  16. Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

    OpenAIRE

    Liljeström, P L; Liljeström, P

    1987-01-01

    Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

  17. Hybridization-based reconstruction of small non-coding RNA transcripts from deep sequencing data.

    Science.gov (United States)

    Ragan, Chikako; Mowry, Bryan J; Bauer, Denis C

    2012-09-01

    Recent advances in RNA sequencing technology (RNA-Seq) enables comprehensive profiling of RNAs by producing millions of short sequence reads from size-fractionated RNA libraries. Although conventional tools for detecting and distinguishing non-coding RNAs (ncRNAs) from reference-genome data can be applied to sequence data, ncRNA detection can be improved by harnessing the full information content provided by this new technology. Here we present NorahDesk, the first unbiased and universally applicable method for small ncRNAs detection from RNA-Seq data. NorahDesk utilizes the coverage-distribution of small RNA sequence data as well as thermodynamic assessments of secondary structure to reliably predict and annotate ncRNA classes. Using publicly available mouse sequence data from brain, skeletal muscle, testis and ovary, we evaluated our method with an emphasis on the performance for microRNAs (miRNAs) and piwi-interacting small RNA (piRNA). We compared our method with Dario and mirDeep2 and found that NorahDesk produces longer transcripts with higher read coverage. This feature makes it the first method particularly suitable for the prediction of both known and novel piRNAs.

  18. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires.

    Science.gov (United States)

    Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z

    2017-07-11

    Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From

  19. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites

    Directory of Open Access Journals (Sweden)

    Stafford Phillip

    2009-09-01

    Full Text Available Abstract Background Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder, is provided in this paper and applied to find or create potential recognition sites in target coding sequences. Results ICRPfinder is applied to find or create restriction enzyme recognition sites by introducing silent mutations. The algorithm is shown capable of mapping existing cut-sites but importantly it also can generate specified new unique cut-sites within a specified region that are guaranteed not to be present elsewhere in the DNA sequence. Conclusion ICRPfinder is a powerful tool for finding or creating specific DNA patterns in a given target coding sequence. ICRPfinder finds or creates patterns, which can include restriction enzyme recognition sites, without changing the translated protein sequence. ICRPfinder is a browser-based JavaScript application and it can run on any platform, in on-line or off-line mode.

  20. Novel HBV recombinants between genotypes B and C in 3'-terminal reverse transcriptase (RT) sequences are associated with enhanced viral DNA load, higher RT point mutation rates and place of birth among Chinese patients.

    Science.gov (United States)

    Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong

    2018-01-01

    As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.

  1. Complete coding sequence of the human raf oncogene and the corresponding structure of the c-raf-1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Bonner, T I; Oppermann, H; Seeburg, P; Kerby, S B; Gunnell, M A; Young, A C; Rapp, U R

    1986-01-24

    The complete 648 amino acid sequence of the human raf oncogene was deduced from the 2977 nucleotide sequence of a fetal liver cDNA. The cDNA has been used to obtain clones which extend the human c-raf-1 locus by an additional 18.9 kb at the 5' end and contain all the remaining coding exons.

  2. The Number, Organization, and Size of Polymorphic Membrane Protein Coding Sequences as well as the Most Conserved Pmp Protein Differ within and across Chlamydia Species.

    Science.gov (United States)

    Van Lent, Sarah; Creasy, Heather Huot; Myers, Garry S A; Vanrompay, Daisy

    2016-01-01

    Variation is a central trait of the polymorphic membrane protein (Pmp) family. The number of pmp coding sequences differs between Chlamydia species, but it is unknown whether the number of pmp coding sequences is constant within a Chlamydia species. The level of conservation of the Pmp proteins has previously only been determined for Chlamydia trachomatis. As different Pmp proteins might be indispensible for the pathogenesis of different Chlamydia species, this study investigated the conservation of Pmp proteins both within and across C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci. The pmp coding sequences were annotated in 16 C. trachomatis, 6 C. pneumoniae, 2 C. abortus, and 16 C. psittaci genomes. The number and organization of polymorphic membrane coding sequences differed within and across the analyzed Chlamydia species. The length of coding sequences of pmpA,pmpB, and pmpH was conserved among all analyzed genomes, while the length of pmpE/F and pmpG, and remarkably also of the subtype pmpD, differed among the analyzed genomes. PmpD, PmpA, PmpH, and PmpA were the most conserved Pmp in C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci, respectively. PmpB was the most conserved Pmp across the 4 analyzed Chlamydia species. © 2016 S. Karger AG, Basel.

  3. The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA

    Directory of Open Access Journals (Sweden)

    Niu Meijuan

    2004-10-01

    Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.

  4. Application of the verona coding definitions of emotional sequences (VR-CoDES) on a pediatric data set.

    Science.gov (United States)

    Vatne, Torun M; Finset, Arnstein; Ørnes, Knut; Ruland, Cornelia M

    2010-09-01

    Adult patients present concerns as defined in the Verona Coding Definitions of Emotional Sequences (VR-CoDES), but we do not know how children express their concerns during medical consultations. This study aimed to evaluate the applicability of VR-CoDES to pediatric oncology consultations. Twenty-eight pediatric consultations were coded with the Verona Coding Definitions of Emotional Sequences (VR-CoDES), and the material was also qualitatively analyzed for descriptive purposes. Five consultations were randomly selected for reliability testing and descriptive statistics were computed. Perfect inter-rater reliability for concerns and moderate reliability for cues were obtained. Cues and/or concerns were present in over half of the consultations. Cues were more frequent than concerns, with the majority of cues being verbal hints to hidden concerns or non-verbal cues. Intensity of expressions, limitations in vocabulary, commonality of statements, and complexity of the setting complicated the use of VR-CoDES. Child-specific cues; use of the imperative, cues about past experiences, and use of onomatopoeia were observed. Children with cancer express concerns during medical consultations. VR-CoDES is a reliable tool for coding concerns in pediatric data sets. For future applications in pediatric settings an appendix should be developed to incorporate the child-specific traits. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

  5. A versatile palindromic amphipathic repeat coding sequence horizontally distributed among diverse bacterial and eucaryotic microbes

    Directory of Open Access Journals (Sweden)

    Glass John I

    2010-07-01

    repeat may be disseminated by HGT and intra-genomic shuffling. Conclusions We describe novel features of PARCELs (Palindromic Amphipathic Repeat Coding ELements, a set of widely distributed repeat protein domains and coding sequences that were likely acquired through HGT by diverse unicellular microbes, further mobilized and diversified within genomes, and co-opted for expression in the membrane proteome of some taxa. Disseminated by multiple gene-centric vehicles, ORFs harboring these elements enhance accessory gene pools as part of the "mobilome" connecting genomes of various clades, in taxa sharing common niches.

  6. A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome

    Directory of Open Access Journals (Sweden)

    Marcin Kierczak

    2009-10-01

    Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.

  7. Consensus coding sequence (CCDS) database: a standardized set of human and mouse protein-coding regions supported by expert curation.

    Science.gov (United States)

    Pujar, Shashikant; O'Leary, Nuala A; Farrell, Catherine M; Loveland, Jane E; Mudge, Jonathan M; Wallin, Craig; Girón, Carlos G; Diekhans, Mark; Barnes, If; Bennett, Ruth; Berry, Andrew E; Cox, Eric; Davidson, Claire; Goldfarb, Tamara; Gonzalez, Jose M; Hunt, Toby; Jackson, John; Joardar, Vinita; Kay, Mike P; Kodali, Vamsi K; Martin, Fergal J; McAndrews, Monica; McGarvey, Kelly M; Murphy, Michael; Rajput, Bhanu; Rangwala, Sanjida H; Riddick, Lillian D; Seal, Ruth L; Suner, Marie-Marthe; Webb, David; Zhu, Sophia; Aken, Bronwen L; Bruford, Elspeth A; Bult, Carol J; Frankish, Adam; Murphy, Terence; Pruitt, Kim D

    2018-01-04

    The Consensus Coding Sequence (CCDS) project provides a dataset of protein-coding regions that are identically annotated on the human and mouse reference genome assembly in genome annotations produced independently by NCBI and the Ensembl group at EMBL-EBI. This dataset is the product of an international collaboration that includes NCBI, Ensembl, HUGO Gene Nomenclature Committee, Mouse Genome Informatics and University of California, Santa Cruz. Identically annotated coding regions, which are generated using an automated pipeline and pass multiple quality assurance checks, are assigned a stable and tracked identifier (CCDS ID). Additionally, coordinated manual review by expert curators from the CCDS collaboration helps in maintaining the integrity and high quality of the dataset. The CCDS data are available through an interactive web page (https://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi) and an FTP site (ftp://ftp.ncbi.nlm.nih.gov/pub/CCDS/). In this paper, we outline the ongoing work, growth and stability of the CCDS dataset and provide updates on new collaboration members and new features added to the CCDS user interface. We also present expert curation scenarios, with specific examples highlighting the importance of an accurate reference genome assembly and the crucial role played by input from the research community. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  8. Phylogeny and resistance profiles of HIV-1 POL sequences from rectal biopsies and blood

    DEFF Research Database (Denmark)

    Katzenstein, Terese Lea; Petersen, A B; Storgaard, M

    2010-01-01

    The phylogeny and resistance profiles of human immunodeficiency virus type 1 (HIV-1) protease (PR) and reverse transcriptase (RT) sequences were compared among six patients with HIV-1 who had received numerous treatments. RNA and DNA fractions were obtained from concurrent blood and rectal biopsy...

  9. The sequence coding and search system: An approach for constructing and analyzing event sequences at commercial nuclear power plants

    International Nuclear Information System (INIS)

    Mays, G.T.

    1989-04-01

    The US Nuclear Regulatory Commission (NRC) has recognized the importance of the collection, assessment, and feedstock of operating experience data from commercial nuclear power plants and has centralized these activities in the Office for Analysis and Evaluation of Operational Data (AEOD). Such data is essential for performing safety and reliability analyses, especially analyses of trends and patterns to identify undesirable changes in plant performance at the earliest opportunity to implement corrective measures to preclude the occurrences of a more serious event. One of NRC's principal tools for collecting and evaluating operating experience data is the Sequence Coding and Search System (SCSS). The SCSS consists of a methodology for structuring event sequences and the requisite computer system to store and search the data. The source information for SCSS is the Licensee Event Report (LER), which is a legally required document. This paper describes the objective SCSS, the information it contains, and the format and approach for constructuring SCSS event sequences. Examples are presented demonstrating the use SCSS to support the analysis of LER data. The SCSS contains over 30,000 LERs describing events from 1980 through the present. Insights gained from working with a complex data system from the initial developmental stage to the point of a mature operating system are highlighted

  10. LZW-Kernel: fast kernel utilizing variable length code blocks from LZW compressors for protein sequence classification.

    Science.gov (United States)

    Filatov, Gleb; Bauwens, Bruno; Kertész-Farkas, Attila

    2018-05-07

    Bioinformatics studies often rely on similarity measures between sequence pairs, which often pose a bottleneck in large-scale sequence analysis. Here, we present a new convolutional kernel function for protein sequences called the LZW-Kernel. It is based on code words identified with the Lempel-Ziv-Welch (LZW) universal text compressor. The LZW-Kernel is an alignment-free method, it is always symmetric, is positive, always provides 1.0 for self-similarity and it can directly be used with Support Vector Machines (SVMs) in classification problems, contrary to normalized compression distance (NCD), which often violates the distance metric properties in practice and requires further techniques to be used with SVMs. The LZW-Kernel is a one-pass algorithm, which makes it particularly plausible for big data applications. Our experimental studies on remote protein homology detection and protein classification tasks reveal that the LZW-Kernel closely approaches the performance of the Local Alignment Kernel (LAK) and the SVM-pairwise method combined with Smith-Waterman (SW) scoring at a fraction of the time. Moreover, the LZW-Kernel outperforms the SVM-pairwise method when combined with BLAST scores, which indicates that the LZW code words might be a better basis for similarity measures than local alignment approximations found with BLAST. In addition, the LZW-Kernel outperforms n-gram based mismatch kernels, hidden Markov model based SAM and Fisher kernel, and protein family based PSI-BLAST, among others. Further advantages include the LZW-Kernel's reliance on a simple idea, its ease of implementation, and its high speed, three times faster than BLAST and several magnitudes faster than SW or LAK in our tests. LZW-Kernel is implemented as a standalone C code and is a free open-source program distributed under GPLv3 license and can be downloaded from https://github.com/kfattila/LZW-Kernel. akerteszfarkas@hse.ru. Supplementary data are available at Bioinformatics Online.

  11. Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples.

    Science.gov (United States)

    Foord, A J; Heine, H G; Pritchard, L I; Lunt, R A; Newberry, K M; Rootes, C L; Boyle, D B

    2006-07-01

    To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis.

  12. Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals.

    Science.gov (United States)

    Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L

    2017-11-08

    The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

  13. mPUMA: a computational approach to microbiota analysis by de novo assembly of operational taxonomic units based on protein-coding barcode sequences.

    Science.gov (United States)

    Links, Matthew G; Chaban, Bonnie; Hemmingsen, Sean M; Muirhead, Kevin; Hill, Janet E

    2013-08-15

    Formation of operational taxonomic units (OTU) is a common approach to data aggregation in microbial ecology studies based on amplification and sequencing of individual gene targets. The de novo assembly of OTU sequences has been recently demonstrated as an alternative to widely used clustering methods, providing robust information from experimental data alone, without any reliance on an external reference database. Here we introduce mPUMA (microbial Profiling Using Metagenomic Assembly, http://mpuma.sourceforge.net), a software package for identification and analysis of protein-coding barcode sequence data. It was developed originally for Cpn60 universal target sequences (also known as GroEL or Hsp60). Using an unattended process that is independent of external reference sequences, mPUMA forms OTUs by DNA sequence assembly and is capable of tracking OTU abundance. mPUMA processes microbial profiles both in terms of the direct DNA sequence as well as in the translated amino acid sequence for protein coding barcodes. By forming OTUs and calculating abundance through an assembly approach, mPUMA is capable of generating inputs for several popular microbiota analysis tools. Using SFF data from sequencing of a synthetic community of Cpn60 sequences derived from the human vaginal microbiome, we demonstrate that mPUMA can faithfully reconstruct all expected OTU sequences and produce compositional profiles consistent with actual community structure. mPUMA enables analysis of microbial communities while empowering the discovery of novel organisms through OTU assembly.

  14. Sequencing illustrates the transcriptional response of Legionella pneumophila during infection and identifies seventy novel small non-coding RNAs.

    LENUS (Irish Health Repository)

    Weissenmayer, Barbara A

    2011-01-01

    Second generation sequencing has prompted a number of groups to re-interrogate the transcriptomes of several bacterial and archaeal species. One of the central findings has been the identification of complex networks of small non-coding RNAs that play central roles in transcriptional regulation in all growth conditions and for the pathogen\\'s interaction with and survival within host cells. Legionella pneumophila is a gram-negative facultative intracellular human pathogen with a distinct biphasic lifestyle. One of its primary environmental hosts in the free-living amoeba Acanthamoeba castellanii and its infection by L. pneumophila mimics that seen in human macrophages. Here we present analysis of strand specific sequencing of the transcriptional response of L. pneumophila during exponential and post-exponential broth growth and during the replicative and transmissive phase of infection inside A. castellanii. We extend previous microarray based studies as well as uncovering evidence of a complex regulatory architecture underpinned by numerous non-coding RNAs. Over seventy new non-coding RNAs could be identified; many of them appear to be strain specific and in configurations not previously reported. We discover a family of non-coding RNAs preferentially expressed during infection conditions and identify a second copy of 6S RNA in L. pneumophila. We show that the newly discovered putative 6S RNA as well as a number of other non-coding RNAs show evidence for antisense transcription. The nature and extent of the non-coding RNAs and their expression patterns suggests that these may well play central roles in the regulation of Legionella spp. specific traits and offer clues as to how L. pneumophila adapts to its intracellular niche. The expression profiles outlined in the study have been deposited into Genbank\\'s Gene Expression Omnibus (GEO) database under the series accession GSE27232.

  15. Self-complementary circular codes in coding theory.

    Science.gov (United States)

    Fimmel, Elena; Michel, Christian J; Starman, Martin; Strüngmann, Lutz

    2018-04-01

    Self-complementary circular codes are involved in pairing genetic processes. A maximal [Formula: see text] self-complementary circular code X of trinucleotides was identified in genes of bacteria, archaea, eukaryotes, plasmids and viruses (Michel in Life 7(20):1-16 2017, J Theor Biol 380:156-177, 2015; Arquès and Michel in J Theor Biol 182:45-58 1996). In this paper, self-complementary circular codes are investigated using the graph theory approach recently formulated in Fimmel et al. (Philos Trans R Soc A 374:20150058, 2016). A directed graph [Formula: see text] associated with any code X mirrors the properties of the code. In the present paper, we demonstrate a necessary condition for the self-complementarity of an arbitrary code X in terms of the graph theory. The same condition has been proven to be sufficient for codes which are circular and of large size [Formula: see text] trinucleotides, in particular for maximal circular codes ([Formula: see text] trinucleotides). For codes of small-size [Formula: see text] trinucleotides, some very rare counterexamples have been constructed. Furthermore, the length and the structure of the longest paths in the graphs associated with the self-complementary circular codes are investigated. It has been proven that the longest paths in such graphs determine the reading frame for the self-complementary circular codes. By applying this result, the reading frame in any arbitrary sequence of trinucleotides is retrieved after at most 15 nucleotides, i.e., 5 consecutive trinucleotides, from the circular code X identified in genes. Thus, an X motif of a length of at least 15 nucleotides in an arbitrary sequence of trinucleotides (not necessarily all of them belonging to X) uniquely defines the reading (correct) frame, an important criterion for analyzing the X motifs in genes in the future.

  16. The sequence coding and search system: an approach for constructing and analyzing event sequences at commercial nuclear power plants

    International Nuclear Information System (INIS)

    Mays, G.T.

    1990-01-01

    The U.S. Nuclear Regulatory Commission (NRC) has recognized the importance of the collection, assessment, and feedback of operating experience data from commercial nuclear power plants and has centralized these activities in the Office for Analysis and Evaluation of Operational Data (AEOD). Such data is essential for performing safety and reliability analyses, especially analyses of trends and patterns to identify undesirable changes in plant performance at the earliest opportunity to implement corrective measures to preclude the occurrence of a more serious event. One of NRC's principal tools for collecting and evaluating operating experience data is the Sequence Coding and Search System (SCSS). The SCSS consists of a methodology for structuring event sequences and the requisite computer system to store and search the data. The source information for SCSS is the Licensee Event Report (LER), which is a legally required document. This paper describes the objectives of SCSS, the information it contains, and the format and approach for constructing SCSS event sequences. Examples are presented demonstrating the use of SCSS to support the analysis of LER data. The SCSS contains over 30,000 LERs describing events from 1980 through the present. Insights gained from working with a complex data system from the initial developmental stage to the point of a mature operating system are highlighted. Considerable experience has been gained in the areas of evolving and changing data requirements, staffing requirements, and quality control and quality assurance procedures for addressing consistency, software/hardware considerations for developing and maintaining a complex system, documentation requirements, and end-user needs. Two other approaches for constructing and evaluating event sequences are examined including the Accident Precursor Program (ASP) where sequences having the potential for core damage are identified and analyzed, and the Significant Event Compilation Tree

  17. Circular codes revisited: a statistical approach.

    Science.gov (United States)

    Gonzalez, D L; Giannerini, S; Rosa, R

    2011-04-21

    In 1996 Arquès and Michel [1996. A complementary circular code in the protein coding genes. J. Theor. Biol. 182, 45-58] discovered the existence of a common circular code in eukaryote and prokaryote genomes. Since then, circular code theory has provoked great interest and underwent a rapid development. In this paper we discuss some theoretical issues related to the synchronization properties of coding sequences and circular codes with particular emphasis on the problem of retrieval and maintenance of the reading frame. Motivated by the theoretical discussion, we adopt a rigorous statistical approach in order to try to answer different questions. First, we investigate the covering capability of the whole class of 216 self-complementary, C(3) maximal codes with respect to a large set of coding sequences. The results indicate that, on average, the code proposed by Arquès and Michel has the best covering capability but, still, there exists a great variability among sequences. Second, we focus on such code and explore the role played by the proportion of the bases by means of a hierarchy of permutation tests. The results show the existence of a sort of optimization mechanism such that coding sequences are tailored as to maximize or minimize the coverage of circular codes on specific reading frames. Such optimization clearly relates the function of circular codes with reading frame synchronization. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?

    Science.gov (United States)

    Nolan, David

    2005-01-01

    Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.

  19. Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

    Science.gov (United States)

    Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

    2014-04-01

    A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

  20. Serotype identification and VP1 coding sequence analysis of foot-and-mouth disease virus from outbreaks in Eastern and Northern Uganda in 2008/9

    DEFF Research Database (Denmark)

    Kasambula, L.; Belsham, Graham; Siegismund, H. R.

    2012-01-01

    regions, and the presence of FMDV RNA in these samples was determined using a standard diagnostic RT-PCR assay. From the total of 27 positive samples, the VP1 coding region was amplified and sequenced. Each of these sequences showed >99% identity to each other, and just five distinct sequences were...

  1. Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

    Science.gov (United States)

    Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

    2016-04-01

    Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

  2. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu

    2011-12-12

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  3. Phylogenetic analyses of the polyprotein coding sequences of serotype O foot-and-mouth disease viruses in East Africa: evidence for interserotypic recombination

    DEFF Research Database (Denmark)

    Balinda, Sheila; Siegismund, Hans; Muwanika, Vincent

    2010-01-01

    from both serotypes A and O. Conclusions Sequences of the VP1 coding region from recent serotype O FMDVs from Kenya and Uganda are all representatives of a specific East African lineage (topotype EA-2), a probable indication that hardly any FMD introductions of this serotype have occurred from outside...... the region in the recent past. Furthermore, evidence for interserotypic recombination, within the non-structural protein coding regions, between FMDVs of serotypes A and O has been obtained. In addition to characterization using the VP1 coding region, analyses involving the non-structural protein coding...

  4. Sequence and RT-PCR expression analysis of two peroxidases from Arabidopsis thaliana belonging to a novel evolutionary branch of plant peroxidases.

    Science.gov (United States)

    Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G

    1997-03-01

    cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP 1a and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid sequence to the well characterized group of basic plant peroxidases represented by the horseradish (Armoracia rusticana) isoperoxidases HRP C, HRP E5 and the similar Arabidopsis isoperoxidases ATP Ca, ATP Cb, and ATP Ea. However ATP 1a is 87% identical in amino acid sequence to a peroxidase encoded by an mRNA isolated from cotton (Gossypium hirsutum). As cotton and Arabidopsis belong to rather diverse families (Malvaceae and Crucifereae, respectively), in contrast with Arabidopsis and horseradish (both Crucifereae), the high degree of sequence identity indicates that this novel type of peroxidase, albeit of unknown function, is likely to be widespread in plant species. The atp 1 and atp 2 types of cDNA sequences were the most redundant among the 28 different isoperoxidases identified among about 200 peroxidase encoding ESTs. Interestingly, 8 out of totally 38 EST sequences coding for ATP 1 showed three identical nucleotide substitutions. This variant form is designated ATP 1b. Similarly, six out of totally 16 EST sequences coding for ATP 2 showed a number of deletions and nucleotide changes. This variant form is designated ATP 2b. The selected EST clones are full-length and contain coding regions of 993 nucleotides for atp 1a, and 984 nucleotides for atp 2a. These regions show 61% DNA sequence identity. The predicted mature proteins ATP 1a, and ATP 2a are 57% identical in sequence and contain the structurally and functionally important residues, characteristic of the plant peroxidase superfamily. However, they do show two differences of importance to peroxidase catalysis: (1) the asparagine residue linked with the active site distal histidine via hydrogen bonding is absent

  5. Comparative analysis of drug resistance mutations in the human immunodeficiency virus reverse transcriptase gene in patients who are non-responsive, responsive and naive to antiretroviral therapy.

    Science.gov (United States)

    Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad

    2016-05-01

    Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.

  6. Mining of biomarker genes from expressed sequence tags and differential display reverse transcriptase-polymerase chain reaction in the self-fertilizing fish, Kryptolebias marmoratus and their expression patterns in response to exposure to an endocrine-disrupting alkylphenol, bisphenol A.

    Science.gov (United States)

    Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong

    2007-06-30

    Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.

  7. Construction and Analysis of a Novel 2-D Optical Orthogonal Codes Based on Modified One-coincidence Sequence

    Science.gov (United States)

    Ji, Jianhua; Wang, Yanfen; Wang, Ke; Xu, Ming; Zhang, Zhipeng; Yang, Shuwen

    2013-09-01

    A new two-dimensional OOC (optical orthogonal codes) named PC/MOCS is constructed, using PC (prime code) for time spreading and MOCS (modified one-coincidence sequence) for wavelength hopping. Compared with PC/PC, the number of wavelengths for PC/MOCS is not limited to a prime number. Compared with PC/OCS, the length of MOCS need not be expanded to the same length of PC. PC/MOCS can be constructed flexibly, and also can use available wavelengths effectively. Theoretical analysis shows that PC/MOCS can reduce the bit error rate (BER) of OCDMA system, and can support more users than PC/PC and PC/OCS.

  8. Deciphering the genetic regulatory code using an inverse error control coding framework.

    Energy Technology Data Exchange (ETDEWEB)

    Rintoul, Mark Daniel; May, Elebeoba Eni; Brown, William Michael; Johnston, Anna Marie; Watson, Jean-Paul

    2005-03-01

    We have found that developing a computational framework for reconstructing error control codes for engineered data and ultimately for deciphering genetic regulatory coding sequences is a challenging and uncharted area that will require advances in computational technology for exact solutions. Although exact solutions are desired, computational approaches that yield plausible solutions would be considered sufficient as a proof of concept to the feasibility of reverse engineering error control codes and the possibility of developing a quantitative model for understanding and engineering genetic regulation. Such evidence would help move the idea of reconstructing error control codes for engineered and biological systems from the high risk high payoff realm into the highly probable high payoff domain. Additionally this work will impact biological sensor development and the ability to model and ultimately develop defense mechanisms against bioagents that can be engineered to cause catastrophic damage. Understanding how biological organisms are able to communicate their genetic message efficiently in the presence of noise can improve our current communication protocols, a continuing research interest. Towards this end, project goals include: (1) Develop parameter estimation methods for n for block codes and for n, k, and m for convolutional codes. Use methods to determine error control (EC) code parameters for gene regulatory sequence. (2) Develop an evolutionary computing computational framework for near-optimal solutions to the algebraic code reconstruction problem. Method will be tested on engineered and biological sequences.

  9. Whole-Exome Sequencing Identifies Rare and Low-Frequency Coding Variants Associated with LDL Cholesterol

    Science.gov (United States)

    Lange, Leslie A.; Hu, Youna; Zhang, He; Xue, Chenyi; Schmidt, Ellen M.; Tang, Zheng-Zheng; Bizon, Chris; Lange, Ethan M.; Smith, Joshua D.; Turner, Emily H.; Jun, Goo; Kang, Hyun Min; Peloso, Gina; Auer, Paul; Li, Kuo-ping; Flannick, Jason; Zhang, Ji; Fuchsberger, Christian; Gaulton, Kyle; Lindgren, Cecilia; Locke, Adam; Manning, Alisa; Sim, Xueling; Rivas, Manuel A.; Holmen, Oddgeir L.; Gottesman, Omri; Lu, Yingchang; Ruderfer, Douglas; Stahl, Eli A.; Duan, Qing; Li, Yun; Durda, Peter; Jiao, Shuo; Isaacs, Aaron; Hofman, Albert; Bis, Joshua C.; Correa, Adolfo; Griswold, Michael E.; Jakobsdottir, Johanna; Smith, Albert V.; Schreiner, Pamela J.; Feitosa, Mary F.; Zhang, Qunyuan; Huffman, Jennifer E.; Crosby, Jacy; Wassel, Christina L.; Do, Ron; Franceschini, Nora; Martin, Lisa W.; Robinson, Jennifer G.; Assimes, Themistocles L.; Crosslin, David R.; Rosenthal, Elisabeth A.; Tsai, Michael; Rieder, Mark J.; Farlow, Deborah N.; Folsom, Aaron R.; Lumley, Thomas; Fox, Ervin R.; Carlson, Christopher S.; Peters, Ulrike; Jackson, Rebecca D.; van Duijn, Cornelia M.; Uitterlinden, André G.; Levy, Daniel; Rotter, Jerome I.; Taylor, Herman A.; Gudnason, Vilmundur; Siscovick, David S.; Fornage, Myriam; Borecki, Ingrid B.; Hayward, Caroline; Rudan, Igor; Chen, Y. Eugene; Bottinger, Erwin P.; Loos, Ruth J.F.; Sætrom, Pål; Hveem, Kristian; Boehnke, Michael; Groop, Leif; McCarthy, Mark; Meitinger, Thomas; Ballantyne, Christie M.; Gabriel, Stacey B.; O’Donnell, Christopher J.; Post, Wendy S.; North, Kari E.; Reiner, Alexander P.; Boerwinkle, Eric; Psaty, Bruce M.; Altshuler, David; Kathiresan, Sekar; Lin, Dan-Yu; Jarvik, Gail P.; Cupples, L. Adrienne; Kooperberg, Charles; Wilson, James G.; Nickerson, Deborah A.; Abecasis, Goncalo R.; Rich, Stephen S.; Tracy, Russell P.; Willer, Cristen J.; Gabriel, Stacey B.; Altshuler, David M.; Abecasis, Gonçalo R.; Allayee, Hooman; Cresci, Sharon; Daly, Mark J.; de Bakker, Paul I.W.; DePristo, Mark A.; Do, Ron; Donnelly, Peter; Farlow, Deborah N.; Fennell, Tim; Garimella, Kiran; Hazen, Stanley L.; Hu, Youna; Jordan, Daniel M.; Jun, Goo; Kathiresan, Sekar; Kang, Hyun Min; Kiezun, Adam; Lettre, Guillaume; Li, Bingshan; Li, Mingyao; Newton-Cheh, Christopher H.; Padmanabhan, Sandosh; Peloso, Gina; Pulit, Sara; Rader, Daniel J.; Reich, David; Reilly, Muredach P.; Rivas, Manuel A.; Schwartz, Steve; Scott, Laura; Siscovick, David S.; Spertus, John A.; Stitziel, Nathaniel O.; Stoletzki, Nina; Sunyaev, Shamil R.; Voight, Benjamin F.; Willer, Cristen J.; Rich, Stephen S.; Akylbekova, Ermeg; Atwood, Larry D.; Ballantyne, Christie M.; Barbalic, Maja; Barr, R. Graham; Benjamin, Emelia J.; Bis, Joshua; Boerwinkle, Eric; Bowden, Donald W.; Brody, Jennifer; Budoff, Matthew; Burke, Greg; Buxbaum, Sarah; Carr, Jeff; Chen, Donna T.; Chen, Ida Y.; Chen, Wei-Min; Concannon, Pat; Crosby, Jacy; Cupples, L. Adrienne; D’Agostino, Ralph; DeStefano, Anita L.; Dreisbach, Albert; Dupuis, Josée; Durda, J. Peter; Ellis, Jaclyn; Folsom, Aaron R.; Fornage, Myriam; Fox, Caroline S.; Fox, Ervin; Funari, Vincent; Ganesh, Santhi K.; Gardin, Julius; Goff, David; Gordon, Ora; Grody, Wayne; Gross, Myron; Guo, Xiuqing; Hall, Ira M.; Heard-Costa, Nancy L.; Heckbert, Susan R.; Heintz, Nicholas; Herrington, David M.; Hickson, DeMarc; Huang, Jie; Hwang, Shih-Jen; Jacobs, David R.; Jenny, Nancy S.; Johnson, Andrew D.; Johnson, Craig W.; Kawut, Steven; Kronmal, Richard; Kurz, Raluca; Lange, Ethan M.; Lange, Leslie A.; Larson, Martin G.; Lawson, Mark; Lewis, Cora E.; Levy, Daniel; Li, Dalin; Lin, Honghuang; Liu, Chunyu; Liu, Jiankang; Liu, Kiang; Liu, Xiaoming; Liu, Yongmei; Longstreth, William T.; Loria, Cay; Lumley, Thomas; Lunetta, Kathryn; Mackey, Aaron J.; Mackey, Rachel; Manichaikul, Ani; Maxwell, Taylor; McKnight, Barbara; Meigs, James B.; Morrison, Alanna C.; Musani, Solomon K.; Mychaleckyj, Josyf C.; Nettleton, Jennifer A.; North, Kari; O’Donnell, Christopher J.; O’Leary, Daniel; Ong, Frank; Palmas, Walter; Pankow, James S.; Pankratz, Nathan D.; Paul, Shom; Perez, Marco; Person, Sharina D.; Polak, Joseph; Post, Wendy S.; Psaty, Bruce M.; Quinlan, Aaron R.; Raffel, Leslie J.; Ramachandran, Vasan S.; Reiner, Alexander P.; Rice, Kenneth; Rotter, Jerome I.; Sanders, Jill P.; Schreiner, Pamela; Seshadri, Sudha; Shea, Steve; Sidney, Stephen; Silverstein, Kevin; Smith, Nicholas L.; Sotoodehnia, Nona; Srinivasan, Asoke; Taylor, Herman A.; Taylor, Kent; Thomas, Fridtjof; Tracy, Russell P.; Tsai, Michael Y.; Volcik, Kelly A.; Wassel, Chrstina L.; Watson, Karol; Wei, Gina; White, Wendy; Wiggins, Kerri L.; Wilk, Jemma B.; Williams, O. Dale; Wilson, Gregory; Wilson, James G.; Wolf, Phillip; Zakai, Neil A.; Hardy, John; Meschia, James F.; Nalls, Michael; Singleton, Andrew; Worrall, Brad; Bamshad, Michael J.; Barnes, Kathleen C.; Abdulhamid, Ibrahim; Accurso, Frank; Anbar, Ran; Beaty, Terri; Bigham, Abigail; Black, Phillip; Bleecker, Eugene; Buckingham, Kati; Cairns, Anne Marie; Caplan, Daniel; Chatfield, Barbara; Chidekel, Aaron; Cho, Michael; Christiani, David C.; Crapo, James D.; Crouch, Julia; Daley, Denise; Dang, Anthony; Dang, Hong; De Paula, Alicia; DeCelie-Germana, Joan; Drumm, Allen DozorMitch; Dyson, Maynard; Emerson, Julia; Emond, Mary J.; Ferkol, Thomas; Fink, Robert; Foster, Cassandra; Froh, Deborah; Gao, Li; Gershan, William; Gibson, Ronald L.; Godwin, Elizabeth; Gondor, Magdalen; Gutierrez, Hector; Hansel, Nadia N.; Hassoun, Paul M.; Hiatt, Peter; Hokanson, John E.; Howenstine, Michelle; Hummer, Laura K.; Kanga, Jamshed; Kim, Yoonhee; Knowles, Michael R.; Konstan, Michael; Lahiri, Thomas; Laird, Nan; Lange, Christoph; Lin, Lin; Lin, Xihong; Louie, Tin L.; Lynch, David; Make, Barry; Martin, Thomas R.; Mathai, Steve C.; Mathias, Rasika A.; McNamara, John; McNamara, Sharon; Meyers, Deborah; Millard, Susan; Mogayzel, Peter; Moss, Richard; Murray, Tanda; Nielson, Dennis; Noyes, Blakeslee; O’Neal, Wanda; Orenstein, David; O’Sullivan, Brian; Pace, Rhonda; Pare, Peter; Parker, H. Worth; Passero, Mary Ann; Perkett, Elizabeth; Prestridge, Adrienne; Rafaels, Nicholas M.; Ramsey, Bonnie; Regan, Elizabeth; Ren, Clement; Retsch-Bogart, George; Rock, Michael; Rosen, Antony; Rosenfeld, Margaret; Ruczinski, Ingo; Sanford, Andrew; Schaeffer, David; Sell, Cindy; Sheehan, Daniel; Silverman, Edwin K.; Sin, Don; Spencer, Terry; Stonebraker, Jackie; Tabor, Holly K.; Varlotta, Laurie; Vergara, Candelaria I.; Weiss, Robert; Wigley, Fred; Wise, Robert A.; Wright, Fred A.; Wurfel, Mark M.; Zanni, Robert; Zou, Fei; Nickerson, Deborah A.; Rieder, Mark J.; Green, Phil; Shendure, Jay; Akey, Joshua M.; Bustamante, Carlos D.; Crosslin, David R.; Eichler, Evan E.; Fox, P. Keolu; Fu, Wenqing; Gordon, Adam; Gravel, Simon; Jarvik, Gail P.; Johnsen, Jill M.; Kan, Mengyuan; Kenny, Eimear E.; Kidd, Jeffrey M.; Lara-Garduno, Fremiet; Leal, Suzanne M.; Liu, Dajiang J.; McGee, Sean; O’Connor, Timothy D.; Paeper, Bryan; Robertson, Peggy D.; Smith, Joshua D.; Staples, Jeffrey C.; Tennessen, Jacob A.; Turner, Emily H.; Wang, Gao; Yi, Qian; Jackson, Rebecca; Peters, Ulrike; Carlson, Christopher S.; Anderson, Garnet; Anton-Culver, Hoda; Assimes, Themistocles L.; Auer, Paul L.; Beresford, Shirley; Bizon, Chris; Black, Henry; Brunner, Robert; Brzyski, Robert; Burwen, Dale; Caan, Bette; Carty, Cara L.; Chlebowski, Rowan; Cummings, Steven; Curb, J. David; Eaton, Charles B.; Ford, Leslie; Franceschini, Nora; Fullerton, Stephanie M.; Gass, Margery; Geller, Nancy; Heiss, Gerardo; Howard, Barbara V.; Hsu, Li; Hutter, Carolyn M.; Ioannidis, John; Jiao, Shuo; Johnson, Karen C.; Kooperberg, Charles; Kuller, Lewis; LaCroix, Andrea; Lakshminarayan, Kamakshi; Lane, Dorothy; Lasser, Norman; LeBlanc, Erin; Li, Kuo-Ping; Limacher, Marian; Lin, Dan-Yu; Logsdon, Benjamin A.; Ludlam, Shari; Manson, JoAnn E.; Margolis, Karen; Martin, Lisa; McGowan, Joan; Monda, Keri L.; Kotchen, Jane Morley; Nathan, Lauren; Ockene, Judith; O’Sullivan, Mary Jo; Phillips, Lawrence S.; Prentice, Ross L.; Robbins, John; Robinson, Jennifer G.; Rossouw, Jacques E.; Sangi-Haghpeykar, Haleh; Sarto, Gloria E.; Shumaker, Sally; Simon, Michael S.; Stefanick, Marcia L.; Stein, Evan; Tang, Hua; Taylor, Kira C.; Thomson, Cynthia A.; Thornton, Timothy A.; Van Horn, Linda; Vitolins, Mara; Wactawski-Wende, Jean; Wallace, Robert; Wassertheil-Smoller, Sylvia; Zeng, Donglin; Applebaum-Bowden, Deborah; Feolo, Michael; Gan, Weiniu; Paltoo, Dina N.; Sholinsky, Phyliss; Sturcke, Anne

    2014-01-01

    Elevated low-density lipoprotein cholesterol (LDL-C) is a treatable, heritable risk factor for cardiovascular disease. Genome-wide association studies (GWASs) have identified 157 variants associated with lipid levels but are not well suited to assess the impact of rare and low-frequency variants. To determine whether rare or low-frequency coding variants are associated with LDL-C, we exome sequenced 2,005 individuals, including 554 individuals selected for extreme LDL-C (>98th or <2nd percentile). Follow-up analyses included sequencing of 1,302 additional individuals and genotype-based analysis of 52,221 individuals. We observed significant evidence of association between LDL-C and the burden of rare or low-frequency variants in PNPLA5, encoding a phospholipase-domain-containing protein, and both known and previously unidentified variants in PCSK9, LDLR and APOB, three known lipid-related genes. The effect sizes for the burden of rare variants for each associated gene were substantially higher than those observed for individual SNPs identified from GWASs. We replicated the PNPLA5 signal in an independent large-scale sequencing study of 2,084 individuals. In conclusion, this large whole-exome-sequencing study for LDL-C identified a gene not known to be implicated in LDL-C and provides unique insight into the design and analysis of similar experiments. PMID:24507775

  10. Verona Coding Definitions of Emotional Sequences (VR-CoDES): Conceptual framework and future directions.

    Science.gov (United States)

    Piccolo, Lidia Del; Finset, Arnstein; Mellblom, Anneli V; Figueiredo-Braga, Margarida; Korsvold, Live; Zhou, Yuefang; Zimmermann, Christa; Humphris, Gerald

    2017-12-01

    To discuss the theoretical and empirical framework of VR-CoDES and potential future direction in research based on the coding system. The paper is based on selective review of papers relevant to the construction and application of VR-CoDES. VR-CoDES system is rooted in patient-centered and biopsychosocial model of healthcare consultations and on a functional approach to emotion theory. According to the VR-CoDES, emotional interaction is studied in terms of sequences consisting of an eliciting event, an emotional expression by the patient and the immediate response by the clinician. The rationale for the emphasis on sequences, on detailed classification of cues and concerns, and on the choices of explicit vs. non-explicit responses and providing vs. reducing room for further disclosure, as basic categories of the clinician responses, is described. Results from research on VR-CoDES may help raise awareness of emotional sequences. Future directions in applying VR-CoDES in research may include studies on predicting patient and clinician behavior within the consultation, qualitative analyses of longer sequences including several VR-CoDES triads, and studies of effects of emotional communication on health outcomes. VR-CoDES may be applied to develop interventions to promote good handling of patients' emotions in healthcare encounters. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Impact of HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype: results of a global collaboration.

    Directory of Open Access Journals (Sweden)

    Rami Kantor

    2005-04-01

    Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.

  12. cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

    International Nuclear Information System (INIS)

    Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.

    1987-01-01

    The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

  13. In Silico Mining of Microsatellites in Coding Sequences of the Date Palm (Arecaceae Genome, Characterization, and Transferability

    Directory of Open Access Journals (Sweden)

    Frédérique Aberlenc-Bertossi

    2014-01-01

    Full Text Available Premise of the study: To complement existing sets of primarily dinucleotide microsatellite loci from noncoding sequences of date palm, we developed primers for tri- and hexanucleotide microsatellite loci identified within genes. Due to their conserved genomic locations, the primers should be useful in other palm taxa, and their utility was tested in seven other Phoenix species and in Chamaerops, Livistona, and Hyphaene. Methods and Results: Tandem repeat motifs of 3–6 bp were searched using a simple sequence repeat (SSR–pipeline package in coding portions of the date palm draft genome sequence. Fifteen loci produced highly consistent amplification, intraspecific polymorphisms, and stepwise mutation patterns. Conclusions: These microsatellite loci showed sufficient levels of variability and transferability to make them useful for population genetic, selection signature, and interspecific gene flow studies in Phoenix and other Coryphoideae genera.

  14. Identification of coding and non-coding mutational hotspots in cancer genomes.

    Science.gov (United States)

    Piraino, Scott W; Furney, Simon J

    2017-01-05

    The identification of mutations that play a causal role in tumour development, so called "driver" mutations, is of critical importance for understanding how cancers form and how they might be treated. Several large cancer sequencing projects have identified genes that are recurrently mutated in cancer patients, suggesting a role in tumourigenesis. While the landscape of coding drivers has been extensively studied and many of the most prominent driver genes are well characterised, comparatively less is known about the role of mutations in the non-coding regions of the genome in cancer development. The continuing fall in genome sequencing costs has resulted in a concomitant increase in the number of cancer whole genome sequences being produced, facilitating systematic interrogation of both the coding and non-coding regions of cancer genomes. To examine the mutational landscapes of tumour genomes we have developed a novel method to identify mutational hotspots in tumour genomes using both mutational data and information on evolutionary conservation. We have applied our methodology to over 1300 whole cancer genomes and show that it identifies prominent coding and non-coding regions that are known or highly suspected to play a role in cancer. Importantly, we applied our method to the entire genome, rather than relying on predefined annotations (e.g. promoter regions) and we highlight recurrently mutated regions that may have resulted from increased exposure to mutational processes rather than selection, some of which have been identified previously as targets of selection. Finally, we implicate several pan-cancer and cancer-specific candidate non-coding regions, which could be involved in tumourigenesis. We have developed a framework to identify mutational hotspots in cancer genomes, which is applicable to the entire genome. This framework identifies known and novel coding and non-coding mutional hotspots and can be used to differentiate candidate driver regions from

  15. Detecting non-coding selective pressure in coding regions

    Directory of Open Access Journals (Sweden)

    Blanchette Mathieu

    2007-02-01

    Full Text Available Abstract Background Comparative genomics approaches, where orthologous DNA regions are compared and inter-species conserved regions are identified, have proven extremely powerful for identifying non-coding regulatory regions located in intergenic or intronic regions. However, non-coding functional elements can also be located within coding region, as is common for exonic splicing enhancers, some transcription factor binding sites, and RNA secondary structure elements affecting mRNA stability, localization, or translation. Since these functional elements are located in regions that are themselves highly conserved because they are coding for a protein, they generally escaped detection by comparative genomics approaches. Results We introduce a comparative genomics approach for detecting non-coding functional elements located within coding regions. Codon evolution is modeled as a mixture of codon substitution models, where each component of the mixture describes the evolution of codons under a specific type of coding selective pressure. We show how to compute the posterior distribution of the entropy and parsimony scores under this null model of codon evolution. The method is applied to a set of growth hormone 1 orthologous mRNA sequences and a known exonic splicing elements is detected. The analysis of a set of CORTBP2 orthologous genes reveals a region of several hundred base pairs under strong non-coding selective pressure whose function remains unknown. Conclusion Non-coding functional elements, in particular those involved in post-transcriptional regulation, are likely to be much more prevalent than is currently known. With the numerous genome sequencing projects underway, comparative genomics approaches like that proposed here are likely to become increasingly powerful at detecting such elements.

  16. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

    2018-01-01

    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  17. Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory

    Directory of Open Access Journals (Sweden)

    Edward J. Steele

    2017-11-01

    Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.

  18. Securing optical code-division multiple-access networks with a postswitching coding scheme of signature reconfiguration

    Science.gov (United States)

    Huang, Jen-Fa; Meng, Sheng-Hui; Lin, Ying-Chen

    2014-11-01

    The optical code-division multiple-access (OCDMA) technique is considered a good candidate for providing optical layer security. An enhanced OCDMA network security mechanism with a pseudonoise (PN) random digital signals type of maximal-length sequence (M-sequence) code switching to protect against eavesdropping is presented. Signature codes unique to individual OCDMA-network users are reconfigured according to the register state of the controlling electrical shift registers. Examples of signature reconfiguration following state switching of the controlling shift register for both the network user and the eavesdropper are numerically illustrated. Dynamically changing the PN state of the shift register to reconfigure the user signature sequence is shown; this hinders eavesdroppers' efforts to decode correct data sequences. The proposed scheme increases the probability of eavesdroppers committing errors in decoding and thereby substantially enhances the degree of an OCDMA network's confidentiality.

  19. Lentin, a novel and potent antifungal protein from shitake mushroom with inhibitory effects on activity of human immunodeficiency virus-1 reverse transcriptase and proliferation of leukemia cells.

    Science.gov (United States)

    Ngai, Patrick H K; Ng, T B

    2003-11-14

    From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.

  20. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  1. Reverse transcriptase inhibitors as microbicides.

    Science.gov (United States)

    Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido

    2012-01-01

    The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.

  2. New tools to analyze overlapping coding regions.

    Science.gov (United States)

    Bayegan, Amir H; Garcia-Martin, Juan Antonio; Clote, Peter

    2016-12-13

    Retroviruses transcribe messenger RNA for the overlapping Gag and Gag-Pol polyproteins, by using a programmed -1 ribosomal frameshift which requires a slippery sequence and an immediate downstream stem-loop secondary structure, together called frameshift stimulating signal (FSS). It follows that the molecular evolution of this genomic region of HIV-1 is highly constrained, since the retroviral genome must contain a slippery sequence (sequence constraint), code appropriate peptides in reading frames 0 and 1 (coding requirements), and form a thermodynamically stable stem-loop secondary structure (structure requirement). We describe a unique computational tool, RNAsampleCDS, designed to compute the number of RNA sequences that code two (or more) peptides p,q in overlapping reading frames, that are identical (or have BLOSUM/PAM similarity that exceeds a user-specified value) to the input peptides p,q. RNAsampleCDS then samples a user-specified number of messenger RNAs that code such peptides; alternatively, RNAsampleCDS can exactly compute the position-specific scoring matrix and codon usage bias for all such RNA sequences. Our software allows the user to stipulate overlapping coding requirements for all 6 possible reading frames simultaneously, even allowing IUPAC constraints on RNA sequences and fixing GC-content. We generalize the notion of codon preference index (CPI) to overlapping reading frames, and use RNAsampleCDS to generate control sequences required in the computation of CPI. Moreover, by applying RNAsampleCDS, we are able to quantify the extent to which the overlapping coding requirement in HIV-1 [resp. HCV] contribute to the formation of the stem-loop [resp. double stem-loop] secondary structure known as the frameshift stimulating signal. Using our software, we confirm that certain experimentally determined deleterious HCV mutations occur in positions for which our software RNAsampleCDS and RNAiFold both indicate a single possible nucleotide. We

  3. Rfam: annotating families of non-coding RNA sequences.

    Science.gov (United States)

    Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W

    2015-01-01

    The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

  4. Deep Sequencing Reveals Uncharted Isoform Heterogeneity of the Protein-Coding Transcriptome in Cerebral Ischemia.

    Science.gov (United States)

    Bhattarai, Sunil; Aly, Ahmed; Garcia, Kristy; Ruiz, Diandra; Pontarelli, Fabrizio; Dharap, Ashutosh

    2018-06-03

    Gene expression in cerebral ischemia has been a subject of intense investigations for several years. Studies utilizing probe-based high-throughput methodologies such as microarrays have contributed significantly to our existing knowledge but lacked the capacity to dissect the transcriptome in detail. Genome-wide RNA-sequencing (RNA-seq) enables comprehensive examinations of transcriptomes for attributes such as strandedness, alternative splicing, alternative transcription start/stop sites, and sequence composition, thus providing a very detailed account of gene expression. Leveraging this capability, we conducted an in-depth, genome-wide evaluation of the protein-coding transcriptome of the adult mouse cortex after transient focal ischemia at 6, 12, or 24 h of reperfusion using RNA-seq. We identified a total of 1007 transcripts at 6 h, 1878 transcripts at 12 h, and 1618 transcripts at 24 h of reperfusion that were significantly altered as compared to sham controls. With isoform-level resolution, we identified 23 splice variants arising from 23 genes that were novel mRNA isoforms. For a subset of genes, we detected reperfusion time-point-dependent splice isoform switching, indicating an expression and/or functional switch for these genes. Finally, for 286 genes across all three reperfusion time-points, we discovered multiple, distinct, simultaneously expressed and differentially altered isoforms per gene that were generated via alternative transcription start/stop sites. Of these, 165 isoforms derived from 109 genes were novel mRNAs. Together, our data unravel the protein-coding transcriptome of the cerebral cortex at an unprecedented depth to provide several new insights into the flexibility and complexity of stroke-related gene transcription and transcript organization.

  5. Natural Plant Alkaloid (Emetine Inhibits HIV-1 Replication by Interfering with Reverse Transcriptase Activity

    Directory of Open Access Journals (Sweden)

    Ana Luiza Chaves Valadão

    2015-06-01

    Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.

  6. Viewing multiple sequence alignments with the JavaScript Sequence Alignment Viewer (JSAV).

    Science.gov (United States)

    Martin, Andrew C R

    2014-01-01

    The JavaScript Sequence Alignment Viewer (JSAV) is designed as a simple-to-use JavaScript component for displaying sequence alignments on web pages. The display of sequences is highly configurable with options to allow alternative coloring schemes, sorting of sequences and 'dotifying' repeated amino acids. An option is also available to submit selected sequences to another web site, or to other JavaScript code. JSAV is implemented purely in JavaScript making use of the JQuery and JQuery-UI libraries. It does not use any HTML5-specific options to help with browser compatibility. The code is documented using JSDOC and is available from http://www.bioinf.org.uk/software/jsav/.

  7. Enzyme engineering through evolution: thermostable recombinant group II intron reverse transcriptases provide new tools for RNA research and biotechnology.

    Science.gov (United States)

    Collins, Kathleen; Nilsen, Timothy W

    2013-08-01

    Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.

  8. Reverse Transcriptase-Containing Particles Induced in Rous Sarcoma Virus-Transformed Rat Cells by Arginine Deprivation

    Science.gov (United States)

    Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel

    1972-01-01

    Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137

  9. Identification of rhabdoviral sequences in oropharyngeal swabs from German and Danish bats.

    Science.gov (United States)

    Fischer, Melina; Freuling, Conrad M; Müller, Thomas; Schatz, Juliane; Rasmussen, Thomas Bruun; Chriel, Mariann; Balkema-Buschmann, Anne; Beer, Martin; Hoffmann, Bernd

    2014-11-25

    In the frame of active lyssavirus surveillance in bats, oropharyngeal swabs from German (N = 2297) and Danish (N = 134) insectivorous bats were investigated using a newly developed generic pan-lyssavirus real-time reverse transcriptase PCR (RT-qPCR). In total, 15 RT-qPCR positive swabs were detected. Remarkably, sequencing of positive samples did not confirm the presence of bat associated lyssaviruses but revealed nine distinct novel rhabdovirus-related sequences. Several novel rhabdovirus-related sequences were detected both in German and Danish insectivorous bats. The results also prove that the novel generic pan-lyssavirus RT-qPCR offers a very broad detection range that allows the collection of further valuable data concerning the broad and complex diversity within the family Rhabdoviridae.

  10. Ultrafast all-optical code-division multiple-access networks

    Science.gov (United States)

    Kwong, Wing C.; Prucnal, Paul R.; Liu, Yanming

    1992-12-01

    In optical code-division multiple access (CDMA), the architecture of optical encoders/decoders is another important factor that needs to be considered, besides the correlation properties of those already extensively studied optical codes. The architecture of optical encoders/decoders affects, for example, the amount of power loss and length of optical delays that are associated with code sequence generation and correlation, which, in turn, affect the power budget, size, and cost of an optical CDMA system. Various CDMA coding architectures are studied in the paper. In contrast to the encoders/decoders used in prime networks (i.e., prime encodes/decoders), which generate, select, and correlate code sequences by a parallel combination of fiber-optic delay-lines, and in 2n networks (i.e., 2n encoders/decoders), which generate and correlate code sequences by a serial combination of 2 X 2 passive couplers and fiber delays with sequence selection performed in a parallel fashion, the modified 2n encoders/decoders generate, select, and correlate code sequences by a serial combination of directional couplers and delays. The power and delay- length requirements of the modified 2n encoders/decoders are compared to that of the prime and 2n encoders/decoders. A 100 Mbit/s optical CDMA experiment in free space demonstrating the feasibility of the all-serial coding architecture using a serial combination of 50/50 beam splitters and retroreflectors at 10 Tchip/s (i.e., 100,000 chip/bit) with 100 fs laser pulses is reported.

  11. Application of MELCOR Code to a French PWR 900 MWe Severe Accident Sequence and Evaluation of Models Performance Focusing on In-Vessel Thermal Hydraulic Results

    International Nuclear Information System (INIS)

    De Rosa, Felice

    2006-01-01

    In the ambit of the Severe Accident Network of Excellence Project (SARNET), funded by the European Union, 6. FISA (Fission Safety) Programme, one of the main tasks is the development and validation of the European Accident Source Term Evaluation Code (ASTEC Code). One of the reference codes used to compare ASTEC results, coming from experimental and Reactor Plant applications, is MELCOR. ENEA is a SARNET member and also an ASTEC and MELCOR user. During the first 18 months of this project, we performed a series of MELCOR and ASTEC calculations referring to a French PWR 900 MWe and to the accident sequence of 'Loss of Steam Generator (SG) Feedwater' (known as H2 sequence in the French classification). H2 is an accident sequence substantially equivalent to a Station Blackout scenario, like a TMLB accident, with the only difference that in H2 sequence the scram is forced to occur with a delay of 28 seconds. The main events during the accident sequence are a loss of normal and auxiliary SG feedwater (0 s), followed by a scram when the water level in SG is equal or less than 0.7 m (after 28 seconds). There is also a main coolant pumps trip when ΔTsat < 10 deg. C, a total opening of the three relief valves when Tric (core maximal outlet temperature) is above 603 K (330 deg. C) and accumulators isolation when primary pressure goes below 1.5 MPa (15 bar). Among many other points, it is worth noting that this was the first time that a MELCOR 1.8.5 input deck was available for a French PWR 900. The main ENEA effort in this period was devoted to prepare the MELCOR input deck using the code version v.1.8.5 (build QZ Oct 2000 with the latest patch 185003 Oct 2001). The input deck, completely new, was prepared taking into account structure, data and same conditions as those found inside ASTEC input decks. The main goal of the work presented in this paper is to put in evidence where and when MELCOR provides good enough results and why, in some cases mainly referring to its

  12. [Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].

    Science.gov (United States)

    Tarasova, O A; Filimonov, D A; Poroikov, V V

    2017-10-01

    Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.

  13. Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

    Directory of Open Access Journals (Sweden)

    Ajay Kumar

    2010-01-01

    Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

  14. The PRC2-binding long non-coding RNAs in human and mouse genomes are associated with predictive sequence features

    Science.gov (United States)

    Tu, Shiqi; Yuan, Guo-Cheng; Shao, Zhen

    2017-01-01

    Recently, long non-coding RNAs (lncRNAs) have emerged as an important class of molecules involved in many cellular processes. One of their primary functions is to shape epigenetic landscape through interactions with chromatin modifying proteins. However, mechanisms contributing to the specificity of such interactions remain poorly understood. Here we took the human and mouse lncRNAs that were experimentally determined to have physical interactions with Polycomb repressive complex 2 (PRC2), and systematically investigated the sequence features of these lncRNAs by developing a new computational pipeline for sequences composition analysis, in which each sequence is considered as a series of transitions between adjacent nucleotides. Through that, PRC2-binding lncRNAs were found to be associated with a set of distinctive and evolutionarily conserved sequence features, which can be utilized to distinguish them from the others with considerable accuracy. We further identified fragments of PRC2-binding lncRNAs that are enriched with these sequence features, and found they show strong PRC2-binding signals and are more highly conserved across species than the other parts, implying their functional importance.

  15. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires

    Directory of Open Access Journals (Sweden)

    Sukrit Silas

    2017-07-01

    Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.

  16. DNA barcode goes two-dimensions: DNA QR code web server.

    Science.gov (United States)

    Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

    2012-01-01

    The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

  17. DNA barcode goes two-dimensions: DNA QR code web server.

    Directory of Open Access Journals (Sweden)

    Chang Liu

    Full Text Available The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

  18. Improving performance of DS-CDMA systems using chaotic complex Bernoulli spreading codes

    Science.gov (United States)

    Farzan Sabahi, Mohammad; Dehghanfard, Ali

    2014-12-01

    The most important goal of spreading spectrum communication system is to protect communication signals against interference and exploitation of information by unintended listeners. In fact, low probability of detection and low probability of intercept are two important parameters to increase the performance of the system. In Direct Sequence Code Division Multiple Access (DS-CDMA) systems, these properties are achieved by multiplying the data information in spreading sequences. Chaotic sequences, with their particular properties, have numerous applications in constructing spreading codes. Using one-dimensional Bernoulli chaotic sequence as spreading code is proposed in literature previously. The main feature of this sequence is its negative auto-correlation at lag of 1, which with proper design, leads to increase in efficiency of the communication system based on these codes. On the other hand, employing the complex chaotic sequences as spreading sequence also has been discussed in several papers. In this paper, use of two-dimensional Bernoulli chaotic sequences is proposed as spreading codes. The performance of a multi-user synchronous and asynchronous DS-CDMA system will be evaluated by applying these sequences under Additive White Gaussian Noise (AWGN) and fading channel. Simulation results indicate improvement of the performance in comparison with conventional spreading codes like Gold codes as well as similar complex chaotic spreading sequences. Similar to one-dimensional Bernoulli chaotic sequences, the proposed sequences also have negative auto-correlation. Besides, construction of complex sequences with lower average cross-correlation is possible with the proposed method.

  19. Interface requirements to couple thermal hydraulics codes to severe accident codes: ICARE/CATHARE

    Energy Technology Data Exchange (ETDEWEB)

    Camous, F.; Jacq, F.; Chatelard, P. [IPSN/DRS/SEMAR CE-Cadarache, St Paul Lez Durance (France)] [and others

    1997-07-01

    In order to describe with the same code the whole sequence of severe LWR accidents, up to the vessel failure, the Institute of Protection and Nuclear Safety has performed a coupling of the severe accident code ICARE2 to the thermalhydraulics code CATHARE2. The resulting code, ICARE/CATHARE, is designed to be as pertinent as possible in all the phases of the accident. This paper is mainly devoted to the description of the ICARE2-CATHARE2 coupling.

  20. Adaptive decoding of convolutional codes

    Science.gov (United States)

    Hueske, K.; Geldmacher, J.; Götze, J.

    2007-06-01

    Convolutional codes, which are frequently used as error correction codes in digital transmission systems, are generally decoded using the Viterbi Decoder. On the one hand the Viterbi Decoder is an optimum maximum likelihood decoder, i.e. the most probable transmitted code sequence is obtained. On the other hand the mathematical complexity of the algorithm only depends on the used code, not on the number of transmission errors. To reduce the complexity of the decoding process for good transmission conditions, an alternative syndrome based decoder is presented. The reduction of complexity is realized by two different approaches, the syndrome zero sequence deactivation and the path metric equalization. The two approaches enable an easy adaptation of the decoding complexity for different transmission conditions, which results in a trade-off between decoding complexity and error correction performance.

  1. Syndrome-source-coding and its universal generalization. [error correcting codes for data compression

    Science.gov (United States)

    Ancheta, T. C., Jr.

    1976-01-01

    A method of using error-correcting codes to obtain data compression, called syndrome-source-coding, is described in which the source sequence is treated as an error pattern whose syndrome forms the compressed data. It is shown that syndrome-source-coding can achieve arbitrarily small distortion with the number of compressed digits per source digit arbitrarily close to the entropy of a binary memoryless source. A 'universal' generalization of syndrome-source-coding is formulated which provides robustly effective distortionless coding of source ensembles. Two examples are given, comparing the performance of noiseless universal syndrome-source-coding to (1) run-length coding and (2) Lynch-Davisson-Schalkwijk-Cover universal coding for an ensemble of binary memoryless sources.

  2. Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

    Science.gov (United States)

    Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

    2017-07-01

    DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

  3. Crystal structures of HIV-1 nonnucleoside reverse transcriptase inhibitors: N-benzyl-4-methyl-benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-07-01

    HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.

  4. High level of APOBEC3F/3G editing in HIV-2 DNA vif and pol sequences from antiretroviral-naive patients.

    Science.gov (United States)

    Bertine, Mélanie; Charpentier, Charlotte; Visseaux, Benoit; Storto, Alexandre; Collin, Gilles; Larrouy, Lucile; Damond, Florence; Matheron, Sophie; Brun-Vézinet, Françoise; Descamps, Diane

    2015-04-24

    In HIV-1, hypermutation introduced by APOBEC3F/3G cytidine deaminase activity leads to defective viruses. In-vivo impact of APOBEC3F/3G editing on HIV-2 sequences remains unknown. The objective of this study was to assess the level of APOBEC3F/3G editing in HIV-2-infected antiretroviral-naive patients. Direct sequencing of vif and pol regions was performed on HIV-2 proviral DNA from antiretroviral-naive patients included in the French Agence Nationale de Recherches sur le SIDA et les hépatites virales CO5 HIV-2 cohort. Hypermutated sequences were identified using Hypermut2.0 program. HIV-1 proviral sequences from Genbank were also assessed. Among 82 antiretroviral-naive HIV-2-infected patients assessed, 15 (28.8%) and five (16.7%) displayed Vif proviral defective sequences in HIV-2 groups A and B, respectively. A lower proportion of defective sequences was observed in protease-reverse transcriptase region. A higher median number of G-to-A mutations was observed in HIV-2 group B than in group A, both in Vif and protease-reverse transcriptase regions (P = 0.02 and P = 0.006, respectively). Compared with HIV-1 Vif sequences, a higher number of Vif defective sequences was observed in HIV-2 group A (P = 0.00001) and group B sequences (P = 0.013). We showed for the first time a high level of APOBEC3F/3G editing in HIV-2 sequences from antiretroviral-naive patients. Our study reported a group effect with a significantly higher level of APOBEC3F/3G editing in HIV-2 group B than in group A sequences.

  5. Flexible manipulation of terahertz wave reflection using polarization insensitive coding metasurfaces.

    Science.gov (United States)

    Jiu-Sheng, Li; Ze-Jiang, Zhao; Jian-Quan, Yao

    2017-11-27

    In order to extend to 3-bit encoding, we propose notched-wheel structures as polarization insensitive coding metasurfaces to control terahertz wave reflection and suppress backward scattering. By using a coding sequence of "00110011…" along x-axis direction and 16 × 16 random coding sequence, we investigate the polarization insensitive properties of the coding metasurfaces. By designing the coding sequences of the basic coding elements, the terahertz wave reflection can be flexibly manipulated. Additionally, radar cross section (RCS) reduction in the backward direction is less than -10dB in a wide band. The present approach can offer application for novel terahertz manipulation devices.

  6. Is a genome a codeword of an error-correcting code?

    Directory of Open Access Journals (Sweden)

    Luzinete C B Faria

    Full Text Available Since a genome is a discrete sequence, the elements of which belong to a set of four letters, the question as to whether or not there is an error-correcting code underlying DNA sequences is unavoidable. The most common approach to answering this question is to propose a methodology to verify the existence of such a code. However, none of the methodologies proposed so far, although quite clever, has achieved that goal. In a recent work, we showed that DNA sequences can be identified as codewords in a class of cyclic error-correcting codes known as Hamming codes. In this paper, we show that a complete intron-exon gene, and even a plasmid genome, can be identified as a Hamming code codeword as well. Although this does not constitute a definitive proof that there is an error-correcting code underlying DNA sequences, it is the first evidence in this direction.

  7. Etravirine and Rilpivirine Drug Resistance Among HIV-1 Subtype C Infected Children Failing Non-Nucleoside Reverse Transcriptase Inhibitor-Based Regimens in South India.

    Science.gov (United States)

    Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami

    2017-06-01

    We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.

  8. Codes and curves

    CERN Document Server

    Walker, Judy L

    2000-01-01

    When information is transmitted, errors are likely to occur. Coding theory examines efficient ways of packaging data so that these errors can be detected, or even corrected. The traditional tools of coding theory have come from combinatorics and group theory. Lately, however, coding theorists have added techniques from algebraic geometry to their toolboxes. In particular, by re-interpreting the Reed-Solomon codes, one can see how to define new codes based on divisors on algebraic curves. For instance, using modular curves over finite fields, Tsfasman, Vladut, and Zink showed that one can define a sequence of codes with asymptotically better parameters than any previously known codes. This monograph is based on a series of lectures the author gave as part of the IAS/PCMI program on arithmetic algebraic geometry. Here, the reader is introduced to the exciting field of algebraic geometric coding theory. Presenting the material in the same conversational tone of the lectures, the author covers linear codes, inclu...

  9. Adaptive decoding of convolutional codes

    Directory of Open Access Journals (Sweden)

    K. Hueske

    2007-06-01

    Full Text Available Convolutional codes, which are frequently used as error correction codes in digital transmission systems, are generally decoded using the Viterbi Decoder. On the one hand the Viterbi Decoder is an optimum maximum likelihood decoder, i.e. the most probable transmitted code sequence is obtained. On the other hand the mathematical complexity of the algorithm only depends on the used code, not on the number of transmission errors. To reduce the complexity of the decoding process for good transmission conditions, an alternative syndrome based decoder is presented. The reduction of complexity is realized by two different approaches, the syndrome zero sequence deactivation and the path metric equalization. The two approaches enable an easy adaptation of the decoding complexity for different transmission conditions, which results in a trade-off between decoding complexity and error correction performance.

  10. Noncoding sequence classification based on wavelet transform analysis: part I

    Science.gov (United States)

    Paredes, O.; Strojnik, M.; Romo-Vázquez, R.; Vélez Pérez, H.; Ranta, R.; Garcia-Torales, G.; Scholl, M. K.; Morales, J. A.

    2017-09-01

    DNA sequences in human genome can be divided into the coding and noncoding ones. Coding sequences are those that are read during the transcription. The identification of coding sequences has been widely reported in literature due to its much-studied periodicity. Noncoding sequences represent the majority of the human genome. They play an important role in gene regulation and differentiation among the cells. However, noncoding sequences do not exhibit periodicities that correlate to their functions. The ENCODE (Encyclopedia of DNA elements) and Epigenomic Roadmap Project projects have cataloged the human noncoding sequences into specific functions. We study characteristics of noncoding sequences with wavelet analysis of genomic signals.

  11. Phylogenetic analyses of the polyprotein coding sequences of serotype O foot-and-mouth disease viruses in East Africa: evidence for interserotypic recombination

    Directory of Open Access Journals (Sweden)

    Balinda Sheila N

    2010-08-01

    Full Text Available Abstract Background Foot-and-mouth disease (FMD is endemic in East Africa with the majority of the reported outbreaks attributed to serotype O virus. In this study, phylogenetic analyses of the polyprotein coding region of serotype O FMD viruses from Kenya and Uganda has been undertaken to infer evolutionary relationships and processes responsible for the generation and maintenance of diversity within this serotype. FMD virus RNA was obtained from six samples following virus isolation in cell culture and in one case by direct extraction from an oropharyngeal sample. Following RT-PCR, the single long open reading frame, encoding the polyprotein, was sequenced. Results Phylogenetic comparisons of the VP1 coding region showed that the recent East African viruses belong to one lineage within the EA-2 topotype while an older Kenyan strain, K/52/1992 is a representative of the topotype EA-1. Evolutionary relationships between the coding regions for the leader protease (L, the capsid region and almost the entire coding region are monophyletic except for the K/52/1992 which is distinct. Furthermore, phylogenetic relationships for the P2 and P3 regions suggest that the K/52/1992 is a probable recombinant between serotypes A and O. A bootscan analysis of K/52/1992 with East African FMD serotype A viruses (A21/KEN/1964 and A23/KEN/1965 and serotype O viral isolate (K/117/1999 revealed that the P2 region is probably derived from a serotype A strain while the P3 region appears to be a mosaic derived from both serotypes A and O. Conclusions Sequences of the VP1 coding region from recent serotype O FMDVs from Kenya and Uganda are all representatives of a specific East African lineage (topotype EA-2, a probable indication that hardly any FMD introductions of this serotype have occurred from outside the region in the recent past. Furthermore, evidence for interserotypic recombination, within the non-structural protein coding regions, between FMDVs of serotypes A

  12. The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.

    Science.gov (United States)

    Zhao, Chen; Pyle, Anna Marie

    2017-12-01

    The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa

    Directory of Open Access Journals (Sweden)

    Aline Aki Tanikawa

    2013-08-01

    Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.

  14. Development of elvitegravir resistance and linkage of integrase inhibitor mutations with protease and reverse transcriptase resistance mutations.

    Directory of Open Access Journals (Sweden)

    Mark A Winters

    Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.

  15. Performance Analysis of Direct-Sequence Code-Division Multiple-Access Communications with Asymmetric Quadrature Phase-Shift-Keying Modulation

    Science.gov (United States)

    Wang, C.-W.; Stark, W.

    2005-01-01

    This article considers a quaternary direct-sequence code-division multiple-access (DS-CDMA) communication system with asymmetric quadrature phase-shift-keying (AQPSK) modulation for unequal error protection (UEP) capability. Both time synchronous and asynchronous cases are investigated. An expression for the probability distribution of the multiple-access interference is derived. The exact bit-error performance and the approximate performance using a Gaussian approximation and random signature sequences are evaluated by extending the techniques used for uniform quadrature phase-shift-keying (QPSK) and binary phase-shift-keying (BPSK) DS-CDMA systems. Finally, a general system model with unequal user power and the near-far problem is considered and analyzed. The results show that, for a system with UEP capability, the less protected data bits are more sensitive to the near-far effect that occurs in a multiple-access environment than are the more protected bits.

  16. MicroRNA-200c modulates the expression of MUC4 and MUC16 by directly targeting their coding sequences in human pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Prakash Radhakrishnan

    Full Text Available Transmembrane mucins, MUC4 and MUC16 are associated with tumor progression and metastatic potential in human pancreatic adenocarcinoma. We discovered that miR-200c interacts with specific sequences within the coding sequence of MUC4 and MUC16 mRNAs, and evaluated the regulatory nature of this association. Pancreatic cancer cell lines S2.028 and T3M-4 transfected with miR-200c showed a 4.18 and 8.50 fold down regulation of MUC4 mRNA, and 4.68 and 4.82 fold down regulation of MUC16 mRNA compared to mock-transfected cells, respectively. A significant reduction of glycoprotein expression was also observed. These results indicate that miR-200c overexpression regulates MUC4 and MUC16 mucins in pancreatic cancer cells by directly targeting the mRNA coding sequence of each, resulting in reduced levels of MUC4 and MUC16 mRNA and protein. These data suggest that, in addition to regulating proteins that modulate EMT, miR-200c influences expression of cell surface mucins in pancreatic cancer.

  17. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients

    DEFF Research Database (Denmark)

    Lundgren, Jens

    2008-01-01

    BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...

  18. Functional interrogation of non-coding DNA through CRISPR genome editing.

    Science.gov (United States)

    Canver, Matthew C; Bauer, Daniel E; Orkin, Stuart H

    2017-05-15

    Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Metal resistance sequences and transgenic plants

    Science.gov (United States)

    Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.

    1999-10-12

    The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.

  20. Role of the K101E substitution in HIV-1 reverse transcriptase in resistance to rilpivirine and other nonnucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A

    2013-11-01

    Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.

  1. Biased Gene Conversion and GC-Content Evolution in the Coding Sequences of Reptiles and Vertebrates

    Science.gov (United States)

    Figuet, Emeric; Ballenghien, Marion; Romiguier, Jonathan; Galtier, Nicolas

    2015-01-01

    Mammalian and avian genomes are characterized by a substantial spatial heterogeneity of GC-content, which is often interpreted as reflecting the effect of local GC-biased gene conversion (gBGC), a meiotic repair bias that favors G and C over A and T alleles in high-recombining genomic regions. Surprisingly, the first fully sequenced nonavian sauropsid (i.e., reptile), the green anole Anolis carolinensis, revealed a highly homogeneous genomic GC-content landscape, suggesting the possibility that gBGC might not be at work in this lineage. Here, we analyze GC-content evolution at third-codon positions (GC3) in 44 vertebrates species, including eight newly sequenced transcriptomes, with a specific focus on nonavian sauropsids. We report that reptiles, including the green anole, have a genome-wide distribution of GC3 similar to that of mammals and birds, and we infer a strong GC3-heterogeneity to be already present in the tetrapod ancestor. We further show that the dynamic of coding sequence GC-content is largely governed by karyotypic features in vertebrates, notably in the green anole, in agreement with the gBGC hypothesis. The discrepancy between third-codon positions and noncoding DNA regarding GC-content dynamics in the green anole could not be explained by the activity of transposable elements or selection on codon usage. This analysis highlights the unique value of third-codon positions as an insertion/deletion-free marker of nucleotide substitution biases that ultimately affect the evolution of proteins. PMID:25527834

  2. De novo ORFs in Drosophila are important to organismal fitness and evolved rapidly from previously non-coding sequences.

    Directory of Open Access Journals (Sweden)

    Josephine A Reinhardt

    Full Text Available How non-coding DNA gives rise to new protein-coding genes (de novo genes is not well understood. Recent work has revealed the origins and functions of a few de novo genes, but common principles governing the evolution or biological roles of these genes are unknown. To better define these principles, we performed a parallel analysis of the evolution and function of six putatively protein-coding de novo genes described in Drosophila melanogaster. Reconstruction of the transcriptional history of de novo genes shows that two de novo genes emerged from novel long non-coding RNAs that arose at least 5 MY prior to evolution of an open reading frame. In contrast, four other de novo genes evolved a translated open reading frame and transcription within the same evolutionary interval suggesting that nascent open reading frames (proto-ORFs, while not required, can contribute to the emergence of a new de novo gene. However, none of the genes arose from proto-ORFs that existed long before expression evolved. Sequence and structural evolution of de novo genes was rapid compared to nearby genes and the structural complexity of de novo genes steadily increases over evolutionary time. Despite the fact that these genes are transcribed at a higher level in males than females, and are most strongly expressed in testes, RNAi experiments show that most of these genes are essential in both sexes during metamorphosis. This lethality suggests that protein coding de novo genes in Drosophila quickly become functionally important.

  3. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  4. Deep Sequencing Reveals the Complete Genome and Evidence for Transcriptional Activity of the First Virus-Like Sequences Identified in Aristotelia chilensis (Maqui Berry

    Directory of Open Access Journals (Sweden)

    Javier Villacreses

    2015-04-01

    Full Text Available Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1. High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs: ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV, Petuvirus genus. ORF1 encodes a movement protein (MP; ORF2 a Reverse Transcriptase (RT and a Ribonuclease H (RNase H domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs, AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq. Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant.

  5. Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda

    Directory of Open Access Journals (Sweden)

    Mengjuan Zhu

    2016-03-01

    Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.

  6. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  7. Capsid coding sequences of foot-and-mouth disease viruses are determinants of pathogenicity in pigs

    DEFF Research Database (Denmark)

    Lohse, Louise; Jackson, Terry; Bøtner, Anette

    2012-01-01

    The surface exposed capsid proteins, VP1, VP2 and VP3, of foot-and-mouth disease virus (FMDV) determine its antigenicity and the ability of the virus to interact with host-cell receptors. Hence, modification of these structural proteins may alter the properties of the virus. In the present study we...... compared the pathogenicity of different FMDVs in young pigs. In total 32 pigs, 7-weeks-old, were exposed to virus, either by direct inoculation or through contact with inoculated pigs, using cell culture adapted (O1K B64), chimeric (O1K/A-TUR and O1K/O-UKG) or field strain (O-UKG/34/2001) viruses. The O1K...... coding sequences are determinants of FMDV pathogenicity in pigs....

  8. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region.

    Science.gov (United States)

    Kress, W John; Erickson, David L

    2007-06-06

    A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination.

  9. Computational Analysis of Molecular Interaction Networks Underlying Change of HIV-1 Resistance to Selected Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan

    2010-12-12

    Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.

  10. Phylogenomic Resolution of the Phylogeny of Laurasiatherian Mammals: Exploring Phylogenetic Signals within Coding and Noncoding Sequences.

    Science.gov (United States)

    Chen, Meng-Yun; Liang, Dan; Zhang, Peng

    2017-08-01

    The interordinal relationships of Laurasiatherian mammals are currently one of the most controversial questions in mammalian phylogenetics. Previous studies mainly relied on coding sequences (CDS) and seldom used noncoding sequences. Here, by data mining public genome data, we compiled an intron data set of 3,638 genes (all introns from a protein-coding gene are considered as a gene) (19,055,073 bp) and a CDS data set of 10,259 genes (20,994,285 bp), covering all major lineages of Laurasiatheria (except Pholidota). We found that the intron data contained stronger and more congruent phylogenetic signals than the CDS data. In agreement with this observation, concatenation and species-tree analyses of the intron data set yielded well-resolved and identical phylogenies, whereas the CDS data set produced weakly supported and incongruent results. Further analyses showed that the phylogeny inferred from the intron data is highly robust to data subsampling and change in outgroup, but the CDS data produced unstable results under the same conditions. Interestingly, gene tree statistical results showed that the most frequently observed gene tree topologies for the CDS and intron data are identical, suggesting that the major phylogenetic signal within the CDS data is actually congruent with that within the intron data. Our final result of Laurasiatheria phylogeny is (Eulipotyphla,((Chiroptera, Perissodactyla),(Carnivora, Cetartiodactyla))), favoring a close relationship between Chiroptera and Perissodactyla. Our study 1) provides a well-supported phylogenetic framework for Laurasiatheria, representing a step towards ending the long-standing "hard" polytomy and 2) argues that intron within genome data is a promising data resource for resolving rapid radiation events across the tree of life. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Report number codes

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, R.N. (ed.)

    1985-05-01

    This publication lists all report number codes processed by the Office of Scientific and Technical Information. The report codes are substantially based on the American National Standards Institute, Standard Technical Report Number (STRN)-Format and Creation Z39.23-1983. The Standard Technical Report Number (STRN) provides one of the primary methods of identifying a specific technical report. The STRN consists of two parts: The report code and the sequential number. The report code identifies the issuing organization, a specific program, or a type of document. The sequential number, which is assigned in sequence by each report issuing entity, is not included in this publication. Part I of this compilation is alphabetized by report codes followed by issuing installations. Part II lists the issuing organization followed by the assigned report code(s). In both Parts I and II, the names of issuing organizations appear for the most part in the form used at the time the reports were issued. However, for some of the more prolific installations which have had name changes, all entries have been merged under the current name.

  12. Report number codes

    International Nuclear Information System (INIS)

    Nelson, R.N.

    1985-05-01

    This publication lists all report number codes processed by the Office of Scientific and Technical Information. The report codes are substantially based on the American National Standards Institute, Standard Technical Report Number (STRN)-Format and Creation Z39.23-1983. The Standard Technical Report Number (STRN) provides one of the primary methods of identifying a specific technical report. The STRN consists of two parts: The report code and the sequential number. The report code identifies the issuing organization, a specific program, or a type of document. The sequential number, which is assigned in sequence by each report issuing entity, is not included in this publication. Part I of this compilation is alphabetized by report codes followed by issuing installations. Part II lists the issuing organization followed by the assigned report code(s). In both Parts I and II, the names of issuing organizations appear for the most part in the form used at the time the reports were issued. However, for some of the more prolific installations which have had name changes, all entries have been merged under the current name

  13. Comparative genomics beyond sequence-based alignments

    DEFF Research Database (Denmark)

    Þórarinsson, Elfar; Yao, Zizhen; Wiklund, Eric D.

    2008-01-01

    Recent computational scans for non-coding RNAs (ncRNAs) in multiple organisms have relied on existing multiple sequence alignments. However, as sequence similarity drops, a key signal of RNA structure--frequent compensating base changes--is increasingly likely to cause sequence-based alignment me...

  14. Generic detection of poleroviruses using an RT-PCR assay targeting the RdRp coding sequence.

    Science.gov (United States)

    Lotos, Leonidas; Efthimiou, Konstantinos; Maliogka, Varvara I; Katis, Nikolaos I

    2014-03-01

    In this study a two-step RT-PCR assay was developed for the generic detection of poleroviruses. The RdRp coding region was selected as the primers' target, since it differs significantly from that of other members in the family Luteoviridae and its sequence can be more informative than other regions in the viral genome. Species specific RT-PCR assays targeting the same region were also developed for the detection of the six most widespread poleroviral species (Beet mild yellowing virus, Beet western yellows virus, Cucurbit aphid-borne virus, Carrot red leaf virus, Potato leafroll virus and Turnip yellows virus) in Greece and the collection of isolates. These isolates along with other characterized ones were used for the evaluation of the generic PCR's detection range. The developed assay efficiently amplified a 593bp RdRp fragment from 46 isolates of 10 different Polerovirus species. Phylogenetic analysis using the generic PCR's amplicon sequence showed that although it cannot accurately infer evolutionary relationships within the genus it can differentiate poleroviruses at the species level. Overall, the described generic assay could be applied for the reliable detection of Polerovirus infections and, in combination with the specific PCRs, for the identification of new and uncharacterized species in the genus. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Annotating non-coding regions of the genome.

    Science.gov (United States)

    Alexander, Roger P; Fang, Gang; Rozowsky, Joel; Snyder, Michael; Gerstein, Mark B

    2010-08-01

    Most of the human genome consists of non-protein-coding DNA. Recently, progress has been made in annotating these non-coding regions through the interpretation of functional genomics experiments and comparative sequence analysis. One can conceptualize functional genomics analysis as involving a sequence of steps: turning the output of an experiment into a 'signal' at each base pair of the genome; smoothing this signal and segmenting it into small blocks of initial annotation; and then clustering these small blocks into larger derived annotations and networks. Finally, one can relate functional genomics annotations to conserved units and measures of conservation derived from comparative sequence analysis.

  16. Codon size reduction as the origin of the triplet genetic code.

    Directory of Open Access Journals (Sweden)

    Pavel V Baranov

    Full Text Available The genetic code appears to be optimized in its robustness to missense errors and frameshift errors. In addition, the genetic code is near-optimal in terms of its ability to carry information in addition to the sequences of encoded proteins. As evolution has no foresight, optimality of the modern genetic code suggests that it evolved from less optimal code variants. The length of codons in the genetic code is also optimal, as three is the minimal nucleotide combination that can encode the twenty standard amino acids. The apparent impossibility of transitions between codon sizes in a discontinuous manner during evolution has resulted in an unbending view that the genetic code was always triplet. Yet, recent experimental evidence on quadruplet decoding, as well as the discovery of organisms with ambiguous and dual decoding, suggest that the possibility of the evolution of triplet decoding from living systems with non-triplet decoding merits reconsideration and further exploration. To explore this possibility we designed a mathematical model of the evolution of primitive digital coding systems which can decode nucleotide sequences into protein sequences. These coding systems can evolve their nucleotide sequences via genetic events of Darwinian evolution, such as point-mutations. The replication rates of such coding systems depend on the accuracy of the generated protein sequences. Computer simulations based on our model show that decoding systems with codons of length greater than three spontaneously evolve into predominantly triplet decoding systems. Our findings suggest a plausible scenario for the evolution of the triplet genetic code in a continuous manner. This scenario suggests an explanation of how protein synthesis could be accomplished by means of long RNA-RNA interactions prior to the emergence of the complex decoding machinery, such as the ribosome, that is required for stabilization and discrimination of otherwise weak triplet codon

  17. Accident sequence quantification with KIRAP

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong

    1997-01-01

    The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP`s cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs.

  18. Accident sequence quantification with KIRAP

    International Nuclear Information System (INIS)

    Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong.

    1997-01-01

    The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP's cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs

  19. [Study of human immunodeficiency virus transmission chains in Andalusia: analysis from baseline antiretroviral resistance sequences].

    Science.gov (United States)

    Pérez-Parra, Santiago; Chueca-Porcuna, Natalia; Álvarez-Estevez, Marta; Pasquau, Juan; Omar, Mohamed; Collado, Antonio; Vinuesa, David; Lozano, Ana Belen; García-García, Federico

    2015-11-01

    Protease and reverse transcriptase HIV-1 sequences provide useful information for patient clinical management, as well as information on resistance to antiretrovirals. The aim of this study is to evaluate transmission events, transmitted drug resistance, and to georeference subtypes among newly diagnosed patients referred to our center. A study was conducted on 693 patients diagnosed between 2005 and 2012 in Southern Spain. Protease and reverse transcriptase sequences were obtained for resistance to cART analysis with Trugene(®) HIV Genotyping Kit (Siemens, NAD). MEGA 5.2, Neighbor-Joining, ArcGIS and REGA were used for subsequent analysis. The results showed 298 patients clustered into 77 different transmission events. Most of the clusters were formed by pairs (n=49), of men having sex with men (n=26), Spanish (n=37), and below 45 years of age (73.5%). Urban areas from Granada, and the coastal areas of Almeria and Granada showed the greatest subtype heterogeneity. Five clusters were formed by more than 10 patients, and 15 clusters had transmitted drug resistance. The study data demonstrate how the phylogenetic characterization of transmission clusters is a powerful tool to monitor the spread of HIV, and may contribute to design correct preventive measures to minimize it. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  20. DNA Barcoding through Quaternary LDPC Codes.

    Science.gov (United States)

    Tapia, Elizabeth; Spetale, Flavio; Krsticevic, Flavia; Angelone, Laura; Bulacio, Pilar

    2015-01-01

    For many parallel applications of Next-Generation Sequencing (NGS) technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH) or have intrinsic poor error correcting abilities (Hamming). Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC) codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10(-2) per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10(-9) at the expense of a rate of read losses just in the order of 10(-6).

  1. DNA Barcoding through Quaternary LDPC Codes.

    Directory of Open Access Journals (Sweden)

    Elizabeth Tapia

    Full Text Available For many parallel applications of Next-Generation Sequencing (NGS technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH or have intrinsic poor error correcting abilities (Hamming. Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10(-2 per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10(-9 at the expense of a rate of read losses just in the order of 10(-6.

  2. Evolving uses of oral reverse transcriptase inhibitors in the HIV-1 epidemic: From treatment to prevention

    NARCIS (Netherlands)

    R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)

    2013-01-01

    textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the

  3. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  4. Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P

    2011-12-08

    RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.

  5. Design of Long Period Pseudo-Random Sequences from the Addition of -Sequences over

    Directory of Open Access Journals (Sweden)

    Ren Jian

    2004-01-01

    Full Text Available Pseudo-random sequence with good correlation property and large linear span is widely used in code division multiple access (CDMA communication systems and cryptology for reliable and secure information transmission. In this paper, sequences with long period, large complexity, balance statistics, and low cross-correlation property are constructed from the addition of -sequences with pairwise-prime linear spans (AMPLS. Using -sequences as building blocks, the proposed method proved to be an efficient and flexible approach to construct long period pseudo-random sequences with desirable properties from short period sequences. Applying the proposed method to , a signal set is constructed.

  6. Nonnucleoside Reverse-transcriptase Inhibitor- vs Ritonavir-boosted Protease Inhibitor-based Regimens for Initial Treatment of HIV Infection

    DEFF Research Database (Denmark)

    Borges, Álvaro H; Lundh, Andreas; Tendal, Britta

    2016-01-01

    BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...

  7. Complete cDNA sequence coding for human docking protein

    Energy Technology Data Exchange (ETDEWEB)

    Hortsch, M; Labeit, S; Meyer, D I

    1988-01-11

    Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.

  8. Older persons' worries expressed during home care visits: exploring the content of cues and concerns identified by the Verona coding definitions of emotional sequences.

    NARCIS (Netherlands)

    Hafskjold, L.; Eide, T.; Holmström, I.K.; Sundling, V.; Dulmen, S. van; Eide, H.

    2016-01-01

    Objective: Little is known about how older persons in home care express their concerns. Emotional cues and concerns can be identified by the Verona coding definitions of emotional sequences (VR-CoDES), but the method gives no insight into what causes the distress and the emotions involved. The aims

  9. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma

    OpenAIRE

    Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

    2018-01-01

    Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...

  10. A STUDY ON DETERMINING THE REFERENCE SPREADING SEQUENCES FOR A DS/CDMACOMMUNICATION SYSTEM

    Directory of Open Access Journals (Sweden)

    Cebrail ÇİFTLİKLİ

    2002-02-01

    Full Text Available In a direct sequence/code division multiple access (DS/CDMA system, the role of the spreading sequences (codes is crucial since the multiple access interference (MAI is the main performance limitation. In this study, we propose an accurate criterion which enables the determination of the reference spreading codes which yield lower bit error rates (BER's in a given code set for a DS/CDMA system using despreading sequences weighted by stepping chip waveforms. The numerical results show that the spreading codes determined by the proposed criterion are the most suitable codes for using as references.

  11. Codes on the Klein quartic, ideals, and decoding

    DEFF Research Database (Denmark)

    Hansen, Johan P.

    1987-01-01

    descriptions as left ideals in the group-algebra GF(2^{3})[G]. This description allows for easy decoding. For instance, in the case of the single error correcting code of length21and dimension16with minimal distance3. decoding is obtained by multiplication with an idempotent in the group algebra.......A sequence of codes with particular symmetries and with large rates compared to their minimal distances is constructed over the field GF(2^{3}). In the sequence there is, for instance, a code of length 21 and dimension10with minimal distance9, and a code of length21and dimension16with minimal...... distance3. The codes are constructed from algebraic geometry using the dictionary between coding theory and algebraic curves over finite fields established by Goppa. The curve used in the present work is the Klein quartic. This curve has the maximal number of rational points over GF(2^{3})allowed by Serre...

  12. Computational drug design strategies applied to the modelling of human immunodeficiency virus-1 reverse transcriptase inhibitors

    Directory of Open Access Journals (Sweden)

    Lucianna Helene Santos

    2015-11-01

    Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.

  13. Generation of pseudo-random sequences for spread spectrum systems

    Science.gov (United States)

    Moser, R.; Stover, J.

    1985-05-01

    The characteristics of pseudo random radio signal sequences (PRS) are explored. The randomness of the PSR is a matter of artificially altering the sequence of binary digits broadcast. Autocorrelations of the two sequences shifted in time, if high, determine if the signals are the same and thus allow for position identification. Cross-correlation can also be calculated between sequences. Correlations closest to zero are obtained with large volume of prime numbers in the sequences. Techniques for selecting optimal and maximal lengths for the sequences are reviewed. If the correlations are near zero in the sequences, then signal channels can accommodate multiple users. Finally, Gold codes are discussed as a technique for maximizing the code lengths.

  14. An upper bound on the number of errors corrected by a convolutional code

    DEFF Research Database (Denmark)

    Justesen, Jørn

    2000-01-01

    The number of errors that a convolutional codes can correct in a segment of the encoded sequence is upper bounded by the number of distinct syndrome sequences of the relevant length.......The number of errors that a convolutional codes can correct in a segment of the encoded sequence is upper bounded by the number of distinct syndrome sequences of the relevant length....

  15. Annotating pathogenic non-coding variants in genic regions.

    Science.gov (United States)

    Gelfman, Sahar; Wang, Quanli; McSweeney, K Melodi; Ren, Zhong; La Carpia, Francesca; Halvorsen, Matt; Schoch, Kelly; Ratzon, Fanni; Heinzen, Erin L; Boland, Michael J; Petrovski, Slavé; Goldstein, David B

    2017-08-09

    Identifying the underlying causes of disease requires accurate interpretation of genetic variants. Current methods ineffectively capture pathogenic non-coding variants in genic regions, resulting in overlooking synonymous and intronic variants when searching for disease risk. Here we present the Transcript-inferred Pathogenicity (TraP) score, which uses sequence context alterations to reliably identify non-coding variation that causes disease. High TraP scores single out extremely rare variants with lower minor allele frequencies than missense variants. TraP accurately distinguishes known pathogenic and benign variants in synonymous (AUC = 0.88) and intronic (AUC = 0.83) public datasets, dismissing benign variants with exceptionally high specificity. TraP analysis of 843 exomes from epilepsy family trios identifies synonymous variants in known epilepsy genes, thus pinpointing risk factors of disease from non-coding sequence data. TraP outperforms leading methods in identifying non-coding variants that are pathogenic and is therefore a valuable tool for use in gene discovery and the interpretation of personal genomes.While non-coding synonymous and intronic variants are often not under strong selective constraint, they can be pathogenic through affecting splicing or transcription. Here, the authors develop a score that uses sequence context alterations to predict pathogenicity of synonymous and non-coding genetic variants, and provide a web server of pre-computed scores.

  16. On Coding Non-Contiguous Letter Combinations

    Directory of Open Access Journals (Sweden)

    Frédéric eDandurand

    2011-06-01

    Full Text Available Starting from the hypothesis that printed word identification initially involves the parallel mapping of visual features onto location-specific letter identities, we analyze the type of information that would be involved in optimally mapping this location-specific orthographic code onto a location-invariant lexical code. We assume that some intermediate level of coding exists between individual letters and whole words, and that this involves the representation of letter combinations. We then investigate the nature of this intermediate level of coding given the constraints of optimality. This intermediate level of coding is expected to compress data while retaining as much information as possible about word identity. Information conveyed by letters is a function of how much they constrain word identity and how visible they are. Optimization of this coding is a combination of minimizing resources (using the most compact representations and maximizing information. We show that in a large proportion of cases, non-contiguous letter sequences contain more information than contiguous sequences, while at the same time requiring less precise coding. Moreover, we found that the best predictor of human performance in orthographic priming experiments was within-word ranking of conditional probabilities, rather than average conditional probabilities. We conclude that from an optimality perspective, readers learn to select certain contiguous and non-contiguous letter combinations as information that provides the best cue to word identity.

  17. Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice

    Science.gov (United States)

    Li, Runqin; Zhang, Yinglin

    2016-01-01

    Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632

  18. High prevalence of HIV-1 transmitted drug-resistance mutations from proviral DNA massively parallel sequencing data of therapy-naïve chronically infected Brazilian blood donors.

    Directory of Open Access Journals (Sweden)

    Rodrigo Pessôa

    Full Text Available An improved understanding of the prevalence of low-abundance transmitted drug-resistance mutations (TDRM in therapy-naïve HIV-1-infected patients may help determine which patients are the best candidates for therapy. In this study, we aimed to obtain a comprehensive picture of the evolving HIV-1 TDRM across the massive parallel sequences (MPS of the viral entire proviral genome in a well-characterized Brazilian blood donor naïve to antiretroviral drugs.The MPS data from 128 samples used in the analysis were sourced from Brazilian blood donors and were previously classified by less-sensitive (LS or "detuned" enzyme immunoassay as non-recent or longstanding HIV-1 infections. The Stanford HIV Resistance Database (HIVDBv 6.2 and IAS-USA mutation lists were used to interpret the pattern of drug resistance. The minority variants with TDRM were identified using a threshold of ≥ 1.0% and ≤ 20% of the reads sequenced. The rate of TDRM in the MPS data of the proviral genome were compared with the corresponding published consensus sequences of their plasma viruses.No TDRM were detected in the integrase or envelope regions. The overall prevalence of TDRM in the protease (PR and reverse transcriptase (RT regions of the HIV-1 pol gene was 44.5% (57/128, including any mutations to the nucleoside analogue reverse transcriptase inhibitors (NRTI and non-nucleoside analogue reverse transcriptase inhibitors (NNRTI. Of the 57 subjects, 43 (75.4% harbored a minority variant containing at least one clinically relevant TDRM. Among the 43 subjects, 33 (76.7% had detectable minority resistant variants to NRTIs, 6 (13.9% to NNRTIs, and 16 (37.2% to PR inhibitors. The comparison of viral sequences in both sources, plasma and cells, would have detected 48 DNA provirus disclosed TDRM by MPS previously missed by plasma bulk analysis.Our findings revealed a high prevalence of TDRM found in this group, as the use of MPS drastically increased the detection of these

  19. Linear network error correction coding

    CERN Document Server

    Guang, Xuan

    2014-01-01

    There are two main approaches in the theory of network error correction coding. In this SpringerBrief, the authors summarize some of the most important contributions following the classic approach, which represents messages by sequences?similar to algebraic coding,?and also briefly discuss the main results following the?other approach,?that uses the theory of rank metric codes for network error correction of representing messages by subspaces. This book starts by establishing the basic linear network error correction (LNEC) model and then characterizes two equivalent descriptions. Distances an

  20. A randomized trial comparing initial HAART regimens of nelfinavir/nevirapine and ritonavir/saquinavir in combination with two nucleoside reverse transcriptase inhibitors

    DEFF Research Database (Denmark)

    Kirk, Ole; Lundgren, Jens D; Pedersen, Court

    2003-01-01

    BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....

  1. Molecular docking and 3D-QSAR studies on triazolinone and pyridazinone, non-nucleoside inhibitor of HIV-1 reverse transcriptase.

    Science.gov (United States)

    Sivan, Sree Kanth; Manga, Vijjulatha

    2010-06-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.

  2. A comparison of the cytotoxicity and proinflammatory cytokine production of EndoSequence root repair material and ProRoot mineral trioxide aggregate in human osteoblast cell culture using reverse-transcriptase polymerase chain reaction.

    Science.gov (United States)

    Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre

    2012-04-01

    The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  3. The Genomic Code: Genome Evolution and Potential Applications

    KAUST Repository

    Bernardi, Giorgio

    2016-01-25

    The genome of metazoans is organized according to a genomic code which comprises three laws: 1) Compositional correlations hold between contiguous coding and non-coding sequences, as well as among the three codon positions of protein-coding genes; these correlations are the consequence of the fact that the genomes under consideration consist of fairly homogeneous, long (≥200Kb) sequences, the isochores; 2) Although isochores are defined on the basis of purely compositional properties, GC levels of isochores are correlated with all tested structural and functional properties of the genome; 3) GC levels of isochores are correlated with chromosome architecture from interphase to metaphase; in the case of interphase the correlation concerns isochores and the three-dimensional “topological associated domains” (TADs); in the case of mitotic chromosomes, the correlation concerns isochores and chromosomal bands. Finally, the genomic code is the fourth and last pillar of molecular biology, the first three pillars being 1) the double helix structure of DNA; 2) the regulation of gene expression in prokaryotes; and 3) the genetic code.

  4. Simultaneous chromatic dispersion and PMD compensation by using coded-OFDM and girth-10 LDPC codes.

    Science.gov (United States)

    Djordjevic, Ivan B; Xu, Lei; Wang, Ting

    2008-07-07

    Low-density parity-check (LDPC)-coded orthogonal frequency division multiplexing (OFDM) is studied as an efficient coded modulation scheme suitable for simultaneous chromatic dispersion and polarization mode dispersion (PMD) compensation. We show that, for aggregate rate of 10 Gb/s, accumulated dispersion over 6500 km of SMF and differential group delay of 100 ps can be simultaneously compensated with penalty within 1.5 dB (with respect to the back-to-back configuration) when training sequence based channel estimation and girth-10 LDPC codes of rate 0.8 are employed.

  5. On the Organizational Dynamics of the Genetic Code

    KAUST Repository

    Zhang, Zhang

    2011-06-07

    The organization of the canonical genetic code needs to be thoroughly illuminated. Here we reorder the four nucleotides—adenine, thymine, guanine and cytosine—according to their emergence in evolution, and apply the organizational rules to devising an algebraic representation for the canonical genetic code. Under a framework of the devised code, we quantify codon and amino acid usages from a large collection of 917 prokaryotic genome sequences, and associate the usages with its intrinsic structure and classification schemes as well as amino acid physicochemical properties. Our results show that the algebraic representation of the code is structurally equivalent to a content-centric organization of the code and that codon and amino acid usages under different classification schemes were correlated closely with GC content, implying a set of rules governing composition dynamics across a wide variety of prokaryotic genome sequences. These results also indicate that codons and amino acids are not randomly allocated in the code, where the six-fold degenerate codons and their amino acids have important balancing roles for error minimization. Therefore, the content-centric code is of great usefulness in deciphering its hitherto unknown regularities as well as the dynamics of nucleotide, codon, and amino acid compositions.

  6. On the Organizational Dynamics of the Genetic Code

    KAUST Repository

    Zhang, Zhang; Yu, Jun

    2011-01-01

    The organization of the canonical genetic code needs to be thoroughly illuminated. Here we reorder the four nucleotides—adenine, thymine, guanine and cytosine—according to their emergence in evolution, and apply the organizational rules to devising an algebraic representation for the canonical genetic code. Under a framework of the devised code, we quantify codon and amino acid usages from a large collection of 917 prokaryotic genome sequences, and associate the usages with its intrinsic structure and classification schemes as well as amino acid physicochemical properties. Our results show that the algebraic representation of the code is structurally equivalent to a content-centric organization of the code and that codon and amino acid usages under different classification schemes were correlated closely with GC content, implying a set of rules governing composition dynamics across a wide variety of prokaryotic genome sequences. These results also indicate that codons and amino acids are not randomly allocated in the code, where the six-fold degenerate codons and their amino acids have important balancing roles for error minimization. Therefore, the content-centric code is of great usefulness in deciphering its hitherto unknown regularities as well as the dynamics of nucleotide, codon, and amino acid compositions.

  7. Flexibility of the genetic code with respect to DNA structure

    DEFF Research Database (Denmark)

    Baisnée, P. F.; Baldi, Pierre; Brunak, Søren

    2001-01-01

    Motivation. The primary function of DNA is to carry genetic information through the genetic code. DNA, however, contains a variety of other signals related, for instance, to reading frame, codon bias, pairwise codon bias, splice sites and transcription regulation, nucleosome positioning and DNA...... structure. Here we study the relationship between the genetic code and DNA structure and address two questions. First, to which degree does the degeneracy of the genetic code and the acceptable amino acid substitution patterns allow for the superimposition of DNA structural signals to protein coding...... sequences? Second, is the origin or evolution of the genetic code likely to have been constrained by DNA structure? Results. We develop an index for code flexibility with respect to DNA structure. Using five different di- or tri-nucleotide models of sequence-dependent DNA structure, we show...

  8. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    Directory of Open Access Journals (Sweden)

    Jonas Binladen

    2007-02-01

    Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

  9. Species delimitation and phylogenetic reconstruction of the sinipercids (Perciformes: Sinipercidae) based on target enrichment of thousands of nuclear coding sequences.

    Science.gov (United States)

    Song, Shuli; Zhao, Jinliang; Li, Chenhong

    2017-06-01

    The sinipercids are freshwater fishes endemic to East Asia, mainly in China. Phylogenetic studies on the sinipercids have made great progress in the last decades, but interspecific relationships and evolutionary history of the sinipercids remain unresolved. Lack of distinctive morphological characters leads to problems in validating of some species, such as Siniperca loona. Moreover, genetic data are needed to delimitate species pairs with explicit hypothesis testing, such as in S. chuatsi vs. S. kneri and Coreoperca whiteheadi vs. C. liui. Here we reconstructed phylogeny of the sinipercids with an unprecedented scale of data, 16,943 loci of single-copy coding sequence data from nine sinipercid species, eight putative sister taxa and two outgroups. Targeted sequences were collected using gene enrichment and Illumina sequencing, yielding thousands of protein coding sequences and single nucleotide polymorphisms (SNPs) data. Maximum likelihood and coalescent species tree analyses resulted in identical and highly supported trees. We confirmed that the centrarchids are sister to the sinipercids. A monophyletic Sinipercidae with two genera, Siniperca and Coreoperca was also supported. Different from most previous studies, S. scherzeri was found as the most basal taxon to other species of Siniperca, which consists of two clades: a clade having S. roulei sister to S. chuatsi and S. kneri, and a clade consisting S. loona sister to S. obscura and S. undulata. We found that both S. loona and C. liui are valid species using Bayes factor delimitation (BFD ∗ ) based on SNPs data. Species delimitation also provided decisive support for S. chuatsi and S. kneri being two distinct species. We calibrated a chronogram of the sinipercids based on 100 loci and three fossil calibration points using BEAST, and reconstructed ancestral ranges of the sinipercids using Lagrange Analysis (DEC model) and Statistical Dispersal-Vicariance Analysis (S-DIVA) implemented in RASP. Divergence time

  10. Novel overlapping coding sequences in Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Jensen, Klaus Thorleif; Petersen, Lise; Falk, Søren

    2006-01-01

    that are in agreement with the primary annotation. Forty two genes from the primary annotation are not predicted by EasyGene. The majority of these genes are listed as hypothetical in the primary annotation. The 15 novel predicted genes all overlap with genes on the complementary strand. We find homologues of several...... of the novel genes in C. trachomatis Serovar A and Chlamydia muridarum. Several of the genes have typical gene-like and protein-like features. Furthermore, we confirm transcriptional activity from 10 of the putative genes. The combined evidence suggests that at least seven of the 15 are protein coding genes...

  11. Phylogeny and resistance profiles of HIV-1 POL sequences from rectal biopsies and blood

    DEFF Research Database (Denmark)

    Katzenstein, T L; Petersen, A B; Storgaard, M

    2010-01-01

    The phylogeny and resistance profiles of human immunodeficiency virus type 1 (HIV-1) protease (PR) and reverse transcriptase (RT) sequences were compared among six patients with HIV-1 who had received numerous treatments. RNA and DNA fractions were obtained from concurrent blood and rectal biopsy...... samples. Phylogenetic trees and resistance profiles showed that the rectal mucosa and the peripheral blood mononuclear cells (PBMCs) harbored different HIV-1 strains. The resistance-associated mutations found in each strain corresponded to the treatment history of the patients. The resistance mutations...... acquired during earlier treatment regimens were detected in the sequences obtained from the rectal samples and in the PBMCs in several of the patients. Also, differences in the resistance profiles were observed between anatomical sites and between RNA and DNA fractions. Thus, a single sample probably...

  12. Polyurethane intravaginal ring for controlled delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1.

    Science.gov (United States)

    Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F

    2008-10-01

    Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

  13. Computer simulation of replacement sequences in copper

    International Nuclear Information System (INIS)

    Schiffgens, J.O.; Schwartz, D.W.; Ariyasu, R.G.; Cascadden, S.E.

    1978-01-01

    Results of computer simulations of , , and replacement sequences in copper are presented, including displacement thresholds, focusing energies, energy losses per replacement, and replacement sequence lengths. These parameters are tabulated for six interatomic potentials and shown to vary in a systematic way with potential stiffness and range. Comparisons of results from calculations made with ADDES, a quasi-dynamical code, and COMENT, a dynamical code, show excellent agreement, demonstrating that the former can be calibrated and used satisfactorily in the analysis of low energy displacement cascades. Upper limits on , , and replacement sequences were found to be approximately 10, approximately 30, and approximately 14 replacements, respectively. (author)

  14. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  15. The Vulnerability Assessment Code for Physical Protection System

    International Nuclear Information System (INIS)

    Jang, Sung Soon; Yoo, Ho Sik

    2007-01-01

    To neutralize the increasing terror threats, nuclear facilities have strong physical protection system (PPS). PPS includes detectors, door locks, fences, regular guard patrols, and a hot line to a nearest military force. To design an efficient PPS and to fully operate it, vulnerability assessment process is required. Evaluating PPS of a nuclear facility is complicate process and, hence, several assessment codes have been developed. The estimation of adversary sequence interruption (EASI) code analyzes vulnerability along a single intrusion path. To evaluate many paths to a valuable asset in an actual facility, the systematic analysis of vulnerability to intrusion (SAVI) code was developed. KAERI improved SAVI and made the Korean analysis of vulnerability to intrusion (KAVI) code. Existing codes (SAVI and KAVI) have limitations in representing the distance of a facility because they use the simplified model of a PPS called adversary sequence diagram. In adversary sequence diagram the position of doors, sensors and fences is described just as the locating area. Thus, the distance between elements is inaccurate and we cannot reflect the range effect of sensors. In this abstract, we suggest accurate and intuitive vulnerability assessment based on raster map modeling of PPS. The raster map of PPS accurately represents the relative position of elements and, thus, the range effect of sensor can be easily incorporable. Most importantly, the raster map is easy to understand

  16. Motion Detection in Ultrasound Image-Sequences Using Tensor Voting

    Science.gov (United States)

    Inba, Masafumi; Yanagida, Hirotaka; Tamura, Yasutaka

    2008-05-01

    Motion detection in ultrasound image sequences using tensor voting is described. We have been developing an ultrasound imaging system adopting a combination of coded excitation and synthetic aperture focusing techniques. In our method, frame rate of the system at distance of 150 mm reaches 5000 frame/s. Sparse array and short duration coded ultrasound signals are used for high-speed data acquisition. However, many artifacts appear in the reconstructed image sequences because of the incompleteness of the transmitted code. To reduce the artifacts, we have examined the application of tensor voting to the imaging method which adopts both coded excitation and synthetic aperture techniques. In this study, the basis of applying tensor voting and the motion detection method to ultrasound images is derived. It was confirmed that velocity detection and feature enhancement are possible using tensor voting in the time and space of simulated ultrasound three-dimensional image sequences.

  17. Coding chaotic billiards. Pt. 3

    International Nuclear Information System (INIS)

    Ullmo, D.; Giannoni, M.J.

    1993-01-01

    Non-tiling compact billiard defined on the pseudosphere is studied 'a la Morse coding'. As for most bounded systems, the coding is non exact. However, two sets of approximate grammar rules can be obtained, one specifying forbidden codes, and the other allowed ones. In-between some sequences remain in the 'unknown' zone, but their relative amount can be reduced to zero if one lets the length of the approximate grammar rules goes to infinity. The relationship between these approximate grammar rules and the 'pruning front' introduced by Cvitanovic et al. is discussed. (authors). 13 refs., 10 figs., 1 tab

  18. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P

    2007-01-01

    BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...

  19. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    Science.gov (United States)

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  20. Reverse transcriptase inhibitors as potential colorectal microbicides.

    Science.gov (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J

    2009-05-01

    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.

  1. Sequence Classification: 399898 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB Non-TMH Non-TMB TMB TMB TMB >gi|15610593|ref|NP_217974.1| PROBABLE DNA-DIRECTED RNA POLYMER...ASE (ALPHA CHAIN) RPOA (TRANSCRIPTASE ALPHA CHAIN) (RNA POLYMERASE ALPHA SUBUNIT) (DNA-DIREC

  2. Sequence Classification: 390122 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB Non-TMH Non-TMB TMB TMB TMB >gi|31794633|ref|NP_857126.1| PROBABLE DNA-DIRECTED RNA POLYMER...ASE (ALPHA CHAIN) RPOA (TRANSCRIPTASE ALPHA CHAIN) (RNA POLYMERASE ALPHA SUBUNIT) (DNA-DIREC

  3. Evaluation of nevirapine and/or hydroxyurea with nucleoside reverse transcriptase inhibitors in treatment-naive HIV-1-infected subjects

    NARCIS (Netherlands)

    Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.

    2004-01-01

    Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add

  4. Performance enhancement of successive interference cancellation scheme based on spectral amplitude coding for optical code-division multiple-access systems using Hadamard codes

    Science.gov (United States)

    Eltaif, Tawfig; Shalaby, Hossam M. H.; Shaari, Sahbudin; Hamarsheh, Mohammad M. N.

    2009-04-01

    A successive interference cancellation scheme is applied to optical code-division multiple-access (OCDMA) systems with spectral amplitude coding (SAC). A detailed analysis of this system, with Hadamard codes used as signature sequences, is presented. The system can easily remove the effect of the strongest signal at each stage of the cancellation process. In addition, simulation of the prose system is performed in order to validate the theoretical results. The system shows a small bit error rate at a large number of active users compared to the SAC OCDMA system. Our results reveal that the proposed system is efficient in eliminating the effect of the multiple-user interference and in the enhancement of the overall performance.

  5. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

    OpenAIRE

    Nicolas Sluis-Cremer

    2014-01-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...

  6. Coding Local and Global Binary Visual Features Extracted From Video Sequences

    Science.gov (United States)

    Baroffio, Luca; Canclini, Antonio; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2015-11-01

    Binary local features represent an effective alternative to real-valued descriptors, leading to comparable results for many visual analysis tasks, while being characterized by significantly lower computational complexity and memory requirements. When dealing with large collections, a more compact representation based on global features is often preferred, which can be obtained from local features by means of, e.g., the Bag-of-Visual-Word (BoVW) model. Several applications, including for example visual sensor networks and mobile augmented reality, require visual features to be transmitted over a bandwidth-limited network, thus calling for coding techniques that aim at reducing the required bit budget, while attaining a target level of efficiency. In this paper we investigate a coding scheme tailored to both local and global binary features, which aims at exploiting both spatial and temporal redundancy by means of intra- and inter-frame coding. In this respect, the proposed coding scheme can be conveniently adopted to support the Analyze-Then-Compress (ATC) paradigm. That is, visual features are extracted from the acquired content, encoded at remote nodes, and finally transmitted to a central controller that performs visual analysis. This is in contrast with the traditional approach, in which visual content is acquired at a node, compressed and then sent to a central unit for further processing, according to the Compress-Then-Analyze (CTA) paradigm. In this paper we experimentally compare ATC and CTA by means of rate-efficiency curves in the context of two different visual analysis tasks: homography estimation and content-based retrieval. Our results show that the novel ATC paradigm based on the proposed coding primitives can be competitive with CTA, especially in bandwidth limited scenarios.

  7. RNA-DNA sequence differences spell genetic code ambiguities

    DEFF Research Database (Denmark)

    Bentin, Thomas; Nielsen, Michael L

    2013-01-01

    A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...

  8. The Coding and Effector Transfer of Movement Sequences

    Science.gov (United States)

    Kovacs, Attila J.; Muhlbauer, Thomas; Shea, Charles H.

    2009-01-01

    Three experiments utilizing a 14-element arm movement sequence were designed to determine if reinstating the visual-spatial coordinates, which require movements to the same spatial locations utilized during acquisition, results in better effector transfer than reinstating the motor coordinates, which require the same pattern of homologous muscle…

  9. Whole-Exome Sequencing of 2,000 Danish Individuals and the Role of Rare Coding Variants in Type 2 Diabetes

    DEFF Research Database (Denmark)

    Lohmueller, Kirk E.; Sparsø, Thomas; Li, Qibin

    2013-01-01

    number of genes. We applied a series of gene-based tests to detect such susceptibility genes. However, no gene showed a significant association with disease risk after we corrected for the number of genes analyzed. Thus, we could reject a model for the genetic architecture of type 2 diabetes where rare......It has been hypothesized that, in aggregate, rare variants in coding regions of genes explain a substantial fraction of the heritability of common diseases. We sequenced the exomes of 1,000 Danish cases with common forms of type 2 diabetes (including body mass index > 27.5 kg/m2 and hypertension...

  10. Optimized Method for Generating and Acquiring GPS Gold Codes

    Directory of Open Access Journals (Sweden)

    Khaled Rouabah

    2015-01-01

    Full Text Available We propose a simpler and faster Gold codes generator, which can be efficiently initialized to any desired code, with a minimum delay. Its principle consists of generating only one sequence (code number 1 from which we can produce all the other different signal codes. This is realized by simply shifting this sequence by different delays that are judiciously determined by using the bicorrelation function characteristics. This is in contrast to the classical Linear Feedback Shift Register (LFSR based Gold codes generator that requires, in addition to the shift process, a significant number of logic XOR gates and a phase selector to change the code. The presence of all these logic XOR gates in classical LFSR based Gold codes generator provokes the consumption of an additional time in the generation and acquisition processes. In addition to its simplicity and its rapidity, the proposed architecture, due to the total absence of XOR gates, has fewer resources than the conventional Gold generator and can thus be produced at lower cost. The Digital Signal Processing (DSP implementations have shown that the proposed architecture presents a solution for acquiring Global Positioning System (GPS satellites signals optimally and in a parallel way.

  11. NMR structure of the HIV-1 reverse transcriptase thumb subdomain

    Energy Technology Data Exchange (ETDEWEB)

    Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)

    2016-12-15

    The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

  12. SequenceL: Automated Parallel Algorithms Derived from CSP-NT Computational Laws

    Science.gov (United States)

    Cooke, Daniel; Rushton, Nelson

    2013-01-01

    With the introduction of new parallel architectures like the cell and multicore chips from IBM, Intel, AMD, and ARM, as well as the petascale processing available for highend computing, a larger number of programmers will need to write parallel codes. Adding the parallel control structure to the sequence, selection, and iterative control constructs increases the complexity of code development, which often results in increased development costs and decreased reliability. SequenceL is a high-level programming language that is, a programming language that is closer to a human s way of thinking than to a machine s. Historically, high-level languages have resulted in decreased development costs and increased reliability, at the expense of performance. In recent applications at JSC and in industry, SequenceL has demonstrated the usual advantages of high-level programming in terms of low cost and high reliability. SequenceL programs, however, have run at speeds typically comparable with, and in many cases faster than, their counterparts written in C and C++ when run on single-core processors. Moreover, SequenceL is able to generate parallel executables automatically for multicore hardware, gaining parallel speedups without any extra effort from the programmer beyond what is required to write the sequen tial/singlecore code. A SequenceL-to-C++ translator has been developed that automatically renders readable multithreaded C++ from a combination of a SequenceL program and sample data input. The SequenceL language is based on two fundamental computational laws, Consume-Simplify- Produce (CSP) and Normalize-Trans - pose (NT), which enable it to automate the creation of parallel algorithms from high-level code that has no annotations of parallelism whatsoever. In our anecdotal experience, SequenceL development has been in every case less costly than development of the same algorithm in sequential (that is, single-core, single process) C or C++, and an order of magnitude less

  13. ReRep: Computational detection of repetitive sequences in genome survey sequences (GSS

    Directory of Open Access Journals (Sweden)

    Alves-Ferreira Marcelo

    2008-09-01

    Full Text Available Abstract Background Genome survey sequences (GSS offer a preliminary global view of a genome since, unlike ESTs, they cover coding as well as non-coding DNA and include repetitive regions of the genome. A more precise estimation of the nature, quantity and variability of repetitive sequences very early in a genome sequencing project is of considerable importance, as such data strongly influence the estimation of genome coverage, library quality and progress in scaffold construction. Also, the elimination of repetitive sequences from the initial assembly process is important to avoid errors and unnecessary complexity. Repetitive sequences are also of interest in a variety of other studies, for instance as molecular markers. Results We designed and implemented a straightforward pipeline called ReRep, which combines bioinformatics tools for identifying repetitive structures in a GSS dataset. In a case study, we first applied the pipeline to a set of 970 GSSs, sequenced in our laboratory from the human pathogen Leishmania braziliensis, the causative agent of leishmaniosis, an important public health problem in Brazil. We also verified the applicability of ReRep to new sequencing technologies using a set of 454-reads of an Escheria coli. The behaviour of several parameters in the algorithm is evaluated and suggestions are made for tuning of the analysis. Conclusion The ReRep approach for identification of repetitive elements in GSS datasets proved to be straightforward and efficient. Several potential repetitive sequences were found in a L. braziliensis GSS dataset generated in our laboratory, and further validated by the analysis of a more complete genomic dataset from the EMBL and Sanger Centre databases. ReRep also identified most of the E. coli K12 repeats prior to assembly in an example dataset obtained by automated sequencing using 454 technology. The parameters controlling the algorithm behaved consistently and may be tuned to the properties

  14. An automated annotation tool for genomic DNA sequences using

    Indian Academy of Sciences (India)

    Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated ...

  15. Genomic sequence around butterfly wing development genes: annotation and comparative analysis.

    Directory of Open Access Journals (Sweden)

    Inês C Conceição

    Full Text Available BACKGROUND: Analysis of genomic sequence allows characterization of genome content and organization, and access beyond gene-coding regions for identification of functional elements. BAC libraries, where relatively large genomic regions are made readily available, are especially useful for species without a fully sequenced genome and can increase genomic coverage of phylogenetic and biological diversity. For example, no butterfly genome is yet available despite the unique genetic and biological properties of this group, such as diversified wing color patterns. The evolution and development of these patterns is being studied in a few target species, including Bicyclus anynana, where a whole-genome BAC library allows targeted access to large genomic regions. METHODOLOGY/PRINCIPAL FINDINGS: We characterize ∼1.3 Mb of genomic sequence around 11 selected genes expressed in B. anynana developing wings. Extensive manual curation of in silico predictions, also making use of a large dataset of expressed genes for this species, identified repetitive elements and protein coding sequence, and highlighted an expansion of Alcohol dehydrogenase genes. Comparative analysis with orthologous regions of the lepidopteran reference genome allowed assessment of conservation of fine-scale synteny (with detection of new inversions and translocations and of DNA sequence (with detection of high levels of conservation of non-coding regions around some, but not all, developmental genes. CONCLUSIONS: The general properties and organization of the available B. anynana genomic sequence are similar to the lepidopteran reference, despite the more than 140 MY divergence. Our results lay the groundwork for further studies of new interesting findings in relation to both coding and non-coding sequence: 1 the Alcohol dehydrogenase expansion with higher similarity between the five tandemly-repeated B. anynana paralogs than with the corresponding B. mori orthologs, and 2 the high

  16. Sequence Classification: 388073 [

    Lifescience Database Archive (English)

    Full Text Available TMB Non-TMH TMB TMB TMB Non-TMB >gi|31792584|ref|NP_855077.1| PROBABLE DNA-DIRECTED RNA POLYMER...ASE (OMEGA CHAIN) RPOZ (TRANSCRIPTASE OMEGA CHAIN) (RNA POLYMERASE OMEGA SUBUNIT) || http://www.ncbi.nlm.nih.gov/protein/31792584 ...

  17. Sequence Classification: 397793 [

    Lifescience Database Archive (English)

    Full Text Available TMB Non-TMH TMB TMB TMB Non-TMB >gi|15608529|ref|NP_215906.1| PROBABLE DNA-DIRECTED RNA POLYMER...ASE (OMEGA CHAIN) RPOZ (TRANSCRIPTASE OMEGA CHAIN) (RNA POLYMERASE OMEGA SUBUNIT) || http://www.ncbi.nlm.nih.gov/protein/15608529 ...

  18. Sequence Classification: 407536 [

    Lifescience Database Archive (English)

    Full Text Available TMB Non-TMH Non-TMB TMB Non-TMB TMB >gi|15829032|ref|NP_326392.1| DNA-DIRECTED RNA POLYMER...ASE ALPHA CHAIN (TRANSCRIPTASE ALPHA CHAIN) (RNA POLYMERASE ALPHA SUBUNIT)rpo || http://www.ncbi.nlm.nih.gov/protein/15829032 ...

  19. Coding Local and Global Binary Visual Features Extracted From Video Sequences.

    Science.gov (United States)

    Baroffio, Luca; Canclini, Antonio; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2015-11-01

    Binary local features represent an effective alternative to real-valued descriptors, leading to comparable results for many visual analysis tasks while being characterized by significantly lower computational complexity and memory requirements. When dealing with large collections, a more compact representation based on global features is often preferred, which can be obtained from local features by means of, e.g., the bag-of-visual word model. Several applications, including, for example, visual sensor networks and mobile augmented reality, require visual features to be transmitted over a bandwidth-limited network, thus calling for coding techniques that aim at reducing the required bit budget while attaining a target level of efficiency. In this paper, we investigate a coding scheme tailored to both local and global binary features, which aims at exploiting both spatial and temporal redundancy by means of intra- and inter-frame coding. In this respect, the proposed coding scheme can conveniently be adopted to support the analyze-then-compress (ATC) paradigm. That is, visual features are extracted from the acquired content, encoded at remote nodes, and finally transmitted to a central controller that performs the visual analysis. This is in contrast with the traditional approach, in which visual content is acquired at a node, compressed and then sent to a central unit for further processing, according to the compress-then-analyze (CTA) paradigm. In this paper, we experimentally compare the ATC and the CTA by means of rate-efficiency curves in the context of two different visual analysis tasks: 1) homography estimation and 2) content-based retrieval. Our results show that the novel ATC paradigm based on the proposed coding primitives can be competitive with the CTA, especially in bandwidth limited scenarios.

  20. Antitumor effect of combination of the inhibitors of two new oncotargets: proton pumps and reverse transcriptase.

    Science.gov (United States)

    Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano

    2017-01-17

    Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.

  1. An RNA-Seq strategy to detect the complete coding and non-coding transcriptome including full-length imprinted macro ncRNAs.

    Directory of Open Access Journals (Sweden)

    Ru Huang

    Full Text Available Imprinted macro non-protein-coding (nc RNAs are cis-repressor transcripts that silence multiple genes in at least three imprinted gene clusters in the mouse genome. Similar macro or long ncRNAs are abundant in the mammalian genome. Here we present the full coding and non-coding transcriptome of two mouse tissues: differentiated ES cells and fetal head using an optimized RNA-Seq strategy. The data produced is highly reproducible in different sequencing locations and is able to detect the full length of imprinted macro ncRNAs such as Airn and Kcnq1ot1, whose length ranges between 80-118 kb. Transcripts show a more uniform read coverage when RNA is fragmented with RNA hydrolysis compared with cDNA fragmentation by shearing. Irrespective of the fragmentation method, all coding and non-coding transcripts longer than 8 kb show a gradual loss of sequencing tags towards the 3' end. Comparisons to published RNA-Seq datasets show that the strategy presented here is more efficient in detecting known functional imprinted macro ncRNAs and also indicate that standardization of RNA preparation protocols would increase the comparability of the transcriptome between different RNA-Seq datasets.

  2. Low-Complexity Multiple Description Coding of Video Based on 3D Block Transforms

    Directory of Open Access Journals (Sweden)

    Andrey Norkin

    2007-02-01

    Full Text Available The paper presents a multiple description (MD video coder based on three-dimensional (3D transforms. Two balanced descriptions are created from a video sequence. In the encoder, video sequence is represented in a form of coarse sequence approximation (shaper included in both descriptions and residual sequence (details which is split between two descriptions. The shaper is obtained by block-wise pruned 3D-DCT. The residual sequence is coded by 3D-DCT or hybrid, LOT+DCT, 3D-transform. The coding scheme is targeted to mobile devices. It has low computational complexity and improved robustness of transmission over unreliable networks. The coder is able to work at very low redundancies. The coding scheme is simple, yet it outperforms some MD coders based on motion-compensated prediction, especially in the low-redundancy region. The margin is up to 3 dB for reconstruction from one description.

  3. Recurrence time statistics: versatile tools for genomic DNA sequence analysis.

    Science.gov (United States)

    Cao, Yinhe; Tung, Wen-Wen; Gao, J B

    2004-01-01

    With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.

  4. Implementation of LT codes based on chaos

    International Nuclear Information System (INIS)

    Zhou Qian; Li Liang; Chen Zengqiang; Zhao Jiaxiang

    2008-01-01

    Fountain codes provide an efficient way to transfer information over erasure channels like the Internet. LT codes are the first codes fully realizing the digital fountain concept. They are asymptotically optimal rateless erasure codes with highly efficient encoding and decoding algorithms. In theory, for each encoding symbol of LT codes, its degree is randomly chosen according to a predetermined degree distribution, and its neighbours used to generate that encoding symbol are chosen uniformly at random. Practical implementation of LT codes usually realizes the randomness through pseudo-randomness number generator like linear congruential method. This paper applies the pseudo-randomness of chaotic sequence in the implementation of LT codes. Two Kent chaotic maps are used to determine the degree and neighbour(s) of each encoding symbol. It is shown that the implemented LT codes based on chaos perform better than the LT codes implemented by the traditional pseudo-randomness number generator. (general)

  5. A New Video Coding Algorithm Using 3D-Subband Coding and Lattice Vector Quantization

    Energy Technology Data Exchange (ETDEWEB)

    Choi, J.H. [Taejon Junior College, Taejon (Korea, Republic of); Lee, K.Y. [Sung Kyun Kwan University, Suwon (Korea, Republic of)

    1997-12-01

    In this paper, we propose an efficient motion adaptive 3-dimensional (3D) video coding algorithm using 3D subband coding (3D-SBC) and lattice vector quantization (LVQ) for low bit rate. Instead of splitting input video sequences into the fixed number of subbands along the temporal axes, we decompose them into temporal subbands of variable size according to motions in frames. Each spatio-temporally splitted 7 subbands are partitioned by quad tree technique and coded with lattice vector quantization(LVQ). The simulation results show 0.1{approx}4.3dB gain over H.261 in peak signal to noise ratio(PSNR) at low bit rate (64Kbps). (author). 13 refs., 13 figs., 4 tabs.

  6. Low-pass shotgun sequencing of the barley genome facilitates rapid identification of genes, conserved non-coding sequences and novel repeats

    Directory of Open Access Journals (Sweden)

    Graner Andreas

    2008-10-01

    Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular

  7. Spread-spectrum communication using binary spatiotemporal chaotic codes

    International Nuclear Information System (INIS)

    Wang Xingang; Zhan Meng; Gong Xiaofeng; Lai, C.H.; Lai, Y.-C.

    2005-01-01

    We propose a scheme to generate binary code for baseband spread-spectrum communication by using a chain of coupled chaotic maps. We compare the performances of this type of spatiotemporal chaotic code with those of a conventional code used frequently in digital communication, the Gold code, and demonstrate that our code is comparable or even superior to the Gold code in several key aspects: security, bit error rate, code generation speed, and the number of possible code sequences. As the field of communicating with chaos faces doubts in terms of performance comparison with conventional digital communication schemes, our work gives a clear message that communicating with chaos can be advantageous and it deserves further attention from the nonlinear science community

  8. Sequence Classification: 407520 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB Non-TMH Non-TMB Non-TMB Non-TMB TMB >gi|15829016|ref|NP_326376.1| DNA-DIRECTED RNA POLYMER...ASE BETA' CHAIN (TRANSCRIPTASE BETA' CHAIN) (RNA POLYMERASE BETA' SUBUNIT) || http://www.ncbi.nlm.nih.gov/protein/15829016 ...

  9. Sequence Classification: 407521 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB Non-TMH Non-TMB Non-TMB Non-TMB TMB >gi|15829017|ref|NP_326377.1| DNA-DIRECTED RNA POLYMER...ASE BETA CHAIN (TRANSCRIPTASE BETA CHAIN) (RNA POLYMERASE BETA SUBUNIT) || http://www.ncbi.nlm.nih.gov/protein/15829017 ...

  10. Utility of QR codes in biological collections.

    Science.gov (United States)

    Diazgranados, Mauricio; Funk, Vicki A

    2013-01-01

    The popularity of QR codes for encoding information such as URIs has increased exponentially in step with the technological advances and availability of smartphones, digital tablets, and other electronic devices. We propose using QR codes on specimens in biological collections to facilitate linking vouchers' electronic information with their associated collections. QR codes can efficiently provide such links for connecting collections, photographs, maps, ecosystem notes, citations, and even GenBank sequences. QR codes have numerous advantages over barcodes, including their small size, superior security mechanisms, increased complexity and quantity of information, and low implementation cost. The scope of this paper is to initiate an academic discussion about using QR codes on specimens in biological collections.

  11. Utility of QR codes in biological collections

    Directory of Open Access Journals (Sweden)

    Mauricio Diazgranados

    2013-07-01

    Full Text Available The popularity of QR codes for encoding information such as URIs has increased exponentially in step with the technological advances and availability of smartphones, digital tablets, and other electronic devices. We propose using QR codes on specimens in biological collections to facilitate linking vouchers’ electronic information with their associated collections. QR codes can efficiently provide such links for connecting collections, photographs, maps, ecosystem notes, citations, and even GenBank sequences. QR codes have numerous advantages over barcodes, including their small size, superior security mechanisms, increased complexity and quantity of information, and low implementation cost. The scope of this paper is to initiate an academic discussion about using QR codes on specimens in biological collections.

  12. Targeted sequencing of large genomic regions with CATCH-Seq.

    Directory of Open Access Journals (Sweden)

    Kenneth Day

    Full Text Available Current target enrichment systems for large-scale next-generation sequencing typically require synthetic oligonucleotides used as capture reagents to isolate sequences of interest. The majority of target enrichment reagents are focused on gene coding regions or promoters en masse. Here we introduce development of a customizable targeted capture system using biotinylated RNA probe baits transcribed from sheared bacterial artificial chromosome clone templates that enables capture of large, contiguous blocks of the genome for sequencing applications. This clone adapted template capture hybridization sequencing (CATCH-Seq procedure can be used to capture both coding and non-coding regions of a gene, and resolve the boundaries of copy number variations within a genomic target site. Furthermore, libraries constructed with methylated adapters prior to solution hybridization also enable targeted bisulfite sequencing. We applied CATCH-Seq to diverse targets ranging in size from 125 kb to 3.5 Mb. Our approach provides a simple and cost effective alternative to other capture platforms because of template-based, enzymatic probe synthesis and the lack of oligonucleotide design costs. Given its similarity in procedure, CATCH-Seq can also be performed in parallel with commercial systems.

  13. MicroRNA Regulation of Telomerase Reverse Transcriptase (TERT: Micro Machines Pull Strings of Papier-Mâché Puppets

    Directory of Open Access Journals (Sweden)

    Ammad Ahmad Farooqi

    2018-04-01

    Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.

  14. Evaluation of sequence ambiguities of the HIV-1 pol gene as a method to identify recent HIV-1 infection in transmitted drug resistance surveys.

    Science.gov (United States)

    Andersson, Emmi; Shao, Wei; Bontell, Irene; Cham, Fatim; Cuong, Do Duy; Wondwossen, Amogne; Morris, Lynn; Hunt, Gillian; Sönnerborg, Anders; Bertagnolio, Silvia; Maldarelli, Frank; Jordan, Michael R

    2013-08-01

    Identification of recent HIV infection within populations is a public health priority for accurate estimation of HIV incidence rates and transmitted drug resistance at population level. Determining HIV incidence rates by prospective follow-up of HIV-uninfected individuals is challenging and serological assays have important limitations. HIV diversity within an infected host increases with duration of infection. We explore a simple bioinformatics approach to assess viral diversity by determining the percentage of ambiguous base calls in sequences derived from standard genotyping of HIV-1 protease and reverse transcriptase. Sequences from 691 recently infected (≤1 year) and chronically infected (>1 year) individuals from Sweden, Vietnam and Ethiopia were analyzed for ambiguity. A significant difference (p<0.0001) in the proportion of ambiguous bases was observed between sequences from individuals with recent and chronic infection in both HIV-1 subtype B and non-B infection, consistent with previous studies. In our analysis, a cutoff of <0.47% ambiguous base calls identified recent infection with a sensitivity and specificity of 88.8% and 74.6% respectively. 1,728 protease and reverse transcriptase sequences from 36 surveys of transmitted HIV drug resistance performed following World Health Organization guidance were analyzed for ambiguity. The 0.47% ambiguity cutoff was applied and survey sequences were classified as likely derived from recently or chronically infected individuals. 71% of patients were classified as likely to have been infected within one year of genotyping but results varied considerably amongst surveys. This bioinformatics approach may provide supporting population-level information to identify recent infection but its application is limited by infection with more than one viral variant, decreasing viral diversity in advanced disease and technical aspects of population based sequencing. Standardization of sequencing techniques and base calling

  15. Porcine UCHL1: genomic organization, chromosome localization and expression analysis

    DEFF Research Database (Denmark)

    Larsen, Knud; Madsen, Lone Bruhn; Bendixen, Christian

    2012-01-01

    to and protection from Parkinson’s disease. Here we report cloning, characterization, expression analysis and mapping of porcine UCHL1. The UCHL1 cDNA was amplified by reverse transcriptase polymerase chain reaction (RT-PCR) using oligonucleotide primers derived from in silico sequences. The porcine cDNA codes...... in developing porcine embryos. UCHL1 transcript was detected as early as 40 days of gestation. A significant decrease in UCHL1 transcript was detected in basal ganglia from day 60 to day 115 of gestation...

  16. Validation of the Serpent 2-DYNSUB code sequence using the Special Power Excursion Reactor Test III (SPERT III)

    International Nuclear Information System (INIS)

    Knebel, Miriam; Mercatali, Luigi; Sanchez, Victor; Stieglitz, Robert; Macian-Juan, Rafael

    2016-01-01

    Highlights: • Full few-group cross section tables created by Monte Carlo lattice code Serpent 2. • Serpent 2 group constant methodology verified for HFP static and transient cases. • Serpent 2-DYNSUB tool chainvalidated using SPERT III REA experiments. • Serpent 2-DYNSUB tool chain suitable to model RIAs in PWRs. - Abstract: The Special Power Excursion Reactor Test III (SPERT III) is studied using the Serpent 2-DYNSUB code sequence in order to validate it for modeling reactivity insertion accidents (RIA) in PWRs. The SPERT III E-core was a thermal research reactor constructed to analyze reactor dynamics. Its configuration resembles a commercial PWR on terms of fuel type, choice of moderator, coolant flow and system pressure. The initial conditions of the rod ejection accident experiments (REA) performed cover cold startup, hot startup, hot standby and operating power scenarios. Eight of these experiments were analyzed in detail. Firstly, multi-dimensional nodal diffusion cross section tables were created for the three-dimensional reactor simulator DYNSUB employing the Monte Carlo neutron transport code Serpent 2. In a second step, DYNSUB stationary simulations were compared to Monte Carlo reference three-dimensional full scale solutions obtained with Serpent 2 (cold startup conditions) and Serpent 2/SUBCHANFLOW (operating power conditions) with a good agreement being observed. The latter tool is an internal coupling of Serpent 2 and the sub-channel thermal-hydraulics code SUBCHANFLOW. Finally, DYNSUB was utilized to study the eight selected transient experiments. Results were found to match measurements well. As the selected experiments cover much of the possible transient (delayed super-critical, prompt super-critical and super-prompt critical excursion) and initial conditions (cold and hot as well as zero, little and full power reactor states) one expects in commercial PWRs, the obtained results give confidence that the Serpent 2-DYNSUB tool chain is

  17. The effect of temperature on the in vitro transcriptase reaction of bluetongue virus, epizootic haemorrhagic disease virus and African horsesickness virus

    International Nuclear Information System (INIS)

    Van Dijk, A.A.; Huismans, H.

    1982-01-01

    Virions of bluetongue virus (BTV), epizootic haemorrhagic disease virus (EHDV) and African horsesickness virus (AHSV) can be converted to core particles by treatment with chymotrypsin and magnesium. The conversion is characterized by the removal of the 2 outer capsid polypeptides of the virion. The loss of these 2 proteins results in an increase in density from 1,36 g/ml to 1,40 g/ml on CsCl gradients. The BTV, EHDV and AHSV core particles have an associated double-stranded RNA dependent RNA transcriptase that appears to transcribe mRNA optimally at 28 degrees Celsius. It was found, at least in the case of BTV, that this low temperature preference is not an intrinsic characteristic of the transcriptase, but is due to a temperature-dependent inhibition of transcription at high core concentrations

  18. Sequence Classification: 387341 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB Non-TMH Non-TMB Non-TMB Non-TMB Non-TMB >gi|31791852|ref|NP_854345.1| DNA-DIRECTED RNA POLYMER...ASE (BETA' CHAIN) RPOC (TRANSCRIPTASE BETA' CHAIN) (RNA POLYMERASE BETA' SUBUNIT). || http://www.ncbi.nlm.nih.gov/protein/31791852 ...

  19. OFFSCALE: A PC input processor for the SCALE code system. The CSASIN processor for the criticality sequences

    International Nuclear Information System (INIS)

    Bowman, S.M.

    1994-11-01

    OFFSCALE is a suite of personal computer input processor programs developed at Oak Ridge National Laboratory to provide an easy-to-use interface for modules in the SCALE-4 code system. CSASIN (formerly known as OFFSCALE) is a program in the OFFSCALE suite that serves as a user-friendly interface for the Criticality Safety Analysis Sequences (CSAS) available in SCALE-4. It is designed to assist a SCALE-4 user in preparing an input file for execution of criticality safety problems. Output from CSASIN generates an input file that may be used to execute the CSAS control module in SCALE-4. CSASIN features a pulldown menu system that accesses sophisticated data entry screens. The program allows the user to quickly set up a CSAS input file and perform data checking. This capability increases productivity and decreases the chance of user error

  20. Full-length sequencing and identification of novel polymorphisms in ...

    Indian Academy of Sciences (India)

    The aim of this work was to sequence the entirecoding region of ACACA gene in Valle del Belice sheep breed to identify polymorphic sites. A total of 51 coding exons of ACACA gene were sequenced in 32 individuals of Valle del Belice sheep breed. Sequencing analysis and alignment of obtained sequences showed the ...

  1. Building the sequence map of the human pan-genome

    DEFF Research Database (Denmark)

    Li, Ruiqiang; Li, Yingrui; Zheng, Hancheng

    2010-01-01

    analysis of predicted genes indicated that the novel sequences contain potentially functional coding regions. We estimate that a complete human pan-genome would contain approximately 19-40 Mb of novel sequence not present in the extant reference genome. The extensive amount of novel sequence contributing...

  2. Sequence embedding for fast construction of guide trees for multiple sequence alignment

    LENUS (Irish Health Repository)

    Blackshields, Gordon

    2010-05-14

    Abstract Background The most widely used multiple sequence alignment methods require sequences to be clustered as an initial step. Most sequence clustering methods require a full distance matrix to be computed between all pairs of sequences. This requires memory and time proportional to N 2 for N sequences. When N grows larger than 10,000 or so, this becomes increasingly prohibitive and can form a significant barrier to carrying out very large multiple alignments. Results In this paper, we have tested variations on a class of embedding methods that have been designed for clustering large numbers of complex objects where the individual distance calculations are expensive. These methods involve embedding the sequences in a space where the similarities within a set of sequences can be closely approximated without having to compute all pair-wise distances. Conclusions We show how this approach greatly reduces computation time and memory requirements for clustering large numbers of sequences and demonstrate the quality of the clusterings by benchmarking them as guide trees for multiple alignment. Source code is available for download from http:\\/\\/www.clustal.org\\/mbed.tgz.

  3. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  4. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.

    Science.gov (United States)

    2004-12-09

    We present here a draft genome sequence of the red jungle fowl, Gallus gallus. Because the chicken is a modern descendant of the dinosaurs and the first non-mammalian amniote to have its genome sequenced, the draft sequence of its genome--composed of approximately one billion base pairs of sequence and an estimated 20,000-23,000 genes--provides a new perspective on vertebrate genome evolution, while also improving the annotation of mammalian genomes. For example, the evolutionary distance between chicken and human provides high specificity in detecting functional elements, both non-coding and coding. Notably, many conserved non-coding sequences are far from genes and cannot be assigned to defined functional classes. In coding regions the evolutionary dynamics of protein domains and orthologous groups illustrate processes that distinguish the lineages leading to birds and mammals. The distinctive properties of avian microchromosomes, together with the inferred patterns of conserved synteny, provide additional insights into vertebrate chromosome architecture.

  5. Fragment Based Strategies for Discovery of Novel HIV-1 Reverse Transcriptase and Integrase Inhibitors.

    Science.gov (United States)

    Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda

    2016-01-01

    Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.

  6. Structure-based methods to predict mutational resistance to diarylpyrimidine non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M

    2018-01-01

    Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.

  7. Multiple tag labeling method for DNA sequencing

    Science.gov (United States)

    Mathies, R.A.; Huang, X.C.; Quesada, M.A.

    1995-07-25

    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  8. Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

    Science.gov (United States)

    Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

    2016-03-01

    Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

  9. A bar coding system for environmental projects

    International Nuclear Information System (INIS)

    Barber, R.B.; Hunt, B.J.; Burgess, G.M.

    1988-01-01

    This paper presents BeCode systems, a bar coding system which provides both nuclear and commercial clients with a data capture and custody management program that is accurate, timely, and beneficial to all levels of project operations. Using bar code identifiers is an essentially paperless and error-free method which provides more efficient delivery of data through its menu card-driven structure, which speeds collection of essential data for uploading to a compatible device. The effects of this sequence include real-time information for operator analysis, management review, audits, planning, scheduling, and cost control

  10. Biophysical Insights into the Inhibitory Mechanism of Non-Nucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer

    2013-11-01

    Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.

  11. A new method for species identification via protein-coding and non-coding DNA barcodes by combining machine learning with bioinformatic methods.

    Science.gov (United States)

    Zhang, Ai-bing; Feng, Jie; Ward, Robert D; Wan, Ping; Gao, Qiang; Wu, Jun; Zhao, Wei-zhong

    2012-01-01

    Species identification via DNA barcodes is contributing greatly to current bioinventory efforts. The initial, and widely accepted, proposal was to use the protein-coding cytochrome c oxidase subunit I (COI) region as the standard barcode for animals, but recently non-coding internal transcribed spacer (ITS) genes have been proposed as candidate barcodes for both animals and plants. However, achieving a robust alignment for non-coding regions can be problematic. Here we propose two new methods (DV-RBF and FJ-RBF) to address this issue for species assignment by both coding and non-coding sequences that take advantage of the power of machine learning and bioinformatics. We demonstrate the value of the new methods with four empirical datasets, two representing typical protein-coding COI barcode datasets (neotropical bats and marine fish) and two representing non-coding ITS barcodes (rust fungi and brown algae). Using two random sub-sampling approaches, we demonstrate that the new methods significantly outperformed existing Neighbor-joining (NJ) and Maximum likelihood (ML) methods for both coding and non-coding barcodes when there was complete species coverage in the reference dataset. The new methods also out-performed NJ and ML methods for non-coding sequences in circumstances of potentially incomplete species coverage, although then the NJ and ML methods performed slightly better than the new methods for protein-coding barcodes. A 100% success rate of species identification was achieved with the two new methods for 4,122 bat queries and 5,134 fish queries using COI barcodes, with 95% confidence intervals (CI) of 99.75-100%. The new methods also obtained a 96.29% success rate (95%CI: 91.62-98.40%) for 484 rust fungi queries and a 98.50% success rate (95%CI: 96.60-99.37%) for 1094 brown algae queries, both using ITS barcodes.

  12. A new method for species identification via protein-coding and non-coding DNA barcodes by combining machine learning with bioinformatic methods.

    Directory of Open Access Journals (Sweden)

    Ai-bing Zhang

    Full Text Available Species identification via DNA barcodes is contributing greatly to current bioinventory efforts. The initial, and widely accepted, proposal was to use the protein-coding cytochrome c oxidase subunit I (COI region as the standard barcode for animals, but recently non-coding internal transcribed spacer (ITS genes have been proposed as candidate barcodes for both animals and plants. However, achieving a robust alignment for non-coding regions can be problematic. Here we propose two new methods (DV-RBF and FJ-RBF to address this issue for species assignment by both coding and non-coding sequences that take advantage of the power of machine learning and bioinformatics. We demonstrate the value of the new methods with four empirical datasets, two representing typical protein-coding COI barcode datasets (neotropical bats and marine fish and two representing non-coding ITS barcodes (rust fungi and brown algae. Using two random sub-sampling approaches, we demonstrate that the new methods significantly outperformed existing Neighbor-joining (NJ and Maximum likelihood (ML methods for both coding and non-coding barcodes when there was complete species coverage in the reference dataset. The new methods also out-performed NJ and ML methods for non-coding sequences in circumstances of potentially incomplete species coverage, although then the NJ and ML methods performed slightly better than the new methods for protein-coding barcodes. A 100% success rate of species identification was achieved with the two new methods for 4,122 bat queries and 5,134 fish queries using COI barcodes, with 95% confidence intervals (CI of 99.75-100%. The new methods also obtained a 96.29% success rate (95%CI: 91.62-98.40% for 484 rust fungi queries and a 98.50% success rate (95%CI: 96.60-99.37% for 1094 brown algae queries, both using ITS barcodes.

  13. The presence of five nifH-like sequences in Clostridium pasteurianum: sequence divergence and transcription properties.

    OpenAIRE

    Wang, S Z; Chen, J S; Johnson, J L

    1988-01-01

    The nifH gene encodes the iron protein (component II) of the nitrogenase complex. We have previously shown the presence in Clostridium pasteurianum of two nifH-like sequences in addition to the nifH1 gene which codes for a protein identical to the isolated iron protein. In the present study, we report that there are at least five nifH-like sequences in C. pasteurianum. DNA sequencing data indicate that the six nifH (nifH1) and nifH-like (nifH2, nifH3, nifH4, nifH5 and nifH6) sequences are not...

  14. Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †

    Science.gov (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.

    2009-01-01

    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271

  15. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3' UTRs and coding sequences.

    Science.gov (United States)

    Šulc, Miroslav; Marín, Ray M; Robins, Harlan S; Vaníček, Jiří

    2015-07-01

    The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  17. Capsid coding sequences of foot-and-mouth disease viruses are determinants of pathogenicity in pigs.

    Science.gov (United States)

    Lohse, Louise; Jackson, Terry; Bøtner, Anette; Belsham, Graham J

    2012-05-24

    The surface exposed capsid proteins, VP1, VP2 and VP3, of foot-and-mouth disease virus (FMDV) determine its antigenicity and the ability of the virus to interact with host-cell receptors. Hence, modification of these structural proteins may alter the properties of the virus.In the present study we compared the pathogenicity of different FMDVs in young pigs. In total 32 pigs, 7-weeks-old, were exposed to virus, either by direct inoculation or through contact with inoculated pigs, using cell culture adapted (O1K B64), chimeric (O1K/A-TUR and O1K/O-UKG) or field strain (O-UKG/34/2001) viruses. The O1K B64 virus and the two chimeric viruses are identical to each other except for the capsid coding region.Animals exposed to O1K B64 did not exhibit signs of disease, while pigs exposed to each of the other viruses showed typical clinical signs of foot-and-mouth disease (FMD). All pigs infected with the O1K/O-UKG chimera or the field strain (O-UKG/34/2001) developed fulminant disease. Furthermore, 3 of 4 in-contact pigs exposed to the O1K/O-UKG virus died in the acute phase of infection, likely from myocardial infection. However, in the group exposed to the O1K/A-TUR chimeric virus, only 1 pig showed symptoms of disease within the time frame of the experiment (10 days). All pigs that developed clinical disease showed a high level of viral RNA in serum and infected pigs that survived the acute phase of infection developed a serotype specific antibody response. It is concluded that the capsid coding sequences are determinants of FMDV pathogenicity in pigs.

  18. A bacterial genetic screen identifies functional coding sequences of the insect mariner transposable element Famar1 amplified from the genome of the earwig, Forficula auricularia.

    Science.gov (United States)

    Barry, Elizabeth G; Witherspoon, David J; Lampe, David J

    2004-02-01

    Transposons of the mariner family are widespread in animal genomes and have apparently infected them by horizontal transfer. Most species carry only old defective copies of particular mariner transposons that have diverged greatly from their active horizontally transferred ancestor, while a few contain young, very similar, and active copies. We report here the use of a whole-genome screen in bacteria to isolate somewhat diverged Famar1 copies from the European earwig, Forficula auricularia, that encode functional transposases. Functional and nonfunctional coding sequences of Famar1 and nonfunctional copies of Ammar1 from the European honey bee, Apis mellifera, were sequenced to examine their molecular evolution. No selection for sequence conservation was detected in any clade of a tree derived from these sequences, not even on branches leading to functional copies. This agrees with the current model for mariner transposon evolution that expects neutral evolution within particular hosts, with selection for function occurring only upon horizontal transfer to a new host. Our results further suggest that mariners are not finely tuned genetic entities and that a greater amount of sequence diversification than had previously been appreciated can occur in functional copies in a single host lineage. Finally, this method of isolating active copies can be used to isolate other novel active transposons without resorting to reconstruction of ancestral sequences.

  19. Reverse Transcriptase drug resistance mutations in HIV-1 Subtype C infected patients on ART in Karonga District, Malawi

    LENUS (Irish Health Repository)

    Bansode, Vijay B

    2011-10-13

    Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge

  20. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy: the D: A: D study

    NARCIS (Netherlands)

    Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,

    2015-01-01

    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  1. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy : the D: A: D study

    NARCIS (Netherlands)

    Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.

    2015-01-01

    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  2. Structural studies of series HIV-1 nonnucleoside reverse transcriptase inhibitors 1-(2,6-difluorobenzyl)-2-(2,6-difluorophenyl)-benzimidazoles with different 4-substituents

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2010-03-01

    Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.

  3. Sequence data and association statistics from 12,940 type 2 diabetes cases and controls

    DEFF Research Database (Denmark)

    Jason, Flannick; Fuchsberger, Christian; Mahajan, Anubha

    2017-01-01

    variants were identified, including 99% of low-frequency (minor allele frequency [MAF] 0.1-5%) non-coding variants in the whole-genome sequenced individuals and 99.7% of low-frequency coding variants in the whole-exome sequenced individuals. Each variant was tested for association with T2D in the sequenced...... individuals, and, to increase power, most were tested in larger numbers of individuals (>80% of low-frequency coding variants in ~82 K Europeans via the exome chip, and ~90% of low-frequency non-coding variants in ~44 K Europeans via genotype imputation). The variants, genotypes, and association statistics...... from these analyses provide the largest reference to date of human genetic information relevant to T2D, for use in activities such as T2D-focused genotype imputation, functional characterization of variants or genes, and other novel analyses to detect associations between sequence variation and T2D....

  4. What Information is Stored in DNA: Does it Contain Digital Error Correcting Codes?

    Science.gov (United States)

    Liebovitch, Larry

    1998-03-01

    The longest term correlations in living systems are the information stored in DNA which reflects the evolutionary history of an organism. The 4 bases (A,T,G,C) encode sequences of amino acids as well as locations of binding sites for proteins that regulate DNA. The fidelity of this important information is maintained by ANALOG error check mechanisms. When a single strand of DNA is replicated the complementary base is inserted in the new strand. Sometimes the wrong base is inserted that sticks out disrupting the phosphate backbone. The new base is not yet methylated, so repair enzymes, that slide along the DNA, can tear out the wrong base and replace it with the right one. The bases in DNA form a sequence of 4 different symbols and so the information is encoded in a DIGITAL form. All the digital codes in our society (ISBN book numbers, UPC product codes, bank account numbers, airline ticket numbers) use error checking code, where some digits are functions of other digits to maintain the fidelity of transmitted informaiton. Does DNA also utitlize a DIGITAL error chekcing code to maintain the fidelity of its information and increase the accuracy of replication? That is, are some bases in DNA functions of other bases upstream or downstream? This raises the interesting mathematical problem: How does one determine whether some symbols in a sequence of symbols are a function of other symbols. It also bears on the issue of determining algorithmic complexity: What is the function that generates the shortest algorithm for reproducing the symbol sequence. The error checking codes most used in our technology are linear block codes. We developed an efficient method to test for the presence of such codes in DNA. We coded the 4 bases as (0,1,2,3) and used Gaussian elimination, modified for modulus 4, to test if some bases are linear combinations of other bases. We used this method to analyze the base sequence in the genes from the lac operon and cytochrome C. We did not find

  5. Optimal interference code based on machine learning

    Science.gov (United States)

    Qian, Ye; Chen, Qian; Hu, Xiaobo; Cao, Ercong; Qian, Weixian; Gu, Guohua

    2016-10-01

    In this paper, we analyze the characteristics of pseudo-random code, by the case of m sequence. Depending on the description of coding theory, we introduce the jamming methods. We simulate the interference effect or probability model by the means of MATLAB to consolidate. In accordance with the length of decoding time the adversary spends, we find out the optimal formula and optimal coefficients based on machine learning, then we get the new optimal interference code. First, when it comes to the phase of recognition, this study judges the effect of interference by the way of simulating the length of time over the decoding period of laser seeker. Then, we use laser active deception jamming simulate interference process in the tracking phase in the next block. In this study we choose the method of laser active deception jamming. In order to improve the performance of the interference, this paper simulates the model by MATLAB software. We find out the least number of pulse intervals which must be received, then we can make the conclusion that the precise interval number of the laser pointer for m sequence encoding. In order to find the shortest space, we make the choice of the greatest common divisor method. Then, combining with the coding regularity that has been found before, we restore pulse interval of pseudo-random code, which has been already received. Finally, we can control the time period of laser interference, get the optimal interference code, and also increase the probability of interference as well.

  6. 2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase

    International Nuclear Information System (INIS)

    Starnes, M.C.

    1988-01-01

    2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells

  7. Sequence History Update Tool

    Science.gov (United States)

    Khanampompan, Teerapat; Gladden, Roy; Fisher, Forest; DelGuercio, Chris

    2008-01-01

    The Sequence History Update Tool performs Web-based sequence statistics archiving for Mars Reconnaissance Orbiter (MRO). Using a single UNIX command, the software takes advantage of sequencing conventions to automatically extract the needed statistics from multiple files. This information is then used to populate a PHP database, which is then seamlessly formatted into a dynamic Web page. This tool replaces a previous tedious and error-prone process of manually editing HTML code to construct a Web-based table. Because the tool manages all of the statistics gathering and file delivery to and from multiple data sources spread across multiple servers, there is also a considerable time and effort savings. With the use of The Sequence History Update Tool what previously took minutes is now done in less than 30 seconds, and now provides a more accurate archival record of the sequence commanding for MRO.

  8. Uniform Circular Antenna Array Applications in Coded DS-CDMA Mobile Communication Systems

    National Research Council Canada - National Science Library

    Seow, Tian

    2003-01-01

    ...) has greatly increased. This thesis examines the use of an equally spaced circular adaptive antenna array at the mobile station for a typical coded direct sequence code division multiple access (DS-CDMA...

  9. Modified Three-Dimensional Multicarrier Optical Prime Codes

    Directory of Open Access Journals (Sweden)

    Rajesh Yadav

    2016-01-01

    Full Text Available We propose a mathematical model for novel three-dimensional multicarrier optical codes in terms of wavelength/time/space based on the prime sequence algorithm. The proposed model has been extensively simulated on MATLAB for prime numbers (P to analyze the performance of code in terms of autocorrelation and cross-correlation. The simulated outcome resembles the mathematical model and gives better results over other methods available in the literature as far as autocorrelation and cross-correlation are concerned. The proposed 3D optical codes are more efficient in terms of cardinality, improved security, and providing quality of services.

  10. The Complete Sequence of a Human Parainfluenzavirus 4 Genome

    Science.gov (United States)

    Yea, Carmen; Cheung, Rose; Collins, Carol; Adachi, Dena; Nishikawa, John; Tellier, Raymond

    2009-01-01

    Although the human parainfluenza virus 4 (HPIV4) has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada). The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97%) with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized. PMID:21994536

  11. The Complete Sequence of a Human Parainfluenzavirus 4 Genome

    Directory of Open Access Journals (Sweden)

    Carmen Yea

    2009-06-01

    Full Text Available Although the human parainfluenza virus 4 (HPIV4 has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada. The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97% with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized.

  12. Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

    NARCIS (Netherlands)

    Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.

    2010-01-01

    Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

  13. Summary description of the scale modular code system

    International Nuclear Information System (INIS)

    Parks, C.V.

    1987-12-01

    SCALE - a modular code system for Standardized Computer Analyses for Licensing Evaluation - has been developed at Oak Ridge National Laboratory at the request of the US Nuclear Regulatory Commission staff. The SCALE system utilizes well-established computer codes and methods within standard analytic sequences that allow simplified free-form input, automate the data processing and coupling between codes, and provide accurate and reliable results. System development has been directed at criticality safety, shielding, and heat transfer analysis of spent fuel transport and/or storage casks. However, only a few of the sequences (and none of the individual functional modules) are restricted to cask applications. This report will provide a background on the history of the SCALE development and review the components and their function within the system. The available data libraries are also discussed, together with the automated features that standardize the data processing and systems analysis. 83 refs., 32 figs., 11 tabs

  14. A BRCA2 mutation incorrectly mapped in the original BRCA2 reference sequence, is a common West Danish founder mutation disrupting mRNA splicing

    DEFF Research Database (Denmark)

    Thomassen, Mads; Pedersen, Inge Søkilde; Vogel, Ida

    2011-01-01

    Inherited mutations in the tumor suppressor genes BRCA1 and BRCA2 predispose carriers to breast and ovarian cancer. The authors have identified a mutation in BRCA2, 7845+1G>A (c.7617+1G>A), not previously regarded as deleterious because of incorrect mapping of the splice junction in the originally...... published genomic reference sequence. This reference sequence is generally used in many laboratories and it maps the mutation 16 base pairs inside intron 15. However, according to the recent reference sequences the mutation is located in the consensus donor splice sequence. By reverse transcriptase analysis......, loss of exon 15 in the final transcript interrupting the open reading frame was demonstrated. Furthermore, the mutation segregates with a cancer phenotype in 18 Danish families. By genetic analysis of more than 3,500 Danish breast/ovarian cancer risk families, the mutation was identified as the most...

  15. ASTEC V2. Overview of code development and application at GRS

    International Nuclear Information System (INIS)

    Reinke, N.; Nowack, H.; Sonnenkalb, M.

    2011-01-01

    The integral code ASTEC (Accident Source Term Evaluation Code) commonly developed since 1996 by the French IRSN and the German GRS is a fast running programme, which allows the calculation of entire sequences of severe accidents (SA) in light water reactors from the initiating event up to the release of fission products into the environment, thereby covering all important in-vessel and containment phenomena. Thus, the main ASTEC application fields are intended to be accident sequence studies, uncertainty and sensitivity studies, probabilistic safety analysis level 2 as well as support to experiments. The modular structure of ASTEC allows running each module independently and separately, e.g. for separate effects analyses as well as a combination of multiple modules for coupled effects testing and integral analyses. Subject of this paper is an overview of the new V2 series of the ASTEC code system and presentation of exemplary results for the application to severe accidents sequences at PWRs. (orig.)

  16. Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

    Science.gov (United States)

    de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

    2000-01-01

    Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

  17. Design of Long Period Pseudo-Random Sequences from the Addition of m -Sequences over 𝔽 p

    Directory of Open Access Journals (Sweden)

    Ren Jian

    2004-01-01

    Full Text Available Pseudo-random sequence with good correlation property and large linear span is widely used in code division multiple access (CDMA communication systems and cryptology for reliable and secure information transmission. In this paper, sequences with long period, large complexity, balance statistics, and low cross-correlation property are constructed from the addition of m -sequences with pairwise-prime linear spans (AMPLS. Using m -sequences as building blocks, the proposed method proved to be an efficient and flexible approach to construct long period pseudo-random sequences with desirable properties from short period sequences. Applying the proposed method to 𝔽 2 , a signal set ( ( 2 n − 1 ( 2 m − 1 , ( 2 n + 1 ( 2 m + 1 , ( 2 ( n + 1 / 2 + 1 ( 2 ( m + 1 / 2 + 1 is constructed.

  18. Long non-coding RNAs: Mechanism of action and functional utility

    OpenAIRE

    Bhat, Shakil Ahmad; Ahmad, Syed Mudasir; Mumtaz, Peerzada Tajamul; Malik, Abrar Ahad; Dar, Mashooq Ahmad; Urwat, Uneeb; Shah, Riaz Ahmad; Ganai, Nazir Ahmad

    2016-01-01

    Recent RNA sequencing studies have revealed that most of the human genome is transcribed, but very little of the total transcriptomes has the ability to encode proteins. Long non-coding RNAs (lncRNAs) are non-coding transcripts longer than 200 nucleotides. Members of the non-coding genome include microRNA (miRNA), small regulatory RNAs and other short RNAs. Most of long non-coding RNA (lncRNAs) are poorly annotated. Recent recognition about lncRNAs highlights their effects in many biological ...

  19. Retrotransposons and non-protein coding RNAs

    DEFF Research Database (Denmark)

    Mourier, Tobias; Willerslev, Eske

    2009-01-01

    does not merely represent spurious transcription. We review examples of functional RNAs transcribed from retrotransposons, and address the collection of non-protein coding RNAs derived from transposable element sequences, including numerous human microRNAs and the neuronal BC RNAs. Finally, we review...

  20. Kangaroo – A pattern-matching program for biological sequences

    Directory of Open Access Journals (Sweden)

    Betel Doron

    2002-07-01

    Full Text Available Abstract Background Biologists are often interested in performing a simple database search to identify proteins or genes that contain a well-defined sequence pattern. Many databases do not provide straightforward or readily available query tools to perform simple searches, such as identifying transcription binding sites, protein motifs, or repetitive DNA sequences. However, in many cases simple pattern-matching searches can reveal a wealth of information. We present in this paper a regular expression pattern-matching tool that was used to identify short repetitive DNA sequences in human coding regions for the purpose of identifying potential mutation sites in mismatch repair deficient cells. Results Kangaroo is a web-based regular expression pattern-matching program that can search for patterns in DNA, protein, or coding region sequences in ten different organisms. The program is implemented to facilitate a wide range of queries with no restriction on the length or complexity of the query expression. The program is accessible on the web at http://bioinfo.mshri.on.ca/kangaroo/ and the source code is freely distributed at http://sourceforge.net/projects/slritools/. Conclusion A low-level simple pattern-matching application can prove to be a useful tool in many research settings. For example, Kangaroo was used to identify potential genetic targets in a human colorectal cancer variant that is characterized by a high frequency of mutations in coding regions containing mononucleotide repeats.

  1. Sequencing the GRHL3 Coding Region Reveals Rare Truncating Mutations and a Common Susceptibility Variant for Nonsyndromic Cleft Palate

    Science.gov (United States)

    Mangold, Elisabeth; Böhmer, Anne C.; Ishorst, Nina; Hoebel, Ann-Kathrin; Gültepe, Pinar; Schuenke, Hannah; Klamt, Johanna; Hofmann, Andrea; Gölz, Lina; Raff, Ruth; Tessmann, Peter; Nowak, Stefanie; Reutter, Heiko; Hemprich, Alexander; Kreusch, Thomas; Kramer, Franz-Josef; Braumann, Bert; Reich, Rudolf; Schmidt, Gül; Jäger, Andreas; Reiter, Rudolf; Brosch, Sibylle; Stavusis, Janis; Ishida, Miho; Seselgyte, Rimante; Moore, Gudrun E.; Nöthen, Markus M.; Borck, Guntram; Aldhorae, Khalid A.; Lace, Baiba; Stanier, Philip; Knapp, Michael; Ludwig, Kerstin U.

    2016-01-01

    Nonsyndromic cleft lip with/without cleft palate (nsCL/P) and nonsyndromic cleft palate only (nsCPO) are the most frequent subphenotypes of orofacial clefts. A common syndromic form of orofacial clefting is Van der Woude syndrome (VWS) where individuals have CL/P or CPO, often but not always associated with lower lip pits. Recently, ∼5% of VWS-affected individuals were identified with mutations in the grainy head-like 3 gene (GRHL3). To investigate GRHL3 in nonsyndromic clefting, we sequenced its coding region in 576 Europeans with nsCL/P and 96 with nsCPO. Most strikingly, nsCPO-affected individuals had a higher minor allele frequency for rs41268753 (0.099) than control subjects (0.049; p = 1.24 × 10−2). This association was replicated in nsCPO/control cohorts from Latvia, Yemen, and the UK (pcombined = 2.63 × 10−5; ORallelic = 2.46 [95% CI 1.6–3.7]) and reached genome-wide significance in combination with imputed data from a GWAS in nsCPO triads (p = 2.73 × 10−9). Notably, rs41268753 is not associated with nsCL/P (p = 0.45). rs41268753 encodes the highly conserved p.Thr454Met (c.1361C>T) (GERP = 5.3), which prediction programs denote as deleterious, has a CADD score of 29.6, and increases protein binding capacity in silico. Sequencing also revealed four novel truncating GRHL3 mutations including two that were de novo in four families, where all nine individuals harboring mutations had nsCPO. This is important for genetic counseling: given that VWS is rare compared to nsCPO, our data suggest that dominant GRHL3 mutations are more likely to cause nonsyndromic than syndromic CPO. Thus, with rare dominant mutations and a common risk variant in the coding region, we have identified an important contribution for GRHL3 in nsCPO. PMID:27018475

  2. Abstract feature codes: The building blocks of the implicit learning system.

    Science.gov (United States)

    Eberhardt, Katharina; Esser, Sarah; Haider, Hilde

    2017-07-01

    According to the Theory of Event Coding (TEC; Hommel, Müsseler, Aschersleben, & Prinz, 2001), action and perception are represented in a shared format in the cognitive system by means of feature codes. In implicit sequence learning research, it is still common to make a conceptual difference between independent motor and perceptual sequences. This supposedly independent learning takes place in encapsulated modules (Keele, Ivry, Mayr, Hazeltine, & Heuer 2003) that process information along single dimensions. These dimensions have remained underspecified so far. It is especially not clear whether stimulus and response characteristics are processed in separate modules. Here, we suggest that feature dimensions as they are described in the TEC should be viewed as the basic content of modules of implicit learning. This means that the modules process all stimulus and response information related to certain feature dimensions of the perceptual environment. In 3 experiments, we investigated by means of a serial reaction time task the nature of the basic units of implicit learning. As a test case, we used stimulus location sequence learning. The results show that a stimulus location sequence and a response location sequence cannot be learned without interference (Experiment 2) unless one of the sequences can be coded via an alternative, nonspatial dimension (Experiment 3). These results support the notion that spatial location is one module of the implicit learning system and, consequently, that there are no separate processing units for stimulus versus response locations. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  3. A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

    NARCIS (Netherlands)

    Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.

    2011-01-01

    The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who

  4. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  5. The Purine Bias of Coding Sequences is Determined by Physicochemical Constraints on Proteins.

    Science.gov (United States)

    Ponce de Leon, Miguel; de Miranda, Antonio Basilio; Alvarez-Valin, Fernando; Carels, Nicolas

    2014-01-01

    For this report, we analyzed protein secondary structures in relation to the statistics of three nucleotide codon positions. The purpose of this investigation was to find which properties of the ribosome, tRNA or protein level, could explain the purine bias (Rrr) as it is observed in coding DNA. We found that the Rrr pattern is the consequence of a regularity (the codon structure) resulting from physicochemical constraints on proteins and thermodynamic constraints on ribosomal machinery. The physicochemical constraints on proteins mainly come from the hydropathy and molecular weight (MW) of secondary structures as well as the energy cost of amino acid synthesis. These constraints appear through a network of statistical correlations, such as (i) the cost of amino acid synthesis, which is in favor of a higher level of guanine in the first codon position, (ii) the constructive contribution of hydropathy alternation in proteins, (iii) the spatial organization of secondary structure in proteins according to solvent accessibility, (iv) the spatial organization of secondary structure according to amino acid hydropathy, (v) the statistical correlation of MW with protein secondary structures and their overall hydropathy, (vi) the statistical correlation of thymine in the second codon position with hydropathy and the energy cost of amino acid synthesis, and (vii) the statistical correlation of adenine in the second codon position with amino acid complexity and the MW of secondary protein structures. Amino acid physicochemical properties and functional constraints on proteins constitute a code that is translated into a purine bias within the coding DNA via tRNAs. In that sense, the Rrr pattern within coding DNA is the effect of information transfer on nucleotide composition from protein to DNA by selection according to the codon positions. Thus, coding DNA structure and ribosomal machinery co-evolved to minimize the energy cost of protein coding given the functional

  6. Evidence for a novel coding sequence overlapping the 5'-terminal ~90 codons of the Gill-associated and Yellow head okavirus envelope glycoprotein gene

    Directory of Open Access Journals (Sweden)

    Atkins John F

    2009-12-01

    Full Text Available Abstract The genus Okavirus (order Nidovirales includes a number of viruses that infect crustaceans, causing major losses in the shrimp industry. These viruses have a linear positive-sense ssRNA genome of ~26-27 kb, encoding a large replicase polyprotein that is expressed from the genomic RNA, and several additional proteins that are expressed from a nested set of 3'-coterminal subgenomic RNAs. In this brief report, we describe the bioinformatic discovery of a new, apparently coding, ORF that overlaps the 5' end of the envelope glycoprotein encoding sequence, ORF3, in the +2 reading frame. The new ORF has a strong coding signature and, in fact, is more conserved at the amino acid level than the overlapping region of ORF3. We propose that translation of the new ORF initiates at a conserved AUG codon separated by just 2 nt from the ORF3 AUG initiation codon, resulting in a novel 86 amino acid protein.

  7. Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

    NARCIS (Netherlands)

    Oude Essink, B. B.; Das, A. T.; Berkhout, B.

    1995-01-01

    Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

  8. Exome sequencing and genetic testing for MODY.

    Directory of Open Access Journals (Sweden)

    Stefan Johansson

    Full Text Available Genetic testing for monogenic diabetes is important for patient care. Given the extensive genetic and clinical heterogeneity of diabetes, exome sequencing might provide additional diagnostic potential when standard Sanger sequencing-based diagnostics is inconclusive.The aim of the study was to examine the performance of exome sequencing for a molecular diagnosis of MODY in patients who have undergone conventional diagnostic sequencing of candidate genes with negative results.We performed exome enrichment followed by high-throughput sequencing in nine patients with suspected MODY. They were Sanger sequencing-negative for mutations in the HNF1A, HNF4A, GCK, HNF1B and INS genes. We excluded common, non-coding and synonymous gene variants, and performed in-depth analysis on filtered sequence variants in a pre-defined set of 111 genes implicated in glucose metabolism.On average, we obtained 45 X median coverage of the entire targeted exome and found 199 rare coding variants per individual. We identified 0-4 rare non-synonymous and nonsense variants per individual in our a priori list of 111 candidate genes. Three of the variants were considered pathogenic (in ABCC8, HNF4A and PPARG, respectively, thus exome sequencing led to a genetic diagnosis in at least three of the nine patients. Approximately 91% of known heterozygous SNPs in the target exomes were detected, but we also found low coverage in some key diabetes genes using our current exome sequencing approach. Novel variants in the genes ARAP1, GLIS3, MADD, NOTCH2 and WFS1 need further investigation to reveal their possible role in diabetes.Our results demonstrate that exome sequencing can improve molecular diagnostics of MODY when used as a complement to Sanger sequencing. However, improvements will be needed, especially concerning coverage, before the full potential of exome sequencing can be realized.

  9. Episodic sequence memory is supported by a theta-gamma phase code.

    Science.gov (United States)

    Heusser, Andrew C; Poeppel, David; Ezzyat, Youssef; Davachi, Lila

    2016-10-01

    The meaning we derive from our experiences is not a simple static extraction of the elements but is largely based on the order in which those elements occur. Models propose that sequence encoding is supported by interactions between high- and low-frequency oscillations, such that elements within an experience are represented by neural cell assemblies firing at higher frequencies (gamma) and sequential order is encoded by the specific timing of firing with respect to a lower frequency oscillation (theta). During episodic sequence memory formation in humans, we provide evidence that items in different sequence positions exhibit greater gamma power along distinct phases of a theta oscillation. Furthermore, this segregation is related to successful temporal order memory. Our results provide compelling evidence that memory for order, a core component of an episodic memory, capitalizes on the ubiquitous physiological mechanism of theta-gamma phase-amplitude coupling.

  10. Simulation with the MELCOR code of two severe accident sequences, Station Blackout and Small Break LOCA, for the Atucha I nuclear power plant

    International Nuclear Information System (INIS)

    Valle Cepero, Reinaldo

    2004-01-01

    The results of the PSA-I applied to the Atucha I nuclear power plant (CNA I) determine the accidental sequences with the most influence related to the probability of the core reactor damage. Among those sequences are include, the Station Blackout and lost of primary coolant, combine with the failure of the emergency injection systems by pipe breaks of diameters between DN100 - DN25 or equivalent areas, Small LOCA. This paper has the objective to model and analyze the behavior of the primary circuit and the pressure vessel during the evolution of those two accidental sequences. It presented a detailed analysis of the main phenomena that occur from the initial moment of the accident to the failure moment of the pressure vessel and the melt material fall to the reactor cavity. Two sequences were taken into account, considering the main phenomena (core uncover, heating, fuel element oxidation, hydrogen generation, degradation and relocation of the melt material, failure of the support structures, etc.) and the time of occurrence, of those events will be different, if it is considered that both sequences will be developed in different scenarios. One case is an accident with the primary circuit to a high pressure (Station Blackout scenario) and the other with a early primary circuit depressurization due to the lost of primary coolant. For this work the MELCOR 1.8.5 code was used and it allows within a unified framework to modeling an extensive spectrum of phenomenology associated with the severe accidents. (author)

  11. Sequence data and association statistics from 12,940 type 2 diabetes cases and controls.

    Science.gov (United States)

    Flannick, Jason; Fuchsberger, Christian; Mahajan, Anubha; Teslovich, Tanya M; Agarwala, Vineeta; Gaulton, Kyle J; Caulkins, Lizz; Koesterer, Ryan; Ma, Clement; Moutsianas, Loukas; McCarthy, Davis J; Rivas, Manuel A; Perry, John R B; Sim, Xueling; Blackwell, Thomas W; Robertson, Neil R; Rayner, N William; Cingolani, Pablo; Locke, Adam E; Tajes, Juan Fernandez; Highland, Heather M; Dupuis, Josee; Chines, Peter S; Lindgren, Cecilia M; Hartl, Christopher; Jackson, Anne U; Chen, Han; Huyghe, Jeroen R; van de Bunt, Martijn; Pearson, Richard D; Kumar, Ashish; Müller-Nurasyid, Martina; Grarup, Niels; Stringham, Heather M; Gamazon, Eric R; Lee, Jaehoon; Chen, Yuhui; Scott, Robert A; Below, Jennifer E; Chen, Peng; Huang, Jinyan; Go, Min Jin; Stitzel, Michael L; Pasko, Dorota; Parker, Stephen C J; Varga, Tibor V; Green, Todd; Beer, Nicola L; Day-Williams, Aaron G; Ferreira, Teresa; Fingerlin, Tasha; Horikoshi, Momoko; Hu, Cheng; Huh, Iksoo; Ikram, Mohammad Kamran; Kim, Bong-Jo; Kim, Yongkang; Kim, Young Jin; Kwon, Min-Seok; Lee, Juyoung; Lee, Selyeong; Lin, Keng-Han; Maxwell, Taylor J; Nagai, Yoshihiko; Wang, Xu; Welch, Ryan P; Yoon, Joon; Zhang, Weihua; Barzilai, Nir; Voight, Benjamin F; Han, Bok-Ghee; Jenkinson, Christopher P; Kuulasmaa, Teemu; Kuusisto, Johanna; Manning, Alisa; Ng, Maggie C Y; Palmer, Nicholette D; Balkau, Beverley; Stančáková, Alena; Abboud, Hanna E; Boeing, Heiner; Giedraitis, Vilmantas; Prabhakaran, Dorairaj; Gottesman, Omri; Scott, James; Carey, Jason; Kwan, Phoenix; Grant, George; Smith, Joshua D; Neale, Benjamin M; Purcell, Shaun; Butterworth, Adam S; Howson, Joanna M M; Lee, Heung Man; Lu, Yingchang; Kwak, Soo-Heon; Zhao, Wei; Danesh, John; Lam, Vincent K L; Park, Kyong Soo; Saleheen, Danish; So, Wing Yee; Tam, Claudia H T; Afzal, Uzma; Aguilar, David; Arya, Rector; Aung, Tin; Chan, Edmund; Navarro, Carmen; Cheng, Ching-Yu; Palli, Domenico; Correa, Adolfo; Curran, Joanne E; Rybin, Dennis; Farook, Vidya S; Fowler, Sharon P; Freedman, Barry I; Griswold, Michael; Hale, Daniel Esten; Hicks, Pamela J; Khor, Chiea-Chuen; Kumar, Satish; Lehne, Benjamin; Thuillier, Dorothée; Lim, Wei Yen; Liu, Jianjun; Loh, Marie; Musani, Solomon K; Puppala, Sobha; Scott, William R; Yengo, Loïc; Tan, Sian-Tsung; Taylor, Herman A; Thameem, Farook; Wilson, Gregory; Wong, Tien Yin; Njølstad, Pål Rasmus; Levy, Jonathan C; Mangino, Massimo; Bonnycastle, Lori L; Schwarzmayr, Thomas; Fadista, João; Surdulescu, Gabriela L; Herder, Christian; Groves, Christopher J; Wieland, Thomas; Bork-Jensen, Jette; Brandslund, Ivan; Christensen, Cramer; Koistinen, Heikki A; Doney, Alex S F; Kinnunen, Leena; Esko, Tõnu; Farmer, Andrew J; Hakaste, Liisa; Hodgkiss, Dylan; Kravic, Jasmina; Lyssenko, Valeri; Hollensted, Mette; Jørgensen, Marit E; Jørgensen, Torben; Ladenvall, Claes; Justesen, Johanne Marie; Käräjämäki, Annemari; Kriebel, Jennifer; Rathmann, Wolfgang; Lannfelt, Lars; Lauritzen, Torsten; Narisu, Narisu; Linneberg, Allan; Melander, Olle; Milani, Lili; Neville, Matt; Orho-Melander, Marju; Qi, Lu; Qi, Qibin; Roden, Michael; Rolandsson, Olov; Swift, Amy; Rosengren, Anders H; Stirrups, Kathleen; Wood, Andrew R; Mihailov, Evelin; Blancher, Christine; Carneiro, Mauricio O; Maguire, Jared; Poplin, Ryan; Shakir, Khalid; Fennell, Timothy; DePristo, Mark; de Angelis, Martin Hrabé; Deloukas, Panos; Gjesing, Anette P; Jun, Goo; Nilsson, Peter; Murphy, Jacquelyn; Onofrio, Robert; Thorand, Barbara; Hansen, Torben; Meisinger, Christa; Hu, Frank B; Isomaa, Bo; Karpe, Fredrik; Liang, Liming; Peters, Annette; Huth, Cornelia; O'Rahilly, Stephen P; Palmer, Colin N A; Pedersen, Oluf; Rauramaa, Rainer; Tuomilehto, Jaakko; Salomaa, Veikko; Watanabe, Richard M; Syvänen, Ann-Christine; Bergman, Richard N; Bharadwaj, Dwaipayan; Bottinger, Erwin P; Cho, Yoon Shin; Chandak, Giriraj R; Chan, Juliana Cn; Chia, Kee Seng; Daly, Mark J; Ebrahim, Shah B; Langenberg, Claudia; Elliott, Paul; Jablonski, Kathleen A; Lehman, Donna M; Jia, Weiping; Ma, Ronald C W; Pollin, Toni I; Sandhu, Manjinder; Tandon, Nikhil; Froguel, Philippe; Barroso, Inês; Teo, Yik Ying; Zeggini, Eleftheria; Loos, Ruth J F; Small, Kerrin S; Ried, Janina S; DeFronzo, Ralph A; Grallert, Harald; Glaser, Benjamin; Metspalu, Andres; Wareham, Nicholas J; Walker, Mark; Banks, Eric; Gieger, Christian; Ingelsson, Erik; Im, Hae Kyung; Illig, Thomas; Franks, Paul W; Buck, Gemma; Trakalo, Joseph; Buck, David; Prokopenko, Inga; Mägi, Reedik; Lind, Lars; Farjoun, Yossi; Owen, Katharine R; Gloyn, Anna L; Strauch, Konstantin; Tuomi, Tiinamaija; Kooner, Jaspal Singh; Lee, Jong-Young; Park, Taesung; Donnelly, Peter; Morris, Andrew D; Hattersley, Andrew T; Bowden, Donald W; Collins, Francis S; Atzmon, Gil; Chambers, John C; Spector, Timothy D; Laakso, Markku; Strom, Tim M; Bell, Graeme I; Blangero, John; Duggirala, Ravindranath; Tai, E Shyong; McVean, Gilean; Hanis, Craig L; Wilson, James G; Seielstad, Mark; Frayling, Timothy M; Meigs, James B; Cox, Nancy J; Sladek, Rob; Lander, Eric S; Gabriel, Stacey; Mohlke, Karen L; Meitinger, Thomas; Groop, Leif; Abecasis, Goncalo; Scott, Laura J; Morris, Andrew P; Kang, Hyun Min; Altshuler, David; Burtt, Noël P; Florez, Jose C; Boehnke, Michael; McCarthy, Mark I

    2017-12-19

    To investigate the genetic basis of type 2 diabetes (T2D) to high resolution, the GoT2D and T2D-GENES consortia catalogued variation from whole-genome sequencing of 2,657 European individuals and exome sequencing of 12,940 individuals of multiple ancestries. Over 27M SNPs, indels, and structural variants were identified, including 99% of low-frequency (minor allele frequency [MAF] 0.1-5%) non-coding variants in the whole-genome sequenced individuals and 99.7% of low-frequency coding variants in the whole-exome sequenced individuals. Each variant was tested for association with T2D in the sequenced individuals, and, to increase power, most were tested in larger numbers of individuals (>80% of low-frequency coding variants in ~82 K Europeans via the exome chip, and ~90% of low-frequency non-coding variants in ~44 K Europeans via genotype imputation). The variants, genotypes, and association statistics from these analyses provide the largest reference to date of human genetic information relevant to T2D, for use in activities such as T2D-focused genotype imputation, functional characterization of variants or genes, and other novel analyses to detect associations between sequence variation and T2D.

  12. Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.

    Science.gov (United States)

    Sharma, Mamta; Saravolatz, Louis D

    2013-02-01

    Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.

  13. Zidovudine (AZT monotherapy selects for the A360V mutation in the connection domain of HIV-1 reverse transcriptase.

    Directory of Open Access Journals (Sweden)

    Jessica H Brehm

    Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.

  14. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity

    International Nuclear Information System (INIS)

    Lubahn, D.B.; Simental, J.A.; Higgs, H.N.; Wilson, E.M.; French, F.S.; Brown, T.R.; Migeon, C.J.

    1989-01-01

    Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but the binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development

  15. Sequence Selection and Performance in DS/CDMA Systems

    Directory of Open Access Journals (Sweden)

    Jefferson Santos Ambrosio

    2016-03-01

    Full Text Available In this work key concepts on coding division multiple access (CDMA communication systems have been discussed. The sequence selection impact on the performance and capacity of direct sequence CDMA (DS/CDMA systems under AWGN and increasing system loading, as well as under multiple antennas channels was investigated.

  16. Impact of Different Spreading Codes Using FEC on DWT Based MC-CDMA System

    OpenAIRE

    Masum, Saleh; Kabir, M. Hasnat; Islam, Md. Matiqul; Shams, Rifat Ara; Ullah, Shaikh Enayet

    2012-01-01

    The effect of different spreading codes in DWT based MC-CDMA wireless communication system is investigated. In this paper, we present the Bit Error Rate (BER) performance of different spreading codes (Walsh-Hadamard code, Orthogonal gold code and Golay complementary sequences) using Forward Error Correction (FEC) of the proposed system. The data is analyzed and is compared among different spreading codes in both coded and uncoded cases. It is found via computer simulation that the performance...

  17. Amino acid code of protein secondary structure.

    Science.gov (United States)

    Shestopalov, B V

    2003-01-01

    The calculation of protein three-dimensional structure from the amino acid sequence is a fundamental problem to be solved. This paper presents principles of the code theory of protein secondary structure, and their consequence--the amino acid code of protein secondary structure. The doublet code model of protein secondary structure, developed earlier by the author (Shestopalov, 1990), is part of this theory. The theory basis are: 1) the name secondary structure is assigned to the conformation, stabilized only by the nearest (intraresidual) and middle-range (at a distance no more than that between residues i and i + 5) interactions; 2) the secondary structure consists of regular (alpha-helical and beta-structural) and irregular (coil) segments; 3) the alpha-helices, beta-strands and coil segments are encoded, respectively, by residue pairs (i, i + 4), (i, i + 2), (i, i = 1), according to the numbers of residues per period, 3.6, 2, 1; 4) all such pairs in the amino acid sequence are codons for elementary structural elements, or structurons; 5) the codons are divided into 21 types depending on their strength, i.e. their encoding capability; 6) overlappings of structurons of one and the same structure generate the longer segments of this structure; 7) overlapping of structurons of different structures is forbidden, and therefore selection of codons is required, the codon selection is hierarchic; 8) the code theory of protein secondary structure generates six variants of the amino acid code of protein secondary structure. There are two possible kinds of model construction based on the theory: the physical one using physical properties of amino acid residues, and the statistical one using results of statistical analysis of a great body of structural data. Some evident consequences of the theory are: a) the theory can be used for calculating the secondary structure from the amino acid sequence as a partial solution of the problem of calculation of protein three

  18. Temporal code-driven stimulation: definition and application to electric fish signaling

    Directory of Open Access Journals (Sweden)

    Angel Lareo

    2016-10-01

    Full Text Available Closed-loop activity-dependent stimulation is a powerful methodology to assess information processing in biological systems. In this context, the development of novel protocols, their implementation in bioinformatics toolboxes and their application to different description levels open up a wide range of possibilities in the study of biological systems. We developed a methodology for studying biological signals representing them as temporal sequences of binary events. A specific sequence of these events (code is chosen to deliver a predefined stimulation in a closed-loop manner. The response to this code-driven stimulation can be used to characterize the system. This methodology was implemented in a real time toolbox and tested in the context of electric fish signaling. We show that while there are codes that evoke a response that cannot be distinguished from a control recording without stimulation, other codes evoke a characteristic distinct response. We also compare the code-driven response to open-loop stimulation. The discussed experiments validate the proposed methodology and the software toolbox.

  19. Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.

    Science.gov (United States)

    Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E

    2013-06-18

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  20. DNA methylation of miRNA coding sequences putatively associated with childhood obesity.

    Science.gov (United States)

    Mansego, M L; Garcia-Lacarte, M; Milagro, F I; Marti, A; Martinez, J A

    2017-02-01

    Epigenetic mechanisms may be involved in obesity onset and its consequences. The aim of the present study was to evaluate whether DNA methylation status in microRNA (miRNA) coding regions is associated with childhood obesity. DNA isolated from white blood cells of 24 children (identification sample: 12 obese and 12 non-obese) from the Grupo Navarro de Obesidad Infantil study was hybridized in a 450 K methylation microarray. Several CpGs whose DNA methylation levels were statistically different between obese and non-obese were validated by MassArray® in 95 children (validation sample) from the same study. Microarray analysis identified 16 differentially methylated CpGs between both groups (6 hypermethylated and 10 hypomethylated). DNA methylation levels in miR-1203, miR-412 and miR-216A coding regions significantly correlated with body mass index standard deviation score (BMI-SDS) and explained up to 40% of the variation of BMI-SDS. The network analysis identified 19 well-defined obesity-relevant biological pathways from the KEGG database. MassArray® validation identified three regions located in or near miR-1203, miR-412 and miR-216A coding regions differentially methylated between obese and non-obese children. The current work identified three CpG sites located in coding regions of three miRNAs (miR-1203, miR-412 and miR-216A) that were differentially methylated between obese and non-obese children, suggesting a role of miRNA epigenetic regulation in childhood obesity. © 2016 World Obesity Federation.

  1. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3′ UTRs and coding sequences

    Science.gov (United States)

    Šulc, Miroslav; Marín, Ray M.; Robins, Harlan S.; Vaníček, Jiří

    2015-01-01

    The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3′ untranslated regions (3′ UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3′ UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA–mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA–mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. PMID:25948580

  2. Sub-band/transform compression of video sequences

    Science.gov (United States)

    Sauer, Ken; Bauer, Peter

    1992-01-01

    The progress on compression of video sequences is discussed. The overall goal of the research was the development of data compression algorithms for high-definition television (HDTV) sequences, but most of our research is general enough to be applicable to much more general problems. We have concentrated on coding algorithms based on both sub-band and transform approaches. Two very fundamental issues arise in designing a sub-band coder. First, the form of the signal decomposition must be chosen to yield band-pass images with characteristics favorable to efficient coding. A second basic consideration, whether coding is to be done in two or three dimensions, is the form of the coders to be applied to each sub-band. Computational simplicity is of essence. We review the first portion of the year, during which we improved and extended some of the previous grant period's results. The pyramid nonrectangular sub-band coder limited to intra-frame application is discussed. Perhaps the most critical component of the sub-band structure is the design of bandsplitting filters. We apply very simple recursive filters, which operate at alternating levels on rectangularly sampled, and quincunx sampled images. We will also cover the techniques we have studied for the coding of the resulting bandpass signals. We discuss adaptive three-dimensional coding which takes advantage of the detection algorithm developed last year. To this point, all the work on this project has been done without the benefit of motion compensation (MC). Motion compensation is included in many proposed codecs, but adds significant computational burden and hardware expense. We have sought to find a lower-cost alternative featuring a simple adaptation to motion in the form of the codec. In sequences of high spatial detail and zooming or panning, it appears that MC will likely be necessary for the proposed quality and bit rates.

  3. Evidence for a relief of repression mechanism for activation of the human telomerase reverse transcriptase promoter.

    Science.gov (United States)

    Wang, Shuwen; Zhu, Jiyue

    2003-05-23

    The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.

  4. On fuzzy semantic similarity measure for DNA coding.

    Science.gov (United States)

    Ahmad, Muneer; Jung, Low Tang; Bhuiyan, Md Al-Amin

    2016-02-01

    A coding measure scheme numerically translates the DNA sequence to a time domain signal for protein coding regions identification. A number of coding measure schemes based on numerology, geometry, fixed mapping, statistical characteristics and chemical attributes of nucleotides have been proposed in recent decades. Such coding measure schemes lack the biologically meaningful aspects of nucleotide data and hence do not significantly discriminate coding regions from non-coding regions. This paper presents a novel fuzzy semantic similarity measure (FSSM) coding scheme centering on FSSM codons׳ clustering and genetic code context of nucleotides. Certain natural characteristics of nucleotides i.e. appearance as a unique combination of triplets, preserving special structure and occurrence, and ability to own and share density distributions in codons have been exploited in FSSM. The nucleotides׳ fuzzy behaviors, semantic similarities and defuzzification based on the center of gravity of nucleotides revealed a strong correlation between nucleotides in codons. The proposed FSSM coding scheme attains a significant enhancement in coding regions identification i.e. 36-133% as compared to other existing coding measure schemes tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Dolores Bautista-España

    Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

  6. LAPU2: a laser pulse propagation code with diffraction

    International Nuclear Information System (INIS)

    Goldstein, J.C.; Dickman, D.O.

    1978-03-01

    Complete descriptions of the mathematical models and numerical methods used in the code LAPU2 are presented. This code can be used to study the propagation with diffraction of a temporally finite pulse through a sequence of resonant media and simple optical components. The treatment assumes cylindrical symmetry and allows nonlinear refractive indices. An unlimited number of different media can be distributed along the propagation path of the pulse. A complete users guide to input data is given as well as a FORTRAN listing of the code

  7. Influence of the Leader protein coding region of foot-and-mouth disease virus on virus replication

    DEFF Research Database (Denmark)

    Belsham, Graham

    2013-01-01

    The foot-and-mouth disease virus (FMDV) Leader (L) protein is produced in two forms, Lab and Lb, differing only at their amino-termini, due to the use of separate initiation codons, usually 84 nt apart. It has been shown previously, and confirmed here, that precise deletion of the Lab coding......, in the context of the virus lacking the Lb coding region, was also tolerated by the virus within BHK cells. However, precise loss of the Lb coding sequence alone blocked FMDV replication in primary bovine thyroid cells. Thus, the requirement for the Leader protein coding sequences is highly dependent...... on the nature and extent of the residual Leader protein sequences and on the host cell system used. FMDVs precisely lacking Lb and with the Lab initiation codon modified may represent safer seed viruses for vaccine production....

  8. Sequencing of 50 human exomes reveals adaptation to high altitude

    DEFF Research Database (Denmark)

    Yi, Xin; Liang, Yu; Huerta-Sanchez, Emilia

    2010-01-01

    Residents of the Tibetan Plateau show heritable adaptations to extreme altitude. We sequenced 50 exomes of ethnic Tibetans, encompassing coding sequences of 92% of human genes, with an average coverage of 18x per individual. Genes showing population-specific allele frequency changes, which repres...... in genetic adaptation to high altitude.......Residents of the Tibetan Plateau show heritable adaptations to extreme altitude. We sequenced 50 exomes of ethnic Tibetans, encompassing coding sequences of 92% of human genes, with an average coverage of 18x per individual. Genes showing population-specific allele frequency changes, which...... represent strong candidates for altitude adaptation, were identified. The strongest signal of natural selection came from endothelial Per-Arnt-Sim (PAS) domain protein 1 (EPAS1), a transcription factor involved in response to hypoxia. One single-nucleotide polymorphism (SNP) at EPAS1 shows a 78% frequency...

  9. Spike Code Flow in Cultured Neuronal Networks.

    Science.gov (United States)

    Tamura, Shinichi; Nishitani, Yoshi; Hosokawa, Chie; Miyoshi, Tomomitsu; Sawai, Hajime; Kamimura, Takuya; Yagi, Yasushi; Mizuno-Matsumoto, Yuko; Chen, Yen-Wei

    2016-01-01

    We observed spike trains produced by one-shot electrical stimulation with 8 × 8 multielectrodes in cultured neuronal networks. Each electrode accepted spikes from several neurons. We extracted the short codes from spike trains and obtained a code spectrum with a nominal time accuracy of 1%. We then constructed code flow maps as movies of the electrode array to observe the code flow of "1101" and "1011," which are typical pseudorandom sequence such as that we often encountered in a literature and our experiments. They seemed to flow from one electrode to the neighboring one and maintained their shape to some extent. To quantify the flow, we calculated the "maximum cross-correlations" among neighboring electrodes, to find the direction of maximum flow of the codes with lengths less than 8. Normalized maximum cross-correlations were almost constant irrespective of code. Furthermore, if the spike trains were shuffled in interval orders or in electrodes, they became significantly small. Thus, the analysis suggested that local codes of approximately constant shape propagated and conveyed information across the network. Hence, the codes can serve as visible and trackable marks of propagating spike waves as well as evaluating information flow in the neuronal network.

  10. Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

    OpenAIRE

    Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

    2008-01-01

    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...

  11. Status of the CONTAIN computer code for LWR containment analysis

    International Nuclear Information System (INIS)

    Bergeron, K.D.; Murata, K.K.; Rexroth, P.E.; Clauser, M.J.; Senglaub, M.E.; Sciacca, F.W.; Trebilcock, W.

    1983-01-01

    The current status of the CONTAIN code for LWR safety analysis is reviewed. Three example calculations are discussed as illustrations of the code's capabilities: (1) a demonstration of the spray model in a realistic PWR problem, and a comparison with CONTEMPT results; (2) a comparison of CONTAIN results for a major aerosol experiment against experimental results and predictions of the HAARM aerosol code; and (3) an LWR sample problem, involving a TMLB' sequence for the Zion reactor containment

  12. Status of the CONTAIN computer code for LWR containment analysis

    International Nuclear Information System (INIS)

    Bergeron, K.D.; Murata, K.K.; Rexroth, P.E.; Clauser, M.J.; Senglaub, M.E.; Sciacca, F.W.; Trebilcock, W.

    1982-01-01

    The current status of the CONTAIN code for LWR safety analysis is reviewed. Three example calculations are discussed as illustrations of the code's capabilities: (1) a demonstration of the spray model in a realistic PWR problem, and a comparison with CONTEMPT results; (2) a comparison of CONTAIN results for a major aerosol experiment against experimental results and predictions of the HAARM aerosol code; and (3) an LWR sample problem, involving a TMLB' sequence for the Zion reactor containment

  13. Adaptable recursive binary entropy coding technique

    Science.gov (United States)

    Kiely, Aaron B.; Klimesh, Matthew A.

    2002-07-01

    We present a novel data compression technique, called recursive interleaved entropy coding, that is based on recursive interleaving of variable-to variable length binary source codes. A compression module implementing this technique has the same functionality as arithmetic coding and can be used as the engine in various data compression algorithms. The encoder compresses a bit sequence by recursively encoding groups of bits that have similar estimated statistics, ordering the output in a way that is suited to the decoder. As a result, the decoder has low complexity. The encoding process for our technique is adaptable in that each bit to be encoded has an associated probability-of-zero estimate that may depend on previously encoded bits; this adaptability allows more effective compression. Recursive interleaved entropy coding may have advantages over arithmetic coding, including most notably the admission of a simple and fast decoder. Much variation is possible in the choice of component codes and in the interleaving structure, yielding coder designs of varying complexity and compression efficiency; coder designs that achieve arbitrarily small redundancy can be produced. We discuss coder design and performance estimation methods. We present practical encoding and decoding algorithms, as well as measured performance results.

  14. Absence of mutations in the coding sequence of the potential tumor suppressor 3pK in metastatic melanoma

    Directory of Open Access Journals (Sweden)

    Houben Roland

    2005-12-01

    Full Text Available Abstract Background Activation of Ras or Raf contributes to tumorigenesis of melanoma. However, constitutive Raf activation is also a characteristic of the majority of benign melanocytic nevi and high intensity signaling of either Ras or Raf was found to induce growth inhibition and senescence rather than transformation. Since the chromosome 3p kinase (3pK is a target of the Ras/Raf/Mek/Erk signaling pathway which antagonizes the function of the oncogene and anti-differentiation factor Bmi-1, 3pK may function as a tumor suppressor in tumors with constitutive Ras/Raf activation. Consequently, we tested whether inactivating 3pK mutations are present in melanoma. Methods 30 metastatic melanoma samples, which were positive for activating mutations of either BRaf or NRas, were analyzed for possible mutations in the 3pk gene. The 10 coding exons and their flanking intron sequences were amplified by PCR and direct sequencing of the PCR products was performed. Results This analysis revealed that besides the presence of some single nucleotide polymorphisms in the 3pk gene, we could not detect any possible loss of function mutation in any of these 30 metastatic melanoma samples selected for the presence of activating mutations within the Ras/Raf/Mek/Erk signaling pathway. Conclusion Hence, in melanoma with constitutively active Ras/Raf inactivating mutations within the 3pk gene do not contribute to the oncogenic phenotype of this highly malignant tumor.

  15. File compression and encryption based on LLS and arithmetic coding

    Science.gov (United States)

    Yu, Changzhi; Li, Hengjian; Wang, Xiyu

    2018-03-01

    e propose a file compression model based on arithmetic coding. Firstly, the original symbols, to be encoded, are input to the encoder one by one, we produce a set of chaotic sequences by using the Logistic and sine chaos system(LLS), and the values of this chaotic sequences are randomly modified the Upper and lower limits of current symbols probability. In order to achieve the purpose of encryption, we modify the upper and lower limits of all character probabilities when encoding each symbols. Experimental results show that the proposed model can achieve the purpose of data encryption while achieving almost the same compression efficiency as the arithmetic coding.

  16. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

    Science.gov (United States)

    Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang

    2010-01-01

    A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408

  17. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

    Directory of Open Access Journals (Sweden)

    Yanrui Li

    2010-01-01

    Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.

  18. Terahertz wave manipulation based on multi-bit coding artificial electromagnetic surfaces

    Science.gov (United States)

    Li, Jiu-Sheng; Zhao, Ze-Jiang; Yao, Jian-Quan

    2018-05-01

    A polarization insensitive multi-bit coding artificial electromagnetic surface is proposed for terahertz wave manipulation. The coding artificial electromagnetic surfaces composed of four-arrow-shaped particles with certain coding sequences can generate multi-bit coding in the terahertz frequencies and manipulate the reflected terahertz waves to the numerous directions by using of different coding distributions. Furthermore, we demonstrate that our coding artificial electromagnetic surfaces have strong abilities to reduce the radar cross section with polarization insensitive for TE and TM incident terahertz waves as well as linear-polarized and circular-polarized terahertz waves. This work offers an effectively strategy to realize more powerful manipulation of terahertz wave.

  19. Isolation and sequencing of a cDNA coding for the human DF3 breast carcinoma-associated antigen

    International Nuclear Information System (INIS)

    Siddiqui, J.; Abe, M.; Hayes, D.; Shani, E.; Yunis, E.; Kufe, D.

    1988-01-01

    The murine monoclonal antibody (mAb) DF3 reacts with a high molecular weight glycoprotein detectable in human breast carcinomas. DF3 antigen expression correlates with human breast tumor differentiation, and the detection of a cross-reactive species in human milk has suggested that this antigen might be useful as a marker of differentiated mammary epithelium. To further characterize DF3 antigen expression, the authors have isolated a cDNA clone from a λgt11 library by screening with mAb DF3. The results demonstrate that this 309-base-pair cDNA, designated pDF9.3, codes for the DF3 epitope. Southern blot analyses of EcoRI-digested DNAs from six human tumor cell lines with 32 P-labeled pDF9.3 have revealed a restriction fragment length polymorphism. Variations in size of the alleles detected by pDF9.3 were also identified in Pst I, but not in HindIII, DNA digests. Furthermore, hybridization of 32 P-labeled pDF9.3 with total cellular RNA from each of these cell lines demonstrated either one or two transcripts that varied from 4.1 to 7.1 kilobases in size. The presence of differently sized transcripts detected by pDF9.3 was also found to correspond with the polymorphic expression of DF3 glycoproteins. Nucleotide sequence analysis of pDF9.3 has revealed a highly conserved (G + C)-rich 60-base-pair tandem repeat. These findings suggest that the variation in size of alleles coding for the polymorphic DF3 glycoprotein may represent different numbers of repeats

  20. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  1. Quantitative analysis of the anti-noise performance of an m-sequence in an electromagnetic method

    Science.gov (United States)

    Yuan, Zhe; Zhang, Yiming; Zheng, Qijia

    2018-02-01

    An electromagnetic method with a transmitted waveform coded by an m-sequence achieved better anti-noise performance compared to the conventional manner with a square-wave. The anti-noise performance of the m-sequence varied with multiple coding parameters; hence, a quantitative analysis of the anti-noise performance for m-sequences with different coding parameters was required to optimize them. This paper proposes the concept of an identification system, with the identified Earth impulse response obtained by measuring the system output with the input of the voltage response. A quantitative analysis of the anti-noise performance of the m-sequence was achieved by analyzing the amplitude-frequency response of the corresponding identification system. The effects of the coding parameters on the anti-noise performance are summarized by numerical simulation, and their optimization is further discussed in our conclusions; the validity of the conclusions is further verified by field experiment. The quantitative analysis method proposed in this paper provides a new insight into the anti-noise mechanism of the m-sequence, and could be used to evaluate the anti-noise performance of artificial sources in other time-domain exploration methods, such as the seismic method.

  2. ICARE/CATHARE and ASTEC code development trends

    International Nuclear Information System (INIS)

    Chatelard, P.; Dorsselaere, J.-P. van

    2000-01-01

    Regarding the computer code development for simulation of LWR severe accidents, IPSN developed a two-tier approach based on detailed codes such as ICARE/CATHARE and simplified models to be assembled in the ASTEC integral code. The ICARE/CATHARE code results from the coupling between the ICARE2 code modelling the core degradation phenomena and the thermalhydraulics code CATHARE2. It allows to calculate PWR and VVER severe accident sequences in the whole RCS. The modelling of the early degradation phase can be considered as rather complete in the ICARE/CATHARE V1 mod1 version (to be released by mid-2000) whereas some models are still missing for the late phase. The main future developments (ICARE/CATHARE V2) will concern the multi-dimensional thermalhydraulics, the quenching of partially damaged cores (mechanical and chemical effects), the debris bed two-phase thermalhydraulics (including reflooding) and the corium behaviour in the lower head. The main other physical improvements should concern the behaviour of boron carbide control rods, the processes governing the core loss of geometry (transition phase) and the oxidation of relocated melts. The ASTEC (Accident Source Term Evaluation Code) integral code, commonly developed by IPSN and GRS, aims to predict an entire LWR (PWR, VVER and BWR) severe accident sequence from the initiating event through to FP release out of the containment, for source term, PSA level 2, or accident management studies. The version ASTEC VO.3 to be released by mid-2000 can be considered now as robust and fast-running enough (between 2 and 12 hours for a one day accident) and allows to perform, with a containment multi-compartment configuration, any scenario accident study accounting for the main safety systems and operator procedures (spray, recombiner, etc.). The next version ASTEC V1, to be released beginning of 2002, will include the frontend simulation and improve modelling of in-vessel core degradation. A large validation activity will

  3. Quantum mean-field decoding algorithm for error-correcting codes

    International Nuclear Information System (INIS)

    Inoue, Jun-ichi; Saika, Yohei; Okada, Masato

    2009-01-01

    We numerically examine a quantum version of TAP (Thouless-Anderson-Palmer)-like mean-field algorithm for the problem of error-correcting codes. For a class of the so-called Sourlas error-correcting codes, we check the usefulness to retrieve the original bit-sequence (message) with a finite length. The decoding dynamics is derived explicitly and we evaluate the average-case performance through the bit-error rate (BER).

  4. Code-modulated visual evoked potentials using fast stimulus presentation and spatiotemporal beamformer decoding.

    Science.gov (United States)

    Wittevrongel, Benjamin; Van Wolputte, Elia; Van Hulle, Marc M

    2017-11-08

    When encoding visual targets using various lagged versions of a pseudorandom binary sequence of luminance changes, the EEG signal recorded over the viewer's occipital pole exhibits so-called code-modulated visual evoked potentials (cVEPs), the phase lags of which can be tied to these targets. The cVEP paradigm has enjoyed interest in the brain-computer interfacing (BCI) community for the reported high information transfer rates (ITR, in bits/min). In this study, we introduce a novel decoding algorithm based on spatiotemporal beamforming, and show that this algorithm is able to accurately identify the gazed target. Especially for a small number of repetitions of the coding sequence, our beamforming approach significantly outperforms an optimised support vector machine (SVM)-based classifier, which is considered state-of-the-art in cVEP-based BCI. In addition to the traditional 60 Hz stimulus presentation rate for the coding sequence, we also explore the 120 Hz rate, and show that the latter enables faster communication, with a maximal median ITR of 172.87 bits/min. Finally, we also report on a transition effect in the EEG signal following the onset of the stimulus sequence, and recommend to exclude the first 150 ms of the trials from decoding when relying on a single presentation of the stimulus sequence.

  5. Motion Vector Sharing and Bitrate Allocation for 3D Video-Plus-Depth Coding

    Directory of Open Access Journals (Sweden)

    Béatrice Pesquet-Popescu

    2008-08-01

    Full Text Available The video-plus-depth data representation uses a regular texture video enriched with the so-called depth map, providing the depth distance for each pixel. The compression efficiency is usually higher for smooth, gray level data representing the depth map than for classical video texture. However, improvements of the coding efficiency are still possible, taking into account the fact that the video and the depth map sequences are strongly correlated. Classically, the correlation between the texture motion vectors and the depth map motion vectors is not exploited in the coding process. The aim of this paper is to reduce the amount of information for describing the motion of the texture video and of the depth map sequences by sharing one common motion vector field. Furthermore, in the literature, the bitrate control scheme generally fixes for the depth map sequence a percentage of 20% of the texture stream bitrate. However, this fixed percentage can affect the depth coding efficiency, and it should also depend on the content of each sequence. We propose a new bitrate allocation strategy between the texture and its associated per-pixel depth information. We provide comparative analysis to measure the quality of the resulting 3D+t sequences.

  6. Draft Genome Sequence of Cupriavidus pauculus Strain KF709, a Biphenyl-Utilizing Bacterium Isolated from Biphenyl-Contaminated Soil

    OpenAIRE

    Watanabe, Takahito; Yamazoe, Atsushi; Hosoyama, Akira; Fujihara, Hidehiko; Suenaga, Hikaru; Hirose, Jun; Futagami, Taiki; Goto, Masatoshi; Kimura, Nobutada; Furukawa, Kensuke

    2015-01-01

    We report the draft genome sequence of Cupriavidus pauculus strain KF709, which comprises 6,826,799 bp with 6,272 coding sequences. The strain KF709 utilizes biphenyl and degrades low-chlorinated biphenyls; however, it possesses fewer coding sequences involved in the degradation of aromatic compounds than other strains belonging to the Betaproteobacteria.

  7. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  8. Why barcode? High-throughput multiplex sequencing of mitochondrial genomes for molecular systematics.

    Science.gov (United States)

    Timmermans, M J T N; Dodsworth, S; Culverwell, C L; Bocak, L; Ahrens, D; Littlewood, D T J; Pons, J; Vogler, A P

    2010-11-01

    Mitochondrial genome sequences are important markers for phylogenetics but taxon sampling remains sporadic because of the great effort and cost required to acquire full-length sequences. Here, we demonstrate a simple, cost-effective way to sequence the full complement of protein coding mitochondrial genes from pooled samples using the 454/Roche platform. Multiplexing was achieved without the need for expensive indexing tags ('barcodes'). The method was trialled with a set of long-range polymerase chain reaction (PCR) fragments from 30 species of Coleoptera (beetles) sequenced in a 1/16th sector of a sequencing plate. Long contigs were produced from the pooled sequences with sequencing depths ranging from ∼10 to 100× per contig. Species identity of individual contigs was established via three 'bait' sequences matching disparate parts of the mitochondrial genome obtained by conventional PCR and Sanger sequencing. This proved that assembly of contigs from the sequencing pool was correct. Our study produced sequences for 21 nearly complete and seven partial sets of protein coding mitochondrial genes. Combined with existing sequences for 25 taxa, an improved estimate of basal relationships in Coleoptera was obtained. The procedure could be employed routinely for mitochondrial genome sequencing at the species level, to provide improved species 'barcodes' that currently use the cox1 gene only.

  9. Short Communication Phylogenetic Characterization of HIV Type 1 CRF01_AE V3 Envelope Sequences in Pregnant Women in Northern Vietnam

    Science.gov (United States)

    Caridha, Rozina; Ha, Tran Thi Thanh; Gaseitsiwe, Simani; Hung, Pham Viet; Anh, Nguyen Mai; Bao, Nguyen Huy; Khang, Dinh Duy; Hien, Nguyen Tran; Cam, Phung Dac; Chiodi, Francesca

    2012-01-01

    Abstract Characterization of HIV-1 strains is important for surveillance of the HIV-1 epidemic. In Vietnam HIV-1-infected pregnant women often fail to receive the care they are entitled to. Here, we analyzed phylogenetically HIV-1 env sequences from 37 HIV-1-infected pregnant women from Ha Noi (n=22) and Hai Phong (n=15), where they delivered in 2005–2007. All carried CRF01_AE in the gp120 V3 region. In 21 women CRF01_AE was also found in the reverse transcriptase gene. We compared their env gp120 V3 sequences phylogenetically in a maximum likelihood tree to those of 198 other CRF01_AE sequences in Vietnam and 229 from neighboring countries, predominantly Thailand, from the HIV-1 database. Altogether 464 sequences were analyzed. All but one of the maternal sequences colocalized with sequences from northern Vietnam. The maternal sequences had evolved the least when compared to sequences collected in Ha Noi in 2002, as shown by analysis of synonymous and nonsynonymous changes, than to other Vietnamese sequences collected earlier and/or elsewhere. Since the HIV-1 epidemic in women in Vietnam may still be underestimated, characterization of HIV-1 in pregnant women is important to observe how HIV-1 has evolved and follow its molecular epidemiology. PMID:21936713

  10. The "periodic table" of the genetic code: A new way to look at the code and the decoding process.

    Science.gov (United States)

    Komar, Anton A

    2016-01-01

    Henri Grosjean and Eric Westhof recently presented an information-rich, alternative view of the genetic code, which takes into account current knowledge of the decoding process, including the complex nature of interactions between mRNA, tRNA and rRNA that take place during protein synthesis on the ribosome, and it also better reflects the evolution of the code. The new asymmetrical circular genetic code has a number of advantages over the traditional codon table and the previous circular diagrams (with a symmetrical/clockwise arrangement of the U, C, A, G bases). Most importantly, all sequence co-variances can be visualized and explained based on the internal logic of the thermodynamics of codon-anticodon interactions.

  11. Novel (2,6-difluorophenyl)(2-(phenylamino)pyrimidin-4-yl) methanones with restricted conformation as potent non-nucleoside reverse transcriptase inhibitors against HIV-1

    Czech Academy of Sciences Publication Activity Database

    Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko

    2016-01-01

    Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016

  12. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Science.gov (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  13. Presence and Expression of Microbial Genes Regulating Soil Nitrogen Dynamics Along the Tanana River Successional Sequence

    Science.gov (United States)

    Boone, R. D.; Rogers, S. L.

    2004-12-01

    We report on work to assess the functional gene sequences for soil microbiota that control nitrogen cycle pathways along the successional sequence (willow, alder, poplar, white spruce, black spruce) on the Tanana River floodplain, Interior Alaska. Microbial DNA and mRNA were extracted from soils (0-10 cm depth) for amoA (ammonium monooxygenase), nifH (nitrogenase reductase), napA (nitrate reductase), and nirS and nirK (nitrite reductase) genes. Gene presence was determined by amplification of a conserved sequence of each gene employing sequence specific oligonucleotide primers and Polymerase Chain Reaction (PCR). Expression of the genes was measured via nested reverse transcriptase PCR amplification of the extracted mRNA. Amplified PCR products were visualized on agarose electrophoresis gels. All five successional stages show evidence for the presence and expression of microbial genes that regulate N fixation (free-living), nitrification, and nitrate reduction. We detected (1) nifH, napA, and nirK presence and amoA expression (mRNA production) for all five successional stages and (2) nirS and amoA presence and nifH, nirK, and napA expression for early successional stages (willow, alder, poplar). The results highlight that the existing body of previous process-level work has not sufficiently considered the microbial potential for a nitrate economy and free-living N fixation along the complete floodplain successional sequence.

  14. Study on a new meteorological sampling scheme developed for the OSCAAR code system

    International Nuclear Information System (INIS)

    Liu Xinhe; Tomita, Kenichi; Homma, Toshimitsu

    2002-03-01

    One important step in Level-3 Probabilistic Safety Assessment is meteorological sequence sampling, on which the previous studies were mainly related to code systems using the straight-line plume model and more efforts are needed for those using the trajectory puff model such as the OSCAAR code system. This report describes the development of a new meteorological sampling scheme for the OSCAAR code system that explicitly considers population distribution. A group of principles set for the development of this new sampling scheme includes completeness, appropriate stratification, optimum allocation, practicability and so on. In this report, discussions are made about the procedures of the new sampling scheme and its application. The calculation results illustrate that although it is quite difficult to optimize stratification of meteorological sequences based on a few environmental parameters the new scheme do gather the most inverse conditions in a single subset of meteorological sequences. The size of this subset may be as small as a few dozens, so that the tail of a complementary cumulative distribution function is possible to remain relatively static in different trials of the probabilistic consequence assessment code. (author)

  15. On the classification of long non-coding RNAs

    KAUST Repository

    Ma, Lina; Bajic, Vladimir B.; Zhang, Zhang

    2013-01-01

    Long non-coding RNAs (lncRNAs) have been found to perform various functions in a wide variety of important biological processes. To make easier interpretation of lncRNA functionality and conduct deep mining on these transcribed sequences

  16. Development of the PRO-LOCA Probabilistic Fracture Mechanics Code, MERIT Final Report

    International Nuclear Information System (INIS)

    Scott, Paul; Kurth, Robert; Cox, Andrew; Olson, Rick; Rudland, Dave

    2010-12-01

    The MERIT project has been an internationally financed program with the main purpose of developing probabilistic models for piping failure of nuclear components and to include these models in a probabilistic code named PRO-LOCA. The principal objective of the project has been to develop probabilistic models for piping failure of nuclear components and to include these models in a probabilistic code. The MERIT program has produced a code named PRO-LOCA with the following features: - Crack initiation models for fatigue or stress corrosion cracking for previously unflawed material. - Subcritical crack growth models for fatigue and stress corrosion cracking for both initiated and pre-existing circumferential defects. - Models for flaw detection by inspections and leak detection. - Crack stability. The PRO-LOCA code can thus predict the leak or break frequency for the whole sequence of initiation, subcritical crack growth until wall penetration and leakage, instability of the through-wall crack (pipe rupture). The outcome of the PRO-LOCA code are a sequence of failure frequencies which represents the probability of surface crack developing, a through-wall crack developing and six different sizes of crack opening areas corresponding to different leak flow rates or LOCA categories. Note that the level of quality assurance of the PRO-LOCA code is such that the code in its current state of development is considered to be more of a research code than a regulatory tool.

  17. Development of the PRO-LOCA Probabilistic Fracture Mechanics Code, MERIT Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Scott, Paul; Kurth, Robert; Cox, Andrew; Olson, Rick (Battelle Columbus (United States)); Rudland, Dave (Nuclear Regulatory Commission (United States))

    2010-12-15

    The MERIT project has been an internationally financed program with the main purpose of developing probabilistic models for piping failure of nuclear components and to include these models in a probabilistic code named PRO-LOCA. The principal objective of the project has been to develop probabilistic models for piping failure of nuclear components and to include these models in a probabilistic code. The MERIT program has produced a code named PRO-LOCA with the following features: - Crack initiation models for fatigue or stress corrosion cracking for previously unflawed material. - Subcritical crack growth models for fatigue and stress corrosion cracking for both initiated and pre-existing circumferential defects. - Models for flaw detection by inspections and leak detection. - Crack stability. The PRO-LOCA code can thus predict the leak or break frequency for the whole sequence of initiation, subcritical crack growth until wall penetration and leakage, instability of the through-wall crack (pipe rupture). The outcome of the PRO-LOCA code are a sequence of failure frequencies which represents the probability of surface crack developing, a through-wall crack developing and six different sizes of crack opening areas corresponding to different leak flow rates or LOCA categories. Note that the level of quality assurance of the PRO-LOCA code is such that the code in its current state of development is considered to be more of a research code than a regulatory tool.

  18. Discrete Ramanujan transform for distinguishing the protein coding regions from other regions.

    Science.gov (United States)

    Hua, Wei; Wang, Jiasong; Zhao, Jian

    2014-01-01

    Based on the study of Ramanujan sum and Ramanujan coefficient, this paper suggests the concepts of discrete Ramanujan transform and spectrum. Using Voss numerical representation, one maps a symbolic DNA strand as a numerical DNA sequence, and deduces the discrete Ramanujan spectrum of the numerical DNA sequence. It is well known that of discrete Fourier power spectrum of protein coding sequence has an important feature of 3-base periodicity, which is widely used for DNA sequence analysis by the technique of discrete Fourier transform. It is performed by testing the signal-to-noise ratio at frequency N/3 as a criterion for the analysis, where N is the length of the sequence. The results presented in this paper show that the property of 3-base periodicity can be only identified as a prominent spike of the discrete Ramanujan spectrum at period 3 for the protein coding regions. The signal-to-noise ratio for discrete Ramanujan spectrum is defined for numerical measurement. Therefore, the discrete Ramanujan spectrum and the signal-to-noise ratio of a DNA sequence can be used for distinguishing the protein coding regions from the noncoding regions. All the exon and intron sequences in whole chromosomes 1, 2, 3 and 4 of Caenorhabditis elegans have been tested and the histograms and tables from the computational results illustrate the reliability of our method. In addition, we have analyzed theoretically and gotten the conclusion that the algorithm for calculating discrete Ramanujan spectrum owns the lower computational complexity and higher computational accuracy. The computational experiments show that the technique by using discrete Ramanujan spectrum for classifying different DNA sequences is a fast and effective method. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. MELT-IIIB: an updated version of the melt code

    International Nuclear Information System (INIS)

    Tabb, K.K.; Lewis, C.H.; O'Dell, L.D.; Padilla, A. Jr.; Smith, D.E.; Wilburn, N.P.

    1979-04-01

    The MELT series is a reactor modeling code designed to investigate a wide variety of hypothetical accident conditions, particularly the transient overpower sequence. MELT-IIIB is the latest in the series

  20. Genetic coding and gene expression - new Quadruplet genetic coding model

    Science.gov (United States)

    Shankar Singh, Rama

    2012-07-01

    Successful demonstration of human genome project has opened the door not only for developing personalized medicine and cure for genetic diseases, but it may also answer the complex and difficult question of the origin of life. It may lead to making 21st century, a century of Biological Sciences as well. Based on the central dogma of Biology, genetic codons in conjunction with tRNA play a key role in translating the RNA bases forming sequence of amino acids leading to a synthesized protein. This is the most critical step in synthesizing the right protein needed for personalized medicine and curing genetic diseases. So far, only triplet codons involving three bases of RNA, transcribed from DNA bases, have been used. Since this approach has several inconsistencies and limitations, even the promise of personalized medicine has not been realized. The new Quadruplet genetic coding model proposed and developed here involves all four RNA bases which in conjunction with tRNA will synthesize the right protein. The transcription and translation process used will be the same, but the Quadruplet codons will help overcome most of the inconsistencies and limitations of the triplet codes. Details of this new Quadruplet genetic coding model and its subsequent potential applications including relevance to the origin of life will be presented.

  1. cDNA sequences of two apolipoproteins from lamprey

    International Nuclear Information System (INIS)

    Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.

    1987-01-01

    The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point

  2. Spike Code Flow in Cultured Neuronal Networks

    Directory of Open Access Journals (Sweden)

    Shinichi Tamura

    2016-01-01

    Full Text Available We observed spike trains produced by one-shot electrical stimulation with 8 × 8 multielectrodes in cultured neuronal networks. Each electrode accepted spikes from several neurons. We extracted the short codes from spike trains and obtained a code spectrum with a nominal time accuracy of 1%. We then constructed code flow maps as movies of the electrode array to observe the code flow of “1101” and “1011,” which are typical pseudorandom sequence such as that we often encountered in a literature and our experiments. They seemed to flow from one electrode to the neighboring one and maintained their shape to some extent. To quantify the flow, we calculated the “maximum cross-correlations” among neighboring electrodes, to find the direction of maximum flow of the codes with lengths less than 8. Normalized maximum cross-correlations were almost constant irrespective of code. Furthermore, if the spike trains were shuffled in interval orders or in electrodes, they became significantly small. Thus, the analysis suggested that local codes of approximately constant shape propagated and conveyed information across the network. Hence, the codes can serve as visible and trackable marks of propagating spike waves as well as evaluating information flow in the neuronal network.

  3. Complete plastid genome sequence of Primula sinensis (Primulaceae: structure comparison, sequence variation and evidence for accD transfer to nucleus

    Directory of Open Access Journals (Sweden)

    Tong-Jian Liu

    2016-06-01

    Full Text Available Species-rich genus Primula L. is a typical plant group with which to understand genetic variance between species in different levels of relationships. Chloroplast genome sequences are used to be the information resource for quantifying this difference and reconstructing evolutionary history. In this study, we reported the complete chloroplast genome sequence of Primula sinensis and compared it with other related species. This genome of chloroplast showed a typical circular quadripartite structure with 150,859 bp in sequence length consisting of 37.2% GC base. Two inverted repeated regions (25,535 bp were separated by a large single-copy region (82,064 bp and a small single-copy region (17,725 bp. The genome consists of 112 genes, including 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Among them, seven coding genes, seven tRNA genes and four rRNA genes have two copies due to their locations in the IR regions. The accD and infA genes lacking intact open reading frames (ORF were identified as pseudogenes. SSR and sequence variation analyses were also performed on the plastome of Primula sinensis, comparing with another available plastome of P. poissonii. The four most variable regions, rpl36–rps8, rps16–trnQ, trnH–psbA and ndhC–trnV, were identified. Phylogenetic relationship estimates using three sub-datasets extracted from a matrix of 57 protein-coding gene sequences showed the identical result that was consistent with previous studies. A transcript found from P. sinensis transcriptome showed a high similarity to plastid accD functional region and was identified as a putative plastid transit peptide at the N-terminal region. The result strongly suggested that plastid accD has been functionally transferred to the nucleus in P. sinensis.

  4. Not All Order Memory Is Equal: Test Demands Reveal Dissociations in Memory for Sequence Information

    Science.gov (United States)

    Jonker, Tanya R.; MacLeod, Colin M.

    2017-01-01

    Remembering the order of a sequence of events is a fundamental feature of episodic memory. Indeed, a number of formal models represent temporal context as part of the memory system, and memory for order has been researched extensively. Yet, the nature of the code(s) underlying sequence memory is still relatively unknown. Across 4 experiments that…

  5. Performance Tuning of x86 OpenMP Codes with MAQAO

    Science.gov (United States)

    Barthou, Denis; Charif Rubial, Andres; Jalby, William; Koliai, Souad; Valensi, Cédric

    Failing to find the best optimization sequence for a given application code can lead to compiler generated codes with poor performances or inappropriate code. It is necessary to analyze performances from the assembly generated code to improve over the compilation process. This paper presents a tool for the performance analysis of multithreaded codes (OpenMP programs support at the moment). MAQAO relies on static performance evaluation to identify compiler optimizations and assess performance of loops. It exploits static binary rewriting for reading and instrumenting object files or executables. Static binary instrumentation allows the insertion of probes at instruction level. Memory accesses can be captured to help tune the code, but such traces require to be compressed. MAQAO can analyze the results and provide hints for tuning the code. We show on some examples how this can help users improve their OpenMP applications.

  6. Selective encryption for H.264/AVC video coding

    Science.gov (United States)

    Shi, Tuo; King, Brian; Salama, Paul

    2006-02-01

    Due to the ease with which digital data can be manipulated and due to the ongoing advancements that have brought us closer to pervasive computing, the secure delivery of video and images has become a challenging problem. Despite the advantages and opportunities that digital video provide, illegal copying and distribution as well as plagiarism of digital audio, images, and video is still ongoing. In this paper we describe two techniques for securing H.264 coded video streams. The first technique, SEH264Algorithm1, groups the data into the following blocks of data: (1) a block that contains the sequence parameter set and the picture parameter set, (2) a block containing a compressed intra coded frame, (3) a block containing the slice header of a P slice, all the headers of the macroblock within the same P slice, and all the luma and chroma DC coefficients belonging to the all the macroblocks within the same slice, (4) a block containing all the ac coefficients, and (5) a block containing all the motion vectors. The first three are encrypted whereas the last two are not. The second method, SEH264Algorithm2, relies on the use of multiple slices per coded frame. The algorithm searches the compressed video sequence for start codes (0x000001) and then encrypts the next N bits of data.

  7. Draft Genome Sequence of Cupriavidus pauculus Strain KF709, a Biphenyl-Utilizing Bacterium Isolated from Biphenyl-Contaminated Soil.

    Science.gov (United States)

    Watanabe, Takahito; Yamazoe, Atsushi; Hosoyama, Akira; Fujihara, Hidehiko; Suenaga, Hikaru; Hirose, Jun; Futagami, Taiki; Goto, Masatoshi; Kimura, Nobutada; Furukawa, Kensuke

    2015-03-26

    We report the draft genome sequence of Cupriavidus pauculus strain KF709, which comprises 6,826,799 bp with 6,272 coding sequences. The strain KF709 utilizes biphenyl and degrades low-chlorinated biphenyls; however, it possesses fewer coding sequences involved in the degradation of aromatic compounds than other strains belonging to the Betaproteobacteria. Copyright © 2015 Watanabe et al.

  8. Selection, Recombination and History in a Parasitic Flatworm (Echinococcus Inferred from Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Haag KL

    1998-01-01

    Full Text Available Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli and four strains of E. granulosus (cattle, horse, pig and sheep strains were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination parameters suggested that cross-fertilisation was rare in the history of the group. However, the relative rates of substitution in the coding sequences showed that positive selection (instead of purifying selection drove the evolution of an elastase and neutrophil chemotaxis inhibitor gene (AgB/1. The phylogenetic analyses revealed several ambiguities, indicating that the taxonomic status of the E. granulosus horse strain should be revised

  9. Conservation patterns in different functional sequence categoriesof divergent Drosophila species

    Energy Technology Data Exchange (ETDEWEB)

    Papatsenko, Dmitri; Kislyuk, Andrey; Levine, Michael; Dubchak, Inna

    2005-10-01

    We have explored the distributions of fully conservedungapped blocks in genome-wide pairwise alignments of recently completedspecies of Drosophila: D.yakuba, D.ananassae, D.pseudoobscura, D.virilisand D.mojavensis. Based on these distributions we have found that nearlyevery functional sequence category possesses its own distinctiveconservation pattern, sometimes independent of the overall sequenceconservation level. In the coding and regulatory regions, the ungappedblocks were longer than in introns, UTRs and non-functional sequences. Atthe same time, the blocks in the coding regions carried 3N+2 signaturecharacteristic to synonymic substitutions in the 3rd codon positions.Larger block sizes in transcription regulatory regions can be explainedby the presence of conserved arrays of binding sites for transcriptionfactors. We also have shown that the longest ungapped blocks, or'ultraconserved' sequences, are associated with specific gene groups,including those encoding ion channels and components of the cytoskeleton.We discussed how restrained conservation patterns may help in mappingfunctional sequence categories and improving genomeannotation.

  10. Comprehensive search for intra- and inter-specific sequence polymorphisms among coding envelope genes of retroviral origin found in the human genome: genes and pseudogenes

    Directory of Open Access Journals (Sweden)

    Vasilescu Alexandre

    2005-09-01

    Full Text Available Abstract Background The human genome carries a high load of proviral-like sequences, called Human Endogenous Retroviruses (HERVs, which are the genomic traces of ancient infections by active retroviruses. These elements are in most cases defective, but open reading frames can still be found for the retroviral envelope gene, with sixteen such genes identified so far. Several of them are conserved during primate evolution, having possibly been co-opted by their host for a physiological role. Results To characterize further their status, we presently sequenced 12 of these genes from a panel of 91 Caucasian individuals. Genomic analyses reveal strong sequence conservation (only two non synonymous Single Nucleotide Polymorphisms [SNPs] for the two HERV-W and HERV-FRD envelope genes, i.e. for the two genes specifically expressed in the placenta and possibly involved in syncytiotrophoblast formation. We further show – using an ex vivo fusion assay for each allelic form – that none of these SNPs impairs the fusogenic function. The other envelope proteins disclose variable polymorphisms, with the occurrence of a stop codon and/or frameshift for most – but not all – of them. Moreover, the sequence conservation analysis of the orthologous genes that can be found in primates shows that three env genes have been maintained in a fully coding state throughout evolution including envW and envFRD. Conclusion Altogether, the present study strongly suggests that some but not all envelope encoding sequences are bona fide genes. It also provides new tools to elucidate the possible role of endogenous envelope proteins as susceptibility factors in a number of pathologies where HERVs have been suspected to be involved.

  11. Screening and Identification of putative long non coding RNAs from transcriptome data of a high yielding blackgram (Vigna mungo, Cv. T9

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar Singh

    2018-04-01

    Full Text Available Blackgram (Vigna mungo is one of primary legumes cultivated throughout India, Cv.T9 being one of its common high yielding cultivar. This article reports RNA sequencing data and a pipeline for prediction of novel long non-coding RNAs from the sequenced data. The raw data generated during sequencing are available at Sequence Read Archive (SRA of NCBI with accession number- SRX1558530 Keywords: Blackgram, Long non-coding RNA, Legumes, RNA sequencing data

  12. TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements.

    Directory of Open Access Journals (Sweden)

    Kamila Maliszewska-Olejniczak

    2015-07-01

    Full Text Available Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs. Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium

  13. Analysis of mutations in the entire coding sequence of the factor VIII gene

    Energy Technology Data Exchange (ETDEWEB)

    Bidichadani, S.I.; Lanyon, W.G.; Connor, J.M. [Glascow Univ. (United Kingdom)] [and others

    1994-09-01

    Hemophilia A is a common X-linked recessive disorder of bleeding caused by deleterious mutations in the gene for clotting factor VIII. The large size of the factor VIII gene, the high frequency of de novo mutations and its tissue-specific expression complicate the detection of mutations. We have used a combination of RT-PCR of ectopic factor VIII transcripts and genomic DNA-PCRs to amplify the entire essential sequence of the factor VIII gene. This is followed by chemical mismatch cleavage analysis and direct sequencing in order to facilitate a comprehensive search for mutations. We describe the characterization of nine potentially pathogenic mutations, six of which are novel. In each case, a correlation of the genotype with the observed phenotype is presented. In order to evaluate the pathogenicity of the five missense mutations detected, we have analyzed them for evolutionary sequence conservation and for their involvement of sequence motifs catalogued in the PROSITE database of protein sites and patterns.

  14. User Instructions for the CiderF Individual Dose Code and Associated Utility Codes

    Energy Technology Data Exchange (ETDEWEB)

    Eslinger, Paul W.; Napier, Bruce A.

    2013-08-30

    Hanford modeling sequence. First, the air transport code HYSPLIT (Draxler et al. 2012) is used instead of the RATCHET code. Second, the new individual dose code CiderF replaces the older CIDER code and five auxiliary codes.

  15. Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A

    2011-01-01

    We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.

  16. APOBEC3DE Inhibits LINE-1 Retrotransposition by Interacting with ORF1p and Influencing LINE Reverse Transcriptase Activity.

    Directory of Open Access Journals (Sweden)

    Weizi Liang

    Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.

  17. Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23

    International Nuclear Information System (INIS)

    Ghaffari, S.H.; Olson, M.O.J.

    1986-01-01

    Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved

  18. Perceptual coding of stereo endoscopy video for minimally invasive surgery

    Science.gov (United States)

    Bartoli, Guido; Menegaz, Gloria; Yang, Guang Zhong

    2007-03-01

    In this paper, we propose a compression scheme that is tailored for stereo-laparoscope sequences. The inter-frame correlation is modeled by the deformation field obtained by elastic registration between two subsequent frames and exploited for prediction of the left sequence. The right sequence is lossy encoded by prediction from the corresponding left images. Wavelet-based coding is applied to both the deformation vector fields and residual images. The resulting system supports spatio temporal scalability, while providing lossless performance. The implementation of the wavelet transform by integer lifting ensures a low computational complexity, thus reducing the required run-time memory allocation and on line implementation. Extensive psychovisual tests were performed for system validation and characterization with respect to the MPEG4 standard for video coding. Results are very encouraging: the PSVC system features the functionalities making it suitable for PACS while providing a good trade-off between usability and performance in lossy mode.

  19. Hidden Structural Codes in Protein Intrinsic Disorder.

    Science.gov (United States)

    Borkosky, Silvia S; Camporeale, Gabriela; Chemes, Lucía B; Risso, Marikena; Noval, María Gabriela; Sánchez, Ignacio E; Alonso, Leonardo G; de Prat Gay, Gonzalo

    2017-10-17

    Intrinsic disorder is a major structural category in biology, accounting for more than 30% of coding regions across the domains of life, yet consists of conformational ensembles in equilibrium, a major challenge in protein chemistry. Anciently evolved papillomavirus genomes constitute an unparalleled case for sequence to structure-function correlation in cases in which there are no folded structures. E7, the major transforming oncoprotein of human papillomaviruses, is a paradigmatic example among the intrinsically disordered proteins. Analysis of a large number of sequences of the same viral protein allowed for the identification of a handful of residues with absolute conservation, scattered along the sequence of its N-terminal intrinsically disordered domain, which intriguingly are mostly leucine residues. Mutation of these led to a pronounced increase in both α-helix and β-sheet structural content, reflected by drastic effects on equilibrium propensities and oligomerization kinetics, and uncovers the existence of local structural elements that oppose canonical folding. These folding relays suggest the existence of yet undefined hidden structural codes behind intrinsic disorder in this model protein. Thus, evolution pinpoints conformational hot spots that could have not been identified by direct experimental methods for analyzing or perturbing the equilibrium of an intrinsically disordered protein ensemble.

  20. Improved entropy encoding for high efficient video coding standard

    Directory of Open Access Journals (Sweden)

    B.S. Sunil Kumar

    2018-03-01

    Full Text Available The High Efficiency Video Coding (HEVC has better coding efficiency, but the encoding performance has to be improved to meet the growing multimedia applications. This paper improves the standard entropy encoding by introducing the optimized weighing parameters, so that higher rate of compression can be accomplished over the standard entropy encoding. The optimization is performed using the recently introduced firefly algorithm. The experimentation is carried out using eight benchmark video sequences and the PSNR for varying rate of data transmission is investigated. Comparative analysis based on the performance statistics is made with the standard entropy encoding. From the obtained results, it is clear that the originality of the decoded video sequence is preserved far better than the proposed method, though the compression rate is increased. Keywords: Entropy, Encoding, HEVC, PSNR, Compression

  1. Sense-antisense (complementary) peptide interactions and the proteomic code; potential opportunities in biology and pharmaceutical science.

    Science.gov (United States)

    Miller, Andrew D

    2015-02-01

    A sense peptide can be defined as a peptide whose sequence is coded by the nucleotide sequence (read 5' → 3') of the sense (positive) strand of DNA. Conversely, an antisense (complementary) peptide is coded by the corresponding nucleotide sequence (read 5' → 3') of the antisense (negative) strand of DNA. Research has been accumulating steadily to suggest that sense peptides are capable of specific interactions with their corresponding antisense peptides. Unfortunately, although more and more examples of specific sense-antisense peptide interactions are emerging, the very idea of such interactions does not conform to standard biology dogma and so there remains a sizeable challenge to lift this concept from being perceived as a peripheral phenomenon if not worse, into becoming part of the scientific mainstream. Specific interactions have now been exploited for the inhibition of number of widely different protein-protein and protein-receptor interactions in vitro and in vivo. Further, antisense peptides have also been used to induce the production of antibodies targeted to specific receptors or else the production of anti-idiotypic antibodies targeted against auto-antibodies. Such illustrations of utility would seem to suggest that observed sense-antisense peptide interactions are not just the consequence of a sequence of coincidental 'lucky-hits'. Indeed, at the very least, one might conclude that sense-antisense peptide interactions represent a potentially new and different source of leads for drug discovery. But could there be more to come from studies in this area? Studies on the potential mechanism of sense-antisense peptide interactions suggest that interactions may be driven by amino acid residue interactions specified from the genetic code. If so, such specified amino acid residue interactions could form the basis for an even wider amino acid residue interaction code (proteomic code) that links gene sequences to actual protein structure and function, even

  2. SequenceCEROSENE: a computational method and web server to visualize spatial residue neighborhoods at the sequence level.

    Science.gov (United States)

    Heinke, Florian; Bittrich, Sebastian; Kaiser, Florian; Labudde, Dirk

    2016-01-01

    To understand the molecular function of biopolymers, studying their structural characteristics is of central importance. Graphics programs are often utilized to conceive these properties, but with the increasing number of available structures in databases or structure models produced by automated modeling frameworks this process requires assistance from tools that allow automated structure visualization. In this paper a web server and its underlying method for generating graphical sequence representations of molecular structures is presented. The method, called SequenceCEROSENE (color encoding of residues obtained by spatial neighborhood embedding), retrieves the sequence of each amino acid or nucleotide chain in a given structure and produces a color coding for each residue based on three-dimensional structure information. From this, color-highlighted sequences are obtained, where residue coloring represent three-dimensional residue locations in the structure. This color encoding thus provides a one-dimensional representation, from which spatial interactions, proximity and relations between residues or entire chains can be deduced quickly and solely from color similarity. Furthermore, additional heteroatoms and chemical compounds bound to the structure, like ligands or coenzymes, are processed and reported as well. To provide free access to SequenceCEROSENE, a web server has been implemented that allows generating color codings for structures deposited in the Protein Data Bank or structure models uploaded by the user. Besides retrieving visualizations in popular graphic formats, underlying raw data can be downloaded as well. In addition, the server provides user interactivity with generated visualizations and the three-dimensional structure in question. Color encoded sequences generated by SequenceCEROSENE can aid to quickly perceive the general characteristics of a structure of interest (or entire sets of complexes), thus supporting the researcher in the initial

  3. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    International Nuclear Information System (INIS)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

    2015-01-01

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

  4. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)

    2015-10-23

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

  5. Locating protein-coding sequences under selection for additional, overlapping functions in 29 mammalian genomes

    DEFF Research Database (Denmark)

    Lin, Michael F; Kheradpour, Pouya; Washietl, Stefan

    2011-01-01

    conservation compared to typical protein-coding genes—especially at synonymous sites. In this study, we use genome alignments of 29 placental mammals to systematically locate short regions within human ORFs that show conspicuously low estimated rates of synonymous substitution across these species. The 29......-species alignment provides statistical power to locate more than 10,000 such regions with resolution down to nine-codon windows, which are found within more than a quarter of all human protein-coding genes and contain ~2% of their synonymous sites. We collect numerous lines of evidence that the observed...... synonymous constraint in these regions reflects selection on overlapping functional elements including splicing regulatory elements, dual-coding genes, RNA secondary structures, microRNA target sites, and developmental enhancers. Our results show that overlapping functional elements are common in mammalian...

  6. Adaptive format conversion for scalable video coding

    Science.gov (United States)

    Wan, Wade K.; Lim, Jae S.

    2001-12-01

    The enhancement layer in many scalable coding algorithms is composed of residual coding information. There is another type of information that can be transmitted instead of (or in addition to) residual coding. Since the encoder has access to the original sequence, it can utilize adaptive format conversion (AFC) to generate the enhancement layer and transmit the different format conversion methods as enhancement data. This paper investigates the use of adaptive format conversion information as enhancement data in scalable video coding. Experimental results are shown for a wide range of base layer qualities and enhancement bitrates to determine when AFC can improve video scalability. Since the parameters needed for AFC are small compared to residual coding, AFC can provide video scalability at low enhancement layer bitrates that are not possible with residual coding. In addition, AFC can also be used in addition to residual coding to improve video scalability at higher enhancement layer bitrates. Adaptive format conversion has not been studied in detail, but many scalable applications may benefit from it. An example of an application that AFC is well-suited for is the migration path for digital television where AFC can provide immediate video scalability as well as assist future migrations.

  7. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    Science.gov (United States)

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  8. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  9. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

    Science.gov (United States)

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

    2017-02-01

    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  10. Application and analysis of performance of dqpsk advanced modulation format in spectral amplitude coding ocdma

    International Nuclear Information System (INIS)

    Memon, A.

    2015-01-01

    SAC (Spectral Amplitude Coding) is a technique of OCDMA (Optical Code Division Multiple Access) to encode and decode data bits by utilizing spectral components of the broadband source. Usually OOK (ON-Off-Keying) modulation format is used in this encoding scheme. To make SAC OCDMA network spectrally efficient, advanced modulation format of DQPSK (Differential Quaternary Phase Shift Keying) is applied, simulated and analyzed, m-sequence code is encoded in the simulated setup. Performance regarding various lengths of m-sequence code is also analyzed and displayed in the pictorial form. The results of the simulation are evaluated with the help of electrical constellation diagram, eye diagram and bit error rate graph. All the graphs indicate better transmission quality in case of advanced modulation format of DQPSK used in SAC OCDMA network as compared with OOK. (author)

  11. A second chance for telomerase reverse transcriptase in anticancer immunotherapy.

    Science.gov (United States)

    Zanetti, Maurizio

    2017-02-01

    Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.

  12. Complexity control algorithm based on adaptive mode selection for interframe coding in high efficiency video coding

    Science.gov (United States)

    Chen, Gang; Yang, Bing; Zhang, Xiaoyun; Gao, Zhiyong

    2017-07-01

    The latest high efficiency video coding (HEVC) standard significantly increases the encoding complexity for improving its coding efficiency. Due to the limited computational capability of handheld devices, complexity constrained video coding has drawn great attention in recent years. A complexity control algorithm based on adaptive mode selection is proposed for interframe coding in HEVC. Considering the direct proportionality between encoding time and computational complexity, the computational complexity is measured in terms of encoding time. First, complexity is mapped to a target in terms of prediction modes. Then, an adaptive mode selection algorithm is proposed for the mode decision process. Specifically, the optimal mode combination scheme that is chosen through offline statistics is developed at low complexity. If the complexity budget has not been used up, an adaptive mode sorting method is employed to further improve coding efficiency. The experimental results show that the proposed algorithm achieves a very large complexity control range (as low as 10%) for the HEVC encoder while maintaining good rate-distortion performance. For the lowdelayP condition, compared with the direct resource allocation method and the state-of-the-art method, an average gain of 0.63 and 0.17 dB in BDPSNR is observed for 18 sequences when the target complexity is around 40%.

  13. Applications of statistical physics and information theory to the analysis of DNA sequences

    Science.gov (United States)

    Grosse, Ivo

    2000-10-01

    DNA carries the genetic information of most living organisms, and the of genome projects is to uncover that genetic information. One basic task in the analysis of DNA sequences is the recognition of protein coding genes. Powerful computer programs for gene recognition have been developed, but most of them are based on statistical patterns that vary from species to species. In this thesis I address the question if there exist universal statistical patterns that are different in coding and noncoding DNA of all living species, regardless of their phylogenetic origin. In search for such species-independent patterns I study the mutual information function of genomic DNA sequences, and find that it shows persistent period-three oscillations. To understand the biological origin of the observed period-three oscillations, I compare the mutual information function of genomic DNA sequences to the mutual information function of stochastic model sequences. I find that the pseudo-exon model is able to reproduce the mutual information function of genomic DNA sequences. Moreover, I find that a generalization of the pseudo-exon model can connect the existence and the functional form of long-range correlations to the presence and the length distributions of coding and noncoding regions. Based on these theoretical studies I am able to find an information-theoretical quantity, the average mutual information (AMI), whose probability distributions are significantly different in coding and noncoding DNA, while they are almost identical in all studied species. These findings show that there exist universal statistical patterns that are different in coding and noncoding DNA of all studied species, and they suggest that the AMI may be used to identify genes in different living species, irrespective of their taxonomic origin.

  14. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  15. Clinical evaluation of coded excitation in medical ultrasound

    DEFF Research Database (Denmark)

    Pedersen, Morten Høgholm; Misaridis, Thanssis; Jensen, Jørgen Arendt

    2003-01-01

    -K Medical model 3535) with transmitter and receiver boards developed in our group and a mechanical 4 MHz transducer were used. The system acquired coded and conventional US image frames interleaved, yielding identical acquisitions with the two techniques. Cine-loop sequences were evaluated by three...

  16. Complete Genome Sequence of the Human Gut Symbiont Roseburia hominis

    DEFF Research Database (Denmark)

    Travis, Anthony J.; Kelly, Denise; Flint, Harry J

    2015-01-01

    We report here the complete genome sequence of the human gut symbiont Roseburia hominis A2-183(T) (= DSM 16839(T) = NCIMB 14029(T)), isolated from human feces. The genome is represented by a 3,592,125-bp chromosome with 3,405 coding sequences. A number of potential functions contributing to host...

  17. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor

    International Nuclear Information System (INIS)

    Antalis, T.M.; Clark, M.A.; Barnes, T.; Lehrbach, P.R.; Devine, P.L.; Schevzov, G.; Goss, N.H.; Stephens, R.W.; Tolstoshev, P.

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A) + RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the λ P/sub L/ promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated M/sub r/ of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators

  18. Identification and chromosomal distribution of copia-like retrotransposon sequences in the coffee (Coffea L. genome

    Directory of Open Access Journals (Sweden)

    Juan-Carlos Herrera

    2013-12-01

    Full Text Available The presence of copia-like transposable elements in seven coffee (Coffea sp. species, including the cultivated Coffea arabica, was investigated. The highly conserved domains of the reverse transcriptase (RT present in the copia retrotransposons were amplified by PCR using degenerated primers. Fragments of roughly 300 bp were obtained and the nucleotide sequence was determined for 36 clones, 19 of which showed good quality. The deduced amino acid sequences were compared by multiple alignment analysis. The data suggested two distinct coffee RT groups, designated as CRTG1 and CRTG2. The sequence identities among the groups ranged from 52 to 60% for CRTG1 and 74 to 85% for CRTG2. The multiple alignment analysis revealed that some of the clones in CRTG1 were closely related to the representative elements present in other plant species such as Brassica napus, Populus ciliata and Picea abis. Furthermore, the chromosomal localization of the RT domains in C. arabica and their putative ancestors was investigated by fluorescence in situ hybridization (FISH analysis. FISH signals were observed throughout the chromosomes following a similar dispersed pattern with some localized regions exhibiting higher concentrations of those elements, providing new evidence of their relative conservation and stability in the coffee genome

  19. Single stock dynamics on high-frequency data: from a compressed coding perspective.

    Directory of Open Access Journals (Sweden)

    Hsieh Fushing

    Full Text Available High-frequency return, trading volume and transaction number are digitally coded via a nonparametric computing algorithm, called hierarchical factor segmentation (HFS, and then are coupled together to reveal a single stock dynamics without global state-space structural assumptions. The base-8 digital coding sequence, which is capable of revealing contrasting aggregation against sparsity of extreme events, is further compressed into a shortened sequence of state transitions. This compressed digital code sequence vividly demonstrates that the aggregation of large absolute returns is the primary driving force for stimulating both the aggregations of large trading volumes and transaction numbers. The state of system-wise synchrony is manifested with very frequent recurrence in the stock dynamics. And this data-driven dynamic mechanism is seen to correspondingly vary as the global market transiting in and out of contraction-expansion cycles. These results not only elaborate the stock dynamics of interest to a fuller extent, but also contradict some classical theories in finance. Overall this version of stock dynamics is potentially more coherent and realistic, especially when the current financial market is increasingly powered by high-frequency trading via computer algorithms, rather than by individual investors.

  20. Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

    International Nuclear Information System (INIS)

    Zhu Hanneng; Chen Wenying; Xiong Sidong

    2000-01-01

    Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

  1. Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report

    Directory of Open Access Journals (Sweden)

    Lapadula Giuseppe

    2007-05-01

    Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.

  2. Spliced RNA of woodchuck hepatitis virus.

    Science.gov (United States)

    Ogston, C W; Razman, D G

    1992-07-01

    Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.

  3. Interface requirements for coupling a containment code to a reactor system thermal hydraulic codes

    International Nuclear Information System (INIS)

    Baratta, A.J.

    1997-01-01

    To perform a complete analysis of a reactor transient, not only the primary system response but the containment response must also be accounted for. Such transients and accidents as a loss of coolant accident in both pressurized water and boiling water reactors and inadvertent operation of safety relief valves all challenge the containment and may influence flows because of containment feedback. More recently, the advanced reactor designs put forth by General Electric and Westinghouse in the US and by Framatome and Seimens in Europe rely on the containment to act as the ultimate heat sink. Techniques used by analysts and engineers to analyze the interaction of the containment and the primary system were usually iterative in nature. Codes such as RELAP or RETRAN were used to analyze the primary system response and CONTAIN or CONTEMPT the containment response. The analysis was performed by first running the system code and representing the containment as a fixed pressure boundary condition. The flows were usually from the primary system to the containment initially and generally under choked conditions. Once the mass flows and timing are determined from the system codes, these conditions were input into the containment code. The resulting pressures and temperatures were then calculated and the containment performance analyzed. The disadvantage of this approach becomes evident when one performs an analysis of a rapid depressurization or a long term accident sequence in which feedback from the containment can occur. For example, in a BWR main steam line break transient, the containment heats up and becomes a source of energy for the primary system. Recent advances in programming and computer technology are available to provide an alternative approach. The author and other researchers have developed linkage codes capable of transferring data between codes at each time step allowing discrete codes to be coupled together

  4. Interface requirements for coupling a containment code to a reactor system thermal hydraulic codes

    Energy Technology Data Exchange (ETDEWEB)

    Baratta, A.J.

    1997-07-01

    To perform a complete analysis of a reactor transient, not only the primary system response but the containment response must also be accounted for. Such transients and accidents as a loss of coolant accident in both pressurized water and boiling water reactors and inadvertent operation of safety relief valves all challenge the containment and may influence flows because of containment feedback. More recently, the advanced reactor designs put forth by General Electric and Westinghouse in the US and by Framatome and Seimens in Europe rely on the containment to act as the ultimate heat sink. Techniques used by analysts and engineers to analyze the interaction of the containment and the primary system were usually iterative in nature. Codes such as RELAP or RETRAN were used to analyze the primary system response and CONTAIN or CONTEMPT the containment response. The analysis was performed by first running the system code and representing the containment as a fixed pressure boundary condition. The flows were usually from the primary system to the containment initially and generally under choked conditions. Once the mass flows and timing are determined from the system codes, these conditions were input into the containment code. The resulting pressures and temperatures were then calculated and the containment performance analyzed. The disadvantage of this approach becomes evident when one performs an analysis of a rapid depressurization or a long term accident sequence in which feedback from the containment can occur. For example, in a BWR main steam line break transient, the containment heats up and becomes a source of energy for the primary system. Recent advances in programming and computer technology are available to provide an alternative approach. The author and other researchers have developed linkage codes capable of transferring data between codes at each time step allowing discrete codes to be coupled together.

  5. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    Science.gov (United States)

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  6. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  7. Computationally Efficient Chaotic Spreading Sequence Selection for Asynchronous DS-CDMA

    Directory of Open Access Journals (Sweden)

    Litviņenko Anna

    2017-12-01

    Full Text Available The choice of the spreading sequence for asynchronous direct-sequence code-division multiple-access (DS-CDMA systems plays a crucial role for the mitigation of multiple-access interference. Considering the rich dynamics of chaotic sequences, their use for spreading allows overcoming the limitations of the classical spreading sequences. However, to ensure low cross-correlation between the sequences, careful selection must be performed. This paper presents a novel exhaustive search algorithm, which allows finding sets of chaotic spreading sequences of required length with a particularly low mutual cross-correlation. The efficiency of the search is verified by simulations, which show a significant advantage compared to non-selected chaotic sequences. Moreover, the impact of sequence length on the efficiency of the selection is studied.

  8. MASTR: multiple alignment and structure prediction of non-coding RNAs using simulated annealing

    DEFF Research Database (Denmark)

    Lindgreen, Stinus; Gardner, Paul P; Krogh, Anders

    2007-01-01

    function that considers sequence conservation, covariation and basepairing probabilities. The results show that the method is very competitive to similar programs available today, both in terms of accuracy and computational efficiency. AVAILABILITY: Source code available from http://mastr.binf.ku.dk/......MOTIVATION: As more non-coding RNAs are discovered, the importance of methods for RNA analysis increases. Since the structure of ncRNA is intimately tied to the function of the molecule, programs for RNA structure prediction are necessary tools in this growing field of research. Furthermore......, it is known that RNA structure is often evolutionarily more conserved than sequence. However, few existing methods are capable of simultaneously considering multiple sequence alignment and structure prediction. RESULT: We present a novel solution to the problem of simultaneous structure prediction...

  9. Gray Code for Cayley Permutations

    Directory of Open Access Journals (Sweden)

    J.-L. Baril

    2003-10-01

    Full Text Available A length-n Cayley permutation p of a total ordered set S is a length-n sequence of elements from S, subject to the condition that if an element x appears in p then all elements y < x also appear in p . In this paper, we give a Gray code list for the set of length-n Cayley permutations. Two successive permutations in this list differ at most in two positions.

  10. Design and performance analysis for several new classes of codes for optical synchronous CDMA and for arbitrary-medium time-hopping synchronous CDMA communication systems

    Science.gov (United States)

    Kostic, Zoran; Titlebaum, Edward L.

    1994-08-01

    New families of spread-spectrum codes are constructed, that are applicable to optical synchronous code-division multiple-access (CDMA) communications as well as to arbitrary-medium time-hopping synchronous CDMA communications. Proposed constructions are based on the mappings from integer sequences into binary sequences. We use the concept of number theoretic quadratic congruences and a subset of Reed-Solomon codes similar to the one utilized in the Welch-Costas frequency-hop (FH) patterns. The properties of the codes are as good as or better than the properties of existing codes for synchronous CDMA communications: Both the number of code-sequences within a single code family and the number of code families with good properties are significantly increased when compared to the known code designs. Possible applications are presented. To evaluate the performance of the proposed codes, a new class of hit arrays called cyclical hit arrays is recalled, which give insight into the previously unknown properties of the few classes of number theoretic FH patterns. Cyclical hit arrays and the proposed mappings are used to determine the exact probability distribution functions of random variables that represent interference between users of a time-hopping or optical CDMA system. Expressions for the bit error probability in multi-user CDMA systems are derived as a function of the number of simultaneous CDMA system users, the length of signature sequences and the threshold of a matched filter detector. The performance results are compared with the results for some previously known codes.

  11. Application and Analysis of Performance of DQPSK Advanced Modulation Format in Spectral Amplitude Coding OCDMA

    Directory of Open Access Journals (Sweden)

    Abdul Latif Memon

    2014-04-01

    Full Text Available SAC (Spectral Amplitude Coding is a technique of OCDMA (Optical Code Division Multiple Access to encode and decode data bits by utilizing spectral components of the broadband source. Usually OOK (ON-Off-Keying modulation format is used in this encoding scheme. To make SAC OCDMA network spectrally efficient, advanced modulation format of DQPSK (Differential Quaternary Phase Shift Keying is applied, simulated and analyzed. m-sequence code is encoded in the simulated setup. Performance regarding various lengths of m-sequence code is also analyzed and displayed in the pictorial form. The results of the simulation are evaluated with the help of electrical constellation diagram, eye diagram and bit error rate graph. All the graphs indicate better transmission quality in case of advanced modulation format of DQPSK used in SAC OCDMA network as compared with OOK

  12. Properties of an Arithmetic Code for Geodesic Flows

    International Nuclear Information System (INIS)

    Chaves, Daniel P B; Palazzo, Reginaldo Jr; Rios Leite, Jose R

    2011-01-01

    Topological analysis of chaotic dynamical systems emerged in the nineties as a powerful tool in the study of strange attractors in low-dimensional dynamical systems. It is based on identifying the stretching and squeezing mechanisms responsible for creating a strange attractor and organize all the unstable periodic orbits in this attractor. This method is concerned with the manifold generated by the chaotic system. Furthermore, as a mathematical object, the manifolds have a well studied geometric and algebraic structure, particularly for the case of compact surfaces. Intending to use this structure in the analysis and application of chaotic systems through their topological characteristics, we determine properties of geodesic codes for compact surfaces necessary for the construction of encoders from the symbolic sequences of experimental data generated by the unstable periodic orbits of the strange attractor (related to the behavior changes of the system with the variation of control parameters) to the geodesic code sequences, which permits to use the surface structure to study the system orbits.

  13. The structural analysis of protein sequences based on the quasi-amino acids code

    International Nuclear Information System (INIS)

    Ping, Zhu; Xu-Qing, Tang; Zhen-Yuan, Xu

    2009-01-01

    Proteomics is the study of proteins and their interactions in a cell. With the successful completion of the Human Genome Project, it comes the postgenome era when the proteomics technology is emerging. This paper studies protein molecule from the algebraic point of view. The algebraic system (Σ, +, *) is introduced, where Σ is the set of 64 codons. According to the characteristics of (Σ, +, *), a novel quasi-amino acids code classification method is introduced and the corresponding algebraic operation table over the set ZU of the 16 kinds of quasi-amino acids is established. The internal relation is revealed about quasi-amino acids. The results show that there exist some very close correlations between the properties of the quasi-amino acids and the codon. All these correlation relationships may play an important part in establishing the logic relationship between codons and the quasi-amino acids during the course of life origination. According to Ma F et al (2003 J. Anhui Agricultural University 30 439), the corresponding relation and the excellent properties about amino acids code are very difficult to observe. The present paper shows that (ZU, ⊕, ) is a field. Furthermore, the operational results display that the codon tga has different property from other stop codons. In fact, in the mitochondrion from human and ox genomic codon, tga is just tryptophane, is not the stop codon like in other genetic code, it is the case of the Chen W C et al (2002 Acta Biophysica Sinica 18(1) 87). The present theory avoids some inexplicable events of the 20 kinds of amino acids code, in other words it solves the problem of 'the 64 codon assignments of mRNA to amino acids is probably completely wrong' proposed by Yang (2006 Progress in Modern Biomedicine 6 3). (cross-disciplinary physics and related areas of science and technology)

  14. Modeling of severe accident sequences with the new modules CESAR and DIVA of ASTEC system code

    International Nuclear Information System (INIS)

    Pignet, Sophie; Guillard, Gaetan; Barre, Francois; Repetto, Georges

    2003-01-01

    Systems of computer codes, so-called 'integral' codes, are being developed to simulate the scenario of a hypothetical severe accident in a light water reactor, from the initial event until the possible radiological release of fission products out of the containment. They couple the predominant physical phenomena that occur in the different reactor zones and simulate the actuation of safety systems by procedures and by operators. In order to allow to study a great number of scenarios, a compromise must be found between precision of results and calculation time: one day of accident time should take less than one day of real time to simulate on a PC computer. This search of compromise is a real challenge for such integral codes. The development of the ASTEC integral code was initiated jointly by IRSN and GRS as an international reference code. The latest version 1.0 of ASTEC, including the new modules CESAR and DIVA which model the behaviour of the reactor cooling system and the core degradation, is presented here. Validation of the modules and one plant application are described

  15. Performance Analysis of New Binary User Codes for DS-CDMA Communication

    Science.gov (United States)

    Usha, Kamle; Jaya Sankar, Kottareddygari

    2016-03-01

    This paper analyzes new binary spreading codes through correlation properties and also presents their performance over additive white Gaussian noise (AWGN) channel. The proposed codes are constructed using gray and inverse gray codes. In this paper, a n-bit gray code appended by its n-bit inverse gray code to construct the 2n-length binary user codes are discussed. Like Walsh codes, these binary user codes are available in sizes of power of two and additionally code sets of length 6 and their even multiples are also available. The simple construction technique and generation of code sets of different sizes are the salient features of the proposed codes. Walsh codes and gold codes are considered for comparison in this paper as these are popularly used for synchronous and asynchronous multi user communications respectively. In the current work the auto and cross correlation properties of the proposed codes are compared with those of Walsh codes and gold codes. Performance of the proposed binary user codes for both synchronous and asynchronous direct sequence CDMA communication over AWGN channel is also discussed in this paper. The proposed binary user codes are found to be suitable for both synchronous and asynchronous DS-CDMA communication.

  16. Coding Across Multicodes and Time in CDMA Systems Employing MMSE Multiuser Detector

    Directory of Open Access Journals (Sweden)

    Park Jeongsoon

    2004-01-01

    Full Text Available When combining a multicode CDMA system with convolutional coding, two methods have been considered in the literature. In one method, coding is across time in each multicode channel while in the other the coding is across both multicodes and time. In this paper, a performance/complexity analysis of decoding metrics and trellis structures for the two schemes is carried out. It is shown that the latter scheme can exploit the multicode diversity inherent in convolutionally coded direct sequence code division multiple access (DS-CDMA systems which employ minimum mean squared error (MMSE multiuser detectors. In particular, when the MMSE detector provides sufficiently different signal-to-interference ratios (SIRs for the multicode channels, coding across multicodes and time can obtain significant performance gain over coding across time, with nearly the same decoding complexity.

  17. Endogenous reverse transcriptase (RT) activity and Chromatin remodeling in normal and transformed cells and early embryos

    International Nuclear Information System (INIS)

    Spadafora, C.; Sciamanna, I.; Misteli, T.

    2009-01-01

    Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma

  18. Decomposing the (seafood vs. meat) evening meal decision-making sequence

    DEFF Research Database (Denmark)

    Perrea, Toula; Brunsø, Karen; Altintzoglou, Themistoklis

    2012-01-01

    as the content of the family’s daily food (i.e. seafood and meat-related) decision-making process. Design/methodology/approach – Twenty-four families in Denmark, Norway and Iceland were asked to fill in a one-to-two-week semi-structured diary regarding any thoughts they had about the decision-making sequence...... regarding their evening meals. Data were analysed by means of content analysis so as to gain insight into the main themes and distinctive patterns with respect to the four stages of the decision-making sequence by identifying a number of codes and sub-codes of high and lower abstraction level. Findings...... – The main results were similar across the three countries. Planning was the most important phase of the evening meal decision-making sequence, where Nordic respondents considered practical issues, and engaged in a more rational type of thinking, allowing cognitive aspects to prevail at this particular stage...

  19. Complete genome sequencing of the luminescent bacterium, Vibrio qinghaiensis sp. Q67 using PacBio technology

    Science.gov (United States)

    Gong, Liang; Wu, Yu; Jian, Qijie; Yin, Chunxiao; Li, Taotao; Gupta, Vijai Kumar; Duan, Xuewu; Jiang, Yueming

    2018-01-01

    Vibrio qinghaiensis sp.-Q67 (Vqin-Q67) is a freshwater luminescent bacterium that continuously emits blue-green light (485 nm). The bacterium has been widely used for detecting toxic contaminants. Here, we report the complete genome sequence of Vqin-Q67, obtained using third-generation PacBio sequencing technology. Continuous long reads were attained from three PacBio sequencing runs and reads >500 bp with a quality value of >0.75 were merged together into a single dataset. This resultant highly-contiguous de novo assembly has no genome gaps, and comprises two chromosomes with substantial genetic information, including protein-coding genes, non-coding RNA, transposon and gene islands. Our dataset can be useful as a comparative genome for evolution and speciation studies, as well as for the analysis of protein-coding gene families, the pathogenicity of different Vibrio species in fish, the evolution of non-coding RNA and transposon, and the regulation of gene expression in relation to the bioluminescence of Vqin-Q67.

  20. Synthesis and evaluation of "AZT-HEPT", "AZT-pyridinone", and "ddC-HEPT" conjugates as inhibitors of HIV reverse transcriptase.

    Science.gov (United States)

    Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C

    2000-05-18

    To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.

  1. Optimal codes as Tanner codes with cyclic component codes

    DEFF Research Database (Denmark)

    Høholdt, Tom; Pinero, Fernando; Zeng, Peng

    2014-01-01

    In this article we study a class of graph codes with cyclic code component codes as affine variety codes. Within this class of Tanner codes we find some optimal binary codes. We use a particular subgraph of the point-line incidence plane of A(2,q) as the Tanner graph, and we are able to describe ...

  2. Channel coding for underwater acoustic single-carrier CDMA communication system

    Science.gov (United States)

    Liu, Lanjun; Zhang, Yonglei; Zhang, Pengcheng; Zhou, Lin; Niu, Jiong

    2017-01-01

    CDMA is an effective multiple access protocol for underwater acoustic networks, and channel coding can effectively reduce the bit error rate (BER) of the underwater acoustic communication system. For the requirements of underwater acoustic mobile networks based on CDMA, an underwater acoustic single-carrier CDMA communication system (UWA/SCCDMA) based on the direct-sequence spread spectrum is proposed, and its channel coding scheme is studied based on convolution, RA, Turbo and LDPC coding respectively. The implementation steps of the Viterbi algorithm of convolutional coding, BP and minimum sum algorithms of RA coding, Log-MAP and SOVA algorithms of Turbo coding, and sum-product algorithm of LDPC coding are given. An UWA/SCCDMA simulation system based on Matlab is designed. Simulation results show that the UWA/SCCDMA based on RA, Turbo and LDPC coding have good performance such that the communication BER is all less than 10-6 in the underwater acoustic channel with low signal to noise ratio (SNR) from -12 dB to -10dB, which is about 2 orders of magnitude lower than that of the convolutional coding. The system based on Turbo coding with Log-MAP algorithm has the best performance.

  3. A quantitative reverse-transcriptase PCR assay for the assessment of drug activities against intracellular Theileria annulata schizonts

    Directory of Open Access Journals (Sweden)

    Isabel Hostettler

    2014-12-01

    Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.

  4. Modeling coding-sequence evolution within the context of residue solvent accessibility.

    Science.gov (United States)

    Scherrer, Michael P; Meyer, Austin G; Wilke, Claus O

    2012-09-12

    Protein structure mediates site-specific patterns of sequence divergence. In particular, residues in the core of a protein (solvent-inaccessible residues) tend to be more evolutionarily conserved than residues on the surface (solvent-accessible residues). Here, we present a model of sequence evolution that explicitly accounts for the relative solvent accessibility of each residue in a protein. Our model is a variant of the Goldman-Yang 1994 (GY94) model in which all model parameters can be functions of the relative solvent accessibility (RSA) of a residue. We apply this model to a data set comprised of nearly 600 yeast genes, and find that an evolutionary-rate ratio ω that varies linearly with RSA provides a better model fit than an RSA-independent ω or an ω that is estimated separately in individual RSA bins. We further show that the branch length t and the transition-transverion ratio κ also vary with RSA. The RSA-dependent GY94 model performs better than an RSA-dependent Muse-Gaut 1994 (MG94) model in which the synonymous and non-synonymous rates individually are linear functions of RSA. Finally, protein core size affects the slope of the linear relationship between ω and RSA, and gene expression level affects both the intercept and the slope. Structure-aware models of sequence evolution provide a significantly better fit than traditional models that neglect structure. The linear relationship between ω and RSA implies that genes are better characterized by their ω slope and intercept than by just their mean ω.

  5. Modeling coding-sequence evolution within the context of residue solvent accessibility

    Directory of Open Access Journals (Sweden)

    Scherrer Michael P

    2012-09-01

    Full Text Available Abstract Background Protein structure mediates site-specific patterns of sequence divergence. In particular, residues in the core of a protein (solvent-inaccessible residues tend to be more evolutionarily conserved than residues on the surface (solvent-accessible residues. Results Here, we present a model of sequence evolution that explicitly accounts for the relative solvent accessibility of each residue in a protein. Our model is a variant of the Goldman-Yang 1994 (GY94 model in which all model parameters can be functions of the relative solvent accessibility (RSA of a residue. We apply this model to a data set comprised of nearly 600 yeast genes, and find that an evolutionary-rate ratio ω that varies linearly with RSA provides a better model fit than an RSA-independent ω or an ω that is estimated separately in individual RSA bins. We further show that the branch length t and the transition-transverion ratio κ also vary with RSA. The RSA-dependent GY94 model performs better than an RSA-dependent Muse-Gaut 1994 (MG94 model in which the synonymous and non-synonymous rates individually are linear functions of RSA. Finally, protein core size affects the slope of the linear relationship between ω and RSA, and gene expression level affects both the intercept and the slope. Conclusions Structure-aware models of sequence evolution provide a significantly better fit than traditional models that neglect structure. The linear relationship between ω and RSA implies that genes are better characterized by their ω slope and intercept than by just their mean ω.

  6. Spectral entropy criteria for structural segmentation in genomic DNA sequences

    International Nuclear Information System (INIS)

    Chechetkin, V.R.; Lobzin, V.V.

    2004-01-01

    The spectral entropy is calculated with Fourier structure factors and characterizes the level of structural ordering in a sequence of symbols. It may efficiently be applied to the assessment and reconstruction of the modular structure in genomic DNA sequences. We present the relevant spectral entropy criteria for the local and non-local structural segmentation in DNA sequences. The results are illustrated with the model examples and analysis of intervening exon-intron segments in the protein-coding regions

  7. A nonlinear QSAR study using oscillating search and SVM as an efficient algorithm to model the inhibition of reverse transcriptase by HEPT derivatives

    International Nuclear Information System (INIS)

    Ferkous, F.; Saihi, Y.

    2018-01-01

    Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)

  8. Automated Testing with Targeted Event Sequence Generation

    DEFF Research Database (Denmark)

    Jensen, Casper Svenning; Prasad, Mukul R.; Møller, Anders

    2013-01-01

    Automated software testing aims to detect errors by producing test inputs that cover as much of the application source code as possible. Applications for mobile devices are typically event-driven, which raises the challenge of automatically producing event sequences that result in high coverage...

  9. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  10. Symmetries in Genetic Systems and the Concept of Geno-Logical Coding

    Directory of Open Access Journals (Sweden)

    Sergey V. Petoukhov

    2016-12-01

    Full Text Available The genetic code of amino acid sequences in proteins does not allow understanding and modeling of inherited processes such as inborn coordinated motions of living bodies, innate principles of sensory information processing, quasi-holographic properties, etc. To be able to model these phenomena, the concept of geno-logical coding, which is connected with logical functions and Boolean algebra, is put forward. The article describes basic pieces of evidence in favor of the existence of the geno-logical code, which exists in p­arallel with the known genetic code of amino acid sequences but which serves for transferring inherited processes along chains of generations. These pieces of evidence have been received due to the analysis of symmetries in structures of molecular-genetic systems. The analysis has revealed a close connection of the genetic system with dyadic groups of binary numbers and with other mathematical objects, which are related with dyadic groups: Walsh functions (which are algebraic characters of dyadic groups, bit-reversal permutations, logical holography, etc. These results provide a new approach for mathematical modeling of genetic structures, which uses known mathematical formalisms from technological fields of noise-immunity coding of information, binary analysis, logical holography, and digital devices of artificial intellect. Some opportunities for a development of algebraic-logical biology are opened.

  11. An optical CDMA system based on chaotic sequences

    Science.gov (United States)

    Liu, Xiao-lei; En, De; Wang, Li-guo

    2014-03-01

    In this paper, a coherent asynchronous optical code division multiple access (OCDMA) system is proposed, whose encoder/decoder is an all-optical generator. This all-optical generator can generate analog and bipolar chaotic sequences satisfying the logistic maps. The formula of bit error rate (BER) is derived, and the relationship of BER and the number of simultaneous transmissions is analyzed. Due to the good property of correlation, this coherent OCDMA system based on these bipolar chaotic sequences can support a large number of simultaneous users, which shows that these chaotic sequences are suitable for asynchronous OCDMA system.

  12. SLACINPT - a FORTRAN program that generates boundary data for the SLAC gun code

    International Nuclear Information System (INIS)

    Michel, W.L.; Hepburn, J.D.

    1982-03-01

    The FORTRAN program SLACINPT was written to simplify the preparation of boundary data for the SLAC gun code. In SLACINPT, the boundary is described by a sequence of straight line or arc segments. From these, the program generates the individual boundary mesh point data, required as input by the SLAC gun code

  13. GuiTope: an application for mapping random-sequence peptides to protein sequences.

    Science.gov (United States)

    Halperin, Rebecca F; Stafford, Phillip; Emery, Jack S; Navalkar, Krupa Arun; Johnston, Stephen Albert

    2012-01-03

    Random-sequence peptide libraries are a commonly used tool to identify novel ligands for binding antibodies, other proteins, and small molecules. It is often of interest to compare the selected peptide sequences to the natural protein binding partners to infer the exact binding site or the importance of particular residues. The ability to search a set of sequences for similarity to a set of peptides may sometimes enable the prediction of an antibody epitope or a novel binding partner. We have developed a software application designed specifically for this task. GuiTope provides a graphical user interface for aligning peptide sequences to protein sequences. All alignment parameters are accessible to the user including the ability to specify the amino acid frequency in the peptide library; these frequencies often differ significantly from those assumed by popular alignment programs. It also includes a novel feature to align di-peptide inversions, which we have found improves the accuracy of antibody epitope prediction from peptide microarray data and shows utility in analyzing phage display datasets. Finally, GuiTope can randomly select peptides from a given library to estimate a null distribution of scores and calculate statistical significance. GuiTope provides a convenient method for comparing selected peptide sequences to protein sequences, including flexible alignment parameters, novel alignment features, ability to search a database, and statistical significance of results. The software is available as an executable (for PC) at http://www.immunosignature.com/software and ongoing updates and source code will be available at sourceforge.net.

  14. GuiTope: an application for mapping random-sequence peptides to protein sequences

    Directory of Open Access Journals (Sweden)

    Halperin Rebecca F

    2012-01-01

    Full Text Available Abstract Background Random-sequence peptide libraries are a commonly used tool to identify novel ligands for binding antibodies, other proteins, and small molecules. It is often of interest to compare the selected peptide sequences to the natural protein binding partners to infer the exact binding site or the importance of particular residues. The ability to search a set of sequences for similarity to a set of peptides may sometimes enable the prediction of an antibody epitope or a novel binding partner. We have developed a software application designed specifically for this task. Results GuiTope provides a graphical user interface for aligning peptide sequences to protein sequences. All alignment parameters are accessible to the user including the ability to specify the amino acid frequency in the peptide library; these frequencies often differ significantly from those assumed by popular alignment programs. It also includes a novel feature to align di-peptide inversions, which we have found improves the accuracy of antibody epitope prediction from peptide microarray data and shows utility in analyzing phage display datasets. Finally, GuiTope can randomly select peptides from a given library to estimate a null distribution of scores and calculate statistical significance. Conclusions GuiTope provides a convenient method for comparing selected peptide sequences to protein sequences, including flexible alignment parameters, novel alignment features, ability to search a database, and statistical significance of results. The software is available as an executable (for PC at http://www.immunosignature.com/software and ongoing updates and source code will be available at sourceforge.net.

  15. Coordination analysis of players' distribution in football using cross-correlation and vector coding techniques.

    Science.gov (United States)

    Moura, Felipe Arruda; van Emmerik, Richard E A; Santana, Juliana Exel; Martins, Luiz Eduardo Barreto; Barros, Ricardo Machado Leite de; Cunha, Sergio Augusto

    2016-12-01

    The purpose of this study was to investigate the coordination between teams spread during football matches using cross-correlation and vector coding techniques. Using a video-based tracking system, we obtained the trajectories of 257 players during 10 matches. Team spread was calculated as functions of time. For a general coordination description, we calculated the cross-correlation between the signals. Vector coding was used to identify the coordination patterns between teams during offensive sequences that ended in shots on goal or defensive tackles. Cross-correlation showed that opponent teams have a tendency to present in-phase coordination, with a short time lag. During offensive sequences, vector coding results showed that, although in-phase coordination dominated, other patterns were observed. We verified that during the early stages, offensive sequences ending in shots on goal present greater anti-phase and attacking team phase periods, compared to sequences ending in tackles. Results suggest that the attacking team may seek to present a contrary behaviour of its opponent (or may lead the adversary behaviour) in the beginning of the attacking play, regarding to the distribution strategy, to increase the chances of a shot on goal. The techniques allowed detecting the coordination patterns between teams, providing additional information about football dynamics and players' interaction.

  16. Code Recognition Device for Automobile, a Panacea for Automobiles Theft

    Directory of Open Access Journals (Sweden)

    Ozomata David AHMED

    2011-06-01

    Full Text Available Code Recognition Device is a security device for automobiles. It responds only to the right sequence of codes that are keyed from the key pad. This closes the electrical circuitry of the automobile and enables it to start. If a wrong key is touched, it resets the device which disengages the electrical circuit of the automobile from the power supply. The device works properly on closing all the doors of the automobile, otherwise it cannot start. Also, once the automobile is in operation, opening of any door will disengage the device and the engine will stop. To restart the engine, the doors must be closed and the codes rendered sequentially-in this case the codes are 1974.

  17. A chemical address for the Morse Code

    Energy Technology Data Exchange (ETDEWEB)

    Cristaldi, Domenico A.; Millesi, Salvatrice; Mineo, Placido; Gulino, Antonino, E-mail: agulino@unict.it

    2016-01-15

    The International Morse Code is a method to communicate information by a sequence of ON–OFF outputs. A unique and sometime long combination of ON and OFF signals is required to distinguish letters, numerals and to separate each letter and each word. In the present study we synthesized a simple new yttrium β-diketonate complex whose photoluminescence intensity is strongly dependent on the excitation input and can be easily tuned. Three of these different optical outputs have been easily “keyed” ON, OFF and as a space for letters and words, thus adding an additional readable output and hence making the Morse Code much more simple and versatile for optical communication.

  18. Quantum secure direct communication network with superdense coding and decoy photons

    International Nuclear Information System (INIS)

    Deng Fuguo; Li Xihan; Li Chunyan; Zhou Ping; Zhou Hongyu

    2007-01-01

    A quantum secure direct communication network scheme is proposed with quantum superdense coding and decoy photons. The servers on a passive optical network prepare and measure the quantum signal, i.e. a sequence of the d-dimensional Bell states. After confirming the security of the photons received from the receiver, the sender codes his secret message on them directly. For preventing a dishonest server from eavesdropping, some decoy photons prepared by measuring one photon in the Bell states are used to replace some original photons. One of the users on the network can communicate to any other one. This scheme has the advantage of high capacity, and it is more convenient than others as only a sequence of photons is transmitted in quantum line

  19. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence

    Science.gov (United States)

    Gordon, Kacy L.; Arthur, Robert K.; Ruvinsky, Ilya

    2015-01-01

    Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2) from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements. PMID:26020930

  20. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence.

    Directory of Open Access Journals (Sweden)

    Kacy L Gordon

    2015-05-01

    Full Text Available Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2 from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements.

  1. Mutation V111I in HIV-2 reverse transcriptase increases the fitness of the nucleoside analogue-resistant K65R and Q151M viruses

    NARCIS (Netherlands)

    I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)

    2015-01-01

    textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have

  2. Interface requirements to couple thermal-hydraulic codes to severe accident codes: ATHLET-CD

    Energy Technology Data Exchange (ETDEWEB)

    Trambauer, K. [GRS, Garching (Germany)

    1997-07-01

    The system code ATHLET-CD is being developed by GRS in cooperation with IKE and IPSN. Its field of application comprises the whole spectrum of leaks and large breaks, as well as operational and abnormal transients for LWRs and VVERs. At present the analyses cover the in-vessel thermal-hydraulics, the early phases of core degradation, as well as fission products and aerosol release from the core and their transport in the Reactor Coolant System. The aim of the code development is to extend the simulation of core degradation up to failure of the reactor pressure vessel and to cover all physically reasonable accident sequences for western and eastern LWRs including RMBKs. The ATHLET-CD structure is highly modular in order to include a manifold spectrum of models and to offer an optimum basis for further development. The code consists of four general modules to describe the reactor coolant system thermal-hydraulics, the core degradation, the fission product core release, and fission product and aerosol transport. Each general module consists of some basic modules which correspond to the process to be simulated or to its specific purpose. Besides the code structure based on the physical modelling, the code follows four strictly separated steps during the course of a calculation: (1) input of structure, geometrical data, initial and boundary condition, (2) initialization of derived quantities, (3) steady state calculation or input of restart data, and (4) transient calculation. In this paper, the transient solution method is briefly presented and the coupling methods are discussed. Three aspects have to be considered for the coupling of different modules in one code system. First is the conservation of masses and energy in the different subsystems as there are fluid, structures, and fission products and aerosols. Second is the convergence of the numerical solution and stability of the calculation. The third aspect is related to the code performance, and running time.

  3. Next generation sequencing and analysis of a conserved transcriptome of New Zealand's kiwi.

    Science.gov (United States)

    Subramanian, Sankar; Huynen, Leon; Millar, Craig D; Lambert, David M

    2010-12-15

    Kiwi is a highly distinctive, flightless and endangered ratite bird endemic to New Zealand. To understand the patterns of molecular evolution of the nuclear protein-coding genes in brown kiwi (Apteryx australis mantelli) and to determine the timescale of avian history we sequenced a transcriptome obtained from a kiwi embryo using next generation sequencing methods. We then assembled the conserved protein-coding regions using the chicken proteome as a scaffold. Using 1,543 conserved protein coding genes we estimated the neutral evolutionary divergence between the kiwi and chicken to be ~45%, which is approximately equal to the divergence computed for the human-mouse pair using the same set of genes. A large fraction of genes was found to be under high selective constraint, as most of the expressed genes appeared to be involved in developmental gene regulation. Our study suggests a significant relationship between gene expression levels and protein evolution. Using sequences from over 700 nuclear genes we estimated the divergence between the two basal avian groups, Palaeognathae and Neognathae to be 132 million years, which is consistent with previous studies using mitochondrial genes. The results of this investigation revealed patterns of mutation and purifying selection in conserved protein coding regions in birds. Furthermore this study suggests a relatively cost-effective way of obtaining a glimpse into the fundamental molecular evolutionary attributes of a genome, particularly when no closely related genomic sequence is available.

  4. Next generation sequencing and analysis of a conserved transcriptome of New Zealand's kiwi

    Directory of Open Access Journals (Sweden)

    Huynen Leon

    2010-12-01

    Full Text Available Abstract Background Kiwi is a highly distinctive, flightless and endangered ratite bird endemic to New Zealand. To understand the patterns of molecular evolution of the nuclear protein-coding genes in brown kiwi (Apteryx australis mantelli and to determine the timescale of avian history we sequenced a transcriptome obtained from a kiwi embryo using next generation sequencing methods. We then assembled the conserved protein-coding regions using the chicken proteome as a scaffold. Results Using 1,543 conserved protein coding genes we estimated the neutral evolutionary divergence between the kiwi and chicken to be ~45%, which is approximately equal to the divergence computed for the human-mouse pair using the same set of genes. A large fraction of genes was found to be under high selective constraint, as most of the expressed genes appeared to be involved in developmental gene regulation. Our study suggests a significant relationship between gene expression levels and protein evolution. Using sequences from over 700 nuclear genes we estimated the divergence between the two basal avian groups, Palaeognathae and Neognathae to be 132 million years, which is consistent with previous studies using mitochondrial genes. Conclusions The results of this investigation revealed patterns of mutation and purifying selection in conserved protein coding regions in birds. Furthermore this study suggests a relatively cost-effective way of obtaining a glimpse into the fundamental molecular evolutionary attributes of a genome, particularly when no closely related genomic sequence is available.

  5. MicroRNA-128 targets myostatin at coding domain sequence to regulate myoblasts in skeletal muscle development.

    Science.gov (United States)

    Shi, Lei; Zhou, Bo; Li, Pinghua; Schinckel, Allan P; Liang, Tingting; Wang, Han; Li, Huizhi; Fu, Lingling; Chu, Qingpo; Huang, Ruihua

    2015-09-01

    MicroRNAs (miRNAs or miRs) play a critical role in skeletal muscle development. In a previous study we observed that miR-128 was highly expressed in skeletal muscle. However, its function in regulating skeletal muscle development is not clear. Our hypothesis was that miR-128 is involved in the regulation of the proliferation and differentiation of skeletal myoblasts. In this study, through bioinformatics analyses, we demonstrate that miR-128 specifically targeted mRNA of myostatin (MSTN), a critical inhibitor of skeletal myogenesis, at coding domain sequence (CDS) region, resulting in down-regulating of myostatin post-transcription. Overexpression of miR-128 inhibited proliferation of mouse C2C12 myoblast cells but promoted myotube formation; whereas knockdown of miR-128 had completely opposite effects. In addition, ectopic miR-128 regulated the expression of myogenic factor 5 (Myf5), myogenin (MyoG), paired box (Pax) 3 and 7. Furthermore, an inverse relationship was found between the expression of miR-128 and MSTN protein expression in vivo and in vitro. Taken together, these results reveal that there is a novel pathway in skeletal muscle development in which miR-128 regulates myostatin at CDS region to inhibit proliferation but promote differentiation of myoblast cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Fast H.264/AVC FRExt intra coding using belief propagation.

    Science.gov (United States)

    Milani, Simone

    2011-01-01

    In the H.264/AVC FRExt coder, the coding performance of Intra coding significantly overcomes the previous still image coding standards, like JPEG2000, thanks to a massive use of spatial prediction. Unfortunately, the adoption of an extensive set of predictors induces a significant increase of the computational complexity required by the rate-distortion optimization routine. The paper presents a complexity reduction strategy that aims at reducing the computational load of the Intra coding with a small loss in the compression performance. The proposed algorithm relies on selecting a reduced set of prediction modes according to their probabilities, which are estimated adopting a belief-propagation procedure. Experimental results show that the proposed method permits saving up to 60 % of the coding time required by an exhaustive rate-distortion optimization method with a negligible loss in performance. Moreover, it permits an accurate control of the computational complexity unlike other methods where the computational complexity depends upon the coded sequence.

  7. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

    Science.gov (United States)

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  8. SeqCompress: an algorithm for biological sequence compression.

    Science.gov (United States)

    Sardaraz, Muhammad; Tahir, Muhammad; Ikram, Ataul Aziz; Bajwa, Hassan

    2014-10-01

    The growth of Next Generation Sequencing technologies presents significant research challenges, specifically to design bioinformatics tools that handle massive amount of data efficiently. Biological sequence data storage cost has become a noticeable proportion of total cost in the generation and analysis. Particularly increase in DNA sequencing rate is significantly outstripping the rate of increase in disk storage capacity, which may go beyond the limit of storage capacity. It is essential to develop algorithms that handle large data sets via better memory management. This article presents a DNA sequence compression algorithm SeqCompress that copes with the space complexity of biological sequences. The algorithm is based on lossless data compression and uses statistical model as well as arithmetic coding to compress DNA sequences. The proposed algorithm is compared with recent specialized compression tools for biological sequences. Experimental results show that proposed algorithm has better compression gain as compared to other existing algorithms. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. A comparative study of pseudorandom sequences used in a c-VEP based BCI for online wheelchair control

    DEFF Research Database (Denmark)

    Isaksen, Jonas L.; Mohebbi, Ali; Puthusserypady, Sadasivan

    2016-01-01

    In this study, a c-VEP based BCI system was developed to run on three distinctive pseudorandom sequences, namely the m-code, the Gold-code, and the Barker-code. The Visual Evoked Potentials (VEPs) were provoked using these codes. In the online session, subjects controlled a LEGO® Mindstorms® robot...

  10. Assembly of the Complete Sitka Spruce Chloroplast Genome Using 10X Genomics' GemCode Sequencing Data.

    Directory of Open Access Journals (Sweden)

    Lauren Coombe

    Full Text Available The linked read sequencing library preparation platform by 10X Genomics produces barcoded sequencing libraries, which are subsequently sequenced using the Illumina short read sequencing technology. In this new approach, long fragments of DNA are partitioned into separate micro-reactions, where the same index sequence is incorporated into each of the sequencing fragment inserts derived from a given long fragment. In this study, we exploited this property by using reads from index sequences associated with a large number of reads, to assemble the chloroplast genome of the Sitka spruce tree (Picea sitchensis. Here we report on the first Sitka spruce chloroplast genome assembled exclusively from P. sitchensis genomic libraries prepared using the 10X Genomics protocol. We show that the resulting 124,049 base pair long genome shares high sequence similarity with the related white spruce and Norway spruce chloroplast genomes, but diverges substantially from a previously published P. sitchensis- P. thunbergii chimeric genome. The use of reads from high-frequency indices enabled separation of the nuclear genome reads from that of the chloroplast, which resulted in the simplification of the de Bruijn graphs used at the various stages of assembly.

  11. Description and applicability of the BEFEM-CODE

    Energy Technology Data Exchange (ETDEWEB)

    Groth, T.

    1980-05-15

    The BEFEM-CODE, developed for rock mechanics problems in hard rock with joints, is a simple FEM code constructed using triangular and quadrilateral elements. As an option, a joint element of the Goodman type may be used. The Cook-Pian type quadrilateral stress hybrid element was introduced into the version of the code used for the Naesliden project, to replace the constant stress quadrilateral elements. This hybrid element, derived with assumed stress distributions, simplifies the excavation process for use in non-linear models. The shear behavior of the Goodman 1976 joint element has been replaced by Goodman's 1968 formulation. This element makes it possible to take dilation into account, but it was not considered necessary to use dilation to simulate proper joint behavior in the Naesliden project. The code uses Barton's shear strength criteria. Excessive nodal forces due to failure and non-linearities in the joint elements are redistributed with stress transfer iterations. Convergence can be speeded up by dividing each excavation sequence into several loadsteps in which the stiffness matrix is recalculated.

  12. Differential Regulation of Telomerase Reverse Transcriptase Promoter Activation and Protein Degradation by Histone Deacetylase Inhibition.

    Science.gov (United States)

    Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis

    2016-06-01

    Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.

  13. Proteogenomics of rare taxonomic phyla: A prospective treasure trove of protein coding genes.

    Science.gov (United States)

    Kumar, Dhirendra; Mondal, Anupam Kumar; Kutum, Rintu; Dash, Debasis

    2016-01-01

    Sustainable innovations in sequencing technologies have resulted in a torrent of microbial genome sequencing projects. However, the prokaryotic genomes sequenced so far are unequally distributed along their phylogenetic tree; few phyla contain the majority, the rest only a few representatives. Accurate genome annotation lags far behind genome sequencing. While automated computational prediction, aided by comparative genomics, remains a popular choice for genome annotation, substantial fraction of these annotations are erroneous. Proteogenomics utilizes protein level experimental observations to annotate protein coding genes on a genome wide scale. Benefits of proteogenomics include discovery and correction of gene annotations regardless of their phylogenetic conservation. This not only allows detection of common, conserved proteins but also the discovery of protein products of rare genes that may be horizontally transferred or taxonomy specific. Chances of encountering such genes are more in rare phyla that comprise a small number of complete genome sequences. We collated all bacterial and archaeal proteogenomic studies carried out to date and reviewed them in the context of genome sequencing projects. Here, we present a comprehensive list of microbial proteogenomic studies, their taxonomic distribution, and also urge for targeted proteogenomics of underexplored taxa to build an extensive reference of protein coding genes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Nucleotide sequences of the Erwinia chrysanthemi ogl and pelE genes negatively regulated by the kdgR gene product.

    Science.gov (United States)

    Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J

    1989-12-21

    The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication.

    Science.gov (United States)

    Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon

    2015-08-01

    The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription

  16. Sequence of maximal distance codes in graphs or other metric spaces

    Directory of Open Access Journals (Sweden)

    Charles Delorme

    2013-11-01

    Full Text Available Given a subset C in a metric space E, its successor is the subset  s(C of points at maximum distance from C in E. We study some properties of the sequence obtained by iterating this operation.  Graphs with their usual distance provide already typical examples.

  17. In Vitro Evaluation of Nonnucleoside Reverse Transcriptase Inhibitors UC-781 and TMC120-R147681 as Human Immunodeficiency Virus Microbicides†

    Science.gov (United States)

    Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul

    2004-01-01

    The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562

  18. Coding Variation in ANGPTL4, LPL, and SVEP1 and the Risk of Coronary Disease

    NARCIS (Netherlands)

    Stitziel, Nathan O; Stirrups, Kathleen E; Masca, Nicholas G D; Erdmann, Jeanette; Ferrario, Paola G; König, Inke R; Weeke, Peter E; Webb, Thomas R; Auer, Paul L; Schick, Ursula M; Lu, Yingchang; Zhang, He; Dube, Marie-Pierre; Goel, Anuj; Farrall, Martin; Peloso, Gina M; Won, Hong-Hee; Do, Ron; van Iperen, Erik; Kanoni, Stavroula; Kruppa, Jochen; Mahajan, Anubha; Scott, Robert A; Willenberg, Christina; Braund, Peter S; van Capelleveen, Julian C; Doney, Alex S F; Donnelly, Louise A; Asselta, Rosanna; Merlini, Piera A; Duga, Stefano; Marziliano, Nicola; Denny, Josh C; Shaffer, Christian M; El-Mokhtari, Nour Eddine; Franke, Andre; Gottesman, Omri; Heilmann, Stefanie; Hengstenberg, Christian; Hoffman, Per; Holmen, Oddgeir L; Hveem, Kristian; Jansson, Jan-Håkan; Jöckel, Karl-Heinz; Kessler, Thorsten; Kriebel, Jennifer; Laugwitz, Karl L; Marouli, Eirini; Martinelli, Nicola; McCarthy, Mark I; Van Zuydam, Natalie R; Meisinger, Christa; Esko, Tõnu; Mihailov, Evelin; Escher, Stefan A; Alvar, Maris; Moebus, Susanne; Morris, Andrew D; Müller-Nurasyid, Martina; Nikpay, Majid; Olivieri, Oliviero; Lemieux Perreault, Louis-Philippe; AlQarawi, Alaa; Robertson, Neil R; Akinsanya, Karen O; Reilly, Dermot F; Vogt, Thomas F; Yin, Wu; Asselbergs, Folkert W; Kooperberg, Charles; Jackson, Rebecca D; Stahl, Eli; Strauch, Konstantin; Varga, Tibor V; Waldenberger, Melanie; Zeng, Lingyao; Kraja, Aldi T; Liu, Chunyu; Ehret, George B; Newton-Cheh, Christopher; Chasman, Daniel I; Chowdhury, Rajiv; Ferrario, Marco; Ford, Ian; Jukema, J Wouter; Kee, Frank; Kuulasmaa, Kari; Nordestgaard, Børge G; Perola, Markus; Saleheen, Danish; Sattar, Naveed; Surendran, Praveen; Tregouet, David; Young, Robin; Howson, Joanna M M; Butterworth, Adam S; Danesh, John; Ardissino, Diego; Bottinger, Erwin P; Erbel, Raimund; Franks, Paul W; Girelli, Domenico; Hall, Alistair S; Hovingh, G Kees; Kastrati, Adnan; Lieb, Wolfgang; Meitinger, Thomas; Kraus, William E; Shah, Svati H; McPherson, Ruth; Orho-Melander, Marju; Melander, Olle; Metspalu, Andres; Palmer, Colin N A; Peters, Annette; Rader, Daniel; Reilly, Muredach P; Loos, Ruth J F; Reiner, Alex P; Roden, Dan M; Tardif, Jean-Claude; Thompson, John R; Wareham, Nicholas J; Watkins, Hugh; Willer, Cristen J; Kathiresan, Sekkar; Deloukas, Panos; Samani, Nilesh J; Schunkert, Heribert

    BACKGROUND: The discovery of low-frequency coding variants affecting the risk of coronary artery disease has facilitated the identification of therapeutic targets. METHODS: Through DNA genotyping, we tested 54,003 coding-sequence variants covering 13,715 human genes in up to 72,868 patients with

  19. 多重随机序列在算术编码中的应用%Application of Multiple Random Sequence in Arithmetic Coding

    Institute of Scientific and Technical Information of China (English)

    周明; 冯民富

    2012-01-01

    Arithmetic coding, for its high compression ratio and moderate coding efficiency, plays an important role in the standard of image compression technology. This algorithm depends on only one argument: the occurrence probability of information source symbols. This probability determines the efficiency of compression, and the interval of information source symbols as well. However, the classical arithmetic coding considers no internal structure of the input sequence of information source symbols, but only the probability of single symbols. Finally to which special combinations the coding intervals should be allocated, and whether there exists an effective allocation algorithm, these are still problems to been considered and settled.%算术编码凭借其高效的压缩比以及适度的编码效率,在图像压缩技术标准(比如JPEG等)中有着重要的地位。该算法仅仅依赖于一个参数:信源符号出现的概率。该概率决定了压缩编码的效率,同时也决定了编码过程中信源符号的间隔。然而,经典的算术编码都没有考虑信源符号输入序列的内在结构,仅仅是考虑单个的符号。这些连续的输入组合中的某些组合若大量出现在信源符号中,就有必要考虑这些组合的出现概率了。而最终需要给哪些特定的组合分配编码区间,以及是否有行之有效的分配算法,都需要考虑。

  20. HLA-E regulatory and coding region variability and haplotypes in a Brazilian population sample.

    Science.gov (United States)

    Ramalho, Jaqueline; Veiga-Castelli, Luciana C; Donadi, Eduardo A; Mendes-Junior, Celso T; Castelli, Erick C

    2017-11-01

    The HLA-E gene is characterized by low but wide expression on different tissues. HLA-E is considered a conserved gene, being one of the least polymorphic class I HLA genes. The HLA-E molecule interacts with Natural Killer cell receptors and T lymphocytes receptors, and might activate or inhibit immune responses depending on the peptide associated with HLA-E and with which receptors HLA-E interacts to. Variable sites within the HLA-E regulatory and coding segments may influence the gene function by modifying its expression pattern or encoded molecule, thus, influencing its interaction with receptors and the peptide. Here we propose an approach to evaluate the gene structure, haplotype pattern and the complete HLA-E variability, including regulatory (promoter and 3'UTR) and coding segments (with introns), by using massively parallel sequencing. We investigated the variability of 420 samples from a very admixed population such as Brazilians by using this approach. Considering a segment of about 7kb, 63 variable sites were detected, arranged into 75 extended haplotypes. We detected 37 different promoter sequences (but few frequent ones), 27 different coding sequences (15 representing new HLA-E alleles) and 12 haplotypes at the 3'UTR segment, two of them presenting a summed frequency of 90%. Despite the number of coding alleles, they encode mainly two different full-length molecules, known as E*01:01 and E*01:03, which corresponds to about 90% of all. In addition, differently from what has been previously observed for other non classical HLA genes, the relationship among the HLA-E promoter, coding and 3'UTR haplotypes is not straightforward because the same promoter and 3'UTR haplotypes were many times associated with different HLA-E coding haplotypes. This data reinforces the presence of only two main full-length HLA-E molecules encoded by the many HLA-E alleles detected in our population sample. In addition, this data does indicate that the distal HLA-E promoter is by

  1. Low-Bandwidth and Non-Compute Intensive Remote Identification of Microbes from Raw Sequencing Reads

    DEFF Research Database (Denmark)

    Gautier, Laurent; Lund, Ole

    2013-01-01

    , allowing a fully automated processing of sequencing data and routine instant quality check of sequencing runs from desktop sequencers. A web access is available at http://tapir.cbs.dtu.dk. The source code for a python command-line client, a server, and supplementary data are available at http://bit.ly/1aURxkc....

  2. Highly accurate fluorogenic DNA sequencing with information theory-based error correction.

    Science.gov (United States)

    Chen, Zitian; Zhou, Wenxiong; Qiao, Shuo; Kang, Li; Duan, Haifeng; Xie, X Sunney; Huang, Yanyi

    2017-12-01

    Eliminating errors in next-generation DNA sequencing has proved challenging. Here we present error-correction code (ECC) sequencing, a method to greatly improve sequencing accuracy by combining fluorogenic sequencing-by-synthesis (SBS) with an information theory-based error-correction algorithm. ECC embeds redundancy in sequencing reads by creating three orthogonal degenerate sequences, generated by alternate dual-base reactions. This is similar to encoding and decoding strategies that have proved effective in detecting and correcting errors in information communication and storage. We show that, when combined with a fluorogenic SBS chemistry with raw accuracy of 98.1%, ECC sequencing provides single-end, error-free sequences up to 200 bp. ECC approaches should enable accurate identification of extremely rare genomic variations in various applications in biology and medicine.

  3. Status of the ASTEC integral code

    International Nuclear Information System (INIS)

    Van Dorsselaere, J.P.; Jacq, F.; Allelein, H.J.

    2000-01-01

    The ASTEC (Accident Source Term Evaluation Code) integrated code is developed since 1997 in close collaboration by IPSN and GRS to predict an entire LWR severe accident sequence from the initiating event up to Fission Product (FP) release out of the containment. The applications of such a code are source term determination studies, scenario evaluations, accident management studies and Probabilistic Safety Assessment level 2 (PSA-2) studies. The version V0 of ASTEC is based on the RCS modules of the ESCADRE integrated code (IPSN) and on the upgraded RALOC and FIPLOC codes (GRS) for containment thermalhydraulics and aerosol behaviour. The latest version V0.2 includes the general feed-back from the overall validation performed in 1998 (25 separate-effect experiments, PHEBUS.FP FPT1 integrated experiment), some modelling improvements (i.e. silver-iodine reactions in the containment sump), and the implementation of the main safety systems for Severe Accident Management. Several reactor-applications are under way on French and German PWR, and on VVER-1000, all with a multi-compartment configuration of the containment. The total IPSN-GRS manpower involved in ASTEC project is today about 20 men/year. The main evolution of the next version V1, foreseen end of 2001, concerns the integration of the front-end phase and the improvement of the in-vessel degradation late-phase modelling. (author)

  4. Comparative analysis of complete chloroplast genome sequence and inversion variation in Lasthenia burkei (Madieae, Asteraceae).

    Science.gov (United States)

    Walker, Joseph F; Zanis, Michael J; Emery, Nancy C

    2014-04-01

    Complete chloroplast genome studies can help resolve relationships among large, complex plant lineages such as Asteraceae. We present the first whole plastome from the Madieae tribe and compare its sequence variation to other chloroplast genomes in Asteraceae. We used high throughput sequencing to obtain the Lasthenia burkei chloroplast genome. We compared sequence structure and rates of molecular evolution in the small single copy (SSC), large single copy (LSC), and inverted repeat (IR) regions to those for eight Asteraceae accessions and one Solanaceae accession. The chloroplast sequence of L. burkei is 150 746 bp and contains 81 unique protein coding genes and 4 coding ribosomal RNA sequences. We identified three major inversions in the L. burkei chloroplast, all of which have been found in other Asteraceae lineages, and a previously unreported inversion in Lactuca sativa. Regions flanking inversions contained tRNA sequences, but did not have particularly high G + C content. Substitution rates varied among the SSC, LSC, and IR regions, and rates of evolution within each region varied among species. Some observed differences in rates of molecular evolution may be explained by the relative proportion of coding to noncoding sequence within regions. Rates of molecular evolution vary substantially within and among chloroplast genomes, and major inversion events may be promoted by the presence of tRNAs. Collectively, these results provide insight into different mechanisms that may promote intramolecular recombination and the inversion of large genomic regions in the plastome.

  5. Symbolic complexity for nucleotide sequences: a sign of the genome structure

    International Nuclear Information System (INIS)

    Salgado-García, R; Ugalde, E

    2016-01-01

    We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)

  6. Sparsity in Linear Predictive Coding of Speech

    DEFF Research Database (Denmark)

    Giacobello, Daniele

    of the effectiveness of their application in audio processing. The second part of the thesis deals with introducing sparsity directly in the linear prediction analysis-by-synthesis (LPAS) speech coding paradigm. We first propose a novel near-optimal method to look for a sparse approximate excitation using a compressed...... one with direct applications to coding but also consistent with the speech production model of voiced speech, where the excitation of the all-pole filter can be modeled as an impulse train, i.e., a sparse sequence. Introducing sparsity in the LP framework will also bring to de- velop the concept...... sensing formulation. Furthermore, we define a novel re-estimation procedure to adapt the predictor coefficients to the given sparse excitation, balancing the two representations in the context of speech coding. Finally, the advantages of the compact parametric representation of a segment of speech, given...

  7. Fractals in DNA sequence analysis

    Institute of Scientific and Technical Information of China (English)

    Yu Zu-Guo(喻祖国); Vo Anh; Gong Zhi-Min(龚志民); Long Shun-Chao(龙顺潮)

    2002-01-01

    Fractal methods have been successfully used to study many problems in physics, mathematics, engineering, finance,and even in biology. There has been an increasing interest in unravelling the mysteries of DNA; for example, how can we distinguish coding and noncoding sequences, and the problems of classification and evolution relationship of organisms are key problems in bioinformatics. Although much research has been carried out by taking into consideration the long-range correlations in DNA sequences, and the global fractal dimension has been used in these works by other people, the models and methods are somewhat rough and the results are not satisfactory. In recent years, our group has introduced a time series model (statistical point of view) and a visual representation (geometrical point of view)to DNA sequence analysis. We have also used fractal dimension, correlation dimension, the Hurst exponent and the dimension spectrum (multifractal analysis) to discuss problems in this field. In this paper, we introduce these fractal models and methods and the results of DNA sequence analysis.

  8. Dynamic benchmarking of simulation codes

    International Nuclear Information System (INIS)

    Henry, R.E.; Paik, C.Y.; Hauser, G.M.

    1996-01-01

    Computer simulation of nuclear power plant response can be a full-scope control room simulator, an engineering simulator to represent the general behavior of the plant under normal and abnormal conditions, or the modeling of the plant response to conditions that would eventually lead to core damage. In any of these, the underlying foundation for their use in analysing situations, training of vendor/utility personnel, etc. is how well they represent what has been known from industrial experience, large integral experiments and separate effects tests. Typically, simulation codes are benchmarked with some of these; the level of agreement necessary being dependent upon the ultimate use of the simulation tool. However, these analytical models are computer codes, and as a result, the capabilities are continually enhanced, errors are corrected, new situations are imposed on the code that are outside of the original design basis, etc. Consequently, there is a continual need to assure that the benchmarks with important transients are preserved as the computer code evolves. Retention of this benchmarking capability is essential to develop trust in the computer code. Given the evolving world of computer codes, how is this retention of benchmarking capabilities accomplished? For the MAAP4 codes this capability is accomplished through a 'dynamic benchmarking' feature embedded in the source code. In particular, a set of dynamic benchmarks are included in the source code and these are exercised every time the archive codes are upgraded and distributed to the MAAP users. Three different types of dynamic benchmarks are used: plant transients; large integral experiments; and separate effects tests. Each of these is performed in a different manner. The first is accomplished by developing a parameter file for the plant modeled and an input deck to describe the sequence; i.e. the entire MAAP4 code is exercised. The pertinent plant data is included in the source code and the computer

  9. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn

    2008-01-01

    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  10. Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells

    Directory of Open Access Journals (Sweden)

    Yong Teng

    2014-02-01

    Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.

  11. Preparation of highly multiplexed small RNA sequencing libraries.

    Science.gov (United States)

    Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos

    2017-08-01

    MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.

  12. Compression of computer generated phase-shifting hologram sequence using AVC and HEVC

    Science.gov (United States)

    Xing, Yafei; Pesquet-Popescu, Béatrice; Dufaux, Frederic

    2013-09-01

    With the capability of achieving twice the compression ratio of Advanced Video Coding (AVC) with similar reconstruction quality, High Efficiency Video Coding (HEVC) is expected to become the newleading technique of video coding. In order to reduce the storage and transmission burden of digital holograms, in this paper we propose to use HEVC for compressing the phase-shifting digital hologram sequences (PSDHS). By simulating phase-shifting digital holography (PSDH) interferometry, interference patterns between illuminated three dimensional( 3D) virtual objects and the stepwise phase changed reference wave are generated as digital holograms. The hologram sequences are obtained by the movement of the virtual objects and compressed by AVC and HEVC. The experimental results show that AVC and HEVC are efficient to compress PSDHS, with HEVC giving better performance. Good compression rate and reconstruction quality can be obtained with bitrate above 15000kbps.

  13. Optimal pseudorandom sequence selection for online c-VEP based BCI control applications

    DEFF Research Database (Denmark)

    Isaksen, Jonas L.; Mohebbi, Ali; Puthusserypady, Sadasivan

    2017-01-01

    to predict the chance of completion and accuracy score. Results: No specific pseudorandom sequence showed superior accuracy on the group basis. When isolating the individual performances with the highest accuracy, time consumption per identification was not significantly increased. The Accuracy Score aids...... is a laborious process. Aims: This study aimed to suggest an efficient method for choosing the optimal stimulus sequence based on a fast test and simple measures to increase the performance and minimize the time consumption for research trials. Methods: A total of 21 healthy subjects were included in an online...... wheelchair control task and completed the same task using stimuli based on the m-code, the gold-code, and the Barker-code. Correct/incorrect identification and time consumption were obtained for each identification. Subject-specific templates were characterized and used in a forward-step first-order model...

  14. Susceptibility of recombinant porcine endogenous retrovirus reverse transcriptase to nucleoside and non-nucleoside inhibitors.

    Science.gov (United States)

    Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X

    2002-12-01

    Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.

  15. A quick and easy improvement of Monte Carlo codes for simulation

    Science.gov (United States)

    Lebrere, A.; Talhi, R.; Tripathy, M.; Pyée, M.

    The simulation of trials of independent random variables of given distribution is a critical element of running Monte-Carlo codes. This is usually performed by using pseudo-random number generators (and in most cases linearcongruential ones). We present here an alternative way to generate sequences with given statistical properties. This sequences are purely deterministic and are given by closed formulae, and can give in some cases better results than classical generators.

  16. Fresh Prime Codes Evaluation for Synchronous PPM and OPPM Signaling for Optical CDMA Networks

    Science.gov (United States)

    Karbassian, M. Massoud; Ghafouri-Shiraz, H.

    2007-06-01

    In this paper, we have proposed a novel prime spreading sequence family hereby referred to as “Double-Padded Modified Prime Code (DPMPC)” for direct-detection synchronous optical code-division multiple-access (OCDMA) networks. The new code is applied to both pulse-position and overlapping pulse-position modulation CDMA networks, and their performances were evaluated and compared with existing prime codes family. In addition, we have analyzed the system throughput and also introduced a new interference cancellation technique which significantly improves the bit error probability of OCDMA networks.

  17. Prediction and identification of sequences coding for orphan enzymes using genomic and metagenomic neighbours

    DEFF Research Database (Denmark)

    Yamada, Takuji; Waller, Alison S.; Raes, Jeroen

    2012-01-01

    Despite the current wealth of sequencing data, one-third of all biochemically characterized metabolic enzymes lack a corresponding gene or protein sequence, and as such can be considered orphan enzymes. They represent a major gap between our molecular and biochemical knowledge, and consequently a...... Systems Biology 8: 581; published online 8 May 2012; doi:10.1038/msb.2012.13...

  18. Optimal power allocation and joint source-channel coding for wireless DS-CDMA visual sensor networks

    Science.gov (United States)

    Pandremmenou, Katerina; Kondi, Lisimachos P.; Parsopoulos, Konstantinos E.

    2011-01-01

    In this paper, we propose a scheme for the optimal allocation of power, source coding rate, and channel coding rate for each of the nodes of a wireless Direct Sequence Code Division Multiple Access (DS-CDMA) visual sensor network. The optimization is quality-driven, i.e. the received quality of the video that is transmitted by the nodes is optimized. The scheme takes into account the fact that the sensor nodes may be imaging scenes with varying levels of motion. Nodes that image low-motion scenes will require a lower source coding rate, so they will be able to allocate a greater portion of the total available bit rate to channel coding. Stronger channel coding will mean that such nodes will be able to transmit at lower power. This will both increase battery life and reduce interference to other nodes. Two optimization criteria are considered. One that minimizes the average video distortion of the nodes and one that minimizes the maximum distortion among the nodes. The transmission powers are allowed to take continuous values, whereas the source and channel coding rates can assume only discrete values. Thus, the resulting optimization problem lies in the field of mixed-integer optimization tasks and is solved using Particle Swarm Optimization. Our experimental results show the importance of considering the characteristics of the video sequences when determining the transmission power, source coding rate and channel coding rate for the nodes of the visual sensor network.

  19. SeqLib: a C ++ API for rapid BAM manipulation, sequence alignment and sequence assembly.

    Science.gov (United States)

    Wala, Jeremiah; Beroukhim, Rameen

    2017-03-01

    We present SeqLib, a C ++ API and command line tool that provides a rapid and user-friendly interface to BAM/SAM/CRAM files, global sequence alignment operations and sequence assembly. Four C libraries perform core operations in SeqLib: HTSlib for BAM access, BWA-MEM and BLAT for sequence alignment and Fermi for error correction and sequence assembly. Benchmarking indicates that SeqLib has lower CPU and memory requirements than leading C ++ sequence analysis APIs. We demonstrate an example of how minimal SeqLib code can extract, error-correct and assemble reads from a CRAM file and then align with BWA-MEM. SeqLib also provides additional capabilities, including chromosome-aware interval queries and read plotting. Command line tools are available for performing integrated error correction, micro-assemblies and alignment. SeqLib is available on Linux and OSX for the C ++98 standard and later at github.com/walaj/SeqLib. SeqLib is released under the Apache2 license. Additional capabilities for BLAT alignment are available under the BLAT license. jwala@broadinstitue.org ; rameen@broadinstitute.org. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  20. Exploration of noncoding sequences in metagenomes.

    Directory of Open Access Journals (Sweden)

    Fabián Tobar-Tosse

    Full Text Available Environment-dependent genomic features have been defined for different metagenomes, whose genes and their associated processes are related to specific environments. Identification of ORFs and their functional categories are the most common methods for association between functional and environmental features. However, this analysis based on finding ORFs misses noncoding sequences and, therefore, some metagenome regulatory or structural information could be discarded. In this work we analyzed 23 whole metagenomes, including coding and noncoding sequences using the following sequence patterns: (G+C content, Codon Usage (Cd, Trinucleotide Usage (Tn, and functional assignments for ORF prediction. Herein, we present evidence of a high proportion of noncoding sequences discarded in common similarity-based methods in metagenomics, and the kind of relevant information present in those. We found a high density of trinucleotide repeat sequences (TRS in noncoding sequences, with a regulatory and adaptive function for metagenome communities. We present associations between trinucleotide values and gene function, where metagenome clustering correlate with microorganism adaptations and kinds of metagenomes. We propose here that noncoding sequences have relevant information to describe metagenomes that could be considered in a whole metagenome analysis in order to improve their organization, classification protocols, and their relation with the environment.