WorldWideScience

Sample records for transcriptase coding sequences

  1. Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis

    Directory of Open Access Journals (Sweden)

    Ma Bi

    2017-10-01

    Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.

  2. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

    Science.gov (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  3. Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase

    OpenAIRE

    DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami

    2012-01-01

    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

  4. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  5. Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

    Science.gov (United States)

    Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

    2012-08-01

    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

  6. Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

    Science.gov (United States)

    Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

    2014-01-13

    high processivity and fidelity of group II intron reverse transcriptases along with their novel template-switching activity, which can directly link RNA-seq adaptor sequences to cDNAs during reverse transcription, open new approaches for RNA-seq and the identification and profiling of non-coding RNAs, with potentially wide applications in research and biotechnology.

  7. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  8. Phylogenetic analysis of HIV-1 reverse transcriptase sequences from 382 patients recruited in JJ Hospital of Mumbai, India, between 2002 and 2008.

    Science.gov (United States)

    Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J

    2009-06-01

    Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.

  9. Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

    Energy Technology Data Exchange (ETDEWEB)

    Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

    2007-02-21

    Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

  10. Development and customization of a color-coded microbeads-based assay for drug resistance in HIV-1 reverse transcriptase.

    Science.gov (United States)

    Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki

    2014-01-01

    Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.

  11. Coding visual features extracted from video sequences.

    Science.gov (United States)

    Baroffio, Luca; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2014-05-01

    Visual features are successfully exploited in several applications (e.g., visual search, object recognition and tracking, etc.) due to their ability to efficiently represent image content. Several visual analysis tasks require features to be transmitted over a bandwidth-limited network, thus calling for coding techniques to reduce the required bit budget, while attaining a target level of efficiency. In this paper, we propose, for the first time, a coding architecture designed for local features (e.g., SIFT, SURF) extracted from video sequences. To achieve high coding efficiency, we exploit both spatial and temporal redundancy by means of intraframe and interframe coding modes. In addition, we propose a coding mode decision based on rate-distortion optimization. The proposed coding scheme can be conveniently adopted to implement the analyze-then-compress (ATC) paradigm in the context of visual sensor networks. That is, sets of visual features are extracted from video frames, encoded at remote nodes, and finally transmitted to a central controller that performs visual analysis. This is in contrast to the traditional compress-then-analyze (CTA) paradigm, in which video sequences acquired at a node are compressed and then sent to a central unit for further processing. In this paper, we compare these coding paradigms using metrics that are routinely adopted to evaluate the suitability of visual features in the context of content-based retrieval, object recognition, and tracking. Experimental results demonstrate that, thanks to the significant coding gains achieved by the proposed coding scheme, ATC outperforms CTA with respect to all evaluation metrics.

  12. Some Algebraic Aspects of MorseCode Sequences

    OpenAIRE

    Johann Cigler

    2003-01-01

    Morse code sequences are very useful to give combinatorial interpretations of various properties of Fibonacci numbers. In this note we study some algebraic and combinatorial aspects of Morse code sequences and obtain several q-analogues of Fibonacci numbers and Fibonacci polynomials and their generalizations.

  13. Some Algebraic Aspects of MorseCode Sequences

    Directory of Open Access Journals (Sweden)

    Johann Cigler

    2003-06-01

    Full Text Available Morse code sequences are very useful to give combinatorial interpretations of various properties of Fibonacci numbers. In this note we study some algebraic and combinatorial aspects of Morse code sequences and obtain several q-analogues of Fibonacci numbers and Fibonacci polynomials and their generalizations.

  14. Purifying selection acts on coding and non-coding sequences of paralogous genes in Arabidopsis thaliana.

    Science.gov (United States)

    Hoffmann, Robert D; Palmgren, Michael

    2016-06-13

    Whole-genome duplications in the ancestors of many diverse species provided the genetic material for evolutionary novelty. Several models explain the retention of paralogous genes. However, how these models are reflected in the evolution of coding and non-coding sequences of paralogous genes is unknown. Here, we analyzed the coding and non-coding sequences of paralogous genes in Arabidopsis thaliana and compared these sequences with those of orthologous genes in Arabidopsis lyrata. Paralogs with lower expression than their duplicate had more nonsynonymous substitutions, were more likely to fractionate, and exhibited less similar expression patterns with their orthologs in the other species. Also, lower-expressed genes had greater tissue specificity. Orthologous conserved non-coding sequences in the promoters, introns, and 3' untranslated regions were less abundant at lower-expressed genes compared to their higher-expressed paralogs. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to ribosomes, whereas paralogs with different expression levels were enriched in terms associated with stress responses. Loss of conserved non-coding sequences in one gene of a paralogous gene pair correlates with reduced expression levels that are more tissue specific. Together with increased mutation rates in the coding sequences, this suggests that similar forces of purifying selection act on coding and non-coding sequences. We propose that coding and non-coding sequences evolve concurrently following gene duplication.

  15. Deep sequencing analysis of HIV-1 reverse transcriptase at baseline and time of failure in patients receiving rilpivirine in the phase III studies ECHO and THRIVE.

    Science.gov (United States)

    Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan

    2016-05-01

    Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.

  16. Novel overlapping coding sequences in Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Jensen, Klaus Thorleif; Petersen, Lise; Falk, Søren

    2006-01-01

    that are in agreement with the primary annotation. Forty two genes from the primary annotation are not predicted by EasyGene. The majority of these genes are listed as hypothetical in the primary annotation. The 15 novel predicted genes all overlap with genes on the complementary strand. We find homologues of several...... of the novel genes in C. trachomatis Serovar A and Chlamydia muridarum. Several of the genes have typical gene-like and protein-like features. Furthermore, we confirm transcriptional activity from 10 of the putative genes. The combined evidence suggests that at least seven of the 15 are protein coding genes...

  17. Genetic Code Analysis Toolkit: A novel tool to explore the coding properties of the genetic code and DNA sequences

    Science.gov (United States)

    Kraljić, K.; Strüngmann, L.; Fimmel, E.; Gumbel, M.

    2018-01-01

    The genetic code is degenerated and it is assumed that redundancy provides error detection and correction mechanisms in the translation process. However, the biological meaning of the code's structure is still under current research. This paper presents a Genetic Code Analysis Toolkit (GCAT) which provides workflows and algorithms for the analysis of the structure of nucleotide sequences. In particular, sets or sequences of codons can be transformed and tested for circularity, comma-freeness, dichotomic partitions and others. GCAT comes with a fertile editor custom-built to work with the genetic code and a batch mode for multi-sequence processing. With the ability to read FASTA files or load sequences from GenBank, the tool can be used for the mathematical and statistical analysis of existing sequence data. GCAT is Java-based and provides a plug-in concept for extensibility. Availability: Open source Homepage:http://www.gcat.bio/

  18. An Auto sequence Code to Integrate a Neutron Unfolding Code with thePC-MCA Accuspec

    International Nuclear Information System (INIS)

    Darsono

    2000-01-01

    In a neutron spectrometry using proton recoil method, the neutronunfolding code is needed to unfold the measured proton spectrum to become theneutron spectrum. The process of the unfolding neutron in the existingneutron spectrometry which was successfully installed last year was doneseparately. This manuscript reports that the auto sequence code to integratethe neutron unfolding code UNFSPEC.EXE with the software facility of thePC-MCA Accuspec has been made and run successfully so that the new neutronspectrometry become compact. The auto sequence code was written based on therules in application program facility of PC-MCA Accuspec and then it wascompiled using AC-EXE. Result of the test of the auto sequence code showedthat for binning width 20, 30, and 40 giving a little different spectrumshape. The binning width around 30 gives a better spectrum in mean of givingsmall error compared to the others. (author)

  19. Algebraic solution of the synthesis problem for coded sequences

    International Nuclear Information System (INIS)

    Leukhin, Anatolii N

    2005-01-01

    The algebraic solution of a 'complex' problem of synthesis of phase-coded (PC) sequences with the zero level of side lobes of the cyclic autocorrelation function (ACF) is proposed. It is shown that the solution of the synthesis problem is connected with the existence of difference sets for a given code dimension. The problem of estimating the number of possible code combinations for a given code dimension is solved. It is pointed out that the problem of synthesis of PC sequences is related to the fundamental problems of discrete mathematics and, first of all, to a number of combinatorial problems, which can be solved, as the number factorisation problem, by algebraic methods by using the theory of Galois fields and groups. (fourth seminar to the memory of d.n. klyshko)

  20. Sequence Coding and Search System Backfit Quality Assurance Program Plan

    International Nuclear Information System (INIS)

    Lovell, C.J.; Stepina, P.L.

    1985-03-01

    The Sequence Coding and Search System is a computer-based encoding system for events described in Licensee Event Reports. This data system contains LERs from 1981 to present. Backfit of the data system to include LERs prior to 1981 is required. This report documents the Quality Assurance Program Plan that EG and G Idaho, Inc. will follow while encoding 1980 LERs

  1. Machine-Checked Sequencer for Critical Embedded Code Generator

    Science.gov (United States)

    Izerrouken, Nassima; Pantel, Marc; Thirioux, Xavier

    This paper presents the development of a correct-by-construction block sequencer for GeneAuto a qualifiable (according to DO178B/ED12B recommendation) automatic code generator. It transforms Simulink models to MISRA C code for safety critical systems. Our approach which combines classical development process and formal specification and verification using proof-assistants, led to preliminary fruitful exchanges with certification authorities. We present parts of the classical user and tools requirements and derived formal specifications, implementation and verification for the correctness and termination of the block sequencer. This sequencer has been successfully applied to real-size industrial use cases from various transportation domain partners and led to requirement errors detection and a correct-by-construction implementation.

  2. DNA watermarks in non-coding regulatory sequences

    Directory of Open Access Journals (Sweden)

    Pyka Martin

    2009-07-01

    Full Text Available Abstract Background DNA watermarks can be applied to identify the unauthorized use of genetically modified organisms. It has been shown that coding regions can be used to encrypt information into living organisms by using the DNA-Crypt algorithm. Yet, if the sequence of interest presents a non-coding DNA sequence, either the function of a resulting functional RNA molecule or a regulatory sequence, such as a promoter, could be affected. For our studies we used the small cytoplasmic RNA 1 in yeast and the lac promoter region of Escherichia coli. Findings The lac promoter was deactivated by the integrated watermark. In addition, the RNA molecules displayed altered configurations after introducing a watermark, but surprisingly were functionally intact, which has been verified by analyzing the growth characteristics of both wild type and watermarked scR1 transformed yeast cells. In a third approach we introduced a second overlapping watermark into the lac promoter, which did not affect the promoter activity. Conclusion Even though the watermarked RNA and one of the watermarked promoters did not show any significant differences compared to the wild type RNA and wild type promoter region, respectively, it cannot be generalized that other RNA molecules or regulatory sequences behave accordingly. Therefore, we do not recommend integrating watermark sequences into regulatory regions.

  3. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  4. Performance Analysis for Cooperative Communication System with QC-LDPC Codes Constructed with Integer Sequences

    Directory of Open Access Journals (Sweden)

    Yan Zhang

    2015-01-01

    Full Text Available This paper presents four different integer sequences to construct quasi-cyclic low-density parity-check (QC-LDPC codes with mathematical theory. The paper introduces the procedure of the coding principle and coding. Four different integer sequences constructing QC-LDPC code are compared with LDPC codes by using PEG algorithm, array codes, and the Mackey codes, respectively. Then, the integer sequence QC-LDPC codes are used in coded cooperative communication. Simulation results show that the integer sequence constructed QC-LDPC codes are effective, and overall performance is better than that of other types of LDPC codes in the coded cooperative communication. The performance of Dayan integer sequence constructed QC-LDPC is the most excellent performance.

  5. Licensee Event Report sequence coding and search procedure workshop

    International Nuclear Information System (INIS)

    Cottrell, W.B.; Gallaher, R.B.

    1981-01-01

    Since mid-1980, the Office for Analysis and Evaluation of Operational Data (AEOD) of the Nuclear Regulatory Commission (NRC) has been developing procedures for the systematic review and analysis of Licensee Event Reports (LERs). These procedures generally address several areas of concern, including identification of significant trends and patterns, event sequence of occurrences, component failures, and system and plant effects. The AEOD and NSIC conducted a workshop on the new coding procedure at the American Museum of Science and Energy in Oak Ridge, TN, on November 24, 1980

  6. Sequence Coding and Search System for licensee event reports: code listings. Volume 2

    International Nuclear Information System (INIS)

    Gallaher, R.B.; Guymon, R.H.; Mays, G.T.; Poore, W.P.; Cagle, R.J.; Harrington, K.H.; Johnson, M.P.

    1985-04-01

    Operating experience data from nuclear power plants are essential for safety and reliability analyses, especially analyses of trends and patterns. The licensee event reports (LERs) that are submitted to the Nuclear Regulatory Commission (NRC) by the nuclear power plant utilities contain much of this data. The NRC's Office for Analysis and Evaluation of Operational Data (AEOD) has developed, under contract with NSIC, a system for codifying the events reported in the LERs. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the LERs to coded sequences that are both computer-readable and computer-searchable. This system provides a structured format for detailed coding of component, system, and unit effects as well as personnel errors. The database contains all current LERs submitted by nuclear power plant utilities for events occurring since 1981 and is updated on a continual basis. Volume 2 contains all valid and acceptable codes used for searching and encoding the LER data. This volume contains updated material through amendment 1 to revision 1 of the working version of ORNL/NSIC-223, Vol. 2

  7. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    Science.gov (United States)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  8. Immune pressure analysis of protease and reverse transcriptase ...

    African Journals Online (AJOL)

    /dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...

  9. Coding patient emotional cues and concerns in medical consultations: the Verona coding definitions of emotional sequences (VR-CoDES).

    NARCIS (Netherlands)

    Zimmermann, C.; Piccolo, L. del; Bensing, J.; Bergvik, S.; Haes, H. de; Eide, H.; Fletcher, I.; Goss, C.; Heaven, C.; Humphris, G.; Young-Mi, K.; Langewitz, W.; Meeuwesen, L.; Nuebling, M.; Rimondini, M.; Salmon, P.; Dulmen, S. van; Wissow, L.; Zandbelt, L.; Finset, A.

    2011-01-01

    Objective: To present the Verona Coding Definitions of Emotional Sequences (VR-CoDES CC), a consensus based system for coding patient expressions of emotional distress in medical consultations, defined as Cues or Concerns. Methods: The system was developed by an international group of communication

  10. Novel HBV recombinants between genotypes B and C in 3'-terminal reverse transcriptase (RT) sequences are associated with enhanced viral DNA load, higher RT point mutation rates and place of birth among Chinese patients.

    Science.gov (United States)

    Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong

    2018-01-01

    As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.

  11. Genome-wide identification of coding and non-coding conserved sequence tags in human and mouse genomes

    Directory of Open Access Journals (Sweden)

    Maggi Giorgio P

    2008-06-01

    Full Text Available Abstract Background The accurate detection of genes and the identification of functional regions is still an open issue in the annotation of genomic sequences. This problem affects new genomes but also those of very well studied organisms such as human and mouse where, despite the great efforts, the inventory of genes and regulatory regions is far from complete. Comparative genomics is an effective approach to address this problem. Unfortunately it is limited by the computational requirements needed to perform genome-wide comparisons and by the problem of discriminating between conserved coding and non-coding sequences. This discrimination is often based (thus dependent on the availability of annotated proteins. Results In this paper we present the results of a comprehensive comparison of human and mouse genomes performed with a new high throughput grid-based system which allows the rapid detection of conserved sequences and accurate assessment of their coding potential. By detecting clusters of coding conserved sequences the system is also suitable to accurately identify potential gene loci. Following this analysis we created a collection of human-mouse conserved sequence tags and carefully compared our results to reliable annotations in order to benchmark the reliability of our classifications. Strikingly we were able to detect several potential gene loci supported by EST sequences but not corresponding to as yet annotated genes. Conclusion Here we present a new system which allows comprehensive comparison of genomes to detect conserved coding and non-coding sequences and the identification of potential gene loci. Our system does not require the availability of any annotated sequence thus is suitable for the analysis of new or poorly annotated genomes.

  12. Complete cDNA sequence coding for human docking protein

    Energy Technology Data Exchange (ETDEWEB)

    Hortsch, M; Labeit, S; Meyer, D I

    1988-01-11

    Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.

  13. Rfam: annotating families of non-coding RNA sequences.

    Science.gov (United States)

    Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W

    2015-01-01

    The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

  14. Fast comparison of IS radar code sequences for lag profile inversion

    Directory of Open Access Journals (Sweden)

    M. S. Lehtinen

    2008-08-01

    Full Text Available A fast method for theoretically comparing the posteriori variances produced by different phase code sequences in incoherent scatter radar (ISR experiments is introduced. Alternating codes of types 1 and 2 are known to be optimal for selected range resolutions, but the code sets are inconveniently long for many purposes like ground clutter estimation and in cases where coherent echoes from lower ionospheric layers are to be analyzed in addition to standard F-layer spectra.

    The method is used in practice for searching binary code quads that have estimation accuracy almost equal to that of much longer alternating code sets. Though the code sequences can consist of as few as four different transmission envelopes, the lag profile estimation variances are near to the theoretical minimum. Thus the short code sequence is equally good as a full cycle of alternating codes with the same pulse length and bit length. The short code groups cannot be directly decoded, but the decoding is done in connection with more computationally expensive lag profile inversion in data analysis.

    The actual code searches as well as the analysis and real data results from the found short code searches are explained in other papers sent to the same issue of this journal. We also discuss interesting subtle differences found between the different alternating codes by this method. We assume that thermal noise dominates the incoherent scatter signal.

  15. RNA-DNA sequence differences spell genetic code ambiguities

    DEFF Research Database (Denmark)

    Bentin, Thomas; Nielsen, Michael L

    2013-01-01

    A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...

  16. The Coding and Effector Transfer of Movement Sequences

    Science.gov (United States)

    Kovacs, Attila J.; Muhlbauer, Thomas; Shea, Charles H.

    2009-01-01

    Three experiments utilizing a 14-element arm movement sequence were designed to determine if reinstating the visual-spatial coordinates, which require movements to the same spatial locations utilized during acquisition, results in better effector transfer than reinstating the motor coordinates, which require the same pattern of homologous muscle…

  17. SEAPATH: A microcomputer code for evaluating physical security effectiveness using adversary sequence diagrams

    International Nuclear Information System (INIS)

    Darby, J.L.

    1986-01-01

    The Adversary Sequence Diagram (ASD) concept was developed by Sandia National Laboratories (SNL) to examine physical security system effectiveness. Sandia also developed a mainframe computer code, PANL, to analyze the ASD. The authors have developed a microcomputer code, SEAPATH, which also analyzes ASD's. The Authors are supporting SNL in software development of the SAVI code; SAVI utilizes the SEAPATH algorithm to identify and quantify paths

  18. Highly conserved non-coding sequences are associated with vertebrate development.

    Directory of Open Access Journals (Sweden)

    Adam Woolfe

    2005-01-01

    Full Text Available In addition to protein coding sequence, the human genome contains a significant amount of regulatory DNA, the identification of which is proving somewhat recalcitrant to both in silico and functional methods. An approach that has been used with some success is comparative sequence analysis, whereby equivalent genomic regions from different organisms are compared in order to identify both similarities and differences. In general, similarities in sequence between highly divergent organisms imply functional constraint. We have used a whole-genome comparison between humans and the pufferfish, Fugu rubripes, to identify nearly 1,400 highly conserved non-coding sequences. Given the evolutionary divergence between these species, it is likely that these sequences are found in, and furthermore are essential to, all vertebrates. Most, and possibly all, of these sequences are located in and around genes that act as developmental regulators. Some of these sequences are over 90% identical across more than 500 bases, being more highly conserved than coding sequence between these two species. Despite this, we cannot find any similar sequences in invertebrate genomes. In order to begin to functionally test this set of sequences, we have used a rapid in vivo assay system using zebrafish embryos that allows tissue-specific enhancer activity to be identified. Functional data is presented for highly conserved non-coding sequences associated with four unrelated developmental regulators (SOX21, PAX6, HLXB9, and SHH, in order to demonstrate the suitability of this screen to a wide range of genes and expression patterns. Of 25 sequence elements tested around these four genes, 23 show significant enhancer activity in one or more tissues. We have identified a set of non-coding sequences that are highly conserved throughout vertebrates. They are found in clusters across the human genome, principally around genes that are implicated in the regulation of development

  19. SRComp: short read sequence compression using burstsort and Elias omega coding.

    Directory of Open Access Journals (Sweden)

    Jeremy John Selva

    Full Text Available Next-generation sequencing (NGS technologies permit the rapid production of vast amounts of data at low cost. Economical data storage and transmission hence becomes an increasingly important challenge for NGS experiments. In this paper, we introduce a new non-reference based read sequence compression tool called SRComp. It works by first employing a fast string-sorting algorithm called burstsort to sort read sequences in lexicographical order and then Elias omega-based integer coding to encode the sorted read sequences. SRComp has been benchmarked on four large NGS datasets, where experimental results show that it can run 5-35 times faster than current state-of-the-art read sequence compression tools such as BEETL and SCALCE, while retaining comparable compression efficiency for large collections of short read sequences. SRComp is a read sequence compression tool that is particularly valuable in certain applications where compression time is of major concern.

  20. A comparison of the cytotoxicity and proinflammatory cytokine production of EndoSequence root repair material and ProRoot mineral trioxide aggregate in human osteoblast cell culture using reverse-transcriptase polymerase chain reaction.

    Science.gov (United States)

    Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre

    2012-04-01

    The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  1. Optical orthogonal code-division multiple-access system - Part 2: Multibits/sequence-period OOCDMA

    Science.gov (United States)

    Kwon, Hyuck M.

    1994-08-01

    In a recently proposed optical orthogonal code division multiple-access (OOCDMA) system, one bit of user's data is transmitted per sequence-period, and a threshold is employed for the final bit decision. In this paper, a system that can transmit multibits per sequence-period is introduced, and avalanche photodiode (APD) noise, thermal noise, and interference, are included. This system, derived by exploiting orthogonal properties of the OOCDMA code sequence and using a maximum search (instead of a threshold) in the final decision, is log(sub 2) F times higher in throughput, where F is sequence-period. For example, four orders of magnitude are better in bit error probability at - 56 dBW received laser power, with F = 1000 chips, 10 'marks' in a sequence, and 10 users of 30 Mb/s data rate for one-bit/sequence-period and 270 Mb/s data rate for multibits/sequence-period system. Furthermore, an exact analysis is performed for the log(sub 2)F bits/sequence-period system with a hard-limiter placed before the receiver, and its performance is compared to the performance without hard-limiter, for the chip-synchronous case. The improvement from using a hard-limiter is significant in the log(sub 2)F bits/sequence-period OCCDMA system.

  2. Modelling of blackout sequence at Atucha-1 using the MARCH3 code

    International Nuclear Information System (INIS)

    Baron, J.; Bastianelli, B.

    1997-01-01

    This paper presents the modelling of a complete blackout at the Atucha-1 NPP as preliminary phase for a Level II safety probabilistic analysis. The MARCH3 code of the STCP (Source Term Code Package) is used, based on a plant model made in accordance with particularities of the plant design. The analysis covers all the severe accident phases. The results allow to view the time sequence of the events, and provide the basis for source term studies. (author). 6 refs., 2 figs

  3. Analysis of the AD sequence in Zion plant using the March 1.1 code

    International Nuclear Information System (INIS)

    Oriolo, F.; Paci, S.

    1985-01-01

    The analyses of the AD sequences for the Zion power plant, made at the Pisa University, in the framework of the participation in the Source Tern Working Group. After a short description of the plant and the sequence under analysis, the model used for the reference computation and the results obtained using the March 1.1 code are shown. Together with the reference computation a series of parametric tests have been also made, concerning some input code variables, in order to ascertain their influence on the transient trend. The results of these analyses are shown in Appendix

  4. Sub-grouping of Plasmodium falciparum 3D7 var genes based on sequence analysis of coding and non-coding regions

    DEFF Research Database (Denmark)

    Lavstsen, Thomas; Salanti, Ali; Jensen, Anja T R

    2003-01-01

    and organization of the 3D7 PfEMP1 repertoire was investigated on the basis of the complete genome sequence. METHODS: Using two tree-building methods we analysed the coding and non-coding sequences of 3D7 var and rif genes as well as var genes of other parasite strains. RESULTS: var genes can be sub...

  5. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    KAUST Repository

    Zhang, Zhang; Yu, Jun

    2010-01-01

    Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

  6. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    KAUST Repository

    Zhang, Zhang

    2010-11-08

    Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

  7. Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

    Science.gov (United States)

    Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

    2010-02-01

    Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

  8. Complete coding sequence of Zika virus from Martinique outbreak in 2015

    Directory of Open Access Journals (Sweden)

    G. Piorkowski

    2016-05-01

    Full Text Available Zika virus is an Aedes-borne Flavivirus causing fever, arthralgia, myalgia rash, associated with Guillain–Barré syndrome and suspected to induce microcephaly in the fetus. We report here the complete coding sequence of the first characterized Caribbean Zika virus strain, isolated from a patient from Martinique in December, 2015.

  9. Multiple Access Interference Reduction Using Received Response Code Sequence for DS-CDMA UWB System

    Science.gov (United States)

    Toh, Keat Beng; Tachikawa, Shin'ichi

    This paper proposes a combination of novel Received Response (RR) sequence at the transmitter and a Matched Filter-RAKE (MF-RAKE) combining scheme receiver system for the Direct Sequence-Code Division Multiple Access Ultra Wideband (DS-CDMA UWB) multipath channel model. This paper also demonstrates the effectiveness of the RR sequence in Multiple Access Interference (MAI) reduction for the DS-CDMA UWB system. It suggests that by using conventional binary code sequence such as the M sequence or the Gold sequence, there is a possibility of generating extra MAI in the UWB system. Therefore, it is quite difficult to collect the energy efficiently although the RAKE reception method is applied at the receiver. The main purpose of the proposed system is to overcome the performance degradation for UWB transmission due to the occurrence of MAI during multiple accessing in the DS-CDMA UWB system. The proposed system improves the system performance by improving the RAKE reception performance using the RR sequence which can reduce the MAI effect significantly. Simulation results verify that significant improvement can be obtained by the proposed system in the UWB multipath channel models.

  10. Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

    Science.gov (United States)

    Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

  11. Blackout sequence modeling for Atucha-I with MARCH3 code

    International Nuclear Information System (INIS)

    Baron, J.; Bastianelli, B.

    1997-01-01

    The modeling of a blackout sequence in Atucha I nuclear power plant is presented in this paper, as a preliminary phase for a level II probabilistic safety assessment. Such sequence is analyzed with the code MARCH3 from STCP (Source Term Code Package), based on a specific model developed for Atucha, that takes into accounts it peculiarities. The analysis includes all the severe accident phases, from the initial transient (loss of heat sink), loss of coolant through the safety valves, core uncovered, heatup, metal-water reaction, melting and relocation, heatup and failure of the pressure vessel, core-concrete interaction in the reactor cavity, heatup and failure of the containment building (multi-compartmented) due to quasi-static overpressurization. The results obtained permit to visualize the time sequence of these events, as well as provide the basis for source term studies. (author) [es

  12. Consensus coding sequence (CCDS) database: a standardized set of human and mouse protein-coding regions supported by expert curation.

    Science.gov (United States)

    Pujar, Shashikant; O'Leary, Nuala A; Farrell, Catherine M; Loveland, Jane E; Mudge, Jonathan M; Wallin, Craig; Girón, Carlos G; Diekhans, Mark; Barnes, If; Bennett, Ruth; Berry, Andrew E; Cox, Eric; Davidson, Claire; Goldfarb, Tamara; Gonzalez, Jose M; Hunt, Toby; Jackson, John; Joardar, Vinita; Kay, Mike P; Kodali, Vamsi K; Martin, Fergal J; McAndrews, Monica; McGarvey, Kelly M; Murphy, Michael; Rajput, Bhanu; Rangwala, Sanjida H; Riddick, Lillian D; Seal, Ruth L; Suner, Marie-Marthe; Webb, David; Zhu, Sophia; Aken, Bronwen L; Bruford, Elspeth A; Bult, Carol J; Frankish, Adam; Murphy, Terence; Pruitt, Kim D

    2018-01-04

    The Consensus Coding Sequence (CCDS) project provides a dataset of protein-coding regions that are identically annotated on the human and mouse reference genome assembly in genome annotations produced independently by NCBI and the Ensembl group at EMBL-EBI. This dataset is the product of an international collaboration that includes NCBI, Ensembl, HUGO Gene Nomenclature Committee, Mouse Genome Informatics and University of California, Santa Cruz. Identically annotated coding regions, which are generated using an automated pipeline and pass multiple quality assurance checks, are assigned a stable and tracked identifier (CCDS ID). Additionally, coordinated manual review by expert curators from the CCDS collaboration helps in maintaining the integrity and high quality of the dataset. The CCDS data are available through an interactive web page (https://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi) and an FTP site (ftp://ftp.ncbi.nlm.nih.gov/pub/CCDS/). In this paper, we outline the ongoing work, growth and stability of the CCDS dataset and provide updates on new collaboration members and new features added to the CCDS user interface. We also present expert curation scenarios, with specific examples highlighting the importance of an accurate reference genome assembly and the crucial role played by input from the research community. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  13. The Evolution of Bony Vertebrate Enhancers at Odds with Their Coding Sequence Landscape.

    Science.gov (United States)

    Yousaf, Aisha; Sohail Raza, Muhammad; Ali Abbasi, Amir

    2015-08-06

    Enhancers lie at the heart of transcriptional and developmental gene regulation. Therefore, changes in enhancer sequences usually disrupt the target gene expression and result in disease phenotypes. Despite the well-established role of enhancers in development and disease, evolutionary sequence studies are lacking. The current study attempts to unravel the puzzle of bony vertebrates' conserved noncoding elements (CNE) enhancer evolution. Bayesian phylogenetics of enhancer sequences spotlights promising interordinal relationships among placental mammals, proposing a closer relationship between humans and laurasiatherians while placing rodents at the basal position. Clock-based estimates of enhancer evolution provided a dynamic picture of interspecific rate changes across the bony vertebrate lineage. Moreover, coelacanth in the study augmented our appreciation of the vertebrate cis-regulatory evolution during water-land transition. Intriguingly, we observed a pronounced upsurge in enhancer evolution in land-dwelling vertebrates. These novel findings triggered us to further investigate the evolutionary trend of coding as well as CNE nonenhancer repertoires, to highlight the relative evolutionary dynamics of diverse genomic landscapes. Surprisingly, the evolutionary rates of enhancer sequences were clearly at odds with those of the coding and the CNE nonenhancer sequences during vertebrate adaptation to land, with land vertebrates exhibiting significantly reduced rates of coding sequence evolution in comparison to their fast evolving regulatory landscape. The observed variation in tetrapod cis-regulatory elements caused the fine-tuning of associated gene regulatory networks. Therefore, the increased evolutionary rate of tetrapods' enhancer sequences might be responsible for the variation in developmental regulatory circuits during the process of vertebrate adaptation to land. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for

  14. Identification of evolutionarily conserved non-AUG-initiated N-terminal extensions in human coding sequences.

    LENUS (Irish Health Repository)

    Ivanov, Ivaylo P

    2011-05-01

    In eukaryotes, it is generally assumed that translation initiation occurs at the AUG codon closest to the messenger RNA 5\\' cap. However, in certain cases, initiation can occur at codons differing from AUG by a single nucleotide, especially the codons CUG, UUG, GUG, ACG, AUA and AUU. While non-AUG initiation has been experimentally verified for a handful of human genes, the full extent to which this phenomenon is utilized--both for increased coding capacity and potentially also for novel regulatory mechanisms--remains unclear. To address this issue, and hence to improve the quality of existing coding sequence annotations, we developed a methodology based on phylogenetic analysis of predicted 5\\' untranslated regions from orthologous genes. We use evolutionary signatures of protein-coding sequences as an indicator of translation initiation upstream of annotated coding sequences. Our search identified novel conserved potential non-AUG-initiated N-terminal extensions in 42 human genes including VANGL2, FGFR1, KCNN4, TRPV6, HDGF, CITED2, EIF4G3 and NTF3, and also affirmed the conservation of known non-AUG-initiated extensions in 17 other genes. In several instances, we have been able to obtain independent experimental evidence of the expression of non-AUG-initiated products from the previously published literature and ribosome profiling data.

  15. Golay sequences coded coherent optical OFDM for long-haul transmission

    Science.gov (United States)

    Qin, Cui; Ma, Xiangrong; Hua, Tao; Zhao, Jing; Yu, Huilong; Zhang, Jian

    2017-09-01

    We propose to use binary Golay sequences in coherent optical orthogonal frequency division multiplexing (CO-OFDM) to improve the long-haul transmission performance. The Golay sequences are generated by binary Reed-Muller codes, which have low peak-to-average power ratio and certain error correction capability. A low-complexity decoding algorithm for the Golay sequences is then proposed to recover the signal. Under same spectral efficiency, the QPSK modulated OFDM with binary Golay sequences coding with and without discrete Fourier transform (DFT) spreading (DFTS-QPSK-GOFDM and QPSK-GOFDM) are compared with the normal BPSK modulated OFDM with and without DFT spreading (DFTS-BPSK-OFDM and BPSK-OFDM) after long-haul transmission. At a 7% forward error correction code threshold (Q2 factor of 8.5 dB), it is shown that DFTS-QPSK-GOFDM outperforms DFTS-BPSK-OFDM by extending the transmission distance by 29% and 18%, in non-dispersion managed and dispersion managed links, respectively.

  16. The sequence coding and search system: an approach for constructing and analyzing event sequences at commercial nuclear power plants

    International Nuclear Information System (INIS)

    Mays, G.T.

    1990-01-01

    The U.S. Nuclear Regulatory Commission (NRC) has recognized the importance of the collection, assessment, and feedback of operating experience data from commercial nuclear power plants and has centralized these activities in the Office for Analysis and Evaluation of Operational Data (AEOD). Such data is essential for performing safety and reliability analyses, especially analyses of trends and patterns to identify undesirable changes in plant performance at the earliest opportunity to implement corrective measures to preclude the occurrence of a more serious event. One of NRC's principal tools for collecting and evaluating operating experience data is the Sequence Coding and Search System (SCSS). The SCSS consists of a methodology for structuring event sequences and the requisite computer system to store and search the data. The source information for SCSS is the Licensee Event Report (LER), which is a legally required document. This paper describes the objectives of SCSS, the information it contains, and the format and approach for constructing SCSS event sequences. Examples are presented demonstrating the use of SCSS to support the analysis of LER data. The SCSS contains over 30,000 LERs describing events from 1980 through the present. Insights gained from working with a complex data system from the initial developmental stage to the point of a mature operating system are highlighted. Considerable experience has been gained in the areas of evolving and changing data requirements, staffing requirements, and quality control and quality assurance procedures for addressing consistency, software/hardware considerations for developing and maintaining a complex system, documentation requirements, and end-user needs. Two other approaches for constructing and evaluating event sequences are examined including the Accident Precursor Program (ASP) where sequences having the potential for core damage are identified and analyzed, and the Significant Event Compilation Tree

  17. Coding and decoding libraries of sequence-defined functional copolymers synthesized via photoligation.

    Science.gov (United States)

    Zydziak, Nicolas; Konrad, Waldemar; Feist, Florian; Afonin, Sergii; Weidner, Steffen; Barner-Kowollik, Christopher

    2016-11-30

    Designing artificial macromolecules with absolute sequence order represents a considerable challenge. Here we report an advanced light-induced avenue to monodisperse sequence-defined functional linear macromolecules up to decamers via a unique photochemical approach. The versatility of the synthetic strategy-combining sequential and modular concepts-enables the synthesis of perfect macromolecules varying in chemical constitution and topology. Specific functions are placed at arbitrary positions along the chain via the successive addition of monomer units and blocks, leading to a library of functional homopolymers, alternating copolymers and block copolymers. The in-depth characterization of each sequence-defined chain confirms the precision nature of the macromolecules. Decoding of the functional information contained in the molecular structure is achieved via tandem mass spectrometry without recourse to their synthetic history, showing that the sequence information can be read. We submit that the presented photochemical strategy is a viable and advanced concept for coding individual monomer units along a macromolecular chain.

  18. PATACSDB—the database of polyA translational attenuators in coding sequences

    Directory of Open Access Journals (Sweden)

    Malgorzata Habich

    2016-02-01

    Full Text Available Recent additions to the repertoire of gene expression regulatory mechanisms are polyadenylate (polyA tracks encoding for poly-lysine runs in protein sequences. Such tracks stall the translation apparatus and induce frameshifting independently of the effects of charged nascent poly-lysine sequence on the ribosome exit channel. As such, they substantially influence the stability of mRNA and the amount of protein produced from a given transcript. Single base changes in these regions are enough to exert a measurable response on both protein and mRNA abundance; this makes each of these sequences a potentially interesting case study for the effects of synonymous mutation, gene dosage balance and natural frameshifting. Here we present PATACSDB, a resource that contain a comprehensive list of polyA tracks from over 250 eukaryotic genomes. Our data is based on the Ensembl genomic database of coding sequences and filtered with algorithm of 12A-1 which selects sequences of polyA tracks with a minimal length of 12 A’s allowing for one mismatched base. The PATACSDB database is accessible at: http://sysbio.ibb.waw.pl/patacsdb. The source code is available at http://github.com/habich/PATACSDB, and it includes the scripts with which the database can be recreated.

  19. RevTrans: multiple alignment of coding DNA from aligned amino acid sequences

    DEFF Research Database (Denmark)

    Wernersson, Rasmus; Pedersen, Anders Gorm

    2003-01-01

    The simple fact that proteins are built from 20 amino acids while DNA only contains four different bases, means that the 'signal-to-noise ratio' in protein sequence alignments is much better than in alignments of DNA. Besides this information-theoretical advantage, protein alignments also benefit...... proteins. It is therefore preferable to align coding DNA at the amino acid level and it is for this purpose we have constructed the program RevTrans. RevTrans constructs a multiple DNA alignment by: (i) translating the DNA; (ii) aligning the resulting peptide sequences; and (iii) building a multiple DNA...

  20. Application of Melcor code for the calculo of TMLB sequence in PWR with natural circulating into the vessel

    International Nuclear Information System (INIS)

    Marten-Fuertes, F.

    1995-01-01

    The use of computer codes to analyze the phenomena of severe accidents is very important to take decisions in Nuclear Safety. This paper presents the MELCOR code used to calculate the TMLB sequence of PWR with natural circulation into the vessels. The main goal of this code is its application for the PSA (probabilistic safety analysis)

  1. Episodic sequence memory is supported by a theta-gamma phase code

    OpenAIRE

    Heusser, Andrew C.; Poeppel, David; Ezzyat, Youssef; Davachi, Lila

    2016-01-01

    The meaning we derive from our experiences is not a simple static extraction of the elements, but is largely based on the order in which those elements occur. Models propose that sequence encoding is supported by interactions between high and low frequency oscillations, such that elements within an experience are represented by neural cell assemblies firing at higher frequencies (i.e. gamma) and sequential order is coded by the specific timing of firing with respect to a lower frequency oscil...

  2. Sequence Coding and Search System for licensee event reports: coder's manual. Volume 4

    International Nuclear Information System (INIS)

    Gallaher, R.B.; Guymon, R.H.; Mays, G.T.; Poore, W.P.; Cagle, R.J.; Harrington, K.H.; Johnson, M.P.

    1985-04-01

    Operating experience data from nuclear power plants are essential for safety and reliability analyses, especially analyses of trends and patterns. The licensee event reports (LERs) that are submitted to the Nuclear Regulatory Commission (NRC) by the nuclear power plant utilities contain much of this data. The NRC's Office for Analysis and Evaluation of Operational Data (AEOD) has developed, under contract with NSIC, a system for codifying the events reported in the LERs. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the LERs to coded sequences that are both computer-readable and computer-searchable. This four volume report documents and describes SCSS in detail. Volume 3 and 4 provide a technical processor, new to SCSS, the information and methodology necessary to capture descriptive data from the LER and to codify that data into a structured format and serve as reference material for the more experienced technical processor, and contains information that is essential for the more advanced user who needs to be familiar with the intricate coding techniques in order to retrieve specific details in a sequence. This volume contains updated material through amendment 1 to revision 1 of the working version of ORNL/NSIC-223, Vol. 4

  3. Sequence Coding and Search System for licensee event reports: coder's manual. Volume 3

    International Nuclear Information System (INIS)

    Gallaher, R.B.; Guymon, R.H.; Mays, G.T.; Poore, W.P.; Cagle, R.J.; Harrington, K.H.; Johnson, M.P.

    1985-04-01

    Operating experience data from nuclear power plants are essential for safety and reliability analyses, especially analyses of trends and patterns. The licensee event reports (LERs) that are submitted to the Nuclear Regulatory Commission (NRC) by the nuclear power plant utilities contain much of this data. The NRC's Office for Analysis and Evaluation of Operational Data (AEOD) has developed, under contract with NSIC, a system for codifying the events reported in the LERs. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the LERs to coded sequences that are both computer-readable and computer-searchable. This four volume report documents and describes SCSS in detail. Volumes 3 and 4 provide a technical processor, new to SCSS, the information and methodology necessary to capture descriptive data from the LER and to codify that data into a structured format and serve as reference material for the more experienced technical processor, and contains information is essential for the more advanced user who needs to be familiar with the intricate coding techniques in order to retrieve specific details in a sequence. This volume contains updated material through amendment 1 to revision 1 of the working version of ORNL/NSIC-223, Vol. 3

  4. The sequence coding and search system: An approach for constructing and analyzing event sequences at commercial nuclear power plants

    International Nuclear Information System (INIS)

    Mays, G.T.

    1989-04-01

    The US Nuclear Regulatory Commission (NRC) has recognized the importance of the collection, assessment, and feedstock of operating experience data from commercial nuclear power plants and has centralized these activities in the Office for Analysis and Evaluation of Operational Data (AEOD). Such data is essential for performing safety and reliability analyses, especially analyses of trends and patterns to identify undesirable changes in plant performance at the earliest opportunity to implement corrective measures to preclude the occurrences of a more serious event. One of NRC's principal tools for collecting and evaluating operating experience data is the Sequence Coding and Search System (SCSS). The SCSS consists of a methodology for structuring event sequences and the requisite computer system to store and search the data. The source information for SCSS is the Licensee Event Report (LER), which is a legally required document. This paper describes the objective SCSS, the information it contains, and the format and approach for constructuring SCSS event sequences. Examples are presented demonstrating the use SCSS to support the analysis of LER data. The SCSS contains over 30,000 LERs describing events from 1980 through the present. Insights gained from working with a complex data system from the initial developmental stage to the point of a mature operating system are highlighted

  5. Coding sequence of human rho cDNAs clone 6 and clone 9

    Energy Technology Data Exchange (ETDEWEB)

    Chardin, P; Madaule, P; Tavitian, A

    1988-03-25

    The authors have isolated human cDNAs including the complete coding sequence for two rho proteins corresponding to the incomplete isolates previously described as clone 6 and clone 9. The deduced a.a. sequences, when compared to the a.a. sequence deduced from clone 12 cDNA, show that there are in human at least three highly homologous rho genes. They suggest that clone 12 be named rhoA, clone 6 : rhoB and clone 9 : rhoC. RhoA, B and C proteins display approx. 30% a.a. identity with ras proteins,. mainly clustered in four highly homologous internal regions corresponding to the GTP binding site; however at least one significant difference is found; the 3 rho proteins have an Alanine in position corresponding to ras Glycine 13, suggesting that rho and ras proteins might have slightly different biochemical properties.

  6. Enhanced Protein Production in Escherichia coli by Optimization of Cloning Scars at the Vector-Coding Sequence Junction

    DEFF Research Database (Denmark)

    Mirzadeh, Kiavash; Martinez, Virginia; Toddo, Stephen

    2015-01-01

    are poorly expressed even when they are codon-optimized and expressed from vectors with powerful genetic elements. In this study, we show that poor expression can be caused by certain nucleotide sequences (e.g., cloning scars) at the junction between the vector and the coding sequence. Since these sequences...

  7. cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

    International Nuclear Information System (INIS)

    Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.

    1987-01-01

    The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

  8. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

    Science.gov (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

    2013-10-01

    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  9. Sequence Coding and Search System for licensee event reports: user's guide. Volume 1, Revision 1

    International Nuclear Information System (INIS)

    Greene, N.M.; Mays, G.T.; Johnson, M.P.

    1985-04-01

    Operating experience data from nuclear power plants are essential for safety and reliability analyses, especially analyses of trends and patterns. The licensee event reports (LERs) that are submitted to the Nuclear Regulatory Commission (NRC) by the nuclear power plant utilities contain much of this data. The NRC's Office for Analysis and Evaluation of Operational Data (AEOD) has developed, under contract with NSIC, a system for codifying the events reported in the LERs. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the LERs to coded sequences that are both computer-readable and computer-searchable. This system provides a structured format for detailed coding of component, system, and unit effects as well as personnel errors. The database contains all current LERs submitted by nuclear power plant utilities for events occurring since 1981 and is updated on a continual basis. This four volume report documents and describes SCSS in detail. Volume 1 is a User's Guide for searching the SCSS database. This volume contains updated material through February 1985 of the working version of ORNL/NSIC-223, Vol. 1

  10. Hybridization-based reconstruction of small non-coding RNA transcripts from deep sequencing data.

    Science.gov (United States)

    Ragan, Chikako; Mowry, Bryan J; Bauer, Denis C

    2012-09-01

    Recent advances in RNA sequencing technology (RNA-Seq) enables comprehensive profiling of RNAs by producing millions of short sequence reads from size-fractionated RNA libraries. Although conventional tools for detecting and distinguishing non-coding RNAs (ncRNAs) from reference-genome data can be applied to sequence data, ncRNA detection can be improved by harnessing the full information content provided by this new technology. Here we present NorahDesk, the first unbiased and universally applicable method for small ncRNAs detection from RNA-Seq data. NorahDesk utilizes the coverage-distribution of small RNA sequence data as well as thermodynamic assessments of secondary structure to reliably predict and annotate ncRNA classes. Using publicly available mouse sequence data from brain, skeletal muscle, testis and ovary, we evaluated our method with an emphasis on the performance for microRNAs (miRNAs) and piwi-interacting small RNA (piRNA). We compared our method with Dario and mirDeep2 and found that NorahDesk produces longer transcripts with higher read coverage. This feature makes it the first method particularly suitable for the prediction of both known and novel piRNAs.

  11. SinEx DB: a database for single exon coding sequences in mammalian genomes.

    Science.gov (United States)

    Jorquera, Roddy; Ortiz, Rodrigo; Ossandon, F; Cárdenas, Juan Pablo; Sepúlveda, Rene; González, Carolina; Holmes, David S

    2016-01-01

    Eukaryotic genes are typically interrupted by intragenic, noncoding sequences termed introns. However, some genes lack introns in their coding sequence (CDS) and are generally known as 'single exon genes' (SEGs). In this work, a SEG is defined as a nuclear, protein-coding gene that lacks introns in its CDS. Whereas, many public databases of Eukaryotic multi-exon genes are available, there are only two specialized databases for SEGs. The present work addresses the need for a more extensive and diverse database by creating SinEx DB, a publicly available, searchable database of predicted SEGs from 10 completely sequenced mammalian genomes including human. SinEx DB houses the DNA and protein sequence information of these SEGs and includes their functional predictions (KOG) and the relative distribution of these functions within species. The information is stored in a relational database built with My SQL Server 5.1.33 and the complete dataset of SEG sequences and their functional predictions are available for downloading. SinEx DB can be interrogated by: (i) a browsable phylogenetic schema, (ii) carrying out BLAST searches to the in-house SinEx DB of SEGs and (iii) via an advanced search mode in which the database can be searched by key words and any combination of searches by species and predicted functions. SinEx DB provides a rich source of information for advancing our understanding of the evolution and function of SEGs.Database URL: www.sinex.cl. © The Author(s) 2016. Published by Oxford University Press.

  12. A versatile palindromic amphipathic repeat coding sequence horizontally distributed among diverse bacterial and eucaryotic microbes

    Directory of Open Access Journals (Sweden)

    Glass John I

    2010-07-01

    repeat may be disseminated by HGT and intra-genomic shuffling. Conclusions We describe novel features of PARCELs (Palindromic Amphipathic Repeat Coding ELements, a set of widely distributed repeat protein domains and coding sequences that were likely acquired through HGT by diverse unicellular microbes, further mobilized and diversified within genomes, and co-opted for expression in the membrane proteome of some taxa. Disseminated by multiple gene-centric vehicles, ORFs harboring these elements enhance accessory gene pools as part of the "mobilome" connecting genomes of various clades, in taxa sharing common niches.

  13. Whole-Exome Sequencing Identifies Rare and Low-Frequency Coding Variants Associated with LDL Cholesterol

    Science.gov (United States)

    Lange, Leslie A.; Hu, Youna; Zhang, He; Xue, Chenyi; Schmidt, Ellen M.; Tang, Zheng-Zheng; Bizon, Chris; Lange, Ethan M.; Smith, Joshua D.; Turner, Emily H.; Jun, Goo; Kang, Hyun Min; Peloso, Gina; Auer, Paul; Li, Kuo-ping; Flannick, Jason; Zhang, Ji; Fuchsberger, Christian; Gaulton, Kyle; Lindgren, Cecilia; Locke, Adam; Manning, Alisa; Sim, Xueling; Rivas, Manuel A.; Holmen, Oddgeir L.; Gottesman, Omri; Lu, Yingchang; Ruderfer, Douglas; Stahl, Eli A.; Duan, Qing; Li, Yun; Durda, Peter; Jiao, Shuo; Isaacs, Aaron; Hofman, Albert; Bis, Joshua C.; Correa, Adolfo; Griswold, Michael E.; Jakobsdottir, Johanna; Smith, Albert V.; Schreiner, Pamela J.; Feitosa, Mary F.; Zhang, Qunyuan; Huffman, Jennifer E.; Crosby, Jacy; Wassel, Christina L.; Do, Ron; Franceschini, Nora; Martin, Lisa W.; Robinson, Jennifer G.; Assimes, Themistocles L.; Crosslin, David R.; Rosenthal, Elisabeth A.; Tsai, Michael; Rieder, Mark J.; Farlow, Deborah N.; Folsom, Aaron R.; Lumley, Thomas; Fox, Ervin R.; Carlson, Christopher S.; Peters, Ulrike; Jackson, Rebecca D.; van Duijn, Cornelia M.; Uitterlinden, André G.; Levy, Daniel; Rotter, Jerome I.; Taylor, Herman A.; Gudnason, Vilmundur; Siscovick, David S.; Fornage, Myriam; Borecki, Ingrid B.; Hayward, Caroline; Rudan, Igor; Chen, Y. Eugene; Bottinger, Erwin P.; Loos, Ruth J.F.; Sætrom, Pål; Hveem, Kristian; Boehnke, Michael; Groop, Leif; McCarthy, Mark; Meitinger, Thomas; Ballantyne, Christie M.; Gabriel, Stacey B.; O’Donnell, Christopher J.; Post, Wendy S.; North, Kari E.; Reiner, Alexander P.; Boerwinkle, Eric; Psaty, Bruce M.; Altshuler, David; Kathiresan, Sekar; Lin, Dan-Yu; Jarvik, Gail P.; Cupples, L. Adrienne; Kooperberg, Charles; Wilson, James G.; Nickerson, Deborah A.; Abecasis, Goncalo R.; Rich, Stephen S.; Tracy, Russell P.; Willer, Cristen J.; Gabriel, Stacey B.; Altshuler, David M.; Abecasis, Gonçalo R.; Allayee, Hooman; Cresci, Sharon; Daly, Mark J.; de Bakker, Paul I.W.; DePristo, Mark A.; Do, Ron; Donnelly, Peter; Farlow, Deborah N.; Fennell, Tim; Garimella, Kiran; Hazen, Stanley L.; Hu, Youna; Jordan, Daniel M.; Jun, Goo; Kathiresan, Sekar; Kang, Hyun Min; Kiezun, Adam; Lettre, Guillaume; Li, Bingshan; Li, Mingyao; Newton-Cheh, Christopher H.; Padmanabhan, Sandosh; Peloso, Gina; Pulit, Sara; Rader, Daniel J.; Reich, David; Reilly, Muredach P.; Rivas, Manuel A.; Schwartz, Steve; Scott, Laura; Siscovick, David S.; Spertus, John A.; Stitziel, Nathaniel O.; Stoletzki, Nina; Sunyaev, Shamil R.; Voight, Benjamin F.; Willer, Cristen J.; Rich, Stephen S.; Akylbekova, Ermeg; Atwood, Larry D.; Ballantyne, Christie M.; Barbalic, Maja; Barr, R. Graham; Benjamin, Emelia J.; Bis, Joshua; Boerwinkle, Eric; Bowden, Donald W.; Brody, Jennifer; Budoff, Matthew; Burke, Greg; Buxbaum, Sarah; Carr, Jeff; Chen, Donna T.; Chen, Ida Y.; Chen, Wei-Min; Concannon, Pat; Crosby, Jacy; Cupples, L. Adrienne; D’Agostino, Ralph; DeStefano, Anita L.; Dreisbach, Albert; Dupuis, Josée; Durda, J. Peter; Ellis, Jaclyn; Folsom, Aaron R.; Fornage, Myriam; Fox, Caroline S.; Fox, Ervin; Funari, Vincent; Ganesh, Santhi K.; Gardin, Julius; Goff, David; Gordon, Ora; Grody, Wayne; Gross, Myron; Guo, Xiuqing; Hall, Ira M.; Heard-Costa, Nancy L.; Heckbert, Susan R.; Heintz, Nicholas; Herrington, David M.; Hickson, DeMarc; Huang, Jie; Hwang, Shih-Jen; Jacobs, David R.; Jenny, Nancy S.; Johnson, Andrew D.; Johnson, Craig W.; Kawut, Steven; Kronmal, Richard; Kurz, Raluca; Lange, Ethan M.; Lange, Leslie A.; Larson, Martin G.; Lawson, Mark; Lewis, Cora E.; Levy, Daniel; Li, Dalin; Lin, Honghuang; Liu, Chunyu; Liu, Jiankang; Liu, Kiang; Liu, Xiaoming; Liu, Yongmei; Longstreth, William T.; Loria, Cay; Lumley, Thomas; Lunetta, Kathryn; Mackey, Aaron J.; Mackey, Rachel; Manichaikul, Ani; Maxwell, Taylor; McKnight, Barbara; Meigs, James B.; Morrison, Alanna C.; Musani, Solomon K.; Mychaleckyj, Josyf C.; Nettleton, Jennifer A.; North, Kari; O’Donnell, Christopher J.; O’Leary, Daniel; Ong, Frank; Palmas, Walter; Pankow, James S.; Pankratz, Nathan D.; Paul, Shom; Perez, Marco; Person, Sharina D.; Polak, Joseph; Post, Wendy S.; Psaty, Bruce M.; Quinlan, Aaron R.; Raffel, Leslie J.; Ramachandran, Vasan S.; Reiner, Alexander P.; Rice, Kenneth; Rotter, Jerome I.; Sanders, Jill P.; Schreiner, Pamela; Seshadri, Sudha; Shea, Steve; Sidney, Stephen; Silverstein, Kevin; Smith, Nicholas L.; Sotoodehnia, Nona; Srinivasan, Asoke; Taylor, Herman A.; Taylor, Kent; Thomas, Fridtjof; Tracy, Russell P.; Tsai, Michael Y.; Volcik, Kelly A.; Wassel, Chrstina L.; Watson, Karol; Wei, Gina; White, Wendy; Wiggins, Kerri L.; Wilk, Jemma B.; Williams, O. Dale; Wilson, Gregory; Wilson, James G.; Wolf, Phillip; Zakai, Neil A.; Hardy, John; Meschia, James F.; Nalls, Michael; Singleton, Andrew; Worrall, Brad; Bamshad, Michael J.; Barnes, Kathleen C.; Abdulhamid, Ibrahim; Accurso, Frank; Anbar, Ran; Beaty, Terri; Bigham, Abigail; Black, Phillip; Bleecker, Eugene; Buckingham, Kati; Cairns, Anne Marie; Caplan, Daniel; Chatfield, Barbara; Chidekel, Aaron; Cho, Michael; Christiani, David C.; Crapo, James D.; Crouch, Julia; Daley, Denise; Dang, Anthony; Dang, Hong; De Paula, Alicia; DeCelie-Germana, Joan; Drumm, Allen DozorMitch; Dyson, Maynard; Emerson, Julia; Emond, Mary J.; Ferkol, Thomas; Fink, Robert; Foster, Cassandra; Froh, Deborah; Gao, Li; Gershan, William; Gibson, Ronald L.; Godwin, Elizabeth; Gondor, Magdalen; Gutierrez, Hector; Hansel, Nadia N.; Hassoun, Paul M.; Hiatt, Peter; Hokanson, John E.; Howenstine, Michelle; Hummer, Laura K.; Kanga, Jamshed; Kim, Yoonhee; Knowles, Michael R.; Konstan, Michael; Lahiri, Thomas; Laird, Nan; Lange, Christoph; Lin, Lin; Lin, Xihong; Louie, Tin L.; Lynch, David; Make, Barry; Martin, Thomas R.; Mathai, Steve C.; Mathias, Rasika A.; McNamara, John; McNamara, Sharon; Meyers, Deborah; Millard, Susan; Mogayzel, Peter; Moss, Richard; Murray, Tanda; Nielson, Dennis; Noyes, Blakeslee; O’Neal, Wanda; Orenstein, David; O’Sullivan, Brian; Pace, Rhonda; Pare, Peter; Parker, H. Worth; Passero, Mary Ann; Perkett, Elizabeth; Prestridge, Adrienne; Rafaels, Nicholas M.; Ramsey, Bonnie; Regan, Elizabeth; Ren, Clement; Retsch-Bogart, George; Rock, Michael; Rosen, Antony; Rosenfeld, Margaret; Ruczinski, Ingo; Sanford, Andrew; Schaeffer, David; Sell, Cindy; Sheehan, Daniel; Silverman, Edwin K.; Sin, Don; Spencer, Terry; Stonebraker, Jackie; Tabor, Holly K.; Varlotta, Laurie; Vergara, Candelaria I.; Weiss, Robert; Wigley, Fred; Wise, Robert A.; Wright, Fred A.; Wurfel, Mark M.; Zanni, Robert; Zou, Fei; Nickerson, Deborah A.; Rieder, Mark J.; Green, Phil; Shendure, Jay; Akey, Joshua M.; Bustamante, Carlos D.; Crosslin, David R.; Eichler, Evan E.; Fox, P. Keolu; Fu, Wenqing; Gordon, Adam; Gravel, Simon; Jarvik, Gail P.; Johnsen, Jill M.; Kan, Mengyuan; Kenny, Eimear E.; Kidd, Jeffrey M.; Lara-Garduno, Fremiet; Leal, Suzanne M.; Liu, Dajiang J.; McGee, Sean; O’Connor, Timothy D.; Paeper, Bryan; Robertson, Peggy D.; Smith, Joshua D.; Staples, Jeffrey C.; Tennessen, Jacob A.; Turner, Emily H.; Wang, Gao; Yi, Qian; Jackson, Rebecca; Peters, Ulrike; Carlson, Christopher S.; Anderson, Garnet; Anton-Culver, Hoda; Assimes, Themistocles L.; Auer, Paul L.; Beresford, Shirley; Bizon, Chris; Black, Henry; Brunner, Robert; Brzyski, Robert; Burwen, Dale; Caan, Bette; Carty, Cara L.; Chlebowski, Rowan; Cummings, Steven; Curb, J. David; Eaton, Charles B.; Ford, Leslie; Franceschini, Nora; Fullerton, Stephanie M.; Gass, Margery; Geller, Nancy; Heiss, Gerardo; Howard, Barbara V.; Hsu, Li; Hutter, Carolyn M.; Ioannidis, John; Jiao, Shuo; Johnson, Karen C.; Kooperberg, Charles; Kuller, Lewis; LaCroix, Andrea; Lakshminarayan, Kamakshi; Lane, Dorothy; Lasser, Norman; LeBlanc, Erin; Li, Kuo-Ping; Limacher, Marian; Lin, Dan-Yu; Logsdon, Benjamin A.; Ludlam, Shari; Manson, JoAnn E.; Margolis, Karen; Martin, Lisa; McGowan, Joan; Monda, Keri L.; Kotchen, Jane Morley; Nathan, Lauren; Ockene, Judith; O’Sullivan, Mary Jo; Phillips, Lawrence S.; Prentice, Ross L.; Robbins, John; Robinson, Jennifer G.; Rossouw, Jacques E.; Sangi-Haghpeykar, Haleh; Sarto, Gloria E.; Shumaker, Sally; Simon, Michael S.; Stefanick, Marcia L.; Stein, Evan; Tang, Hua; Taylor, Kira C.; Thomson, Cynthia A.; Thornton, Timothy A.; Van Horn, Linda; Vitolins, Mara; Wactawski-Wende, Jean; Wallace, Robert; Wassertheil-Smoller, Sylvia; Zeng, Donglin; Applebaum-Bowden, Deborah; Feolo, Michael; Gan, Weiniu; Paltoo, Dina N.; Sholinsky, Phyliss; Sturcke, Anne

    2014-01-01

    Elevated low-density lipoprotein cholesterol (LDL-C) is a treatable, heritable risk factor for cardiovascular disease. Genome-wide association studies (GWASs) have identified 157 variants associated with lipid levels but are not well suited to assess the impact of rare and low-frequency variants. To determine whether rare or low-frequency coding variants are associated with LDL-C, we exome sequenced 2,005 individuals, including 554 individuals selected for extreme LDL-C (>98th or <2nd percentile). Follow-up analyses included sequencing of 1,302 additional individuals and genotype-based analysis of 52,221 individuals. We observed significant evidence of association between LDL-C and the burden of rare or low-frequency variants in PNPLA5, encoding a phospholipase-domain-containing protein, and both known and previously unidentified variants in PCSK9, LDLR and APOB, three known lipid-related genes. The effect sizes for the burden of rare variants for each associated gene were substantially higher than those observed for individual SNPs identified from GWASs. We replicated the PNPLA5 signal in an independent large-scale sequencing study of 2,084 individuals. In conclusion, this large whole-exome-sequencing study for LDL-C identified a gene not known to be implicated in LDL-C and provides unique insight into the design and analysis of similar experiments. PMID:24507775

  14. Verona Coding Definitions of Emotional Sequences (VR-CoDES): Conceptual framework and future directions.

    Science.gov (United States)

    Piccolo, Lidia Del; Finset, Arnstein; Mellblom, Anneli V; Figueiredo-Braga, Margarida; Korsvold, Live; Zhou, Yuefang; Zimmermann, Christa; Humphris, Gerald

    2017-12-01

    To discuss the theoretical and empirical framework of VR-CoDES and potential future direction in research based on the coding system. The paper is based on selective review of papers relevant to the construction and application of VR-CoDES. VR-CoDES system is rooted in patient-centered and biopsychosocial model of healthcare consultations and on a functional approach to emotion theory. According to the VR-CoDES, emotional interaction is studied in terms of sequences consisting of an eliciting event, an emotional expression by the patient and the immediate response by the clinician. The rationale for the emphasis on sequences, on detailed classification of cues and concerns, and on the choices of explicit vs. non-explicit responses and providing vs. reducing room for further disclosure, as basic categories of the clinician responses, is described. Results from research on VR-CoDES may help raise awareness of emotional sequences. Future directions in applying VR-CoDES in research may include studies on predicting patient and clinician behavior within the consultation, qualitative analyses of longer sequences including several VR-CoDES triads, and studies of effects of emotional communication on health outcomes. VR-CoDES may be applied to develop interventions to promote good handling of patients' emotions in healthcare encounters. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. An Explicit Construction of a sequence of codes attaining the Tsfasman-Vladut-Zink Bound:The first steps

    DEFF Research Database (Denmark)

    Høholdt, Tom; Voss, Cornelia

    1997-01-01

    We present a sequence of codes attaining the Tsfasman-Vladut-Zink bound. The construction is based on the tower of Artin-Schreier extensions described by Garcia and Stichtenoth (1995). We also determine the dual codes. The first steps of the constructions are explicitly given as generator matrices...

  16. Sequence-based heuristics for faster annotation of non-coding RNA families.

    Science.gov (United States)

    Weinberg, Zasha; Ruzzo, Walter L

    2006-01-01

    Non-coding RNAs (ncRNAs) are functional RNA molecules that do not code for proteins. Covariance Models (CMs) are a useful statistical tool to find new members of an ncRNA gene family in a large genome database, using both sequence and, importantly, RNA secondary structure information. Unfortunately, CM searches are extremely slow. Previously, we created rigorous filters, which provably sacrifice none of a CM's accuracy, while making searches significantly faster for virtually all ncRNA families. However, these rigorous filters make searches slower than heuristics could be. In this paper we introduce profile HMM-based heuristic filters. We show that their accuracy is usually superior to heuristics based on BLAST. Moreover, we compared our heuristics with those used in tRNAscan-SE, whose heuristics incorporate a significant amount of work specific to tRNAs, where our heuristics are generic to any ncRNA. Performance was roughly comparable, so we expect that our heuristics provide a high-quality solution that--unlike family-specific solutions--can scale to hundreds of ncRNA families. The source code is available under GNU Public License at the supplementary web site.

  17. Code-Switching to Know a TL Equivalent of an L1 Word: Request-Provision-Acknowledgement (RPA) Sequence

    Science.gov (United States)

    Lucero, Edgar

    2011-01-01

    This article focuses on the learner's use of Code-switching to learn the TL (Target Language) equivalent of an L1 word. The interactional pattern that this situation creates defines the Request-Provision-Acknowledgement (RPA) sequence. The article explains each of the turns of the sequence under the combination of the Ethnomethodological…

  18. Complete coding sequence of the human raf oncogene and the corresponding structure of the c-raf-1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Bonner, T I; Oppermann, H; Seeburg, P; Kerby, S B; Gunnell, M A; Young, A C; Rapp, U R

    1986-01-24

    The complete 648 amino acid sequence of the human raf oncogene was deduced from the 2977 nucleotide sequence of a fetal liver cDNA. The cDNA has been used to obtain clones which extend the human c-raf-1 locus by an additional 18.9 kb at the 5' end and contain all the remaining coding exons.

  19. Capsid coding sequences of foot-and-mouth disease viruses are determinants of pathogenicity in pigs

    DEFF Research Database (Denmark)

    Lohse, Louise; Jackson, Terry; Bøtner, Anette

    2012-01-01

    The surface exposed capsid proteins, VP1, VP2 and VP3, of foot-and-mouth disease virus (FMDV) determine its antigenicity and the ability of the virus to interact with host-cell receptors. Hence, modification of these structural proteins may alter the properties of the virus. In the present study we...... compared the pathogenicity of different FMDVs in young pigs. In total 32 pigs, 7-weeks-old, were exposed to virus, either by direct inoculation or through contact with inoculated pigs, using cell culture adapted (O1K B64), chimeric (O1K/A-TUR and O1K/O-UKG) or field strain (O-UKG/34/2001) viruses. The O1K...... coding sequences are determinants of FMDV pathogenicity in pigs....

  20. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P

    2007-01-01

    BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...

  1. Deep Sequencing Reveals Uncharted Isoform Heterogeneity of the Protein-Coding Transcriptome in Cerebral Ischemia.

    Science.gov (United States)

    Bhattarai, Sunil; Aly, Ahmed; Garcia, Kristy; Ruiz, Diandra; Pontarelli, Fabrizio; Dharap, Ashutosh

    2018-06-03

    Gene expression in cerebral ischemia has been a subject of intense investigations for several years. Studies utilizing probe-based high-throughput methodologies such as microarrays have contributed significantly to our existing knowledge but lacked the capacity to dissect the transcriptome in detail. Genome-wide RNA-sequencing (RNA-seq) enables comprehensive examinations of transcriptomes for attributes such as strandedness, alternative splicing, alternative transcription start/stop sites, and sequence composition, thus providing a very detailed account of gene expression. Leveraging this capability, we conducted an in-depth, genome-wide evaluation of the protein-coding transcriptome of the adult mouse cortex after transient focal ischemia at 6, 12, or 24 h of reperfusion using RNA-seq. We identified a total of 1007 transcripts at 6 h, 1878 transcripts at 12 h, and 1618 transcripts at 24 h of reperfusion that were significantly altered as compared to sham controls. With isoform-level resolution, we identified 23 splice variants arising from 23 genes that were novel mRNA isoforms. For a subset of genes, we detected reperfusion time-point-dependent splice isoform switching, indicating an expression and/or functional switch for these genes. Finally, for 286 genes across all three reperfusion time-points, we discovered multiple, distinct, simultaneously expressed and differentially altered isoforms per gene that were generated via alternative transcription start/stop sites. Of these, 165 isoforms derived from 109 genes were novel mRNAs. Together, our data unravel the protein-coding transcriptome of the cerebral cortex at an unprecedented depth to provide several new insights into the flexibility and complexity of stroke-related gene transcription and transcript organization.

  2. Phylogenomic Resolution of the Phylogeny of Laurasiatherian Mammals: Exploring Phylogenetic Signals within Coding and Noncoding Sequences.

    Science.gov (United States)

    Chen, Meng-Yun; Liang, Dan; Zhang, Peng

    2017-08-01

    The interordinal relationships of Laurasiatherian mammals are currently one of the most controversial questions in mammalian phylogenetics. Previous studies mainly relied on coding sequences (CDS) and seldom used noncoding sequences. Here, by data mining public genome data, we compiled an intron data set of 3,638 genes (all introns from a protein-coding gene are considered as a gene) (19,055,073 bp) and a CDS data set of 10,259 genes (20,994,285 bp), covering all major lineages of Laurasiatheria (except Pholidota). We found that the intron data contained stronger and more congruent phylogenetic signals than the CDS data. In agreement with this observation, concatenation and species-tree analyses of the intron data set yielded well-resolved and identical phylogenies, whereas the CDS data set produced weakly supported and incongruent results. Further analyses showed that the phylogeny inferred from the intron data is highly robust to data subsampling and change in outgroup, but the CDS data produced unstable results under the same conditions. Interestingly, gene tree statistical results showed that the most frequently observed gene tree topologies for the CDS and intron data are identical, suggesting that the major phylogenetic signal within the CDS data is actually congruent with that within the intron data. Our final result of Laurasiatheria phylogeny is (Eulipotyphla,((Chiroptera, Perissodactyla),(Carnivora, Cetartiodactyla))), favoring a close relationship between Chiroptera and Perissodactyla. Our study 1) provides a well-supported phylogenetic framework for Laurasiatheria, representing a step towards ending the long-standing "hard" polytomy and 2) argues that intron within genome data is a promising data resource for resolving rapid radiation events across the tree of life. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    Directory of Open Access Journals (Sweden)

    Jonas Binladen

    2007-02-01

    Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

  4. Reverse transcriptase inhibitors as microbicides.

    Science.gov (United States)

    Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido

    2012-01-01

    The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.

  5. Biased Gene Conversion and GC-Content Evolution in the Coding Sequences of Reptiles and Vertebrates

    Science.gov (United States)

    Figuet, Emeric; Ballenghien, Marion; Romiguier, Jonathan; Galtier, Nicolas

    2015-01-01

    Mammalian and avian genomes are characterized by a substantial spatial heterogeneity of GC-content, which is often interpreted as reflecting the effect of local GC-biased gene conversion (gBGC), a meiotic repair bias that favors G and C over A and T alleles in high-recombining genomic regions. Surprisingly, the first fully sequenced nonavian sauropsid (i.e., reptile), the green anole Anolis carolinensis, revealed a highly homogeneous genomic GC-content landscape, suggesting the possibility that gBGC might not be at work in this lineage. Here, we analyze GC-content evolution at third-codon positions (GC3) in 44 vertebrates species, including eight newly sequenced transcriptomes, with a specific focus on nonavian sauropsids. We report that reptiles, including the green anole, have a genome-wide distribution of GC3 similar to that of mammals and birds, and we infer a strong GC3-heterogeneity to be already present in the tetrapod ancestor. We further show that the dynamic of coding sequence GC-content is largely governed by karyotypic features in vertebrates, notably in the green anole, in agreement with the gBGC hypothesis. The discrepancy between third-codon positions and noncoding DNA regarding GC-content dynamics in the green anole could not be explained by the activity of transposable elements or selection on codon usage. This analysis highlights the unique value of third-codon positions as an insertion/deletion-free marker of nucleotide substitution biases that ultimately affect the evolution of proteins. PMID:25527834

  6. Transduplication resulted in the incorporation of two protein-coding sequences into the Turmoil-1 transposable element of C. elegans

    Directory of Open Access Journals (Sweden)

    Pupko Tal

    2008-10-01

    Full Text Available Abstract Transposable elements may acquire unrelated gene fragments into their sequences in a process called transduplication. Transduplication of protein-coding genes is common in plants, but is unknown of in animals. Here, we report that the Turmoil-1 transposable element in C. elegans has incorporated two protein-coding sequences into its inverted terminal repeat (ITR sequences. The ITRs of Turmoil-1 contain a conserved RNA recognition motif (RRM that originated from the rsp-2 gene and a fragment from the protein-coding region of the cpg-3 gene. We further report that an open reading frame specific to C. elegans may have been created as a result of a Turmoil-1 insertion. Mutations at the 5' splice site of this open reading frame may have reactivated the transduplicated RRM motif. Reviewers This article was reviewed by Dan Graur and William Martin. For the full reviews, please go to the Reviewers' Reports section.

  7. SHARAKU: an algorithm for aligning and clustering read mapping profiles of deep sequencing in non-coding RNA processing.

    Science.gov (United States)

    Tsuchiya, Mariko; Amano, Kojiro; Abe, Masaya; Seki, Misato; Hase, Sumitaka; Sato, Kengo; Sakakibara, Yasubumi

    2016-06-15

    Deep sequencing of the transcripts of regulatory non-coding RNA generates footprints of post-transcriptional processes. After obtaining sequence reads, the short reads are mapped to a reference genome, and specific mapping patterns can be detected called read mapping profiles, which are distinct from random non-functional degradation patterns. These patterns reflect the maturation processes that lead to the production of shorter RNA sequences. Recent next-generation sequencing studies have revealed not only the typical maturation process of miRNAs but also the various processing mechanisms of small RNAs derived from tRNAs and snoRNAs. We developed an algorithm termed SHARAKU to align two read mapping profiles of next-generation sequencing outputs for non-coding RNAs. In contrast with previous work, SHARAKU incorporates the primary and secondary sequence structures into an alignment of read mapping profiles to allow for the detection of common processing patterns. Using a benchmark simulated dataset, SHARAKU exhibited superior performance to previous methods for correctly clustering the read mapping profiles with respect to 5'-end processing and 3'-end processing from degradation patterns and in detecting similar processing patterns in deriving the shorter RNAs. Further, using experimental data of small RNA sequencing for the common marmoset brain, SHARAKU succeeded in identifying the significant clusters of read mapping profiles for similar processing patterns of small derived RNA families expressed in the brain. The source code of our program SHARAKU is available at http://www.dna.bio.keio.ac.jp/sharaku/, and the simulated dataset used in this work is available at the same link. Accession code: The sequence data from the whole RNA transcripts in the hippocampus of the left brain used in this work is available from the DNA DataBank of Japan (DDBJ) Sequence Read Archive (DRA) under the accession number DRA004502. yasu@bio.keio.ac.jp Supplementary data are available

  8. FOURTH SEMINAR TO THE MEMORY OF D.N. KLYSHKO: Algebraic solution of the synthesis problem for coded sequences

    Science.gov (United States)

    Leukhin, Anatolii N.

    2005-08-01

    The algebraic solution of a 'complex' problem of synthesis of phase-coded (PC) sequences with the zero level of side lobes of the cyclic autocorrelation function (ACF) is proposed. It is shown that the solution of the synthesis problem is connected with the existence of difference sets for a given code dimension. The problem of estimating the number of possible code combinations for a given code dimension is solved. It is pointed out that the problem of synthesis of PC sequences is related to the fundamental problems of discrete mathematics and, first of all, to a number of combinatorial problems, which can be solved, as the number factorisation problem, by algebraic methods by using the theory of Galois fields and groups.

  9. IdentiCS – Identification of coding sequence and in silico reconstruction of the metabolic network directly from unannotated low-coverage bacterial genome sequence

    Directory of Open Access Journals (Sweden)

    Zeng An-Ping

    2004-08-01

    Full Text Available Abstract Background A necessary step for a genome level analysis of the cellular metabolism is the in silico reconstruction of the metabolic network from genome sequences. The available methods are mainly based on the annotation of genome sequences including two successive steps, the prediction of coding sequences (CDS and their function assignment. The annotation process takes time. The available methods often encounter difficulties when dealing with unfinished error-containing genomic sequence. Results In this work a fast method is proposed to use unannotated genome sequence for predicting CDSs and for an in silico reconstruction of metabolic networks. Instead of using predicted genes or CDSs to query public databases, entries from public DNA or protein databases are used as queries to search a local database of the unannotated genome sequence to predict CDSs. Functions are assigned to the predicted CDSs simultaneously. The well-annotated genome of Salmonella typhimurium LT2 is used as an example to demonstrate the applicability of the method. 97.7% of the CDSs in the original annotation are correctly identified. The use of SWISS-PROT-TrEMBL databases resulted in an identification of 98.9% of CDSs that have EC-numbers in the published annotation. Furthermore, two versions of sequences of the bacterium Klebsiella pneumoniae with different genome coverage (3.9 and 7.9 fold, respectively are examined. The results suggest that a 3.9-fold coverage of the bacterial genome could be sufficiently used for the in silico reconstruction of the metabolic network. Compared to other gene finding methods such as CRITICA our method is more suitable for exploiting sequences of low genome coverage. Based on the new method, a program called IdentiCS (Identification of Coding Sequences from Unfinished Genome Sequences is delivered that combines the identification of CDSs with the reconstruction, comparison and visualization of metabolic networks (free to download

  10. Capsid coding sequences of foot-and-mouth disease viruses are determinants of pathogenicity in pigs.

    Science.gov (United States)

    Lohse, Louise; Jackson, Terry; Bøtner, Anette; Belsham, Graham J

    2012-05-24

    The surface exposed capsid proteins, VP1, VP2 and VP3, of foot-and-mouth disease virus (FMDV) determine its antigenicity and the ability of the virus to interact with host-cell receptors. Hence, modification of these structural proteins may alter the properties of the virus.In the present study we compared the pathogenicity of different FMDVs in young pigs. In total 32 pigs, 7-weeks-old, were exposed to virus, either by direct inoculation or through contact with inoculated pigs, using cell culture adapted (O1K B64), chimeric (O1K/A-TUR and O1K/O-UKG) or field strain (O-UKG/34/2001) viruses. The O1K B64 virus and the two chimeric viruses are identical to each other except for the capsid coding region.Animals exposed to O1K B64 did not exhibit signs of disease, while pigs exposed to each of the other viruses showed typical clinical signs of foot-and-mouth disease (FMD). All pigs infected with the O1K/O-UKG chimera or the field strain (O-UKG/34/2001) developed fulminant disease. Furthermore, 3 of 4 in-contact pigs exposed to the O1K/O-UKG virus died in the acute phase of infection, likely from myocardial infection. However, in the group exposed to the O1K/A-TUR chimeric virus, only 1 pig showed symptoms of disease within the time frame of the experiment (10 days). All pigs that developed clinical disease showed a high level of viral RNA in serum and infected pigs that survived the acute phase of infection developed a serotype specific antibody response. It is concluded that the capsid coding sequences are determinants of FMDV pathogenicity in pigs.

  11. [Transposition errors during learning to reproduce a sequence by the right- and the left-hand movements: simulation of positional and movement coding].

    Science.gov (United States)

    Liakhovetskiĭ, V A; Bobrova, E V; Skopin, G N

    2012-01-01

    Transposition errors during the reproduction of a hand movement sequence make it possible to receive important information on the internal representation of this sequence in the motor working memory. Analysis of such errors showed that learning to reproduce sequences of the left-hand movements improves the system of positional coding (coding ofpositions), while learning of the right-hand movements improves the system of vector coding (coding of movements). Learning of the right-hand movements after the left-hand performance involved the system of positional coding "imposed" by the left hand. Learning of the left-hand movements after the right-hand performance activated the system of vector coding. Transposition errors during learning to reproduce movement sequences can be explained by neural network using either vector coding or both vector and positional coding.

  12. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3' UTRs and coding sequences.

    Science.gov (United States)

    Šulc, Miroslav; Marín, Ray M; Robins, Harlan S; Vaníček, Jiří

    2015-07-01

    The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3′ UTRs and coding sequences

    Science.gov (United States)

    Šulc, Miroslav; Marín, Ray M.; Robins, Harlan S.; Vaníček, Jiří

    2015-01-01

    The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3′ untranslated regions (3′ UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3′ UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA–mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA–mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. PMID:25948580

  14. Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

    OpenAIRE

    Liljeström, P L; Liljeström, P

    1987-01-01

    Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

  15. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites

    Directory of Open Access Journals (Sweden)

    Stafford Phillip

    2009-09-01

    Full Text Available Abstract Background Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder, is provided in this paper and applied to find or create potential recognition sites in target coding sequences. Results ICRPfinder is applied to find or create restriction enzyme recognition sites by introducing silent mutations. The algorithm is shown capable of mapping existing cut-sites but importantly it also can generate specified new unique cut-sites within a specified region that are guaranteed not to be present elsewhere in the DNA sequence. Conclusion ICRPfinder is a powerful tool for finding or creating specific DNA patterns in a given target coding sequence. ICRPfinder finds or creates patterns, which can include restriction enzyme recognition sites, without changing the translated protein sequence. ICRPfinder is a browser-based JavaScript application and it can run on any platform, in on-line or off-line mode.

  16. Source coherence impairments in a direct detection direct sequence optical code-division multiple-access system.

    Science.gov (United States)

    Fsaifes, Ihsan; Lepers, Catherine; Lourdiane, Mounia; Gallion, Philippe; Beugin, Vincent; Guignard, Philippe

    2007-02-01

    We demonstrate that direct sequence optical code- division multiple-access (DS-OCDMA) encoders and decoders using sampled fiber Bragg gratings (S-FBGs) behave as multipath interferometers. In that case, chip pulses of the prime sequence codes generated by spreading in time-coherent data pulses can result from multiple reflections in the interferometers that can superimpose within a chip time duration. We show that the autocorrelation function has to be considered as the sum of complex amplitudes of the combined chip as the laser source coherence time is much greater than the integration time of the photodetector. To reduce the sensitivity of the DS-OCDMA system to the coherence time of the laser source, we analyze the use of sparse and nonperiodic quadratic congruence and extended quadratic congruence codes.

  17. Source coherence impairments in a direct detection direct sequence optical code-division multiple-access system

    Science.gov (United States)

    Fsaifes, Ihsan; Lepers, Catherine; Lourdiane, Mounia; Gallion, Philippe; Beugin, Vincent; Guignard, Philippe

    2007-02-01

    We demonstrate that direct sequence optical code- division multiple-access (DS-OCDMA) encoders and decoders using sampled fiber Bragg gratings (S-FBGs) behave as multipath interferometers. In that case, chip pulses of the prime sequence codes generated by spreading in time-coherent data pulses can result from multiple reflections in the interferometers that can superimpose within a chip time duration. We show that the autocorrelation function has to be considered as the sum of complex amplitudes of the combined chip as the laser source coherence time is much greater than the integration time of the photodetector. To reduce the sensitivity of the DS-OCDMA system to the coherence time of the laser source, we analyze the use of sparse and nonperiodic quadratic congruence and extended quadratic congruence codes.

  18. Comparisons between Arabidopsis thaliana and Drosophila melanogaster in relation to Coding and Noncoding Sequence Length and Gene Expression

    Directory of Open Access Journals (Sweden)

    Rachel Caldwell

    2015-01-01

    Full Text Available There is a continuing interest in the analysis of gene architecture and gene expression to determine the relationship that may exist. Advances in high-quality sequencing technologies and large-scale resource datasets have increased the understanding of relationships and cross-referencing of expression data to the large genome data. Although a negative correlation between expression level and gene (especially transcript length has been generally accepted, there have been some conflicting results arising from the literature concerning the impacts of different regions of genes, and the underlying reason is not well understood. The research aims to apply quantile regression techniques for statistical analysis of coding and noncoding sequence length and gene expression data in the plant, Arabidopsis thaliana, and fruit fly, Drosophila melanogaster, to determine if a relationship exists and if there is any variation or similarities between these species. The quantile regression analysis found that the coding sequence length and gene expression correlations varied, and similarities emerged for the noncoding sequence length (5′ and 3′ UTRs between animal and plant species. In conclusion, the information described in this study provides the basis for further exploration into gene regulation with regard to coding and noncoding sequence length.

  19. Mining of biomarker genes from expressed sequence tags and differential display reverse transcriptase-polymerase chain reaction in the self-fertilizing fish, Kryptolebias marmoratus and their expression patterns in response to exposure to an endocrine-disrupting alkylphenol, bisphenol A.

    Science.gov (United States)

    Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong

    2007-06-30

    Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.

  20. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  1. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  2. Anti-HBV treatment induces novel reverse transcriptase mutations with reflective effect on HBV S antigen

    NARCIS (Netherlands)

    Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina

    2013-01-01

    The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences

  3. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  4. Simultaneous sequencing of coding and noncoding RNA reveals a human transcriptome dominated by a small number of highly expressed noncoding genes.

    Science.gov (United States)

    Boivin, Vincent; Deschamps-Francoeur, Gabrielle; Couture, Sonia; Nottingham, Ryan M; Bouchard-Bourelle, Philia; Lambowitz, Alan M; Scott, Michelle S; Abou-Elela, Sherif

    2018-07-01

    Comparing the abundance of one RNA molecule to another is crucial for understanding cellular functions but most sequencing techniques can target only specific subsets of RNA. In this study, we used a new fragmented ribodepleted TGIRT sequencing method that uses a thermostable group II intron reverse transcriptase (TGIRT) to generate a portrait of the human transcriptome depicting the quantitative relationship of all classes of nonribosomal RNA longer than 60 nt. Comparison between different sequencing methods indicated that FRT is more accurate in ranking both mRNA and noncoding RNA than viral reverse transcriptase-based sequencing methods, even those that specifically target these species. Measurements of RNA abundance in different cell lines using this method correlate with biochemical estimates, confirming tRNA as the most abundant nonribosomal RNA biotype. However, the single most abundant transcript is 7SL RNA, a component of the signal recognition particle. S tructured n on c oding RNAs (sncRNAs) associated with the same biological process are expressed at similar levels, with the exception of RNAs with multiple functions like U1 snRNA. In general, sncRNAs forming RNPs are hundreds to thousands of times more abundant than their mRNA counterparts. Surprisingly, only 50 sncRNA genes produce half of the non-rRNA transcripts detected in two different cell lines. Together the results indicate that the human transcriptome is dominated by a small number of highly expressed sncRNAs specializing in functions related to translation and splicing. © 2018 Boivin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  5. Application of the verona coding definitions of emotional sequences (VR-CoDES) on a pediatric data set.

    Science.gov (United States)

    Vatne, Torun M; Finset, Arnstein; Ørnes, Knut; Ruland, Cornelia M

    2010-09-01

    Adult patients present concerns as defined in the Verona Coding Definitions of Emotional Sequences (VR-CoDES), but we do not know how children express their concerns during medical consultations. This study aimed to evaluate the applicability of VR-CoDES to pediatric oncology consultations. Twenty-eight pediatric consultations were coded with the Verona Coding Definitions of Emotional Sequences (VR-CoDES), and the material was also qualitatively analyzed for descriptive purposes. Five consultations were randomly selected for reliability testing and descriptive statistics were computed. Perfect inter-rater reliability for concerns and moderate reliability for cues were obtained. Cues and/or concerns were present in over half of the consultations. Cues were more frequent than concerns, with the majority of cues being verbal hints to hidden concerns or non-verbal cues. Intensity of expressions, limitations in vocabulary, commonality of statements, and complexity of the setting complicated the use of VR-CoDES. Child-specific cues; use of the imperative, cues about past experiences, and use of onomatopoeia were observed. Children with cancer express concerns during medical consultations. VR-CoDES is a reliable tool for coding concerns in pediatric data sets. For future applications in pediatric settings an appendix should be developed to incorporate the child-specific traits. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

  6. Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

    International Nuclear Information System (INIS)

    Bavand, M.R.; Laub, O.

    1988-01-01

    Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

  7. Sequencing illustrates the transcriptional response of Legionella pneumophila during infection and identifies seventy novel small non-coding RNAs.

    LENUS (Irish Health Repository)

    Weissenmayer, Barbara A

    2011-01-01

    Second generation sequencing has prompted a number of groups to re-interrogate the transcriptomes of several bacterial and archaeal species. One of the central findings has been the identification of complex networks of small non-coding RNAs that play central roles in transcriptional regulation in all growth conditions and for the pathogen\\'s interaction with and survival within host cells. Legionella pneumophila is a gram-negative facultative intracellular human pathogen with a distinct biphasic lifestyle. One of its primary environmental hosts in the free-living amoeba Acanthamoeba castellanii and its infection by L. pneumophila mimics that seen in human macrophages. Here we present analysis of strand specific sequencing of the transcriptional response of L. pneumophila during exponential and post-exponential broth growth and during the replicative and transmissive phase of infection inside A. castellanii. We extend previous microarray based studies as well as uncovering evidence of a complex regulatory architecture underpinned by numerous non-coding RNAs. Over seventy new non-coding RNAs could be identified; many of them appear to be strain specific and in configurations not previously reported. We discover a family of non-coding RNAs preferentially expressed during infection conditions and identify a second copy of 6S RNA in L. pneumophila. We show that the newly discovered putative 6S RNA as well as a number of other non-coding RNAs show evidence for antisense transcription. The nature and extent of the non-coding RNAs and their expression patterns suggests that these may well play central roles in the regulation of Legionella spp. specific traits and offer clues as to how L. pneumophila adapts to its intracellular niche. The expression profiles outlined in the study have been deposited into Genbank\\'s Gene Expression Omnibus (GEO) database under the series accession GSE27232.

  8. [Influence of "prehistory" of sequential movements of the right and the left hand on reproduction: coding of positions, movements and sequence structure].

    Science.gov (United States)

    Bobrova, E V; Liakhovetskiĭ, V A; Borshchevskaia, E R

    2011-01-01

    The dependence of errors during reproduction of a sequence of hand movements without visual feedback on the previous right- and left-hand performance ("prehistory") and on positions in space of sequence elements (random or ordered by the explicit rule) was analyzed. It was shown that the preceding information about the ordered positions of the sequence elements was used during right-hand movements, whereas left-hand movements were performed with involvement of the information about the random sequence. The data testify to a central mechanism of the analysis of spatial structure of sequence elements. This mechanism activates movement coding specific for the left hemisphere (vector coding) in case of an ordered sequence structure and positional coding specific for the right hemisphere in case of a random sequence structure.

  9. In Silico Mining of Microsatellites in Coding Sequences of the Date Palm (Arecaceae Genome, Characterization, and Transferability

    Directory of Open Access Journals (Sweden)

    Frédérique Aberlenc-Bertossi

    2014-01-01

    Full Text Available Premise of the study: To complement existing sets of primarily dinucleotide microsatellite loci from noncoding sequences of date palm, we developed primers for tri- and hexanucleotide microsatellite loci identified within genes. Due to their conserved genomic locations, the primers should be useful in other palm taxa, and their utility was tested in seven other Phoenix species and in Chamaerops, Livistona, and Hyphaene. Methods and Results: Tandem repeat motifs of 3–6 bp were searched using a simple sequence repeat (SSR–pipeline package in coding portions of the date palm draft genome sequence. Fifteen loci produced highly consistent amplification, intraspecific polymorphisms, and stepwise mutation patterns. Conclusions: These microsatellite loci showed sufficient levels of variability and transferability to make them useful for population genetic, selection signature, and interspecific gene flow studies in Phoenix and other Coryphoideae genera.

  10. Prediction and identification of sequences coding for orphan enzymes using genomic and metagenomic neighbours

    DEFF Research Database (Denmark)

    Yamada, Takuji; Waller, Alison S.; Raes, Jeroen

    2012-01-01

    Despite the current wealth of sequencing data, one-third of all biochemically characterized metabolic enzymes lack a corresponding gene or protein sequence, and as such can be considered orphan enzymes. They represent a major gap between our molecular and biochemical knowledge, and consequently a...... Systems Biology 8: 581; published online 8 May 2012; doi:10.1038/msb.2012.13...

  11. Serotype identification and VP1 coding sequence analysis of foot-and-mouth disease virus from outbreaks in Eastern and Northern Uganda in 2008/9

    DEFF Research Database (Denmark)

    Kasambula, L.; Belsham, Graham; Siegismund, H. R.

    2012-01-01

    regions, and the presence of FMDV RNA in these samples was determined using a standard diagnostic RT-PCR assay. From the total of 27 positive samples, the VP1 coding region was amplified and sequenced. Each of these sequences showed >99% identity to each other, and just five distinct sequences were...

  12. De novo ORFs in Drosophila are important to organismal fitness and evolved rapidly from previously non-coding sequences.

    Directory of Open Access Journals (Sweden)

    Josephine A Reinhardt

    Full Text Available How non-coding DNA gives rise to new protein-coding genes (de novo genes is not well understood. Recent work has revealed the origins and functions of a few de novo genes, but common principles governing the evolution or biological roles of these genes are unknown. To better define these principles, we performed a parallel analysis of the evolution and function of six putatively protein-coding de novo genes described in Drosophila melanogaster. Reconstruction of the transcriptional history of de novo genes shows that two de novo genes emerged from novel long non-coding RNAs that arose at least 5 MY prior to evolution of an open reading frame. In contrast, four other de novo genes evolved a translated open reading frame and transcription within the same evolutionary interval suggesting that nascent open reading frames (proto-ORFs, while not required, can contribute to the emergence of a new de novo gene. However, none of the genes arose from proto-ORFs that existed long before expression evolved. Sequence and structural evolution of de novo genes was rapid compared to nearby genes and the structural complexity of de novo genes steadily increases over evolutionary time. Despite the fact that these genes are transcribed at a higher level in males than females, and are most strongly expressed in testes, RNAi experiments show that most of these genes are essential in both sexes during metamorphosis. This lethality suggests that protein coding de novo genes in Drosophila quickly become functionally important.

  13. Modeling of severe accident sequences with the new modules CESAR and DIVA of ASTEC system code

    International Nuclear Information System (INIS)

    Pignet, Sophie; Guillard, Gaetan; Barre, Francois; Repetto, Georges

    2003-01-01

    Systems of computer codes, so-called 'integral' codes, are being developed to simulate the scenario of a hypothetical severe accident in a light water reactor, from the initial event until the possible radiological release of fission products out of the containment. They couple the predominant physical phenomena that occur in the different reactor zones and simulate the actuation of safety systems by procedures and by operators. In order to allow to study a great number of scenarios, a compromise must be found between precision of results and calculation time: one day of accident time should take less than one day of real time to simulate on a PC computer. This search of compromise is a real challenge for such integral codes. The development of the ASTEC integral code was initiated jointly by IRSN and GRS as an international reference code. The latest version 1.0 of ASTEC, including the new modules CESAR and DIVA which model the behaviour of the reactor cooling system and the core degradation, is presented here. Validation of the modules and one plant application are described

  14. Locating protein-coding sequences under selection for additional, overlapping functions in 29 mammalian genomes

    DEFF Research Database (Denmark)

    Lin, Michael F; Kheradpour, Pouya; Washietl, Stefan

    2011-01-01

    conservation compared to typical protein-coding genes—especially at synonymous sites. In this study, we use genome alignments of 29 placental mammals to systematically locate short regions within human ORFs that show conspicuously low estimated rates of synonymous substitution across these species. The 29......-species alignment provides statistical power to locate more than 10,000 such regions with resolution down to nine-codon windows, which are found within more than a quarter of all human protein-coding genes and contain ~2% of their synonymous sites. We collect numerous lines of evidence that the observed...... synonymous constraint in these regions reflects selection on overlapping functional elements including splicing regulatory elements, dual-coding genes, RNA secondary structures, microRNA target sites, and developmental enhancers. Our results show that overlapping functional elements are common in mammalian...

  15. Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23

    International Nuclear Information System (INIS)

    Ghaffari, S.H.; Olson, M.O.J.

    1986-01-01

    Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved

  16. The Purine Bias of Coding Sequences is Determined by Physicochemical Constraints on Proteins.

    Science.gov (United States)

    Ponce de Leon, Miguel; de Miranda, Antonio Basilio; Alvarez-Valin, Fernando; Carels, Nicolas

    2014-01-01

    For this report, we analyzed protein secondary structures in relation to the statistics of three nucleotide codon positions. The purpose of this investigation was to find which properties of the ribosome, tRNA or protein level, could explain the purine bias (Rrr) as it is observed in coding DNA. We found that the Rrr pattern is the consequence of a regularity (the codon structure) resulting from physicochemical constraints on proteins and thermodynamic constraints on ribosomal machinery. The physicochemical constraints on proteins mainly come from the hydropathy and molecular weight (MW) of secondary structures as well as the energy cost of amino acid synthesis. These constraints appear through a network of statistical correlations, such as (i) the cost of amino acid synthesis, which is in favor of a higher level of guanine in the first codon position, (ii) the constructive contribution of hydropathy alternation in proteins, (iii) the spatial organization of secondary structure in proteins according to solvent accessibility, (iv) the spatial organization of secondary structure according to amino acid hydropathy, (v) the statistical correlation of MW with protein secondary structures and their overall hydropathy, (vi) the statistical correlation of thymine in the second codon position with hydropathy and the energy cost of amino acid synthesis, and (vii) the statistical correlation of adenine in the second codon position with amino acid complexity and the MW of secondary protein structures. Amino acid physicochemical properties and functional constraints on proteins constitute a code that is translated into a purine bias within the coding DNA via tRNAs. In that sense, the Rrr pattern within coding DNA is the effect of information transfer on nucleotide composition from protein to DNA by selection according to the codon positions. Thus, coding DNA structure and ribosomal machinery co-evolved to minimize the energy cost of protein coding given the functional

  17. The PRC2-binding long non-coding RNAs in human and mouse genomes are associated with predictive sequence features

    Science.gov (United States)

    Tu, Shiqi; Yuan, Guo-Cheng; Shao, Zhen

    2017-01-01

    Recently, long non-coding RNAs (lncRNAs) have emerged as an important class of molecules involved in many cellular processes. One of their primary functions is to shape epigenetic landscape through interactions with chromatin modifying proteins. However, mechanisms contributing to the specificity of such interactions remain poorly understood. Here we took the human and mouse lncRNAs that were experimentally determined to have physical interactions with Polycomb repressive complex 2 (PRC2), and systematically investigated the sequence features of these lncRNAs by developing a new computational pipeline for sequences composition analysis, in which each sequence is considered as a series of transitions between adjacent nucleotides. Through that, PRC2-binding lncRNAs were found to be associated with a set of distinctive and evolutionarily conserved sequence features, which can be utilized to distinguish them from the others with considerable accuracy. We further identified fragments of PRC2-binding lncRNAs that are enriched with these sequence features, and found they show strong PRC2-binding signals and are more highly conserved across species than the other parts, implying their functional importance.

  18. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  19. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence

    Science.gov (United States)

    Gordon, Kacy L.; Arthur, Robert K.; Ruvinsky, Ilya

    2015-01-01

    Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2) from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements. PMID:26020930

  20. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence.

    Directory of Open Access Journals (Sweden)

    Kacy L Gordon

    2015-05-01

    Full Text Available Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2 from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements.

  1. Coding Local and Global Binary Visual Features Extracted From Video Sequences

    Science.gov (United States)

    Baroffio, Luca; Canclini, Antonio; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2015-11-01

    Binary local features represent an effective alternative to real-valued descriptors, leading to comparable results for many visual analysis tasks, while being characterized by significantly lower computational complexity and memory requirements. When dealing with large collections, a more compact representation based on global features is often preferred, which can be obtained from local features by means of, e.g., the Bag-of-Visual-Word (BoVW) model. Several applications, including for example visual sensor networks and mobile augmented reality, require visual features to be transmitted over a bandwidth-limited network, thus calling for coding techniques that aim at reducing the required bit budget, while attaining a target level of efficiency. In this paper we investigate a coding scheme tailored to both local and global binary features, which aims at exploiting both spatial and temporal redundancy by means of intra- and inter-frame coding. In this respect, the proposed coding scheme can be conveniently adopted to support the Analyze-Then-Compress (ATC) paradigm. That is, visual features are extracted from the acquired content, encoded at remote nodes, and finally transmitted to a central controller that performs visual analysis. This is in contrast with the traditional approach, in which visual content is acquired at a node, compressed and then sent to a central unit for further processing, according to the Compress-Then-Analyze (CTA) paradigm. In this paper we experimentally compare ATC and CTA by means of rate-efficiency curves in the context of two different visual analysis tasks: homography estimation and content-based retrieval. Our results show that the novel ATC paradigm based on the proposed coding primitives can be competitive with CTA, especially in bandwidth limited scenarios.

  2. Coding Local and Global Binary Visual Features Extracted From Video Sequences.

    Science.gov (United States)

    Baroffio, Luca; Canclini, Antonio; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2015-11-01

    Binary local features represent an effective alternative to real-valued descriptors, leading to comparable results for many visual analysis tasks while being characterized by significantly lower computational complexity and memory requirements. When dealing with large collections, a more compact representation based on global features is often preferred, which can be obtained from local features by means of, e.g., the bag-of-visual word model. Several applications, including, for example, visual sensor networks and mobile augmented reality, require visual features to be transmitted over a bandwidth-limited network, thus calling for coding techniques that aim at reducing the required bit budget while attaining a target level of efficiency. In this paper, we investigate a coding scheme tailored to both local and global binary features, which aims at exploiting both spatial and temporal redundancy by means of intra- and inter-frame coding. In this respect, the proposed coding scheme can conveniently be adopted to support the analyze-then-compress (ATC) paradigm. That is, visual features are extracted from the acquired content, encoded at remote nodes, and finally transmitted to a central controller that performs the visual analysis. This is in contrast with the traditional approach, in which visual content is acquired at a node, compressed and then sent to a central unit for further processing, according to the compress-then-analyze (CTA) paradigm. In this paper, we experimentally compare the ATC and the CTA by means of rate-efficiency curves in the context of two different visual analysis tasks: 1) homography estimation and 2) content-based retrieval. Our results show that the novel ATC paradigm based on the proposed coding primitives can be competitive with the CTA, especially in bandwidth limited scenarios.

  3. Construction and Analysis of a Novel 2-D Optical Orthogonal Codes Based on Modified One-coincidence Sequence

    Science.gov (United States)

    Ji, Jianhua; Wang, Yanfen; Wang, Ke; Xu, Ming; Zhang, Zhipeng; Yang, Shuwen

    2013-09-01

    A new two-dimensional OOC (optical orthogonal codes) named PC/MOCS is constructed, using PC (prime code) for time spreading and MOCS (modified one-coincidence sequence) for wavelength hopping. Compared with PC/PC, the number of wavelengths for PC/MOCS is not limited to a prime number. Compared with PC/OCS, the length of MOCS need not be expanded to the same length of PC. PC/MOCS can be constructed flexibly, and also can use available wavelengths effectively. Theoretical analysis shows that PC/MOCS can reduce the bit error rate (BER) of OCDMA system, and can support more users than PC/PC and PC/OCS.

  4. Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

  5. Episodic sequence memory is supported by a theta-gamma phase code.

    Science.gov (United States)

    Heusser, Andrew C; Poeppel, David; Ezzyat, Youssef; Davachi, Lila

    2016-10-01

    The meaning we derive from our experiences is not a simple static extraction of the elements but is largely based on the order in which those elements occur. Models propose that sequence encoding is supported by interactions between high- and low-frequency oscillations, such that elements within an experience are represented by neural cell assemblies firing at higher frequencies (gamma) and sequential order is encoded by the specific timing of firing with respect to a lower frequency oscillation (theta). During episodic sequence memory formation in humans, we provide evidence that items in different sequence positions exhibit greater gamma power along distinct phases of a theta oscillation. Furthermore, this segregation is related to successful temporal order memory. Our results provide compelling evidence that memory for order, a core component of an episodic memory, capitalizes on the ubiquitous physiological mechanism of theta-gamma phase-amplitude coupling.

  6. Cracking the Code of Human Diseases Using Next-Generation Sequencing: Applications, Challenges, and Perspectives

    Directory of Open Access Journals (Sweden)

    Vincenza Precone

    2015-01-01

    Full Text Available Next-generation sequencing (NGS technologies have greatly impacted on every field of molecular research mainly because they reduce costs and increase throughput of DNA sequencing. These features, together with the technology’s flexibility, have opened the way to a variety of applications including the study of the molecular basis of human diseases. Several analytical approaches have been developed to selectively enrich regions of interest from the whole genome in order to identify germinal and/or somatic sequence variants and to study DNA methylation. These approaches are now widely used in research, and they are already being used in routine molecular diagnostics. However, some issues are still controversial, namely, standardization of methods, data analysis and storage, and ethical aspects. Besides providing an overview of the NGS-based approaches most frequently used to study the molecular basis of human diseases at DNA level, we discuss the principal challenges and applications of NGS in the field of human genomics.

  7. Multi-scale coding of genomic information: From DNA sequence to genome structure and function

    International Nuclear Information System (INIS)

    Arneodo, Alain; Vaillant, Cedric; Audit, Benjamin; Argoul, Francoise; D'Aubenton-Carafa, Yves; Thermes, Claude

    2011-01-01

    Understanding how chromatin is spatially and dynamically organized in the nucleus of eukaryotic cells and how this affects genome functions is one of the main challenges of cell biology. Since the different orders of packaging in the hierarchical organization of DNA condition the accessibility of DNA sequence elements to trans-acting factors that control the transcription and replication processes, there is actually a wealth of structural and dynamical information to learn in the primary DNA sequence. In this review, we show that when using concepts, methodologies, numerical and experimental techniques coming from statistical mechanics and nonlinear physics combined with wavelet-based multi-scale signal processing, we are able to decipher the multi-scale sequence encoding of chromatin condensation-decondensation mechanisms that play a fundamental role in regulating many molecular processes involved in nuclear functions.

  8. LZW-Kernel: fast kernel utilizing variable length code blocks from LZW compressors for protein sequence classification.

    Science.gov (United States)

    Filatov, Gleb; Bauwens, Bruno; Kertész-Farkas, Attila

    2018-05-07

    Bioinformatics studies often rely on similarity measures between sequence pairs, which often pose a bottleneck in large-scale sequence analysis. Here, we present a new convolutional kernel function for protein sequences called the LZW-Kernel. It is based on code words identified with the Lempel-Ziv-Welch (LZW) universal text compressor. The LZW-Kernel is an alignment-free method, it is always symmetric, is positive, always provides 1.0 for self-similarity and it can directly be used with Support Vector Machines (SVMs) in classification problems, contrary to normalized compression distance (NCD), which often violates the distance metric properties in practice and requires further techniques to be used with SVMs. The LZW-Kernel is a one-pass algorithm, which makes it particularly plausible for big data applications. Our experimental studies on remote protein homology detection and protein classification tasks reveal that the LZW-Kernel closely approaches the performance of the Local Alignment Kernel (LAK) and the SVM-pairwise method combined with Smith-Waterman (SW) scoring at a fraction of the time. Moreover, the LZW-Kernel outperforms the SVM-pairwise method when combined with BLAST scores, which indicates that the LZW code words might be a better basis for similarity measures than local alignment approximations found with BLAST. In addition, the LZW-Kernel outperforms n-gram based mismatch kernels, hidden Markov model based SAM and Fisher kernel, and protein family based PSI-BLAST, among others. Further advantages include the LZW-Kernel's reliance on a simple idea, its ease of implementation, and its high speed, three times faster than BLAST and several magnitudes faster than SW or LAK in our tests. LZW-Kernel is implemented as a standalone C code and is a free open-source program distributed under GPLv3 license and can be downloaded from https://github.com/kfattila/LZW-Kernel. akerteszfarkas@hse.ru. Supplementary data are available at Bioinformatics Online.

  9. Comparative analysis of protein coding sequences from human, mouse and the domesticated pig

    DEFF Research Database (Denmark)

    Jørgensen, Frank Grønlund; Hobolth, Asger; Hornshøj, Henrik

    2005-01-01

    Background: The availability of abundant sequence data from key model organisms has made large scale studies of mulecular evolution an exciting possibility. Here we use full length cDNA alignments comprising more than 700,000 nucleotides from human, mouse, pig and the Japanese pufferfish Fugu rub...... rubrices in order to investigate 1) the relationships between three major lineages of mammals: rodents, artiodactys and primates, and 2) the rate of evolution and the occurrence of positive Darwinian selection using codon based models of sequence evolution. Results: We provide evidence...

  10. Analysis of mutations in the entire coding sequence of the factor VIII gene

    Energy Technology Data Exchange (ETDEWEB)

    Bidichadani, S.I.; Lanyon, W.G.; Connor, J.M. [Glascow Univ. (United Kingdom)] [and others

    1994-09-01

    Hemophilia A is a common X-linked recessive disorder of bleeding caused by deleterious mutations in the gene for clotting factor VIII. The large size of the factor VIII gene, the high frequency of de novo mutations and its tissue-specific expression complicate the detection of mutations. We have used a combination of RT-PCR of ectopic factor VIII transcripts and genomic DNA-PCRs to amplify the entire essential sequence of the factor VIII gene. This is followed by chemical mismatch cleavage analysis and direct sequencing in order to facilitate a comprehensive search for mutations. We describe the characterization of nine potentially pathogenic mutations, six of which are novel. In each case, a correlation of the genotype with the observed phenotype is presented. In order to evaluate the pathogenicity of the five missense mutations detected, we have analyzed them for evolutionary sequence conservation and for their involvement of sequence motifs catalogued in the PROSITE database of protein sites and patterns.

  11. Sequence of maximal distance codes in graphs or other metric spaces

    Directory of Open Access Journals (Sweden)

    Charles Delorme

    2013-11-01

    Full Text Available Given a subset C in a metric space E, its successor is the subset  s(C of points at maximum distance from C in E. We study some properties of the sequence obtained by iterating this operation.  Graphs with their usual distance provide already typical examples.

  12. The structural analysis of protein sequences based on the quasi-amino acids code

    International Nuclear Information System (INIS)

    Ping, Zhu; Xu-Qing, Tang; Zhen-Yuan, Xu

    2009-01-01

    Proteomics is the study of proteins and their interactions in a cell. With the successful completion of the Human Genome Project, it comes the postgenome era when the proteomics technology is emerging. This paper studies protein molecule from the algebraic point of view. The algebraic system (Σ, +, *) is introduced, where Σ is the set of 64 codons. According to the characteristics of (Σ, +, *), a novel quasi-amino acids code classification method is introduced and the corresponding algebraic operation table over the set ZU of the 16 kinds of quasi-amino acids is established. The internal relation is revealed about quasi-amino acids. The results show that there exist some very close correlations between the properties of the quasi-amino acids and the codon. All these correlation relationships may play an important part in establishing the logic relationship between codons and the quasi-amino acids during the course of life origination. According to Ma F et al (2003 J. Anhui Agricultural University 30 439), the corresponding relation and the excellent properties about amino acids code are very difficult to observe. The present paper shows that (ZU, ⊕, ) is a field. Furthermore, the operational results display that the codon tga has different property from other stop codons. In fact, in the mitochondrion from human and ox genomic codon, tga is just tryptophane, is not the stop codon like in other genetic code, it is the case of the Chen W C et al (2002 Acta Biophysica Sinica 18(1) 87). The present theory avoids some inexplicable events of the 20 kinds of amino acids code, in other words it solves the problem of 'the 64 codon assignments of mRNA to amino acids is probably completely wrong' proposed by Yang (2006 Progress in Modern Biomedicine 6 3). (cross-disciplinary physics and related areas of science and technology)

  13. DNA methylation of miRNA coding sequences putatively associated with childhood obesity.

    Science.gov (United States)

    Mansego, M L; Garcia-Lacarte, M; Milagro, F I; Marti, A; Martinez, J A

    2017-02-01

    Epigenetic mechanisms may be involved in obesity onset and its consequences. The aim of the present study was to evaluate whether DNA methylation status in microRNA (miRNA) coding regions is associated with childhood obesity. DNA isolated from white blood cells of 24 children (identification sample: 12 obese and 12 non-obese) from the Grupo Navarro de Obesidad Infantil study was hybridized in a 450 K methylation microarray. Several CpGs whose DNA methylation levels were statistically different between obese and non-obese were validated by MassArray® in 95 children (validation sample) from the same study. Microarray analysis identified 16 differentially methylated CpGs between both groups (6 hypermethylated and 10 hypomethylated). DNA methylation levels in miR-1203, miR-412 and miR-216A coding regions significantly correlated with body mass index standard deviation score (BMI-SDS) and explained up to 40% of the variation of BMI-SDS. The network analysis identified 19 well-defined obesity-relevant biological pathways from the KEGG database. MassArray® validation identified three regions located in or near miR-1203, miR-412 and miR-216A coding regions differentially methylated between obese and non-obese children. The current work identified three CpG sites located in coding regions of three miRNAs (miR-1203, miR-412 and miR-216A) that were differentially methylated between obese and non-obese children, suggesting a role of miRNA epigenetic regulation in childhood obesity. © 2016 World Obesity Federation.

  14. CpG + CpNpG Analysis of Protein-Coding Sequences from Tomato

    DEFF Research Database (Denmark)

    Hobolth, Asger; Nielsen, Rasmus; Wang, Ying

    2006-01-01

    We develop codon-based models for simultaneously inferring the mutational effects of CpG and CpNpG methylation in coding regions. In a data set of 369 tomato genes, we show that there is very little effect of CpNpG methylation but a strong effect of CpG methylation affecting almost all genes. We...... further show that the CpNpG and CpG effects are largely uncorrelated. Our results suggest different roles of CpG and CpNpG methylation, with CpNpG methylation possibly playing a specialized role in defense against transposons and RNA viruses....

  15. Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

    International Nuclear Information System (INIS)

    Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.

    2004-01-01

    Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

  16. Non coding RNA: sequence-specific guide for chromatin modification and DNA damage signaling

    Directory of Open Access Journals (Sweden)

    Sofia eFrancia

    2015-11-01

    Full Text Available Chromatin conformation shapes the environment in which our genome is transcribed into RNA. Transcription is a source of DNA damage, thus it often occurs concomitantly to DNA damage signaling. Growing amounts of evidence suggest that different types of RNAs can, independently from their protein-coding properties, directly affect chromatin conformation, transcription and splicing, as well as promote the activation of the DNA damage response (DDR and DNA repair. Therefore, transcription paradoxically functions to both threaten and safeguard genome integrity. On the other hand, DNA damage signaling is known to modulate chromatin to suppress transcription of the surrounding genetic unit. It is thus intriguing to understand how transcription can modulate DDR signaling while, in turn, DDR signaling represses transcription of chromatin around the DNA lesion. An unexpected player in this field is the RNA interference (RNAi machinery, which play roles in transcription, splicing and chromatin modulation in several organisms. Non-coding RNAs (ncRNAs and several protein factors involved in the RNAi pathway are well known master regulators of chromatin while only recent reports suggest that ncRNAs are involved in DDR signaling and homology-mediated DNA repair. Here, we discuss the experimental evidence supporting the idea that ncRNAs act at the genomic loci from which they are transcribed to modulate chromatin, DDR signaling and DNA repair.

  17. Natural image sequences constrain dynamic receptive fields and imply a sparse code.

    Science.gov (United States)

    Häusler, Chris; Susemihl, Alex; Nawrot, Martin P

    2013-11-06

    In their natural environment, animals experience a complex and dynamic visual scenery. Under such natural stimulus conditions, neurons in the visual cortex employ a spatially and temporally sparse code. For the input scenario of natural still images, previous work demonstrated that unsupervised feature learning combined with the constraint of sparse coding can predict physiologically measured receptive fields of simple cells in the primary visual cortex. This convincingly indicated that the mammalian visual system is adapted to the natural spatial input statistics. Here, we extend this approach to the time domain in order to predict dynamic receptive fields that can account for both spatial and temporal sparse activation in biological neurons. We rely on temporal restricted Boltzmann machines and suggest a novel temporal autoencoding training procedure. When tested on a dynamic multi-variate benchmark dataset this method outperformed existing models of this class. Learning features on a large dataset of natural movies allowed us to model spatio-temporal receptive fields for single neurons. They resemble temporally smooth transformations of previously obtained static receptive fields and are thus consistent with existing theories. A neuronal spike response model demonstrates how the dynamic receptive field facilitates temporal and population sparseness. We discuss the potential mechanisms and benefits of a spatially and temporally sparse representation of natural visual input. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Modeling coding-sequence evolution within the context of residue solvent accessibility.

    Science.gov (United States)

    Scherrer, Michael P; Meyer, Austin G; Wilke, Claus O

    2012-09-12

    Protein structure mediates site-specific patterns of sequence divergence. In particular, residues in the core of a protein (solvent-inaccessible residues) tend to be more evolutionarily conserved than residues on the surface (solvent-accessible residues). Here, we present a model of sequence evolution that explicitly accounts for the relative solvent accessibility of each residue in a protein. Our model is a variant of the Goldman-Yang 1994 (GY94) model in which all model parameters can be functions of the relative solvent accessibility (RSA) of a residue. We apply this model to a data set comprised of nearly 600 yeast genes, and find that an evolutionary-rate ratio ω that varies linearly with RSA provides a better model fit than an RSA-independent ω or an ω that is estimated separately in individual RSA bins. We further show that the branch length t and the transition-transverion ratio κ also vary with RSA. The RSA-dependent GY94 model performs better than an RSA-dependent Muse-Gaut 1994 (MG94) model in which the synonymous and non-synonymous rates individually are linear functions of RSA. Finally, protein core size affects the slope of the linear relationship between ω and RSA, and gene expression level affects both the intercept and the slope. Structure-aware models of sequence evolution provide a significantly better fit than traditional models that neglect structure. The linear relationship between ω and RSA implies that genes are better characterized by their ω slope and intercept than by just their mean ω.

  19. Modeling coding-sequence evolution within the context of residue solvent accessibility

    Directory of Open Access Journals (Sweden)

    Scherrer Michael P

    2012-09-01

    Full Text Available Abstract Background Protein structure mediates site-specific patterns of sequence divergence. In particular, residues in the core of a protein (solvent-inaccessible residues tend to be more evolutionarily conserved than residues on the surface (solvent-accessible residues. Results Here, we present a model of sequence evolution that explicitly accounts for the relative solvent accessibility of each residue in a protein. Our model is a variant of the Goldman-Yang 1994 (GY94 model in which all model parameters can be functions of the relative solvent accessibility (RSA of a residue. We apply this model to a data set comprised of nearly 600 yeast genes, and find that an evolutionary-rate ratio ω that varies linearly with RSA provides a better model fit than an RSA-independent ω or an ω that is estimated separately in individual RSA bins. We further show that the branch length t and the transition-transverion ratio κ also vary with RSA. The RSA-dependent GY94 model performs better than an RSA-dependent Muse-Gaut 1994 (MG94 model in which the synonymous and non-synonymous rates individually are linear functions of RSA. Finally, protein core size affects the slope of the linear relationship between ω and RSA, and gene expression level affects both the intercept and the slope. Conclusions Structure-aware models of sequence evolution provide a significantly better fit than traditional models that neglect structure. The linear relationship between ω and RSA implies that genes are better characterized by their ω slope and intercept than by just their mean ω.

  20. Phylogeny, character evolution, and biogeography of Cuscuta (dodders; Convolvulaceae) inferred from coding plastid and nuclear sequences.

    Science.gov (United States)

    García, Miguel A; Costea, Mihai; Kuzmina, Maria; Stefanović, Saša

    2014-04-01

    The parasitic genus Cuscuta, containing some 200 species circumscribed traditionally in three subgenera, is nearly cosmopolitan, occurring in a wide range of habitats and hosts. Previous molecular studies, on subgenera Grammica and Cuscuta, delimited major clades within these groups. However, the sequences used were unalignable among subgenera, preventing the phylogenetic comparison across the genus. We conducted a broad phylogenetic study using rbcL and nrLSU sequences covering the morphological, physiological, and geographical diversity of Cuscuta. We used parsimony methods to reconstruct ancestral states for taxonomically important characters. Biogeographical inferences were obtained using statistical and Bayesian approaches. Four well-supported major clades are resolved. Two of them correspond to subgenera Monogynella and Grammica. Subgenus Cuscuta is paraphyletic, with section Pachystigma sister to subgenus Grammica. Previously described cases of strongly supported discordance between plastid and nuclear phylogenies, interpreted as reticulation events, are confirmed here and three new cases are detected. Dehiscent fruits and globose stigmas are inferred as ancestral character states, whereas the ancestral style number is ambiguous. Biogeographical reconstructions suggest an Old World origin for the genus and subsequent spread to the Americas as a consequence of one long-distance dispersal. Hybridization may play an important yet underestimated role in the evolution of Cuscuta. Our results disagree with scenarios of evolution (polarity) previously proposed for several taxonomically important morphological characters, and with their usage and significance. While several cases of long-distance dispersal are inferred, vicariance or dispersal to adjacent areas emerges as the dominant biogeographical pattern.

  1. Validation of the Serpent 2-DYNSUB code sequence using the Special Power Excursion Reactor Test III (SPERT III)

    International Nuclear Information System (INIS)

    Knebel, Miriam; Mercatali, Luigi; Sanchez, Victor; Stieglitz, Robert; Macian-Juan, Rafael

    2016-01-01

    Highlights: • Full few-group cross section tables created by Monte Carlo lattice code Serpent 2. • Serpent 2 group constant methodology verified for HFP static and transient cases. • Serpent 2-DYNSUB tool chainvalidated using SPERT III REA experiments. • Serpent 2-DYNSUB tool chain suitable to model RIAs in PWRs. - Abstract: The Special Power Excursion Reactor Test III (SPERT III) is studied using the Serpent 2-DYNSUB code sequence in order to validate it for modeling reactivity insertion accidents (RIA) in PWRs. The SPERT III E-core was a thermal research reactor constructed to analyze reactor dynamics. Its configuration resembles a commercial PWR on terms of fuel type, choice of moderator, coolant flow and system pressure. The initial conditions of the rod ejection accident experiments (REA) performed cover cold startup, hot startup, hot standby and operating power scenarios. Eight of these experiments were analyzed in detail. Firstly, multi-dimensional nodal diffusion cross section tables were created for the three-dimensional reactor simulator DYNSUB employing the Monte Carlo neutron transport code Serpent 2. In a second step, DYNSUB stationary simulations were compared to Monte Carlo reference three-dimensional full scale solutions obtained with Serpent 2 (cold startup conditions) and Serpent 2/SUBCHANFLOW (operating power conditions) with a good agreement being observed. The latter tool is an internal coupling of Serpent 2 and the sub-channel thermal-hydraulics code SUBCHANFLOW. Finally, DYNSUB was utilized to study the eight selected transient experiments. Results were found to match measurements well. As the selected experiments cover much of the possible transient (delayed super-critical, prompt super-critical and super-prompt critical excursion) and initial conditions (cold and hot as well as zero, little and full power reactor states) one expects in commercial PWRs, the obtained results give confidence that the Serpent 2-DYNSUB tool chain is

  2. mPUMA: a computational approach to microbiota analysis by de novo assembly of operational taxonomic units based on protein-coding barcode sequences.

    Science.gov (United States)

    Links, Matthew G; Chaban, Bonnie; Hemmingsen, Sean M; Muirhead, Kevin; Hill, Janet E

    2013-08-15

    Formation of operational taxonomic units (OTU) is a common approach to data aggregation in microbial ecology studies based on amplification and sequencing of individual gene targets. The de novo assembly of OTU sequences has been recently demonstrated as an alternative to widely used clustering methods, providing robust information from experimental data alone, without any reliance on an external reference database. Here we introduce mPUMA (microbial Profiling Using Metagenomic Assembly, http://mpuma.sourceforge.net), a software package for identification and analysis of protein-coding barcode sequence data. It was developed originally for Cpn60 universal target sequences (also known as GroEL or Hsp60). Using an unattended process that is independent of external reference sequences, mPUMA forms OTUs by DNA sequence assembly and is capable of tracking OTU abundance. mPUMA processes microbial profiles both in terms of the direct DNA sequence as well as in the translated amino acid sequence for protein coding barcodes. By forming OTUs and calculating abundance through an assembly approach, mPUMA is capable of generating inputs for several popular microbiota analysis tools. Using SFF data from sequencing of a synthetic community of Cpn60 sequences derived from the human vaginal microbiome, we demonstrate that mPUMA can faithfully reconstruct all expected OTU sequences and produce compositional profiles consistent with actual community structure. mPUMA enables analysis of microbial communities while empowering the discovery of novel organisms through OTU assembly.

  3. Phylogenetic analyses of the polyprotein coding sequences of serotype O foot-and-mouth disease viruses in East Africa: evidence for interserotypic recombination

    DEFF Research Database (Denmark)

    Balinda, Sheila; Siegismund, Hans; Muwanika, Vincent

    2010-01-01

    from both serotypes A and O. Conclusions Sequences of the VP1 coding region from recent serotype O FMDVs from Kenya and Uganda are all representatives of a specific East African lineage (topotype EA-2), a probable indication that hardly any FMD introductions of this serotype have occurred from outside...... the region in the recent past. Furthermore, evidence for interserotypic recombination, within the non-structural protein coding regions, between FMDVs of serotypes A and O has been obtained. In addition to characterization using the VP1 coding region, analyses involving the non-structural protein coding...

  4. Species delimitation and phylogenetic reconstruction of the sinipercids (Perciformes: Sinipercidae) based on target enrichment of thousands of nuclear coding sequences.

    Science.gov (United States)

    Song, Shuli; Zhao, Jinliang; Li, Chenhong

    2017-06-01

    The sinipercids are freshwater fishes endemic to East Asia, mainly in China. Phylogenetic studies on the sinipercids have made great progress in the last decades, but interspecific relationships and evolutionary history of the sinipercids remain unresolved. Lack of distinctive morphological characters leads to problems in validating of some species, such as Siniperca loona. Moreover, genetic data are needed to delimitate species pairs with explicit hypothesis testing, such as in S. chuatsi vs. S. kneri and Coreoperca whiteheadi vs. C. liui. Here we reconstructed phylogeny of the sinipercids with an unprecedented scale of data, 16,943 loci of single-copy coding sequence data from nine sinipercid species, eight putative sister taxa and two outgroups. Targeted sequences were collected using gene enrichment and Illumina sequencing, yielding thousands of protein coding sequences and single nucleotide polymorphisms (SNPs) data. Maximum likelihood and coalescent species tree analyses resulted in identical and highly supported trees. We confirmed that the centrarchids are sister to the sinipercids. A monophyletic Sinipercidae with two genera, Siniperca and Coreoperca was also supported. Different from most previous studies, S. scherzeri was found as the most basal taxon to other species of Siniperca, which consists of two clades: a clade having S. roulei sister to S. chuatsi and S. kneri, and a clade consisting S. loona sister to S. obscura and S. undulata. We found that both S. loona and C. liui are valid species using Bayes factor delimitation (BFD ∗ ) based on SNPs data. Species delimitation also provided decisive support for S. chuatsi and S. kneri being two distinct species. We calibrated a chronogram of the sinipercids based on 100 loci and three fossil calibration points using BEAST, and reconstructed ancestral ranges of the sinipercids using Lagrange Analysis (DEC model) and Statistical Dispersal-Vicariance Analysis (S-DIVA) implemented in RASP. Divergence time

  5. OFFSCALE: A PC input processor for the SCALE code system. The CSASIN processor for the criticality sequences

    International Nuclear Information System (INIS)

    Bowman, S.M.

    1994-11-01

    OFFSCALE is a suite of personal computer input processor programs developed at Oak Ridge National Laboratory to provide an easy-to-use interface for modules in the SCALE-4 code system. CSASIN (formerly known as OFFSCALE) is a program in the OFFSCALE suite that serves as a user-friendly interface for the Criticality Safety Analysis Sequences (CSAS) available in SCALE-4. It is designed to assist a SCALE-4 user in preparing an input file for execution of criticality safety problems. Output from CSASIN generates an input file that may be used to execute the CSAS control module in SCALE-4. CSASIN features a pulldown menu system that accesses sophisticated data entry screens. The program allows the user to quickly set up a CSAS input file and perform data checking. This capability increases productivity and decreases the chance of user error

  6. Deconstruction of archaeal genome depict strategic consensus in core pathways coding sequence assembly.

    Directory of Open Access Journals (Sweden)

    Ayon Pal

    Full Text Available A comprehensive in silico analysis of 71 species representing the different taxonomic classes and physiological genre of the domain Archaea was performed. These organisms differed in their physiological attributes, particularly oxygen tolerance and energy metabolism. We explored the diversity and similarity in the codon usage pattern in the genes and genomes of these organisms, emphasizing on their core cellular pathways. Our thrust was to figure out whether there is any underlying similarity in the design of core pathways within these organisms. Analyses of codon utilization pattern, construction of hierarchical linear models of codon usage, expression pattern and codon pair preference pointed to the fact that, in the archaea there is a trend towards biased use of synonymous codons in the core cellular pathways and the Nc-plots appeared to display the physiological variations present within the different species. Our analyses revealed that aerobic species of archaea possessed a larger degree of freedom in regulating expression levels than could be accounted for by codon usage bias alone. This feature might be a consequence of their enhanced metabolic activities as a result of their adaptation to the relatively O2-rich environment. Species of archaea, which are related from the taxonomical viewpoint, were found to have striking similarities in their ORF structuring pattern. In the anaerobic species of archaea, codon bias was found to be a major determinant of gene expression. We have also detected a significant difference in the codon pair usage pattern between the whole genome and the genes related to vital cellular pathways, and it was not only species-specific but pathway specific too. This hints towards the structuring of ORFs with better decoding accuracy during translation. Finally, a codon-pathway interaction in shaping the codon design of pathways was observed where the transcription pathway exhibited a significantly different coding

  7. Deconstruction of archaeal genome depict strategic consensus in core pathways coding sequence assembly.

    Science.gov (United States)

    Pal, Ayon; Banerjee, Rachana; Mondal, Uttam K; Mukhopadhyay, Subhasis; Bothra, Asim K

    2015-01-01

    A comprehensive in silico analysis of 71 species representing the different taxonomic classes and physiological genre of the domain Archaea was performed. These organisms differed in their physiological attributes, particularly oxygen tolerance and energy metabolism. We explored the diversity and similarity in the codon usage pattern in the genes and genomes of these organisms, emphasizing on their core cellular pathways. Our thrust was to figure out whether there is any underlying similarity in the design of core pathways within these organisms. Analyses of codon utilization pattern, construction of hierarchical linear models of codon usage, expression pattern and codon pair preference pointed to the fact that, in the archaea there is a trend towards biased use of synonymous codons in the core cellular pathways and the Nc-plots appeared to display the physiological variations present within the different species. Our analyses revealed that aerobic species of archaea possessed a larger degree of freedom in regulating expression levels than could be accounted for by codon usage bias alone. This feature might be a consequence of their enhanced metabolic activities as a result of their adaptation to the relatively O2-rich environment. Species of archaea, which are related from the taxonomical viewpoint, were found to have striking similarities in their ORF structuring pattern. In the anaerobic species of archaea, codon bias was found to be a major determinant of gene expression. We have also detected a significant difference in the codon pair usage pattern between the whole genome and the genes related to vital cellular pathways, and it was not only species-specific but pathway specific too. This hints towards the structuring of ORFs with better decoding accuracy during translation. Finally, a codon-pathway interaction in shaping the codon design of pathways was observed where the transcription pathway exhibited a significantly different coding frequency signature.

  8. Analyses of SBO sequence of VVER1000 reactor using TRACE and MELCOR codes

    International Nuclear Information System (INIS)

    Mazzini, Guido; Kyncl, Milos; Miglierini, Bruno; Kopecek, Vit

    2015-01-01

    In response to the Fukushima accident, the European Commission ordered to perform stress tests to all European Nuclear Power Plants (NPPs). Due to shortage of time a number of conclusions in national stress tests reports were based on engineering judgment only. In the Czech Republic, as a follow up, a consortium of Research Organizations and Universities has decided to simulate selected stress tests scenarios, in particular station Black-Out (SBO) and Loss of Ultimate Sink (LoUS), with the aim to verify conclusions made in the national stress report and to analyse time response of respective source term releases. These activities are carried out in the frame of the project 'Prevention, preparedness and mitigation of consequences of Severe Accident (SA) at Czech NPPs in relation to lessons learned from stress tests after Fukushima' financed by the Ministry of Interior. The Research Centre Rez has been working on the preparation of a MELCOR model for VVER1000 NPP starting with a plant systems nodalization. The basic idea of this paper is to benchmark the MELCOR model with the validated TRACE model, first comparing the steady state and continuing in a long term SBO plus another event until the beginning of the severe accident. The presented work focuses mainly on the preliminary comparison of the thermo-hydraulics of the two models created in MELCOR and TRACE codes. After that, preliminary general results of the SA progression showing the hydrogen production and the relocation phenomena will be shortly discussed. This scenario is considered closed after some seconds to the break of the lower head. (author)

  9. The Number, Organization, and Size of Polymorphic Membrane Protein Coding Sequences as well as the Most Conserved Pmp Protein Differ within and across Chlamydia Species.

    Science.gov (United States)

    Van Lent, Sarah; Creasy, Heather Huot; Myers, Garry S A; Vanrompay, Daisy

    2016-01-01

    Variation is a central trait of the polymorphic membrane protein (Pmp) family. The number of pmp coding sequences differs between Chlamydia species, but it is unknown whether the number of pmp coding sequences is constant within a Chlamydia species. The level of conservation of the Pmp proteins has previously only been determined for Chlamydia trachomatis. As different Pmp proteins might be indispensible for the pathogenesis of different Chlamydia species, this study investigated the conservation of Pmp proteins both within and across C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci. The pmp coding sequences were annotated in 16 C. trachomatis, 6 C. pneumoniae, 2 C. abortus, and 16 C. psittaci genomes. The number and organization of polymorphic membrane coding sequences differed within and across the analyzed Chlamydia species. The length of coding sequences of pmpA,pmpB, and pmpH was conserved among all analyzed genomes, while the length of pmpE/F and pmpG, and remarkably also of the subtype pmpD, differed among the analyzed genomes. PmpD, PmpA, PmpH, and PmpA were the most conserved Pmp in C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci, respectively. PmpB was the most conserved Pmp across the 4 analyzed Chlamydia species. © 2016 S. Karger AG, Basel.

  10. Nonsense mutation in the glycoprotein Ibα coding sequence associated with Bernard-Soulier syndrome

    International Nuclear Information System (INIS)

    Ware, J.; Russell, S.R.; Vicente, V.; Scharf, R.E.; Tomer, A.; McMillian, R.; Ruggeri, Z.M.

    1990-01-01

    Three distinct gene products, the α and β chains of glycoprotein (GP) Ib and GP IX, constitute the platelet membrane GP Ib-IX complex, a receptor for von Willebrand factor and thrombin involved in platelet adhesion and aggregation. Defective function of the GP Ib-IX complex is the hallmark of a rare congenital bleeding disorder of still undefined pathogenesis, the Bernard-Soulier syndrome. The authors have analyzed the molecular basis of the disease in one patient in whom immunoblotting of solubilized platelets demonstrated absence of normal GP Ibα but presence of a smaller immunoreactive species. The truncated polypeptide was also present, along with normal protein, in platelets from the patient's mother and two of his four children. Genetic characterization identified a nucleotide transition changing the Trp-343 codon (TGG) to a nonsense codon (TGA). Such a mutation explains the origin of the smaller GP Ibα, which by lacking half of the sequence on the carboxyl-terminal side, including the transmembrane domain, cannot be properly inserted in the platelet membrane. Both normal and mutant codons were found in the patient, suggesting that he is a compound heterozygote with a still unidentified defect in the other GP Ibα allele. Nonsense mutation and truncated GP Ibα polypeptide were found to cosegregate in four individuals through three generations and were associated with either Bernard-Soulier syndrome or carrier state phenotype. The molecular abnormality demonstrated in this family provides evidence that defective synthesis of GP Ibα alters the membrane expression of the GP Ib-IX complex and may be responsible for Bernard-Soulier syndrome

  11. Absence of mutations in the coding sequence of the potential tumor suppressor 3pK in metastatic melanoma

    Directory of Open Access Journals (Sweden)

    Houben Roland

    2005-12-01

    Full Text Available Abstract Background Activation of Ras or Raf contributes to tumorigenesis of melanoma. However, constitutive Raf activation is also a characteristic of the majority of benign melanocytic nevi and high intensity signaling of either Ras or Raf was found to induce growth inhibition and senescence rather than transformation. Since the chromosome 3p kinase (3pK is a target of the Ras/Raf/Mek/Erk signaling pathway which antagonizes the function of the oncogene and anti-differentiation factor Bmi-1, 3pK may function as a tumor suppressor in tumors with constitutive Ras/Raf activation. Consequently, we tested whether inactivating 3pK mutations are present in melanoma. Methods 30 metastatic melanoma samples, which were positive for activating mutations of either BRaf or NRas, were analyzed for possible mutations in the 3pk gene. The 10 coding exons and their flanking intron sequences were amplified by PCR and direct sequencing of the PCR products was performed. Results This analysis revealed that besides the presence of some single nucleotide polymorphisms in the 3pk gene, we could not detect any possible loss of function mutation in any of these 30 metastatic melanoma samples selected for the presence of activating mutations within the Ras/Raf/Mek/Erk signaling pathway. Conclusion Hence, in melanoma with constitutively active Ras/Raf inactivating mutations within the 3pk gene do not contribute to the oncogenic phenotype of this highly malignant tumor.

  12. Generic detection of poleroviruses using an RT-PCR assay targeting the RdRp coding sequence.

    Science.gov (United States)

    Lotos, Leonidas; Efthimiou, Konstantinos; Maliogka, Varvara I; Katis, Nikolaos I

    2014-03-01

    In this study a two-step RT-PCR assay was developed for the generic detection of poleroviruses. The RdRp coding region was selected as the primers' target, since it differs significantly from that of other members in the family Luteoviridae and its sequence can be more informative than other regions in the viral genome. Species specific RT-PCR assays targeting the same region were also developed for the detection of the six most widespread poleroviral species (Beet mild yellowing virus, Beet western yellows virus, Cucurbit aphid-borne virus, Carrot red leaf virus, Potato leafroll virus and Turnip yellows virus) in Greece and the collection of isolates. These isolates along with other characterized ones were used for the evaluation of the generic PCR's detection range. The developed assay efficiently amplified a 593bp RdRp fragment from 46 isolates of 10 different Polerovirus species. Phylogenetic analysis using the generic PCR's amplicon sequence showed that although it cannot accurately infer evolutionary relationships within the genus it can differentiate poleroviruses at the species level. Overall, the described generic assay could be applied for the reliable detection of Polerovirus infections and, in combination with the specific PCRs, for the identification of new and uncharacterized species in the genus. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Isolation and sequencing of a cDNA coding for the human DF3 breast carcinoma-associated antigen

    International Nuclear Information System (INIS)

    Siddiqui, J.; Abe, M.; Hayes, D.; Shani, E.; Yunis, E.; Kufe, D.

    1988-01-01

    The murine monoclonal antibody (mAb) DF3 reacts with a high molecular weight glycoprotein detectable in human breast carcinomas. DF3 antigen expression correlates with human breast tumor differentiation, and the detection of a cross-reactive species in human milk has suggested that this antigen might be useful as a marker of differentiated mammary epithelium. To further characterize DF3 antigen expression, the authors have isolated a cDNA clone from a λgt11 library by screening with mAb DF3. The results demonstrate that this 309-base-pair cDNA, designated pDF9.3, codes for the DF3 epitope. Southern blot analyses of EcoRI-digested DNAs from six human tumor cell lines with 32 P-labeled pDF9.3 have revealed a restriction fragment length polymorphism. Variations in size of the alleles detected by pDF9.3 were also identified in Pst I, but not in HindIII, DNA digests. Furthermore, hybridization of 32 P-labeled pDF9.3 with total cellular RNA from each of these cell lines demonstrated either one or two transcripts that varied from 4.1 to 7.1 kilobases in size. The presence of differently sized transcripts detected by pDF9.3 was also found to correspond with the polymorphic expression of DF3 glycoproteins. Nucleotide sequence analysis of pDF9.3 has revealed a highly conserved (G + C)-rich 60-base-pair tandem repeat. These findings suggest that the variation in size of alleles coding for the polymorphic DF3 glycoprotein may represent different numbers of repeats

  14. Sequencing the GRHL3 Coding Region Reveals Rare Truncating Mutations and a Common Susceptibility Variant for Nonsyndromic Cleft Palate

    Science.gov (United States)

    Mangold, Elisabeth; Böhmer, Anne C.; Ishorst, Nina; Hoebel, Ann-Kathrin; Gültepe, Pinar; Schuenke, Hannah; Klamt, Johanna; Hofmann, Andrea; Gölz, Lina; Raff, Ruth; Tessmann, Peter; Nowak, Stefanie; Reutter, Heiko; Hemprich, Alexander; Kreusch, Thomas; Kramer, Franz-Josef; Braumann, Bert; Reich, Rudolf; Schmidt, Gül; Jäger, Andreas; Reiter, Rudolf; Brosch, Sibylle; Stavusis, Janis; Ishida, Miho; Seselgyte, Rimante; Moore, Gudrun E.; Nöthen, Markus M.; Borck, Guntram; Aldhorae, Khalid A.; Lace, Baiba; Stanier, Philip; Knapp, Michael; Ludwig, Kerstin U.

    2016-01-01

    Nonsyndromic cleft lip with/without cleft palate (nsCL/P) and nonsyndromic cleft palate only (nsCPO) are the most frequent subphenotypes of orofacial clefts. A common syndromic form of orofacial clefting is Van der Woude syndrome (VWS) where individuals have CL/P or CPO, often but not always associated with lower lip pits. Recently, ∼5% of VWS-affected individuals were identified with mutations in the grainy head-like 3 gene (GRHL3). To investigate GRHL3 in nonsyndromic clefting, we sequenced its coding region in 576 Europeans with nsCL/P and 96 with nsCPO. Most strikingly, nsCPO-affected individuals had a higher minor allele frequency for rs41268753 (0.099) than control subjects (0.049; p = 1.24 × 10−2). This association was replicated in nsCPO/control cohorts from Latvia, Yemen, and the UK (pcombined = 2.63 × 10−5; ORallelic = 2.46 [95% CI 1.6–3.7]) and reached genome-wide significance in combination with imputed data from a GWAS in nsCPO triads (p = 2.73 × 10−9). Notably, rs41268753 is not associated with nsCL/P (p = 0.45). rs41268753 encodes the highly conserved p.Thr454Met (c.1361C>T) (GERP = 5.3), which prediction programs denote as deleterious, has a CADD score of 29.6, and increases protein binding capacity in silico. Sequencing also revealed four novel truncating GRHL3 mutations including two that were de novo in four families, where all nine individuals harboring mutations had nsCPO. This is important for genetic counseling: given that VWS is rare compared to nsCPO, our data suggest that dominant GRHL3 mutations are more likely to cause nonsyndromic than syndromic CPO. Thus, with rare dominant mutations and a common risk variant in the coding region, we have identified an important contribution for GRHL3 in nsCPO. PMID:27018475

  15. Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

    International Nuclear Information System (INIS)

    Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.

    1986-01-01

    The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

  16. [Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].

    Science.gov (United States)

    Tarasova, O A; Filimonov, D A; Poroikov, V V

    2017-10-01

    Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.

  17. MicroRNA-128 targets myostatin at coding domain sequence to regulate myoblasts in skeletal muscle development.

    Science.gov (United States)

    Shi, Lei; Zhou, Bo; Li, Pinghua; Schinckel, Allan P; Liang, Tingting; Wang, Han; Li, Huizhi; Fu, Lingling; Chu, Qingpo; Huang, Ruihua

    2015-09-01

    MicroRNAs (miRNAs or miRs) play a critical role in skeletal muscle development. In a previous study we observed that miR-128 was highly expressed in skeletal muscle. However, its function in regulating skeletal muscle development is not clear. Our hypothesis was that miR-128 is involved in the regulation of the proliferation and differentiation of skeletal myoblasts. In this study, through bioinformatics analyses, we demonstrate that miR-128 specifically targeted mRNA of myostatin (MSTN), a critical inhibitor of skeletal myogenesis, at coding domain sequence (CDS) region, resulting in down-regulating of myostatin post-transcription. Overexpression of miR-128 inhibited proliferation of mouse C2C12 myoblast cells but promoted myotube formation; whereas knockdown of miR-128 had completely opposite effects. In addition, ectopic miR-128 regulated the expression of myogenic factor 5 (Myf5), myogenin (MyoG), paired box (Pax) 3 and 7. Furthermore, an inverse relationship was found between the expression of miR-128 and MSTN protein expression in vivo and in vitro. Taken together, these results reveal that there is a novel pathway in skeletal muscle development in which miR-128 regulates myostatin at CDS region to inhibit proliferation but promote differentiation of myoblast cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates.

    Science.gov (United States)

    Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc

    2017-11-01

    The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Older persons' worries expressed during home care visits: exploring the content of cues and concerns identified by the Verona coding definitions of emotional sequences.

    NARCIS (Netherlands)

    Hafskjold, L.; Eide, T.; Holmström, I.K.; Sundling, V.; Dulmen, S. van; Eide, H.

    2016-01-01

    Objective: Little is known about how older persons in home care express their concerns. Emotional cues and concerns can be identified by the Verona coding definitions of emotional sequences (VR-CoDES), but the method gives no insight into what causes the distress and the emotions involved. The aims

  20. Reverse transcriptase inhibitors as potential colorectal microbicides.

    Science.gov (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J

    2009-05-01

    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.

  1. Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

    Directory of Open Access Journals (Sweden)

    Elisabeth Humphris-Narayanan

    Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

  2. Low-pass shotgun sequencing of the barley genome facilitates rapid identification of genes, conserved non-coding sequences and novel repeats

    Directory of Open Access Journals (Sweden)

    Graner Andreas

    2008-10-01

    Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular

  3. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  4. Individual variation of human S1P₁ coding sequence leads to heterogeneity in receptor function and drug interactions.

    Science.gov (United States)

    Obinata, Hideru; Gutkind, Sarah; Stitham, Jeremiah; Okuno, Toshiaki; Yokomizo, Takehiko; Hwa, John; Hla, Timothy

    2014-12-01

    Sphingosine 1-phosphate receptor 1 (S1P₁), an abundantly-expressed G protein-coupled receptor which regulates key vascular and immune responses, is a therapeutic target in autoimmune diseases. Fingolimod/Gilenya (FTY720), an oral medication for relapsing-remitting multiple sclerosis, targets S1P₁ receptors on immune and neural cells to suppress neuroinflammation. However, suppression of endothelial S1P₁ receptors is associated with cardiac and vascular adverse effects. Here we report the genetic variations of the S1P₁ coding region from exon sequencing of >12,000 individuals and their functional consequences. We conducted functional analyses of 14 nonsynonymous single nucleotide polymorphisms (SNPs) of the S1PR1 gene. One SNP mutant (Arg¹²⁰ to Pro) failed to transmit sphingosine 1-phosphate (S1P)-induced intracellular signals such as calcium increase and activation of p44/42 MAPK and Akt. Two other mutants (Ile⁴⁵ to Thr and Gly³⁰⁵ to Cys) showed normal intracellular signals but impaired S1P-induced endocytosis, which made the receptor resistant to FTY720-induced degradation. Another SNP mutant (Arg¹³ to Gly) demonstrated protection from coronary artery disease in a high cardiovascular risk population. Individuals with this mutation showed a significantly lower percentage of multi-vessel coronary obstruction in a risk factor-matched case-control study. This study suggests that individual genetic variations of S1P₁ can influence receptor function and, therefore, infer differential disease risks and interaction with S1P₁-targeted therapeutics. Copyright © 2014 by the American Society for Biochemistry and Molecular Biology, Inc.

  5. Development of the Verona coding definitions of emotional sequences to code health providers' responses (VR-CoDES-P) to patient cues and concerns

    NARCIS (Netherlands)

    del Piccolo, Lidia; de Haes, Hanneke; Heaven, Cathy; Jansen, Jesse; Verheul, William; Bensing, Jozien; Bergvik, Svein; Deveugele, Myriam; Eide, Hilde; Fletcher, Ian; Goss, Claudia; Humphris, Gerry; Kim, Young-Mi; Langewitz, Wolf; Mazzi, Maria Angela; Mjaaland, Trond; Moretti, Francesca; Nübling, Matthias; Rimondini, Michela; Salmon, Peter; Sibbern, Tonje; Skre, Ingunn; van Dulmen, Sandra; Wissow, Larry; Young, Bridget; Zandbelt, Linda; Zimmermann, Christa; Finset, Arnstein

    2011-01-01

    Objective: To present a method to classify health provider responses to patient cues and concerns according to the VR-CoDES-CC (Del Piccolo et al. (2009) [2] and Zimmermann et al. (submitted for publication) [3]). The system permits sequence analysis and a detailed description of how providers

  6. Development of the Verona coding definitions of emotional sequences to code health providers' responses (VR-CoDES-P) to patient cues and concerns.

    NARCIS (Netherlands)

    Piccolo, L. del; Haes, H. de; Heaven, C.; Jansen, J.; Verheul, W.; Bensing, J.; Bergvik, S.; Deveugele, M.; Eide, H.; Fletcher, I.; Goss, C.; Humphris, G.; Young-Mi, K.; Langewitz, W.; Mazzi, M.A.; Mjaaland, T.; Moretti, F.; Nübling, M.; Rimondini, M.; Salmon, P.; Sibbern, T.; Skre, I.; Dulmen, S. van; Wissow, L.; Young, B.; Zandbelt, L.; Zimmermann, C.; Finset, A.

    2011-01-01

    Objective: To present a method to classify health provider responses to patient cues and concerns according to the VR-CoDES-CC (Del Piccolo et al. (2009) [2] and Zimmermann et al. (submitted for publication) [3]). The system permits sequence analysis and a detailed description of how providers

  7. Characterization of the FoxL2 proximal promoter and coding sequence from the common snapping turtle (Chelydra serpentina).

    Science.gov (United States)

    Guo, Lei; Rhen, Turk

    2017-10-01

    Sex is determined by temperature during embryogenesis in snapping turtles, Chelydra serpentina. Previous studies in this species show that dihydrotestosterone (DHT) induces ovarian development at temperatures that normally produce males or mixed sex ratios. The feminizing effect of DHT is associated with increased expression of FoxL2, suggesting that androgens regulate transcription of FoxL2. To test this hypothesis, we cloned the proximal promoter (1.6kb) and coding sequence for snapping turtle FoxL2 (tFoxL2) in frame with mCherry to produce a fluorescent reporter. The tFoxL2-mCherry fusion plasmid or mCherry control plasmid were stably transfected into mouse KK1 granulosa cells. These cells were then treated with 0, 1, 10, or 100nM DHT to assess androgen effects on tFoxL2-mCherry expression. In contrast to the main hypothesis, DHT did not alter expression of the tFoxL2-mCherry reporter. However, normal serum increased expression of tFoxL2-mCherry when compared to charcoal-stripped serum, indicating that the cloned region of tFoxL2 contains cis regulatory elements. We also used the tFoxL2-mCherry plasmid as an expression vector to test the hypothesis that DHT and tFoxL2 interact to regulate expression of endogenous genes in granulosa cells. While tFoxL2-mCherry and DHT had independent effects on mouse FoxL2, FshR, GnRHR, and StAR expression, tFoxL2-mCherry potentiated low concentration DHT effects on mouse aromatase expression. Further studies will be required to determine whether synergistic regulation of aromatase by DHT and FoxL2 also occurs in turtle gonads during the sex-determining period, which would explain the feminizing effect of DHT in this species. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Analysis of full coding sequence of the TP53 gene in invasive vulvar cancers: Implications for therapy.

    Science.gov (United States)

    Kashofer, Karl; Regauer, Sigrid

    2017-08-01

    This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.

  9. Application of MELCOR Code to a French PWR 900 MWe Severe Accident Sequence and Evaluation of Models Performance Focusing on In-Vessel Thermal Hydraulic Results

    International Nuclear Information System (INIS)

    De Rosa, Felice

    2006-01-01

    In the ambit of the Severe Accident Network of Excellence Project (SARNET), funded by the European Union, 6. FISA (Fission Safety) Programme, one of the main tasks is the development and validation of the European Accident Source Term Evaluation Code (ASTEC Code). One of the reference codes used to compare ASTEC results, coming from experimental and Reactor Plant applications, is MELCOR. ENEA is a SARNET member and also an ASTEC and MELCOR user. During the first 18 months of this project, we performed a series of MELCOR and ASTEC calculations referring to a French PWR 900 MWe and to the accident sequence of 'Loss of Steam Generator (SG) Feedwater' (known as H2 sequence in the French classification). H2 is an accident sequence substantially equivalent to a Station Blackout scenario, like a TMLB accident, with the only difference that in H2 sequence the scram is forced to occur with a delay of 28 seconds. The main events during the accident sequence are a loss of normal and auxiliary SG feedwater (0 s), followed by a scram when the water level in SG is equal or less than 0.7 m (after 28 seconds). There is also a main coolant pumps trip when ΔTsat < 10 deg. C, a total opening of the three relief valves when Tric (core maximal outlet temperature) is above 603 K (330 deg. C) and accumulators isolation when primary pressure goes below 1.5 MPa (15 bar). Among many other points, it is worth noting that this was the first time that a MELCOR 1.8.5 input deck was available for a French PWR 900. The main ENEA effort in this period was devoted to prepare the MELCOR input deck using the code version v.1.8.5 (build QZ Oct 2000 with the latest patch 185003 Oct 2001). The input deck, completely new, was prepared taking into account structure, data and same conditions as those found inside ASTEC input decks. The main goal of the work presented in this paper is to put in evidence where and when MELCOR provides good enough results and why, in some cases mainly referring to its

  10. A bacterial genetic screen identifies functional coding sequences of the insect mariner transposable element Famar1 amplified from the genome of the earwig, Forficula auricularia.

    Science.gov (United States)

    Barry, Elizabeth G; Witherspoon, David J; Lampe, David J

    2004-02-01

    Transposons of the mariner family are widespread in animal genomes and have apparently infected them by horizontal transfer. Most species carry only old defective copies of particular mariner transposons that have diverged greatly from their active horizontally transferred ancestor, while a few contain young, very similar, and active copies. We report here the use of a whole-genome screen in bacteria to isolate somewhat diverged Famar1 copies from the European earwig, Forficula auricularia, that encode functional transposases. Functional and nonfunctional coding sequences of Famar1 and nonfunctional copies of Ammar1 from the European honey bee, Apis mellifera, were sequenced to examine their molecular evolution. No selection for sequence conservation was detected in any clade of a tree derived from these sequences, not even on branches leading to functional copies. This agrees with the current model for mariner transposon evolution that expects neutral evolution within particular hosts, with selection for function occurring only upon horizontal transfer to a new host. Our results further suggest that mariners are not finely tuned genetic entities and that a greater amount of sequence diversification than had previously been appreciated can occur in functional copies in a single host lineage. Finally, this method of isolating active copies can be used to isolate other novel active transposons without resorting to reconstruction of ancestral sequences.

  11. Assembly of the Complete Sitka Spruce Chloroplast Genome Using 10X Genomics' GemCode Sequencing Data.

    Directory of Open Access Journals (Sweden)

    Lauren Coombe

    Full Text Available The linked read sequencing library preparation platform by 10X Genomics produces barcoded sequencing libraries, which are subsequently sequenced using the Illumina short read sequencing technology. In this new approach, long fragments of DNA are partitioned into separate micro-reactions, where the same index sequence is incorporated into each of the sequencing fragment inserts derived from a given long fragment. In this study, we exploited this property by using reads from index sequences associated with a large number of reads, to assemble the chloroplast genome of the Sitka spruce tree (Picea sitchensis. Here we report on the first Sitka spruce chloroplast genome assembled exclusively from P. sitchensis genomic libraries prepared using the 10X Genomics protocol. We show that the resulting 124,049 base pair long genome shares high sequence similarity with the related white spruce and Norway spruce chloroplast genomes, but diverges substantially from a previously published P. sitchensis- P. thunbergii chimeric genome. The use of reads from high-frequency indices enabled separation of the nuclear genome reads from that of the chloroplast, which resulted in the simplification of the de Bruijn graphs used at the various stages of assembly.

  12. Species tree phylogeny and character evolution in the genus Centipeda (Asteraceae): evidence from DNA sequences from coding and non-coding loci from the plastid and nuclear genomes.

    Science.gov (United States)

    Nylinder, Stephan; Cronholm, Bodil; de Lange, Peter J; Walsh, Neville; Anderberg, Arne A

    2013-08-01

    A species tree phylogeny of the Australian/New Zealand genus Centipeda (Asteraceae) is estimated based on nucleotide sequence data. We analysed sequences of nuclear ribosomal DNA (ETS, ITS) and three plasmid loci (ndhF, psbA-trnH, and trnL-F) using the multi-species coalescent module in BEAST. A total of 129 individuals from all 10 recognised species of Centipeda were sampled throughout the species distribution ranges, including two subspecies. We conclude that the inferred species tree topology largely conform previous assumptions on species relationships. Centipeda racemosa (Snuffweed) is the sister to remaining species, which is also the only consistently perennial representative in the genus. Centipeda pleiocephala (Tall Sneezeweed) and C. nidiformis (Cotton Sneezeweed) constitute a species pair, as does C. borealis and C. minima (Spreading Sneezeweed), all sharing the symplesiomorphic characters of spherical capitulum and convex receptacle with C. racemosa. Another species group comprising C. thespidioides (Desert Sneezeweed), C. cunninghamii (Old man weed, or Common sneeze-weed), C. crateriformis is well-supported but then include the morphologically aberrant C. aotearoana, all sharing the character of having capitula that mature more slowly relative the subtending shoot. Centipeda elatinoides takes on a weakly supported intermediate position between the two mentioned groups, and is difficult to relate to any of the former groups based on morphological characters. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors

    DEFF Research Database (Denmark)

    Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran

    2017-01-01

    BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...

  14. Phylogenetic analyses of the polyprotein coding sequences of serotype O foot-and-mouth disease viruses in East Africa: evidence for interserotypic recombination

    Directory of Open Access Journals (Sweden)

    Balinda Sheila N

    2010-08-01

    Full Text Available Abstract Background Foot-and-mouth disease (FMD is endemic in East Africa with the majority of the reported outbreaks attributed to serotype O virus. In this study, phylogenetic analyses of the polyprotein coding region of serotype O FMD viruses from Kenya and Uganda has been undertaken to infer evolutionary relationships and processes responsible for the generation and maintenance of diversity within this serotype. FMD virus RNA was obtained from six samples following virus isolation in cell culture and in one case by direct extraction from an oropharyngeal sample. Following RT-PCR, the single long open reading frame, encoding the polyprotein, was sequenced. Results Phylogenetic comparisons of the VP1 coding region showed that the recent East African viruses belong to one lineage within the EA-2 topotype while an older Kenyan strain, K/52/1992 is a representative of the topotype EA-1. Evolutionary relationships between the coding regions for the leader protease (L, the capsid region and almost the entire coding region are monophyletic except for the K/52/1992 which is distinct. Furthermore, phylogenetic relationships for the P2 and P3 regions suggest that the K/52/1992 is a probable recombinant between serotypes A and O. A bootscan analysis of K/52/1992 with East African FMD serotype A viruses (A21/KEN/1964 and A23/KEN/1965 and serotype O viral isolate (K/117/1999 revealed that the P2 region is probably derived from a serotype A strain while the P3 region appears to be a mosaic derived from both serotypes A and O. Conclusions Sequences of the VP1 coding region from recent serotype O FMDVs from Kenya and Uganda are all representatives of a specific East African lineage (topotype EA-2, a probable indication that hardly any FMD introductions of this serotype have occurred from outside the region in the recent past. Furthermore, evidence for interserotypic recombination, within the non-structural protein coding regions, between FMDVs of serotypes A

  15. Evolution of ASTEC V1.2 rev.1 code for WWER-1000 reactors/SBO sequence

    International Nuclear Information System (INIS)

    Georgieva, J.; Stefanova, A.; Groudev, P.; Tusheva, P.; Kalchev, B.; Passalacqua, R.

    2006-01-01

    In this paper a comparison between calculations of severe accidents occurred from WWER-1000 with ASTEC code specified for an event of full unloading with relief valves stuck opened with no hydroaccumulators intervention is presented. The purpose of the analyses provided is to present the relationship between the improvements of the actual version (ASTEC Vl.2 rev. 1) and ASTEC V1.1 p2 like: code modifications, incoming data improvements. Such discrepancies are to be examined. Case by case suggestions for ASTEC improvements are to be provided

  16. Simulation with the MELCOR code of two severe accident sequences, Station Blackout and Small Break LOCA, for the Atucha I nuclear power plant

    International Nuclear Information System (INIS)

    Valle Cepero, Reinaldo

    2004-01-01

    The results of the PSA-I applied to the Atucha I nuclear power plant (CNA I) determine the accidental sequences with the most influence related to the probability of the core reactor damage. Among those sequences are include, the Station Blackout and lost of primary coolant, combine with the failure of the emergency injection systems by pipe breaks of diameters between DN100 - DN25 or equivalent areas, Small LOCA. This paper has the objective to model and analyze the behavior of the primary circuit and the pressure vessel during the evolution of those two accidental sequences. It presented a detailed analysis of the main phenomena that occur from the initial moment of the accident to the failure moment of the pressure vessel and the melt material fall to the reactor cavity. Two sequences were taken into account, considering the main phenomena (core uncover, heating, fuel element oxidation, hydrogen generation, degradation and relocation of the melt material, failure of the support structures, etc.) and the time of occurrence, of those events will be different, if it is considered that both sequences will be developed in different scenarios. One case is an accident with the primary circuit to a high pressure (Station Blackout scenario) and the other with a early primary circuit depressurization due to the lost of primary coolant. For this work the MELCOR 1.8.5 code was used and it allows within a unified framework to modeling an extensive spectrum of phenomenology associated with the severe accidents. (author)

  17. MicroRNA-200c modulates the expression of MUC4 and MUC16 by directly targeting their coding sequences in human pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Prakash Radhakrishnan

    Full Text Available Transmembrane mucins, MUC4 and MUC16 are associated with tumor progression and metastatic potential in human pancreatic adenocarcinoma. We discovered that miR-200c interacts with specific sequences within the coding sequence of MUC4 and MUC16 mRNAs, and evaluated the regulatory nature of this association. Pancreatic cancer cell lines S2.028 and T3M-4 transfected with miR-200c showed a 4.18 and 8.50 fold down regulation of MUC4 mRNA, and 4.68 and 4.82 fold down regulation of MUC16 mRNA compared to mock-transfected cells, respectively. A significant reduction of glycoprotein expression was also observed. These results indicate that miR-200c overexpression regulates MUC4 and MUC16 mucins in pancreatic cancer cells by directly targeting the mRNA coding sequence of each, resulting in reduced levels of MUC4 and MUC16 mRNA and protein. These data suggest that, in addition to regulating proteins that modulate EMT, miR-200c influences expression of cell surface mucins in pancreatic cancer.

  18. An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

    DEFF Research Database (Denmark)

    Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

    2004-01-01

    Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

  19. Calibrated user-friendly reverse transcriptase-PCR assay

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Rammer, P

    1998-01-01

    We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...

  20. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  1. Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.

    Science.gov (United States)

    Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao

    2015-10-01

    Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.

  2. Evidence for a novel coding sequence overlapping the 5'-terminal ~90 codons of the Gill-associated and Yellow head okavirus envelope glycoprotein gene

    Directory of Open Access Journals (Sweden)

    Atkins John F

    2009-12-01

    Full Text Available Abstract The genus Okavirus (order Nidovirales includes a number of viruses that infect crustaceans, causing major losses in the shrimp industry. These viruses have a linear positive-sense ssRNA genome of ~26-27 kb, encoding a large replicase polyprotein that is expressed from the genomic RNA, and several additional proteins that are expressed from a nested set of 3'-coterminal subgenomic RNAs. In this brief report, we describe the bioinformatic discovery of a new, apparently coding, ORF that overlaps the 5' end of the envelope glycoprotein encoding sequence, ORF3, in the +2 reading frame. The new ORF has a strong coding signature and, in fact, is more conserved at the amino acid level than the overlapping region of ORF3. We propose that translation of the new ORF initiates at a conserved AUG codon separated by just 2 nt from the ORF3 AUG initiation codon, resulting in a novel 86 amino acid protein.

  3. Whole-Exome Sequencing of 2,000 Danish Individuals and the Role of Rare Coding Variants in Type 2 Diabetes

    DEFF Research Database (Denmark)

    Lohmueller, Kirk E.; Sparsø, Thomas; Li, Qibin

    2013-01-01

    number of genes. We applied a series of gene-based tests to detect such susceptibility genes. However, no gene showed a significant association with disease risk after we corrected for the number of genes analyzed. Thus, we could reject a model for the genetic architecture of type 2 diabetes where rare......It has been hypothesized that, in aggregate, rare variants in coding regions of genes explain a substantial fraction of the heritability of common diseases. We sequenced the exomes of 1,000 Danish cases with common forms of type 2 diabetes (including body mass index > 27.5 kg/m2 and hypertension...

  4. Performance Analysis of Direct-Sequence Code-Division Multiple-Access Communications with Asymmetric Quadrature Phase-Shift-Keying Modulation

    Science.gov (United States)

    Wang, C.-W.; Stark, W.

    2005-01-01

    This article considers a quaternary direct-sequence code-division multiple-access (DS-CDMA) communication system with asymmetric quadrature phase-shift-keying (AQPSK) modulation for unequal error protection (UEP) capability. Both time synchronous and asynchronous cases are investigated. An expression for the probability distribution of the multiple-access interference is derived. The exact bit-error performance and the approximate performance using a Gaussian approximation and random signature sequences are evaluated by extending the techniques used for uniform quadrature phase-shift-keying (QPSK) and binary phase-shift-keying (BPSK) DS-CDMA systems. Finally, a general system model with unequal user power and the near-far problem is considered and analyzed. The results show that, for a system with UEP capability, the less protected data bits are more sensitive to the near-far effect that occurs in a multiple-access environment than are the more protected bits.

  5. Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.

    Directory of Open Access Journals (Sweden)

    Anna Figueiredo

    2006-11-01

    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.

  6. In silico Coding Sequence Analysis of Walnut GAI and PIP2 Genes and Comparison with Different Plant Species

    Directory of Open Access Journals (Sweden)

    Mahdi Mohseniazar

    2017-02-01

    Full Text Available Introduction: Dwarfism is one of the important traits in breeding of crops and horticulture plants. A dwarfing rootstock will produce trees with 15-50% of standard trees size. In modern intensive fruit tree orchards, dwarfing rootstocks are commonly used to reduce trees size, enabling high-density planting and easy management, thus achieving higher yield. Trees on dwarfing rootstocks can also exhibit other economically important traits, such as precocious flowering, increased yield and increased disease resistance. Dwarf rootstocks have been extensively studied and released in stone and pome fruits, because of presence of genetic materials and the simplicity of budding methods. Control of tree size using genetically dwarf rootstocks for achievement to higher density and mechanized orchard systems is now very important for walnut production in the world especially in Iran. Many different genes can be involved in appear of this. Mutations in GAI and PIP2 genes cause dwarf trait by two different mechanisms in some plant species. In this case, we study in silico analysis of GAI and PIP2 genes consist of conserved sequences and domains, exon and intron number, function of their proteins, targeting, secondary and tertiary structure, and post translational modification. Materials and methods: The GAI and PIP2 mRNA and protein sequences (FASTA format belonging to 17 monocotyledon and dicotyledon were downloaded from NCBI (http://www.ncbi.nlm.nih.gov accessed, on September 2014. Several online web services and software were used for analysis of GAI and PIP2 mRNA and Proteins in plants. Comparative and bioinformatics analyses of PIP2 and GAI proteins were performed online at two websites NCBI (http://www.ncbi.nih.gov and EXPASY (http://expasy.org/tools. Molecular Evolutionary Genetics Analysis (MEGA; version 4 program and CLUSTAL-W with default parameters were used for multiple alignments of sequences. The phylogenetic analysis of GAI and PIP2 protein was

  7. In silico Coding Sequence Analysis of Walnut GAI and PIP2 Genes and Comparison with Different Plant Species

    Directory of Open Access Journals (Sweden)

    Mahdi Mohseniazar

    2017-09-01

    Full Text Available Introduction: Dwarfism is one of the important traits in breeding of crops and horticulture plants. A dwarfing rootstock will produce trees with 15-50% of standard trees size. In modern intensive fruit tree orchards, dwarfing rootstocks are commonly used to reduce trees size, enabling high-density planting and easy management, thus achieving higher yield. Trees on dwarfing rootstocks can also exhibit other economically important traits, such as precocious flowering, increased yield and increased disease resistance. Dwarf rootstocks have been extensively studied and released in stone and pome fruits, because of presence of genetic materials and the simplicity of budding methods. Control of tree size using genetically dwarf rootstocks for achievement to higher density and mechanized orchard systems is now very important for walnut production in the world especially in Iran. Many different genes can be involved in appear of this. Mutations in GAI and PIP2 genes cause dwarf trait by two different mechanisms in some plant species. In this case, we study in silico analysis of GAI and PIP2 genes consist of conserved sequences and domains, exon and intron number, function of their proteins, targeting, secondary and tertiary structure, and post translational modification. Materials and methods: The GAI and PIP2 mRNA and protein sequences (FASTA format belonging to 17 monocotyledon and dicotyledon were downloaded from NCBI (http://www.ncbi.nlm.nih.gov accessed, on September 2014. Several online web services and software were used for analysis of GAI and PIP2 mRNA and Proteins in plants. Comparative and bioinformatics analyses of PIP2 and GAI proteins were performed online at two websites NCBI (http://www.ncbi.nih.gov and EXPASY (http://expasy.org/tools. Molecular Evolutionary Genetics Analysis (MEGA; version 4 program and CLUSTAL-W with default parameters were used for multiple alignments of sequences. The phylogenetic analysis of GAI and PIP2 protein was

  8. Comprehensive search for intra- and inter-specific sequence polymorphisms among coding envelope genes of retroviral origin found in the human genome: genes and pseudogenes

    Directory of Open Access Journals (Sweden)

    Vasilescu Alexandre

    2005-09-01

    Full Text Available Abstract Background The human genome carries a high load of proviral-like sequences, called Human Endogenous Retroviruses (HERVs, which are the genomic traces of ancient infections by active retroviruses. These elements are in most cases defective, but open reading frames can still be found for the retroviral envelope gene, with sixteen such genes identified so far. Several of them are conserved during primate evolution, having possibly been co-opted by their host for a physiological role. Results To characterize further their status, we presently sequenced 12 of these genes from a panel of 91 Caucasian individuals. Genomic analyses reveal strong sequence conservation (only two non synonymous Single Nucleotide Polymorphisms [SNPs] for the two HERV-W and HERV-FRD envelope genes, i.e. for the two genes specifically expressed in the placenta and possibly involved in syncytiotrophoblast formation. We further show – using an ex vivo fusion assay for each allelic form – that none of these SNPs impairs the fusogenic function. The other envelope proteins disclose variable polymorphisms, with the occurrence of a stop codon and/or frameshift for most – but not all – of them. Moreover, the sequence conservation analysis of the orthologous genes that can be found in primates shows that three env genes have been maintained in a fully coding state throughout evolution including envW and envFRD. Conclusion Altogether, the present study strongly suggests that some but not all envelope encoding sequences are bona fide genes. It also provides new tools to elucidate the possible role of endogenous envelope proteins as susceptibility factors in a number of pathologies where HERVs have been suspected to be involved.

  9. Browning in Annona cherimola fruit: role of polyphenol oxidase and characterization of a coding sequence of the enzyme.

    Science.gov (United States)

    Prieto, Humberto; Utz, Daniella; Castro, Alvaro; Aguirre, Carlos; González-Agüero, Mauricio; Valdés, Héctor; Cifuentes, Nicolas; Defilippi, Bruno G; Zamora, Pablo; Zúñiga, Gustavo; Campos-Vargas, Reinaldo

    2007-10-31

    Cherimoya (Annona cherimola Mill.) fruit is an attractive candidate for food processing applications as fresh cut. However, along with its desirable delicate taste, cherimoya shows a marked susceptibility to browning. This condition is mainly attributed to polyphenol oxidase activity (PPO). A general lack of knowledge regarding PPO and its role in the oxidative loss of quality in processed cherimoya fruit requires a better understanding of the mechanisms involved. The work carried out included the cloning of a full-length cDNA, an analysis of its properties in the deduced amino sequence, and linkage of its mRNA levels with enzyme activity in mature and ripe fruits after wounding. The results showed one gene different at the nucleotide level when compared with previously reported genes, but a well-conserved protein, either in functional and in structural terms. Cherimoya PPO gene (Ac-ppo, GenBank DQ990911) showed to be present apparently in one copy of the genome, and its transcripts could be significantly detected in leaves and less abundantly in flowers and fruits. Analysis of wounded matured and ripened fruits revealed an inductive behavior for mRNA levels in the flesh of mature cherimoya after 16 h. Although the highest enzymatic activity was observed on rind, a consistent PPO activity was detected on flesh samples. A lack of correlation between PPO mRNA level and PPO activity was observed, especially in flesh tissue. This is probably due to the presence of monophenolic substrates inducing a lag period, enzyme inhibitors and/or diphenolic substrates causing suicide inactivation, and proenzyme or latent isoforms of PPO. To our knowledge this is the first report of a complete PPO sequence in cherimoya. Furthermore, the gene is highly divergent from known nucleotide sequences but shows a well conserved protein in terms of its function, deduced structure, and physiological role.

  10. Molecular phylogeny of Edraianthus (Grassy Bells; Campanulaceae) based on non-coding plastid DNA sequences

    DEFF Research Database (Denmark)

    Stefanovic, Sasa; Lakusic, Dmitar; Kuzmina, Maria

    2008-01-01

    The Balkan Peninsula is known as an ice-age refugium and an area with high rates of speciation and diversification. Only a few genera have their centers of distribution in the Balkans and the endemic genus Edraianthus is one of its most prominent groups. As such, Edraianthus is an excellent model...... divided into three sections: E. sect. Edraianthus, E. sect. Uniflori, and E. sect. Spathulati. We present here the first phylogenetic study of Edraianthus based on multiple plastid DNA sequences (trnL-F region and rbcL-atpB spacer) derived from a wide taxonomic sampling and geographic range. While...

  11. A large-scale study of the random variability of a coding sequence: a study on the CFTR gene.

    Science.gov (United States)

    Modiano, Guido; Bombieri, Cristina; Ciminelli, Bianca Maria; Belpinati, Francesca; Giorgi, Silvia; Georges, Marie des; Scotet, Virginie; Pompei, Fiorenza; Ciccacci, Cinzia; Guittard, Caroline; Audrézet, Marie Pierre; Begnini, Angela; Toepfer, Michael; Macek, Milan; Ferec, Claude; Claustres, Mireille; Pignatti, Pier Franco

    2005-02-01

    Coding single nucleotide substitutions (cSNSs) have been studied on hundreds of genes using small samples (n(g) approximately 100-150 genes). In the present investigation, a large random European population sample (average n(g) approximately 1500) was studied for a single gene, the CFTR (Cystic Fibrosis Transmembrane conductance Regulator). The nonsynonymous (NS) substitutions exhibited, in accordance with previous reports, a mean probability of being polymorphic (q > 0.005), much lower than that of the synonymous (S) substitutions, but they showed a similar rate of subpolymorphic (q < 0.005) variability. This indicates that, in autosomal genes that may have harmful recessive alleles (nonduplicated genes with important functions), genetic drift overwhelms selection in the subpolymorphic range of variability, making disadvantageous alleles behave as neutral. These results imply that the majority of the subpolymorphic nonsynonymous alleles of these genes are selectively negative or even pathogenic.

  12. Highly conserved non-coding elements on either side of SOX9 associated with Pierre Robin sequence.

    Science.gov (United States)

    Benko, Sabina; Fantes, Judy A; Amiel, Jeanne; Kleinjan, Dirk-Jan; Thomas, Sophie; Ramsay, Jacqueline; Jamshidi, Negar; Essafi, Abdelkader; Heaney, Simon; Gordon, Christopher T; McBride, David; Golzio, Christelle; Fisher, Malcolm; Perry, Paul; Abadie, Véronique; Ayuso, Carmen; Holder-Espinasse, Muriel; Kilpatrick, Nicky; Lees, Melissa M; Picard, Arnaud; Temple, I Karen; Thomas, Paul; Vazquez, Marie-Paule; Vekemans, Michel; Roest Crollius, Hugues; Hastie, Nicholas D; Munnich, Arnold; Etchevers, Heather C; Pelet, Anna; Farlie, Peter G; Fitzpatrick, David R; Lyonnet, Stanislas

    2009-03-01

    Pierre Robin sequence (PRS) is an important subgroup of cleft palate. We report several lines of evidence for the existence of a 17q24 locus underlying PRS, including linkage analysis results, a clustering of translocation breakpoints 1.06-1.23 Mb upstream of SOX9, and microdeletions both approximately 1.5 Mb centromeric and approximately 1.5 Mb telomeric of SOX9. We have also identified a heterozygous point mutation in an evolutionarily conserved region of DNA with in vitro and in vivo features of a developmental enhancer. This enhancer is centromeric to the breakpoint cluster and maps within one of the microdeletion regions. The mutation abrogates the in vitro enhancer function and alters binding of the transcription factor MSX1 as compared to the wild-type sequence. In the developing mouse mandible, the 3-Mb region bounded by the microdeletions shows a regionally specific chromatin decompaction in cells expressing Sox9. Some cases of PRS may thus result from developmental misexpression of SOX9 due to disruption of very-long-range cis-regulatory elements.

  13. 多重随机序列在算术编码中的应用%Application of Multiple Random Sequence in Arithmetic Coding

    Institute of Scientific and Technical Information of China (English)

    周明; 冯民富

    2012-01-01

    Arithmetic coding, for its high compression ratio and moderate coding efficiency, plays an important role in the standard of image compression technology. This algorithm depends on only one argument: the occurrence probability of information source symbols. This probability determines the efficiency of compression, and the interval of information source symbols as well. However, the classical arithmetic coding considers no internal structure of the input sequence of information source symbols, but only the probability of single symbols. Finally to which special combinations the coding intervals should be allocated, and whether there exists an effective allocation algorithm, these are still problems to been considered and settled.%算术编码凭借其高效的压缩比以及适度的编码效率,在图像压缩技术标准(比如JPEG等)中有着重要的地位。该算法仅仅依赖于一个参数:信源符号出现的概率。该概率决定了压缩编码的效率,同时也决定了编码过程中信源符号的间隔。然而,经典的算术编码都没有考虑信源符号输入序列的内在结构,仅仅是考虑单个的符号。这些连续的输入组合中的某些组合若大量出现在信源符号中,就有必要考虑这些组合的出现概率了。而最终需要给哪些特定的组合分配编码区间,以及是否有行之有效的分配算法,都需要考虑。

  14. Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.

    Science.gov (United States)

    Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari

    2018-05-03

    Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.

  15. New insights into flavivirus evolution, taxonomy and biogeographic history, extended by analysis of canonical and alternative coding sequences.

    Directory of Open Access Journals (Sweden)

    Gregory Moureau

    Full Text Available To generate the most diverse phylogenetic dataset for the flaviviruses to date, we determined the genomic sequences and phylogenetic relationships of 14 flaviviruses, of which 10 are primarily associated with Culex spp. mosquitoes. We analyze these data, in conjunction with a comprehensive collection of flavivirus genomes, to characterize flavivirus evolutionary and biogeographic history in unprecedented detail and breadth. Based on the presumed introduction of yellow fever virus into the Americas via the transatlantic slave trade, we extrapolated a timescale for a relevant subset of flaviviruses whose evolutionary history, shows that different Culex-spp. associated flaviviruses have been introduced from the Old World to the New World on at least five separate occasions, with 2 different sets of factors likely to have contributed to the dispersal of the different viruses. We also discuss the significance of programmed ribosomal frameshifting in a central region of the polyprotein open reading frame in some mosquito-associated flaviviruses.

  16. Characterization of a polymorphism in the coding sequence of FCN3 resulting in a Ficolin-3 (Hakata antigen) deficiency state

    DEFF Research Database (Denmark)

    Munthe-Fog, Lea; Hummelshøj, Tina; Ma, Ying Jie

    2008-01-01

    Ficolin-3 (Hakata antigen or H-ficolin) is a soluble pattern recognition molecule in the lectin complement pathway. We speculated whether common genetic variations in the FCN3 gene contribute to deficiency of Ficolin-3. The FCN3 gene was sequenced in 237 healthy Danish Caucasians. The relevance...... of polymorphisms was assessed with antibodies against Ficolin-3 in a novel ELISA system and by production of recombinant Ficolin-3 variants. Ficolin-3 serum profiles were analyzed by SDS-PAGE and western blotting. Ficolin-3 serum concentration varied 10-fold (median, 24microg/ml; range, 3-54microg/ml). Out.......025). SDS-PAGE and western blotting of serum revealed a weak band corresponding to the truncated molecule in addition to the normal Ficolin-3 pattern. Characterization of recombinant Ficolin-3 derived from FCN3+1637delC showed that in the homozygous situation this allelic variant would lead to Ficolin-3...

  17. Functional anthology of intrinsic disorder. 2. Cellular components, domains, technical terms, developmental processes, and coding sequence diversities correlated with long disordered regions.

    Science.gov (United States)

    Vucetic, Slobodan; Xie, Hongbo; Iakoucheva, Lilia M; Oldfield, Christopher J; Dunker, A Keith; Obradovic, Zoran; Uversky, Vladimir N

    2007-05-01

    Biologically active proteins without stable ordered structure (i.e., intrinsically disordered proteins) are attracting increased attention. Functional repertoires of ordered and disordered proteins are very different, and the ability to differentiate whether a given function is associated with intrinsic disorder or with a well-folded protein is crucial for modern protein science. However, there is a large gap between the number of proteins experimentally confirmed to be disordered and their actual number in nature. As a result, studies of functional properties of confirmed disordered proteins, while helpful in revealing the functional diversity of protein disorder, provide only a limited view. To overcome this problem, a bioinformatics approach for comprehensive study of functional roles of protein disorder was proposed in the first paper of this series (Xie, H.; Vucetic, S.; Iakoucheva, L. M.; Oldfield, C. J.; Dunker, A. K.; Obradovic, Z.; Uversky, V. N. Functional anthology of intrinsic disorder. 1. Biological processes and functions of proteins with long disordered regions. J. Proteome Res. 2007, 5, 1882-1898). Applying this novel approach to Swiss-Prot sequences and functional keywords, we found over 238 and 302 keywords to be strongly positively or negatively correlated, respectively, with long intrinsically disordered regions. This paper describes approximately 90 Swiss-Prot keywords attributed to the cellular components, domains, technical terms, developmental processes, and coding sequence diversities possessing strong positive and negative correlation with long disordered regions.

  18. Functional Anthology of Intrinsic Disorder. II. Cellular Components, Domains, Technical Terms, Developmental Processes and Coding Sequence Diversities Correlated with Long Disordered Regions

    Science.gov (United States)

    Vucetic, Slobodan; Xie, Hongbo; Iakoucheva, Lilia M.; Oldfield, Christopher J.; Dunker, A. Keith; Obradovic, Zoran; Uversky, Vladimir N.

    2008-01-01

    Biologically active proteins without stable ordered structure (i.e., intrinsically disordered proteins) are attracting increased attention. Functional repertoires of ordered and disordered proteins are very different, and the ability to differentiate whether a given function is associated with intrinsic disorder or with a well-folded protein is crucial for modern protein science. However, there is a large gap between the number of proteins experimentally confirmed to be disordered and their actual number in nature. As a result, studies of functional properties of confirmed disordered proteins, while helpful in revealing the functional diversity of protein disorder, provide only a limited view. To overcome this problem, a bioinformatics approach for comprehensive study of functional roles of protein disorder was proposed in the first paper of this series (Xie H., Vucetic S., Iakoucheva L.M., Oldfield C.J., Dunker A.K., Obradovic Z., Uversky V.N. (2006) Functional anthology of intrinsic disorder. I. Biological processes and functions of proteins with long disordered regions. J. Proteome Res.). Applying this novel approach to Swiss-Prot sequences and functional keywords, we found over 238 and 302 keywords to be strongly positively or negatively correlated, respectively, with long intrinsically disordered regions. This paper describes ~90 Swiss-Prot keywords attributed to the cellular components, domains, technical terms, developmental processes and coding sequence diversities possessing strong positive and negative correlation with long disordered regions. PMID:17391015

  19. Color differences among feral pigeons (Columba livia) are not attributable to sequence variation in the coding region of the melanocortin-1 receptor gene (MC1R)

    Science.gov (United States)

    2013-01-01

    Background Genetic variation at the melanocortin-1 receptor (MC1R) gene is correlated with melanin color variation in many birds. Feral pigeons (Columba livia) show two major melanin-based colorations: a red coloration due to pheomelanic pigment and a black coloration due to eumelanic pigment. Furthermore, within each color type, feral pigeons display continuous variation in the amount of melanin pigment present in the feathers, with individuals varying from pure white to a full dark melanic color. Coloration is highly heritable and it has been suggested that it is under natural or sexual selection, or both. Our objective was to investigate whether MC1R allelic variants are associated with plumage color in feral pigeons. Findings We sequenced 888 bp of the coding sequence of MC1R among pigeons varying both in the type, eumelanin or pheomelanin, and the amount of melanin in their feathers. We detected 10 non-synonymous substitutions and 2 synonymous substitution but none of them were associated with a plumage type. It remains possible that non-synonymous substitutions that influence coloration are present in the short MC1R fragment that we did not sequence but this seems unlikely because we analyzed the entire functionally important region of the gene. Conclusions Our results show that color differences among feral pigeons are probably not attributable to amino acid variation at the MC1R locus. Therefore, variation in regulatory regions of MC1R or variation in other genes may be responsible for the color polymorphism of feral pigeons. PMID:23915680

  20. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  1. Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?

    Science.gov (United States)

    Nolan, David

    2005-01-01

    Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.

  2. Development of elvitegravir resistance and linkage of integrase inhibitor mutations with protease and reverse transcriptase resistance mutations.

    Directory of Open Access Journals (Sweden)

    Mark A Winters

    Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.

  3. Older persons' worries expressed during home care visits: Exploring the content of cues and concerns identified by the Verona coding definitions of emotional sequences.

    Science.gov (United States)

    Hafskjold, Linda; Eide, Tom; Holmström, Inger K; Sundling, Vibeke; van Dulmen, Sandra; Eide, Hilde

    2016-12-01

    Little is known about how older persons in home care express their concerns. Emotional cues and concerns can be identified by the Verona coding definitions of emotional sequences (VR-CoDES), but the method gives no insight into what causes the distress and the emotions involved. The aims of this study are to explore (1) older persons' worries and (2) the content of these expressions. An observational exploratory two-step approach was used to investigate audiotaped recordings from 38 Norwegian home care visits with older persons and nurse assistants. First, 206 cues and concerns were identified using VR-CoDES. Second, the content and context of these expressions were analysed inductively. Four main categories emerged: worries about relationships with others, worries about health care-related issues, worries about aging and bodily impairment, and life narratives and value issues, with several subcategories showing the causes of worry and emotions involved. The two-step approach provides an in-depth knowledge of older persons' worries, causes of worries, and their related emotions. The subcategories described in a language close to the experience can be useful in practice development and communication training for students and health care providers. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  4. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali

    2015-11-27

    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  5. A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome

    Directory of Open Access Journals (Sweden)

    Marcin Kierczak

    2009-10-01

    Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.

  6. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki

    2015-01-01

    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  7. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.

    Science.gov (United States)

    Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko

    2011-01-01

    HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

  8. NMR structure of the HIV-1 reverse transcriptase thumb subdomain

    Energy Technology Data Exchange (ETDEWEB)

    Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)

    2016-12-15

    The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

  9. The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2014-03-01

    Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

  10. Sequence analysis of Epstein-Barr virus EBNA-2 gene coding amino acid 148-487 in nasopharyngeal and gastric carcinomas

    Directory of Open Access Journals (Sweden)

    Wang Xinying

    2012-02-01

    Full Text Available Abstract Background The Epstein-Barr virus (EBV nuclear antigen 2 (EBNA-2 plays a key role in the B-cell growth transformation by initiating and maintaining the proliferation of infected B-cell upon EBV infection in vitro. Most studies about EBNA-2 have focused on its functions yet little is known for its intertypic polymorphisms. Results Coding region for amino acid (aa 148-487 of the EBNA-2 gene was sequenced in 25 EBV-associated gastric carcinomas (EBVaGCs, 56 nasopharyngeal carcinomas (NPCs and 32 throat washings (TWs from healthy donors in Northern China. Three variations (g48991t, c48998a, t49613a were detected in all of the samples (113/113, 100%. EBNA-2 could be classified into four distinct subtypes: E2-A, E2-B, E2-C and E2-D based on the deletion status of three aa (294Q, 357K and 358G. Subtypes E2-A and E2-C were detected in 56/113 (49.6%, 38/113 (33.6% samples, respectively. E2-A was observed more in EBVaGCs samples and subtype E2-D was only detected in the NPC samples. Variation analysis in EBNA-2 functional domains: the TAD residue (I438L and the NLS residues (E476G, P484H and I486T were only detected in NPC samples which located in the carboxyl terminus of EBNA-2 gene. Conclusions The subtypes E2-A and E2-C were the dominant genotypes of the EBNA-2 gene in Northern China. The subtype E2-D may be associated with the tumorigenesis of NPC. The NPC isolates were prone harbor to more mutations than the other two groups in the functional domains.

  11. Evolutionary changes in gene expression, coding sequence and copy-number at the Cyp6g1 locus contribute to resistance to multiple insecticides in Drosophila.

    Directory of Open Access Journals (Sweden)

    Thomas W R Harrop

    Full Text Available Widespread use of insecticides has led to insecticide resistance in many populations of insects. In some populations, resistance has evolved to multiple pesticides. In Drosophila melanogaster, resistance to multiple classes of insecticide is due to the overexpression of a single cytochrome P450 gene, Cyp6g1. Overexpression of Cyp6g1 appears to have evolved in parallel in Drosophila simulans, a sibling species of D. melanogaster, where it is also associated with insecticide resistance. However, it is not known whether the ability of the CYP6G1 enzyme to provide resistance to multiple insecticides evolved recently in D. melanogaster or if this function is present in all Drosophila species. Here we show that duplication of the Cyp6g1 gene occurred at least four times during the evolution of different Drosophila species, and the ability of CYP6G1 to confer resistance to multiple insecticides exists in D. melanogaster and D. simulans but not in Drosophila willistoni or Drosophila virilis. In D. virilis, which has multiple copies of Cyp6g1, one copy confers resistance to DDT and another to nitenpyram, suggesting that the divergence of protein sequence between copies subsequent to the duplication affected the activity of the enzyme. All orthologs tested conferred resistance to one or more insecticides, suggesting that CYP6G1 had the capacity to provide resistance to anthropogenic chemicals before they existed. Finally, we show that expression of Cyp6g1 in the Malpighian tubules, which contributes to DDT resistance in D. melanogaster, is specific to the D. melanogaster-D. simulans lineage. Our results suggest that a combination of gene duplication, regulatory changes and protein coding changes has taken place at the Cyp6g1 locus during evolution and this locus may play a role in providing resistance to different environmental toxins in different Drosophila species.

  12. Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

    Science.gov (United States)

    Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

    2014-04-01

    A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

  13. Diagnostic and prognostic signatures from the small non-coding RNA transcriptome in prostate cancer

    DEFF Research Database (Denmark)

    Martens-Uzunova, E S; Jalava, S E; Dits, N F

    2011-01-01

    Prostate cancer (PCa) is the most frequent male malignancy and the second most common cause of cancer-related death in Western countries. Current clinical and pathological methods are limited in the prediction of postoperative outcome. It is becoming increasingly evident that small non-coding RNA...... signatures of 102 fresh-frozen patient samples during PCa progression by miRNA microarrays. Both platforms were cross-validated by quantitative reverse transcriptase-PCR. Besides the altered expression of several miRNAs, our deep sequencing analyses revealed strong differential expression of small nucleolar...... RNAs (snoRNAs) and transfer RNAs (tRNAs). From microarray analysis, we derived a miRNA diagnostic classifier that accurately distinguishes normal from cancer samples. Furthermore, we were able to construct a PCa prognostic predictor that independently forecasts postoperative outcome. Importantly...

  14. Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.

    Science.gov (United States)

    Sharma, Mamta; Saravolatz, Louis D

    2013-02-01

    Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.

  15. Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †

    Science.gov (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.

    2009-01-01

    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271

  16. A second chance for telomerase reverse transcriptase in anticancer immunotherapy.

    Science.gov (United States)

    Zanetti, Maurizio

    2017-02-01

    Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.

  17. 2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase

    International Nuclear Information System (INIS)

    Starnes, M.C.

    1988-01-01

    2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells

  18. Codes and curves

    CERN Document Server

    Walker, Judy L

    2000-01-01

    When information is transmitted, errors are likely to occur. Coding theory examines efficient ways of packaging data so that these errors can be detected, or even corrected. The traditional tools of coding theory have come from combinatorics and group theory. Lately, however, coding theorists have added techniques from algebraic geometry to their toolboxes. In particular, by re-interpreting the Reed-Solomon codes, one can see how to define new codes based on divisors on algebraic curves. For instance, using modular curves over finite fields, Tsfasman, Vladut, and Zink showed that one can define a sequence of codes with asymptotically better parameters than any previously known codes. This monograph is based on a series of lectures the author gave as part of the IAS/PCMI program on arithmetic algebraic geometry. Here, the reader is introduced to the exciting field of algebraic geometric coding theory. Presenting the material in the same conversational tone of the lectures, the author covers linear codes, inclu...

  19. Two-terminal video coding.

    Science.gov (United States)

    Yang, Yang; Stanković, Vladimir; Xiong, Zixiang; Zhao, Wei

    2009-03-01

    Following recent works on the rate region of the quadratic Gaussian two-terminal source coding problem and limit-approaching code designs, this paper examines multiterminal source coding of two correlated, i.e., stereo, video sequences to save the sum rate over independent coding of both sequences. Two multiterminal video coding schemes are proposed. In the first scheme, the left sequence of the stereo pair is coded by H.264/AVC and used at the joint decoder to facilitate Wyner-Ziv coding of the right video sequence. The first I-frame of the right sequence is successively coded by H.264/AVC Intracoding and Wyner-Ziv coding. An efficient stereo matching algorithm based on loopy belief propagation is then adopted at the decoder to produce pixel-level disparity maps between the corresponding frames of the two decoded video sequences on the fly. Based on the disparity maps, side information for both motion vectors and motion-compensated residual frames of the right sequence are generated at the decoder before Wyner-Ziv encoding. In the second scheme, source splitting is employed on top of classic and Wyner-Ziv coding for compression of both I-frames to allow flexible rate allocation between the two sequences. Experiments with both schemes on stereo video sequences using H.264/AVC, LDPC codes for Slepian-Wolf coding of the motion vectors, and scalar quantization in conjunction with LDPC codes for Wyner-Ziv coding of the residual coefficients give a slightly lower sum rate than separate H.264/AVC coding of both sequences at the same video quality.

  20. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  1. Molecular phylogeny of 21 tropical bamboo species reconstructed by integrating non-coding internal transcribed spacer (ITS1 and 2) sequences and their consensus secondary structure.

    Science.gov (United States)

    Ghosh, Jayadri Sekhar; Bhattacharya, Samik; Pal, Amita

    2017-06-01

    The unavailability of the reproductive structure and unpredictability of vegetative characters for the identification and phylogenetic study of bamboo prompted the application of molecular techniques for greater resolution and consensus. We first employed internal transcribed spacer (ITS1, 5.8S rRNA and ITS2) sequences to construct the phylogenetic tree of 21 tropical bamboo species. While the sequence alone could grossly reconstruct the traditional phylogeny amongst the 21-tropical species studied, some anomalies were encountered that prompted a further refinement of the phylogenetic analyses. Therefore, we integrated the secondary structure of the ITS sequences to derive individual sequence-structure matrix to gain more resolution on the phylogenetic reconstruction. The results showed that ITS sequence-structure is the reliable alternative to the conventional phenotypic method for the identification of bamboo species. The best-fit topology obtained by the sequence-structure based phylogeny over the sole sequence based one underscores closer clustering of all the studied Bambusa species (Sub-tribe Bambusinae), while Melocanna baccifera, which belongs to Sub-Tribe Melocanneae, disjointedly clustered as an out-group within the consensus phylogenetic tree. In this study, we demonstrated the dependability of the combined (ITS sequence+structure-based) approach over the only sequence-based analysis for phylogenetic relationship assessment of bamboo.

  2. Impact of HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype: results of a global collaboration.

    Directory of Open Access Journals (Sweden)

    Rami Kantor

    2005-04-01

    Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.

  3. Code Cactus; Code Cactus

    Energy Technology Data Exchange (ETDEWEB)

    Fajeau, M; Nguyen, L T; Saunier, J [Commissariat a l' Energie Atomique, Centre d' Etudes Nucleaires de Saclay, 91 - Gif-sur-Yvette (France)

    1966-09-01

    This code handles the following problems: -1) Analysis of thermal experiments on a water loop at high or low pressure; steady state or transient behavior; -2) Analysis of thermal and hydrodynamic behavior of water-cooled and moderated reactors, at either high or low pressure, with boiling permitted; fuel elements are assumed to be flat plates: - Flowrate in parallel channels coupled or not by conduction across plates, with conditions of pressure drops or flowrate, variable or not with respect to time is given; the power can be coupled to reactor kinetics calculation or supplied by the code user. The code, containing a schematic representation of safety rod behavior, is a one dimensional, multi-channel code, and has as its complement (FLID), a one-channel, two-dimensional code. (authors) [French] Ce code permet de traiter les problemes ci-dessous: 1. Depouillement d'essais thermiques sur boucle a eau, haute ou basse pression, en regime permanent ou transitoire; 2. Etudes thermiques et hydrauliques de reacteurs a eau, a plaques, a haute ou basse pression, ebullition permise: - repartition entre canaux paralleles, couples on non par conduction a travers plaques, pour des conditions de debit ou de pertes de charge imposees, variables ou non dans le temps; - la puissance peut etre couplee a la neutronique et une representation schematique des actions de securite est prevue. Ce code (Cactus) a une dimension d'espace et plusieurs canaux, a pour complement Flid qui traite l'etude d'un seul canal a deux dimensions. (auteurs)

  4. Cloning and sequencing of the gene coding for alcohol dehydrogenase of Bacillus stearothermophilus and rational shift of the optimum pH.

    OpenAIRE

    Sakoda, H; Imanaka, T

    1992-01-01

    Using Bacillus subtilis as a host and pTB524 as a vector plasmid, we cloned the thermostable alcohol dehydrogenase (ADH-T) gene (adhT) from Bacillus stearothermophilus NCA1503 and determined its nucleotide sequence. The deduced amino acid sequence (337 amino acids) was compared with the sequences of ADHs from four different origins. The amino acid residues responsible for the catalytic activity of horse liver ADH had been clarified on the basis of three-dimensional structure. Since those cata...

  5. Lentin, a novel and potent antifungal protein from shitake mushroom with inhibitory effects on activity of human immunodeficiency virus-1 reverse transcriptase and proliferation of leukemia cells.

    Science.gov (United States)

    Ngai, Patrick H K; Ng, T B

    2003-11-14

    From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.

  6. N348I in the connection domain of HIV-1 reverse transcriptase confers zidovudine and nevirapine resistance.

    Directory of Open Access Journals (Sweden)

    Soo-Huey Yap

    2007-12-01

    Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which

  7. Evidence for a relief of repression mechanism for activation of the human telomerase reverse transcriptase promoter.

    Science.gov (United States)

    Wang, Shuwen; Zhu, Jiyue

    2003-05-23

    The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.

  8. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

    Science.gov (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

    2007-10-01

    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  9. Complete genome sequence of a Chinese isolate of pepper vein yellows virus and evolutionary analysis based on the CP, MP and RdRp coding regions.

    Science.gov (United States)

    Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun

    2016-03-01

    The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.

  10. Phylogenetic footprinting of non-coding RNA: hammerhead ribozyme sequences in a satellite DNA family of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae

    Directory of Open Access Journals (Sweden)

    Venanzetti Federica

    2010-01-01

    Full Text Available Abstract Background The great variety in sequence, length, complexity, and abundance of satellite DNA has made it difficult to ascribe any function to this genome component. Recent studies have shown that satellite DNA can be transcribed and be involved in regulation of chromatin structure and gene expression. Some satellite DNAs, such as the pDo500 sequence family in Dolichopoda cave crickets, have a catalytic hammerhead (HH ribozyme structure and activity embedded within each repeat. Results We assessed the phylogenetic footprints of the HH ribozyme within the pDo500 sequences from 38 different populations representing 12 species of Dolichopoda. The HH region was significantly more conserved than the non-hammerhead (NHH region of the pDo500 repeat. In addition, stems were more conserved than loops. In stems, several compensatory mutations were detected that maintain base pairing. The core region of the HH ribozyme was affected by very few nucleotide substitutions and the cleavage position was altered only once among 198 sequences. RNA folding of the HH sequences revealed that a potentially active HH ribozyme can be found in most of the Dolichopoda populations and species. Conclusions The phylogenetic footprints suggest that the HH region of the pDo500 sequence family is selected for function in Dolichopoda cave crickets. However, the functional role of HH ribozymes in eukaryotic organisms is unclear. The possible functions have been related to trans cleavage of an RNA target by a ribonucleoprotein and regulation of gene expression. Whether the HH ribozyme in Dolichopoda is involved in similar functions remains to be investigated. Future studies need to demonstrate how the observed nucleotide changes and evolutionary constraint have affected the catalytic efficiency of the hammerhead.

  11. Length and nucleotide sequence polymorphism at the trnL and trnF non-coding regions of chloroplast genomes among Saccharum and Erianthus species

    Science.gov (United States)

    The aneupolyploidy genome of sugarcane (Saccharum hybrids spp.) and lack of a classical genetic linkage map make genetics research most difficult for sugarcane. Whole genome sequencing and genetic characterization of sugarcane and related taxa are far behind other crops. In this study, universal PCR...

  12. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  13. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity

    International Nuclear Information System (INIS)

    Lubahn, D.B.; Simental, J.A.; Higgs, H.N.; Wilson, E.M.; French, F.S.; Brown, T.R.; Migeon, C.J.

    1989-01-01

    Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but the binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development

  14. A reflection of the coding of meaning in patient-physician interaction: Jürgen Habermas' theory of communication applied to sequence analysis.

    Science.gov (United States)

    Skirbekk, Helge

    2004-08-01

    This paper introduces parts of Jürgen Habermas' theory of communication in an attempt to understand how meaning is coded in patient-physician communication. By having a closer look at how patients and physicians make assertions with their utterances, light will be shed on difficult aspects of reaching understanding in the clinical encounter. Habermas' theory will be used to differentiate assertions into validity claims referring to truth, truthfulness and rightness. An analysis of hypothetical physician-replies to a patient suffering from back pains will substantiate the necessity for such a theory.

  15. Nucleotide sequence of the Escherichia coli pyrE gene and of the DNA in front of the protein-coding region

    DEFF Research Database (Denmark)

    Poulsen, Peter; Jensen, Kaj Frank; Valentin-Hansen, Poul

    1983-01-01

    leader segment in front of the protein-coding region. This leader contains a structure with features characteristic for a (translated?) rho-independent transcriptional terminator, which is preceded by a cluster of uridylate residues. This indicates that the frequency of pyrE transcription is regulated......Orotate phosphoribosyltransferase (EC 2.4.2.10) was purified to electrophoretic homogeneity from a strain of Escherichia coli containing the pyrE gene cloned on a multicopy plasmid. The relative molecular masses (Mr) of the native enzyme and its subunit were estimated by means of gel filtration...

  16. Computational Analysis of Molecular Interaction Networks Underlying Change of HIV-1 Resistance to Selected Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan

    2010-12-12

    Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.

  17. Diversity of antisense and other non-coding RNAs in Archaea revealed by comparative small RNA sequencing in four Pyrobaculum species

    Directory of Open Access Journals (Sweden)

    David L Bernick

    2012-07-01

    Full Text Available A great diversity of small, non-coding RNA molecules with roles in gene regulation and RNA processing have been intensely studied in eukaryotic and bacterial model organisms, yet our knowledge of possible parallel roles for small RNAs in archaea is limited. We employed RNA-seq to identify novel small RNA across multiple species of the hyperthermophilic genus Pyrobaculum, known for unusual RNA gene characteristics. By comparing transcriptional data collected in parallel among four species, we were able to identify conserved RNA genes fitting into known and novel families. Among our findings, we highlight three novel cis-antisense small RNAs encoded opposite to key regulatory (ferric uptake regulator, metabolic (triose-phosphate isomerase, and core transcriptional apparatus genes (transcription factor B. We also found a large increase in the number of conserved C/D box small RNA genes over what had been previously recognized; many of these genes are encoded antisense to protein coding genes. The conserved opposition to orthologous genes across the Pyrobaculum genus suggests similarities to other cis-antisense regulatory systems. Furthermore, the genus-specific nature of these small RNAs indicates they are relatively recent, stable adaptations.

  18. Cloning and sequencing of the gene coding for alcohol dehydrogenase of Bacillus stearothermophilus and rational shift of the optimum pH.

    Science.gov (United States)

    Sakoda, H; Imanaka, T

    1992-02-01

    Using Bacillus subtilis as a host and pTB524 as a vector plasmid, we cloned the thermostable alcohol dehydrogenase (ADH-T) gene (adhT) from Bacillus stearothermophilus NCA1503 and determined its nucleotide sequence. The deduced amino acid sequence (337 amino acids) was compared with the sequences of ADHs from four different origins. The amino acid residues responsible for the catalytic activity of horse liver ADH had been clarified on the basis of three-dimensional structure. Since those catalytic amino acid residues were fairly conserved in ADH-T and other ADHs, ADH-T was inferred to have basically the same proton release system as horse liver ADH. The putative proton release system of ADH-T was elucidated by introducing point mutations at the catalytic amino acid residues, Cys-38 (cysteine at position 38), Thr-40, and His-43, with site-directed mutagenesis. The mutant enzyme Thr-40-Ser (Thr-40 was replaced by serine) showed a little lower level of activity than wild-type ADH-T did. The result indicates that the OH group of serine instead of threonine can also be used for the catalytic activity. To change the pKa value of the putative system, His-43 was replaced by the more basic amino acid arginine. As a result, the optimum pH of the mutant enzyme His-43-Arg was shifted from 7.8 (wild-type enzyme) to 9.0. His-43-Arg exhibited a higher level of activity than wild-type enzyme at the optimum pH.

  19. Identification and expression of the tig gene coding for trigger factor from psychrophilic bacteria with no information of genome sequence available.

    Science.gov (United States)

    Lee, Kyunghee; Choi, Hyojung; Im, Hana

    2009-08-01

    Trigger factor (TF) plays a key role as a molecular chaperone with a peptidyl-prolyl cis-trans isomerase (PPIase) activity by which cells promote folding of newly synthesized proteins coming out of ribosomes. Since psychrophilic bacteria grow at a quite low temperature, between 4 and 15 degrees C, TF from such bacteria was investigated and compared with that of mesophilic bacteria E. coli in order to offer an explanation of cold-adaptation at a molecular level. Using a combination of gradient PCRs with homologous primers and LA PCR in vitro cloning technology, the tig gene was fully identified from Psychromonas arctica, whose genome sequence is not yet available. The resulting amino acid sequence of the TF was compared with other homologous TFs using sequence alignments to search for common domains. In addition, we have developed a protein expression system, by which TF proteins from P. arctica (PaTF) were produced by IPTG induction upon cloning the tig gene on expression vectors, such as pAED4. We have further examined the role of expressed psychrophilic PaTF on survival against cold treatment at 4 degrees C. Finally, we have attempted the in vitro biochemical characterization of TF proteins with His-tags expressed in a pET system, such as the PPIase activity of PaTF protein. Our results demonstrate that the expressed PaTF proteins helped cells survive against cold environments in vivo and the purified PaTF in vitro display the functional PPIase activity in a concentration dependent manner.

  20. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires

    Directory of Open Access Journals (Sweden)

    Sukrit Silas

    2017-07-01

    Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.

  1. Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity

    Science.gov (United States)

    House, M.L.; Kim, C.H.; Reno, P.W.

    1998-01-01

    Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.

  2. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

    2018-01-01

    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  3. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients

    DEFF Research Database (Denmark)

    Lundgren, Jens

    2008-01-01

    BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...

  4. Evolving uses of oral reverse transcriptase inhibitors in the HIV-1 epidemic: From treatment to prevention

    NARCIS (Netherlands)

    R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)

    2013-01-01

    textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the

  5. Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory

    Directory of Open Access Journals (Sweden)

    Edward J. Steele

    2017-11-01

    Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.

  6. Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

    Science.gov (United States)

    Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

    2016-04-01

    Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

  7. gEVE: a genome-based endogenous viral element database provides comprehensive viral protein-coding sequences in mammalian genomes.

    Science.gov (United States)

    Nakagawa, So; Takahashi, Mahoko Ueda

    2016-01-01

    In mammals, approximately 10% of genome sequences correspond to endogenous viral elements (EVEs), which are derived from ancient viral infections of germ cells. Although most EVEs have been inactivated, some open reading frames (ORFs) of EVEs obtained functions in the hosts. However, EVE ORFs usually remain unannotated in the genomes, and no databases are available for EVE ORFs. To investigate the function and evolution of EVEs in mammalian genomes, we developed EVE ORF databases for 20 genomes of 19 mammalian species. A total of 736,771 non-overlapping EVE ORFs were identified and archived in a database named gEVE (http://geve.med.u-tokai.ac.jp). The gEVE database provides nucleotide and amino acid sequences, genomic loci and functional annotations of EVE ORFs for all 20 genomes. In analyzing RNA-seq data with the gEVE database, we successfully identified the expressed EVE genes, suggesting that the gEVE database facilitates studies of the genomic analyses of various mammalian species.Database URL: http://geve.med.u-tokai.ac.jp. © The Author(s) 2016. Published by Oxford University Press.

  8. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires.

    Science.gov (United States)

    Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z

    2017-07-11

    Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From

  9. Telomerase reverse transcriptase locus polymorphisms and cancer risk: a field synopsis and meta-analysis.

    Science.gov (United States)

    Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato

    2012-06-06

    Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic

  10. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.

    2011-01-01

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

  11. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  12. Telomerase reverse transcriptase promoter mutations in bladder cancer

    DEFF Research Database (Denmark)

    Allory, Yves; Beukers, Willemien; Sagrera, Ana

    2014-01-01

    for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...

  13. Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals.

    Science.gov (United States)

    Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L

    2017-11-08

    The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

  14. Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing

    Directory of Open Access Journals (Sweden)

    Peng Huiru

    2011-04-01

    Full Text Available Abstract Background Biotic and abiotic stresses, such as powdery mildew infection and high temperature, are important limiting factors for yield and grain quality in wheat production. Emerging evidences suggest that long non-protein coding RNAs (npcRNAs are developmentally regulated and play roles in development and stress responses of plants. However, identification of long npcRNAs is limited to a few plant species, such as Arabidopsis, rice and maize, no systematic identification of long npcRNAs and their responses to abiotic and biotic stresses is reported in wheat. Results In this study, by using computational analysis and experimental approach we identified 125 putative wheat stress responsive long npcRNAs, which are not conserved among plant species. Among them, some were precursors of small RNAs such as microRNAs and siRNAs, two long npcRNAs were identified as signal recognition particle (SRP 7S RNA variants, and three were characterized as U3 snoRNAs. We found that wheat long npcRNAs showed tissue dependent expression patterns and were responsive to powdery mildew infection and heat stress. Conclusion Our results indicated that diverse sets of wheat long npcRNAs were responsive to powdery mildew infection and heat stress, and could function in wheat responses to both biotic and abiotic stresses, which provided a starting point to understand their functions and regulatory mechanisms in the future.

  15. Profiling of Long Non-coding RNAs and mRNAs by RNA-Sequencing in the Hippocampi of Adult Mice Following Propofol Sedation.

    Science.gov (United States)

    Fan, Jun; Zhou, Quan; Li, Yan; Song, Xiuling; Hu, Jijie; Qin, Zaisheng; Tang, Jing; Tao, Tao

    2018-01-01

    Propofol is a frequently used intravenous anesthetic agent. The impairment caused by propofol on the neural system, especially the hippocampus, has been widely reported. However, the molecular mechanism underlying the effects of propofol on learning and memory functions in the hippocampus is still unclear. In the present study we performed lncRNA and mRNA analysis in the hippocampi of adult mice, after propofol sedation, through RNA-Sequencing (RNA-Seq). A total of 146 differentially expressed lncRNAs and 1103 mRNAs were identified. Bioinformatics analysis, including gene ontology (GO) analysis, pathway analysis and network analysis, were done for the identified dysregulated genes. Pathway analysis indicated that the FoxO signaling pathway played an important role in the effects of propofol on the hippocampus. Finally, four lncRNAs and three proteins were selected from the FoxO-related network for further validation. The up-regulation of lncE230001N04Rik and the down-regulation of lncRP23-430H21.1 and lncB230206L02Rik showed the same fold change tendencies but changes in Gm26532 were not statistically significant in the RNA-Seq results, following propofol sedation. The FoxO pathway-related proteins, PI3K and AKT, are up-regulated in propofol-exposed group. FoxO3a is down-regulated at both mRNA and protein levels. Our study reveals that propofol sedation can influence the expression of lncRNAs and mRNAs in the hippocampus, and bioinformatics analysis have identified key biological processes and pathways associated with propofol sedation. Cumulatively, our results provide a framework for further study on the role of lncRNAs in propofol-induced or -related neurotoxicity, particularly with regards to hippocampus-related dysfunction.

  16. Profiling of Long Non-coding RNAs and mRNAs by RNA-Sequencing in the Hippocampi of Adult Mice Following Propofol Sedation

    Directory of Open Access Journals (Sweden)

    Jun Fan

    2018-03-01

    Full Text Available Propofol is a frequently used intravenous anesthetic agent. The impairment caused by propofol on the neural system, especially the hippocampus, has been widely reported. However, the molecular mechanism underlying the effects of propofol on learning and memory functions in the hippocampus is still unclear. In the present study we performed lncRNA and mRNA analysis in the hippocampi of adult mice, after propofol sedation, through RNA-Sequencing (RNA-Seq. A total of 146 differentially expressed lncRNAs and 1103 mRNAs were identified. Bioinformatics analysis, including gene ontology (GO analysis, pathway analysis and network analysis, were done for the identified dysregulated genes. Pathway analysis indicated that the FoxO signaling pathway played an important role in the effects of propofol on the hippocampus. Finally, four lncRNAs and three proteins were selected from the FoxO-related network for further validation. The up-regulation of lncE230001N04Rik and the down-regulation of lncRP23-430H21.1 and lncB230206L02Rik showed the same fold change tendencies but changes in Gm26532 were not statistically significant in the RNA-Seq results, following propofol sedation. The FoxO pathway-related proteins, PI3K and AKT, are up-regulated in propofol-exposed group. FoxO3a is down-regulated at both mRNA and protein levels. Our study reveals that propofol sedation can influence the expression of lncRNAs and mRNAs in the hippocampus, and bioinformatics analysis have identified key biological processes and pathways associated with propofol sedation. Cumulatively, our results provide a framework for further study on the role of lncRNAs in propofol-induced or -related neurotoxicity, particularly with regards to hippocampus-related dysfunction.

  17. Comparative analysis of drug resistance mutations in the human immunodeficiency virus reverse transcriptase gene in patients who are non-responsive, responsive and naive to antiretroviral therapy.

    Science.gov (United States)

    Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad

    2016-05-01

    Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.

  18. MicroRNA Regulation of Telomerase Reverse Transcriptase (TERT: Micro Machines Pull Strings of Papier-Mâché Puppets

    Directory of Open Access Journals (Sweden)

    Ammad Ahmad Farooqi

    2018-04-01

    Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.

  19. Coding Partitions

    Directory of Open Access Journals (Sweden)

    Fabio Burderi

    2007-05-01

    Full Text Available Motivated by the study of decipherability conditions for codes weaker than Unique Decipherability (UD, we introduce the notion of coding partition. Such a notion generalizes that of UD code and, for codes that are not UD, allows to recover the ``unique decipherability" at the level of the classes of the partition. By tacking into account the natural order between the partitions, we define the characteristic partition of a code X as the finest coding partition of X. This leads to introduce the canonical decomposition of a code in at most one unambiguouscomponent and other (if any totally ambiguouscomponents. In the case the code is finite, we give an algorithm for computing its canonical partition. This, in particular, allows to decide whether a given partition of a finite code X is a coding partition. This last problem is then approached in the case the code is a rational set. We prove its decidability under the hypothesis that the partition contains a finite number of classes and each class is a rational set. Moreover we conjecture that the canonical partition satisfies such a hypothesis. Finally we consider also some relationships between coding partitions and varieties of codes.

  20. Detection of Multiple Budding Yeast Cells and a Partial Sequence of 43-kDa Glycoprotein Coding Gene of Paracoccidioides brasiliensis from a Case of Lacaziosis in a Female Pacific White-Sided Dolphin (Lagenorhynchus obliquidens).

    Science.gov (United States)

    Minakawa, Tomoko; Ueda, Keiichi; Tanaka, Miyuu; Tanaka, Natsuki; Kuwamura, Mitsuru; Izawa, Takeshi; Konno, Toshihiro; Yamate, Jyoji; Itano, Eiko Nakagawa; Sano, Ayako; Wada, Shinpei

    2016-08-01

    Lacaziosis, formerly called as lobomycosis, is a zoonotic mycosis, caused by Lacazia loboi, found in humans and dolphins, and is endemic in the countries on the Atlantic Ocean, Indian Ocean and Pacific Ocean of Japanese coast. Susceptible Cetacean species include the bottlenose dolphin (Tursiops truncatus), the Indian Ocean bottlenose dolphin (T. aduncus), and the estuarine dolphin (Sotalia guianensis); however, no cases have been recorded in other Cetacean species. We diagnosed a case of Lacaziosis in a Pacific white-sided dolphin (Lagenorhynchus obliquidens) nursing in an aquarium in Japan. The dolphin was a female estimated to be more than 14 years old at the end of June 2015 and was captured in a coast of Japan Sea in 2001. Multiple, lobose, and solid granulomatous lesions with or without ulcers appeared on her jaw, back, flipper and fluke skin, in July 2014. The granulomatous skin lesions from the present case were similar to those of our previous cases. Multiple budding and chains of round yeast cells were detected in the biopsied samples. The partial sequence of 43-kDa glycoprotein coding gene confirmed by a nested PCR and sequencing, which revealed a different genotype from both Amazonian and Japanese lacaziosis in bottlenose dolphins, and was 99 % identical to those derived from Paracoccidioides brasiliensis; a sister fungal species to L. loboi. This is the first case of lacaziosis in Pacific white-sided dolphin.

  1. The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.

    Science.gov (United States)

    Zhao, Chen; Pyle, Anna Marie

    2017-12-01

    The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Computational drug design strategies applied to the modelling of human immunodeficiency virus-1 reverse transcriptase inhibitors

    Directory of Open Access Journals (Sweden)

    Lucianna Helene Santos

    2015-11-01

    Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.

  3. Crystal structures of HIV-1 nonnucleoside reverse transcriptase inhibitors: N-benzyl-4-methyl-benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-07-01

    HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.

  4. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

    OpenAIRE

    Nicolas Sluis-Cremer

    2014-01-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...

  5. Natural Plant Alkaloid (Emetine Inhibits HIV-1 Replication by Interfering with Reverse Transcriptase Activity

    Directory of Open Access Journals (Sweden)

    Ana Luiza Chaves Valadão

    2015-06-01

    Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.

  6. Zidovudine (AZT monotherapy selects for the A360V mutation in the connection domain of HIV-1 reverse transcriptase.

    Directory of Open Access Journals (Sweden)

    Jessica H Brehm

    Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.

  7. Reverse Transcriptase drug resistance mutations in HIV-1 Subtype C infected patients on ART in Karonga District, Malawi

    LENUS (Irish Health Repository)

    Bansode, Vijay B

    2011-10-13

    Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge

  8. Enzyme engineering through evolution: thermostable recombinant group II intron reverse transcriptases provide new tools for RNA research and biotechnology.

    Science.gov (United States)

    Collins, Kathleen; Nilsen, Timothy W

    2013-08-01

    Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.

  9. Etravirine and Rilpivirine Drug Resistance Among HIV-1 Subtype C Infected Children Failing Non-Nucleoside Reverse Transcriptase Inhibitor-Based Regimens in South India.

    Science.gov (United States)

    Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami

    2017-06-01

    We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.

  10. Report number codes

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, R.N. (ed.)

    1985-05-01

    This publication lists all report number codes processed by the Office of Scientific and Technical Information. The report codes are substantially based on the American National Standards Institute, Standard Technical Report Number (STRN)-Format and Creation Z39.23-1983. The Standard Technical Report Number (STRN) provides one of the primary methods of identifying a specific technical report. The STRN consists of two parts: The report code and the sequential number. The report code identifies the issuing organization, a specific program, or a type of document. The sequential number, which is assigned in sequence by each report issuing entity, is not included in this publication. Part I of this compilation is alphabetized by report codes followed by issuing installations. Part II lists the issuing organization followed by the assigned report code(s). In both Parts I and II, the names of issuing organizations appear for the most part in the form used at the time the reports were issued. However, for some of the more prolific installations which have had name changes, all entries have been merged under the current name.

  11. Report number codes

    International Nuclear Information System (INIS)

    Nelson, R.N.

    1985-05-01

    This publication lists all report number codes processed by the Office of Scientific and Technical Information. The report codes are substantially based on the American National Standards Institute, Standard Technical Report Number (STRN)-Format and Creation Z39.23-1983. The Standard Technical Report Number (STRN) provides one of the primary methods of identifying a specific technical report. The STRN consists of two parts: The report code and the sequential number. The report code identifies the issuing organization, a specific program, or a type of document. The sequential number, which is assigned in sequence by each report issuing entity, is not included in this publication. Part I of this compilation is alphabetized by report codes followed by issuing installations. Part II lists the issuing organization followed by the assigned report code(s). In both Parts I and II, the names of issuing organizations appear for the most part in the form used at the time the reports were issued. However, for some of the more prolific installations which have had name changes, all entries have been merged under the current name

  12. Role of the K101E substitution in HIV-1 reverse transcriptase in resistance to rilpivirine and other nonnucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A

    2013-11-01

    Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.

  13. A quantitative reverse-transcriptase PCR assay for the assessment of drug activities against intracellular Theileria annulata schizonts

    Directory of Open Access Journals (Sweden)

    Isabel Hostettler

    2014-12-01

    Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.

  14. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  15. Speaking Code

    DEFF Research Database (Denmark)

    Cox, Geoff

    Speaking Code begins by invoking the “Hello World” convention used by programmers when learning a new language, helping to establish the interplay of text and code that runs through the book. Interweaving the voice of critical writing from the humanities with the tradition of computing and software...

  16. Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples.

    Science.gov (United States)

    Foord, A J; Heine, H G; Pritchard, L I; Lunt, R A; Newberry, K M; Rootes, C L; Boyle, D B

    2006-07-01

    To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis.

  17. Circular codes revisited: a statistical approach.

    Science.gov (United States)

    Gonzalez, D L; Giannerini, S; Rosa, R

    2011-04-21

    In 1996 Arquès and Michel [1996. A complementary circular code in the protein coding genes. J. Theor. Biol. 182, 45-58] discovered the existence of a common circular code in eukaryote and prokaryote genomes. Since then, circular code theory has provoked great interest and underwent a rapid development. In this paper we discuss some theoretical issues related to the synchronization properties of coding sequences and circular codes with particular emphasis on the problem of retrieval and maintenance of the reading frame. Motivated by the theoretical discussion, we adopt a rigorous statistical approach in order to try to answer different questions. First, we investigate the covering capability of the whole class of 216 self-complementary, C(3) maximal codes with respect to a large set of coding sequences. The results indicate that, on average, the code proposed by Arquès and Michel has the best covering capability but, still, there exists a great variability among sequences. Second, we focus on such code and explore the role played by the proportion of the bases by means of a hierarchy of permutation tests. The results show the existence of a sort of optimization mechanism such that coding sequences are tailored as to maximize or minimize the coverage of circular codes on specific reading frames. Such optimization clearly relates the function of circular codes with reading frame synchronization. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Biophysical Insights into the Inhibitory Mechanism of Non-Nucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer

    2013-11-01

    Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.

  19. Endogenous reverse transcriptase (RT) activity and Chromatin remodeling in normal and transformed cells and early embryos

    International Nuclear Information System (INIS)

    Spadafora, C.; Sciamanna, I.; Misteli, T.

    2009-01-01

    Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma

  20. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma

    OpenAIRE

    Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

    2018-01-01

    Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...

  1. Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

    International Nuclear Information System (INIS)

    Zhu Hanneng; Chen Wenying; Xiong Sidong

    2000-01-01

    Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

  2. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

    Science.gov (United States)

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

    2017-02-01

    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  3. The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA

    Directory of Open Access Journals (Sweden)

    Niu Meijuan

    2004-10-01

    Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.

  4. Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda

    Directory of Open Access Journals (Sweden)

    Mengjuan Zhu

    2016-03-01

    Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.

  5. Phylogeny and resistance profiles of HIV-1 POL sequences from rectal biopsies and blood

    DEFF Research Database (Denmark)

    Katzenstein, Terese Lea; Petersen, A B; Storgaard, M

    2010-01-01

    The phylogeny and resistance profiles of human immunodeficiency virus type 1 (HIV-1) protease (PR) and reverse transcriptase (RT) sequences were compared among six patients with HIV-1 who had received numerous treatments. RNA and DNA fractions were obtained from concurrent blood and rectal biopsy...

  6. Coding Labour

    Directory of Open Access Journals (Sweden)

    Anthony McCosker

    2014-03-01

    Full Text Available As well as introducing the Coding Labour section, the authors explore the diffusion of code across the material contexts of everyday life, through the objects and tools of mediation, the systems and practices of cultural production and organisational management, and in the material conditions of labour. Taking code beyond computation and software, their specific focus is on the increasingly familiar connections between code and labour with a focus on the codification and modulation of affect through technologies and practices of management within the contemporary work organisation. In the grey literature of spreadsheets, minutes, workload models, email and the like they identify a violence of forms through which workplace affect, in its constant flux of crisis and ‘prodromal’ modes, is regulated and governed.

  7. Antitumor effect of combination of the inhibitors of two new oncotargets: proton pumps and reverse transcriptase.

    Science.gov (United States)

    Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano

    2017-01-17

    Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.

  8. Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa

    Directory of Open Access Journals (Sweden)

    Aline Aki Tanikawa

    2013-08-01

    Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.

  9. Fragment Based Strategies for Discovery of Novel HIV-1 Reverse Transcriptase and Integrase Inhibitors.

    Science.gov (United States)

    Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda

    2016-01-01

    Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.

  10. Polyurethane intravaginal ring for controlled delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1.

    Science.gov (United States)

    Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F

    2008-10-01

    Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

  11. Structure-based methods to predict mutational resistance to diarylpyrimidine non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M

    2018-01-01

    Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.

  12. Self-complementary circular codes in coding theory.

    Science.gov (United States)

    Fimmel, Elena; Michel, Christian J; Starman, Martin; Strüngmann, Lutz

    2018-04-01

    Self-complementary circular codes are involved in pairing genetic processes. A maximal [Formula: see text] self-complementary circular code X of trinucleotides was identified in genes of bacteria, archaea, eukaryotes, plasmids and viruses (Michel in Life 7(20):1-16 2017, J Theor Biol 380:156-177, 2015; Arquès and Michel in J Theor Biol 182:45-58 1996). In this paper, self-complementary circular codes are investigated using the graph theory approach recently formulated in Fimmel et al. (Philos Trans R Soc A 374:20150058, 2016). A directed graph [Formula: see text] associated with any code X mirrors the properties of the code. In the present paper, we demonstrate a necessary condition for the self-complementarity of an arbitrary code X in terms of the graph theory. The same condition has been proven to be sufficient for codes which are circular and of large size [Formula: see text] trinucleotides, in particular for maximal circular codes ([Formula: see text] trinucleotides). For codes of small-size [Formula: see text] trinucleotides, some very rare counterexamples have been constructed. Furthermore, the length and the structure of the longest paths in the graphs associated with the self-complementary circular codes are investigated. It has been proven that the longest paths in such graphs determine the reading frame for the self-complementary circular codes. By applying this result, the reading frame in any arbitrary sequence of trinucleotides is retrieved after at most 15 nucleotides, i.e., 5 consecutive trinucleotides, from the circular code X identified in genes. Thus, an X motif of a length of at least 15 nucleotides in an arbitrary sequence of trinucleotides (not necessarily all of them belonging to X) uniquely defines the reading (correct) frame, an important criterion for analyzing the X motifs in genes in the future.

  13. Speech coding

    Energy Technology Data Exchange (ETDEWEB)

    Ravishankar, C., Hughes Network Systems, Germantown, MD

    1998-05-08

    Speech is the predominant means of communication between human beings and since the invention of the telephone by Alexander Graham Bell in 1876, speech services have remained to be the core service in almost all telecommunication systems. Original analog methods of telephony had the disadvantage of speech signal getting corrupted by noise, cross-talk and distortion Long haul transmissions which use repeaters to compensate for the loss in signal strength on transmission links also increase the associated noise and distortion. On the other hand digital transmission is relatively immune to noise, cross-talk and distortion primarily because of the capability to faithfully regenerate digital signal at each repeater purely based on a binary decision. Hence end-to-end performance of the digital link essentially becomes independent of the length and operating frequency bands of the link Hence from a transmission point of view digital transmission has been the preferred approach due to its higher immunity to noise. The need to carry digital speech became extremely important from a service provision point of view as well. Modem requirements have introduced the need for robust, flexible and secure services that can carry a multitude of signal types (such as voice, data and video) without a fundamental change in infrastructure. Such a requirement could not have been easily met without the advent of digital transmission systems, thereby requiring speech to be coded digitally. The term Speech Coding is often referred to techniques that represent or code speech signals either directly as a waveform or as a set of parameters by analyzing the speech signal. In either case, the codes are transmitted to the distant end where speech is reconstructed or synthesized using the received set of codes. A more generic term that is applicable to these techniques that is often interchangeably used with speech coding is the term voice coding. This term is more generic in the sense that the

  14. Optimal codes as Tanner codes with cyclic component codes

    DEFF Research Database (Denmark)

    Høholdt, Tom; Pinero, Fernando; Zeng, Peng

    2014-01-01

    In this article we study a class of graph codes with cyclic code component codes as affine variety codes. Within this class of Tanner codes we find some optimal binary codes. We use a particular subgraph of the point-line incidence plane of A(2,q) as the Tanner graph, and we are able to describe ...

  15. Aztheca Code

    International Nuclear Information System (INIS)

    Quezada G, S.; Espinosa P, G.; Centeno P, J.; Sanchez M, H.

    2017-09-01

    This paper presents the Aztheca code, which is formed by the mathematical models of neutron kinetics, power generation, heat transfer, core thermo-hydraulics, recirculation systems, dynamic pressure and level models and control system. The Aztheca code is validated with plant data, as well as with predictions from the manufacturer when the reactor operates in a stationary state. On the other hand, to demonstrate that the model is applicable during a transient, an event occurred in a nuclear power plant with a BWR reactor is selected. The plant data are compared with the results obtained with RELAP-5 and the Aztheca model. The results show that both RELAP-5 and the Aztheca code have the ability to adequately predict the behavior of the reactor. (Author)

  16. Vocable Code

    DEFF Research Database (Denmark)

    Soon, Winnie; Cox, Geoff

    2018-01-01

    a computational and poetic composition for two screens: on one of these, texts and voices are repeated and disrupted by mathematical chaos, together exploring the performativity of code and language; on the other, is a mix of a computer programming syntax and human language. In this sense queer code can...... be understood as both an object and subject of study that intervenes in the world’s ‘becoming' and how material bodies are produced via human and nonhuman practices. Through mixing the natural and computer language, this article presents a script in six parts from a performative lecture for two persons...

  17. NSURE code

    International Nuclear Information System (INIS)

    Rattan, D.S.

    1993-11-01

    NSURE stands for Near-Surface Repository code. NSURE is a performance assessment code. developed for the safety assessment of near-surface disposal facilities for low-level radioactive waste (LLRW). Part one of this report documents the NSURE model, governing equations and formulation of the mathematical models, and their implementation under the SYVAC3 executive. The NSURE model simulates the release of nuclides from an engineered vault, their subsequent transport via the groundwater and surface water pathways tot he biosphere, and predicts the resulting dose rate to a critical individual. Part two of this report consists of a User's manual, describing simulation procedures, input data preparation, output and example test cases

  18. Adaptive decoding of convolutional codes

    Directory of Open Access Journals (Sweden)

    K. Hueske

    2007-06-01

    Full Text Available Convolutional codes, which are frequently used as error correction codes in digital transmission systems, are generally decoded using the Viterbi Decoder. On the one hand the Viterbi Decoder is an optimum maximum likelihood decoder, i.e. the most probable transmitted code sequence is obtained. On the other hand the mathematical complexity of the algorithm only depends on the used code, not on the number of transmission errors. To reduce the complexity of the decoding process for good transmission conditions, an alternative syndrome based decoder is presented. The reduction of complexity is realized by two different approaches, the syndrome zero sequence deactivation and the path metric equalization. The two approaches enable an easy adaptation of the decoding complexity for different transmission conditions, which results in a trade-off between decoding complexity and error correction performance.

  19. Adaptive decoding of convolutional codes

    Science.gov (United States)

    Hueske, K.; Geldmacher, J.; Götze, J.

    2007-06-01

    Convolutional codes, which are frequently used as error correction codes in digital transmission systems, are generally decoded using the Viterbi Decoder. On the one hand the Viterbi Decoder is an optimum maximum likelihood decoder, i.e. the most probable transmitted code sequence is obtained. On the other hand the mathematical complexity of the algorithm only depends on the used code, not on the number of transmission errors. To reduce the complexity of the decoding process for good transmission conditions, an alternative syndrome based decoder is presented. The reduction of complexity is realized by two different approaches, the syndrome zero sequence deactivation and the path metric equalization. The two approaches enable an easy adaptation of the decoding complexity for different transmission conditions, which results in a trade-off between decoding complexity and error correction performance.

  20. The Aster code; Code Aster

    Energy Technology Data Exchange (ETDEWEB)

    Delbecq, J.M

    1999-07-01

    The Aster code is a 2D or 3D finite-element calculation code for structures developed by the R and D direction of Electricite de France (EdF). This dossier presents a complete overview of the characteristics and uses of the Aster code: introduction of version 4; the context of Aster (organisation of the code development, versions, systems and interfaces, development tools, quality assurance, independent validation); static mechanics (linear thermo-elasticity, Euler buckling, cables, Zarka-Casier method); non-linear mechanics (materials behaviour, big deformations, specific loads, unloading and loss of load proportionality indicators, global algorithm, contact and friction); rupture mechanics (G energy restitution level, restitution level in thermo-elasto-plasticity, 3D local energy restitution level, KI and KII stress intensity factors, calculation of limit loads for structures), specific treatments (fatigue, rupture, wear, error estimation); meshes and models (mesh generation, modeling, loads and boundary conditions, links between different modeling processes, resolution of linear systems, display of results etc..); vibration mechanics (modal and harmonic analysis, dynamics with shocks, direct transient dynamics, seismic analysis and aleatory dynamics, non-linear dynamics, dynamical sub-structuring); fluid-structure interactions (internal acoustics, mass, rigidity and damping); linear and non-linear thermal analysis; steels and metal industry (structure transformations); coupled problems (internal chaining, internal thermo-hydro-mechanical coupling, chaining with other codes); products and services. (J.S.)

  1. Coding Class

    DEFF Research Database (Denmark)

    Ejsing-Duun, Stine; Hansbøl, Mikala

    Denne rapport rummer evaluering og dokumentation af Coding Class projektet1. Coding Class projektet blev igangsat i skoleåret 2016/2017 af IT-Branchen i samarbejde med en række medlemsvirksomheder, Københavns kommune, Vejle Kommune, Styrelsen for IT- og Læring (STIL) og den frivillige forening...... Coding Pirates2. Rapporten er forfattet af Docent i digitale læringsressourcer og forskningskoordinator for forsknings- og udviklingsmiljøet Digitalisering i Skolen (DiS), Mikala Hansbøl, fra Institut for Skole og Læring ved Professionshøjskolen Metropol; og Lektor i læringsteknologi, interaktionsdesign......, design tænkning og design-pædagogik, Stine Ejsing-Duun fra Forskningslab: It og Læringsdesign (ILD-LAB) ved Institut for kommunikation og psykologi, Aalborg Universitet i København. Vi har fulgt og gennemført evaluering og dokumentation af Coding Class projektet i perioden november 2016 til maj 2017...

  2. Uplink Coding

    Science.gov (United States)

    Andrews, Ken; Divsalar, Dariush; Dolinar, Sam; Moision, Bruce; Hamkins, Jon; Pollara, Fabrizio

    2007-01-01

    This slide presentation reviews the objectives, meeting goals and overall NASA goals for the NASA Data Standards Working Group. The presentation includes information on the technical progress surrounding the objective, short LDPC codes, and the general results on the Pu-Pw tradeoff.

  3. ANIMAL code

    International Nuclear Information System (INIS)

    Lindemuth, I.R.

    1979-01-01

    This report describes ANIMAL, a two-dimensional Eulerian magnetohydrodynamic computer code. ANIMAL's physical model also appears. Formulated are temporal and spatial finite-difference equations in a manner that facilitates implementation of the algorithm. Outlined are the functions of the algorithm's FORTRAN subroutines and variables

  4. Network Coding

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Network Coding. K V Rashmi Nihar B Shah P Vijay Kumar. General Article Volume 15 Issue 7 July 2010 pp 604-621. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/015/07/0604-0621 ...

  5. MCNP code

    International Nuclear Information System (INIS)

    Cramer, S.N.

    1984-01-01

    The MCNP code is the major Monte Carlo coupled neutron-photon transport research tool at the Los Alamos National Laboratory, and it represents the most extensive Monte Carlo development program in the United States which is available in the public domain. The present code is the direct descendent of the original Monte Carlo work of Fermi, von Neumaum, and Ulam at Los Alamos in the 1940s. Development has continued uninterrupted since that time, and the current version of MCNP (or its predecessors) has always included state-of-the-art methods in the Monte Carlo simulation of radiation transport, basic cross section data, geometry capability, variance reduction, and estimation procedures. The authors of the present code have oriented its development toward general user application. The documentation, though extensive, is presented in a clear and simple manner with many examples, illustrations, and sample problems. In addition to providing the desired results, the output listings give a a wealth of detailed information (some optional) concerning each state of the calculation. The code system is continually updated to take advantage of advances in computer hardware and software, including interactive modes of operation, diagnostic interrupts and restarts, and a variety of graphical and video aids

  6. Expander Codes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 1. Expander Codes - The Sipser–Spielman Construction. Priti Shankar. General Article Volume 10 ... Author Affiliations. Priti Shankar1. Department of Computer Science and Automation, Indian Institute of Science Bangalore 560 012, India.

  7. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  8. The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Dolores Bautista-España

    Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

  9. Susceptibility of recombinant porcine endogenous retrovirus reverse transcriptase to nucleoside and non-nucleoside inhibitors.

    Science.gov (United States)

    Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X

    2002-12-01

    Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.

  10. Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A

    2011-01-01

    We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.

  11. Differential Regulation of Telomerase Reverse Transcriptase Promoter Activation and Protein Degradation by Histone Deacetylase Inhibition.

    Science.gov (United States)

    Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis

    2016-06-01

    Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.

  12. Sequence History Update Tool

    Science.gov (United States)

    Khanampompan, Teerapat; Gladden, Roy; Fisher, Forest; DelGuercio, Chris

    2008-01-01

    The Sequence History Update Tool performs Web-based sequence statistics archiving for Mars Reconnaissance Orbiter (MRO). Using a single UNIX command, the software takes advantage of sequencing conventions to automatically extract the needed statistics from multiple files. This information is then used to populate a PHP database, which is then seamlessly formatted into a dynamic Web page. This tool replaces a previous tedious and error-prone process of manually editing HTML code to construct a Web-based table. Because the tool manages all of the statistics gathering and file delivery to and from multiple data sources spread across multiple servers, there is also a considerable time and effort savings. With the use of The Sequence History Update Tool what previously took minutes is now done in less than 30 seconds, and now provides a more accurate archival record of the sequence commanding for MRO.

  13. Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.

    Science.gov (United States)

    Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E

    2013-06-18

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  14. Evaluation of nevirapine and/or hydroxyurea with nucleoside reverse transcriptase inhibitors in treatment-naive HIV-1-infected subjects

    NARCIS (Netherlands)

    Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.

    2004-01-01

    Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add

  15. Nonnucleoside Reverse-transcriptase Inhibitor- vs Ritonavir-boosted Protease Inhibitor-based Regimens for Initial Treatment of HIV Infection

    DEFF Research Database (Denmark)

    Borges, Álvaro H; Lundh, Andreas; Tendal, Britta

    2016-01-01

    BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...

  16. Coding chaotic billiards. Pt. 3

    International Nuclear Information System (INIS)

    Ullmo, D.; Giannoni, M.J.

    1993-01-01

    Non-tiling compact billiard defined on the pseudosphere is studied 'a la Morse coding'. As for most bounded systems, the coding is non exact. However, two sets of approximate grammar rules can be obtained, one specifying forbidden codes, and the other allowed ones. In-between some sequences remain in the 'unknown' zone, but their relative amount can be reduced to zero if one lets the length of the approximate grammar rules goes to infinity. The relationship between these approximate grammar rules and the 'pruning front' introduced by Cvitanovic et al. is discussed. (authors). 13 refs., 10 figs., 1 tab

  17. Linear network error correction coding

    CERN Document Server

    Guang, Xuan

    2014-01-01

    There are two main approaches in the theory of network error correction coding. In this SpringerBrief, the authors summarize some of the most important contributions following the classic approach, which represents messages by sequences?similar to algebraic coding,?and also briefly discuss the main results following the?other approach,?that uses the theory of rank metric codes for network error correction of representing messages by subspaces. This book starts by establishing the basic linear network error correction (LNEC) model and then characterizes two equivalent descriptions. Distances an

  18. Panda code

    International Nuclear Information System (INIS)

    Altomare, S.; Minton, G.

    1975-02-01

    PANDA is a new two-group one-dimensional (slab/cylinder) neutron diffusion code designed to replace and extend the FAB series. PANDA allows for the nonlinear effects of xenon, enthalpy and Doppler. Fuel depletion is allowed. PANDA has a completely general search facility which will seek criticality, maximize reactivity, or minimize peaking. Any single parameter may be varied in a search. PANDA is written in FORTRAN IV, and as such is nearly machine independent. However, PANDA has been written with the present limitations of the Westinghouse CDC-6600 system in mind. Most computation loops are very short, and the code is less than half the useful 6600 memory size so that two jobs can reside in the core at once. (auth)

  19. CANAL code

    International Nuclear Information System (INIS)

    Gara, P.; Martin, E.

    1983-01-01

    The CANAL code presented here optimizes a realistic iron free extraction channel which has to provide a given transversal magnetic field law in the median plane: the current bars may be curved, have finite lengths and cooling ducts and move in a restricted transversal area; terminal connectors may be added, images of the bars in pole pieces may be included. A special option optimizes a real set of circular coils [fr

  20. Implementation of LT codes based on chaos

    International Nuclear Information System (INIS)

    Zhou Qian; Li Liang; Chen Zengqiang; Zhao Jiaxiang

    2008-01-01

    Fountain codes provide an efficient way to transfer information over erasure channels like the Internet. LT codes are the first codes fully realizing the digital fountain concept. They are asymptotically optimal rateless erasure codes with highly efficient encoding and decoding algorithms. In theory, for each encoding symbol of LT codes, its degree is randomly chosen according to a predetermined degree distribution, and its neighbours used to generate that encoding symbol are chosen uniformly at random. Practical implementation of LT codes usually realizes the randomness through pseudo-randomness number generator like linear congruential method. This paper applies the pseudo-randomness of chaotic sequence in the implementation of LT codes. Two Kent chaotic maps are used to determine the degree and neighbour(s) of each encoding symbol. It is shown that the implemented LT codes based on chaos perform better than the LT codes implemented by the traditional pseudo-randomness number generator. (general)

  1. Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments.

    Science.gov (United States)

    Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen

    2011-02-01

    Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

  2. Detecting non-coding selective pressure in coding regions

    Directory of Open Access Journals (Sweden)

    Blanchette Mathieu

    2007-02-01

    Full Text Available Abstract Background Comparative genomics approaches, where orthologous DNA regions are compared and inter-species conserved regions are identified, have proven extremely powerful for identifying non-coding regulatory regions located in intergenic or intronic regions. However, non-coding functional elements can also be located within coding region, as is common for exonic splicing enhancers, some transcription factor binding sites, and RNA secondary structure elements affecting mRNA stability, localization, or translation. Since these functional elements are located in regions that are themselves highly conserved because they are coding for a protein, they generally escaped detection by comparative genomics approaches. Results We introduce a comparative genomics approach for detecting non-coding functional elements located within coding regions. Codon evolution is modeled as a mixture of codon substitution models, where each component of the mixture describes the evolution of codons under a specific type of coding selective pressure. We show how to compute the posterior distribution of the entropy and parsimony scores under this null model of codon evolution. The method is applied to a set of growth hormone 1 orthologous mRNA sequences and a known exonic splicing elements is detected. The analysis of a set of CORTBP2 orthologous genes reveals a region of several hundred base pairs under strong non-coding selective pressure whose function remains unknown. Conclusion Non-coding functional elements, in particular those involved in post-transcriptional regulation, are likely to be much more prevalent than is currently known. With the numerous genome sequencing projects underway, comparative genomics approaches like that proposed here are likely to become increasingly powerful at detecting such elements.

  3. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  4. From concatenated codes to graph codes

    DEFF Research Database (Denmark)

    Justesen, Jørn; Høholdt, Tom

    2004-01-01

    We consider codes based on simple bipartite expander graphs. These codes may be seen as the first step leading from product type concatenated codes to more complex graph codes. We emphasize constructions of specific codes of realistic lengths, and study the details of decoding by message passing...

  5. The Unstructured Paramyxovirus Nucleocapsid Protein Tail Domain Modulates Viral Pathogenesis through Regulation of Transcriptase Activity.

    Science.gov (United States)

    Thakkar, Vidhi D; Cox, Robert M; Sawatsky, Bevan; da Fontoura Budaszewski, Renata; Sourimant, Julien; Wabbel, Katrin; Makhsous, Negar; Greninger, Alexander L; von Messling, Veronika; Plemper, Richard K

    2018-04-15

    The paramyxovirus replication machinery comprises the viral large (L) protein and phosphoprotein (P-protein) in addition to the nucleocapsid (N) protein, which encapsidates the single-stranded RNA genome. Common to paramyxovirus N proteins is a C-terminal tail (Ntail). The mechanistic role and relevance for virus replication of the structurally disordered central Ntail section are unknown. Focusing initially on members of the Morbillivirus genus, a series of measles virus (MeV) and canine distemper virus (CDV) N proteins were generated with internal deletions in the unstructured tail section. N proteins with large tail truncations remained bioactive in mono- and polycistronic minireplicon assays and supported efficient replication of recombinant viruses. Bioactivity of Ntail mutants extended to N proteins derived from highly pathogenic Nipah virus. To probe an effect of Ntail truncations on viral pathogenesis, recombinant CDVs were analyzed in a lethal CDV/ferret model of morbillivirus disease. The recombinant viruses displayed different stages of attenuation ranging from ameliorated clinical symptoms to complete survival of infected animals, depending on the molecular nature of the Ntail truncation. Reinfection of surviving animals with pathogenic CDV revealed robust protection against a lethal challenge. The highly attenuated virus was genetically stable after ex vivo passaging and recovery from infected animals. Mechanistically, gradual viral attenuation coincided with stepwise altered viral transcriptase activity in infected cells. These results identify the central Ntail section as a determinant for viral pathogenesis and establish a novel platform to engineer gradual virus attenuation for next-generation paramyxovirus vaccine design. IMPORTANCE Investigating the role of the paramyxovirus N protein tail domain (Ntail) in virus replication, we demonstrated in this study that the structurally disordered central Ntail region is a determinant for viral

  6. Interface requirements to couple thermal hydraulics codes to severe accident codes: ICARE/CATHARE

    Energy Technology Data Exchange (ETDEWEB)

    Camous, F.; Jacq, F.; Chatelard, P. [IPSN/DRS/SEMAR CE-Cadarache, St Paul Lez Durance (France)] [and others

    1997-07-01

    In order to describe with the same code the whole sequence of severe LWR accidents, up to the vessel failure, the Institute of Protection and Nuclear Safety has performed a coupling of the severe accident code ICARE2 to the thermalhydraulics code CATHARE2. The resulting code, ICARE/CATHARE, is designed to be as pertinent as possible in all the phases of the accident. This paper is mainly devoted to the description of the ICARE2-CATHARE2 coupling.

  7. Profile of Mutations in the Reverse Transcriptase and Overlapping Surface Genes of Hepatitis B Virus (HBV) in Treatment-Naïve Indonesian HBV Carriers.

    Science.gov (United States)

    Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake

    2017-11-22

    Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.

  8. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang

    2010-06-01

    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  9. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

    Science.gov (United States)

    Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang

    2010-01-01

    A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408

  10. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

    Directory of Open Access Journals (Sweden)

    Yanrui Li

    2010-01-01

    Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.

  11. Noncoding sequence classification based on wavelet transform analysis: part I

    Science.gov (United States)

    Paredes, O.; Strojnik, M.; Romo-Vázquez, R.; Vélez Pérez, H.; Ranta, R.; Garcia-Torales, G.; Scholl, M. K.; Morales, J. A.

    2017-09-01

    DNA sequences in human genome can be divided into the coding and noncoding ones. Coding sequences are those that are read during the transcription. The identification of coding sequences has been widely reported in literature due to its much-studied periodicity. Noncoding sequences represent the majority of the human genome. They play an important role in gene regulation and differentiation among the cells. However, noncoding sequences do not exhibit periodicities that correlate to their functions. The ENCODE (Encyclopedia of DNA elements) and Epigenomic Roadmap Project projects have cataloged the human noncoding sequences into specific functions. We study characteristics of noncoding sequences with wavelet analysis of genomic signals.

  12. Karakteristik Reverse Transcriptase Gen Polymerase Virus Hepatitis B Pada Penderita Hepatitis B Kronis Asimptomatik Pra-Pengobatan

    Directory of Open Access Journals (Sweden)

    Turyadi Turyadi

    2018-01-01

    Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase.   Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis

  13. Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells

    Directory of Open Access Journals (Sweden)

    Yong Teng

    2014-02-01

    Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.

  14. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo

    2016-06-01

    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  15. Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report

    Directory of Open Access Journals (Sweden)

    Lapadula Giuseppe

    2007-05-01

    Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.

  16. Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.

    Science.gov (United States)

    Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V

    2011-12-20

    Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.

  17. TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats

    Science.gov (United States)

    Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin

    2011-01-01

    In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472

  18. Reverse transcriptase directs viral evolution in a deep ocean methane seep

    Science.gov (United States)

    Paul, B. G.; Bagby, S. C.

    2013-12-01

    Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

  19. Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer

    International Nuclear Information System (INIS)

    Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen

    2001-01-01

    Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts

  20. The emerging profile of cross-resistance among the nonnucleoside HIV-1 reverse transcriptase inhibitors.

    Science.gov (United States)

    Sluis-Cremer, Nicolas

    2014-07-31

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  1. 3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    S. Ganguly

    2008-01-01

    Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.

  2. Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

    International Nuclear Information System (INIS)

    Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado

    2011-01-01

    LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

  3. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer

    2014-07-01

    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  4. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.

    Science.gov (United States)

    Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

    2018-01-01

    Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .

  5. 4'-Ethynyl-2-fluoro-2'-deoxyadenosine, MK-8591: a novel HIV-1 reverse transcriptase translocation inhibitor.

    Science.gov (United States)

    Markowitz, Martin; Sarafianos, Stefan G

    2018-07-01

    4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.

  6. Structural investigation of HIV-1 nonnucleoside reverse transcriptase inhibitors: 2-Aryl-substituted benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-11-01

    Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.

  7. Telomerase Activation in Atherosclerosis and Induction of Telomerase Reverse Transcriptase Expression by Inflammatory Stimuli in Macrophages

    Science.gov (United States)

    Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis

    2010-01-01

    Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948

  8. Accident sequence quantification with KIRAP

    International Nuclear Information System (INIS)

    Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong.

    1997-01-01

    The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP's cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs

  9. Accident sequence quantification with KIRAP

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong

    1997-01-01

    The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP`s cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs.

  10. Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

    OpenAIRE

    Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

    2008-01-01

    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...

  11. Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P

    2011-12-08

    RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.

  12. Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

    Directory of Open Access Journals (Sweden)

    Ajay Kumar

    2010-01-01

    Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

  13. Reverse Transcriptase-Containing Particles Induced in Rous Sarcoma Virus-Transformed Rat Cells by Arginine Deprivation

    Science.gov (United States)

    Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel

    1972-01-01

    Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137

  14. Comparative genomics beyond sequence-based alignments

    DEFF Research Database (Denmark)

    Þórarinsson, Elfar; Yao, Zizhen; Wiklund, Eric D.

    2008-01-01

    Recent computational scans for non-coding RNAs (ncRNAs) in multiple organisms have relied on existing multiple sequence alignments. However, as sequence similarity drops, a key signal of RNA structure--frequent compensating base changes--is increasingly likely to cause sequence-based alignment me...

  15. Automatic coding method of the ACR Code

    International Nuclear Information System (INIS)

    Park, Kwi Ae; Ihm, Jong Sool; Ahn, Woo Hyun; Baik, Seung Kook; Choi, Han Yong; Kim, Bong Gi

    1993-01-01

    The authors developed a computer program for automatic coding of ACR(American College of Radiology) code. The automatic coding of the ACR code is essential for computerization of the data in the department of radiology. This program was written in foxbase language and has been used for automatic coding of diagnosis in the Department of Radiology, Wallace Memorial Baptist since May 1992. The ACR dictionary files consisted of 11 files, one for the organ code and the others for the pathology code. The organ code was obtained by typing organ name or code number itself among the upper and lower level codes of the selected one that were simultaneous displayed on the screen. According to the first number of the selected organ code, the corresponding pathology code file was chosen automatically. By the similar fashion of organ code selection, the proper pathologic dode was obtained. An example of obtained ACR code is '131.3661'. This procedure was reproducible regardless of the number of fields of data. Because this program was written in 'User's Defined Function' from, decoding of the stored ACR code was achieved by this same program and incorporation of this program into program in to another data processing was possible. This program had merits of simple operation, accurate and detail coding, and easy adjustment for another program. Therefore, this program can be used for automation of routine work in the department of radiology

  16. Genome sequence analysis of five Canadian isolates of strawberry mottle virus reveals extensive intra-species diversity and a longer RNA2 with increased coding capacity compared to a previously characterized European isolate.

    Science.gov (United States)

    Bhagwat, Basdeo; Dickison, Virginia; Ding, Xinlun; Walker, Melanie; Bernardy, Michael; Bouthillier, Michel; Creelman, Alexa; DeYoung, Robyn; Li, Yinzi; Nie, Xianzhou; Wang, Aiming; Xiang, Yu; Sanfaçon, Hélène

    2016-06-01

    In this study, we report the genome sequence of five isolates of strawberry mottle virus (family Secoviridae, order Picornavirales) from strawberry field samples with decline symptoms collected in Eastern Canada. The Canadian isolates differed from the previously characterized European isolate 1134 in that they had a longer RNA2, resulting in a 239-amino-acid extension of the C-terminal region of the polyprotein. Sequence analysis suggests that reassortment and recombination occurred among the isolates. Phylogenetic analysis revealed that the Canadian isolates are diverse, grouping in two separate branches along with isolates from Europe and the Americas.

  17. Error-correction coding

    Science.gov (United States)

    Hinds, Erold W. (Principal Investigator)

    1996-01-01

    This report describes the progress made towards the completion of a specific task on error-correcting coding. The proposed research consisted of investigating the use of modulation block codes as the inner code of a concatenated coding system in order to improve the overall space link communications performance. The study proposed to identify and analyze candidate codes that will complement the performance of the overall coding system which uses the interleaved RS (255,223) code as the outer code.

  18. Dynamic benchmarking of simulation codes

    International Nuclear Information System (INIS)

    Henry, R.E.; Paik, C.Y.; Hauser, G.M.

    1996-01-01

    Computer simulation of nuclear power plant response can be a full-scope control room simulator, an engineering simulator to represent the general behavior of the plant under normal and abnormal conditions, or the modeling of the plant response to conditions that would eventually lead to core damage. In any of these, the underlying foundation for their use in analysing situations, training of vendor/utility personnel, etc. is how well they represent what has been known from industrial experience, large integral experiments and separate effects tests. Typically, simulation codes are benchmarked with some of these; the level of agreement necessary being dependent upon the ultimate use of the simulation tool. However, these analytical models are computer codes, and as a result, the capabilities are continually enhanced, errors are corrected, new situations are imposed on the code that are outside of the original design basis, etc. Consequently, there is a continual need to assure that the benchmarks with important transients are preserved as the computer code evolves. Retention of this benchmarking capability is essential to develop trust in the computer code. Given the evolving world of computer codes, how is this retention of benchmarking capabilities accomplished? For the MAAP4 codes this capability is accomplished through a 'dynamic benchmarking' feature embedded in the source code. In particular, a set of dynamic benchmarks are included in the source code and these are exercised every time the archive codes are upgraded and distributed to the MAAP users. Three different types of dynamic benchmarks are used: plant transients; large integral experiments; and separate effects tests. Each of these is performed in a different manner. The first is accomplished by developing a parameter file for the plant modeled and an input deck to describe the sequence; i.e. the entire MAAP4 code is exercised. The pertinent plant data is included in the source code and the computer

  19. Dynamic Shannon Coding

    OpenAIRE

    Gagie, Travis

    2005-01-01

    We present a new algorithm for dynamic prefix-free coding, based on Shannon coding. We give a simple analysis and prove a better upper bound on the length of the encoding produced than the corresponding bound for dynamic Huffman coding. We show how our algorithm can be modified for efficient length-restricted coding, alphabetic coding and coding with unequal letter costs.

  20. Fundamentals of convolutional coding

    CERN Document Server

    Johannesson, Rolf

    2015-01-01

    Fundamentals of Convolutional Coding, Second Edition, regarded as a bible of convolutional coding brings you a clear and comprehensive discussion of the basic principles of this field * Two new chapters on low-density parity-check (LDPC) convolutional codes and iterative coding * Viterbi, BCJR, BEAST, list, and sequential decoding of convolutional codes * Distance properties of convolutional codes * Includes a downloadable solutions manual

  1. Codes Over Hyperfields

    Directory of Open Access Journals (Sweden)

    Atamewoue Surdive

    2017-12-01

    Full Text Available In this paper, we define linear codes and cyclic codes over a finite Krasner hyperfield and we characterize these codes by their generator matrices and parity check matrices. We also demonstrate that codes over finite Krasner hyperfields are more interesting for code theory than codes over classical finite fields.

  2. Leptin as a critical regulator of hepatocellular carcinoma development through modulation of human telomerase reverse transcriptase

    Directory of Open Access Journals (Sweden)

    Stefanou Nikolaos

    2010-08-01

    Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.

  3. The structure of FIV reverse transcriptase and its implications for non-nucleoside inhibitor resistance.

    Directory of Open Access Journals (Sweden)

    Meytal Galilee

    2018-01-01

    Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study

  4. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Directory of Open Access Journals (Sweden)

    Ilaria eSciamanna

    2016-02-01

    Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  5. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Science.gov (United States)

    Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado

    2016-02-01

    In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  6. Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.

    Science.gov (United States)

    Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D

    2006-11-15

    TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients

  7. The predictive and prognostic potential of plasma telomerase reverse transcriptase (TERT) RNA in rectal cancer patients

    Science.gov (United States)

    Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita

    2018-01-01

    Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673

  8. New prognostic factor telomerase reverse transcriptase promotor mutation presents without MR imaging biomarkers in primary glioblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)

    2017-12-15

    Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)

  9. HIV Salvage Therapy Does Not Require Nucleoside Reverse Transcriptase Inhibitors: A Randomized, Controlled Trial.

    Science.gov (United States)

    Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H

    2015-12-15

    Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).

  10. Sequence assembly

    DEFF Research Database (Denmark)

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  11. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  12. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  13. Expression of human telomerase reverse transcriptase protein in oral epithelial dysplasia and oral squamous cell carcinoma: An immunohistochemical study

    Science.gov (United States)

    Raghunandan, Bangalore Nagarajachar; Sanjai, Karpagaselvi; Kumaraswamy, Jayalakshmi; Papaiah, Lokesh; Pandey, Bhavna; Jyothi, Bellur MadhavaRao

    2016-01-01

    Background: Telomerase is an RNA-dependent DNA polymerase that synthesizes TTAGGG telomeric DNA sequences and almost universally provides the molecular basis for unlimited proliferative potential. The telomeres become shorter with each cycle of replication and reach a critical limit; most cells die or enter stage of replicative senescence. Telomere length maintenance by telomerase is required for all the cells that exhibit limitless replicative potential. It has been postulated that reactivation of telomerase expression is necessary for the continuous proliferation of neoplastic cells to attain immortality. Use of immunohistochemistry (IHC) is a useful, reliable method of localizing the human telomerase reverse transcriptase (hTERT) protein in tissue sections which permits cellular localization. Although there exists a lot of information on telomerase in oral cancer, little is known about their expression in oral epithelial dysplasia and their progression to oral squamous cell carcinoma (OSCC) compared to normal oral mucosa. This study addresses this lacuna. Aims: To compare the expression of hTERT protein in oral epithelial dysplasia and OSCC with normal oral mucosa by Immunohistochemical method. Subjects and Methods: In this preliminary study, IHC was used to detect the expression of hTERT protein in OSCC (n = 20), oral epithelial dysplasia (n = 21) and normal oral mucosa (n = 10). The tissue localization of immunostain, cellular localization of immunostain, nature of stain, intensity of stain, percentage of cells stained with hTERT protein were studied. A total number of 100 cells were counted in each slide. Statistical Analysis: All the data were analyzed using SPSS software version 16.0. The tissue localization, cellular localization of cytoplasmic/nuclear/both of hTERT stain, staining intensity was compared across the groups using Pearson's Chi-square test. The mean percentage of cells stained for oral epithelial dysplasia, OSCC and normal oral mucosa were

  14. An upper bound on the number of errors corrected by a convolutional code

    DEFF Research Database (Denmark)

    Justesen, Jørn

    2000-01-01

    The number of errors that a convolutional codes can correct in a segment of the encoded sequence is upper bounded by the number of distinct syndrome sequences of the relevant length.......The number of errors that a convolutional codes can correct in a segment of the encoded sequence is upper bounded by the number of distinct syndrome sequences of the relevant length....

  15. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu

    2011-12-12

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  16. Vector Network Coding Algorithms

    OpenAIRE

    Ebrahimi, Javad; Fragouli, Christina

    2010-01-01

    We develop new algebraic algorithms for scalar and vector network coding. In vector network coding, the source multicasts information by transmitting vectors of length L, while intermediate nodes process and combine their incoming packets by multiplying them with L x L coding matrices that play a similar role as coding c in scalar coding. Our algorithms for scalar network jointly optimize the employed field size while selecting the coding coefficients. Similarly, for vector coding, our algori...

  17. Syndrome-source-coding and its universal generalization. [error correcting codes for data compression

    Science.gov (United States)

    Ancheta, T. C., Jr.

    1976-01-01

    A method of using error-correcting codes to obtain data compression, called syndrome-source-coding, is described in which the source sequence is treated as an error pattern whose syndrome forms the compressed data. It is shown that syndrome-source-coding can achieve arbitrarily small distortion with the number of compressed digits per source digit arbitrarily close to the entropy of a binary memoryless source. A 'universal' generalization of syndrome-source-coding is formulated which provides robustly effective distortionless coding of source ensembles. Two examples are given, comparing the performance of noiseless universal syndrome-source-coding to (1) run-length coding and (2) Lynch-Davisson-Schalkwijk-Cover universal coding for an ensemble of binary memoryless sources.

  18. Homological stabilizer codes

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Jonas T., E-mail: jonastyleranderson@gmail.com

    2013-03-15

    In this paper we define homological stabilizer codes on qubits which encompass codes such as Kitaev's toric code and the topological color codes. These codes are defined solely by the graphs they reside on. This feature allows us to use properties of topological graph theory to determine the graphs which are suitable as homological stabilizer codes. We then show that all toric codes are equivalent to homological stabilizer codes on 4-valent graphs. We show that the topological color codes and toric codes correspond to two distinct classes of graphs. We define the notion of label set equivalencies and show that under a small set of constraints the only homological stabilizer codes without local logical operators are equivalent to Kitaev's toric code or to the topological color codes. - Highlights: Black-Right-Pointing-Pointer We show that Kitaev's toric codes are equivalent to homological stabilizer codes on 4-valent graphs. Black-Right-Pointing-Pointer We show that toric codes and color codes correspond to homological stabilizer codes on distinct graphs. Black-Right-Pointing-Pointer We find and classify all 2D homological stabilizer codes. Black-Right-Pointing-Pointer We find optimal codes among the homological stabilizer codes.

  19. Gray Code for Cayley Permutations

    Directory of Open Access Journals (Sweden)

    J.-L. Baril

    2003-10-01

    Full Text Available A length-n Cayley permutation p of a total ordered set S is a length-n sequence of elements from S, subject to the condition that if an element x appears in p then all elements y < x also appear in p . In this paper, we give a Gray code list for the set of length-n Cayley permutations. Two successive permutations in this list differ at most in two positions.

  20. Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M

    2017-12-01

    Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these

  1. [Diagnostic significance of serum free DNA human telomerase reverse transcriptase quantitative determination on spinal cord injury].

    Science.gov (United States)

    Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B

    2018-02-06

    Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.

  2. Characterization of active reverse transcriptase and nucleoprotein complexes of the yeast retrotransposon Ty3 in vitro.

    Science.gov (United States)

    Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L

    1999-12-17

    Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.

  3. Diagnostic Coding for Epilepsy.

    Science.gov (United States)

    Williams, Korwyn; Nuwer, Marc R; Buchhalter, Jeffrey R

    2016-02-01

    Accurate coding is an important function of neurologic practice. This contribution to Continuum is part of an ongoing series that presents helpful coding information along with examples related to the issue topic. Tips for diagnosis coding, Evaluation and Management coding, procedure coding, or a combination are presented, depending on which is most applicable to the subject area of the issue.

  4. Coding of Neuroinfectious Diseases.

    Science.gov (United States)

    Barkley, Gregory L

    2015-12-01

    Accurate coding is an important function of neurologic practice. This contribution to Continuum is part of an ongoing series that presents helpful coding information along with examples related to the issue topic. Tips for diagnosis coding, Evaluation and Management coding, procedure coding, or a combination are presented, depending on which is most applicable to the subject area of the issue.

  5. Sequence Classification: 399898 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB Non-TMH Non-TMB TMB TMB TMB >gi|15610593|ref|NP_217974.1| PROBABLE DNA-DIRECTED RNA POLYMER...ASE (ALPHA CHAIN) RPOA (TRANSCRIPTASE ALPHA CHAIN) (RNA POLYMERASE ALPHA SUBUNIT) (DNA-DIREC

  6. Sequence Classification: 387341 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB Non-TMH Non-TMB Non-TMB Non-TMB Non-TMB >gi|31791852|ref|NP_854345.1| DNA-DIRECTED RNA POLYMER...ASE (BETA' CHAIN) RPOC (TRANSCRIPTASE BETA' CHAIN) (RNA POLYMERASE BETA' SUBUNIT). || http://www.ncbi.nlm.nih.gov/protein/31791852 ...

  7. Sequence Classification: 388073 [

    Lifescience Database Archive (English)

    Full Text Available TMB Non-TMH TMB TMB TMB Non-TMB >gi|31792584|ref|NP_855077.1| PROBABLE DNA-DIRECTED RNA POLYMER...ASE (OMEGA CHAIN) RPOZ (TRANSCRIPTASE OMEGA CHAIN) (RNA POLYMERASE OMEGA SUBUNIT) || http://www.ncbi.nlm.nih.gov/protein/31792584 ...

  8. Sequence Classification: 397793 [

    Lifescience Database Archive (English)

    Full Text Available TMB Non-TMH TMB TMB TMB Non-TMB >gi|15608529|ref|NP_215906.1| PROBABLE DNA-DIRECTED RNA POLYMER...ASE (OMEGA CHAIN) RPOZ (TRANSCRIPTASE OMEGA CHAIN) (RNA POLYMERASE OMEGA SUBUNIT) || http://www.ncbi.nlm.nih.gov/protein/15608529 ...

  9. Sequence Classification: 407536 [

    Lifescience Database Archive (English)

    Full Text Available TMB Non-TMH Non-TMB TMB Non-TMB TMB >gi|15829032|ref|NP_326392.1| DNA-DIRECTED RNA POLYMER...ASE ALPHA CHAIN (TRANSCRIPTASE ALPHA CHAIN) (RNA POLYMERASE ALPHA SUBUNIT)rpo || http://www.ncbi.nlm.nih.gov/protein/15829032 ...

  10. Sequence Classification: 407520 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB Non-TMH Non-TMB Non-TMB Non-TMB TMB >gi|15829016|ref|NP_326376.1| DNA-DIRECTED RNA POLYMER...ASE BETA' CHAIN (TRANSCRIPTASE BETA' CHAIN) (RNA POLYMERASE BETA' SUBUNIT) || http://www.ncbi.nlm.nih.gov/protein/15829016 ...

  11. Sequence Classification: 407521 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB Non-TMH Non-TMB Non-TMB Non-TMB TMB >gi|15829017|ref|NP_326377.1| DNA-DIRECTED RNA POLYMER...ASE BETA CHAIN (TRANSCRIPTASE BETA CHAIN) (RNA POLYMERASE BETA SUBUNIT) || http://www.ncbi.nlm.nih.gov/protein/15829017 ...

  12. Sequence Classification: 390122 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB Non-TMH Non-TMB TMB TMB TMB >gi|31794633|ref|NP_857126.1| PROBABLE DNA-DIRECTED RNA POLYMER...ASE (ALPHA CHAIN) RPOA (TRANSCRIPTASE ALPHA CHAIN) (RNA POLYMERASE ALPHA SUBUNIT) (DNA-DIREC

  13. In Vitro Evaluation of Nonnucleoside Reverse Transcriptase Inhibitors UC-781 and TMC120-R147681 as Human Immunodeficiency Virus Microbicides†

    Science.gov (United States)

    Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul

    2004-01-01

    The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562

  14. Development of a pan-Simbu real-time reverse transcriptase PCR for the detection of Simbu serogroup viruses and comparison with SBV diagnostic PCR systems.

    Science.gov (United States)

    Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd

    2013-11-05

    Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable

  15. Design and performance of the CDC real-time reverse transcriptase PCR swine flu panel for detection of 2009 A (H1N1) pandemic influenza virus.

    Science.gov (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

    2011-07-01

    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.

  16. Pre-existing mutations in reverse transcriptase of hepatitis B virus in treatment-naive Chinese patients with chronic hepatitis B.

    Directory of Open Access Journals (Sweden)

    Jie Xu

    Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.

  17. Molecular cloning of Kuruma shrimp Marsupenaeus japonicus endonuclease-reverse transcriptase and its positive role in white spot syndrome virus and Vibrio alginolyticus infection.

    Science.gov (United States)

    Ma, Xiongchao; Sun, Baozhen; Zhu, Fei

    2018-02-01

    This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Vector Network Coding

    OpenAIRE

    Ebrahimi, Javad; Fragouli, Christina

    2010-01-01

    We develop new algebraic algorithms for scalar and vector network coding. In vector network coding, the source multicasts information by transmitting vectors of length L, while intermediate nodes process and combine their incoming packets by multiplying them with L X L coding matrices that play a similar role as coding coefficients in scalar coding. Our algorithms for scalar network jointly optimize the employed field size while selecting the coding coefficients. Similarly, for vector co...

  19. Entropy Coding in HEVC

    OpenAIRE

    Sze, Vivienne; Marpe, Detlev

    2014-01-01

    Context-Based Adaptive Binary Arithmetic Coding (CABAC) is a method of entropy coding first introduced in H.264/AVC and now used in the latest High Efficiency Video Coding (HEVC) standard. While it provides high coding efficiency, the data dependencies in H.264/AVC CABAC make it challenging to parallelize and thus limit its throughput. Accordingly, during the standardization of entropy coding for HEVC, both aspects of coding efficiency and throughput were considered. This chapter describes th...

  20. Generalized concatenated quantum codes

    International Nuclear Information System (INIS)

    Grassl, Markus; Shor, Peter; Smith, Graeme; Smolin, John; Zeng Bei

    2009-01-01

    We discuss the concept of generalized concatenated quantum codes. This generalized concatenation method provides a systematical way for constructing good quantum codes, both stabilizer codes and nonadditive codes. Using this method, we construct families of single-error-correcting nonadditive quantum codes, in both binary and nonbinary cases, which not only outperform any stabilizer codes for finite block length but also asymptotically meet the quantum Hamming bound for large block length.

  1. Rateless feedback codes

    DEFF Research Database (Denmark)

    Sørensen, Jesper Hemming; Koike-Akino, Toshiaki; Orlik, Philip

    2012-01-01

    This paper proposes a concept called rateless feedback coding. We redesign the existing LT and Raptor codes, by introducing new degree distributions for the case when a few feedback opportunities are available. We show that incorporating feedback to LT codes can significantly decrease both...... the coding overhead and the encoding/decoding complexity. Moreover, we show that, at the price of a slight increase in the coding overhead, linear complexity is achieved with Raptor feedback coding....

  2. Advanced video coding systems

    CERN Document Server

    Gao, Wen

    2015-01-01

    This comprehensive and accessible text/reference presents an overview of the state of the art in video coding technology. Specifically, the book introduces the tools of the AVS2 standard, describing how AVS2 can help to achieve a significant improvement in coding efficiency for future video networks and applications by incorporating smarter coding tools such as scene video coding. Topics and features: introduces the basic concepts in video coding, and presents a short history of video coding technology and standards; reviews the coding framework, main coding tools, and syntax structure of AV

  3. Coding for dummies

    CERN Document Server

    Abraham, Nikhil

    2015-01-01

    Hands-on exercises help you learn to code like a pro No coding experience is required for Coding For Dummies,your one-stop guide to building a foundation of knowledge inwriting computer code for web, application, and softwaredevelopment. It doesn't matter if you've dabbled in coding or neverwritten a line of code, this book guides you through the basics.Using foundational web development languages like HTML, CSS, andJavaScript, it explains in plain English how coding works and whyit's needed. Online exercises developed by Codecademy, a leading online codetraining site, help hone coding skill

  4. New tools to analyze overlapping coding regions.

    Science.gov (United States)

    Bayegan, Amir H; Garcia-Martin, Juan Antonio; Clote, Peter

    2016-12-13

    Retroviruses transcribe messenger RNA for the overlapping Gag and Gag-Pol polyproteins, by using a programmed -1 ribosomal frameshift which requires a slippery sequence and an immediate downstream stem-loop secondary structure, together called frameshift stimulating signal (FSS). It follows that the molecular evolution of this genomic region of HIV-1 is highly constrained, since the retroviral genome must contain a slippery sequence (sequence constraint), code appropriate peptides in reading frames 0 and 1 (coding requirements), and form a thermodynamically stable stem-loop secondary structure (structure requirement). We describe a unique computational tool, RNAsampleCDS, designed to compute the number of RNA sequences that code two (or more) peptides p,q in overlapping reading frames, that are identical (or have BLOSUM/PAM similarity that exceeds a user-specified value) to the input peptides p,q. RNAsampleCDS then samples a user-specified number of messenger RNAs that code such peptides; alternatively, RNAsampleCDS can exactly compute the position-specific scoring matrix and codon usage bias for all such RNA sequences. Our software allows the user to stipulate overlapping coding requirements for all 6 possible reading frames simultaneously, even allowing IUPAC constraints on RNA sequences and fixing GC-content. We generalize the notion of codon preference index (CPI) to overlapping reading frames, and use RNAsampleCDS to generate control sequences required in the computation of CPI. Moreover, by applying RNAsampleCDS, we are able to quantify the extent to which the overlapping coding requirement in HIV-1 [resp. HCV] contribute to the formation of the stem-loop [resp. double stem-loop] secondary structure known as the frameshift stimulating signal. Using our software, we confirm that certain experimentally determined deleterious HCV mutations occur in positions for which our software RNAsampleCDS and RNAiFold both indicate a single possible nucleotide. We

  5. APOBEC3DE Inhibits LINE-1 Retrotransposition by Interacting with ORF1p and Influencing LINE Reverse Transcriptase Activity.

    Directory of Open Access Journals (Sweden)

    Weizi Liang

    Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.

  6. DNA Barcoding through Quaternary LDPC Codes.

    Science.gov (United States)

    Tapia, Elizabeth; Spetale, Flavio; Krsticevic, Flavia; Angelone, Laura; Bulacio, Pilar

    2015-01-01

    For many parallel applications of Next-Generation Sequencing (NGS) technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH) or have intrinsic poor error correcting abilities (Hamming). Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC) codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10(-2) per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10(-9) at the expense of a rate of read losses just in the order of 10(-6).

  7. DNA Barcoding through Quaternary LDPC Codes.

    Directory of Open Access Journals (Sweden)

    Elizabeth Tapia

    Full Text Available For many parallel applications of Next-Generation Sequencing (NGS technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH or have intrinsic poor error correcting abilities (Hamming. Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10(-2 per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10(-9 at the expense of a rate of read losses just in the order of 10(-6.

  8. Full-length sequencing and identification of novel polymorphisms in ...

    Indian Academy of Sciences (India)

    The aim of this work was to sequence the entirecoding region of ACACA gene in Valle del Belice sheep breed to identify polymorphic sites. A total of 51 coding exons of ACACA gene were sequenced in 32 individuals of Valle del Belice sheep breed. Sequencing analysis and alignment of obtained sequences showed the ...

  9. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  10. An automated annotation tool for genomic DNA sequences using

    Indian Academy of Sciences (India)

    Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated ...

  11. Sequence and RT-PCR expression analysis of two peroxidases from Arabidopsis thaliana belonging to a novel evolutionary branch of plant peroxidases.

    Science.gov (United States)

    Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G

    1997-03-01

    cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP 1a and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid sequence to the well characterized group of basic plant peroxidases represented by the horseradish (Armoracia rusticana) isoperoxidases HRP C, HRP E5 and the similar Arabidopsis isoperoxidases ATP Ca, ATP Cb, and ATP Ea. However ATP 1a is 87% identical in amino acid sequence to a peroxidase encoded by an mRNA isolated from cotton (Gossypium hirsutum). As cotton and Arabidopsis belong to rather diverse families (Malvaceae and Crucifereae, respectively), in contrast with Arabidopsis and horseradish (both Crucifereae), the high degree of sequence identity indicates that this novel type of peroxidase, albeit of unknown function, is likely to be widespread in plant species. The atp 1 and atp 2 types of cDNA sequences were the most redundant among the 28 different isoperoxidases identified among about 200 peroxidase encoding ESTs. Interestingly, 8 out of totally 38 EST sequences coding for ATP 1 showed three identical nucleotide substitutions. This variant form is designated ATP 1b. Similarly, six out of totally 16 EST sequences coding for ATP 2 showed a number of deletions and nucleotide changes. This variant form is designated ATP 2b. The selected EST clones are full-length and contain coding regions of 993 nucleotides for atp 1a, and 984 nucleotides for atp 2a. These regions show 61% DNA sequence identity. The predicted mature proteins ATP 1a, and ATP 2a are 57% identical in sequence and contain the structurally and functionally important residues, characteristic of the plant peroxidase superfamily. However, they do show two differences of importance to peroxidase catalysis: (1) the asparagine residue linked with the active site distal histidine via hydrogen bonding is absent

  12. Discussion on LDPC Codes and Uplink Coding

    Science.gov (United States)

    Andrews, Ken; Divsalar, Dariush; Dolinar, Sam; Moision, Bruce; Hamkins, Jon; Pollara, Fabrizio

    2007-01-01

    This slide presentation reviews the progress that the workgroup on Low-Density Parity-Check (LDPC) for space link coding. The workgroup is tasked with developing and recommending new error correcting codes for near-Earth, Lunar, and deep space applications. Included in the presentation is a summary of the technical progress of the workgroup. Charts that show the LDPC decoder sensitivity to symbol scaling errors are reviewed, as well as a chart showing the performance of several frame synchronizer algorithms compared to that of some good codes and LDPC decoder tests at ESTL. Also reviewed is a study on Coding, Modulation, and Link Protocol (CMLP), and the recommended codes. A design for the Pseudo-Randomizer with LDPC Decoder and CRC is also reviewed. A chart that summarizes the three proposed coding systems is also presented.

  13. Molecular phylogenetics of the family Cyprinidae (Actinopterygii: Cypriniformes) as evidenced by sequence variation in the first intron of S7 ribosomal protein-coding gene: further evidence from a nuclear gene of the systematic chaos in the family.

    Science.gov (United States)

    He, Shunping; Mayden, Richard L; Wang, Xuzheng; Wang, Wei; Tang, Kevin L; Chen, Wei-Jen; Chen, Yiyu

    2008-03-01

    The family Cyprinidae is the largest freshwater fish group in the world, including over 200 genera and 2100 species. The phylogenetic relationships of major clades within this family are simply poorly understood, largely because of the overwhelming diversity of the group; however, several investigators have advanced different hypotheses of relationships that pre- and post-date the use of shared-derived characters as advocated through phylogenetic systematics. As expected, most previous investigations used morphological characters. Recently, mitochondrial DNA (mtDNA) sequences and combined morphological and mtDNA investigations have been used to explore and advance our understanding of species relationships and test monophyletic groupings. Limitations of these studies include limited taxon sampling and a strict reliance upon maternally inherited mtDNA variation. The present study is the first endeavor to recover the phylogenetic relationships of the 12 previously recognized monophyletic subfamilies within the Cyprinidae using newly sequenced nuclear DNA (nDNA) for over 50 species representing members of the different previously hypothesized subfamily and family groupings within the Cyprinidae and from other cypriniform families as outgroup taxa. Hypothesized phylogenetic relationships are constructed using maximum parsimony and Basyesian analyses of 1042 sites, of which 971 sites were variable and 790 were phylogenetically informative. Using other appropriate cypriniform taxa of the families Catostomidae (Myxocyprinus asiaticus), Gyrinocheilidae (Gyrinocheilus aymonieri), and Balitoridae (Nemacheilus sp. and Beaufortia kweichowensis) as outgroups, the Cyprinidae is resolved as a monophyletic group. Within the family the genera Raiamas, Barilius, Danio, and Rasbora, representing many of the tropical cyprinids, represent basal members of the family. All other species can be classified into variably supported and resolved monophyletic lineages, depending upon analysis

  14. Deciphering the genetic regulatory code using an inverse error control coding framework.

    Energy Technology Data Exchange (ETDEWEB)

    Rintoul, Mark Daniel; May, Elebeoba Eni; Brown, William Michael; Johnston, Anna Marie; Watson, Jean-Paul

    2005-03-01

    We have found that developing a computational framework for reconstructing error control codes for engineered data and ultimately for deciphering genetic regulatory coding sequences is a challenging and uncharted area that will require advances in computational technology for exact solutions. Although exact solutions are desired, computational approaches that yield plausible solutions would be considered sufficient as a proof of concept to the feasibility of reverse engineering error control codes and the possibility of developing a quantitative model for understanding and engineering genetic regulation. Such evidence would help move the idea of reconstructing error control codes for engineered and biological systems from the high risk high payoff realm into the highly probable high payoff domain. Additionally this work will impact biological sensor development and the ability to model and ultimately develop defense mechanisms against bioagents that can be engineered to cause catastrophic damage. Understanding how biological organisms are able to communicate their genetic message efficiently in the presence of noise can improve our current communication protocols, a continuing research interest. Towards this end, project goals include: (1) Develop parameter estimation methods for n for block codes and for n, k, and m for convolutional codes. Use methods to determine error control (EC) code parameters for gene regulatory sequence. (2) Develop an evolutionary computing computational framework for near-optimal solutions to the algebraic code reconstruction problem. Method will be tested on engineered and biological sequences.

  15. Locally orderless registration code

    DEFF Research Database (Denmark)

    2012-01-01

    This is code for the TPAMI paper "Locally Orderless Registration". The code requires intel threadding building blocks installed and is provided for 64 bit on mac, linux and windows.......This is code for the TPAMI paper "Locally Orderless Registration". The code requires intel threadding building blocks installed and is provided for 64 bit on mac, linux and windows....

  16. Decoding Codes on Graphs

    Indian Academy of Sciences (India)

    Shannon limit of the channel. Among the earliest discovered codes that approach the. Shannon limit were the low density parity check (LDPC) codes. The term low density arises from the property of the parity check matrix defining the code. We will now define this matrix and the role that it plays in decoding. 2. Linear Codes.

  17. Manually operated coded switch

    International Nuclear Information System (INIS)

    Barnette, J.H.

    1978-01-01

    The disclosure related to a manually operated recodable coded switch in which a code may be inserted, tried and used to actuate a lever controlling an external device. After attempting a code, the switch's code wheels must be returned to their zero positions before another try is made

  18. Coding in Muscle Disease.

    Science.gov (United States)

    Jones, Lyell K; Ney, John P

    2016-12-01

    Accurate coding is critically important for clinical practice and research. Ongoing changes to diagnostic and billing codes require the clinician to stay abreast of coding updates. Payment for health care services, data sets for health services research, and reporting for medical quality improvement all require accurate administrative coding. This article provides an overview of administrative coding for patients with muscle disease and includes a case-based review of diagnostic and Evaluation and Management (E/M) coding principles in patients with myopathy. Procedural coding for electrodiagnostic studies and neuromuscular ultrasound is also reviewed.

  19. Flexible manipulation of terahertz wave reflection using polarization insensitive coding metasurfaces.

    Science.gov (United States)

    Jiu-Sheng, Li; Ze-Jiang, Zhao; Jian-Quan, Yao

    2017-11-27

    In order to extend to 3-bit encoding, we propose notched-wheel structures as polarization insensitive coding metasurfaces to control terahertz wave reflection and suppress backward scattering. By using a coding sequence of "00110011…" along x-axis direction and 16 × 16 random coding sequence, we investigate the polarization insensitive properties of the coding metasurfaces. By designing the coding sequences of the basic coding elements, the terahertz wave reflection can be flexibly manipulated. Additionally, radar cross section (RCS) reduction in the backward direction is less than -10dB in a wide band. The present approach can offer application for novel terahertz manipulation devices.

  20. QR Codes 101

    Science.gov (United States)

    Crompton, Helen; LaFrance, Jason; van 't Hooft, Mark

    2012-01-01

    A QR (quick-response) code is a two-dimensional scannable code, similar in function to a traditional bar code that one might find on a product at the supermarket. The main difference between the two is that, while a traditional bar code can hold a maximum of only 20 digits, a QR code can hold up to 7,089 characters, so it can contain much more…

  1. A bar coding system for environmental projects

    International Nuclear Information System (INIS)

    Barber, R.B.; Hunt, B.J.; Burgess, G.M.

    1988-01-01

    This paper presents BeCode systems, a bar coding system which provides both nuclear and commercial clients with a data capture and custody management program that is accurate, timely, and beneficial to all levels of project operations. Using bar code identifiers is an essentially paperless and error-free method which provides more efficient delivery of data through its menu card-driven structure, which speeds collection of essential data for uploading to a compatible device. The effects of this sequence include real-time information for operator analysis, management review, audits, planning, scheduling, and cost control

  2. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    International Nuclear Information System (INIS)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

    2015-01-01

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

  3. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)

    2015-10-23

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

  4. Utility of QR codes in biological collections.

    Science.gov (United States)

    Diazgranados, Mauricio; Funk, Vicki A

    2013-01-01

    The popularity of QR codes for encoding information such as URIs has increased exponentially in step with the technological advances and availability of smartphones, digital tablets, and other electronic devices. We propose using QR codes on specimens in biological collections to facilitate linking vouchers' electronic information with their associated collections. QR codes can efficiently provide such links for connecting collections, photographs, maps, ecosystem notes, citations, and even GenBank sequences. QR codes have numerous advantages over barcodes, including their small size, superior security mechanisms, increased complexity and quantity of information, and low implementation cost. The scope of this paper is to initiate an academic discussion about using QR codes on specimens in biological collections.

  5. Utility of QR codes in biological collections

    Directory of Open Access Journals (Sweden)

    Mauricio Diazgranados

    2013-07-01

    Full Text Available The popularity of QR codes for encoding information such as URIs has increased exponentially in step with the technological advances and availability of smartphones, digital tablets, and other electronic devices. We propose using QR codes on specimens in biological collections to facilitate linking vouchers’ electronic information with their associated collections. QR codes can efficiently provide such links for connecting collections, photographs, maps, ecosystem notes, citations, and even GenBank sequences. QR codes have numerous advantages over barcodes, including their small size, superior security mechanisms, increased complexity and quantity of information, and low implementation cost. The scope of this paper is to initiate an academic discussion about using QR codes on specimens in biological collections.

  6. On Coding Non-Contiguous Letter Combinations

    Directory of Open Access Journals (Sweden)

    Frédéric eDandurand

    2011-06-01

    Full Text Available Starting from the hypothesis that printed word identification initially involves the parallel mapping of visual features onto location-specific letter identities, we analyze the type of information that would be involved in optimally mapping this location-specific orthographic code onto a location-invariant lexical code. We assume that some intermediate level of coding exists between individual letters and whole words, and that this involves the representation of letter combinations. We then investigate the nature of this intermediate level of coding given the constraints of optimality. This intermediate level of coding is expected to compress data while retaining as much information as possible about word identity. Information conveyed by letters is a function of how much they constrain word identity and how visible they are. Optimization of this coding is a combination of minimizing resources (using the most compact representations and maximizing information. We show that in a large proportion of cases, non-contiguous letter sequences contain more information than contiguous sequences, while at the same time requiring less precise coding. Moreover, we found that the best predictor of human performance in orthographic priming experiments was within-word ranking of conditional probabilities, rather than average conditional probabilities. We conclude that from an optimality perspective, readers learn to select certain contiguous and non-contiguous letter combinations as information that provides the best cue to word identity.

  7. Design of Long Period Pseudo-Random Sequences from the Addition of -Sequences over

    Directory of Open Access Journals (Sweden)

    Ren Jian

    2004-01-01

    Full Text Available Pseudo-random sequence with good correlation property and large linear span is widely used in code division multiple access (CDMA communication systems and cryptology for reliable and secure information transmission. In this paper, sequences with long period, large complexity, balance statistics, and low cross-correlation property are constructed from the addition of -sequences with pairwise-prime linear spans (AMPLS. Using -sequences as building blocks, the proposed method proved to be an efficient and flexible approach to construct long period pseudo-random sequences with desirable properties from short period sequences. Applying the proposed method to , a signal set is constructed.

  8. Multiple tag labeling method for DNA sequencing

    Science.gov (United States)

    Mathies, R.A.; Huang, X.C.; Quesada, M.A.

    1995-07-25

    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  9. Computer simulation of replacement sequences in copper

    International Nuclear Information System (INIS)

    Schiffgens, J.O.; Schwartz, D.W.; Ariyasu, R.G.; Cascadden, S.E.

    1978-01-01

    Results of computer simulations of , , and replacement sequences in copper are presented, including displacement thresholds, focusing energies, energy losses per replacement, and replacement sequence lengths. These parameters are tabulated for six interatomic potentials and shown to vary in a systematic way with potential stiffness and range. Comparisons of results from calculations made with ADDES, a quasi-dynamical code, and COMENT, a dynamical code, show excellent agreement, demonstrating that the former can be calibrated and used satisfactorily in the analysis of low energy displacement cascades. Upper limits on , , and replacement sequences were found to be approximately 10, approximately 30, and approximately 14 replacements, respectively. (author)

  10. Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)

    2010-03-26

    The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.

  11. Impact of Different Spreading Codes Using FEC on DWT Based MC-CDMA System

    OpenAIRE

    Masum, Saleh; Kabir, M. Hasnat; Islam, Md. Matiqul; Shams, Rifat Ara; Ullah, Shaikh Enayet

    2012-01-01

    The effect of different spreading codes in DWT based MC-CDMA wireless communication system is investigated. In this paper, we present the Bit Error Rate (BER) performance of different spreading codes (Walsh-Hadamard code, Orthogonal gold code and Golay complementary sequences) using Forward Error Correction (FEC) of the proposed system. The data is analyzed and is compared among different spreading codes in both coded and uncoded cases. It is found via computer simulation that the performance...

  12. In vitro cross-resistance profile of nucleoside reverse transcriptase inhibitor (NRTI) BMS-986001 against known NRTI resistance mutations.

    Science.gov (United States)

    Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark

    2013-11-01

    BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.

  13. Improving performance of DS-CDMA systems using chaotic complex Bernoulli spreading codes

    Science.gov (United States)

    Farzan Sabahi, Mohammad; Dehghanfard, Ali

    2014-12-01

    The most important goal of spreading spectrum communication system is to protect communication signals against interference and exploitation of information by unintended listeners. In fact, low probability of detection and low probability of intercept are two important parameters to increase the performance of the system. In Direct Sequence Code Division Multiple Access (DS-CDMA) systems, these properties are achieved by multiplying the data information in spreading sequences. Chaotic sequences, with their particular properties, have numerous applications in constructing spreading codes. Using one-dimensional Bernoulli chaotic sequence as spreading code is proposed in literature previously. The main feature of this sequence is its negative auto-correlation at lag of 1, which with proper design, leads to increase in efficiency of the communication system based on these codes. On the other hand, employing the complex chaotic sequences as spreading sequence also has been discussed in several papers. In this paper, use of two-dimensional Bernoulli chaotic sequences is proposed as spreading codes. The performance of a multi-user synchronous and asynchronous DS-CDMA system will be evaluated by applying these sequences under Additive White Gaussian Noise (AWGN) and fading channel. Simulation results indicate improvement of the performance in comparison with conventional spreading codes like Gold codes as well as similar complex chaotic spreading sequences. Similar to one-dimensional Bernoulli chaotic sequences, the proposed sequences also have negative auto-correlation. Besides, construction of complex sequences with lower average cross-correlation is possible with the proposed method.

  14. A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

    NARCIS (Netherlands)

    Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.

    2011-01-01

    The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who

  15. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

    Science.gov (United States)

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  16. Mutation V111I in HIV-2 reverse transcriptase increases the fitness of the nucleoside analogue-resistant K65R and Q151M viruses

    NARCIS (Netherlands)

    I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)

    2015-01-01

    textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have

  17. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy: the D: A: D study

    NARCIS (Netherlands)

    Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,

    2015-01-01

    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  18. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy : the D: A: D study

    NARCIS (Netherlands)

    Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.

    2015-01-01

    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  19. Novel (2,6-difluorophenyl)(2-(phenylamino)pyrimidin-4-yl) methanones with restricted conformation as potent non-nucleoside reverse transcriptase inhibitors against HIV-1

    Czech Academy of Sciences Publication Activity Database

    Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko

    2016-01-01

    Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016

  20. Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

    NARCIS (Netherlands)

    Oude Essink, B. B.; Das, A. T.; Berkhout, B.

    1995-01-01

    Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

  1. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  2. Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

    NARCIS (Netherlands)

    Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.

    2010-01-01

    Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

  3. The materiality of Code

    DEFF Research Database (Denmark)

    Soon, Winnie

    2014-01-01

    This essay studies the source code of an artwork from a software studies perspective. By examining code that come close to the approach of critical code studies (Marino, 2006), I trace the network artwork, Pupufu (Lin, 2009) to understand various real-time approaches to social media platforms (MSN......, Twitter and Facebook). The focus is not to investigate the functionalities and efficiencies of the code, but to study and interpret the program level of code in order to trace the use of various technological methods such as third-party libraries and platforms’ interfaces. These are important...... to understand the socio-technical side of a changing network environment. Through the study of code, including but not limited to source code, technical specifications and other materials in relation to the artwork production, I would like to explore the materiality of code that goes beyond technical...

  4. Coding for optical channels

    CERN Document Server

    Djordjevic, Ivan; Vasic, Bane

    2010-01-01

    This unique book provides a coherent and comprehensive introduction to the fundamentals of optical communications, signal processing and coding for optical channels. It is the first to integrate the fundamentals of coding theory and optical communication.

  5. SEVERO code - user's manual

    International Nuclear Information System (INIS)

    Sacramento, A.M. do.

    1989-01-01

    This user's manual contains all the necessary information concerning the use of SEVERO code. This computer code is related to the statistics of extremes = extreme winds, extreme precipitation and flooding hazard risk analysis. (A.C.A.S.)

  6. Retrotransposons and non-protein coding RNAs

    DEFF Research Database (Denmark)

    Mourier, Tobias; Willerslev, Eske

    2009-01-01

    does not merely represent spurious transcription. We review examples of functional RNAs transcribed from retrotransposons, and address the collection of non-protein coding RNAs derived from transposable element sequences, including numerous human microRNAs and the neuronal BC RNAs. Finally, we review...

  7. Synthesizing Certified Code

    OpenAIRE

    Whalen, Michael; Schumann, Johann; Fischer, Bernd

    2002-01-01

    Code certification is a lightweight approach for formally demonstrating software quality. Its basic idea is to require code producers to provide formal proofs that their code satisfies certain quality properties. These proofs serve as certificates that can be checked independently. Since code certification uses the same underlying technology as program verification, it requires detailed annotations (e.g., loop invariants) to make the proofs possible. However, manually adding annotations to th...

  8. FERRET data analysis code

    International Nuclear Information System (INIS)

    Schmittroth, F.

    1979-09-01

    A documentation of the FERRET data analysis code is given. The code provides a way to combine related measurements and calculations in a consistent evaluation. Basically a very general least-squares code, it is oriented towards problems frequently encountered in nuclear data and reactor physics. A strong emphasis is on the proper treatment of uncertainties and correlations and in providing quantitative uncertainty estimates. Documentation includes a review of the method, structure of the code, input formats, and examples

  9. Stylize Aesthetic QR Code

    OpenAIRE

    Xu, Mingliang; Su, Hao; Li, Yafei; Li, Xi; Liao, Jing; Niu, Jianwei; Lv, Pei; Zhou, Bing

    2018-01-01

    With the continued proliferation of smart mobile devices, Quick Response (QR) code has become one of the most-used types of two-dimensional code in the world. Aiming at beautifying the appearance of QR codes, existing works have developed a series of techniques to make the QR code more visual-pleasant. However, these works still leave much to be desired, such as visual diversity, aesthetic quality, flexibility, universal property, and robustness. To address these issues, in this paper, we pro...

  10. Enhancing QR Code Security

    OpenAIRE

    Zhang, Linfan; Zheng, Shuang

    2015-01-01

    Quick Response code opens possibility to convey data in a unique way yet insufficient prevention and protection might lead into QR code being exploited on behalf of attackers. This thesis starts by presenting a general introduction of background and stating two problems regarding QR code security, which followed by a comprehensive research on both QR code itself and related issues. From the research a solution taking advantages of cloud and cryptography together with an implementation come af...

  11. Uniform Circular Antenna Array Applications in Coded DS-CDMA Mobile Communication Systems

    National Research Council Canada - National Science Library

    Seow, Tian

    2003-01-01

    ...) has greatly increased. This thesis examines the use of an equally spaced circular adaptive antenna array at the mobile station for a typical coded direct sequence code division multiple access (DS-CDMA...

  12. Opening up codings?

    DEFF Research Database (Denmark)

    Steensig, Jakob; Heinemann, Trine

    2015-01-01

    doing formal coding and when doing more “traditional” conversation analysis research based on collections. We are more wary, however, of the implication that coding-based research is the end result of a process that starts with qualitative investigations and ends with categories that can be coded...

  13. Gauge color codes

    DEFF Research Database (Denmark)

    Bombin Palomo, Hector

    2015-01-01

    Color codes are topological stabilizer codes with unusual transversality properties. Here I show that their group of transversal gates is optimal and only depends on the spatial dimension, not the local geometry. I also introduce a generalized, subsystem version of color codes. In 3D they allow...

  14. Refactoring test code

    NARCIS (Netherlands)

    A. van Deursen (Arie); L.M.F. Moonen (Leon); A. van den Bergh; G. Kok

    2001-01-01

    textabstractTwo key aspects of extreme programming (XP) are unit testing and merciless refactoring. Given the fact that the ideal test code / production code ratio approaches 1:1, it is not surprising that unit tests are being refactored. We found that refactoring test code is different from

  15. Hypoxia induces telomerase reverse transcriptase (TERT gene expression in non-tumor fish tissues in vivo: the marine medaka (Oryzias melastigma model

    Directory of Open Access Journals (Sweden)

    Mok Helen OL

    2006-09-01

    Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This

  16. Spike Code Flow in Cultured Neuronal Networks.

    Science.gov (United States)

    Tamura, Shinichi; Nishitani, Yoshi; Hosokawa, Chie; Miyoshi, Tomomitsu; Sawai, Hajime; Kamimura, Takuya; Yagi, Yasushi; Mizuno-Matsumoto, Yuko; Chen, Yen-Wei

    2016-01-01

    We observed spike trains produced by one-shot electrical stimulation with 8 × 8 multielectrodes in cultured neuronal networks. Each electrode accepted spikes from several neurons. We extracted the short codes from spike trains and obtained a code spectrum with a nominal time accuracy of 1%. We then constructed code flow maps as movies of the electrode array to observe the code flow of "1101" and "1011," which are typical pseudorandom sequence such as that we often encountered in a literature and our experiments. They seemed to flow from one electrode to the neighboring one and maintained their shape to some extent. To quantify the flow, we calculated the "maximum cross-correlations" among neighboring electrodes, to find the direction of maximum flow of the codes with lengths less than 8. Normalized maximum cross-correlations were almost constant irrespective of code. Furthermore, if the spike trains were shuffled in interval orders or in electrodes, they became significantly small. Thus, the analysis suggested that local codes of approximately constant shape propagated and conveyed information across the network. Hence, the codes can serve as visible and trackable marks of propagating spike waves as well as evaluating information flow in the neuronal network.

  17. Spike Code Flow in Cultured Neuronal Networks

    Directory of Open Access Journals (Sweden)

    Shinichi Tamura

    2016-01-01

    Full Text Available We observed spike trains produced by one-shot electrical stimulation with 8 × 8 multielectrodes in cultured neuronal networks. Each electrode accepted spikes from several neurons. We extracted the short codes from spike trains and obtained a code spectrum with a nominal time accuracy of 1%. We then constructed code flow maps as movies of the electrode array to observe the code flow of “1101” and “1011,” which are typical pseudorandom sequence such as that we often encountered in a literature and our experiments. They seemed to flow from one electrode to the neighboring one and maintained their shape to some extent. To quantify the flow, we calculated the “maximum cross-correlations” among neighboring electrodes, to find the direction of maximum flow of the codes with lengths less than 8. Normalized maximum cross-correlations were almost constant irrespective of code. Furthermore, if the spike trains were shuffled in interval orders or in electrodes, they became significantly small. Thus, the analysis suggested that local codes of approximately constant shape propagated and conveyed information across the network. Hence, the codes can serve as visible and trackable marks of propagating spike waves as well as evaluating information flow in the neuronal network.

  18. Software Certification - Coding, Code, and Coders

    Science.gov (United States)

    Havelund, Klaus; Holzmann, Gerard J.

    2011-01-01

    We describe a certification approach for software development that has been adopted at our organization. JPL develops robotic spacecraft for the exploration of the solar system. The flight software that controls these spacecraft is considered to be mission critical. We argue that the goal of a software certification process cannot be the development of "perfect" software, i.e., software that can be formally proven to be correct under all imaginable and unimaginable circumstances. More realistically, the goal is to guarantee a software development process that is conducted by knowledgeable engineers, who follow generally accepted procedures to control known risks, while meeting agreed upon standards of workmanship. We target three specific issues that must be addressed in such a certification procedure: the coding process, the code that is developed, and the skills of the coders. The coding process is driven by standards (e.g., a coding standard) and tools. The code is mechanically checked against the standard with the help of state-of-the-art static source code analyzers. The coders, finally, are certified in on-site training courses that include formal exams.

  19. On the classification of long non-coding RNAs

    KAUST Repository

    Ma, Lina; Bajic, Vladimir B.; Zhang, Zhang

    2013-01-01

    Long non-coding RNAs (lncRNAs) have been found to perform various functions in a wide variety of important biological processes. To make easier interpretation of lncRNA functionality and conduct deep mining on these transcribed sequences

  20. MELT-IIIB: an updated version of the melt code

    International Nuclear Information System (INIS)

    Tabb, K.K.; Lewis, C.H.; O'Dell, L.D.; Padilla, A. Jr.; Smith, D.E.; Wilburn, N.P.

    1979-04-01

    The MELT series is a reactor modeling code designed to investigate a wide variety of hypothetical accident conditions, particularly the transient overpower sequence. MELT-IIIB is the latest in the series

  1. Optimal interference code based on machine learning

    Science.gov (United States)

    Qian, Ye; Chen, Qian; Hu, Xiaobo; Cao, Ercong; Qian, Weixian; Gu, Guohua

    2016-10-01

    In this paper, we analyze the characteristics of pseudo-random code, by the case of m sequence. Depending on the description of coding theory, we introduce the jamming methods. We simulate the interference effect or probability model by the means of MATLAB to consolidate. In accordance with the length of decoding time the adversary spends, we find out the optimal formula and optimal coefficients based on machine learning, then we get the new optimal interference code. First, when it comes to the phase of recognition, this study judges the effect of interference by the way of simulating the length of time over the decoding period of laser seeker. Then, we use laser active deception jamming simulate interference process in the tracking phase in the next block. In this study we choose the method of laser active deception jamming. In order to improve the performance of the interference, this paper simulates the model by MATLAB software. We find out the least number of pulse intervals which must be received, then we can make the conclusion that the precise interval number of the laser pointer for m sequence encoding. In order to find the shortest space, we make the choice of the greatest common divisor method. Then, combining with the coding regularity that has been found before, we restore pulse interval of pseudo-random code, which has been already received. Finally, we can control the time period of laser interference, get the optimal interference code, and also increase the probability of interference as well.

  2. Genetic coding and gene expression - new Quadruplet genetic coding model

    Science.gov (United States)

    Shankar Singh, Rama

    2012-07-01

    Successful demonstration of human genome project has opened the door not only for developing personalized medicine and cure for genetic diseases, but it may also answer the complex and difficult question of the origin of life. It may lead to making 21st century, a century of Biological Sciences as well. Based on the central dogma of Biology, genetic codons in conjunction with tRNA play a key role in translating the RNA bases forming sequence of amino acids leading to a synthesized protein. This is the most critical step in synthesizing the right protein needed for personalized medicine and curing genetic diseases. So far, only triplet codons involving three bases of RNA, transcribed from DNA bases, have been used. Since this approach has several inconsistencies and limitations, even the promise of personalized medicine has not been realized. The new Quadruplet genetic coding model proposed and developed here involves all four RNA bases which in conjunction with tRNA will synthesize the right protein. The transcription and translation process used will be the same, but the Quadruplet codons will help overcome most of the inconsistencies and limitations of the triplet codes. Details of this new Quadruplet genetic coding model and its subsequent potential applications including relevance to the origin of life will be presented.

  3. The network code

    International Nuclear Information System (INIS)

    1997-01-01

    The Network Code defines the rights and responsibilities of all users of the natural gas transportation system in the liberalised gas industry in the United Kingdom. This report describes the operation of the Code, what it means, how it works and its implications for the various participants in the industry. The topics covered are: development of the competitive gas market in the UK; key points in the Code; gas transportation charging; impact of the Code on producers upstream; impact on shippers; gas storage; supply point administration; impact of the Code on end users; the future. (20 tables; 33 figures) (UK)

  4. Coding for Electronic Mail

    Science.gov (United States)

    Rice, R. F.; Lee, J. J.

    1986-01-01

    Scheme for coding facsimile messages promises to reduce data transmission requirements to one-tenth current level. Coding scheme paves way for true electronic mail in which handwritten, typed, or printed messages or diagrams sent virtually instantaneously - between buildings or between continents. Scheme, called Universal System for Efficient Electronic Mail (USEEM), uses unsupervised character recognition and adaptive noiseless coding of text. Image quality of resulting delivered messages improved over messages transmitted by conventional coding. Coding scheme compatible with direct-entry electronic mail as well as facsimile reproduction. Text transmitted in this scheme automatically translated to word-processor form.

  5. NAGRADATA. Code key. Geology

    International Nuclear Information System (INIS)

    Mueller, W.H.; Schneider, B.; Staeuble, J.

    1984-01-01

    This reference manual provides users of the NAGRADATA system with comprehensive keys to the coding/decoding of geological and technical information to be stored in or retreaved from the databank. Emphasis has been placed on input data coding. When data is retreaved the translation into plain language of stored coded information is done automatically by computer. Three keys each, list the complete set of currently defined codes for the NAGRADATA system, namely codes with appropriate definitions, arranged: 1. according to subject matter (thematically) 2. the codes listed alphabetically and 3. the definitions listed alphabetically. Additional explanation is provided for the proper application of the codes and the logic behind the creation of new codes to be used within the NAGRADATA system. NAGRADATA makes use of codes instead of plain language for data storage; this offers the following advantages: speed of data processing, mainly data retrieval, economies of storage memory requirements, the standardisation of terminology. The nature of this thesaurian type 'key to codes' makes it impossible to either establish a final form or to cover the entire spectrum of requirements. Therefore, this first issue of codes to NAGRADATA must be considered to represent the current state of progress of a living system and future editions will be issued in a loose leave ringbook system which can be updated by an organised (updating) service. (author)

  6. XSOR codes users manual

    International Nuclear Information System (INIS)

    Jow, Hong-Nian; Murfin, W.B.; Johnson, J.D.

    1993-11-01

    This report describes the source term estimation codes, XSORs. The codes are written for three pressurized water reactors (Surry, Sequoyah, and Zion) and two boiling water reactors (Peach Bottom and Grand Gulf). The ensemble of codes has been named ''XSOR''. The purpose of XSOR codes is to estimate the source terms which would be released to the atmosphere in severe accidents. A source term includes the release fractions of several radionuclide groups, the timing and duration of releases, the rates of energy release, and the elevation of releases. The codes have been developed by Sandia National Laboratories for the US Nuclear Regulatory Commission (NRC) in support of the NUREG-1150 program. The XSOR codes are fast running parametric codes and are used as surrogates for detailed mechanistic codes. The XSOR codes also provide the capability to explore the phenomena and their uncertainty which are not currently modeled by the mechanistic codes. The uncertainty distributions of input parameters may be used by an. XSOR code to estimate the uncertainty of source terms

  7. Reactor lattice codes

    International Nuclear Information System (INIS)

    Kulikowska, T.

    1999-01-01

    The present lecture has a main goal to show how the transport lattice calculations are realised in a standard computer code. This is illustrated on the example of the WIMSD code, belonging to the most popular tools for reactor calculations. Most of the approaches discussed here can be easily modified to any other lattice code. The description of the code assumes the basic knowledge of reactor lattice, on the level given in the lecture on 'Reactor lattice transport calculations'. For more advanced explanation of the WIMSD code the reader is directed to the detailed descriptions of the code cited in References. The discussion of the methods and models included in the code is followed by the generally used homogenisation procedure and several numerical examples of discrepancies in calculated multiplication factors based on different sources of library data. (author)

  8. DLLExternalCode

    Energy Technology Data Exchange (ETDEWEB)

    2014-05-14

    DLLExternalCode is the a general dynamic-link library (DLL) interface for linking GoldSim (www.goldsim.com) with external codes. The overall concept is to use GoldSim as top level modeling software with interfaces to external codes for specific calculations. The DLLExternalCode DLL that performs the linking function is designed to take a list of code inputs from GoldSim, create an input file for the external application, run the external code, and return a list of outputs, read from files created by the external application, back to GoldSim. Instructions for creating the input file, running the external code, and reading the output are contained in an instructions file that is read and interpreted by the DLL.

  9. Spread-spectrum communication using binary spatiotemporal chaotic codes

    International Nuclear Information System (INIS)

    Wang Xingang; Zhan Meng; Gong Xiaofeng; Lai, C.H.; Lai, Y.-C.

    2005-01-01

    We propose a scheme to generate binary code for baseband spread-spectrum communication by using a chain of coupled chaotic maps. We compare the performances of this type of spatiotemporal chaotic code with those of a conventional code used frequently in digital communication, the Gold code, and demonstrate that our code is comparable or even superior to the Gold code in several key aspects: security, bit error rate, code generation speed, and the number of possible code sequences. As the field of communicating with chaos faces doubts in terms of performance comparison with conventional digital communication schemes, our work gives a clear message that communicating with chaos can be advantageous and it deserves further attention from the nonlinear science community

  10. Codes on the Klein quartic, ideals, and decoding

    DEFF Research Database (Denmark)

    Hansen, Johan P.

    1987-01-01

    descriptions as left ideals in the group-algebra GF(2^{3})[G]. This description allows for easy decoding. For instance, in the case of the single error correcting code of length21and dimension16with minimal distance3. decoding is obtained by multiplication with an idempotent in the group algebra.......A sequence of codes with particular symmetries and with large rates compared to their minimal distances is constructed over the field GF(2^{3}). In the sequence there is, for instance, a code of length 21 and dimension10with minimal distance9, and a code of length21and dimension16with minimal...... distance3. The codes are constructed from algebraic geometry using the dictionary between coding theory and algebraic curves over finite fields established by Goppa. The curve used in the present work is the Klein quartic. This curve has the maximal number of rational points over GF(2^{3})allowed by Serre...

  11. Flexibility of the genetic code with respect to DNA structure

    DEFF Research Database (Denmark)

    Baisnée, P. F.; Baldi, Pierre; Brunak, Søren

    2001-01-01

    Motivation. The primary function of DNA is to carry genetic information through the genetic code. DNA, however, contains a variety of other signals related, for instance, to reading frame, codon bias, pairwise codon bias, splice sites and transcription regulation, nucleosome positioning and DNA...... structure. Here we study the relationship between the genetic code and DNA structure and address two questions. First, to which degree does the degeneracy of the genetic code and the acceptable amino acid substitution patterns allow for the superimposition of DNA structural signals to protein coding...... sequences? Second, is the origin or evolution of the genetic code likely to have been constrained by DNA structure? Results. We develop an index for code flexibility with respect to DNA structure. Using five different di- or tri-nucleotide models of sequence-dependent DNA structure, we show...

  12. Identification of coding and non-coding mutational hotspots in cancer genomes.

    Science.gov (United States)

    Piraino, Scott W; Furney, Simon J

    2017-01-05

    The identification of mutations that play a causal role in tumour development, so called "driver" mutations, is of critical importance for understanding how cancers form and how they might be treated. Several large cancer sequencing projects have identified genes that are recurrently mutated in cancer patients, suggesting a role in tumourigenesis. While the landscape of coding drivers has been extensively studied and many of the most prominent driver genes are well characterised, comparatively less is known about the role of mutations in the non-coding regions of the genome in cancer development. The continuing fall in genome sequencing costs has resulted in a concomitant increase in the number of cancer whole genome sequences being produced, facilitating systematic interrogation of both the coding and non-coding regions of cancer genomes. To examine the mutational landscapes of tumour genomes we have developed a novel method to identify mutational hotspots in tumour genomes using both mutational data and information on evolutionary conservation. We have applied our methodology to over 1300 whole cancer genomes and show that it identifies prominent coding and non-coding regions that are known or highly suspected to play a role in cancer. Importantly, we applied our method to the entire genome, rather than relying on predefined annotations (e.g. promoter regions) and we highlight recurrently mutated regions that may have resulted from increased exposure to mutational processes rather than selection, some of which have been identified previously as targets of selection. Finally, we implicate several pan-cancer and cancer-specific candidate non-coding regions, which could be involved in tumourigenesis. We have developed a framework to identify mutational hotspots in cancer genomes, which is applicable to the entire genome. This framework identifies known and novel coding and non-coding mutional hotspots and can be used to differentiate candidate driver regions from

  13. A STUDY ON DETERMINING THE REFERENCE SPREADING SEQUENCES FOR A DS/CDMACOMMUNICATION SYSTEM

    Directory of Open Access Journals (Sweden)

    Cebrail ÇİFTLİKLİ

    2002-02-01

    Full Text Available In a direct sequence/code division multiple access (DS/CDMA system, the role of the spreading sequences (codes is crucial since the multiple access interference (MAI is the main performance limitation. In this study, we propose an accurate criterion which enables the determination of the reference spreading codes which yield lower bit error rates (BER's in a given code set for a DS/CDMA system using despreading sequences weighted by stepping chip waveforms. The numerical results show that the spreading codes determined by the proposed criterion are the most suitable codes for using as references.

  14. Building the sequence map of the human pan-genome

    DEFF Research Database (Denmark)

    Li, Ruiqiang; Li, Yingrui; Zheng, Hancheng

    2010-01-01

    analysis of predicted genes indicated that the novel sequences contain potentially functional coding regions. We estimate that a complete human pan-genome would contain approximately 19-40 Mb of novel sequence not present in the extant reference genome. The extensive amount of novel sequence contributing...

  15. Comparison between quantitative nucleic acid sequence-based amplification, real-time reverse transcriptase PCR, and real-time PCR for quantification of Leishmania parasites

    NARCIS (Netherlands)

    van der Meide, Wendy; Guerra, Jorge; Schoone, Gerard; Farenhorst, Marit; Coelho, Leila; Faber, William; Peekel, Inge; Schallig, Henk

    2008-01-01

    DNA or RNA amplification methods for detection of Leishmania parasites have advantages regarding sensitivity and potential quantitative characteristics in comparison with conventional diagnostic methods but are often still not routinely applied. However, the use and application of molecular assays

  16. Simultaneous chromatic dispersion and PMD compensation by using coded-OFDM and girth-10 LDPC codes.

    Science.gov (United States)

    Djordjevic, Ivan B; Xu, Lei; Wang, Ting

    2008-07-07

    Low-density parity-check (LDPC)-coded orthogonal frequency division multiplexing (OFDM) is studied as an efficient coded modulation scheme suitable for simultaneous chromatic dispersion and polarization mode dispersion (PMD) compensation. We show that, for aggregate rate of 10 Gb/s, accumulated dispersion over 6500 km of SMF and differential group delay of 100 ps can be simultaneously compensated with penalty within 1.5 dB (with respect to the back-to-back configuration) when training sequence based channel estimation and girth-10 LDPC codes of rate 0.8 are employed.

  17. Toric Varieties and Codes, Error-correcting Codes, Quantum Codes, Secret Sharing and Decoding

    DEFF Research Database (Denmark)

    Hansen, Johan Peder

    We present toric varieties and associated toric codes and their decoding. Toric codes are applied to construct Linear Secret Sharing Schemes (LSSS) with strong multiplication by the Massey construction. Asymmetric Quantum Codes are obtained from toric codes by the A.R. Calderbank P.W. Shor and A.......M. Steane construction of stabilizer codes (CSS) from linear codes containing their dual codes....

  18. Status of the CONTAIN computer code for LWR containment analysis

    International Nuclear Information System (INIS)

    Bergeron, K.D.; Murata, K.K.; Rexroth, P.E.; Clauser, M.J.; Senglaub, M.E.; Sciacca, F.W.; Trebilcock, W.

    1983-01-01

    The current status of the CONTAIN code for LWR safety analysis is reviewed. Three example calculations are discussed as illustrations of the code's capabilities: (1) a demonstration of the spray model in a realistic PWR problem, and a comparison with CONTEMPT results; (2) a comparison of CONTAIN results for a major aerosol experiment against experimental results and predictions of the HAARM aerosol code; and (3) an LWR sample problem, involving a TMLB' sequence for the Zion reactor containment

  19. Status of the CONTAIN computer code for LWR containment analysis

    International Nuclear Information System (INIS)

    Bergeron, K.D.; Murata, K.K.; Rexroth, P.E.; Clauser, M.J.; Senglaub, M.E.; Sciacca, F.W.; Trebilcock, W.

    1982-01-01

    The current status of the CONTAIN code for LWR safety analysis is reviewed. Three example calculations are discussed as illustrations of the code's capabilities: (1) a demonstration of the spray model in a realistic PWR problem, and a comparison with CONTEMPT results; (2) a comparison of CONTAIN results for a major aerosol experiment against experimental results and predictions of the HAARM aerosol code; and (3) an LWR sample problem, involving a TMLB' sequence for the Zion reactor containment

  20. Autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter suppresses human ovarian carcinoma growth in vitro and in mice.

    Science.gov (United States)

    Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue

    2013-05-01

    To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis

  1. An Optimal Linear Coding for Index Coding Problem

    OpenAIRE

    Pezeshkpour, Pouya

    2015-01-01

    An optimal linear coding solution for index coding problem is established. Instead of network coding approach by focus on graph theoric and algebraic methods a linear coding program for solving both unicast and groupcast index coding problem is presented. The coding is proved to be the optimal solution from the linear perspective and can be easily utilize for any number of messages. The importance of this work is lying mostly on the usage of the presented coding in the groupcast index coding ...

  2. Codon usage bias analysis for the coding sequences of Camellia ...

    African Journals Online (AJOL)

    sunny t

    2016-02-24

    Feb 24, 2016 ... suggested that codon usage bias is driven by selection, particularly for .... For example, as mentioned above, highly expressed genes tend to use fewer ... directional codon bias measure effective number of codons (ENc) was ...

  3. MPEC-4 Based Intelligent Coding for Plume Video Sequences

    National Research Council Canada - National Science Library

    Park, Gean

    1999-01-01

    The multimedia technology, which will lead in the 21st century, will depend on how to manipulate visual information efficiently, and will be focused on the interactive visual information exchange and user interactions...

  4. Molecular cloning of full-length coding sequences and ...

    African Journals Online (AJOL)

    DR TONUKARI NYEROVWO

    structure and function of collagen, the distribution patterns of these two characteristic residues in α chains of ... the extracellular matrix. Besides ... number in collagen family and the major matrix protein in ..... Dashes represent missing residues.

  5. The Aesthetics of Coding

    DEFF Research Database (Denmark)

    Andersen, Christian Ulrik

    2007-01-01

    Computer art is often associated with computer-generated expressions (digitally manipulated audio/images in music, video, stage design, media facades, etc.). In recent computer art, however, the code-text itself – not the generated output – has become the artwork (Perl Poetry, ASCII Art, obfuscated...... code, etc.). The presentation relates this artistic fascination of code to a media critique expressed by Florian Cramer, claiming that the graphical interface represents a media separation (of text/code and image) causing alienation to the computer’s materiality. Cramer is thus the voice of a new ‘code...... avant-garde’. In line with Cramer, the artists Alex McLean and Adrian Ward (aka Slub) declare: “art-oriented programming needs to acknowledge the conditions of its own making – its poesis.” By analysing the Live Coding performances of Slub (where they program computer music live), the presentation...

  6. Majorana fermion codes

    International Nuclear Information System (INIS)

    Bravyi, Sergey; Terhal, Barbara M; Leemhuis, Bernhard

    2010-01-01

    We initiate the study of Majorana fermion codes (MFCs). These codes can be viewed as extensions of Kitaev's one-dimensional (1D) model of unpaired Majorana fermions in quantum wires to higher spatial dimensions and interacting fermions. The purpose of MFCs is to protect quantum information against low-weight fermionic errors, that is, operators acting on sufficiently small subsets of fermionic modes. We examine to what extent MFCs can surpass qubit stabilizer codes in terms of their stability properties. A general construction of 2D MFCs is proposed that combines topological protection based on a macroscopic code distance with protection based on fermionic parity conservation. Finally, we use MFCs to show how to transform any qubit stabilizer code to a weakly self-dual CSS code.

  7. Theory of epigenetic coding.

    Science.gov (United States)

    Elder, D

    1984-06-07

    The logic of genetic control of development may be based on a binary epigenetic code. This paper revises the author's previous scheme dealing with the numerology of annelid metamerism in these terms. Certain features of the code had been deduced to be combinatorial, others not. This paradoxical contrast is resolved here by the interpretation that these features relate to different operations of the code; the combinatiorial to coding identity of units, the non-combinatorial to coding production of units. Consideration of a second paradox in the theory of epigenetic coding leads to a new solution which further provides a basis for epimorphic regeneration, and may in particular throw light on the "regeneration-duplication" phenomenon. A possible test of the model is also put forward.

  8. DISP1 code

    International Nuclear Information System (INIS)

    Vokac, P.

    1999-12-01

    DISP1 code is a simple tool for assessment of the dispersion of the fission product cloud escaping from a nuclear power plant after an accident. The code makes it possible to tentatively check the feasibility of calculations by more complex PSA3 codes and/or codes for real-time dispersion calculations. The number of input parameters is reasonably low and the user interface is simple enough to allow a rapid processing of sensitivity analyses. All input data entered through the user interface are stored in the text format. Implementation of dispersion model corrections taken from the ARCON96 code enables the DISP1 code to be employed for assessment of the radiation hazard within the NPP area, in the control room for instance. (P.A.)

  9. Adaptive format conversion for scalable video coding

    Science.gov (United States)

    Wan, Wade K.; Lim, Jae S.

    2001-12-01

    The enhancement layer in many scalable coding algorithms is composed of residual coding information. There is another type of information that can be transmitted instead of (or in addition to) residual coding. Since the encoder has access to the original sequence, it can utilize adaptive format conversion (AFC) to generate the enhancement layer and transmit the different format conversion methods as enhancement data. This paper investigates the use of adaptive format conversion information as enhancement data in scalable video coding. Experimental results are shown for a wide range of base layer qualities and enhancement bitrates to determine when AFC can improve video scalability. Since the parameters needed for AFC are small compared to residual coding, AFC can provide video scalability at low enhancement layer bitrates that are not possible with residual coding. In addition, AFC can also be used in addition to residual coding to improve video scalability at higher enhancement layer bitrates. Adaptive format conversion has not been studied in detail, but many scalable applications may benefit from it. An example of an application that AFC is well-suited for is the migration path for digital television where AFC can provide immediate video scalability as well as assist future migrations.

  10. Phonological coding during reading.

    Science.gov (United States)

    Leinenger, Mallorie

    2014-11-01

    The exact role that phonological coding (the recoding of written, orthographic information into a sound based code) plays during silent reading has been extensively studied for more than a century. Despite the large body of research surrounding the topic, varying theories as to the time course and function of this recoding still exist. The present review synthesizes this body of research, addressing the topics of time course and function in tandem. The varying theories surrounding the function of phonological coding (e.g., that phonological codes aid lexical access, that phonological codes aid comprehension and bolster short-term memory, or that phonological codes are largely epiphenomenal in skilled readers) are first outlined, and the time courses that each maps onto (e.g., that phonological codes come online early [prelexical] or that phonological codes come online late [postlexical]) are discussed. Next the research relevant to each of these proposed functions is reviewed, discussing the varying methodologies that have been used to investigate phonological coding (e.g., response time methods, reading while eye-tracking or recording EEG and MEG, concurrent articulation) and highlighting the advantages and limitations of each with respect to the study of phonological coding. In response to the view that phonological coding is largely epiphenomenal in skilled readers, research on the use of phonological codes in prelingually, profoundly deaf readers is reviewed. Finally, implications for current models of word identification (activation-verification model, Van Orden, 1987; dual-route model, e.g., M. Coltheart, Rastle, Perry, Langdon, & Ziegler, 2001; parallel distributed processing model, Seidenberg & McClelland, 1989) are discussed. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

  11. The aeroelastic code FLEXLAST

    Energy Technology Data Exchange (ETDEWEB)

    Visser, B. [Stork Product Eng., Amsterdam (Netherlands)

    1996-09-01

    To support the discussion on aeroelastic codes, a description of the code FLEXLAST was given and experiences within benchmarks and measurement programmes were summarized. The code FLEXLAST has been developed since 1982 at Stork Product Engineering (SPE). Since 1992 FLEXLAST has been used by Dutch industries for wind turbine and rotor design. Based on the comparison with measurements, it can be concluded that the main shortcomings of wind turbine modelling lie in the field of aerodynamics, wind field and wake modelling. (au)

  12. MORSE Monte Carlo code

    International Nuclear Information System (INIS)

    Cramer, S.N.

    1984-01-01

    The MORSE code is a large general-use multigroup Monte Carlo code system. Although no claims can be made regarding its superiority in either theoretical details or Monte Carlo techniques, MORSE has been, since its inception at ORNL in the late 1960s, the most widely used Monte Carlo radiation transport code. The principal reason for this popularity is that MORSE is relatively easy to use, independent of any installation or distribution center, and it can be easily customized to fit almost any specific need. Features of the MORSE code are described

  13. QR codes for dummies

    CERN Document Server

    Waters, Joe

    2012-01-01

    Find out how to effectively create, use, and track QR codes QR (Quick Response) codes are popping up everywhere, and businesses are reaping the rewards. Get in on the action with the no-nonsense advice in this streamlined, portable guide. You'll find out how to get started, plan your strategy, and actually create the codes. Then you'll learn to link codes to mobile-friendly content, track your results, and develop ways to give your customers value that will keep them coming back. It's all presented in the straightforward style you've come to know and love, with a dash of humor thrown

  14. Tokamak Systems Code

    International Nuclear Information System (INIS)

    Reid, R.L.; Barrett, R.J.; Brown, T.G.

    1985-03-01

    The FEDC Tokamak Systems Code calculates tokamak performance, cost, and configuration as a function of plasma engineering parameters. This version of the code models experimental tokamaks. It does not currently consider tokamak configurations that generate electrical power or incorporate breeding blankets. The code has a modular (or subroutine) structure to allow independent modeling for each major tokamak component or system. A primary benefit of modularization is that a component module may be updated without disturbing the remainder of the systems code as long as the imput to or output from the module remains unchanged

  15. Efficient Coding of Information: Huffman Coding -RE ...

    Indian Academy of Sciences (India)

    to a stream of equally-likely symbols so as to recover the original stream in the event of errors. The for- ... The source-coding problem is one of finding a mapping from U to a ... probability that the random variable X takes the value x written as ...

  16. NR-code: Nonlinear reconstruction code

    Science.gov (United States)

    Yu, Yu; Pen, Ue-Li; Zhu, Hong-Ming

    2018-04-01

    NR-code applies nonlinear reconstruction to the dark matter density field in redshift space and solves for the nonlinear mapping from the initial Lagrangian positions to the final redshift space positions; this reverses the large-scale bulk flows and improves the precision measurement of the baryon acoustic oscillations (BAO) scale.

  17. The development of HEPT-type HIV non-nucleoside reverse transcriptase inhibitors and its implications for DABO family.

    Science.gov (United States)

    Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong

    2012-01-01

    1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.

  18. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

    Science.gov (United States)

    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

    2014-01-01

    Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

  19. Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase.

    Science.gov (United States)

    Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio

    2016-09-30

    We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

  20. In Vitro Antioxidant Properties, HIV-1 Reverse Transcriptase and Acetylcholinesterase Inhibitory Effects of Traditional Herbal Preparations Sold in South Africa

    Directory of Open Access Journals (Sweden)

    Johannes Van Staden

    2010-10-01

    Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.