WorldWideScience

Sample records for transcriptase coding sequences

  1. Detection of multiple, novel reverse transcriptase coding sequences in human nucleic acids: relation to primate retroviruses

    International Nuclear Information System (INIS)

    Shih, A.; Misra, R.; Rush, M.G.

    1989-01-01

    A variety of chemically synthesized oligonucleotides designed on the basis of amino acid and/or nucleotide sequence data were used to detect a large number of novel reverse transcriptase coding sequences in human and mouse DNAs. Procedures involving Southern blotting, library screening, and the polymerase chain reaction were all used to detect such sequences; the polymerase chain reaction was the most rapid and productive approach. In the polymerase chain reaction, oligonucleotide mixtures based on consensus sequence homologies to reverse transcriptase coding sequences and unique oligonucleotides containing perfect homology to the coding sequences of human T-cell leukemia virus types I and II were both effective in amplifying reverse transcriptase-related DNA. It is shown that human DNA contains a wide spectrum of retrovirus-related reverse transcriptase coding sequences, including some that are clearly related to human T-cell leukemia virus types I and II, some that are related to the L-1 family of long interspersed nucleotide sequences, and others that are related to previously described human endogenous proviral DNAs. In addition, human T-cell leukemia virus type I-related sequences appear to be transcribed in both normal human T cells and in a cell line derived from a human teratocarcinoma

  2. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases.

    Science.gov (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C; Nottingham, Ryan M; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. © 2015 Qin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  3. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  4. Authentic reverse transcriptase is coded by jockey, a mobile Drosophila element related to mammalian LINEs.

    Science.gov (United States)

    Ivanov, V A; Melnikov, A A; Siunov, A V; Fodor, I I; Ilyin, Y V

    1991-01-01

    The mobile element jockey is similar in structural organization and coding potential to the LINEs of various organisms. It is transcribed at different stages of Drosophila ontogenesis. The Drosophila LINE family includes active transposable elements. Current models for the mechanism of transposition involve reverse transcription of an RNA intermediate and utilization of element-encoded proteins. As demonstrated here, a 2.23 kb DNA fragment from the region of jockey encoding the putative reverse transcriptase was stably introduced into an expression system under inducible control of the Escherichia coli lac regulatory elements. We describe the expression of the 92 kDa protein and identify this polypeptide alone as the authentic jockey reverse transcriptase based on some of its physical and enzymic properties. The jockey polymerase demonstrates RNA and DNA-directed DNA polymerase activities but lacks detectable RNase H, has a temperature optimum at 26 degrees C, requires Mg2+ or Mn2+ as a cofactor and is inactivated by sulphydryl reagent. The enzyme prefers poly(rC) and poly(rA) as template and 'activated' DNA is not effective. Images PMID:1714378

  5. Some Algebraic Aspects of Morse Code Sequences

    OpenAIRE

    Cigler, Johann

    2003-01-01

    International audience; Morse code sequences are very useful to give combinatorial interpretations of various properties of Fibonacci numbers. In this note we study some algebraic and combinatorial aspects of Morse code sequences and obtain several q-analogues of Fibonacci numbers and Fibonacci polynomials and their generalizations.

  6. Nonspatial Sequence Coding in CA1 Neurons.

    Science.gov (United States)

    Allen, Timothy A; Salz, Daniel M; McKenzie, Sam; Fortin, Norbert J

    2016-02-03

    The hippocampus is critical to the memory for sequences of events, a defining feature of episodic memory. However, the fundamental neuronal mechanisms underlying this capacity remain elusive. While considerable research indicates hippocampal neurons can represent sequences of locations, direct evidence of coding for the memory of sequential relationships among nonspatial events remains lacking. To address this important issue, we recorded neural activity in CA1 as rats performed a hippocampus-dependent sequence-memory task. Briefly, the task involves the presentation of repeated sequences of odors at a single port and requires rats to identify each item as "in sequence" or "out of sequence". We report that, while the animals' location and behavior remained constant, hippocampal activity differed depending on the temporal context of items-in this case, whether they were presented in or out of sequence. Some neurons showed this effect across items or sequence positions (general sequence cells), while others exhibited selectivity for specific conjunctions of item and sequence position information (conjunctive sequence cells) or for specific probe types (probe-specific sequence cells). We also found that the temporal context of individual trials could be accurately decoded from the activity of neuronal ensembles, that sequence coding at the single-cell and ensemble level was linked to sequence memory performance, and that slow-gamma oscillations (20-40 Hz) were more strongly modulated by temporal context and performance than theta oscillations (4-12 Hz). These findings provide compelling evidence that sequence coding extends beyond the domain of spatial trajectories and is thus a fundamental function of the hippocampus. The ability to remember the order of life events depends on the hippocampus, but the underlying neural mechanisms remain poorly understood. Here we addressed this issue by recording neural activity in hippocampal region CA1 while rats performed a

  7. Hierarchical morphological segmentation for image sequence coding.

    Science.gov (United States)

    Salembier, P; Pardas, M

    1994-01-01

    This paper deals with a hierarchical morphological segmentation algorithm for image sequence coding. Mathematical morphology is very attractive for this purpose because it efficiently deals with geometrical features such as size, shape, contrast, or connectivity that can be considered as segmentation-oriented features. The algorithm follows a top-down procedure. It first takes into account the global information and produces a coarse segmentation, that is, with a small number of regions. Then, the segmentation quality is improved by introducing regions corresponding to more local information. The algorithm, considering sequences as being functions on a 3-D space, directly segments 3-D regions. A 3-D approach is used to get a segmentation that is stable in time and to directly solve the region correspondence problem. Each segmentation stage relies on four basic steps: simplification, marker extraction, decision, and quality estimation. The simplification removes information from the sequence to make it easier to segment. Morphological filters based on partial reconstruction are proven to be very efficient for this purpose, especially in the case of sequences. The marker extraction identifies the presence of homogeneous 3-D regions. It is based on constrained flat region labeling and morphological contrast extraction. The goal of the decision is to precisely locate the contours of regions detected by the marker extraction. This decision is performed by a modified watershed algorithm. Finally, the quality estimation concentrates on the coding residue, all the information about the 3-D regions that have not been properly segmented and therefore coded. The procedure allows the introduction of the texture and contour coding schemes within the segmentation algorithm. The coding residue is transmitted to the next segmentation stage to improve the segmentation and coding quality. Finally, segmentation and coding examples are presented to show the validity and interest of

  8. Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

    Energy Technology Data Exchange (ETDEWEB)

    Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

    2007-02-21

    Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

  9. Novel overlapping coding sequences in Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Jensen, Klaus Thorleif; Petersen, Lise; Falk, Søren

    2006-01-01

    Chlamydia trachomatis is the aetiological agent of trachoma and sexually transmitted infections. The C. trachomatis genome sequence revealed an organism adapted to the intracellular habitat with a high coding ratio and a small genome consisting of 1.042-kilobase (kb) with 895 annotated protein...... of the novel genes in C. trachomatis Serovar A and Chlamydia muridarum. Several of the genes have typical gene-like and protein-like features. Furthermore, we confirm transcriptional activity from 10 of the putative genes. The combined evidence suggests that at least seven of the 15 are protein coding genes...

  10. Hierarchical morphological segmentation for image sequence coding

    OpenAIRE

    Salembier Clairon, Philippe Jean; Pardàs Feliu, Montse

    1994-01-01

    This paper deals with a hierarchical morphological segmentation algorithm for image sequence coding. Mathematical morphology is very attractive for this purpose because it efficiently deals with geometrical features such as size, shape, contrast, or connectivity that can be considered as segmentation-oriented features. The algorithm follows a top-down procedure. It first takes into account the global information and produces a coarse segmentation, that is, with a small number of regions. Then...

  11. Distinctive Drug-resistant Mutation Profiles and Interpretations of HIV-1 Proviral DNA Revealed by Deep Sequencing in Reverse Transcriptase.

    Science.gov (United States)

    Yin, Qian Qian; Li, Zhen Peng; Zhao, Hai; Pan, Dong; Wang, Yan; Xu, Wei Si; Xing, Hui; Feng, Yi; Jiang, Shi Bo; Shao, Yi Ming; Ma, Li Ying

    2016-04-01

    To investigate distinctive features in drug-resistant mutations (DRMs) and interpretations for reverse transcriptase inhibitors (RTIs) between proviral DNA and paired viral RNA in HIV-1-infected patients. Forty-three HIV-1-infected individuals receiving first-line antiretroviral therapy were recruited to participate in a multicenter AIDS Cohort Study in Anhui and Henan Provinces in China in 2004. Drug resistance genotyping was performed by bulk sequencing and deep sequencing on the plasma and whole blood of 77 samples, respectively. Drug-resistance interpretation was compared between viral RNA and paired proviral DNA. Compared with bulk sequencing, deep sequencing could detect more DRMs and samples with DRMs in both viral RNA and proviral DNA. The mutations M184I and M230I were more prevalent in proviral DNA than in viral RNA (Fisher's exact test, PDNA, and 5 of these samples with different DRMs between proviral DNA and paired viral RNA showed a higher level of drug resistance to the first-line drugs. Considering 'minority resistant variants', 22 samples (28.57%) were associated with a higher level of drug resistance to the tested RTIs for proviral DNA when compared with paired viral RNA. Compared with viral RNA, the distinctive information of DRMs and drug resistance interpretations for proviral DNA could be obtained by deep sequencing, which could provide more detailed and precise information for drug resistance monitoring and the rational design of optimal antiretroviral therapy regimens. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  12. The mature reverse transcriptase molecules in virions of mouse mammary tumor virus possess protease-derived sequences

    International Nuclear Information System (INIS)

    Entin-Meer, Michal; Avidan, Orna; Hizi, Amnon

    2003-01-01

    Our efforts to express in bacteria the enzymatically active reverse transcriptase (RT) of mouse mammary tumor virus (MMTV) have shown that the RT is active only after adding 27 amino acid residues, which are derived from the end of the pro gene, to the amino-terminus of the RT (Biochem, J. (1998) 329, 579-587). In the present study we have tested whether the mature RT found in virions is also fused to protease-derived sequences. To this end, we have analyzed the RT molecules in virions of MMTV by using two antisera directed against peptides, derived from either the carboxyl-terminus of MMTV protease or the middle of MMTV RT. The data suggest that the mature RT, located in virions, contains at its amino-terminus sequences from the carboxyl-terminus of the protease protein. This finding supports previous suggestions that MMTV RT is a transframe protein (derived from both pro and pol reading frames of MMTV) and that amino acid residues located at the carboxyl-terminus of the protease have a dual usage as integral parts of both the protease and the RT enzymes

  13. Random Coding Bounds for DNA Codes Based on Fibonacci Ensembles of DNA Sequences

    Science.gov (United States)

    2008-07-01

    Highway, Suite 1204, Arlington, VA 22202-4302, and to the Office of Management and Budget, Paperwork Reduction Project (0704-0188) Washington, DC...COVERED (From - To) 6 Jul 08 – 11 Jul 08 4. TITLE AND SUBTITLE RANDOM CODING BOUNDS FOR DNA CODES BASED ON FIBONACCI ENSEMBLES OF DNA SEQUENCES...sequences which are generalizations of the Fibonacci sequences. 15. SUBJECT TERMS DNA Codes, Fibonacci Ensembles, DNA Computing, Code Optimization 16

  14. Orpinomyces cellulase celf protein and coding sequences

    Science.gov (United States)

    Li, Xin-Liang; Chen, Huizhong; Ljungdahl, Lars G.

    2000-09-05

    A cDNA (1,520 bp), designated celF, consisting of an open reading frame (ORF) encoding a polypeptide (CelF) of 432 amino acids was isolated from a cDNA library of the anaerobic rumen fungus Orpinomyces PC-2 constructed in Escherichia coli. Analysis of the deduced amino acid sequence showed that starting from the N-terminus, CelF consists of a signal peptide, a cellulose binding domain (CBD) followed by an extremely Asn-rich linker region which separate the CBD and the catalytic domains. The latter is located at the C-terminus. The catalytic domain of CelF is highly homologous to CelA and CelC of Orpinomyces PC-2, to CelA of Neocallimastix patriciarum and also to cellobiohydrolase IIs (CBHIIs) from aerobic fungi. However, Like CelA of Neocallimastix patriciarum, CelF does not have the noncatalytic repeated peptide domain (NCRPD) found in CelA and CelC from the same organism. The recombinant protein CelF hydrolyzes cellooligosaccharides in the pattern of CBHII, yielding only cellobiose as product with cellotetraose as the substrate. The genomic celF is interrupted by a 111 bp intron, located within the region coding for the CBD. The intron of the celF has features in common with genes from aerobic filamentous fungi.

  15. ARC Code TI: sequenceMiner

    Data.gov (United States)

    National Aeronautics and Space Administration — The sequenceMiner was developed to address the problem of detecting and describing anomalies in large sets of high-dimensional symbol sequences. sequenceMiner works...

  16. Purifying selection acts on coding and non-coding sequences of paralogous genes in Arabidopsis thaliana.

    Science.gov (United States)

    Hoffmann, Robert D; Palmgren, Michael

    2016-06-13

    Whole-genome duplications in the ancestors of many diverse species provided the genetic material for evolutionary novelty. Several models explain the retention of paralogous genes. However, how these models are reflected in the evolution of coding and non-coding sequences of paralogous genes is unknown. Here, we analyzed the coding and non-coding sequences of paralogous genes in Arabidopsis thaliana and compared these sequences with those of orthologous genes in Arabidopsis lyrata. Paralogs with lower expression than their duplicate had more nonsynonymous substitutions, were more likely to fractionate, and exhibited less similar expression patterns with their orthologs in the other species. Also, lower-expressed genes had greater tissue specificity. Orthologous conserved non-coding sequences in the promoters, introns, and 3' untranslated regions were less abundant at lower-expressed genes compared to their higher-expressed paralogs. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to ribosomes, whereas paralogs with different expression levels were enriched in terms associated with stress responses. Loss of conserved non-coding sequences in one gene of a paralogous gene pair correlates with reduced expression levels that are more tissue specific. Together with increased mutation rates in the coding sequences, this suggests that similar forces of purifying selection act on coding and non-coding sequences. We propose that coding and non-coding sequences evolve concurrently following gene duplication.

  17. Some Algebraic Aspects of MorseCode Sequences

    Directory of Open Access Journals (Sweden)

    Johann Cigler

    2003-06-01

    Full Text Available Morse code sequences are very useful to give combinatorial interpretations of various properties of Fibonacci numbers. In this note we study some algebraic and combinatorial aspects of Morse code sequences and obtain several q-analogues of Fibonacci numbers and Fibonacci polynomials and their generalizations.

  18. Some Algebraic Aspects of MorseCode Sequences

    OpenAIRE

    Johann Cigler

    2003-01-01

    Morse code sequences are very useful to give combinatorial interpretations of various properties of Fibonacci numbers. In this note we study some algebraic and combinatorial aspects of Morse code sequences and obtain several q-analogues of Fibonacci numbers and Fibonacci polynomials and their generalizations.

  19. Sequence Variations in the Non-Coding Sequence of CTX Phages in Vibrio cholerae.

    Science.gov (United States)

    Kim, Eun Jin; Yu, Hyun Jin; Kim, Dong Wook

    2016-08-28

    This study focused on the variations in the non-coding sequences between ctxB and rstR of various CTX phages. The non-coding sequences of CTX-1 and CTX-cla are phage type-specific. The length of the non-coding region of CTX-1 and CTX-cla is 601 and 730 nucleotides, respectively. The non-coding sequence of CTX phage could be divided into three regions. There is a phage type-specific Variable region between two homologous Common regions (Common regions 1 and 2). The non-coding sequence of RS1 element is similar to CTX-1 except that Common region 1 is replaced by a short RS1-specific sequence. The non-coding sequences of CTX-2 and CTX-cla are homologous, indicating the non-coding sequence of CTX-2 is derived from CTX-cla. The non-coding region of CTX-O139 is similar to CTX-cla and CTX-2; however, it contains an extra phage type-specific sequence between Common region 2 and rstR. The variations in the non-coding sequences of CTX phages might be associated with the difference in the replication efficiency and the directionality in the integration into the V. cholerae chromosome.

  20. Genetic Code Analysis Toolkit: A novel tool to explore the coding properties of the genetic code and DNA sequences

    Science.gov (United States)

    Kraljić, K.; Strüngmann, L.; Fimmel, E.; Gumbel, M.

    2018-01-01

    The genetic code is degenerated and it is assumed that redundancy provides error detection and correction mechanisms in the translation process. However, the biological meaning of the code's structure is still under current research. This paper presents a Genetic Code Analysis Toolkit (GCAT) which provides workflows and algorithms for the analysis of the structure of nucleotide sequences. In particular, sets or sequences of codons can be transformed and tested for circularity, comma-freeness, dichotomic partitions and others. GCAT comes with a fertile editor custom-built to work with the genetic code and a batch mode for multi-sequence processing. With the ability to read FASTA files or load sequences from GenBank, the tool can be used for the mathematical and statistical analysis of existing sequence data. GCAT is Java-based and provides a plug-in concept for extensibility. Availability: Open source Homepage:http://www.gcat.bio/

  1. Deep sequencing analysis of HIV-1 reverse transcriptase at baseline and time of failure in patients receiving rilpivirine in the phase III studies ECHO and THRIVE.

    Science.gov (United States)

    Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan

    2016-05-01

    Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.

  2. The impact of the nucleosome code on protein-coding sequence evolution in yeast.

    Directory of Open Access Journals (Sweden)

    Tobias Warnecke

    2008-11-01

    Full Text Available Coding sequence evolution was once thought to be the result of selection on optimal protein function alone. Selection can, however, also act at the RNA level, for example, to facilitate rapid translation or ensure correct splicing. Here, we ask whether the way DNA works also imposes constraints on coding sequence evolution. We identify nucleosome positioning as a likely candidate to set up such a DNA-level selective regime and use high-resolution microarray data in yeast to compare the evolution of coding sequence bound to or free from nucleosomes. Controlling for gene expression and intra-gene location, we find a nucleosome-free "linker" sequence to evolve on average 5-6% slower at synonymous sites. A reduced rate of evolution in linker is especially evident at the 5' end of genes, where the effect extends to non-synonymous substitution rates. This is consistent with regular nucleosome architecture in this region being important in the context of gene expression control. As predicted, codons likely to generate a sequence unfavourable to nucleosome formation are enriched in linker sequence. Amino acid content is likewise skewed as a function of nucleosome occupancy. We conclude that selection operating on DNA to maintain correct positioning of nucleosomes impacts codon choice, amino acid choice, and synonymous and non-synonymous rates of evolution in coding sequence. The results support the exclusion model for nucleosome positioning and provide an alternative interpretation for runs of rare codons. As the intimate association of histones and DNA is a universal characteristic of genic sequence in eukaryotes, selection on coding sequence composition imposed by nucleosome positioning should be phylogenetically widespread.

  3. DNA watermarks in non-coding regulatory sequences

    Directory of Open Access Journals (Sweden)

    Pyka Martin

    2009-07-01

    Full Text Available Abstract Background DNA watermarks can be applied to identify the unauthorized use of genetically modified organisms. It has been shown that coding regions can be used to encrypt information into living organisms by using the DNA-Crypt algorithm. Yet, if the sequence of interest presents a non-coding DNA sequence, either the function of a resulting functional RNA molecule or a regulatory sequence, such as a promoter, could be affected. For our studies we used the small cytoplasmic RNA 1 in yeast and the lac promoter region of Escherichia coli. Findings The lac promoter was deactivated by the integrated watermark. In addition, the RNA molecules displayed altered configurations after introducing a watermark, but surprisingly were functionally intact, which has been verified by analyzing the growth characteristics of both wild type and watermarked scR1 transformed yeast cells. In a third approach we introduced a second overlapping watermark into the lac promoter, which did not affect the promoter activity. Conclusion Even though the watermarked RNA and one of the watermarked promoters did not show any significant differences compared to the wild type RNA and wild type promoter region, respectively, it cannot be generalized that other RNA molecules or regulatory sequences behave accordingly. Therefore, we do not recommend integrating watermark sequences into regulatory regions.

  4. Satisfiability, sequence niches and molecular codes in cellular signalling.

    Science.gov (United States)

    Myers, C R

    2008-09-01

    Biological information processing as implemented by regulatory and signalling networks in living cells requires sufficient specificity of molecular interaction to distinguish signals from one another, but much of regulation and signalling involves somewhat fuzzy and promiscuous recognition of molecular sequences and structures, which can leave systems vulnerable to crosstalk. A simple model of biomolecular interactions that reveals both a sharp onset of crosstalk and a fragmentation of the neutral network of viable solutions is examined as more proteins compete for regions of sequence space, revealing intrinsic limits to reliable signalling in the face of promiscuity. These results suggest connections to both phase transitions in constraint satisfaction problems and coding theory bounds on the size of communication codes.

  5. Sensitive Deep-Sequencing-Based HIV-1 Genotyping Assay To Simultaneously Determine Susceptibility to Protease, Reverse Transcriptase, Integrase, and Maturation Inhibitors, as Well as HIV-1 Coreceptor Tropism

    Science.gov (United States)

    Gibson, Richard M.; Meyer, Ashley M.; Winner, Dane; Archer, John; Feyertag, Felix; Ruiz-Mateos, Ezequiel; Leal, Manuel; Robertson, David L.; Schmotzer, Christine L.

    2014-01-01

    With 29 individual antiretroviral drugs available from six classes that are approved for the treatment of HIV-1 infection, a combination of different phenotypic and genotypic tests is currently needed to monitor HIV-infected individuals. In this study, we developed a novel HIV-1 genotypic assay based on deep sequencing (DeepGen HIV) to simultaneously assess HIV-1 susceptibilities to all drugs targeting the three viral enzymes and to predict HIV-1 coreceptor tropism. Patient-derived gag-p2/NCp7/p1/p6/pol-PR/RT/IN- and env-C2V3 PCR products were sequenced using the Ion Torrent Personal Genome Machine. Reads spanning the 3′ end of the Gag, protease (PR), reverse transcriptase (RT), integrase (IN), and V3 regions were extracted, truncated, translated, and assembled for genotype and HIV-1 coreceptor tropism determination. DeepGen HIV consistently detected both minority drug-resistant viruses and non-R5 HIV-1 variants from clinical specimens with viral loads of ≥1,000 copies/ml and from B and non-B subtypes. Additional mutations associated with resistance to PR, RT, and IN inhibitors, previously undetected by standard (Sanger) population sequencing, were reliably identified at frequencies as low as 1%. DeepGen HIV results correlated with phenotypic (original Trofile, 92%; enhanced-sensitivity Trofile assay [ESTA], 80%; TROCAI, 81%; and VeriTrop, 80%) and genotypic (population sequencing/Geno2Pheno with a 10% false-positive rate [FPR], 84%) HIV-1 tropism test results. DeepGen HIV (83%) and Trofile (85%) showed similar concordances with the clinical response following an 8-day course of maraviroc monotherapy (MCT). In summary, this novel all-inclusive HIV-1 genotypic and coreceptor tropism assay, based on deep sequencing of the PR, RT, IN, and V3 regions, permits simultaneous multiplex detection of low-level drug-resistant and/or non-R5 viruses in up to 96 clinical samples. This comprehensive test, the first of its class, will be instrumental in the development of new

  6. Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing

    Science.gov (United States)

    Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R.; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M.

    2013-01-01

    Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility (“retrohoming”) by a process that requires reverse transcription of a highly structured, 2–2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3′ ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications. PMID:23697550

  7. Sequence Coding and Search System for licensee event reports: code listings. Volume 2

    International Nuclear Information System (INIS)

    Gallaher, R.B.; Guymon, R.H.; Mays, G.T.; Poore, W.P.; Cagle, R.J.; Harrington, K.H.; Johnson, M.P.

    1985-04-01

    Operating experience data from nuclear power plants are essential for safety and reliability analyses, especially analyses of trends and patterns. The licensee event reports (LERs) that are submitted to the Nuclear Regulatory Commission (NRC) by the nuclear power plant utilities contain much of this data. The NRC's Office for Analysis and Evaluation of Operational Data (AEOD) has developed, under contract with NSIC, a system for codifying the events reported in the LERs. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the LERs to coded sequences that are both computer-readable and computer-searchable. This system provides a structured format for detailed coding of component, system, and unit effects as well as personnel errors. The database contains all current LERs submitted by nuclear power plant utilities for events occurring since 1981 and is updated on a continual basis. Volume 2 contains all valid and acceptable codes used for searching and encoding the LER data. This volume contains updated material through amendment 1 to revision 1 of the working version of ORNL/NSIC-223, Vol. 2

  8. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    Science.gov (United States)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  9. Optimal coding of vectorcardiographic sequences using spatial prediction.

    Science.gov (United States)

    Augustyniak, Piotr

    2007-05-01

    This paper discusses principles, implementation details, and advantages of sequence coding algorithm applied to the compression of vectocardiograms (VCG). The main novelty of the proposed method is the automatic management of distortion distribution controlled by the local signal contents in both technical and medical aspects. As in clinical practice, the VCG loops representing P, QRS, and T waves in the three-dimensional (3-D) space are considered here as three simultaneous sequences of objects. Because of the similarity of neighboring loops, encoding the values of prediction error significantly reduces the data set volume. The residual values are de-correlated with the discrete cosine transform (DCT) and truncated at certain energy threshold. The presented method is based on the irregular temporal distribution of medical data in the signal and takes advantage of variable sampling frequency for automatically detected VCG loops. The features of the proposed algorithm are confirmed by the results of the numerical experiment carried out for a wide range of real records. The average data reduction ratio reaches a value of 8.15 while the percent root-mean-square difference (PRD) distortion ratio for the most important sections of signal does not exceed 1.1%.

  10. Telomerase reverse transcriptase promoter mutations in bladder cancer

    DEFF Research Database (Denmark)

    Allory, Yves; Beukers, Willemien; Sagrera, Ana

    2014-01-01

    BACKGROUND: Hotspot mutations in the promoter of the gene coding for telomerase reverse transcriptase (TERT) have been described and proposed to activate gene expression. OBJECTIVES: To investigate TERT mutation frequency, spectrum, association with expression and clinical outcome, and potential ...

  11. MPEC-4 Based Intelligent Coding for Plume Video Sequences

    National Research Council Canada - National Science Library

    Park, Gean

    1999-01-01

    .... Among those technologies, MPEG-4 codec can multiplex a set of independently coded, arbitrarily shaped video objects and transmit it through either fixed or variable rate channels such as internet...

  12. Non-coding sequence retrieval system for comparative genomic analysis of gene regulatory elements

    Directory of Open Access Journals (Sweden)

    Temple Matthew H

    2007-03-01

    Full Text Available Abstract Background Completion of the human genome sequence along with other species allows for greater understanding of the biochemical mechanisms and processes that govern healthy as well as diseased states. The large size of the genome sequences has made them difficult to study using traditional methods. There are many studies focusing on the protein coding sequences, however, not much is known about the function of non-coding regions of the genome. It has been demonstrated that parts of the non-coding region play a critical role as gene regulatory elements. Enhancers that regulate transcription processes have been found in intergenic regions. Furthermore, it is observed that regulatory elements found in non-coding regions are highly conserved across different species. However, the analysis of these regulatory elements is not as straightforward as it may first seem. The development of a centralized resource that allows for the quick and easy retrieval of non-coding sequences from multiple species and is capable of handing multi-gene queries is critical for the analysis of non-coding sequences. Here we describe the development of a web-based non-coding sequence retrieval system. Results This paper presents a Non-Coding Sequences Retrieval System (NCSRS. The NCSRS is a web-based bioinformatics tool that performs fast and convenient retrieval of non-coding and coding sequences from multiple species related to a specific gene or set of genes. This tool has compiled resources from multiple sources into one easy to use and convenient web based interface. With no software installation necessary, the user needs only internet access to use this tool. Conclusion The unique features of this tool will be very helpful for those studying gene regulatory elements that exist in non-coding regions. The web based application can be accessed on the internet at: http://cell.rutgers.edu/ncsrs/.

  13. Rfam: annotating families of non-coding RNA sequences.

    Science.gov (United States)

    Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W

    2015-01-01

    The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

  14. Immune pressure analysis of protease and reverse transcriptase ...

    African Journals Online (AJOL)

    /dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...

  15. Locating protein-coding sequences under selection for additional, overlapping functions in 29 mammalian genomes

    DEFF Research Database (Denmark)

    Lin, Michael F; Kheradpour, Pouya; Washietl, Stefan

    2011-01-01

    synonymous constraint in these regions reflects selection on overlapping functional elements including splicing regulatory elements, dual-coding genes, RNA secondary structures, microRNA target sites, and developmental enhancers. Our results show that overlapping functional elements are common in mammalian......The degeneracy of the genetic code allows protein-coding DNA and RNA sequences to simultaneously encode additional, overlapping functional elements. A sequence in which both protein-coding and additional overlapping functions have evolved under purifying selection should show increased evolutionary...

  16. RNA-DNA sequence differences spell genetic code ambiguities

    DEFF Research Database (Denmark)

    Bentin, Thomas; Nielsen, Michael L

    2013-01-01

    A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...

  17. Recurrent Coding Sequence Variation Explains Only A Small Fraction of the Genetic Architecture of Colorectal Cancer

    NARCIS (Netherlands)

    Timofeeva, Maria N.; Ben Kinnersley, [Unknown; Farrington, Susan M.; Whiffin, Nicola; Palles, Claire; Svinti, Victoria; Lloyd, Amy; Gorman, Maggie; Ooi, Li-Yin; Hosking, Fay; Barclay, Ella; Zgaga, Lina; Dobbins, Sara; Martin, Lynn; Theodoratou, Evropi; Broderick, Peter; Tenesa, Albert; Smillie, Claire; Grimes, Graeme; Hayward, Caroline; Campbell, Archie; Porteous, David; Deary, Ian J.; Harris, Sarah E.; Northwood, Emma L.; Barrett, Jennifer H.; Smith, Gillian; Wolf, Roland; Forman, David; Morreau, Hans; Ruano, Dina; Tops, Carli; Wijnen, Juul; Schrumpf, Melanie; Boot, Arnoud; Vasen, Hans F. A.; Hes, Frederik J.; van Wezel, Tom; Franke, Andre; Lieb, Wolgang; Schafmayer, Clemens; Hampe, Jochen; Buch, Stephan; Propping, Peter; Hemminki, Kari; Foersti, Asta; Westers, Helga; Hofstra, Robert; Pinheiro, Manuela; Pinto, Carla; Teixeira, Manuel; Ruiz-Ponte, Clara; Fernandez-Rozadilla, Ceres; Carracedo, Angel; Castells, Antoni; Castellvi-Bel, Sergi; Campbell, Harry; Bishop, D. Timothy; Tomlinson, Ian P. M.; Dunlop, Malcolm G.; Houlston, Richard S.

    2015-01-01

    Whilst common genetic variation in many non-coding genomic regulatory regions are known to impart risk of colorectal cancer (CRC), much of the heritability of CRC remains unexplained. To examine the role of recurrent coding sequence variation in CRC aetiology, we genotyped 12,638 CRCs cases and

  18. SEAPATH: A microcomputer code for evaluating physical security effectiveness using adversary sequence diagrams

    International Nuclear Information System (INIS)

    Darby, J.L.

    1986-01-01

    The Adversary Sequence Diagram (ASD) concept was developed by Sandia National Laboratories (SNL) to examine physical security system effectiveness. Sandia also developed a mainframe computer code, PANL, to analyze the ASD. The authors have developed a microcomputer code, SEAPATH, which also analyzes ASD's. The Authors are supporting SNL in software development of the SAVI code; SAVI utilizes the SEAPATH algorithm to identify and quantify paths

  19. Depletion of Shine-Dalgarno Sequences Within Bacterial Coding Regions Is Expression Dependent

    Science.gov (United States)

    Yang, Chuyue; Hockenberry, Adam J.; Jewett, Michael C.; Amaral, Luís A. N.

    2016-01-01

    Efficient and accurate protein synthesis is crucial for organismal survival in competitive environments. Translation efficiency (the number of proteins translated from a single mRNA in a given time period) is the combined result of differential translation initiation, elongation, and termination rates. Previous research identified the Shine-Dalgarno (SD) sequence as a modulator of translation initiation in bacterial genes, while codon usage biases are frequently implicated as a primary determinant of elongation rate variation. Recent studies have suggested that SD sequences within coding sequences may negatively affect translation elongation speed, but this claim remains controversial. Here, we present a metric to quantify the prevalence of SD sequences in coding regions. We analyze hundreds of bacterial genomes and find that the coding sequences of highly expressed genes systematically contain fewer SD sequences than expected, yielding a robust correlation between the normalized occurrence of SD sites and protein abundances across a range of bacterial taxa. We further show that depletion of SD sequences within ribosomal protein genes is correlated with organismal growth rates, supporting the hypothesis of strong selection against the presence of these sequences in coding regions and suggesting their association with translation efficiency in bacteria. PMID:27605518

  20. Depletion of Shine-Dalgarno Sequences Within Bacterial Coding Regions Is Expression Dependent

    Directory of Open Access Journals (Sweden)

    Chuyue Yang

    2016-11-01

    Full Text Available Efficient and accurate protein synthesis is crucial for organismal survival in competitive environments. Translation efficiency (the number of proteins translated from a single mRNA in a given time period is the combined result of differential translation initiation, elongation, and termination rates. Previous research identified the Shine-Dalgarno (SD sequence as a modulator of translation initiation in bacterial genes, while codon usage biases are frequently implicated as a primary determinant of elongation rate variation. Recent studies have suggested that SD sequences within coding sequences may negatively affect translation elongation speed, but this claim remains controversial. Here, we present a metric to quantify the prevalence of SD sequences in coding regions. We analyze hundreds of bacterial genomes and find that the coding sequences of highly expressed genes systematically contain fewer SD sequences than expected, yielding a robust correlation between the normalized occurrence of SD sites and protein abundances across a range of bacterial taxa. We further show that depletion of SD sequences within ribosomal protein genes is correlated with organismal growth rates, supporting the hypothesis of strong selection against the presence of these sequences in coding regions and suggesting their association with translation efficiency in bacteria.

  1. Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing.

    Science.gov (United States)

    Kanda, Kojun; Pflug, James M; Sproul, John S; Dasenko, Mark A; Maddison, David R

    2015-01-01

    In this paper we explore high-throughput Illumina sequencing of nuclear protein-coding, ribosomal, and mitochondrial genes in small, dried insects stored in natural history collections. We sequenced one tenebrionid beetle and 12 carabid beetles ranging in size from 3.7 to 9.7 mm in length that have been stored in various museums for 4 to 84 years. Although we chose a number of old, small specimens for which we expected low sequence recovery, we successfully recovered at least some low-copy nuclear protein-coding genes from all specimens. For example, in one 56-year-old beetle, 4.4 mm in length, our de novo assembly recovered about 63% of approximately 41,900 nucleotides in a target suite of 67 nuclear protein-coding gene fragments, and 70% using a reference-based assembly. Even in the least successfully sequenced carabid specimen, reference-based assembly yielded fragments that were at least 50% of the target length for 34 of 67 nuclear protein-coding gene fragments. Exploration of alternative references for reference-based assembly revealed few signs of bias created by the reference. For all specimens we recovered almost complete copies of ribosomal and mitochondrial genes. We verified the general accuracy of the sequences through comparisons with sequences obtained from PCR and Sanger sequencing, including of conspecific, fresh specimens, and through phylogenetic analysis that tested the placement of sequences in predicted regions. A few possible inaccuracies in the sequences were detected, but these rarely affected the phylogenetic placement of the samples. Although our sample sizes are low, an exploratory regression study suggests that the dominant factor in predicting success at recovering nuclear protein-coding genes is a high number of Illumina reads, with success at PCR of COI and killing by immersion in ethanol being secondary factors; in analyses of only high-read samples, the primary significant explanatory variable was body length, with small beetles

  2. Highly conserved non-coding sequences are associated with vertebrate development.

    Directory of Open Access Journals (Sweden)

    Adam Woolfe

    2005-01-01

    Full Text Available In addition to protein coding sequence, the human genome contains a significant amount of regulatory DNA, the identification of which is proving somewhat recalcitrant to both in silico and functional methods. An approach that has been used with some success is comparative sequence analysis, whereby equivalent genomic regions from different organisms are compared in order to identify both similarities and differences. In general, similarities in sequence between highly divergent organisms imply functional constraint. We have used a whole-genome comparison between humans and the pufferfish, Fugu rubripes, to identify nearly 1,400 highly conserved non-coding sequences. Given the evolutionary divergence between these species, it is likely that these sequences are found in, and furthermore are essential to, all vertebrates. Most, and possibly all, of these sequences are located in and around genes that act as developmental regulators. Some of these sequences are over 90% identical across more than 500 bases, being more highly conserved than coding sequence between these two species. Despite this, we cannot find any similar sequences in invertebrate genomes. In order to begin to functionally test this set of sequences, we have used a rapid in vivo assay system using zebrafish embryos that allows tissue-specific enhancer activity to be identified. Functional data is presented for highly conserved non-coding sequences associated with four unrelated developmental regulators (SOX21, PAX6, HLXB9, and SHH, in order to demonstrate the suitability of this screen to a wide range of genes and expression patterns. Of 25 sequence elements tested around these four genes, 23 show significant enhancer activity in one or more tissues. We have identified a set of non-coding sequences that are highly conserved throughout vertebrates. They are found in clusters across the human genome, principally around genes that are implicated in the regulation of development

  3. SRComp: short read sequence compression using burstsort and Elias omega coding.

    Directory of Open Access Journals (Sweden)

    Jeremy John Selva

    Full Text Available Next-generation sequencing (NGS technologies permit the rapid production of vast amounts of data at low cost. Economical data storage and transmission hence becomes an increasingly important challenge for NGS experiments. In this paper, we introduce a new non-reference based read sequence compression tool called SRComp. It works by first employing a fast string-sorting algorithm called burstsort to sort read sequences in lexicographical order and then Elias omega-based integer coding to encode the sorted read sequences. SRComp has been benchmarked on four large NGS datasets, where experimental results show that it can run 5-35 times faster than current state-of-the-art read sequence compression tools such as BEETL and SCALCE, while retaining comparable compression efficiency for large collections of short read sequences. SRComp is a read sequence compression tool that is particularly valuable in certain applications where compression time is of major concern.

  4. Development and Characterization of a Highly Specific and Sensitive SYBR Green Reverse Transcriptase PCR Assay for Detection of the 2009 Pandemic H1N1 Influenza Virus on the Basis of Sequence Signatures▿ †

    Science.gov (United States)

    Medina, Rafael A.; Rojas, Mark; Tuin, Astrid; Huff, Stephen; Ferres, Marcela; Martinez-Valdebenito, Constanza; Godoy, Paula; García-Sastre, Adolfo; Fofanov, Yuriy; SantaLucia, John

    2011-01-01

    The emergence and rapid spread of the 2009 H1N1 pandemic influenza virus showed that many diagnostic tests were unsuitable for detecting the novel virus isolates. In most countries the probe-based TaqMan assay developed by the U.S. Centers for Disease Control and Prevention was used for diagnostic purposes. The substantial sequence data that became available during the course of the pandemic created the opportunity to utilize bioinformatics tools to evaluate the unique sequence properties of this virus for the development of diagnostic tests. We used a comprehensive computational approach to examine conserved 2009 H1N1 sequence signatures that are at least 20 nucleotides long and contain at least two mismatches compared to any other known H1N1 genome. We found that the hemagglutinin (HA) and neuraminidase (NA) genes contained sequence signatures that are highly conserved among 2009 H1N1 isolates. Based on the NA gene signatures, we used Visual-OMP to design primers with optimal hybridization affinity and we used ThermoBLAST to minimize amplification artifacts. This procedure resulted in a highly sensitive and discriminatory 2009 H1N1 detection assay. Importantly, we found that the primer set can be used reliably in both a conventional TaqMan and a SYBR green reverse transcriptase (RT)-PCR assay with no loss of specificity or sensitivity. We validated the diagnostic accuracy of the NA SYBR green assay with 125 clinical specimens obtained between May and August 2009 in Chile, and we showed diagnostic efficacy comparable to the CDC assay. Our approach highlights the use of systematic computational approaches to develop robust diagnostic tests during a viral pandemic. PMID:21084522

  5. Modelling of blackout sequence at Atucha-1 using the MARCH3 code

    International Nuclear Information System (INIS)

    Baron, J.; Bastianelli, B.

    1997-01-01

    This paper presents the modelling of a complete blackout at the Atucha-1 NPP as preliminary phase for a Level II safety probabilistic analysis. The MARCH3 code of the STCP (Source Term Code Package) is used, based on a plant model made in accordance with particularities of the plant design. The analysis covers all the severe accident phases. The results allow to view the time sequence of the events, and provide the basis for source term studies. (author). 6 refs., 2 figs

  6. Optical orthogonal code-division multiple-access system - Part 2: Multibits/sequence-period OOCDMA

    Science.gov (United States)

    Kwon, Hyuck M.

    1994-08-01

    In a recently proposed optical orthogonal code division multiple-access (OOCDMA) system, one bit of user's data is transmitted per sequence-period, and a threshold is employed for the final bit decision. In this paper, a system that can transmit multibits per sequence-period is introduced, and avalanche photodiode (APD) noise, thermal noise, and interference, are included. This system, derived by exploiting orthogonal properties of the OOCDMA code sequence and using a maximum search (instead of a threshold) in the final decision, is log(sub 2) F times higher in throughput, where F is sequence-period. For example, four orders of magnitude are better in bit error probability at - 56 dBW received laser power, with F = 1000 chips, 10 'marks' in a sequence, and 10 users of 30 Mb/s data rate for one-bit/sequence-period and 270 Mb/s data rate for multibits/sequence-period system. Furthermore, an exact analysis is performed for the log(sub 2)F bits/sequence-period system with a hard-limiter placed before the receiver, and its performance is compared to the performance without hard-limiter, for the chip-synchronous case. The improvement from using a hard-limiter is significant in the log(sub 2)F bits/sequence-period OCCDMA system.

  7. Development of 112 unique expressed sequence tags from chicken liver using an arbitrarily primed reserve transcriptase-polymerase chain reaction and single strand conformation gel purification method

    NARCIS (Netherlands)

    Carré, W.; Diot, C.; Fillon, V.; Crooijmans, R.P.M.A.; Lagarrique, S.; Morrisson, M.; Vignal, A.; Groenen, M.A.M.; Douai, M.

    2001-01-01

    In order to provide information on chicken genome expression, expressed sequence tags (ESTs) were developed from chicken liver RNAs using a method based on arbitrarily primed reverse transcription-polymerase chain reaction (RT-PCR) of total RNAs. The method is similar to differential display, using

  8. A lossless compression method for medical image sequences using JPEG-LS and interframe coding.

    Science.gov (United States)

    Miaou, Shaou-Gang; Ke, Fu-Sheng; Chen, Shu-Ching

    2009-09-01

    Hospitals and medical centers produce an enormous amount of digital medical images every day, especially in the form of image sequences, which requires considerable storage space. One solution could be the application of lossless compression. Among available methods, JPEG-LS has excellent coding performance. However, it only compresses a single picture with intracoding and does not utilize the interframe correlation among pictures. Therefore, this paper proposes a method that combines the JPEG-LS and an interframe coding with motion vectors to enhance the compression performance of using JPEG-LS alone. Since the interframe correlation between two adjacent images in a medical image sequence is usually not as high as that in a general video image sequence, the interframe coding is activated only when the interframe correlation is high enough. With six capsule endoscope image sequences under test, the proposed method achieves average compression gains of 13.3% and 26.3% over the methods of using JPEG-LS and JPEG2000 alone, respectively. Similarly, for an MRI image sequence, coding gains of 77.5% and 86.5% are correspondingly obtained.

  9. Severe accident source term characteristics for selected Peach Bottom sequences predicted by the MELCOR Code

    Energy Technology Data Exchange (ETDEWEB)

    Carbajo, J.J. [Oak Ridge National Lab., TN (United States)

    1993-09-01

    The purpose of this report is to compare in-containment source terms developed for NUREG-1159, which used the Source Term Code Package (STCP), with those generated by MELCOR to identify significant differences. For this comparison, two short-term depressurized station blackout sequences (with a dry cavity and with a flooded cavity) and a Loss-of-Coolant Accident (LOCA) concurrent with complete loss of the Emergency Core Cooling System (ECCS) were analyzed for the Peach Bottom Atomic Power Station (a BWR-4 with a Mark I containment). The results indicate that for the sequences analyzed, the two codes predict similar total in-containment release fractions for each of the element groups. However, the MELCOR/CORBH Package predicts significantly longer times for vessel failure and reduced energy of the released material for the station blackout sequences (when compared to the STCP results). MELCOR also calculated smaller releases into the environment than STCP for the station blackout sequences.

  10. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    KAUST Repository

    Zhang, Zhang

    2010-11-08

    Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

  11. Sigma: multiple alignment of weakly-conserved non-coding DNA sequence

    Directory of Open Access Journals (Sweden)

    Siddharthan Rahul

    2006-03-01

    Full Text Available Abstract Background Existing tools for multiple-sequence alignment focus on aligning protein sequence or protein-coding DNA sequence, and are often based on extensions to Needleman-Wunsch-like pairwise alignment methods. We introduce a new tool, Sigma, with a new algorithm and scoring scheme designed specifically for non-coding DNA sequence. This problem acquires importance with the increasing number of published sequences of closely-related species. In particular, studies of gene regulation seek to take advantage of comparative genomics, and recent algorithms for finding regulatory sites in phylogenetically-related intergenic sequence require alignment as a preprocessing step. Much can also be learned about evolution from intergenic DNA, which tends to evolve faster than coding DNA. Sigma uses a strategy of seeking the best possible gapless local alignments (a strategy earlier used by DiAlign, at each step making the best possible alignment consistent with existing alignments, and scores the significance of the alignment based on the lengths of the aligned fragments and a background model which may be supplied or estimated from an auxiliary file of intergenic DNA. Results Comparative tests of sigma with five earlier algorithms on synthetic data generated to mimic real data show excellent performance, with Sigma balancing high "sensitivity" (more bases aligned with effective filtering of "incorrect" alignments. With real data, while "correctness" can't be directly quantified for the alignment, running the PhyloGibbs motif finder on pre-aligned sequence suggests that Sigma's alignments are superior. Conclusion By taking into account the peculiarities of non-coding DNA, Sigma fills a gap in the toolbox of bioinformatics.

  12. Complete Coding Sequences of Three Toscana Virus Strains Isolated from Sandflies in France.

    Science.gov (United States)

    Baklouti, Amal; Leparc Goffard, Isabelle; Piorkowski, Geraldine; Coutard, Bruno; Papageorgiou, Nicolas; De Lamballerie, Xavier; Charrel, Rémi N

    2016-02-11

    Toscana virus (TOSV) is an arthropod-borne virus belonging to the sandfly fever Naples virus species within the genus Phlebovirus. We report here the complete coding sequences of three TOSV strains belonging to lineage B and isolated from sandflies trapped in the Southeast of France between 2009 and 2013. Copyright © 2016 Baklouti et al.

  13. Exome sequencing-driven discovery of coding polymorphisms associated with common metabolic phenotypes

    NARCIS (Netherlands)

    Albrechtsen, A.; Grarup, N.; Li, Y.; Sparso, T.; Tian, G.; Cao, H.; Jiang, T.; Kim, S.Y.; Korneliussen, T.; Li, Q.; Nie, C.; Wu, R.; Skotte, L.; Morris, A.P.; Ladenvall, C.; Cauchi, S.; Stancakova, A.; Andersen, G.; Astrup, A.; Banasik, K.; Bennett, A.J.; Bolund, L.; Charpentier, G.; Chen, Y.; Dekker, J.M.; Doney, A.S.F.; Dorkhan, M.; Forsen, T.; Frayling, T.M.; Groves, C.J.; Gui, Y; Hallmans, G.; Hattersley, A.T.; He, K.; Hitman, G.A.; Holmkvist, J.; Huang, S.; Jiang, H.; Jin, X.; Justesen, J.M.; Kristiansen, K.; Kuusisto, J.; Lajer, M.; Lantieri, O.; Li, W.; Liang, H.; Liao, Q.; Liu, X.; Ma, T.; Ma, X.; Manijak, M.P.; Marre, M.; Mokrosinski, J.; Morris, A.D.; Mu, B.; Nielsen, A.A.; Nijpels, G.; Nilsson, P.; Palmer, C.N.A.; Rayner, N.W.; Renstrom, F.; Ribel-Madsen, R.; Robertson, N.; Rolandsson, O.; Rossing, P.; Schwartz, T.W.; Slagboom, P.E.; Sterner, M.; Tang, M.; Tarnow, L.; Tuomi, T.; van 't Riet, E.; van Leeuwen, N.; Varga, T.V.; Vestmar, M.A.; Walker, M.; Wang, B.; Wang, Y.; Wu, H.; Xi, F.; Yengo, L.; Yu, C.; Zhang, X.; Zhang, J.; Zhang, Q.; Zhang, W.; Zheng, H.; Zhou, Y.; Altshuler, D.; 't Hart, L.M.; Franks, P.W.; Balkau, B.; Froguel, P.; McCarthy, M.I.; Laakso, M.; Groop, L.; Christensen, C.; Brandslund, I.; Lauritzen, T.; Witte, D.R.; Linneberg, A.; Jorgensen, T.; Hansen, T.; Wang, J.; Nielsen, R.; Pedersen, O.

    2013-01-01

    Aims/hypothesis: Human complex metabolic traits are in part regulated by genetic determinants. Here we applied exome sequencing to identify novel associations of coding polymorphisms at minor allele frequencies (MAFs) >1% with common metabolic phenotypes. Methods: The study comprised three stages.

  14. Exome sequencing-driven discovery of coding polymorphisms associated with common metabolic phenotypes

    DEFF Research Database (Denmark)

    Albrechtsen, Anders; Grarup, Niels; Li, Y

    2013-01-01

    AIMS/HYPOTHESIS: Human complex metabolic traits are in part regulated by genetic determinants. Here we applied exome sequencing to identify novel associations of coding polymorphisms at minor allele frequencies (MAFs) >1% with common metabolic phenotypes. METHODS: The study comprised three stages...

  15. Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

    Science.gov (United States)

    Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

  16. Development and evaluation of a culture-independent method for source determination of fecal wastes in surface and storm waters using reverse transcriptase-PCR detection of FRNA coliphage genogroup gene sequences.

    Science.gov (United States)

    A complete method, incorporating recently improved reverse transcriptase-PCR primer/probe assays and including controls for determining interferences to phage recoveries from water sample concentrates and for detecting interferences to their analysis, was developed for the direct...

  17. Blackout sequence modeling for Atucha-I with MARCH3 code

    International Nuclear Information System (INIS)

    Baron, J.; Bastianelli, B.

    1997-01-01

    The modeling of a blackout sequence in Atucha I nuclear power plant is presented in this paper, as a preliminary phase for a level II probabilistic safety assessment. Such sequence is analyzed with the code MARCH3 from STCP (Source Term Code Package), based on a specific model developed for Atucha, that takes into accounts it peculiarities. The analysis includes all the severe accident phases, from the initial transient (loss of heat sink), loss of coolant through the safety valves, core uncovered, heatup, metal-water reaction, melting and relocation, heatup and failure of the pressure vessel, core-concrete interaction in the reactor cavity, heatup and failure of the containment building (multi-compartmented) due to quasi-static overpressurization. The results obtained permit to visualize the time sequence of these events, as well as provide the basis for source term studies. (author) [es

  18. Identification of evolutionarily conserved non-AUG-initiated N-terminal extensions in human coding sequences.

    LENUS (Irish Health Repository)

    Ivanov, Ivaylo P

    2011-05-01

    In eukaryotes, it is generally assumed that translation initiation occurs at the AUG codon closest to the messenger RNA 5\\' cap. However, in certain cases, initiation can occur at codons differing from AUG by a single nucleotide, especially the codons CUG, UUG, GUG, ACG, AUA and AUU. While non-AUG initiation has been experimentally verified for a handful of human genes, the full extent to which this phenomenon is utilized--both for increased coding capacity and potentially also for novel regulatory mechanisms--remains unclear. To address this issue, and hence to improve the quality of existing coding sequence annotations, we developed a methodology based on phylogenetic analysis of predicted 5\\' untranslated regions from orthologous genes. We use evolutionary signatures of protein-coding sequences as an indicator of translation initiation upstream of annotated coding sequences. Our search identified novel conserved potential non-AUG-initiated N-terminal extensions in 42 human genes including VANGL2, FGFR1, KCNN4, TRPV6, HDGF, CITED2, EIF4G3 and NTF3, and also affirmed the conservation of known non-AUG-initiated extensions in 17 other genes. In several instances, we have been able to obtain independent experimental evidence of the expression of non-AUG-initiated products from the previously published literature and ribosome profiling data.

  19. The nucleotide sequence of threonine transfer RNA coded by bacteriophage T4

    International Nuclear Information System (INIS)

    Guthrie, C.; Scholla, C.A.; Yesian, H.; Abelson, J.

    1978-01-01

    The nucleotide sequence of a low molecular weight RNA coded by bacteriophage T4 (and previously identified as species α) has been determined. The molecule is of particular biological interest for its associated biosynthetic properties. This RNA is 76 nucleotides in length, contains eight modified bases, and can be arranged in a cloverleaf configuration common to tRNAs. The anticodon sequence is UGU, which corresponds to the threonine-specific codons ACsub(G)sup(A). The nucleotide sequence was determined primarily by nearest-neighbour analysis of RNA synthesized in vitro using [α- 32 P] nucleoside triphosphates. Using the single-strand specific nuclease S1, two in vivo labelled half-molecules were generated and analysed. This information together with restrictions imposed by nearest-neighbour data, provided a unique linear sequence of nucleotides with the features of secondary structure common to tRNA molecules. (author)

  20. The sequence coding and search system: an approach for constructing and analyzing event sequences at commercial nuclear power plants

    International Nuclear Information System (INIS)

    Mays, G.T.

    1990-01-01

    The U.S. Nuclear Regulatory Commission (NRC) has recognized the importance of the collection, assessment, and feedback of operating experience data from commercial nuclear power plants and has centralized these activities in the Office for Analysis and Evaluation of Operational Data (AEOD). Such data is essential for performing safety and reliability analyses, especially analyses of trends and patterns to identify undesirable changes in plant performance at the earliest opportunity to implement corrective measures to preclude the occurrence of a more serious event. One of NRC's principal tools for collecting and evaluating operating experience data is the Sequence Coding and Search System (SCSS). The SCSS consists of a methodology for structuring event sequences and the requisite computer system to store and search the data. The source information for SCSS is the Licensee Event Report (LER), which is a legally required document. This paper describes the objectives of SCSS, the information it contains, and the format and approach for constructing SCSS event sequences. Examples are presented demonstrating the use of SCSS to support the analysis of LER data. The SCSS contains over 30,000 LERs describing events from 1980 through the present. Insights gained from working with a complex data system from the initial developmental stage to the point of a mature operating system are highlighted. Considerable experience has been gained in the areas of evolving and changing data requirements, staffing requirements, and quality control and quality assurance procedures for addressing consistency, software/hardware considerations for developing and maintaining a complex system, documentation requirements, and end-user needs. Two other approaches for constructing and evaluating event sequences are examined including the Accident Precursor Program (ASP) where sequences having the potential for core damage are identified and analyzed, and the Significant Event Compilation Tree

  1. PATACSDB—the database of polyA translational attenuators in coding sequences

    Directory of Open Access Journals (Sweden)

    Malgorzata Habich

    2016-02-01

    Full Text Available Recent additions to the repertoire of gene expression regulatory mechanisms are polyadenylate (polyA tracks encoding for poly-lysine runs in protein sequences. Such tracks stall the translation apparatus and induce frameshifting independently of the effects of charged nascent poly-lysine sequence on the ribosome exit channel. As such, they substantially influence the stability of mRNA and the amount of protein produced from a given transcript. Single base changes in these regions are enough to exert a measurable response on both protein and mRNA abundance; this makes each of these sequences a potentially interesting case study for the effects of synonymous mutation, gene dosage balance and natural frameshifting. Here we present PATACSDB, a resource that contain a comprehensive list of polyA tracks from over 250 eukaryotic genomes. Our data is based on the Ensembl genomic database of coding sequences and filtered with algorithm of 12A-1 which selects sequences of polyA tracks with a minimal length of 12 A’s allowing for one mismatched base. The PATACSDB database is accessible at: http://sysbio.ibb.waw.pl/patacsdb. The source code is available at http://github.com/habich/PATACSDB, and it includes the scripts with which the database can be recreated.

  2. Coding and spacer sequences in the 5.8S-2S region of Sciara coprophila ribosomal DNA.

    OpenAIRE

    Jordan, B R; Latil-Damotte, M; Jourdan, R

    1980-01-01

    The sequence of 436 nucleotides around the region coding for 5.8S RNA in the Sciara coprophila rDNA transcription unit (1) has been determined. Regions coding for 5.8S and 2S RNAs have been identified; they are 80 - 90% homologous to the corresponding Drosophila sequences and are separated by a 22 nucleotide long spacer. This sequence as well as the two before the 5.8 and after the 2S coding region are very different from the corresponding Drosophila sequences. The main features reported in t...

  3. Sequence Coding and Search System for licensee event reports: coder's manual. Volume 3

    International Nuclear Information System (INIS)

    Gallaher, R.B.; Guymon, R.H.; Mays, G.T.; Poore, W.P.; Cagle, R.J.; Harrington, K.H.; Johnson, M.P.

    1985-04-01

    Operating experience data from nuclear power plants are essential for safety and reliability analyses, especially analyses of trends and patterns. The licensee event reports (LERs) that are submitted to the Nuclear Regulatory Commission (NRC) by the nuclear power plant utilities contain much of this data. The NRC's Office for Analysis and Evaluation of Operational Data (AEOD) has developed, under contract with NSIC, a system for codifying the events reported in the LERs. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the LERs to coded sequences that are both computer-readable and computer-searchable. This four volume report documents and describes SCSS in detail. Volumes 3 and 4 provide a technical processor, new to SCSS, the information and methodology necessary to capture descriptive data from the LER and to codify that data into a structured format and serve as reference material for the more experienced technical processor, and contains information is essential for the more advanced user who needs to be familiar with the intricate coding techniques in order to retrieve specific details in a sequence. This volume contains updated material through amendment 1 to revision 1 of the working version of ORNL/NSIC-223, Vol. 3

  4. Sequence Coding and Search System for licensee event reports: coder's manual. Volume 4

    International Nuclear Information System (INIS)

    Gallaher, R.B.; Guymon, R.H.; Mays, G.T.; Poore, W.P.; Cagle, R.J.; Harrington, K.H.; Johnson, M.P.

    1985-04-01

    Operating experience data from nuclear power plants are essential for safety and reliability analyses, especially analyses of trends and patterns. The licensee event reports (LERs) that are submitted to the Nuclear Regulatory Commission (NRC) by the nuclear power plant utilities contain much of this data. The NRC's Office for Analysis and Evaluation of Operational Data (AEOD) has developed, under contract with NSIC, a system for codifying the events reported in the LERs. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the LERs to coded sequences that are both computer-readable and computer-searchable. This four volume report documents and describes SCSS in detail. Volume 3 and 4 provide a technical processor, new to SCSS, the information and methodology necessary to capture descriptive data from the LER and to codify that data into a structured format and serve as reference material for the more experienced technical processor, and contains information that is essential for the more advanced user who needs to be familiar with the intricate coding techniques in order to retrieve specific details in a sequence. This volume contains updated material through amendment 1 to revision 1 of the working version of ORNL/NSIC-223, Vol. 4

  5. Rapid Quantification of Mutant Fitness in Diverse Bacteria by Sequencing Randomly Bar-Coded Transposons

    Science.gov (United States)

    Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; Lamson, Jacob S.; He, Jennifer; Hoover, Cindi A.; Blow, Matthew J.; Bristow, James; Butland, Gareth

    2015-01-01

    ABSTRACT Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with any transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative d-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. PMID:25968644

  6. The sequence coding and search system: An approach for constructing and analyzing event sequences at commercial nuclear power plants

    International Nuclear Information System (INIS)

    Mays, G.T.

    1989-04-01

    The US Nuclear Regulatory Commission (NRC) has recognized the importance of the collection, assessment, and feedstock of operating experience data from commercial nuclear power plants and has centralized these activities in the Office for Analysis and Evaluation of Operational Data (AEOD). Such data is essential for performing safety and reliability analyses, especially analyses of trends and patterns to identify undesirable changes in plant performance at the earliest opportunity to implement corrective measures to preclude the occurrences of a more serious event. One of NRC's principal tools for collecting and evaluating operating experience data is the Sequence Coding and Search System (SCSS). The SCSS consists of a methodology for structuring event sequences and the requisite computer system to store and search the data. The source information for SCSS is the Licensee Event Report (LER), which is a legally required document. This paper describes the objective SCSS, the information it contains, and the format and approach for constructuring SCSS event sequences. Examples are presented demonstrating the use SCSS to support the analysis of LER data. The SCSS contains over 30,000 LERs describing events from 1980 through the present. Insights gained from working with a complex data system from the initial developmental stage to the point of a mature operating system are highlighted

  7. The Tgif2 gene contains a retained intron within the coding sequence

    Directory of Open Access Journals (Sweden)

    Wotton David

    2006-01-01

    Full Text Available Abstract Background TGIF and TGIF2 are homeodomain proteins, which act as TGFβ specific Smad transcriptional corepressors. TGIF recruits general repressors including mSin3 and CtBP. The related TGIF2 protein functions in a similar manner, but does not bind CtBP. In addition to repressing TGFβ activated gene expression, TGIF and TGIF2 repress gene expression by binding directly to DNA. TGIF and TGIF2 share two major blocks of similarity, encompassing the homeodomain, and a conserved carboxyl terminal repression domain. Here we characterize two splice variants of the Tgif2 gene from mouse and demonstrate that the Tgif2 gene contains a retained intron. Results By PCR from mouse cDNA, we identified two alternate splice forms of the Tgif2 gene. One splice variant encodes the full length 237 amino acid Tgif2, whereas the shorter form results in the removal of 39 codons from the centre of the coding region. The generation of this alternate splice form occurs with the mouse RNA, but not the human, and both splice forms are present in all mouse tissues analyzed. Human and mouse Tgif2 coding sequences contain a retained intron, which in mouse Tgif2 is removed by splicing from around 25–50% of RNAs, as assessed by RT-PCR. This splicing event is dependent on sequences within the mouse Tgif2 coding sequence. Both splice forms of mouse Tgif2 encode proteins which are active transcriptional repressors, and can repress both TGFβ dependent and independent transcription. In addition, we show that human and mouse Tgif2 interact with the transcriptional corepressor mSin3. Conclusion These data demonstrate that the Tgif2 gene contains a retained intron, within the second coding exon. This retained intron is not removed from the human mRNA at a detectable level, but is spliced out in a significant proportion of mouse RNAs. This alternate splicing is dependent entirely on sequences within the mouse Tgif2 coding sequence, suggesting the presence of an exonic

  8. A direct sequence spread spectrum code acquisition circuit for wireless sensor networks

    Science.gov (United States)

    Ghaisari, Jafar; Ferdosi, Arash

    2011-06-01

    Narrow band (NB), spread spectrum (SS), and ultra wide band (UWB) are three physical layer bandwidth types used in wireless sensor networks (WSN). SS and UWB technologies have many advantages over NB, which make them preferable for WSN. Synchronisation of different nodes in a WSN is an important task that is necessary to improve cooperation and lifetime of nodes. Code acquisition is the main step of a node's time synchronisation. In this article, a pseudo noise code generator and a code acquisition circuit are proposed, designed and tested using direct sequence SS technique. To investigate the properties of the designed circuits, simulations are carried out via Xilinx Foundation Series software in the real mode. The results demonstrate excellent performance of the proposed algorithms and circuits in all realistic conditions. The code acquisition circuit proposed an adaptive testing window for single dwell serial search method. The code acquisition circuit is a clock phase free approach, thus the clock coherency step is cancelled. Moreover, clock phase difference between transmitter and receiver nodes does not mostly affect the acquisition and thus synchronisation time.

  9. Screening of selected starter cultures for the presence of DNA sequences coding for tyrosine decarboxylase

    Directory of Open Access Journals (Sweden)

    Radka Burdychová

    2006-01-01

    Full Text Available Here, seven different starter cultures used in the production of fermented sausages were screened for the presence or absence of specific DNA sequences coding for tyrosine decarboxylase. PCR with the a set of specific primers TDC2/TDC5 (COTON et al., 2004 was used. The PCR analysis of DNA from two starter cultures confirmed the presence of DNA sequences for tyrosine decarboxylase. A detailed analysis of the starter cultures showed that DNA sequences for tyrosine decarboxylase are contained in genomic DNA of Lactobacillus curvatus and Lactobacillus sakei. These results show suitability of the described PCR method for the screening of starter cultures for the presence of the gene for tyrosine decarboxylase that is responsible for the production of the biogenic amine tyramine.

  10. Identification of minority resistance mutations in the HIV-1 integrase coding region using next generation sequencing

    DEFF Research Database (Denmark)

    Fonager, Jannik; Larsson, Jonas T; Hussing, Christian

    2015-01-01

    BACKGROUND: The current widely applied standard method to screen for HIV-1 genotypic resistance is based on Sanger population sequencing (Sseq), which does not allow for the identification of minority variants (MVs) below the limit of detection for the Sseq-method in patients receiving integrase...... strand-transfer inhibitors (INSTI). Next generation sequencing (NGS) has facilitated the detection of MVs at a much deeper level than Sseq. OBJECTIVES: Here, we compared Illumina MiSeq and Sseq approaches to evaluate the detection of MVs involved in resistance to the three commonly used INSTI......: raltegravir (RAL), elvitegravir (EVG) and dolutegravir (DTG). STUDY DESIGN: NGS and Sseq were used to analyze RT-PCR products of the HIV-1 integrase coding region from six patients and in serial samples from two patients. NGS sequences were assembled and analyzed using the low frequency variant detection...

  11. Short pulse acquisition by low sampling rate with phase-coded sequence in lidar system

    Science.gov (United States)

    Wu, Long; Xu, Jiajia; Lv, Wentao; Yang, Xiaocheng

    2016-11-01

    The requirement of high range resolution results in impractical collection of every returned laser pulse due to the limited response speed of imaging detectors. This paper proposes a phase coded sequence acquisition method for signal preprocessing. The system employs an m-sequence with N bits for demonstration with the detector controlled to accumulate N+1 bits of the echo signals to deduce one single returned laser pulse. An indoor experiment achieved 2 μs resolution with the sampling period of 28 μs by employing a 15-bit m-sequence. This method shows the potential to improve the detection capabilities of narrow laser pulses with the detectors at a low frame rate, especially for the imaging lidar systems. Meanwhile, the lidar system is able to improve the range resolution with available detectors of restricted performance.

  12. Radioimmunoassay for mammalian type C viral reverse transcriptase

    International Nuclear Information System (INIS)

    Krakower, J.M.; Barbacid, M.; Aaronson, S.A.

    1977-01-01

    Radioimmunological techniques were applied to the analysis of reverse transcriptases of mammalian type C RNA viruses. The polymerase of Rauscher mouse leukemia virus was purified by ion exchange and sequential affinity chromatography. Radioimmunoassays that utilized the viral enzyme as a probe detected as little as 1 ng of purified polymerase. No cross-reactivity could be demonstrated between the reverse transcriptase and other known virus-coded proteins. By comparing the immunological reactivity of the purified enzyme with the reactivity of detergent-disrupted virions, Rauscher mouse leukemia virus was shown to contain the antigenic equivalent of 40 molecules of reverse transcriptase. In a homologous competition immunoassay, the Rauscher viral enzyme demonstrated type-specific antigenic determinants, which distinguish it from other mouse type C viral polymerases. In a broadly reactive interspecies immunoassay, the reverse transcriptases of a number of mammalian type C viruses were cross-reactive, indicating their shared antigenic determinants. Various treatments that inhibited or inactivated DNA polymerase activity had little or no effect on the immunological properties of the enzyme. Thus, radioimmunoassays should be useful in the search for type C viral reverse transcriptase as a marker of subviral expression

  13. Purification and sequence analysis of the mRNA coding for an immunoglobulin heavy chain

    International Nuclear Information System (INIS)

    Cowan, N.J.; Secher, D.S.; Milstein, C.

    1976-01-01

    A mutant cell line (IF2) derived from the mouse myeloma MOPC 21 has been used for the isolation and sequence analysis of H-chain mRNA. The IF2 cells synthesise an H-chain of reduced size in which the Csub(H)1 homology region is missing. Sizing of the IF2 H-chain mRNA and wild-type H-chain mRNA revealed that the deletion is expressed at the mRNA level. The mutant H-chain mRNA sedimented at 16-S, enabling effective resolution from 18-S ribosomal RNA. In experiments using IF2 cells labelled with [ 32 P]phosphate, the 16-S mRNA was purified by oligo(T)-cellulose chromatography. Polyacrylamide gel analysis of the poly(A)-containing fraction showed the presence of a single radioactive band. Comparison of the mobility of this band relative to markers of known molecular weight revealed that the molecule contained about 1,600 nucleotides. Digestion of the 32 P-labelled mRNA with T 1 ribonuclease and two-dimensional fractionation of the resulting oligonucleotides yielded a fingerprint' suitable for a preliminary sequence analysis. By using the established amino acid sequence of the IF2 H-chain and a knowledge of the genetic code, 14 oligonucleotides were assigned within the constant region and four within the variable region of the IF2 H-chain. This sequence data accounts for 19.5% of the coding region. Several other oligonucleotides, which could not be assigned within the coding region but which occurred in approximately molar yield, have also been partially characterised. These oligonucleotides are presumably derived from the untranslated regions of the mRNA. (orig.) [de

  14. cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

    International Nuclear Information System (INIS)

    Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.

    1987-01-01

    The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

  15. Sequence coding and search system for licensee event reports. User's guide

    International Nuclear Information System (INIS)

    Green, N.M.; Mays, G.T.; Johnson, M.P.

    1984-08-01

    The Nuclear Regulatory Commission's Office for Analysis and Evaluation of Operational Data has developed, through the Nuclear Operations Analysis Center (NOAC) at Oak Ridge National Laboratory (ORNL), a system to aid in the evaluation of the Licensee Event Reports (LERs) submitted by the nuclear power plant utilities. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the incident reports to a coded sequence that is both computer-readable and computer-searchable. This system provides a structured format for detailed coding of component, system, and unit effects, as well as personnel errors. The database contains all current LERs submitted by the nuclear power plant utilities after January 1, 1981, and is updated on a continual basis with new LERs, as they are submitted. The database is maintained by NOAC on the IBM-3033 computer system at ORNL. Following a description of SCSS and structure of the database, a tutorial section is provided to acquaint the first-time user with logon procedures and the necessary commands to retrieve, display, and analyze LERs

  16. Sequence Coding and Search System for licensee event reports: user's guide. Volume 1, Revision 1

    International Nuclear Information System (INIS)

    Greene, N.M.; Mays, G.T.; Johnson, M.P.

    1985-04-01

    Operating experience data from nuclear power plants are essential for safety and reliability analyses, especially analyses of trends and patterns. The licensee event reports (LERs) that are submitted to the Nuclear Regulatory Commission (NRC) by the nuclear power plant utilities contain much of this data. The NRC's Office for Analysis and Evaluation of Operational Data (AEOD) has developed, under contract with NSIC, a system for codifying the events reported in the LERs. The primary objective of the Sequence Coding and Search System (SCSS) is to reduce the descriptive text of the LERs to coded sequences that are both computer-readable and computer-searchable. This system provides a structured format for detailed coding of component, system, and unit effects as well as personnel errors. The database contains all current LERs submitted by nuclear power plant utilities for events occurring since 1981 and is updated on a continual basis. This four volume report documents and describes SCSS in detail. Volume 1 is a User's Guide for searching the SCSS database. This volume contains updated material through February 1985 of the working version of ORNL/NSIC-223, Vol. 1

  17. Identification of the conserved coding sequences of three chitin synthase genes in Fonsecaea pedrosoi.

    Science.gov (United States)

    Karuppayil, S M; Peng, M; Mendoza, L; Levins, T A; Szaniszlo, P J

    1996-01-01

    Primers having designs based on highly conserved stretches in the deduced amino acid sequences of chitin synthase (CHS) genes were used in PCR reactions to amplify 600 bp and 366 bp products from the genomic DNA of three major causal agents of chromoblastomycosis. Cloning and sequencing of the PCR products of one of these fungi, Fonsecaea pedrosoi, identified three CHS sequences designated as FpCHS1, FpCHS2 and FpCHS3. FpCHS1 and FpCHS2 were homologous to regions of CHS1 and CHS2 of Saccharomyces cerevisiae, and their derived amino acid sequences fell into chitin synthase classes I and II, respectively. FpCHS3 was homologous to a region of the CAL1/CSD2 gene of S. cerevisiae, which codes for the chitin synthase three (Chs3) enzyme in that fungus. Phylogenetic trees constructed using the deduced amino acid sequences of PCR-amplified CHS products from many fungi clustered F. pedrosoi with other dematiaceous fungi, providing new molecular evidence for the genetic relatedness of these organisms. The identification of these CHS genes in F. pedrosoi will facilitate future studies of the functional roles of chitin synthases in the unique in vivo dimorphism exhibited by chromoblastomycotic fungi.

  18. Hybridization-based reconstruction of small non-coding RNA transcripts from deep sequencing data.

    Science.gov (United States)

    Ragan, Chikako; Mowry, Bryan J; Bauer, Denis C

    2012-09-01

    Recent advances in RNA sequencing technology (RNA-Seq) enables comprehensive profiling of RNAs by producing millions of short sequence reads from size-fractionated RNA libraries. Although conventional tools for detecting and distinguishing non-coding RNAs (ncRNAs) from reference-genome data can be applied to sequence data, ncRNA detection can be improved by harnessing the full information content provided by this new technology. Here we present NorahDesk, the first unbiased and universally applicable method for small ncRNAs detection from RNA-Seq data. NorahDesk utilizes the coverage-distribution of small RNA sequence data as well as thermodynamic assessments of secondary structure to reliably predict and annotate ncRNA classes. Using publicly available mouse sequence data from brain, skeletal muscle, testis and ovary, we evaluated our method with an emphasis on the performance for microRNAs (miRNAs) and piwi-interacting small RNA (piRNA). We compared our method with Dario and mirDeep2 and found that NorahDesk produces longer transcripts with higher read coverage. This feature makes it the first method particularly suitable for the prediction of both known and novel piRNAs.

  19. Capsid coding sequences of foot-and-mouth disease viruses are determinants of pathogenicity in pigs

    DEFF Research Database (Denmark)

    Lohse, Louise; Jackson, Terry; Bøtner, Anette

    2012-01-01

    compared the pathogenicity of different FMDVs in young pigs. In total 32 pigs, 7-weeks-old, were exposed to virus, either by direct inoculation or through contact with inoculated pigs, using cell culture adapted (O1K B64), chimeric (O1K/A-TUR and O1K/O-UKG) or field strain (O-UKG/34/2001) viruses. The O1K...... B64 virus and the two chimeric viruses are identical to each other except for the capsid coding region. Animals exposed to O1K B64 did not exhibit signs of disease, while pigs exposed to each of the other viruses showed typical clinical signs of foot-and-mouth disease (FMD). All pigs infected...... coding sequences are determinants of FMDV pathogenicity in pigs....

  20. Comparative analysis of protein coding sequences from human, mouse, and the domesticated pig  

    DEFF Research Database (Denmark)

    Jørgensen, Frank Grønlund; Hobolth, Asger; Hornshøj, H.

    2005-01-01

    Background The availability of abundant sequence data from key model organisms has made large scale studies of molecular evolution an exciting possibility. Here we use full length cDNA alignments comprising more than 700,000 nucleotides from human, mouse, pig and the Japanese pufferfish Fugu...... indicate that a large fraction of these genes may have lost their function quite recently or may still be functional genes in some or all of the three mammalian species. Conclusions We present a comparative analysis of protein coding genes from three major mammalian lineages. Our study demonstrates...... the usefulness of codon-based likelihood models in detecting selection and it illustrates the value of sequencing organisms at different phylogenetic distances for comparative studies....

  1. Temporal and Rate Coding for Discrete Event Sequences in the Hippocampus.

    Science.gov (United States)

    Terada, Satoshi; Sakurai, Yoshio; Nakahara, Hiroyuki; Fujisawa, Shigeyoshi

    2017-06-21

    Although the hippocampus is critical to episodic memory, neuronal representations supporting this role, especially relating to nonspatial information, remain elusive. Here, we investigated rate and temporal coding of hippocampal CA1 neurons in rats performing a cue-combination task that requires the integration of sequentially provided sound and odor cues. The majority of CA1 neurons displayed sensory cue-, combination-, or choice-specific (simply, "event"-specific) elevated discharge activities, which were sustained throughout the event period. These event cells underwent transient theta phase precession at event onset, followed by sustained phase locking to the early theta phases. As a result of this unique single neuron behavior, the theta sequences of CA1 cell assemblies of the event sequences had discrete representations. These results help to update the conceptual framework for space encoding toward a more general model of episodic event representations in the hippocampus. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Verona Coding Definitions of Emotional Sequences (VR-CoDES): Conceptual framework and future directions.

    Science.gov (United States)

    Piccolo, Lidia Del; Finset, Arnstein; Mellblom, Anneli V; Figueiredo-Braga, Margarida; Korsvold, Live; Zhou, Yuefang; Zimmermann, Christa; Humphris, Gerald

    2017-12-01

    To discuss the theoretical and empirical framework of VR-CoDES and potential future direction in research based on the coding system. The paper is based on selective review of papers relevant to the construction and application of VR-CoDES. VR-CoDES system is rooted in patient-centered and biopsychosocial model of healthcare consultations and on a functional approach to emotion theory. According to the VR-CoDES, emotional interaction is studied in terms of sequences consisting of an eliciting event, an emotional expression by the patient and the immediate response by the clinician. The rationale for the emphasis on sequences, on detailed classification of cues and concerns, and on the choices of explicit vs. non-explicit responses and providing vs. reducing room for further disclosure, as basic categories of the clinician responses, is described. Results from research on VR-CoDES may help raise awareness of emotional sequences. Future directions in applying VR-CoDES in research may include studies on predicting patient and clinician behavior within the consultation, qualitative analyses of longer sequences including several VR-CoDES triads, and studies of effects of emotional communication on health outcomes. VR-CoDES may be applied to develop interventions to promote good handling of patients' emotions in healthcare encounters. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Memorization of Sequences of Movements of the Right or the Left Hand by Right- and Left-Handers: Vector Coding.

    Science.gov (United States)

    Bobrova, E V; Bogacheva, I N; Lyakhovetskii, V A; Fabinskaja, A A; Fomina, E V

    2017-01-01

    In order to test the hypothesis of hemisphere specialization for different types of information coding (the right hemisphere, for positional coding; the left one, for vector coding), we analyzed the errors of right and left-handers during a task involving the memorization of sequences of movements by the left or the right hand, which activates vector coding by changing the order of movements in memorized sequences. The task was first performed by the right or the left hand, then by the opposite hand. It was found that both'right- and left-handers use the information about the previous movements of the dominant hand, but not of the non-dom" inant one. After changing the hand, right-handers use the information about previous movements of the second hand, while left-handers do not. We compared our results with the data of previous experiments, in which positional coding was activated, and concluded that both right- and left-handers use vector coding for memorizing the sequences of their dominant hands and positional coding for memorizing the sequences of non-dominant hand. No similar patterns of errors were found between right- and left-handers after changing the hand, which suggests that in right- and left-handersthe skills are transferred in different ways depending on the type of coding.

  4. Sub-grouping of Plasmodium falciparum 3D7 var genes based on sequence analysis of coding and non-coding regions

    DEFF Research Database (Denmark)

    Lavstsen, Thomas; Salanti, Ali; Jensen, Anja T R

    2003-01-01

    BACKGROUND: The variant surface antigen family Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP1) is an important target for protective immunity and is implicated in the pathology of malaria through its ability to adhere to host endothelial receptors. The sequence diversity and organiz......BACKGROUND: The variant surface antigen family Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP1) is an important target for protective immunity and is implicated in the pathology of malaria through its ability to adhere to host endothelial receptors. The sequence diversity...... and organization of the 3D7 PfEMP1 repertoire was investigated on the basis of the complete genome sequence. METHODS: Using two tree-building methods we analysed the coding and non-coding sequences of 3D7 var and rif genes as well as var genes of other parasite strains. RESULTS: var genes can be sub...

  5. Both Maintenance and Avoidance of RNA-Binding Protein Interactions Constrain Coding Sequence Evolution.

    Science.gov (United States)

    Savisaar, Rosina; Hurst, Laurence D

    2017-05-01

    While the principal force directing coding sequence (CDS) evolution is selection on protein function, to ensure correct gene expression CDSs must also maintain interactions with RNA-binding proteins (RBPs). Understanding how our genes are shaped by these RNA-level pressures is necessary for diagnostics and for improving transgenes. However, the evolutionary impact of the need to maintain RBP interactions remains unresolved. Are coding sequences constrained by the need to specify RBP binding motifs? If so, what proportion of mutations are affected? Might sequence evolution also be constrained by the need not to specify motifs that might attract unwanted binding, for instance because it would interfere with exon definition? Here, we have scanned human CDSs for motifs that have been experimentally determined to be recognized by RBPs. We observe two sets of motifs-those that are enriched over nucleotide-controlled null and those that are depleted. Importantly, the depleted set is enriched for motifs recognized by non-CDS binding RBPs. Supporting the functional relevance of our observations, we find that motifs that are more enriched are also slower-evolving. The net effect of this selection to preserve is a reduction in the over-all rate of synonymous evolution of 2-3% in both primates and rodents. Stronger motif depletion, on the other hand, is associated with stronger selection against motif gain in evolution. The challenge faced by our CDSs is therefore not only one of attracting the right RBPs but also of avoiding the wrong ones, all while also evolving under selection pressures related to protein structure. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Variation in conserved non-coding sequences on chromosome 5q andsusceptibility to asthma and atopy

    Energy Technology Data Exchange (ETDEWEB)

    Donfack, Joseph; Schneider, Daniel H.; Tan, Zheng; Kurz,Thorsten; Dubchak, Inna; Frazer, Kelly A.; Ober, Carole

    2005-09-10

    Background: Evolutionarily conserved sequences likely havebiological function. Methods: To determine whether variation in conservedsequences in non-coding DNA contributes to risk for human disease, westudied six conserved non-coding elements in the Th2 cytokine cluster onhuman chromosome 5q31 in a large Hutterite pedigree and in samples ofoutbred European American and African American asthma cases and controls.Results: Among six conserved non-coding elements (>100 bp,>70percent identity; human-mouse comparison), we identified one singlenucleotide polymorphism (SNP) in each of two conserved elements and sixSNPs in the flanking regions of three conserved elements. We genotypedour samples for four of these SNPs and an additional three SNPs each inthe IL13 and IL4 genes. While there was only modest evidence forassociation with single SNPs in the Hutterite and European Americansamples (P<0.05), there were highly significant associations inEuropean Americans between asthma and haplotypes comprised of SNPs in theIL4 gene (P<0.001), including a SNP in a conserved non-codingelement. Furthermore, variation in the IL13 gene was strongly associatedwith total IgE (P = 0.00022) and allergic sensitization to mold allergens(P = 0.00076) in the Hutterites, and more modestly associated withsensitization to molds in the European Americans and African Americans (P<0.01). Conclusion: These results indicate that there is overalllittle variation in the conserved non-coding elements on 5q31, butvariation in IL4 and IL13, including possibly one SNP in a conservedelement, influence asthma and atopic phenotypes in diversepopulations.

  7. CoRAL: predicting non-coding RNAs from small RNA-sequencing data.

    Science.gov (United States)

    Leung, Yuk Yee; Ryvkin, Paul; Ungar, Lyle H; Gregory, Brian D; Wang, Li-San

    2013-08-01

    The surprising observation that virtually the entire human genome is transcribed means we know little about the function of many emerging classes of RNAs, except their astounding diversities. Traditional RNA function prediction methods rely on sequence or alignment information, which are limited in their abilities to classify the various collections of non-coding RNAs (ncRNAs). To address this, we developed Classification of RNAs by Analysis of Length (CoRAL), a machine learning-based approach for classification of RNA molecules. CoRAL uses biologically interpretable features including fragment length and cleavage specificity to distinguish between different ncRNA populations. We evaluated CoRAL using genome-wide small RNA sequencing data sets from four human tissue types and were able to classify six different types of RNAs with ∼80% cross-validation accuracy. Analysis by CoRAL revealed that microRNAs, small nucleolar and transposon-derived RNAs are highly discernible and consistent across all human tissue types assessed, whereas long intergenic ncRNAs, small cytoplasmic RNAs and small nuclear RNAs show less consistent patterns. The ability to reliably annotate loci across tissue types demonstrates the potential of CoRAL to characterize ncRNAs using small RNA sequencing data in less well-characterized organisms.

  8. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

    Science.gov (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

    2013-10-01

    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  9. CSTminer: a web tool for the identification of coding and noncoding conserved sequence tags through cross-species genome comparison

    Science.gov (United States)

    Castrignanò, Tiziana; Canali, Alessandro; Grillo, Giorgio; Liuni, Sabino; Mignone, Flavio; Pesole, Graziano

    2004-01-01

    The identification and characterization of genome tracts that are highly conserved across species during evolution may contribute significantly to the functional annotation of whole-genome sequences. Indeed, such sequences are likely to correspond to known or unknown coding exons or regulatory motifs. Here, we present a web server implementing a previously developed algorithm that, by comparing user-submitted genome sequences, is able to identify statistically significant conserved blocks and assess their coding or noncoding nature through the measure of a coding potential score. The web tool, available at http://www.caspur.it/CSTminer/, is dynamically interconnected with the Ensembl genome resources and produces a graphical output showing a map of detected conserved sequences and annotated gene features. PMID:15215464

  10. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P

    2007-01-01

    the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. CONCLUSIONS: We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences...

  11. Sequences related to the ox pancreatic ribonuclease coding region in the genomic DNA of mammalian species.

    Science.gov (United States)

    Breukelman, H J; Beintema, J J; Confalone, E; Costanzo, C; Sasso, M P; Carsana, A; Palmieri, M; Furia, A

    1993-07-01

    Mammalian pancreatic ribonucleases form a family of homologous proteins that has been extensively investigated. The primary structures of these enzymes were used to derive phylogenetic trees. These analyses indicate that the presence of three strictly homologous enzymes in the bovine species (the pancreatic, seminal, and cerebral ribonucleases) is due to gene duplication events which occurred during the evolution of ancestral ruminants. In this paper we present evidence that confirms this finding and that suggests an overall structural conservation of the putative ribonuclease genes in ruminant species. We could also demonstrate that the sequences related to ox ribonuclease coding regions present in genomic DNA of the giraffe species are the orthologues of the bovine genes encoding the three ribonucleases mentioned above.

  12. A quantum-inspired genetic algorithm based on probabilistic coding for multiple sequence alignment.

    Science.gov (United States)

    Huo, Hong-Wei; Stojkovic, Vojislav; Xie, Qiao-Luan

    2010-02-01

    Quantum parallelism arises from the ability of a quantum memory register to exist in a superposition of base states. Since the number of possible base states is 2(n), where n is the number of qubits in the quantum memory register, one operation on a quantum computer performs what an exponential number of operations on a classical computer performs. The power of quantum algorithms comes from taking advantages of quantum parallelism. Quantum algorithms are exponentially faster than classical algorithms. Genetic optimization algorithms are stochastic search algorithms which are used to search large, nonlinear spaces where expert knowledge is lacking or difficult to encode. QGMALIGN--a probabilistic coding based quantum-inspired genetic algorithm for multiple sequence alignment is presented. A quantum rotation gate as a mutation operator is used to guide the quantum state evolution. Six genetic operators are designed on the coding basis to improve the solution during the evolutionary process. The experimental results show that QGMALIGN can compete with the popular methods, such as CLUSTALX and SAGA, and performs well on the presenting biological data. Moreover, the addition of genetic operators to the quantum-inspired algorithm lowers the cost of overall running time.

  13. Metallothionein coding sequence identification and seasonal mRNA expression of detoxification genes in the bivalve Corbicula fluminea.

    Science.gov (United States)

    Bigot, Aurélie; Doyen, Périne; Vasseur, Paule; Rodius, François

    2009-02-01

    The aim of this study was to identify a metallothionein (MT) coding sequence from the freshwater bivalve Corbicula fluminea and to measure the seasonal transcriptional pattern of MT in parallel with several detoxification genes: superoxide dismutase (SOD), catalase (CAT), glutathione S-transferases (GST) and glutathione peroxidases (GPx), in the digestive gland and the gills of this bivalve during a 1-year period. We identified a C. fluminea MT complete cDNA sequence using RT-PCR and RACE-PCR. The amino acid sequence deduced from the coding sequence encodes for a protein of 73 amino acids containing 21 cysteine residues. This protein exhibits high identities and similarities with the MT sequences of numerous bivalves. MT, SOD, CAT, pi-GST and Se-GPx expression patterns did not exhibit major seasonal variations. A slight increase of MT was observed in July. Therefore, the mRNA expression of these five genes could be used as biomarkers for monitoring studies.

  14. Evolution of the alternative AQP2 gene: Acquisition of a novel protein-coding sequence in dolphins.

    Science.gov (United States)

    Kishida, Takushi; Suzuki, Miwa; Takayama, Asuka

    2018-01-01

    Taxon-specific de novo protein-coding sequences are thought to be important for taxon-specific environmental adaptation. A recent study revealed that bottlenose dolphins acquired a novel isoform of aquaporin 2 generated by alternative splicing (alternative AQP2), which helps dolphins to live in hyperosmotic seawater. The AQP2 gene consists of four exons, but the alternative AQP2 gene lacks the fourth exon and instead has a longer third exon that includes the original third exon and a part of the original third intron. Here, we show that the latter half of the third exon of the alternative AQP2 arose from a non-protein-coding sequence. Intact ORF of this de novo sequence is shared not by all cetaceans, but only by delphinoids. However, this sequence is conservative in all modern cetaceans, implying that this de novo sequence potentially plays important roles for marine adaptation in cetaceans. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. [Cloning, sequencing and subcloning of cDNA coding for group I allergen of Dermatophagoides farinae].

    Science.gov (United States)

    Yang, Qing-gui; Li, Chao-pin

    2004-06-01

    To clone, sequence and subclone the cDNA coding for group 1 allergen of Dermatophagoides farinae (Der f 1). The cDNA of Der f 1 was amplified by RT-PCR and PCR. After purified, the gene fragment was cloned into a vector pMD-18T. The recombinant plasmid pMD-18T-Der f 1 was transformed into E. coli JM109. Positive clones were screened and identified by PCR and digestion with restriction enzyme. The sequence of inserted Der f 1 gene fragment was also detected. Der f 1 was then subcloned into the vector of pET-32a(+). The Der f 1 gene fragment of Dermatophagoides farinae was specifically amplified from RNA by RT-PCR and PCR. The recombinant plasmid pMD-18T-Der f 1 and pET-32a(+)-Der f 1 was constructed and digested by Bam H I and Sac I, the size of gene fragment was 646 bp and in accordance with the expected one. The pET-32a(+)-Der f 1 subcloning has been constructed successfully.

  16. Natural selection on coding and noncoding DNA sequences is associated with virulence genes in a plant pathogenic fungus.

    Science.gov (United States)

    Rech, Gabriel E; Sanz-Martín, José M; Anisimova, Maria; Sukno, Serenella A; Thon, Michael R

    2014-09-04

    Natural selection leaves imprints on DNA, offering the opportunity to identify functionally important regions of the genome. Identifying the genomic regions affected by natural selection within pathogens can aid in the pursuit of effective strategies to control diseases. In this study, we analyzed genome-wide patterns of selection acting on different classes of sequences in a worldwide sample of eight strains of the model plant-pathogenic fungus Colletotrichum graminicola. We found evidence of selective sweeps, balancing selection, and positive selection affecting both protein-coding and noncoding DNA of pathogenicity-related sequences. Genes encoding putative effector proteins and secondary metabolite biosynthetic enzymes show evidence of positive selection acting on the coding sequence, consistent with an Arms Race model of evolution. The 5' untranslated regions (UTRs) of genes coding for effector proteins and genes upregulated during infection show an excess of high-frequency polymorphisms likely the consequence of balancing selection and consistent with the Red Queen hypothesis of evolution acting on these putative regulatory sequences. Based on the findings of this work, we propose that even though adaptive substitutions on coding sequences are important for proteins that interact directly with the host, polymorphisms in the regulatory sequences may confer flexibility of gene expression in the virulence processes of this important plant pathogen. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Biased Gene Conversion and GC-Content Evolution in the Coding Sequences of Reptiles and Vertebrates

    Science.gov (United States)

    Figuet, Emeric; Ballenghien, Marion; Romiguier, Jonathan; Galtier, Nicolas

    2015-01-01

    Mammalian and avian genomes are characterized by a substantial spatial heterogeneity of GC-content, which is often interpreted as reflecting the effect of local GC-biased gene conversion (gBGC), a meiotic repair bias that favors G and C over A and T alleles in high-recombining genomic regions. Surprisingly, the first fully sequenced nonavian sauropsid (i.e., reptile), the green anole Anolis carolinensis, revealed a highly homogeneous genomic GC-content landscape, suggesting the possibility that gBGC might not be at work in this lineage. Here, we analyze GC-content evolution at third-codon positions (GC3) in 44 vertebrates species, including eight newly sequenced transcriptomes, with a specific focus on nonavian sauropsids. We report that reptiles, including the green anole, have a genome-wide distribution of GC3 similar to that of mammals and birds, and we infer a strong GC3-heterogeneity to be already present in the tetrapod ancestor. We further show that the dynamic of coding sequence GC-content is largely governed by karyotypic features in vertebrates, notably in the green anole, in agreement with the gBGC hypothesis. The discrepancy between third-codon positions and noncoding DNA regarding GC-content dynamics in the green anole could not be explained by the activity of transposable elements or selection on codon usage. This analysis highlights the unique value of third-codon positions as an insertion/deletion-free marker of nucleotide substitution biases that ultimately affect the evolution of proteins. PMID:25527834

  18. Transduplication resulted in the incorporation of two protein-coding sequences into the Turmoil-1 transposable element of C. elegans

    Directory of Open Access Journals (Sweden)

    Pupko Tal

    2008-10-01

    Full Text Available Abstract Transposable elements may acquire unrelated gene fragments into their sequences in a process called transduplication. Transduplication of protein-coding genes is common in plants, but is unknown of in animals. Here, we report that the Turmoil-1 transposable element in C. elegans has incorporated two protein-coding sequences into its inverted terminal repeat (ITR sequences. The ITRs of Turmoil-1 contain a conserved RNA recognition motif (RRM that originated from the rsp-2 gene and a fragment from the protein-coding region of the cpg-3 gene. We further report that an open reading frame specific to C. elegans may have been created as a result of a Turmoil-1 insertion. Mutations at the 5' splice site of this open reading frame may have reactivated the transduplicated RRM motif. Reviewers This article was reviewed by Dan Graur and William Martin. For the full reviews, please go to the Reviewers' Reports section.

  19. Putative HIV and SIV G-Quadruplex Sequences in Coding and Noncoding Regions Can Form G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Petra Krafčíková

    2017-01-01

    Full Text Available The HIV virus is one of the most studied viruses in the world. This is especially true in terms of gene sequencing, and to date more than 9 thousand genomic sequences of HIV isolates have been sequenced and analyzed. In this study, a series of DNA sequences, which have the potential to form G-quadruplex structures, is analyzed. Several such sequences were found in various coding and noncoding virus domains, including the U3 LTR, tat, rev, env, and vpx regions. Interestingly, a homological sequence to the already well-known HIV integrase aptamer was identified in the minus-strand. The sequences derived from original isolates were analyzed using standard spectral and electrophoretic methods. In addition, a recently developed methodology is applied which uses induced circular dichroism spectral profiles of G-quadruplex-ligand (Thiazole Orange complexes to determine if G-rich sequences can adopt G-quadruplex structure. Targeting the G-quadruplexes or peptide domains corresponding to the G-rich coding sequence in HIV offers researchers attractive therapeutic targets which would be of particular use in the development of novel antiviral therapies. The analysis of G-rich regions can provide researchers with a path to find specific targets which could be of interest for specific types of virus.

  20. Coding and spacer sequences in the 5.8S-2S region of Sciara coprophila ribosomal DNA.

    Science.gov (United States)

    Jordan, B R; Latil-Damotte, M; Jourdan, R

    1980-08-25

    The sequence of 436 nucleotides around the region coding for 5.8S RNA in the Sciara coprophila rDNA transcription unit (1) has been determined. Regions coding for 5.8S and 2S RNAs have been identified; they are 80 - 90% homologous to the corresponding Drosophila sequences and are separated by a 22 nucleotide long spacer. This sequence as well as the two before the 5.8 and after the 2S coding region are very different from the corresponding Drosophila sequences. The main features reported in the Drosophila study (2) are however also found, i.e. all three spacers are very rich in A-T; the sequence of the internal spacer allows base pairing; 5.8S and 2S RNAs can pair through their 3' and 5' terminal regions respectively. The features previously proposed as processing sites in the Drosophila case are thus all found in Sciara in spite of very different spacer sequences.

  1. [Transposition errors during learning to reproduce a sequence by the right- and the left-hand movements: simulation of positional and movement coding].

    Science.gov (United States)

    Liakhovetskiĭ, V A; Bobrova, E V; Skopin, G N

    2012-01-01

    Transposition errors during the reproduction of a hand movement sequence make it possible to receive important information on the internal representation of this sequence in the motor working memory. Analysis of such errors showed that learning to reproduce sequences of the left-hand movements improves the system of positional coding (coding ofpositions), while learning of the right-hand movements improves the system of vector coding (coding of movements). Learning of the right-hand movements after the left-hand performance involved the system of positional coding "imposed" by the left hand. Learning of the left-hand movements after the right-hand performance activated the system of vector coding. Transposition errors during learning to reproduce movement sequences can be explained by neural network using either vector coding or both vector and positional coding.

  2. IdentiCS – Identification of coding sequence and in silico reconstruction of the metabolic network directly from unannotated low-coverage bacterial genome sequence

    Directory of Open Access Journals (Sweden)

    Zeng An-Ping

    2004-08-01

    Full Text Available Abstract Background A necessary step for a genome level analysis of the cellular metabolism is the in silico reconstruction of the metabolic network from genome sequences. The available methods are mainly based on the annotation of genome sequences including two successive steps, the prediction of coding sequences (CDS and their function assignment. The annotation process takes time. The available methods often encounter difficulties when dealing with unfinished error-containing genomic sequence. Results In this work a fast method is proposed to use unannotated genome sequence for predicting CDSs and for an in silico reconstruction of metabolic networks. Instead of using predicted genes or CDSs to query public databases, entries from public DNA or protein databases are used as queries to search a local database of the unannotated genome sequence to predict CDSs. Functions are assigned to the predicted CDSs simultaneously. The well-annotated genome of Salmonella typhimurium LT2 is used as an example to demonstrate the applicability of the method. 97.7% of the CDSs in the original annotation are correctly identified. The use of SWISS-PROT-TrEMBL databases resulted in an identification of 98.9% of CDSs that have EC-numbers in the published annotation. Furthermore, two versions of sequences of the bacterium Klebsiella pneumoniae with different genome coverage (3.9 and 7.9 fold, respectively are examined. The results suggest that a 3.9-fold coverage of the bacterial genome could be sufficiently used for the in silico reconstruction of the metabolic network. Compared to other gene finding methods such as CRITICA our method is more suitable for exploiting sequences of low genome coverage. Based on the new method, a program called IdentiCS (Identification of Coding Sequences from Unfinished Genome Sequences is delivered that combines the identification of CDSs with the reconstruction, comparison and visualization of metabolic networks (free to download

  3. Complete Coding Sequences of Two Dengue Virus Type 2 Strains Isolated from an Outbreak in Burkina Faso in 2016.

    Science.gov (United States)

    Baronti, Cécile; Piorkowski, Géraldine; Touret, Franck; Charrel, Rémi; de Lamballerie, Xavier; Nougairede, Antoine

    2017-04-27

    We report here the complete coding sequences of two strains of dengue virus type 2, isolated in France from patients returning from Burkina Faso in November 2016. Both strains (cosmopolitan genotype) are almost identical (99.91% nucleotide identity) and closely related to a strain circulating in Burkina Faso in 1983. Copyright © 2017 Baronti et al.

  4. Complete Coding Sequences of Two Dengue Virus Type 2 Strains Isolated from an Outbreak in Burkina Faso in 2016

    OpenAIRE

    Baronti, C?cile; Piorkowski, G?raldine; Touret, Franck; Charrel, R?mi; de Lamballerie, Xavier; Nougairede, Antoine

    2017-01-01

    ABSTRACT We report here the complete coding sequences of two strains of dengue virus type 2, isolated in France from patients returning from Burkina Faso in November 2016. Both strains (cosmopolitan genotype) are almost identical (99.91% nucleotide identity) and closely related to a strain circulating in Burkina Faso in 1983.

  5. Source coherence impairments in a direct detection direct sequence optical code-division multiple-access system

    Science.gov (United States)

    Fsaifes, Ihsan; Lepers, Catherine; Lourdiane, Mounia; Gallion, Philippe; Beugin, Vincent; Guignard, Philippe

    2007-02-01

    We demonstrate that direct sequence optical code- division multiple-access (DS-OCDMA) encoders and decoders using sampled fiber Bragg gratings (S-FBGs) behave as multipath interferometers. In that case, chip pulses of the prime sequence codes generated by spreading in time-coherent data pulses can result from multiple reflections in the interferometers that can superimpose within a chip time duration. We show that the autocorrelation function has to be considered as the sum of complex amplitudes of the combined chip as the laser source coherence time is much greater than the integration time of the photodetector. To reduce the sensitivity of the DS-OCDMA system to the coherence time of the laser source, we analyze the use of sparse and nonperiodic quadratic congruence and extended quadratic congruence codes.

  6. Source coherence impairments in a direct detection direct sequence optical code-division multiple-access system.

    Science.gov (United States)

    Fsaifes, Ihsan; Lepers, Catherine; Lourdiane, Mounia; Gallion, Philippe; Beugin, Vincent; Guignard, Philippe

    2007-02-01

    We demonstrate that direct sequence optical code- division multiple-access (DS-OCDMA) encoders and decoders using sampled fiber Bragg gratings (S-FBGs) behave as multipath interferometers. In that case, chip pulses of the prime sequence codes generated by spreading in time-coherent data pulses can result from multiple reflections in the interferometers that can superimpose within a chip time duration. We show that the autocorrelation function has to be considered as the sum of complex amplitudes of the combined chip as the laser source coherence time is much greater than the integration time of the photodetector. To reduce the sensitivity of the DS-OCDMA system to the coherence time of the laser source, we analyze the use of sparse and nonperiodic quadratic congruence and extended quadratic congruence codes.

  7. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites

    Directory of Open Access Journals (Sweden)

    Stafford Phillip

    2009-09-01

    Full Text Available Abstract Background Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder, is provided in this paper and applied to find or create potential recognition sites in target coding sequences. Results ICRPfinder is applied to find or create restriction enzyme recognition sites by introducing silent mutations. The algorithm is shown capable of mapping existing cut-sites but importantly it also can generate specified new unique cut-sites within a specified region that are guaranteed not to be present elsewhere in the DNA sequence. Conclusion ICRPfinder is a powerful tool for finding or creating specific DNA patterns in a given target coding sequence. ICRPfinder finds or creates patterns, which can include restriction enzyme recognition sites, without changing the translated protein sequence. ICRPfinder is a browser-based JavaScript application and it can run on any platform, in on-line or off-line mode.

  8. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites.

    Science.gov (United States)

    Li, Chao; Li, Yuhua; Zhang, Xiangmin; Stafford, Phillip; Dinu, Valentin

    2009-09-11

    Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder, is provided in this paper and applied to find or create potential recognition sites in target coding sequences. ICRPfinder is applied to find or create restriction enzyme recognition sites by introducing silent mutations. The algorithm is shown capable of mapping existing cut-sites but importantly it also can generate specified new unique cut-sites within a specified region that are guaranteed not to be present elsewhere in the DNA sequence. ICRPfinder is a powerful tool for finding or creating specific DNA patterns in a given target coding sequence. ICRPfinder finds or creates patterns, which can include restriction enzyme recognition sites, without changing the translated protein sequence. ICRPfinder is a browser-based JavaScript application and it can run on any platform, in on-line or off-line mode.

  9. Comparisons between Arabidopsis thaliana and Drosophila melanogaster in relation to Coding and Noncoding Sequence Length and Gene Expression

    Directory of Open Access Journals (Sweden)

    Rachel Caldwell

    2015-01-01

    Full Text Available There is a continuing interest in the analysis of gene architecture and gene expression to determine the relationship that may exist. Advances in high-quality sequencing technologies and large-scale resource datasets have increased the understanding of relationships and cross-referencing of expression data to the large genome data. Although a negative correlation between expression level and gene (especially transcript length has been generally accepted, there have been some conflicting results arising from the literature concerning the impacts of different regions of genes, and the underlying reason is not well understood. The research aims to apply quantile regression techniques for statistical analysis of coding and noncoding sequence length and gene expression data in the plant, Arabidopsis thaliana, and fruit fly, Drosophila melanogaster, to determine if a relationship exists and if there is any variation or similarities between these species. The quantile regression analysis found that the coding sequence length and gene expression correlations varied, and similarities emerged for the noncoding sequence length (5′ and 3′ UTRs between animal and plant species. In conclusion, the information described in this study provides the basis for further exploration into gene regulation with regard to coding and noncoding sequence length.

  10. Enhanced Protein Production in Escherichia coli by Optimization of Cloning Scars at the Vector-Coding Sequence Junction

    DEFF Research Database (Denmark)

    Mirzadeh, Kiavash; Martinez, Virginia; Toddo, Stephen

    2015-01-01

    lie between the Shine-Dalgarno sequence and the start codon, they are an integral part of the translation initiation region. To identify the most optimal sequences, we devised a simple and inexpensive PCR-based step that generates sequence variants at the vector-coding sequence junction...

  11. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  12. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  13. Long Non-Coding RNA and Alternative Splicing Modulations in Parkinson's Leukocytes Identified by RNA Sequencing

    Science.gov (United States)

    Soreq, Lilach; Guffanti, Alessandro; Salomonis, Nathan; Simchovitz, Alon; Israel, Zvi; Bergman, Hagai; Soreq, Hermona

    2014-01-01

    The continuously prolonged human lifespan is accompanied by increase in neurodegenerative diseases incidence, calling for the development of inexpensive blood-based diagnostics. Analyzing blood cell transcripts by RNA-Seq is a robust means to identify novel biomarkers that rapidly becomes a commonplace. However, there is lack of tools to discover novel exons, junctions and splicing events and to precisely and sensitively assess differential splicing through RNA-Seq data analysis and across RNA-Seq platforms. Here, we present a new and comprehensive computational workflow for whole-transcriptome RNA-Seq analysis, using an updated version of the software AltAnalyze, to identify both known and novel high-confidence alternative splicing events, and to integrate them with both protein-domains and microRNA binding annotations. We applied the novel workflow on RNA-Seq data from Parkinson's disease (PD) patients' leukocytes pre- and post- Deep Brain Stimulation (DBS) treatment and compared to healthy controls. Disease-mediated changes included decreased usage of alternative promoters and N-termini, 5′-end variations and mutually-exclusive exons. The PD regulated FUS and HNRNP A/B included prion-like domains regulated regions. We also present here a workflow to identify and analyze long non-coding RNAs (lncRNAs) via RNA-Seq data. We identified reduced lncRNA expression and selective PD-induced changes in 13 of over 6,000 detected leukocyte lncRNAs, four of which were inversely altered post-DBS. These included the U1 spliceosomal lncRNA and RP11-462G22.1, each entailing sequence complementarity to numerous microRNAs. Analysis of RNA-Seq from PD and unaffected controls brains revealed over 7,000 brain-expressed lncRNAs, of which 3,495 were co-expressed in the leukocytes including U1, which showed both leukocyte and brain increases. Furthermore, qRT-PCR validations confirmed these co-increases in PD leukocytes and two brain regions, the amygdala and substantia

  14. Application of the verona coding definitions of emotional sequences (VR-CoDES) on a pediatric data set.

    Science.gov (United States)

    Vatne, Torun M; Finset, Arnstein; Ørnes, Knut; Ruland, Cornelia M

    2010-09-01

    Adult patients present concerns as defined in the Verona Coding Definitions of Emotional Sequences (VR-CoDES), but we do not know how children express their concerns during medical consultations. This study aimed to evaluate the applicability of VR-CoDES to pediatric oncology consultations. Twenty-eight pediatric consultations were coded with the Verona Coding Definitions of Emotional Sequences (VR-CoDES), and the material was also qualitatively analyzed for descriptive purposes. Five consultations were randomly selected for reliability testing and descriptive statistics were computed. Perfect inter-rater reliability for concerns and moderate reliability for cues were obtained. Cues and/or concerns were present in over half of the consultations. Cues were more frequent than concerns, with the majority of cues being verbal hints to hidden concerns or non-verbal cues. Intensity of expressions, limitations in vocabulary, commonality of statements, and complexity of the setting complicated the use of VR-CoDES. Child-specific cues; use of the imperative, cues about past experiences, and use of onomatopoeia were observed. Children with cancer express concerns during medical consultations. VR-CoDES is a reliable tool for coding concerns in pediatric data sets. For future applications in pediatric settings an appendix should be developed to incorporate the child-specific traits. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

  15. Sequencing illustrates the transcriptional response of Legionella pneumophila during infection and identifies seventy novel small non-coding RNAs.

    LENUS (Irish Health Repository)

    Weissenmayer, Barbara A

    2011-01-01

    Second generation sequencing has prompted a number of groups to re-interrogate the transcriptomes of several bacterial and archaeal species. One of the central findings has been the identification of complex networks of small non-coding RNAs that play central roles in transcriptional regulation in all growth conditions and for the pathogen\\'s interaction with and survival within host cells. Legionella pneumophila is a gram-negative facultative intracellular human pathogen with a distinct biphasic lifestyle. One of its primary environmental hosts in the free-living amoeba Acanthamoeba castellanii and its infection by L. pneumophila mimics that seen in human macrophages. Here we present analysis of strand specific sequencing of the transcriptional response of L. pneumophila during exponential and post-exponential broth growth and during the replicative and transmissive phase of infection inside A. castellanii. We extend previous microarray based studies as well as uncovering evidence of a complex regulatory architecture underpinned by numerous non-coding RNAs. Over seventy new non-coding RNAs could be identified; many of them appear to be strain specific and in configurations not previously reported. We discover a family of non-coding RNAs preferentially expressed during infection conditions and identify a second copy of 6S RNA in L. pneumophila. We show that the newly discovered putative 6S RNA as well as a number of other non-coding RNAs show evidence for antisense transcription. The nature and extent of the non-coding RNAs and their expression patterns suggests that these may well play central roles in the regulation of Legionella spp. specific traits and offer clues as to how L. pneumophila adapts to its intracellular niche. The expression profiles outlined in the study have been deposited into Genbank\\'s Gene Expression Omnibus (GEO) database under the series accession GSE27232.

  16. Sequencing illustrates the transcriptional response of Legionella pneumophila during infection and identifies seventy novel small non-coding RNAs.

    Directory of Open Access Journals (Sweden)

    Barbara A Weissenmayer

    2011-03-01

    Full Text Available Second generation sequencing has prompted a number of groups to re-interrogate the transcriptomes of several bacterial and archaeal species. One of the central findings has been the identification of complex networks of small non-coding RNAs that play central roles in transcriptional regulation in all growth conditions and for the pathogen's interaction with and survival within host cells. Legionella pneumophila is a gram-negative facultative intracellular human pathogen with a distinct biphasic lifestyle. One of its primary environmental hosts in the free-living amoeba Acanthamoeba castellanii and its infection by L. pneumophila mimics that seen in human macrophages. Here we present analysis of strand specific sequencing of the transcriptional response of L. pneumophila during exponential and post-exponential broth growth and during the replicative and transmissive phase of infection inside A. castellanii. We extend previous microarray based studies as well as uncovering evidence of a complex regulatory architecture underpinned by numerous non-coding RNAs. Over seventy new non-coding RNAs could be identified; many of them appear to be strain specific and in configurations not previously reported. We discover a family of non-coding RNAs preferentially expressed during infection conditions and identify a second copy of 6S RNA in L. pneumophila. We show that the newly discovered putative 6S RNA as well as a number of other non-coding RNAs show evidence for antisense transcription. The nature and extent of the non-coding RNAs and their expression patterns suggests that these may well play central roles in the regulation of Legionella spp. specific traits and offer clues as to how L. pneumophila adapts to its intracellular niche. The expression profiles outlined in the study have been deposited into Genbank's Gene Expression Omnibus (GEO database under the series accession GSE27232.

  17. De novo ORFs in Drosophila are important to organismal fitness and evolved rapidly from previously non-coding sequences.

    Directory of Open Access Journals (Sweden)

    Josephine A Reinhardt

    Full Text Available How non-coding DNA gives rise to new protein-coding genes (de novo genes is not well understood. Recent work has revealed the origins and functions of a few de novo genes, but common principles governing the evolution or biological roles of these genes are unknown. To better define these principles, we performed a parallel analysis of the evolution and function of six putatively protein-coding de novo genes described in Drosophila melanogaster. Reconstruction of the transcriptional history of de novo genes shows that two de novo genes emerged from novel long non-coding RNAs that arose at least 5 MY prior to evolution of an open reading frame. In contrast, four other de novo genes evolved a translated open reading frame and transcription within the same evolutionary interval suggesting that nascent open reading frames (proto-ORFs, while not required, can contribute to the emergence of a new de novo gene. However, none of the genes arose from proto-ORFs that existed long before expression evolved. Sequence and structural evolution of de novo genes was rapid compared to nearby genes and the structural complexity of de novo genes steadily increases over evolutionary time. Despite the fact that these genes are transcribed at a higher level in males than females, and are most strongly expressed in testes, RNAi experiments show that most of these genes are essential in both sexes during metamorphosis. This lethality suggests that protein coding de novo genes in Drosophila quickly become functionally important.

  18. [Influence of "prehistory" of sequential movements of the right and the left hand on reproduction: coding of positions, movements and sequence structure].

    Science.gov (United States)

    Bobrova, E V; Liakhovetskiĭ, V A; Borshchevskaia, E R

    2011-01-01

    The dependence of errors during reproduction of a sequence of hand movements without visual feedback on the previous right- and left-hand performance ("prehistory") and on positions in space of sequence elements (random or ordered by the explicit rule) was analyzed. It was shown that the preceding information about the ordered positions of the sequence elements was used during right-hand movements, whereas left-hand movements were performed with involvement of the information about the random sequence. The data testify to a central mechanism of the analysis of spatial structure of sequence elements. This mechanism activates movement coding specific for the left hemisphere (vector coding) in case of an ordered sequence structure and positional coding specific for the right hemisphere in case of a random sequence structure.

  19. In silico mining of microsatellites in coding sequences of the date palm (Arecaceae) genome, characterization, and transferability.

    Science.gov (United States)

    Aberlenc-Bertossi, Frédérique; Castillo, Karina; Tranchant-Dubreuil, Christine; Chérif, Emira; Ballardini, Marco; Abdoulkader, Sabira; Gros-Balthazard, Muriel; Chabrillange, Nathalie; Santoni, Sylvain; Mercuri, Antonio; Pintaud, Jean-Christophe

    2014-01-01

    To complement existing sets of primarily dinucleotide microsatellite loci from noncoding sequences of date palm, we developed primers for tri- and hexanucleotide microsatellite loci identified within genes. Due to their conserved genomic locations, the primers should be useful in other palm taxa, and their utility was tested in seven other Phoenix species and in Chamaerops, Livistona, and Hyphaene. • Tandem repeat motifs of 3-6 bp were searched using a simple sequence repeat (SSR)-pipeline package in coding portions of the date palm draft genome sequence. Fifteen loci produced highly consistent amplification, intraspecific polymorphisms, and stepwise mutation patterns. • These microsatellite loci showed sufficient levels of variability and transferability to make them useful for population genetic, selection signature, and interspecific gene flow studies in Phoenix and other Coryphoideae genera.

  20. In Silico Mining of Microsatellites in Coding Sequences of the Date Palm (Arecaceae Genome, Characterization, and Transferability

    Directory of Open Access Journals (Sweden)

    Frédérique Aberlenc-Bertossi

    2014-01-01

    Full Text Available Premise of the study: To complement existing sets of primarily dinucleotide microsatellite loci from noncoding sequences of date palm, we developed primers for tri- and hexanucleotide microsatellite loci identified within genes. Due to their conserved genomic locations, the primers should be useful in other palm taxa, and their utility was tested in seven other Phoenix species and in Chamaerops, Livistona, and Hyphaene. Methods and Results: Tandem repeat motifs of 3–6 bp were searched using a simple sequence repeat (SSR–pipeline package in coding portions of the date palm draft genome sequence. Fifteen loci produced highly consistent amplification, intraspecific polymorphisms, and stepwise mutation patterns. Conclusions: These microsatellite loci showed sufficient levels of variability and transferability to make them useful for population genetic, selection signature, and interspecific gene flow studies in Phoenix and other Coryphoideae genera.

  1. Prediction and identification of sequences coding for orphan enzymes using genomic and metagenomic neighbours

    DEFF Research Database (Denmark)

    Yamada, Takuji; Waller, Alison S.; Raes, Jeroen

    2012-01-01

    Despite the current wealth of sequencing data, one-third of all biochemically characterized metabolic enzymes lack a corresponding gene or protein sequence, and as such can be considered orphan enzymes. They represent a major gap between our molecular and biochemical knowledge, and consequently a...

  2. Computer code (WETBERAN) for wet sequence behavior of radioactive nuclides in LWR plant at accident conditions

    International Nuclear Information System (INIS)

    Shimooke, T.; Kobayashi, K.; Sato, S.

    1985-01-01

    The WETBERAN code has been developed to simulate the isotopic- and time-dependent behaviors of fission products (FP) which leak through the multiple paths of liquid and gas flows within LWR plant under accident conditions. In this code, emphasis is put on the phenomena pertinent to the presence of water. The TMI, SL-1 and Ginna accidents were analyzed to show the code capability. The TMI 40 day analysis gave detailed information of FP behaviors, both leaking from and remaining in the plant, and proved effectiveness of the network model describing the multiple leakage paths. The SL-1 analysis was made to study halogen reduction by water, which cannot be taken into account by CORRAL. The Ginna analysis was to check the iodine transport by droplets usually generated by primary water flashing at SG tube rupture

  3. HLA-F coding and regulatory segments variability determined by massively parallel sequencing procedures in a Brazilian population sample.

    Science.gov (United States)

    Lima, Thálitta Hetamaro Ayala; Buttura, Renato Vidal; Donadi, Eduardo Antônio; Veiga-Castelli, Luciana Caricati; Mendes-Junior, Celso Teixeira; Castelli, Erick C

    2016-10-01

    Human Leucocyte Antigen F (HLA-F) is a non-classical HLA class I gene distinguished from its classical counterparts by low allelic polymorphism and distinctive expression patterns. Its exact function remains unknown. It is believed that HLA-F has tolerogenic and immune modulatory properties. Currently, there is little information regarding the HLA-F allelic variation among human populations and the available studies have evaluated only a fraction of the HLA-F gene segment and/or have searched for known alleles only. Here we present a strategy to evaluate the complete HLA-F variability including its 5' upstream, coding and 3' downstream segments by using massively parallel sequencing procedures. HLA-F variability was surveyed on 196 individuals from the Brazilian Southeast. The results indicate that the HLA-F gene is indeed conserved at the protein level, where thirty coding haplotypes or coding alleles were detected, encoding only four different HLA-F full-length protein molecules. Moreover, a same protein molecule is encoded by 82.45% of all coding alleles detected in this Brazilian population sample. However, the HLA-F nucleotide and haplotype variability is much higher than our current knowledge both in Brazilians and considering the 1000 Genomes Project data. This protein conservation is probably a consequence of the key role of HLA-F in the immune system physiology. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  4. Construction and Analysis of a Novel 2-D Optical Orthogonal Codes Based on Modified One-coincidence Sequence

    Science.gov (United States)

    Ji, Jianhua; Wang, Yanfen; Wang, Ke; Xu, Ming; Zhang, Zhipeng; Yang, Shuwen

    2013-09-01

    A new two-dimensional OOC (optical orthogonal codes) named PC/MOCS is constructed, using PC (prime code) for time spreading and MOCS (modified one-coincidence sequence) for wavelength hopping. Compared with PC/PC, the number of wavelengths for PC/MOCS is not limited to a prime number. Compared with PC/OCS, the length of MOCS need not be expanded to the same length of PC. PC/MOCS can be constructed flexibly, and also can use available wavelengths effectively. Theoretical analysis shows that PC/MOCS can reduce the bit error rate (BER) of OCDMA system, and can support more users than PC/PC and PC/OCS.

  5. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  6. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence

    Science.gov (United States)

    Gordon, Kacy L.; Arthur, Robert K.; Ruvinsky, Ilya

    2015-01-01

    Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2) from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements. PMID:26020930

  7. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence.

    Directory of Open Access Journals (Sweden)

    Kacy L Gordon

    2015-05-01

    Full Text Available Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2 from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements.

  8. Multi-scale coding of genomic information: From DNA sequence to genome structure and function

    Energy Technology Data Exchange (ETDEWEB)

    Arneodo, Alain, E-mail: alain.arneodo@ens-lyon.f [Universite de Lyon, F-69000 Lyon (France); Laboratoire Joliot-Curie and Laboratoire de Physique, CNRS, Ecole Normale Superieure de Lyon, F-69007 Lyon (France); Vaillant, Cedric, E-mail: cedric.vaillant@ens-lyon.f [Universite de Lyon, F-69000 Lyon (France); Laboratoire Joliot-Curie and Laboratoire de Physique, CNRS, Ecole Normale Superieure de Lyon, F-69007 Lyon (France); Audit, Benjamin, E-mail: benjamin.audit@ens-lyon.f [Universite de Lyon, F-69000 Lyon (France); Laboratoire Joliot-Curie and Laboratoire de Physique, CNRS, Ecole Normale Superieure de Lyon, F-69007 Lyon (France); Argoul, Francoise, E-mail: francoise.argoul@ens-lyon.f [Universite de Lyon, F-69000 Lyon (France); Laboratoire Joliot-Curie and Laboratoire de Physique, CNRS, Ecole Normale Superieure de Lyon, F-69007 Lyon (France); D' Aubenton-Carafa, Yves, E-mail: daubenton@cgm.cnrs-gif.f [Centre de Genetique Moleculaire, CNRS, Allee de la Terrasse, 91198 Gif-sur-Yvette (France); Thermes, Claude, E-mail: claude.thermes@cgm.cnrs-gif.f [Centre de Genetique Moleculaire, CNRS, Allee de la Terrasse, 91198 Gif-sur-Yvette (France)

    2011-02-15

    Understanding how chromatin is spatially and dynamically organized in the nucleus of eukaryotic cells and how this affects genome functions is one of the main challenges of cell biology. Since the different orders of packaging in the hierarchical organization of DNA condition the accessibility of DNA sequence elements to trans-acting factors that control the transcription and replication processes, there is actually a wealth of structural and dynamical information to learn in the primary DNA sequence. In this review, we show that when using concepts, methodologies, numerical and experimental techniques coming from statistical mechanics and nonlinear physics combined with wavelet-based multi-scale signal processing, we are able to decipher the multi-scale sequence encoding of chromatin condensation-decondensation mechanisms that play a fundamental role in regulating many molecular processes involved in nuclear functions.

  9. Cracking the Code of Human Diseases Using Next-Generation Sequencing: Applications, Challenges, and Perspectives.

    Science.gov (United States)

    Precone, Vincenza; Del Monaco, Valentina; Esposito, Maria Valeria; De Palma, Fatima Domenica Elisa; Ruocco, Anna; Salvatore, Francesco; D'Argenio, Valeria

    2015-01-01

    Next-generation sequencing (NGS) technologies have greatly impacted on every field of molecular research mainly because they reduce costs and increase throughput of DNA sequencing. These features, together with the technology's flexibility, have opened the way to a variety of applications including the study of the molecular basis of human diseases. Several analytical approaches have been developed to selectively enrich regions of interest from the whole genome in order to identify germinal and/or somatic sequence variants and to study DNA methylation. These approaches are now widely used in research, and they are already being used in routine molecular diagnostics. However, some issues are still controversial, namely, standardization of methods, data analysis and storage, and ethical aspects. Besides providing an overview of the NGS-based approaches most frequently used to study the molecular basis of human diseases at DNA level, we discuss the principal challenges and applications of NGS in the field of human genomics.

  10. Cracking the Code of Human Diseases Using Next-Generation Sequencing: Applications, Challenges, and Perspectives

    Directory of Open Access Journals (Sweden)

    Vincenza Precone

    2015-01-01

    Full Text Available Next-generation sequencing (NGS technologies have greatly impacted on every field of molecular research mainly because they reduce costs and increase throughput of DNA sequencing. These features, together with the technology’s flexibility, have opened the way to a variety of applications including the study of the molecular basis of human diseases. Several analytical approaches have been developed to selectively enrich regions of interest from the whole genome in order to identify germinal and/or somatic sequence variants and to study DNA methylation. These approaches are now widely used in research, and they are already being used in routine molecular diagnostics. However, some issues are still controversial, namely, standardization of methods, data analysis and storage, and ethical aspects. Besides providing an overview of the NGS-based approaches most frequently used to study the molecular basis of human diseases at DNA level, we discuss the principal challenges and applications of NGS in the field of human genomics.

  11. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  12. Functional analysis of an intergenic non-coding sequence within mce1 operon of M.tuberculosis

    Directory of Open Access Journals (Sweden)

    Bose Mridula

    2010-04-01

    Full Text Available Abstract Background The mce operons play an important role in the entry of M. tuberculosis into macrophages and non-phagocytic cells. Their non-redundant function as well as complex regulation is implied by the phenotype of mce mutants. Recently, mce1 operon was found to extend over 13 genes, fadD5 (Rv0166 being the first gene of the operon. The presence of a non-coding sequence of 200 base pairs between Rv0166 and Rv0167 is peculiar to mce1 among the four mce operons of M.tuberculosis. We have examined the function of this region. Results We predicted putative promoter activity of the 200 base pairs of non-coding, intergenic region between Rv0166 and Rv0167 in silico using MEME software and designate it as intergenic promoter, IGPr. We demonstrate both promoter activity and a putative negative regulatory function of this fragment by reporter assays carried out in the surrogate host M.smegmatis. We find that the repressive elements not only control the native promoter but also repress a heterologous promoter of M.smegmatis. The higher activity of the intergenic promoter in a clinical isolate in comparison with the wild type sequence from M.tuberculosis H37Rv could be correlated with a point mutation within the negative element. We have mapped two transcription start sites for mce1 operon both of which are utilized in M.tuberculosis H37Rv as well as the clinical isolate VPCI591. Our studies show that the promoter activity in the non-coding region is relevant not only in reporter gene expression but also in the expression of mce1 operon in M. tuberculosis cells grown in synthetic medium. Conclusion The mce operon of M.tuberculosis H37Rv potentially can be transcribed from two promoters P1 and P2, former mapping upstream of Rv0166 and the latter in the non-coding intergenic region between Rv0166 and Rv0167. The transcription initiation from P1 results in a transcript with Rv0166 while that from P2 will be without it. The sequences between the

  13. The structural analysis of protein sequences based on the quasi-amino acids code

    International Nuclear Information System (INIS)

    Ping, Zhu; Xu-Qing, Tang; Zhen-Yuan, Xu

    2009-01-01

    Proteomics is the study of proteins and their interactions in a cell. With the successful completion of the Human Genome Project, it comes the postgenome era when the proteomics technology is emerging. This paper studies protein molecule from the algebraic point of view. The algebraic system (Σ, +, *) is introduced, where Σ is the set of 64 codons. According to the characteristics of (Σ, +, *), a novel quasi-amino acids code classification method is introduced and the corresponding algebraic operation table over the set ZU of the 16 kinds of quasi-amino acids is established. The internal relation is revealed about quasi-amino acids. The results show that there exist some very close correlations between the properties of the quasi-amino acids and the codon. All these correlation relationships may play an important part in establishing the logic relationship between codons and the quasi-amino acids during the course of life origination. According to Ma F et al (2003 J. Anhui Agricultural University 30 439), the corresponding relation and the excellent properties about amino acids code are very difficult to observe. The present paper shows that (ZU, ⊕, ) is a field. Furthermore, the operational results display that the codon tga has different property from other stop codons. In fact, in the mitochondrion from human and ox genomic codon, tga is just tryptophane, is not the stop codon like in other genetic code, it is the case of the Chen W C et al (2002 Acta Biophysica Sinica 18(1) 87). The present theory avoids some inexplicable events of the 20 kinds of amino acids code, in other words it solves the problem of 'the 64 codon assignments of mRNA to amino acids is probably completely wrong' proposed by Yang (2006 Progress in Modern Biomedicine 6 3). (cross-disciplinary physics and related areas of science and technology)

  14. DNA methylation of miRNA coding sequences putatively associated with childhood obesity.

    Science.gov (United States)

    Mansego, M L; Garcia-Lacarte, M; Milagro, F I; Marti, A; Martinez, J A

    2017-02-01

    Epigenetic mechanisms may be involved in obesity onset and its consequences. The aim of the present study was to evaluate whether DNA methylation status in microRNA (miRNA) coding regions is associated with childhood obesity. DNA isolated from white blood cells of 24 children (identification sample: 12 obese and 12 non-obese) from the Grupo Navarro de Obesidad Infantil study was hybridized in a 450 K methylation microarray. Several CpGs whose DNA methylation levels were statistically different between obese and non-obese were validated by MassArray® in 95 children (validation sample) from the same study. Microarray analysis identified 16 differentially methylated CpGs between both groups (6 hypermethylated and 10 hypomethylated). DNA methylation levels in miR-1203, miR-412 and miR-216A coding regions significantly correlated with body mass index standard deviation score (BMI-SDS) and explained up to 40% of the variation of BMI-SDS. The network analysis identified 19 well-defined obesity-relevant biological pathways from the KEGG database. MassArray® validation identified three regions located in or near miR-1203, miR-412 and miR-216A coding regions differentially methylated between obese and non-obese children. The current work identified three CpG sites located in coding regions of three miRNAs (miR-1203, miR-412 and miR-216A) that were differentially methylated between obese and non-obese children, suggesting a role of miRNA epigenetic regulation in childhood obesity. © 2016 World Obesity Federation.

  15. (PCG) Protein Crystal Growth HIV Reverse Transcriptase

    Science.gov (United States)

    1992-01-01

    HIV Reverse Transcriptase crystals grown during the USML-1 (STS-50) mission using Commercial Refrigerator/Incubator Module (CR/IM) at 4 degrees C and the Vapor Diffusion Apparatus (VDA). Reverse transcriptase is an enzyme responsible for copying the nucleic acid genome of the AIDS virus from RNA to DNA. Studies indicated that the space-grown crystals were larger and better ordered (beyond 4 angstroms) than were comparable Earth-grown crystals. Principal Investigators were Charles Bugg and Larry DeLucas.

  16. Sequence of maximal distance codes in graphs or other metric spaces

    Directory of Open Access Journals (Sweden)

    Charles Delorme

    2013-11-01

    Full Text Available Given a subset C in a metric space E, its successor is the subset  s(C of points at maximum distance from C in E. We study some properties of the sequence obtained by iterating this operation.  Graphs with their usual distance provide already typical examples.

  17. Analysis of mutations in the entire coding sequence of the factor VIII gene

    Energy Technology Data Exchange (ETDEWEB)

    Bidichadani, S.I.; Lanyon, W.G.; Connor, J.M. [Glascow Univ. (United Kingdom)] [and others

    1994-09-01

    Hemophilia A is a common X-linked recessive disorder of bleeding caused by deleterious mutations in the gene for clotting factor VIII. The large size of the factor VIII gene, the high frequency of de novo mutations and its tissue-specific expression complicate the detection of mutations. We have used a combination of RT-PCR of ectopic factor VIII transcripts and genomic DNA-PCRs to amplify the entire essential sequence of the factor VIII gene. This is followed by chemical mismatch cleavage analysis and direct sequencing in order to facilitate a comprehensive search for mutations. We describe the characterization of nine potentially pathogenic mutations, six of which are novel. In each case, a correlation of the genotype with the observed phenotype is presented. In order to evaluate the pathogenicity of the five missense mutations detected, we have analyzed them for evolutionary sequence conservation and for their involvement of sequence motifs catalogued in the PROSITE database of protein sites and patterns.

  18. Comparative analysis of protein coding sequences from human, mouse and the domesticated pig

    DEFF Research Database (Denmark)

    Jørgensen, Frank Grønlund; Hobolth, Asger; Hornshøj, Henrik

    2005-01-01

    Background: The availability of abundant sequence data from key model organisms has made large scale studies of mulecular evolution an exciting possibility. Here we use full length cDNA alignments comprising more than 700,000 nucleotides from human, mouse, pig and the Japanese pufferfish Fugu...

  19. Full-length coding sequences of three major histocompatibility complex class I-related chain A alleles, MICA*019, MICA*027 and MICA*045, identified by sequence-based typing in Chinese individuals.

    Science.gov (United States)

    Xu, Y P; Gao, S Q; Tao, H

    2015-10-01

    Full-length coding sequences of three major histocompatibility complex class I-related chain A alleles, MICA*019, MICA*027 and MICA*045. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. CpG + CpNpG Analysis of Protein-Coding Sequences from Tomato

    DEFF Research Database (Denmark)

    Hobolth, Asger; Nielsen, Rasmus; Wang, Ying

    2006-01-01

    We develop codon-based models for simultaneously inferring the mutational effects of CpG and CpNpG methylation in coding regions. In a data set of 369 tomato genes, we show that there is very little effect of CpNpG methylation but a strong effect of CpG methylation affecting almost all genes. We...... further show that the CpNpG and CpG effects are largely uncorrelated. Our results suggest different roles of CpG and CpNpG methylation, with CpNpG methylation possibly playing a specialized role in defense against transposons and RNA viruses....

  1. Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

    International Nuclear Information System (INIS)

    Bavand, M.R.; Laub, O.

    1988-01-01

    Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

  2. Non coding RNA: sequence-specific guide for chromatin modification and DNA damage signaling

    Directory of Open Access Journals (Sweden)

    Sofia eFrancia

    2015-11-01

    Full Text Available Chromatin conformation shapes the environment in which our genome is transcribed into RNA. Transcription is a source of DNA damage, thus it often occurs concomitantly to DNA damage signaling. Growing amounts of evidence suggest that different types of RNAs can, independently from their protein-coding properties, directly affect chromatin conformation, transcription and splicing, as well as promote the activation of the DNA damage response (DDR and DNA repair. Therefore, transcription paradoxically functions to both threaten and safeguard genome integrity. On the other hand, DNA damage signaling is known to modulate chromatin to suppress transcription of the surrounding genetic unit. It is thus intriguing to understand how transcription can modulate DDR signaling while, in turn, DDR signaling represses transcription of chromatin around the DNA lesion. An unexpected player in this field is the RNA interference (RNAi machinery, which play roles in transcription, splicing and chromatin modulation in several organisms. Non-coding RNAs (ncRNAs and several protein factors involved in the RNAi pathway are well known master regulators of chromatin while only recent reports suggest that ncRNAs are involved in DDR signaling and homology-mediated DNA repair. Here, we discuss the experimental evidence supporting the idea that ncRNAs act at the genomic loci from which they are transcribed to modulate chromatin, DDR signaling and DNA repair.

  3. Motion-compensated visual pattern image sequence coding for full-motion multisession videoconferencing on multimedia workstations

    Science.gov (United States)

    Barnett, Barry S.; Bovik, Alan C.

    1996-04-01

    Motion-compensated visual pattern image sequence coding (MCVPISC) is an improved motion-compensated version of the visual pattern image sequence coding (VPISC) encoder. It is a high-performance video codec that is easily implemented in software. The MCVPISC codec is intended for real-time desktop computer applications such as multimedia delivery, local area network and point-to-point (modem) video conferencing. We describe a version of MCVPISC that has achieved bit rates of 0.15 bits/pixel or better for MPEG-2 test sequences (source encoding reduces this bit rate by about half). The computational complexity of the monochrome and color versions of the encoder is less than three integer operations per pixel. The decoder is bounded between 0.016 and 0.125 logical and integer operations per pixel. A prototype video conferencing system based on the MCVPISC codec has been implemented. The system hardware is comprised of two multimedia personal computers, two camcorders, two frame grabbers, and an ethernet connection. The prototype system software has a simple structure and runs under DOS and WindowsTM 3.1. It includes a user interface, a video IIO interface, an event driven network interface, and a free running or frame synchronous video codec that also acts as the controller for the video and network interfaces. We have demonstrated that this prototype can support up to five full duplex full-motion video conferencing sessions. Future work will concentrate on expanding the prototype to support synchronous audio, multiple hardware and software platforms, and network protocols.

  4. Isotope-coded N-terminal sulfonation of peptides allows quantitative proteomic analysis with increased de novo peptide sequencing capability.

    Science.gov (United States)

    Lee, Yong Ho; Han, Hoon; Chang, Seok-Bok; Lee, Sang-Won

    2004-01-01

    Recently various methods for the N-terminal sulfonation of peptides have been developed for the mass spectrometric analyses of proteomic samples to facilitate de novo sequencing of the peptides produced. This paper describes the isotope-coded N-terminal sulfonation (ICenS) of peptides; this procedure allows both de novo peptide sequencing and quantitative proteomics to be studied simultaneously. As N-terminal sulfonation reagents, 13C-labeled 4-sulfophenyl[13C6]isothiocyanate (13C-SPITC) and unlabeled 4-sulfophenyl isothiocyanate (12C-SPITC) were synthesized. The experimental and reference peptide mixtures were derivatized independently using 13C-SPITC and 12C-SPITC and then combined to generate an isotopically labeled peptide mixture in which each isotopic pair differs in mass by 6 Da. Capillary reverse-phase liquid chromatography/tandem mass spectrometry experiments on the resulting peptide mixtures revealed several immediate advantages of ICenS in addition to the de novo sequencing capability of N-terminal sulfonation, namely, differentiation between N-terminal sulfonated peptides and unmodified peptides in mass spectra, differentiation between N- and C-terminal fragments in tandem mass spectra of multiply protonated peptides by comparing fragmentations of the isotopic pairs, and relative peptide quantification between proteome samples. We demonstrate that the combination of N-terminal sulfonation and isotope coding in the mass spectrometric analysis of proteomic samples is a viable method that overcomes many problems associated with current N-terminal sulfonation methods. Copyright 2004 John Wiley & Sons, Ltd.

  5. RevTrans: multiple alignment of coding DNA from aligned amino acid sequences

    DEFF Research Database (Denmark)

    Wernersson, Rasmus; Pedersen, Anders Gorm

    2003-01-01

    The simple fact that proteins are built from 20 amino acids while DNA only contains four different bases, means that the 'signal-to-noise ratio' in protein sequence alignments is much better than in alignments of DNA. Besides this information-theoretical advantage, protein alignments also benefit...... analysis. RevTrans also accepts user-provided protein alignments for greater control of the alignment process. The RevTrans web server is freely available at http://www.cbs.dtu.dk/services/RevTrans/....

  6. Identification of novel long non-coding RNAs deregulated in hepatocellular carcinoma using RNA-sequencing.

    Science.gov (United States)

    Esposti, Davide Degli; Hernandez-Vargas, Hector; Voegele, Catherine; Fernandez-Jimenez, Nora; Forey, Nathalie; Bancel, Brigitte; Le Calvez-Kelm, Florence; McKay, James; Merle, Philippe; Herceg, Zdenko

    2016-05-31

    Functional characterization of long non-coding RNAs (lncRNAs) and their pathological relevance is still a challenging task. Abnormal expression of a few long non-coding RNAs have been found associated with hepatocellular carcinoma, with potential implications to both improve our understanding of molecular mechanism of liver carcinogenesis and to discover biomarkers for early diagnosis or therapy. However, the understanding of the global role of lncRNAs during HCC development is still in its infancy. In this study, we produced RNA-Seq data from 23 liver tissues (controls, cirrhotic and HCCs) and applied statistical and gene network analysis approaches to identify and characterize expressed lncRNAs. We detected 5,525 lncRNAs across different tissue types and identified 57 differentially expressed lncRNAs in HCC compared with adjacent non-tumour tissues using stringent criteria (FDR2). Using weighted gene co-expression network analysis (WGCNA), we found that differentially expressed lncRNAs are co-expressed with genes involved in cell cycle regulation, TGF-β signalling and liver metabolism. Furthermore, we found that more than 20% of differentially expressed lncRNAs are associated to actively transcribed enhancers and that the co-expression patterns with their closest genes change dramatically during HCC development. Our study provides the most comprehensive compendium of lncRNAs expressed in HCC, as well as in control or cirrhotic livers. Our results identified both known oncogenic lncRNAs (such as H19 and CRNDE) and novel lncRNAs involved in cell cycle deregulation and liver metabolism deficits occurring during HCC development.

  7. Validation of the Serpent 2-DYNSUB code sequence using the Special Power Excursion Reactor Test III (SPERT III)

    International Nuclear Information System (INIS)

    Knebel, Miriam; Mercatali, Luigi; Sanchez, Victor; Stieglitz, Robert; Macian-Juan, Rafael

    2016-01-01

    Highlights: • Full few-group cross section tables created by Monte Carlo lattice code Serpent 2. • Serpent 2 group constant methodology verified for HFP static and transient cases. • Serpent 2-DYNSUB tool chainvalidated using SPERT III REA experiments. • Serpent 2-DYNSUB tool chain suitable to model RIAs in PWRs. - Abstract: The Special Power Excursion Reactor Test III (SPERT III) is studied using the Serpent 2-DYNSUB code sequence in order to validate it for modeling reactivity insertion accidents (RIA) in PWRs. The SPERT III E-core was a thermal research reactor constructed to analyze reactor dynamics. Its configuration resembles a commercial PWR on terms of fuel type, choice of moderator, coolant flow and system pressure. The initial conditions of the rod ejection accident experiments (REA) performed cover cold startup, hot startup, hot standby and operating power scenarios. Eight of these experiments were analyzed in detail. Firstly, multi-dimensional nodal diffusion cross section tables were created for the three-dimensional reactor simulator DYNSUB employing the Monte Carlo neutron transport code Serpent 2. In a second step, DYNSUB stationary simulations were compared to Monte Carlo reference three-dimensional full scale solutions obtained with Serpent 2 (cold startup conditions) and Serpent 2/SUBCHANFLOW (operating power conditions) with a good agreement being observed. The latter tool is an internal coupling of Serpent 2 and the sub-channel thermal-hydraulics code SUBCHANFLOW. Finally, DYNSUB was utilized to study the eight selected transient experiments. Results were found to match measurements well. As the selected experiments cover much of the possible transient (delayed super-critical, prompt super-critical and super-prompt critical excursion) and initial conditions (cold and hot as well as zero, little and full power reactor states) one expects in commercial PWRs, the obtained results give confidence that the Serpent 2-DYNSUB tool chain is

  8. Species delimitation and phylogenetic reconstruction of the sinipercids (Perciformes: Sinipercidae) based on target enrichment of thousands of nuclear coding sequences.

    Science.gov (United States)

    Song, Shuli; Zhao, Jinliang; Li, Chenhong

    2017-06-01

    The sinipercids are freshwater fishes endemic to East Asia, mainly in China. Phylogenetic studies on the sinipercids have made great progress in the last decades, but interspecific relationships and evolutionary history of the sinipercids remain unresolved. Lack of distinctive morphological characters leads to problems in validating of some species, such as Siniperca loona. Moreover, genetic data are needed to delimitate species pairs with explicit hypothesis testing, such as in S. chuatsi vs. S. kneri and Coreoperca whiteheadi vs. C. liui. Here we reconstructed phylogeny of the sinipercids with an unprecedented scale of data, 16,943 loci of single-copy coding sequence data from nine sinipercid species, eight putative sister taxa and two outgroups. Targeted sequences were collected using gene enrichment and Illumina sequencing, yielding thousands of protein coding sequences and single nucleotide polymorphisms (SNPs) data. Maximum likelihood and coalescent species tree analyses resulted in identical and highly supported trees. We confirmed that the centrarchids are sister to the sinipercids. A monophyletic Sinipercidae with two genera, Siniperca and Coreoperca was also supported. Different from most previous studies, S. scherzeri was found as the most basal taxon to other species of Siniperca, which consists of two clades: a clade having S. roulei sister to S. chuatsi and S. kneri, and a clade consisting S. loona sister to S. obscura and S. undulata. We found that both S. loona and C. liui are valid species using Bayes factor delimitation (BFD ∗ ) based on SNPs data. Species delimitation also provided decisive support for S. chuatsi and S. kneri being two distinct species. We calibrated a chronogram of the sinipercids based on 100 loci and three fossil calibration points using BEAST, and reconstructed ancestral ranges of the sinipercids using Lagrange Analysis (DEC model) and Statistical Dispersal-Vicariance Analysis (S-DIVA) implemented in RASP. Divergence time

  9. Deconstruction of archaeal genome depict strategic consensus in core pathways coding sequence assembly.

    Directory of Open Access Journals (Sweden)

    Ayon Pal

    Full Text Available A comprehensive in silico analysis of 71 species representing the different taxonomic classes and physiological genre of the domain Archaea was performed. These organisms differed in their physiological attributes, particularly oxygen tolerance and energy metabolism. We explored the diversity and similarity in the codon usage pattern in the genes and genomes of these organisms, emphasizing on their core cellular pathways. Our thrust was to figure out whether there is any underlying similarity in the design of core pathways within these organisms. Analyses of codon utilization pattern, construction of hierarchical linear models of codon usage, expression pattern and codon pair preference pointed to the fact that, in the archaea there is a trend towards biased use of synonymous codons in the core cellular pathways and the Nc-plots appeared to display the physiological variations present within the different species. Our analyses revealed that aerobic species of archaea possessed a larger degree of freedom in regulating expression levels than could be accounted for by codon usage bias alone. This feature might be a consequence of their enhanced metabolic activities as a result of their adaptation to the relatively O2-rich environment. Species of archaea, which are related from the taxonomical viewpoint, were found to have striking similarities in their ORF structuring pattern. In the anaerobic species of archaea, codon bias was found to be a major determinant of gene expression. We have also detected a significant difference in the codon pair usage pattern between the whole genome and the genes related to vital cellular pathways, and it was not only species-specific but pathway specific too. This hints towards the structuring of ORFs with better decoding accuracy during translation. Finally, a codon-pathway interaction in shaping the codon design of pathways was observed where the transcription pathway exhibited a significantly different coding

  10. Deconstruction of archaeal genome depict strategic consensus in core pathways coding sequence assembly.

    Science.gov (United States)

    Pal, Ayon; Banerjee, Rachana; Mondal, Uttam K; Mukhopadhyay, Subhasis; Bothra, Asim K

    2015-01-01

    A comprehensive in silico analysis of 71 species representing the different taxonomic classes and physiological genre of the domain Archaea was performed. These organisms differed in their physiological attributes, particularly oxygen tolerance and energy metabolism. We explored the diversity and similarity in the codon usage pattern in the genes and genomes of these organisms, emphasizing on their core cellular pathways. Our thrust was to figure out whether there is any underlying similarity in the design of core pathways within these organisms. Analyses of codon utilization pattern, construction of hierarchical linear models of codon usage, expression pattern and codon pair preference pointed to the fact that, in the archaea there is a trend towards biased use of synonymous codons in the core cellular pathways and the Nc-plots appeared to display the physiological variations present within the different species. Our analyses revealed that aerobic species of archaea possessed a larger degree of freedom in regulating expression levels than could be accounted for by codon usage bias alone. This feature might be a consequence of their enhanced metabolic activities as a result of their adaptation to the relatively O2-rich environment. Species of archaea, which are related from the taxonomical viewpoint, were found to have striking similarities in their ORF structuring pattern. In the anaerobic species of archaea, codon bias was found to be a major determinant of gene expression. We have also detected a significant difference in the codon pair usage pattern between the whole genome and the genes related to vital cellular pathways, and it was not only species-specific but pathway specific too. This hints towards the structuring of ORFs with better decoding accuracy during translation. Finally, a codon-pathway interaction in shaping the codon design of pathways was observed where the transcription pathway exhibited a significantly different coding frequency signature.

  11. OFFSCALE: A PC input processor for the SCALE code system. The CSASIN processor for the criticality sequences

    International Nuclear Information System (INIS)

    Bowman, S.M.

    1994-11-01

    OFFSCALE is a suite of personal computer input processor programs developed at Oak Ridge National Laboratory to provide an easy-to-use interface for modules in the SCALE-4 code system. CSASIN (formerly known as OFFSCALE) is a program in the OFFSCALE suite that serves as a user-friendly interface for the Criticality Safety Analysis Sequences (CSAS) available in SCALE-4. It is designed to assist a SCALE-4 user in preparing an input file for execution of criticality safety problems. Output from CSASIN generates an input file that may be used to execute the CSAS control module in SCALE-4. CSASIN features a pulldown menu system that accesses sophisticated data entry screens. The program allows the user to quickly set up a CSAS input file and perform data checking. This capability increases productivity and decreases the chance of user error

  12. [Analyses of coding sequence point mutation and polymorphism of TGFBI gene in Chinese patients with keratoconus].

    Science.gov (United States)

    GUAN, Tao; MA, Zhang-wei; DING, Shi-ping

    2011-04-01

    To investigate the point mutations and polymorphisms of transforming growth factor beta-induced gene (TGFBI) in Chinese patients with keratoconus and discuss the relationship between the feature of gene mutations and single nucleotide polymorphisms of TGFBI gene and keratoconus. Polymerase chain reaction single strand conformation polymorphism and DNA direct sequencing were performed in 30 keratoconus cases and 30 healthy controls. All 17 exons of the TGFBI gene were analyzed for point mutations and single nucleotide polymorphisms. Totally two heterozygous nucleotide changes were identified in exon 12 of the TGFBI gene. The codon 535 is changed from GGA to TGA in 1 patient, leading to a substitution of glycine to a stop codon at the protein level (G535X). The codon 540 is changed from TTT to TTC in 2 patients and 1 control individual, resulting in a nonsense mutation (F54F), and is a single nucleotide polymorphism of the gene. Mutation and polymorphisms of the TGFBI gene were detected in Chinese patients with keratoconus in this study. The results suggest that TGFBI gene might play an important role in the pathogenesis of keratoconus.

  13. Consistent levels of A-to-I RNA editing across individuals in coding sequences and non-conserved Alu repeats

    Directory of Open Access Journals (Sweden)

    Osenberg Sivan

    2010-10-01

    Full Text Available Abstract Background Adenosine to inosine (A-to-I RNA-editing is an essential post-transcriptional mechanism that occurs in numerous sites in the human transcriptome, mainly within Alu repeats. It has been shown to have consistent levels of editing across individuals in a few targets in the human brain and altered in several human pathologies. However, the variability across human individuals of editing levels in other tissues has not been studied so far. Results Here, we analyzed 32 skin samples, looking at A-to-I editing level in three genes within coding sequences and in the Alu repeats of six different genes. We observed highly consistent editing levels across different individuals as well as across tissues, not only in coding targets but, surprisingly, also in the non evolutionary conserved Alu repeats. Conclusions Our findings suggest that A-to-I RNA-editing of Alu elements is a tightly regulated process and, as such, might have been recruited in the course of primate evolution for post-transcriptional regulatory mechanisms.

  14. The Number, Organization, and Size of Polymorphic Membrane Protein Coding Sequences as well as the Most Conserved Pmp Protein Differ within and across Chlamydia Species.

    Science.gov (United States)

    Van Lent, Sarah; Creasy, Heather Huot; Myers, Garry S A; Vanrompay, Daisy

    2016-01-01

    Variation is a central trait of the polymorphic membrane protein (Pmp) family. The number of pmp coding sequences differs between Chlamydia species, but it is unknown whether the number of pmp coding sequences is constant within a Chlamydia species. The level of conservation of the Pmp proteins has previously only been determined for Chlamydia trachomatis. As different Pmp proteins might be indispensible for the pathogenesis of different Chlamydia species, this study investigated the conservation of Pmp proteins both within and across C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci. The pmp coding sequences were annotated in 16 C. trachomatis, 6 C. pneumoniae, 2 C. abortus, and 16 C. psittaci genomes. The number and organization of polymorphic membrane coding sequences differed within and across the analyzed Chlamydia species. The length of coding sequences of pmpA,pmpB, and pmpH was conserved among all analyzed genomes, while the length of pmpE/F and pmpG, and remarkably also of the subtype pmpD, differed among the analyzed genomes. PmpD, PmpA, PmpH, and PmpA were the most conserved Pmp in C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci, respectively. PmpB was the most conserved Pmp across the 4 analyzed Chlamydia species. © 2016 S. Karger AG, Basel.

  15. Nonsense mutation in the glycoprotein Ibα coding sequence associated with Bernard-Soulier syndrome

    International Nuclear Information System (INIS)

    Ware, J.; Russell, S.R.; Vicente, V.; Scharf, R.E.; Tomer, A.; McMillian, R.; Ruggeri, Z.M.

    1990-01-01

    Three distinct gene products, the α and β chains of glycoprotein (GP) Ib and GP IX, constitute the platelet membrane GP Ib-IX complex, a receptor for von Willebrand factor and thrombin involved in platelet adhesion and aggregation. Defective function of the GP Ib-IX complex is the hallmark of a rare congenital bleeding disorder of still undefined pathogenesis, the Bernard-Soulier syndrome. The authors have analyzed the molecular basis of the disease in one patient in whom immunoblotting of solubilized platelets demonstrated absence of normal GP Ibα but presence of a smaller immunoreactive species. The truncated polypeptide was also present, along with normal protein, in platelets from the patient's mother and two of his four children. Genetic characterization identified a nucleotide transition changing the Trp-343 codon (TGG) to a nonsense codon (TGA). Such a mutation explains the origin of the smaller GP Ibα, which by lacking half of the sequence on the carboxyl-terminal side, including the transmembrane domain, cannot be properly inserted in the platelet membrane. Both normal and mutant codons were found in the patient, suggesting that he is a compound heterozygote with a still unidentified defect in the other GP Ibα allele. Nonsense mutation and truncated GP Ibα polypeptide were found to cosegregate in four individuals through three generations and were associated with either Bernard-Soulier syndrome or carrier state phenotype. The molecular abnormality demonstrated in this family provides evidence that defective synthesis of GP Ibα alters the membrane expression of the GP Ib-IX complex and may be responsible for Bernard-Soulier syndrome

  16. Absence of mutations in the coding sequence of the potential tumor suppressor 3pK in metastatic melanoma

    Directory of Open Access Journals (Sweden)

    Houben Roland

    2005-12-01

    Full Text Available Abstract Background Activation of Ras or Raf contributes to tumorigenesis of melanoma. However, constitutive Raf activation is also a characteristic of the majority of benign melanocytic nevi and high intensity signaling of either Ras or Raf was found to induce growth inhibition and senescence rather than transformation. Since the chromosome 3p kinase (3pK is a target of the Ras/Raf/Mek/Erk signaling pathway which antagonizes the function of the oncogene and anti-differentiation factor Bmi-1, 3pK may function as a tumor suppressor in tumors with constitutive Ras/Raf activation. Consequently, we tested whether inactivating 3pK mutations are present in melanoma. Methods 30 metastatic melanoma samples, which were positive for activating mutations of either BRaf or NRas, were analyzed for possible mutations in the 3pk gene. The 10 coding exons and their flanking intron sequences were amplified by PCR and direct sequencing of the PCR products was performed. Results This analysis revealed that besides the presence of some single nucleotide polymorphisms in the 3pk gene, we could not detect any possible loss of function mutation in any of these 30 metastatic melanoma samples selected for the presence of activating mutations within the Ras/Raf/Mek/Erk signaling pathway. Conclusion Hence, in melanoma with constitutively active Ras/Raf inactivating mutations within the 3pk gene do not contribute to the oncogenic phenotype of this highly malignant tumor.

  17. Genomic integration of the full-length dystrophin coding sequence in Duchenne muscular dystrophy induced pluripotent stem cells.

    Science.gov (United States)

    Farruggio, Alfonso P; Bhakta, Mital S; du Bois, Haley; Ma, Julia; P Calos, Michele

    2017-04-01

    The plasmid vectors that express the full-length human dystrophin coding sequence in human cells was developed. Dystrophin, the protein mutated in Duchenne muscular dystrophy, is extraordinarily large, providing challenges for cloning and plasmid production in Escherichia coli. The authors expressed dystrophin from the strong, widely expressed CAG promoter, along with co-transcribed luciferase and mCherry marker genes useful for tracking plasmid expression. Introns were added at the 3' and 5' ends of the dystrophin sequence to prevent translation in E. coli, resulting in improved plasmid yield. Stability and yield were further improved by employing a lower-copy number plasmid origin of replication. The dystrophin plasmids also carried an attB site recognized by phage phiC31 integrase, enabling the plasmids to be integrated into the human genome at preferred locations by phiC31 integrase. The authors demonstrated single-copy integration of plasmid DNA into the genome and production of human dystrophin in the human 293 cell line, as well as in induced pluripotent stem cells derived from a patient with Duchenne muscular dystrophy. Plasmid-mediated dystrophin expression was also demonstrated in mouse muscle. The dystrophin expression plasmids described here will be useful in cell and gene therapy studies aimed at ameliorating Duchenne muscular dystrophy. Copyright © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

    International Nuclear Information System (INIS)

    Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.

    2004-01-01

    Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

  19. Sequencing the GRHL3 Coding Region Reveals Rare Truncating Mutations and a Common Susceptibility Variant for Nonsyndromic Cleft Palate

    Science.gov (United States)

    Mangold, Elisabeth; Böhmer, Anne C.; Ishorst, Nina; Hoebel, Ann-Kathrin; Gültepe, Pinar; Schuenke, Hannah; Klamt, Johanna; Hofmann, Andrea; Gölz, Lina; Raff, Ruth; Tessmann, Peter; Nowak, Stefanie; Reutter, Heiko; Hemprich, Alexander; Kreusch, Thomas; Kramer, Franz-Josef; Braumann, Bert; Reich, Rudolf; Schmidt, Gül; Jäger, Andreas; Reiter, Rudolf; Brosch, Sibylle; Stavusis, Janis; Ishida, Miho; Seselgyte, Rimante; Moore, Gudrun E.; Nöthen, Markus M.; Borck, Guntram; Aldhorae, Khalid A.; Lace, Baiba; Stanier, Philip; Knapp, Michael; Ludwig, Kerstin U.

    2016-01-01

    Nonsyndromic cleft lip with/without cleft palate (nsCL/P) and nonsyndromic cleft palate only (nsCPO) are the most frequent subphenotypes of orofacial clefts. A common syndromic form of orofacial clefting is Van der Woude syndrome (VWS) where individuals have CL/P or CPO, often but not always associated with lower lip pits. Recently, ∼5% of VWS-affected individuals were identified with mutations in the grainy head-like 3 gene (GRHL3). To investigate GRHL3 in nonsyndromic clefting, we sequenced its coding region in 576 Europeans with nsCL/P and 96 with nsCPO. Most strikingly, nsCPO-affected individuals had a higher minor allele frequency for rs41268753 (0.099) than control subjects (0.049; p = 1.24 × 10−2). This association was replicated in nsCPO/control cohorts from Latvia, Yemen, and the UK (pcombined = 2.63 × 10−5; ORallelic = 2.46 [95% CI 1.6–3.7]) and reached genome-wide significance in combination with imputed data from a GWAS in nsCPO triads (p = 2.73 × 10−9). Notably, rs41268753 is not associated with nsCL/P (p = 0.45). rs41268753 encodes the highly conserved p.Thr454Met (c.1361C>T) (GERP = 5.3), which prediction programs denote as deleterious, has a CADD score of 29.6, and increases protein binding capacity in silico. Sequencing also revealed four novel truncating GRHL3 mutations including two that were de novo in four families, where all nine individuals harboring mutations had nsCPO. This is important for genetic counseling: given that VWS is rare compared to nsCPO, our data suggest that dominant GRHL3 mutations are more likely to cause nonsyndromic than syndromic CPO. Thus, with rare dominant mutations and a common risk variant in the coding region, we have identified an important contribution for GRHL3 in nsCPO. PMID:27018475

  20. C.U.R.R.F. (Codon Usage regarding Restriction Finder): a free Java(®)-based tool to detect potential restriction sites in both coding and non-coding DNA sequences.

    Science.gov (United States)

    Gatter, Michael; Gatter, Thomas; Matthäus, Falk

    2012-10-01

    The synthesis of complete genes is becoming a more and more popular approach in heterologous gene expression. Reasons for this are the decreasing prices and the numerous advantages in comparison to classic molecular cloning methods. Two of these advantages are the possibility to adapt the codon usage to the host organism and the option to introduce restriction enzyme target sites of choice. C.U.R.R.F. (Codon Usage regarding Restriction Finder) is a free Java(®)-based software program which is able to detect possible restriction sites in both coding and non-coding DNA sequences by introducing multiple silent or non-silent mutations, respectively. The deviation of an alternative sequence containing a desired restriction motive from the sequence with the optimal codon usage is considered during the search of potential restriction sites in coding DNA and mRNA sequences as well as protein sequences. C.U.R.R.F is available at http://www.zvm.tu-dresden.de/die_tu_dresden/fakultaeten/fakultaet_mathematik_und_naturwissenschaften/fachrichtung_biologie/mikrobiologie/allgemeine_mikrobiologie/currf.

  1. Phenobarbital-dependent protein binding to Barbie box-like sequences in the coding region of cytochrome P450BM-3 gene from Bacillus megaterium.

    Science.gov (United States)

    Gaidamakova, E K; Alpatov, O V; Ischenko, I V; Kovalenko, S P; Lyakhovich, V V

    1996-12-12

    Phenobarbital-dependent protein binding was shown to occur to DNA fragments from the coding region of the cytochrome P450BM-3 gene from Bacillus megaterium. Incubation of the DNA fragments from the coding region of the gene with total cell extract from Bacillus megaterium revealed two DNA regions with protein-binding capacity: +237/+318 and +319/+425 considering 'O' as the start of cytochrome P450BM-3 translation. DNaseI footprint analysis of the fragment +319/+425 with the total cell extract showed that some protein(s) protected DNA stretches from the position +373 up to the position +389 on the transcribed strand and from the position +378 up to the position +398 on the non-transcribed strand. DNaseI footprint analysis of the fragment +237/+318 revealed the protection in the region +262/+277 on the non-transcribed strand. Three regions protected by cell extract protein(s) from DNaseI hydrolysis (+262/+277, +373/+389 and +378/+398) appeared to be strongly homologous to the Barbie box sequence. Barbie-box-like sequences were found in the majority of regulatory regions of phenobarbital-inducible genes whose regulatory sequences had been reported (Fulco et al., 1994). Our results suggest that a functional role of Barbie box sequence takes place not only in regulatory but also in the coding region of the gene. In line with that hypothesis we analyzed all cytochrome P450 genes in respect to the presence of Barbie box-like sequences in their coding parts. At least one cytochrome P450 gene (CYP6A1, phenobarbital-inducible gene from Musca domestica) was shown to contain Barbie box sequence in the coding part of the gene.

  2. Practical Considerations For Developing Nucleoside Reverse Transcriptase Inhibitors

    OpenAIRE

    Hurwitz, Selwyn J.; Schinazi, Raymond F.

    2012-01-01

    Nucleoside reverse transcriptase inhibitors (NRTI) remain a cornerstone of current antiretroviral regimens in combinations usually with a non-nucleoside reverse transcriptase inhibitor (NNRTI), a protease inhibitor (PI), or an integrase inhibitor (INI). The antiretroviral efficacy and relative safety of current NRTI results from a tight and relatively specific binding of their phosphorylated nucleoside triphosphates (NRTI-TP) with the HIV-1 reverse transcriptase which is ess...

  3. Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research

    Science.gov (United States)

    Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in the architecture of eukaryotic genomes and are the evolutionary origin of retroviruses, including human immunodeficiency virus (HIV).

  4. TRENDS [Transport and Retention of Nuclides in Dominant Sequences]: A code for modeling iodine behavior in containment during severe accidents

    International Nuclear Information System (INIS)

    Weber, C.F.; Beahm, E.C.; Kress, T.S.; Daish, S.R.; Shockley, W.E.

    1989-01-01

    The ultimate aim of a description of iodine behavior in severe LWR accidents is a time-dependent accounting of iodine species released into containment and to the environment. Factors involved in the behavior of iodine can be conveniently divided into four general categories: (1) initial release into containment, (2) interaction of iodine species in containment not directly involving water pools, (3) interaction of iodine species in, or with, water pools, and (4) interaction with special systems such as ice condensers or gas treatment systems. To fill the large gaps in knowledge and to provide a means for assaying the iodine source term, this program has proceeded along two paths: (1) Experimental studies of the chemical behavior of iodine under containment conditions. (2) Development of TRENDS (Transport and Retention of Nuclides in Dominant Sequences), a computer code for modeling the behavior of iodine in containment and its release from containment. The main body of this report consists of a description of TRENDS. These two parts to the program are complementary in that models within TRENDS use data that were produced in the experimental program; therefore, these models are supported by experimental evidence that was obtained under conditions expected in severe accidents. 7 refs., 1 fig., 2 tabs

  5. Older persons' worries expressed during home care visits: exploring the content of cues and concerns identified by the Verona coding definitions of emotional sequences.

    NARCIS (Netherlands)

    Hafskjold, L.; Eide, T.; Holmström, I.K.; Sundling, V.; Dulmen, S. van; Eide, H.

    2016-01-01

    Objective: Little is known about how older persons in home care express their concerns. Emotional cues and concerns can be identified by the Verona coding definitions of emotional sequences (VR-CoDES), but the method gives no insight into what causes the distress and the emotions involved. The aims

  6. Serotype identification and VP1 coding sequence analysis of foot-and-mouth disease virus from outbreaks in Eastern and Northern Uganda in 2008/9

    DEFF Research Database (Denmark)

    Kasambula, L.; Belsham, Graham; Siegismund, H. R.

    2012-01-01

    was to identify the serotype and compare the variable protein (VP)1 coding sequences of the viruses responsible for FMD outbreaks during 2008 and 2009, to trace the transmission pathways of the disease in Uganda. Probang and epithelial swab samples were collected from cattle with clinical signs of FMD in the two......In April 2008, foot-and-mouth disease (FMD) outbreaks were reported in Kamuli district of the eastern region of Uganda. Soon after lifting the quarantines in this area, further FMD outbreaks were reported in northern Uganda, which spread to more than 10 districts. The aim of this study...... identified. BLAST searches and phylogenetic analysis of the complete variable protein (VP)1 coding sequences revealed that they belonged to serotype O, topotype EA-2. The close similarity between the virus sequences suggested introduction from a single source. We therefore conclude that FMD in the northern...

  7. Nucleotide sequence analyses of the MRP1 gene in four populations suggest negative selection on its coding region

    Directory of Open Access Journals (Sweden)

    Ryan Stephen

    2006-05-01

    Full Text Available Abstract Background The MRP1 gene encodes the 190 kDa multidrug resistance-associated protein 1 (MRP1/ABCC1 and effluxes diverse drugs and xenobiotics. Sequence variations within this gene might account for differences in drug response in different individuals. To facilitate association studies of this gene with diseases and/or drug response, exons and flanking introns of MRP1 were screened for polymorphisms in 142 DNA samples from four different populations. Results Seventy-one polymorphisms, including 60 biallelic single nucleotide polymorphisms (SNPs, ten insertions/deletions (indel and one short tandem repeat (STR were identified. Thirty-four of these polymorphisms have not been previously reported. Interestingly, the STR polymorphism at the 5' untranslated region (5'UTR occurs at high but different frequencies in the different populations. Frequencies of common polymorphisms in our populations were comparable to those of similar populations in HAPMAP or Perlegen. Nucleotide diversity indices indicated that the coding region of MRP1 may have undergone negative selection or recent population expansion. SNPs E10/1299 G>T (R433S and E16/2012 G>T (G671V which occur at low frequency in only one or two of four populations examined were predicted to be functionally deleterious and hence are likely to be under negative selection. Conclusion Through in silico approaches, we identified two rare SNPs that are potentially negatively selected. These SNPs may be useful for studies associating this gene with rare events including adverse drug reactions.

  8. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  9. Deep sequencing of RNA from immune cell-derived vesicles uncovers the selective incorporation of small non-coding RNA biotypes with potential regulatory functions.

    Science.gov (United States)

    Nolte-'t Hoen, Esther N M; Buermans, Henk P J; Waasdorp, Maaike; Stoorvogel, Willem; Wauben, Marca H M; 't Hoen, Peter A C

    2012-10-01

    Cells release RNA-carrying vesicles and membrane-free RNA/protein complexes into the extracellular milieu. Horizontal vesicle-mediated transfer of such shuttle RNA between cells allows dissemination of genetically encoded messages, which may modify the function of target cells. Other studies used array analysis to establish the presence of microRNAs and mRNA in cell-derived vesicles from many sources. Here, we used an unbiased approach by deep sequencing of small RNA released by immune cells. We found a large variety of small non-coding RNA species representing pervasive transcripts or RNA cleavage products overlapping with protein coding regions, repeat sequences or structural RNAs. Many of these RNAs were enriched relative to cellular RNA, indicating that cells destine specific RNAs for extracellular release. Among the most abundant small RNAs in shuttle RNA were sequences derived from vault RNA, Y-RNA and specific tRNAs. Many of the highly abundant small non-coding transcripts in shuttle RNA are evolutionary well-conserved and have previously been associated to gene regulatory functions. These findings allude to a wider range of biological effects that could be mediated by shuttle RNA than previously expected. Moreover, the data present leads for unraveling how cells modify the function of other cells via transfer of specific non-coding RNA species.

  10. Low-pass shotgun sequencing of the barley genome facilitates rapid identification of genes, conserved non-coding sequences and novel repeats

    Directory of Open Access Journals (Sweden)

    Graner Andreas

    2008-10-01

    Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular

  11. Construction of the Coding Sequence of the Transcription Variant 2 of the Human Renalase Gene and Its Expression in the Prokaryotic System

    Directory of Open Access Journals (Sweden)

    Alexei E. Medvedev

    2013-06-01

    Full Text Available Renalase is a recently discovered protein, involved in regulation of blood pressure in humans and animals. Although several splice variants of human renalase mRNA transcripts have been recognized, only one protein product, hRenalase1, has been found so far. In this study, we have used polymerase chain reaction (PCR-based amplification of individual exons of the renalase gene and their joining for construction of full-length hRenalase2 coding sequence followed by expression of hRenalase2 as a polyHis recombinant protein in Escherichia coli cells. To date this is the first report on synthesis and purification of hRenalase2. Applicability of this approach was verified by constructing hRenalase1 coding sequence, its sequencing and expression in E. coli cells. hRenalase1 was used for generation of polyclonal antiserum in sheep. Western blot analysis has shown that polyclonal anti-renalase1 antibodies effectively interact with the hRenalase2 protein. The latter suggests that some functions and expression patterns of hRenalase1 documented by antibody-based data may be attributed to the presence of hRenalase2. The realized approach may be also used for construction of coding sequences of various (especially weakly expressible genes, their transcript variants, etc.

  12. Human Endogenous Retrovirus (HERV-K) Reverse Transcriptase as a Breast Cancer Prognostic Marker

    OpenAIRE

    Golan, Maya; Hizi, Amnon; Resau, James H.; Yaal-Hahoshen, Neora; Reichman, Hadar; Keydar, Iafa; Tsarfaty, Ilan

    2008-01-01

    A reverse transcriptase (RT) cDNA, designated HERV-K-T47D-RT, was isolated from a hormonally treated human breast cancer cell line. The protein product putative sequence is 97% identical to the human endogenous HERV-K retroviral sequences. Recombinant T47D-RT protein was used to generate polyclonal antibodies. The expression of HERV-K-T47D-RT protein increased in T47D cells after treatment with estrogen and progesterone. The RT-associated DNA polymerase activity was substantially increased af...

  13. Human Endogenous Retrovirus (HERV-K) Reverse Transcriptase as a Breast Cancer Prognostic Marker123

    OpenAIRE

    Golan, Maya; Hizi, Amnon; Resau, James H; Yaal-Hahoshen, Neora; Reichman, Hadar; Keydar, Iafa; Tsarfaty, Ilan

    2008-01-01

    A reverse transcriptase (RT) cDNA, designated HERV-K-T47D-RT, was isolated from a hormonally treated human breast cancer cell line. The protein product putative sequence is 97% identical to the human endogenous HERV-K retroviral sequences. Recombinant T47D-RT protein was used to generate polyclonal antibodies. The expression of HERV-K-T47D-RT protein increased in T47D cells after treatment with estrogen and progesterone. The RT-associated DNA polymerase activity was substantially increased af...

  14. Cloning, sequence analysis, and expression of cDNA coding for the major house dust mite allergen, Der f 1, in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Y. Cui

    2008-05-01

    Full Text Available Our objective was to clone, express and characterize adult Dermatophagoides farinae group 1 (Der f 1 allergens to further produce recombinant allergens for future clinical applications in order to eliminate side reactions from crude extracts of mites. Based on GenBank data, we designed primers and amplified the cDNA fragment coding for Der f 1 by nested-PCR. After purification and recovery, the cDNA fragment was cloned into the pMD19-T vector. The fragment was then sequenced, subcloned into the plasmid pET28a(+, expressed in Escherichia coli BL21 and identified by Western blotting. The cDNA coding for Der f 1 was cloned, sequenced and expressed successfully. Sequence analysis showed the presence of an open reading frame containing 966 bp that encodes a protein of 321 amino acids. Interestingly, homology analysis showed that the Der p 1 shared more than 87% identity in amino acid sequence with Eur m 1 but only 80% with Der f 1. Furthermore, phylogenetic analyses suggested that D. pteronyssinus was evolutionarily closer to Euroglyphus maynei than to D. farinae, even though D. pteronyssinus and D. farinae belong to the same Dermatophagoides genus. A total of three cysteine peptidase active sites were found in the predicted amino acid sequence, including 127-138 (QGGCGSCWAFSG, 267-277 (NYHAVNIVGYG and 284-303 (YWIVRNSWDTTWGDSGYGYF. Moreover, secondary structure analysis revealed that Der f 1 contained an a helix (33.96%, an extended strand (17.13%, a ß turn (5.61%, and a random coil (43.30%. A simple three-dimensional model of this protein was constructed using a Swiss-model server. The cDNA coding for Der f 1 was cloned, sequenced and expressed successfully. Alignment and phylogenetic analysis suggests that D. pteronyssinus is evolutionarily more similar to E. maynei than to D. farinae.

  15. Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

    International Nuclear Information System (INIS)

    Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.

    1986-01-01

    The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

  16. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites

    OpenAIRE

    Li, Chao; Li, Yuhua; Zhang, Xiangmin; Stafford, Phillip; Dinu, Valentin

    2009-01-01

    Abstract Background Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder...

  17. [Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].

    Science.gov (United States)

    Tarasova, O A; Filimonov, D A; Poroikov, V V

    2017-10-01

    Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.

  18. A Sabin 2-related poliovirus recombinant contains a homologous sequence of human enterovirus species C in the viral polymerase coding region.

    Science.gov (United States)

    Zhang, Yong; Zhang, Fan; Zhu, Shuangli; Chen, Li; Yan, Dongmei; Wang, Dongyan; Tang, Ruiyan; Zhu, Hui; Hou, Xiaohui; An, Hongqiu; Zhang, Hong; Xu, Wenbo

    2010-02-01

    A type 2 vaccine-related poliovirus (strain CHN3024), differing from the Sabin 2 strain by 0.44% in the VP1 coding region was isolated from a patient with vaccine-associated paralytic poliomyelitis. Sequences downstream of nucleotide position 6735 (3D(pol) coding region) were derived from an unidentified sequence; no close match for a potential parent was found, but it could be classified into a non-polio human enteroviruses species C (HEV-C) phylogeny. The virus differed antigenically from the parental Sabin strain, having an amino acid substitution in the neutralizing antigenic site 1. The similarity between CHN3024 and Sabin 2 sequences suggests that the recombination was recent; this is supported by the estimation that the initiating OPV dose was given only 36-75 days before sampling. The patient's clinical manifestations, intratypic differentiation examination, and whole-genome sequencing showed that this recombinant exhibited characteristics of neurovirulent vaccine-derived polioviruses (VDPV), which may, thus, pose a potential threat to a polio-free world.

  19. Assembly of the Complete Sitka Spruce Chloroplast Genome Using 10X Genomics' GemCode Sequencing Data.

    Directory of Open Access Journals (Sweden)

    Lauren Coombe

    Full Text Available The linked read sequencing library preparation platform by 10X Genomics produces barcoded sequencing libraries, which are subsequently sequenced using the Illumina short read sequencing technology. In this new approach, long fragments of DNA are partitioned into separate micro-reactions, where the same index sequence is incorporated into each of the sequencing fragment inserts derived from a given long fragment. In this study, we exploited this property by using reads from index sequences associated with a large number of reads, to assemble the chloroplast genome of the Sitka spruce tree (Picea sitchensis. Here we report on the first Sitka spruce chloroplast genome assembled exclusively from P. sitchensis genomic libraries prepared using the 10X Genomics protocol. We show that the resulting 124,049 base pair long genome shares high sequence similarity with the related white spruce and Norway spruce chloroplast genomes, but diverges substantially from a previously published P. sitchensis- P. thunbergii chimeric genome. The use of reads from high-frequency indices enabled separation of the nuclear genome reads from that of the chloroplast, which resulted in the simplification of the de Bruijn graphs used at the various stages of assembly.

  20. Phylogenetic analyses of the polyprotein coding sequences of serotype O foot-and-mouth disease viruses in East Africa: evidence for interserotypic recombination

    Directory of Open Access Journals (Sweden)

    Balinda Sheila N

    2010-08-01

    Full Text Available Abstract Background Foot-and-mouth disease (FMD is endemic in East Africa with the majority of the reported outbreaks attributed to serotype O virus. In this study, phylogenetic analyses of the polyprotein coding region of serotype O FMD viruses from Kenya and Uganda has been undertaken to infer evolutionary relationships and processes responsible for the generation and maintenance of diversity within this serotype. FMD virus RNA was obtained from six samples following virus isolation in cell culture and in one case by direct extraction from an oropharyngeal sample. Following RT-PCR, the single long open reading frame, encoding the polyprotein, was sequenced. Results Phylogenetic comparisons of the VP1 coding region showed that the recent East African viruses belong to one lineage within the EA-2 topotype while an older Kenyan strain, K/52/1992 is a representative of the topotype EA-1. Evolutionary relationships between the coding regions for the leader protease (L, the capsid region and almost the entire coding region are monophyletic except for the K/52/1992 which is distinct. Furthermore, phylogenetic relationships for the P2 and P3 regions suggest that the K/52/1992 is a probable recombinant between serotypes A and O. A bootscan analysis of K/52/1992 with East African FMD serotype A viruses (A21/KEN/1964 and A23/KEN/1965 and serotype O viral isolate (K/117/1999 revealed that the P2 region is probably derived from a serotype A strain while the P3 region appears to be a mosaic derived from both serotypes A and O. Conclusions Sequences of the VP1 coding region from recent serotype O FMDVs from Kenya and Uganda are all representatives of a specific East African lineage (topotype EA-2, a probable indication that hardly any FMD introductions of this serotype have occurred from outside the region in the recent past. Furthermore, evidence for interserotypic recombination, within the non-structural protein coding regions, between FMDVs of serotypes A

  1. Quantitation of avian RNA tumor virus reverse transcriptase by radioimmunoassay

    International Nuclear Information System (INIS)

    Panet, A.; Baltimore, D.; Hanafusa, T.

    1975-01-01

    A radioimmunoassay was developed that can detect and quantitate 3 ng or more of the avian RNA tumor virus reverse transcriptase. The assay detected no antigenic sites in Rous sarcoma virus α virions or in virions of a murine RNA tumor virus. About 70 molecules of reverse transcriptase were found per virion of avian myeloblastosis virus with this assay or with an assay based on antibody inhibition of enzymatic activity. The assay detected about 270 ng of enzyme per mg of cell protein in virus-producing cells; uninfected cells had much less antigenic material but contained some determinants able to displace radioactive antigen. No additional antigenic determinants on reverse transcriptase could be detected that were not found on the separated α subunit of the enzyme. Although sevenfold less sensitive than enzymatic activity as a measure of reverse transcriptase, the radioimmunoassay can detect antigen using small amounts of protein and in the presence of inhibitors

  2. Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

    Directory of Open Access Journals (Sweden)

    Elisabeth Humphris-Narayanan

    Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

  3. Using machine learning and high-throughput RNA sequencing to classify the precursors of small non-coding RNAs

    OpenAIRE

    Ryvkin, Paul; Leung, Yuk Yee; Ungar, Lyle H.; Gregory, Brian D.; Wang, Li-San

    2013-01-01

    Recent advances in high-throughput sequencing allow researchers to examine the transcriptome in more detail than ever before. Using a method known as high-throughput small RNA-sequencing, we can now profile the expression of small regulatory RNAs such as microRNAs and small interfering RNAs (siRNAs) with a great deal of sensitivity. However, there are many other types of small RNAs (

  4. Human DNA contains sequences homologous to the 5'-non-coding region of hepatits C virus: characterization with restriction endonucleases reveals individual varieties.

    Science.gov (United States)

    Dennin, Reinhard H; Wo, Jianer

    2003-07-01

    To investigate a 272 base pair section of the 5'-non-coding region of genomic DNA from the peripheral blood monounuclear cells of healthy hepatitis virus C (HCV)-negative human subjects (not patients). This sequence section bears interest because (1) it harbors several potential methylation (Cp-rich) sites, and (2) it represents the largest part of its internal ribosomal entry site. A pre-PCR digestion protocol was established making consistent use of four restriction endonucleases selected for certain features: SmaI, XmaCI, MspI, and HpaII are inhibited if methylation(s) are present at certain cytosines within their cutting sequences. The suspected HCV-specific sequence was found in the DNA of each subject tested. The pre-PCR digestion assay reveals individual differences in their pattern of methylation, which may be due to possible epigenetic phenomena. The results provide formal proof that these HCV-specific sequences are contained in the genomic or extra chromosomal target DNA, and probably belong to a new class of endogenous sequences.

  5. Nucleotide sequence of the Escherichia coli pyrE gene and of the DNA in front of the protein-coding region

    DEFF Research Database (Denmark)

    Poulsen, Peter; Jensen, Kaj Frank; Valentin-Hansen, Poul

    1983-01-01

    Orotate phosphoribosyltransferase (EC 2.4.2.10) was purified to electrophoretic homogeneity from a strain of Escherichia coli containing the pyrE gene cloned on a multicopy plasmid. The relative molecular masses (Mr) of the native enzyme and its subunit were estimated by means of gel filtration....... From the results the following conclusions may be drawn. Orotate phosphoribosyltransferase is a dimeric protein with subunits of Mr 23 326 consisting of 211 amino acid residues. The pyrE gene is transcribed in a counter-clockwise direction from the E. coli chromosome as an mRNA with a considerable...... and electrophoresis in the presence of dodecyl sulfate. The amino acid sequences at the N and C termini, as well as the amino acid composition, were determined. The nucleotide sequence of the structural pyrE gene, including 394 nucleotide residues preceding the beginning of the coding frame, was also established...

  6. Evaluation of the Genetic Variation of Non Coding Control Region of BK Virus Using Nested-PCR Sequencing Method in Renal Graft Patients

    Directory of Open Access Journals (Sweden)

    A Emami

    2015-05-01

    Full Text Available Background & aim: Polyomaviruses (BK is a comprehensive infection with more than of 80% prevalence in the world. One of the most important reasons of BK virus nephropathy is in the renal transplant recipients and rejection of transplanted tissue between them. Non Coding region of this virus play a regulatory role in replication and amplification of the virus. The aim of this study was to evaluate the genetic patterns of this area in renal graft at Namazi Transplantation Center, Shiraz, Iran. Methods: In the present experimental study, 380 renal allograft serums were collected. DNAs of 129 eligible samples were extracted and evaluated using a virus genome. The presence of the virus was determined by qualitative and sequencing. Of these, 129 samples were tested for the presence of virus according to the condition study, using quantitative, qualitative genomic amplification and sequencing. Results: The study showed symptoms of nephropathy, 76 (58.9% of them were males and 46 (35.7% were females with the mean age 38.0±.089 years of age. In general, 46 patients (35.7% percent were positive for BK Polyomaviruses. After comparing the genomic sequence with applications of molecular they were categorized in three groups and then recorded in gene bank. Conclusion: About 35% of renal transplant recipients with high creatinine levels were positive for the presence of BK virus. Non-coding region of respondents in the sample survey revealed that among patients with the most common genotypes were rearranged the entire transplant patients were observed at this tranplant center. Examination of these sequences indicated that this rearrangments had a specific pattern, different from the standard strain of archaea type.

  7. Simultaneous detection of different mRNA sequences coding for neuropeptide hormones by double in situ hybridization using FITC- and biotin-labeled oligonucleotides.

    Science.gov (United States)

    Dirks, R W; van Gijlswijk, R P; Tullis, R H; Smit, A B; van Minnen, J; van der Ploeg, M; Raap, A K

    1990-04-01

    Oligonucleotides labeled with FITC or biotin were applied for detection of specific mRNAs in microscopic preparations by in situ hybridization. The oligonucleotides were labeled with one FITC or biotin molecule at the 5' end or with a tail of biotin molecules at the 3' end. The target sequences were mRNAs coding for an ovulation hormone (CDCH) in the caudodorsal cells (CDC) of the pond snail Lymnaea stagnalis and a molluscan insulin-like peptide (MIP) in the light green cells (LGC) of the same organism. The hybridized oligonucleotides were detected either directly after the hybridization procedure by fluorescence microscopy or indirectly after an immunocytochemical procedure to visualize the biotin or FITC moiety. The results indicate that the detectability of the mRNA sequences is at least partially dependent on the accessibility of the target sequences for the immunocytochemical detection systems. The positive hybridization results obtained with oligonucleotides containing different labels enabled us to perform double hybridization experiments for simultaneous detection of CDCH and MIP mRNAs in one tissue section. Using FITC- and biotin-labeled oligonucleotides, we also demonstrated simultaneously different sequences on the same mRNA molecule.

  8. Structural and functional similarities between HIV-1 reverse transcriptase and the Escherichia coli RNA polymerase beta' subunit.

    Science.gov (United States)

    Szilvay, A M; Stern, B; Blichenberg, A; Helland, D E

    2000-10-27

    Four monoclonal antibodies (MAbs) recognizing HIV-1 reverse transcriptase (RT) were shown here to cross-react with the beta' subunit of Escherichia coli RNA polymerase (RNAP). The anti-RT MAbs bind to a peptide comprising residues 294-305 of the RT amino acid sequence. Computer analyses revealed sequence similarity between this peptide and two regions of the RNAP beta' subunit. MAb-binding studies using RT mutants suggested that the epitope is located to amino acids 652-663 of the beta' sequence. One of the MAbs which inhibited the polymerase activity of RT also mediated a dose dependent inhibition of the RNAP activity.

  9. A single point mutation within the coding sequence of cholera toxin B subunit will increase its expression yield.

    Science.gov (United States)

    Bakhshi, Bita; Boustanshenas, Mina; Ghorbani, Masoud

    2014-07-01

    Cholera toxin B subunit (CTB) has been extensively considered as an immunogenic and adjuvant protein, but its yield of expression is not satisfactory in many studies. The aim of this study was to compare the expression of native and mutant recombinant CTB (rCTB) in pQE vector. ctxB fragment from Vibrio cholerae O1 ATCC14035 containing the substitution of mutant ctxB for amino acid S128T was amplified by PCR and cloned in pGETM-T easy vector. It was then transformed to E. coli Top 10F' and cultured on LB agar plate containing ampicillin. Sequence analysis confirmed the mature ctxB gene sequence and the mutant one in both constructs which were further subcloned to pQE-30 vector. Both constructs were subsequently transformed to E. coli M15 (pREP4) for expression of mature and mutant rCTB. SDS-PAGE analysis showed the maximum expression of rCTB in both systems at 5 hours after induction and Western-blot analysis confirmed the presence of rCTB in blotting membranes. The expression of mutant rCTB was much higher than mature rCTB, which may be the result of serine-to-threonine substitution at position 128 of mature rCTB amino acid sequence created by PCR mutagenesis. The mutant rCTB retained pentameric stability and its ability to bind to anti- cholera toxin IgG antibodies. Point mutation in ctxB sequence resulted in over-expression of rCTB, probably due to the increase of solubility of produced rCTB. Consequently, this expression system can be used to produce rCTB in high yield.

  10. Using machine learning and high-throughput RNA sequencing to classify the precursors of small non-coding RNAs.

    Science.gov (United States)

    Ryvkin, Paul; Leung, Yuk Yee; Ungar, Lyle H; Gregory, Brian D; Wang, Li-San

    2014-05-01

    Recent advances in high-throughput sequencing allow researchers to examine the transcriptome in more detail than ever before. Using a method known as high-throughput small RNA-sequencing, we can now profile the expression of small regulatory RNAs such as microRNAs and small interfering RNAs (siRNAs) with a great deal of sensitivity. However, there are many other types of small RNAs (small nucleolar RNAs), snRNAs (small nuclear RNAs), scRNAs (small cytoplasmic RNAs), tRNAs (transfer RNAs), and transposon-derived RNAs. Here, we present a user's guide for CoRAL (Classification of RNAs by Analysis of Length), a computational method for discriminating between different classes of RNA using high-throughput small RNA-sequencing data. Not only can CoRAL distinguish between RNA classes with high accuracy, but it also uses features that are relevant to small RNA biogenesis pathways. By doing so, CoRAL can give biologists a glimpse into the characteristics of different RNA processing pathways and how these might differ between tissue types, biological conditions, or even different species. CoRAL is available at http://wanglab.pcbi.upenn.edu/coral/. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. In silico Coding Sequence Analysis of Walnut GAI and PIP2 Genes and Comparison with Different Plant Species

    Directory of Open Access Journals (Sweden)

    Mahdi Mohseniazar

    2017-02-01

    Full Text Available Introduction: Dwarfism is one of the important traits in breeding of crops and horticulture plants. A dwarfing rootstock will produce trees with 15-50% of standard trees size. In modern intensive fruit tree orchards, dwarfing rootstocks are commonly used to reduce trees size, enabling high-density planting and easy management, thus achieving higher yield. Trees on dwarfing rootstocks can also exhibit other economically important traits, such as precocious flowering, increased yield and increased disease resistance. Dwarf rootstocks have been extensively studied and released in stone and pome fruits, because of presence of genetic materials and the simplicity of budding methods. Control of tree size using genetically dwarf rootstocks for achievement to higher density and mechanized orchard systems is now very important for walnut production in the world especially in Iran. Many different genes can be involved in appear of this. Mutations in GAI and PIP2 genes cause dwarf trait by two different mechanisms in some plant species. In this case, we study in silico analysis of GAI and PIP2 genes consist of conserved sequences and domains, exon and intron number, function of their proteins, targeting, secondary and tertiary structure, and post translational modification. Materials and methods: The GAI and PIP2 mRNA and protein sequences (FASTA format belonging to 17 monocotyledon and dicotyledon were downloaded from NCBI (http://www.ncbi.nlm.nih.gov accessed, on September 2014. Several online web services and software were used for analysis of GAI and PIP2 mRNA and Proteins in plants. Comparative and bioinformatics analyses of PIP2 and GAI proteins were performed online at two websites NCBI (http://www.ncbi.nih.gov and EXPASY (http://expasy.org/tools. Molecular Evolutionary Genetics Analysis (MEGA; version 4 program and CLUSTAL-W with default parameters were used for multiple alignments of sequences. The phylogenetic analysis of GAI and PIP2 protein was

  12. Molecular phylogeny of Edraianthus (Grassy Bells; Campanulaceae) based on non-coding plastid DNA sequences

    DEFF Research Database (Denmark)

    Stefanovic, Sasa; Lakusic, Dmitar; Kuzmina, Maria

    2008-01-01

    The Balkan Peninsula is known as an ice-age refugium and an area with high rates of speciation and diversification. Only a few genera have their centers of distribution in the Balkans and the endemic genus Edraianthus is one of its most prominent groups. As such, Edraianthus is an excellent model...... divided into three sections: E. sect. Edraianthus, E. sect. Uniflori, and E. sect. Spathulati. We present here the first phylogenetic study of Edraianthus based on multiple plastid DNA sequences (trnL-F region and rbcL-atpB spacer) derived from a wide taxonomic sampling and geographic range. While...

  13. New insights into flavivirus evolution, taxonomy and biogeographic history, extended by analysis of canonical and alternative coding sequences.

    Directory of Open Access Journals (Sweden)

    Gregory Moureau

    Full Text Available To generate the most diverse phylogenetic dataset for the flaviviruses to date, we determined the genomic sequences and phylogenetic relationships of 14 flaviviruses, of which 10 are primarily associated with Culex spp. mosquitoes. We analyze these data, in conjunction with a comprehensive collection of flavivirus genomes, to characterize flavivirus evolutionary and biogeographic history in unprecedented detail and breadth. Based on the presumed introduction of yellow fever virus into the Americas via the transatlantic slave trade, we extrapolated a timescale for a relevant subset of flaviviruses whose evolutionary history, shows that different Culex-spp. associated flaviviruses have been introduced from the Old World to the New World on at least five separate occasions, with 2 different sets of factors likely to have contributed to the dispersal of the different viruses. We also discuss the significance of programmed ribosomal frameshifting in a central region of the polyprotein open reading frame in some mosquito-associated flaviviruses.

  14. Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.

    Science.gov (United States)

    Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao

    2015-10-01

    Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.

  15. Model for a transcript map of human chromosome 21: isolation of new coding sequences from exon and enriched cDNA libraries.

    Science.gov (United States)

    Yaspo, M L; Gellen, L; Mott, R; Korn, B; Nizetic, D; Poustka, A M; Lehrach, H

    1995-08-01

    The construction of a transcriptional map for human chromosome 21 requires the generation of a specific catalogue of genes, together with corresponding mapping information. Towards this goal, we conducted a pilot study on a pool of random chromosome 21 cosmids representing 2 Mb of non-contiguous DNA. Exon-amplification and cDNA selection methods were used in combination to extract the coding content from these cosmids, and to derive expressed sequences libraries. These libraries and the source cosmid library were arrayed at high density for hybridisation screening. A strategy was used which related data obtained by multiple hybridisations of clones originating from one library, screened against the other libraries. In this way, it was possible to integrate the information with the physical map and to compare the gene recovery rate of each technique. cDNAs and exons were grouped into bins delineated by EcoRI cosmid fragments, and a subset of 91 cDNAs and 29 exons have been sequenced. These sequences defined 79 non-overlapping potential coding segments distributed in 24 transcriptional units, which were mapped along 21q. Northern blot analysis performed for a subset of cDNAs indicated the existence of a cognate transcript. Comparison to databases indicated three segments matching to known chromosome 21 genes: PFKL, COL6A1 and S100B and six segments matching to unmapped anonymous expressed sequence tags (ESTs). At the translated nucleotide level, strong homologies to known proteins were found with ATP-binding transporters of the ABC family and the dihydroorotase domain of pyrimidine synthetases. These data strongly suggest that bona fide partial genes have been isolated. Several of the newly isolated transcriptional units map to clinically important regions, in particular those involved in Down's syndrome, progressive myoclonus epilepsia and auto-immune polyglandular disease. The study presented here illustrates the complementarity of exon-amplification and c

  16. Detection of allergen coding sequences of kiwi, peach, and apple in processed food by qPCR.

    Science.gov (United States)

    Graziano, Sara; Gullì, Mariolina; Marmiroli, Nelson

    2017-12-06

    Food traceability becomes lifesaving for persons suffering severe allergy or intolerance, and therefore need a complete avoidance of the immune-trigger food. This paper describes how to fingerprint the presence of some allergenic species (kiwi, peach, and apple) in foods by quantitative real-time PCR (qPCR). Five DNA extraction procedures were tested on fruits and foods. The results were statistically evaluated, and discussed. Analysis by qPCR with SYBR Green was developed to detect traces of these allergenic species in foods. Plasmids containing the target sequences of kiwi, peach and apple were employed as internal reference standard. Analysis of spiked food samples showed a limit of detection of 25 mg kg -1 for kiwi, 20 mg kg -1 for peach and 50 mg kg -1 for apple. The qPCR method here developed, combined with the use of internal plasmid reference standard, represents a specific system for the quick detection of allergenic species in complex food matrices, with a limit of detection comparable with those reported using more time-consuming methods. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  17. New clinical perspectives on non-nucleoside reverse transcriptase ...

    African Journals Online (AJOL)

    New clinical perspectives on non-nucleoside reverse transcriptase inhibitors. S Miller. Abstract. No Abstract. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors ...

  18. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  19. new clinical perspectives on non- nucleoside reverse transcriptase ...

    African Journals Online (AJOL)

    NUCLEOSIDE REVERSE TRANSCRIPTASE. INHIBITORS. TilE SOUTIIERN AFRICAN JOU NAL OF IIIV MEDICINE metabolised in the liver via the P450 cytochrome system, a pathway shared with many other compounds. This creates a risk for drug/drug interactions and the potential to modify the efficacy and/or toxicity of ...

  20. Evaluation of the HIV-1 reverse transcriptase inhibitory properties of ...

    African Journals Online (AJOL)

    Evaluation of the HIV-1 reverse transcriptase inhibitory properties of extracts from some medicinal plants in Kenya. Geoffrey M Rukunga, Mawuli W Kofi-Tsekpo, Masahiko Kurokawa, Seiji Kageyama, Geoffrey M Mungai, John M Muli, Festus M Tolo, Rukia M Kibaya, Charles N Muthaura, James N Kanyara, Peter M Tukei, ...

  1. Calibrated user-friendly reverse transcriptase-PCR assay

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Rammer, P

    1998-01-01

    We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CURT...

  2. Quantification of HIV GAG RNA using real time reverse transcriptase PCR.

    Science.gov (United States)

    Shapshak, Paul; Duncan, Robert; McCoy, Clyde B; Page, J Bryan

    2005-01-01

    Quantification of HIV-1 is important to quantify risk for disease progression as well as for acquiring infection associated with drug abuse. Prior quantification methods include immune and enzymatic procedures, e.g., quantifying HIV-1 p24 protein by ELISA and the Reverse Transcriptase by enzymatic assay. Improved quantification of HIV-1 RNA and cDNA was established using PCR. This paper describes a real-time PCR technique using the Applied Biosystems 5700 Sequence Detection System and Taqman reverse transcriptase PCR. We initially standardized the PCR method using ribosomal-RNA to obtain relative quantification. Pure gag RNA was used for standard curves, controls, and to obtain absolute RNA quantification. Pure HIV gag RNA was produced by T7-directed transcription of the plasmid pWISP98-85. Detailed statistical analyses describe using absolute standard curves, and intraassay and interassay coefficients of variation to validate the methods. The presented method is highly reproducible and the assay's performance is comparable to prior assays. The assay is validated with an 8-log range down to 80 copies.

  3. Color differences among feral pigeons (Columba livia) are not attributable to sequence variation in the coding region of the melanocortin-1 receptor gene (MC1R)

    Science.gov (United States)

    2013-01-01

    Background Genetic variation at the melanocortin-1 receptor (MC1R) gene is correlated with melanin color variation in many birds. Feral pigeons (Columba livia) show two major melanin-based colorations: a red coloration due to pheomelanic pigment and a black coloration due to eumelanic pigment. Furthermore, within each color type, feral pigeons display continuous variation in the amount of melanin pigment present in the feathers, with individuals varying from pure white to a full dark melanic color. Coloration is highly heritable and it has been suggested that it is under natural or sexual selection, or both. Our objective was to investigate whether MC1R allelic variants are associated with plumage color in feral pigeons. Findings We sequenced 888 bp of the coding sequence of MC1R among pigeons varying both in the type, eumelanin or pheomelanin, and the amount of melanin in their feathers. We detected 10 non-synonymous substitutions and 2 synonymous substitution but none of them were associated with a plumage type. It remains possible that non-synonymous substitutions that influence coloration are present in the short MC1R fragment that we did not sequence but this seems unlikely because we analyzed the entire functionally important region of the gene. Conclusions Our results show that color differences among feral pigeons are probably not attributable to amino acid variation at the MC1R locus. Therefore, variation in regulatory regions of MC1R or variation in other genes may be responsible for the color polymorphism of feral pigeons. PMID:23915680

  4. Older persons' worries expressed during home care visits: Exploring the content of cues and concerns identified by the Verona coding definitions of emotional sequences.

    Science.gov (United States)

    Hafskjold, Linda; Eide, Tom; Holmström, Inger K; Sundling, Vibeke; van Dulmen, Sandra; Eide, Hilde

    2016-12-01

    Little is known about how older persons in home care express their concerns. Emotional cues and concerns can be identified by the Verona coding definitions of emotional sequences (VR-CoDES), but the method gives no insight into what causes the distress and the emotions involved. The aims of this study are to explore (1) older persons' worries and (2) the content of these expressions. An observational exploratory two-step approach was used to investigate audiotaped recordings from 38 Norwegian home care visits with older persons and nurse assistants. First, 206 cues and concerns were identified using VR-CoDES. Second, the content and context of these expressions were analysed inductively. Four main categories emerged: worries about relationships with others, worries about health care-related issues, worries about aging and bodily impairment, and life narratives and value issues, with several subcategories showing the causes of worry and emotions involved. The two-step approach provides an in-depth knowledge of older persons' worries, causes of worries, and their related emotions. The subcategories described in a language close to the experience can be useful in practice development and communication training for students and health care providers. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. Effect of the HIV-1 nucleocapsid protein on reverse transcriptase pause sites revealed by single molecule microscopy

    Science.gov (United States)

    Jouonang, A.; Przybilla, F.; Godet, J.; Sharma, K. K.; Restlé, T.; de Rocquigny, H.; Darlix, J.-L.; Kenfack, C.; Didier, P.; Mély, Y.

    2013-02-01

    During reverse transcription, the HIV-1 RNA is converted by the reverse transcriptase (RT) into proviral DNA. RT is assisted by the HIV-1 nucleocapsid (NCp7) protein that notably increases the ability of RT to synthesize DNA through pause sites. Using single molecule FRET, we monitored the NCp7 effect on the binding of RT to nucleic acid sequences corresponding to two different pause sites. NCp7 was found to modify the distribution of RT orientations on the oligonucleotides and decrease the residence time of RT on one of the pause sites. These results give direct insight into the NCp7 molecular mechanism in reverse transcription.

  6. Sequence heterogeneity of the envelope -like domain in the ...

    African Journals Online (AJOL)

    Abbreviations; LTR: long terminal repeat, ORF: open-reading frame, PCR: polymerase chain reaction, RT: reverse transcriptase gene. The current study aimed to investigate the evolution of env-like sequences in the Egyptian cotton Gossypium barbadense. DNA sequence determination and analysis of env -like sequences ...

  7. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  8. Evolutionary changes in gene expression, coding sequence and copy-number at the Cyp6g1 locus contribute to resistance to multiple insecticides in Drosophila.

    Directory of Open Access Journals (Sweden)

    Thomas W R Harrop

    Full Text Available Widespread use of insecticides has led to insecticide resistance in many populations of insects. In some populations, resistance has evolved to multiple pesticides. In Drosophila melanogaster, resistance to multiple classes of insecticide is due to the overexpression of a single cytochrome P450 gene, Cyp6g1. Overexpression of Cyp6g1 appears to have evolved in parallel in Drosophila simulans, a sibling species of D. melanogaster, where it is also associated with insecticide resistance. However, it is not known whether the ability of the CYP6G1 enzyme to provide resistance to multiple insecticides evolved recently in D. melanogaster or if this function is present in all Drosophila species. Here we show that duplication of the Cyp6g1 gene occurred at least four times during the evolution of different Drosophila species, and the ability of CYP6G1 to confer resistance to multiple insecticides exists in D. melanogaster and D. simulans but not in Drosophila willistoni or Drosophila virilis. In D. virilis, which has multiple copies of Cyp6g1, one copy confers resistance to DDT and another to nitenpyram, suggesting that the divergence of protein sequence between copies subsequent to the duplication affected the activity of the enzyme. All orthologs tested conferred resistance to one or more insecticides, suggesting that CYP6G1 had the capacity to provide resistance to anthropogenic chemicals before they existed. Finally, we show that expression of Cyp6g1 in the Malpighian tubules, which contributes to DDT resistance in D. melanogaster, is specific to the D. melanogaster-D. simulans lineage. Our results suggest that a combination of gene duplication, regulatory changes and protein coding changes has taken place at the Cyp6g1 locus during evolution and this locus may play a role in providing resistance to different environmental toxins in different Drosophila species.

  9. Diagnostic and prognostic signatures from the small non-coding RNA transcriptome in prostate cancer

    DEFF Research Database (Denmark)

    Martens-Uzunova, E S; Jalava, S E; Dits, N F

    2011-01-01

    Prostate cancer (PCa) is the most frequent male malignancy and the second most common cause of cancer-related death in Western countries. Current clinical and pathological methods are limited in the prediction of postoperative outcome. It is becoming increasingly evident that small non-coding RNA...... signatures of 102 fresh-frozen patient samples during PCa progression by miRNA microarrays. Both platforms were cross-validated by quantitative reverse transcriptase-PCR. Besides the altered expression of several miRNAs, our deep sequencing analyses revealed strong differential expression of small nucleolar...... RNAs (snoRNAs) and transfer RNAs (tRNAs). From microarray analysis, we derived a miRNA diagnostic classifier that accurately distinguishes normal from cancer samples. Furthermore, we were able to construct a PCa prognostic predictor that independently forecasts postoperative outcome. Importantly...

  10. Development of elvitegravir resistance and linkage of integrase inhibitor mutations with protease and reverse transcriptase resistance mutations.

    Directory of Open Access Journals (Sweden)

    Mark A Winters

    Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.

  11. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali

    2015-11-27

    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  12. Molecular phylogeny of 21 tropical bamboo species reconstructed by integrating non-coding internal transcribed spacer (ITS1 and 2) sequences and their consensus secondary structure.

    Science.gov (United States)

    Ghosh, Jayadri Sekhar; Bhattacharya, Samik; Pal, Amita

    2017-06-01

    The unavailability of the reproductive structure and unpredictability of vegetative characters for the identification and phylogenetic study of bamboo prompted the application of molecular techniques for greater resolution and consensus. We first employed internal transcribed spacer (ITS1, 5.8S rRNA and ITS2) sequences to construct the phylogenetic tree of 21 tropical bamboo species. While the sequence alone could grossly reconstruct the traditional phylogeny amongst the 21-tropical species studied, some anomalies were encountered that prompted a further refinement of the phylogenetic analyses. Therefore, we integrated the secondary structure of the ITS sequences to derive individual sequence-structure matrix to gain more resolution on the phylogenetic reconstruction. The results showed that ITS sequence-structure is the reliable alternative to the conventional phenotypic method for the identification of bamboo species. The best-fit topology obtained by the sequence-structure based phylogeny over the sole sequence based one underscores closer clustering of all the studied Bambusa species (Sub-tribe Bambusinae), while Melocanna baccifera, which belongs to Sub-Tribe Melocanneae, disjointedly clustered as an out-group within the consensus phylogenetic tree. In this study, we demonstrated the dependability of the combined (ITS sequence+structure-based) approach over the only sequence-based analysis for phylogenetic relationship assessment of bamboo.

  13. NMR structure of the HIV-1 reverse transcriptase thumb subdomain

    Energy Technology Data Exchange (ETDEWEB)

    Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)

    2016-12-15

    The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

  14. Telomerase reverse transcriptase promoter mutations in primary cutaneous melanoma.

    Science.gov (United States)

    Heidenreich, Barbara; Nagore, Eduardo; Rachakonda, P Sivaramakrishna; Garcia-Casado, Zaida; Requena, Celia; Traves, Victor; Becker, Jürgen; Soufir, Nadem; Hemminki, Kari; Kumar, Rajiv

    2014-02-26

    We previously reported a disease segregating causal germline mutation in a melanoma family and recurrent somatic mutations in metastasized tumours from unrelated patients in the core promoter region of the telomerase reverse transcriptase (TERT) gene. Here we show that the TERT promoter mutations, besides causing an increased gene expression, associate with increased patient age, increased Breslow thickness and tumour ulceration in 287 primary melanomas. The mutations are more frequent at both intermittently and chronically sun-exposed sites than non-exposed sites and tend to co-occur with BRAF and CDKN2A alterations. The association with parameters generally connected with poor outcome, coupled with high recurrence and mechanistic relevance, raises the possibility of the eventual use of TERT promoter mutations in the disease management.

  15. NMR structure of the HIV-1 reverse transcriptase thumb subdomain

    International Nuclear Information System (INIS)

    Sharaf, Naima G.; Brereton, Andrew E.; Byeon, In-Ja L.; Andrew Karplus, P.; Gronenborn, Angela M.

    2016-01-01

    The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

  16. Cloning and sequence determination of a gene encoding an osmotin-like protein from strawberry (Fragaria X ananassa Duch.).

    Science.gov (United States)

    Wu, J; Khan, A A; Shih CY, T; Shih, D S

    2001-12-01

    Osmotin and osmotin-like proteins (OLPs) are pathogenesis-related (PR) proteins, whose synthesis is normally stimulated upon infection of plants by pathogens. A strawberry genomic clone containing an osmotin-like protein (OLP) gene was isolated and sequenced. This clone contains an open reading frame of 681 nucleotides without any intron. The predicted amino acid sequence of the protein shares high degrees of homology with a number of other OLPs and related proteins, of which several are known to have antifungal activities. Southern hybridization analysis of strawberry genomic DNA suggested that the OLP is coded by a multi-gene family. Results from reverse transcriptase-polymerase chain reaction indicated that this OLP gene is expressed in uninfected strawberry plants.

  17. Highly efficient inhibition of human immunodeficiency virus type 1 reverse transcriptase by aptamers functionalized gold nanoparticles

    Science.gov (United States)

    Shiang, Yen-Chun; Ou, Chung-Mao; Chen, Shih-Ju; Ou, Ting-Yu; Lin, Han-Jia; Huang, Chih-Ching; Chang, Huan-Tsung

    2013-03-01

    We have developed aptamer (Apt)-conjugated gold nanoparticles (Apt-Au NPs, 13 nm in diameter) as highly effective inhibitors for human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT). Two Apts, RT1t49 (Aptpol) and ODN 93 (AptRH), which recognize the polymerase and RNase H regions of HIV-1 RT, are used to conjugate Au NPs to prepare Aptpol-Au NPs and AptRH-Au NPs, respectively. In addition to DNA sequence, the surface density of the aptamers on Au NPs (nApt-Au NPs; n is the number of aptamer molecules on each Au NP) and the linker length number (Tm; m is the base number of the deoxythymidine linker) between the aptamer and Au NPs play important roles in determining their inhibition activity. A HIV-lentiviral vector-based antiviral assay has been applied to determine the inhibitory effect of aptamers or Apt-Au NPs on the early stages of their replication cycle. The nuclease-stable G-quadruplex structure of 40AptRH-T45-Au NPs shows inhibitory efficiency in the retroviral replication cycle with a decreasing infectivity (40.2%).We have developed aptamer (Apt)-conjugated gold nanoparticles (Apt-Au NPs, 13 nm in diameter) as highly effective inhibitors for human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT). Two Apts, RT1t49 (Aptpol) and ODN 93 (AptRH), which recognize the polymerase and RNase H regions of HIV-1 RT, are used to conjugate Au NPs to prepare Aptpol-Au NPs and AptRH-Au NPs, respectively. In addition to DNA sequence, the surface density of the aptamers on Au NPs (nApt-Au NPs; n is the number of aptamer molecules on each Au NP) and the linker length number (Tm; m is the base number of the deoxythymidine linker) between the aptamer and Au NPs play important roles in determining their inhibition activity. A HIV-lentiviral vector-based antiviral assay has been applied to determine the inhibitory effect of aptamers or Apt-Au NPs on the early stages of their replication cycle. The nuclease-stable G-quadruplex structure of 40AptRH-T45

  18. Conservation of functional domains and limited heterogeneity of HIV-1 reverse transcriptase gene following vertical transmission

    Directory of Open Access Journals (Sweden)

    Ahmad Nafees

    2005-05-01

    Full Text Available Abstract Background The reverse transcriptase (RT enzyme of human immunodeficiency virus type 1 (HIV-1 plays a crucial role in the life cycle of the virus by converting the single stranded RNA genome into double stranded DNA that integrates into the host chromosome. In addition, RT is also responsible for the generation of mutations throughout the viral genome, including in its own sequences and is thus responsible for the generation of quasi-species in HIV-1-infected individuals. We therefore characterized the molecular properties of RT, including the conservation of functional motifs, degree of genetic diversity, and evolutionary dynamics from five mother-infant pairs following vertical transmission. Results The RT open reading frame was maintained with a frequency of 87.2% in five mother-infant pairs' sequences following vertical transmission. There was a low degree of viral heterogeneity and estimates of genetic diversity in mother-infant pairs' sequences. Both mothers and infants RT sequences were under positive selection pressure, as determined by the ratios of non-synonymous to synonymous substitutions. Phylogenetic analysis of 132 mother-infant RT sequences revealed distinct clusters for each mother-infant pair, suggesting that the epidemiologically linked mother-infant pairs were evolutionarily closer to each other as compared with epidemiologically unlinked mother-infant pairs. The functional domains of RT which are responsible for reverse transcription, DNA polymerization and RNase H activity were mostly conserved in the RT sequences analyzed in this study. Specifically, the active sites and domains required for primer binding, template binding, primer and template positioning and nucleotide recruitment were conserved in all mother-infant pairs' sequences. Conclusion The maintenance of an intact RT open reading frame, conservation of functional domains for RT activity, preservation of several amino acid motifs in epidemiologically

  19. Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

    Science.gov (United States)

    Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

    2014-04-01

    A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

  20. Proteomic identification of proteins differentially expressed following overexpression of hTERT (human telomerase reverse transcriptase in cancer cells.

    Directory of Open Access Journals (Sweden)

    Rishi Kumar Jaiswal

    Full Text Available Reverse transcriptase activity of telomerase adds telomeric repeat sequences at extreme ends of the newly replicated chromosome in actively dividing cells. Telomerase expression is not detected in terminally differentiated cells but is noticeable in 90% of the cancer cells. hTERT (human telomerase reverse transcriptase expression seems to promote invasiveness of cancer cells. We here present proteomic profiles of cells overexpressing or knocked down for hTERT. This study also attempts to find out the potential interacting partners of hTERT in cancer cell lines. Two-dimensional gel electrophoresis (2-DE of two different cell lines U2OS (a naturally hTERT negative cell line and HeLa revealed differential expression of proteins in hTERT over-expressing cells. In U2OS cell line 28 spots were picked among which 23 spots represented upregulated and 5 represented down regulated proteins. In HeLa cells 21 were upregulated and 2 were down regulated out of 23 selected spots under otherwise identical experimental conditions. Some heat shock proteins viz. Hsp60 and Hsp70 and GAPDH, which is a housekeeping gene, were found similarly upregulated in both the cell lines. The upregulation of these proteins were further confirmed at RNA and protein level by real-time PCR and western blotting respectively.

  1. Phylogenetic analyses of the polyprotein coding sequences of serotype O foot-and-mouth disease viruses in East Africa: evidence for interserotypic recombination

    DEFF Research Database (Denmark)

    Balinda, Sheila; Siegismund, Hans; Muwanika, Vincent

    2010-01-01

    evolutionary relationships and processes responsible for the generation and maintenance of diversity within this serotype. FMD virus RNA was obtained from six samples following virus isolation in cell culture and in one case by direct extraction from an oropharyngeal sample. Following RT-PCR, the single long....... Evolutionary relationships between the coding regions for the leader protease (L), the capsid region and almost the entire coding region are monophyletic except for the K/52/1992 which is distinct. Furthermore, phylogenetic relationships for the P2 and P3 regions suggest that the K/52/1992 is a probable...

  2. Weak correlation between sequence conservation in promoter regions and in protein-coding regions of human-mouse orthologous gene pairs

    Directory of Open Access Journals (Sweden)

    Nakai Kenta

    2008-04-01

    Full Text Available Abstract Background Interspecies sequence comparison is a powerful tool to extract functional or evolutionary information from the genomes of organisms. A number of studies have compared protein sequences or promoter sequences between mammals, which provided many insights into genomics. However, the correlation between protein conservation and promoter conservation remains controversial. Results We examined promoter conservation as well as protein conservation for 6,901 human and mouse orthologous genes, and observed a very weak correlation between them. We further investigated their relationship by decomposing it based on functional categories, and identified categories with significant tendencies. Remarkably, the 'ribosome' category showed significantly low promoter conservation, despite its high protein conservation, and the 'extracellular matrix' category showed significantly high promoter conservation, in spite of its low protein conservation. Conclusion Our results show the relation of gene function to protein conservation and promoter conservation, and revealed that there seem to be nonparallel components between protein and promoter sequence evolution.

  3. Coding assignment and nucleotide sequence of simian rotavirus SA11 gene segment 10: location of glycosylation sites suggests that the signal peptide is not cleaved.

    OpenAIRE

    Both, G W; Siegman, L J; Bellamy, A R; Atkinson, P H

    1983-01-01

    A cloned DNA copy of simian rotavirus SA11 genomic segment 10 was used to confirm the assignment of the nonstructural glycoprotein NCVP5 to this gene. Determination of the nucleotide sequence for gene 10 indicated that NCVP5 is 175 amino acids in length and has an N-terminal hydrophobic region with the characteristics of a signal sequence for membrane translocation. Unexpectedly, this region was also the location for the only two potential glycosylation sites within the molecule, asparagine r...

  4. Ultrasonographic prediction of highly aggressive telomerase reverse transcriptase (TERT) promoter-mutated papillary thyroid cancer.

    Science.gov (United States)

    Kim, Tae Hyuk; Ki, Chang-Seok; Hahn, Soo Yeon; Oh, Young Lyun; Jang, Hye Won; Kim, Sun Wook; Chung, Jae Hoon; Shin, Jung Hee

    2017-08-01

    Telomerase reverse transcriptase promoter mutations are found in highly aggressive thyroid malignancies. Our aim was to define the ultrasonographic features of telomerase reverse transcriptase promoter-mutated papillary thyroid cancer and to evaluate their predictive performances. Ultrasonographic findings were reviewed for 185 patients with surgically confirmed papillary thyroid cancer between 1994 and 2004. Genomic DNA to identify telomerase reverse transcriptase promoter mutations was extracted from archived surgical specimens. Logistic regression analysis was performed to compare clinical factors and ultrasonographic findings between telomerase reverse transcriptase promoter-mutated and wild-type papillary thyroid cancers. A telomerase reverse transcriptase promoter mutation was detected in 8.1% (15 of 185) of specimens from papillary thyroid cancer patients with a strong trend toward increasing age. Nonparallel orientation and microlobulated margin were independent ultrasonographic findings for predicting telomerase reverse transcriptase promoter-mutated papillary thyroid cancer in patients over 50 years (odds ratio 5.898, 95% confidence interval 1.092-31.851, P = 0.039 for orientation; odds ratio 5.813, 95% confidence interval 1.320-25.602, P = 0.020 for margin). Prevalence of telomerase reverse transcriptase promoter mutations increased to 50.0% in papillary thyroid cancer patients older than 50 years with both ultrasonographic findings and was 0% in patients without either finding. For identifying telomerase reverse transcriptase promoter-mutated papillary thyroid cancer, ultrasonographic had 64.3% sensitivity, 80.8% specificity, 50.0% positive predictive value and 88.4% negative predictive value. Telomerase reverse transcriptase promoter-mutated papillary thyroid cancer could be suggested by the ultrasonographic features of nonparallel orientation and microlobulated margin in patients older than 50 years. Prebiopsy recognition of this unique

  5. Identification of an active reverse transcriptase enzyme encoded by a human endogenous HERV-K retrovirus

    NARCIS (Netherlands)

    Berkhout, B.; Jebbink, M.; Zsíros, J.

    1999-01-01

    Of the numerous endogenous retroviral elements that are present in the human genome, the abundant HERV-K family is distinct because several members are transcriptionally active and coding for biologically active proteins. A detailed phylogeny of the HERV-K family based on the partial sequence of the

  6. [Human immunodeficiency virus and AIDS in terms of reverse transcriptase and molecular evolution].

    Science.gov (United States)

    Doi, H

    1998-03-01

    Human immunodeficiency virus type 1 (HIV-1) evolves rapidly in the host. The computer analysis of the HIV-1 genome has shown that the mutation manner is dependent on oligonucleotide sequences (in particular, six bases long); thus HIV-1 adaptively evolves. The six-base-long interaction between template-primer oligonucleotide and the reverse transcriptase (RT) has been revealed by the crystal structure of RT, in vitro termination assay of plymerization, and hydroxyl radical footprint analysis. It has been thought that AIDS is caused by the large numbers of HIV-1 quasispecies yielded by the adaptive and rapid evolution in the host. However, the slow evolution and the high levels of viral RNA in the progressive HIV-1 infected individuals (progressives) were recently reported; in contrast, the adaptive and rapid evolution and the low viral-RNA levels were reported in the non-progressives. This suggests that the physiological environment, e.g. pH and dNTP balance, in which RT works in the progressives is different from that in the non-progressives.

  7. Phylogenetic footprinting of non-coding RNA: hammerhead ribozyme sequences in a satellite DNA family of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae

    Directory of Open Access Journals (Sweden)

    Venanzetti Federica

    2010-01-01

    Full Text Available Abstract Background The great variety in sequence, length, complexity, and abundance of satellite DNA has made it difficult to ascribe any function to this genome component. Recent studies have shown that satellite DNA can be transcribed and be involved in regulation of chromatin structure and gene expression. Some satellite DNAs, such as the pDo500 sequence family in Dolichopoda cave crickets, have a catalytic hammerhead (HH ribozyme structure and activity embedded within each repeat. Results We assessed the phylogenetic footprints of the HH ribozyme within the pDo500 sequences from 38 different populations representing 12 species of Dolichopoda. The HH region was significantly more conserved than the non-hammerhead (NHH region of the pDo500 repeat. In addition, stems were more conserved than loops. In stems, several compensatory mutations were detected that maintain base pairing. The core region of the HH ribozyme was affected by very few nucleotide substitutions and the cleavage position was altered only once among 198 sequences. RNA folding of the HH sequences revealed that a potentially active HH ribozyme can be found in most of the Dolichopoda populations and species. Conclusions The phylogenetic footprints suggest that the HH region of the pDo500 sequence family is selected for function in Dolichopoda cave crickets. However, the functional role of HH ribozymes in eukaryotic organisms is unclear. The possible functions have been related to trans cleavage of an RNA target by a ribonucleoprotein and regulation of gene expression. Whether the HH ribozyme in Dolichopoda is involved in similar functions remains to be investigated. Future studies need to demonstrate how the observed nucleotide changes and evolutionary constraint have affected the catalytic efficiency of the hammerhead.

  8. Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.

    Science.gov (United States)

    Sharma, Mamta; Saravolatz, Louis D

    2013-02-01

    Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.

  9. A widespread class of reverse transcriptase-related cellular genes.

    Science.gov (United States)

    Gladyshev, Eugene A; Arkhipova, Irina R

    2011-12-20

    Reverse transcriptases (RTs) polymerize DNA on RNA templates. They fall into several structurally related but distinct classes and form an assemblage of RT-like enzymes that, in addition to RTs, also includes certain viral RNA-dependent RNA polymerases (RdRP) synthesizing RNA on RNA templates. It is generally believed that most RT-like enzymes originate from retrotransposons or viruses and have no specific function in the host cell, with telomerases being the only notable exception. Here we report on the discovery and properties of a unique class of RT-related cellular genes collectively named rvt. We present evidence that rvts are not components of retrotransposons or viruses, but single-copy genes with a characteristic domain structure that may contain introns in evolutionarily conserved positions, occur in syntenic regions, and evolve under purifying selection. These genes can be found in all major taxonomic groups including protists, fungi, animals, plants, and even bacteria, although they exhibit patchy phylogenetic distribution in each kingdom. We also show that the RVT protein purified from one of its natural hosts, Neurospora crassa, exists in a multimeric form and has the ability to polymerize NTPs as well as dNTPs in vitro, with a strong preference for NTPs, using Mn(2+) as a cofactor. The existence of a previously unknown class of single-copy RT-related genes calls for reevaluation of the current views on evolution and functional roles of RNA-dependent polymerases in living cells.

  10. 2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase

    International Nuclear Information System (INIS)

    Starnes, M.C.

    1988-01-01

    2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells

  11. Impact of human leukocyte antigen-B*51-restricted cytotoxic T-lymphocyte pressure on mutation patterns of nonnucleoside reverse transcriptase inhibitor resistance.

    Science.gov (United States)

    Gatanaga, Hiroyuki; Ode, Hirotaka; Hachiya, Atsuko; Hayashida, Tsunefusa; Sato, Hironori; Takiguchi, Masafumi; Oka, Shinichi

    2010-03-13

    The objective of this study is to determine the impact of human leukocyte antigen (HLA)-B*51-restricted cytotoxic T-lymphocyte (CTL) pressure on the development of nonnucleoside reverse transcriptase inhibitor (NNRTI) resistance. The prevalence of HIV-1 harboring an escape mutation, I135X, in a major epitope of HLA-B*51-restricted CTL located in reverse transcriptase is increasing worldwide. We analyzed the effects of escape mutations on the emerging mutation patterns of NNRTI resistance. Monoclonal HIV-1 sequences harboring each of the escape mutations, including I135L (HIV-1I135L), I135V (HIV-1I135V), I135T (HIV-1I135T), and I135R (HIV-1I135R) in reverse transcriptase, and a wild-type monoclonal HIV-1 (HIV-1WT) were cultured in the presence of increasing concentrations of efavirenz. Induced mutations during culture passages of the culture were analyzed. E138K emerged during the cultural passages of HIV-1I135V, HIV-1I135T, and HIV-1I135R, but not during the passages of HIV-1WT. The combination of I135T, the most frequent escape mutation, and E138K (HIV-1I135T/E138K) conferred significant resistance to efavirenz, nevirapine, and etravirine. The HIV-1I135L/E138K and HIV-1I135R/E138K were significantly resistant to nevirapine and etravirine, respectively, though each solo of escape mutations and E138K did not confer significant resistance to NNRTI. Computational analysis indicated that I135T and E138K cooperatively extend the gap between the binding site of reverse transcriptase and NNRTI. HLA-B*51-restricted CTL can induce novel mutation patterns of NNRTI resistance by selecting escape mutations. The spread of CTL escape variants may alter the mutation patterns of drug resistance.

  12. Designing hypothesis of substituted benzoxazinones as HIV-1 reverse transcriptase inhibitors: QSAR approach.

    Science.gov (United States)

    Veerasamy, Ravichandran; Subramaniam, Dinesh Kumar; Chean, Ooi Chia; Ying, Ng Mei

    2012-10-01

    A linear quantitative structure activity relationship (QSAR) model is presented for predicting human immunodeficiency virus-1 (HIV-1) reverse transcriptase enzyme inhibition. The 2D QSAR and 3D-QSAR models were developed by stepwise multiple linear regression, partial least square (PLS) regression and k-nearest neighbor-molecular field analysis, PLS regression, respectively using a database consisting of 33 recently discovered benzoxazinones. The primary findings of this study is that the number of hydrogen atoms, number of (-NH2) group connected with solitary single bond alters the inhibition of HIV-1 reverse transcriptase. Further, presence of electrostatic, hydrophobic and steric field descriptors significantly affects the ability of benzoxazinone derivatives to inhibit HIV-1 reverse transcriptase. The selected descriptors could serve as a primer for the design of novel and potent antagonists of HIV-1 reverse transcriptase.

  13. Strategy to sequence the 89 exons of the human LRP1 gene coding for the lipoprotein receptor related protein: identification of one expressed mutation among 48 polymorphisms.

    Science.gov (United States)

    Van Leuven, F; Stas, L; Thiry, E; Nelissen, B; Miyake, Y

    1998-09-01

    The human lipoprotein receptor related protein (LRP) binds and internalizes a diverse set of ligands, making LRP the most multifunctional endocytic receptor known. This is possible due to the large size, i.e., 600 kDa, of the receptor protein containing three clusters of putative ligand binding domains, each structurally comparable to the classical LDL receptor. Based on previous structural analysis of the human LRP1 gene (Van Leuven et al., 1994, Genomics, 24: 78-89), a strategy was developed to sequence the 89 exons of the LRP1 gene, including partial intron sequences. The gene was amplified from individual genomic DNA by long-range PCR, in 14 amplicons sized between 0.4 and 11 kb that were used as templates for 110 sequencing primers. In total, 48 mutations and intronic polymorphisms were identified. Two previously reported polymorphisms, i.e., in the promoter region and in exon 3, were precisely defined by sequencing. The first expressed mutation, i.e., an alanine to valine transition at position 217 of the LRP precursor protein, was detected on one allele in 2 of 33 individuals. Although the strategy is still subject to refinement, this approach is reported to allow others to analyze genetic differences in the human LRP1 gene, with particular reference to the recently reported association with late-onset Alzheimer disease. Copyright 1998 Academic Press.

  14. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  15. Sequence variability in HC-Pro coding regions of Korean Soybean mosaic virus isolates is associated with differences in RNA silencing suppression

    Science.gov (United States)

    Soybean mosaic virus (SMV), a member of the family Potyviridae, is an important viral pathogen affecting soybean production in Korea. The variability in helper component proteinase (HC-Pro) sequences and pathogenicity of SMV tissue samples from seven Korean provinces was investigated and compared wi...

  16. LRE2, an active human L1 element, has low level transcriptional activity and extremely low reverse transcriptase activity

    Energy Technology Data Exchange (ETDEWEB)

    Holmes, S.E.; Dombroski, B.A.; Sassaman, D.M. [Univ. of Pennsylvania School of Medicine, Philadelphia, PA (United States)] [and others

    1994-09-01

    Previously, we found a 2 kb insertion containing a rearranged L1 element plus a unique sequence component (USC) within exon 48 of the dystrophin gene of a patient with muscular dystrophy. We used the USC to clone the precursor of this insertion, the second known {open_quotes}active{close_quotes} human L1 element. The locus LRE2 (L1 Retrotransposable Element 2) has an allele derived from the patient which matches the insertion sequence exactly. LRE2 has a perfect 13-15 bp target site duplication, 2 open reading frames (ORFs), and an unusual 21 bp truncation of the 5{prime} end in a region known to be important for L1 transcription. The truncated LRE2 promoter has about 20% of the transcriptional activity of a previously studied L1 promoter after transfection into NTera2D1 cells of a construct in which the L1 promoter drives the expression of a lacZ gene. In addition, the reverse transcriptase (RT) encoded by LRE2 is active in an in vivo pseudogene assay in yeast and an in vitro assay. However, in both assays the RT of LRE2 is 1-5% as active as that of LRE1. These data demonstrate that multiple {open_quotes}active{close_quotes} L1 elements exist in the human genome, and that active elements can have highly variable rates of transcription and reverse transcriptase activity. That the RT of LRE2 has extremely low activity suggests the possibility that retrotransposition of an L1 element may in some cases involve an RT encoded by another L1 element.

  17. Microcollinearity in an ethylene receptor coding gene region of the Coffea canephora genome is extensively conserved with Vitis vinifera and other distant dicotyledonous sequenced genomes

    Directory of Open Access Journals (Sweden)

    Campa Claudine

    2009-02-01

    Full Text Available Abstract Background Coffea canephora, also called Robusta, belongs to the Rubiaceae, the fourth largest angiosperm family. This diploid species (2x = 2n = 22 has a fairly small genome size of ≈ 690 Mb and despite its extreme economic importance, particularly for developing countries, knowledge on the genome composition, structure and evolution remain very limited. Here, we report the 160 kb of the first C. canephora Bacterial Artificial Chromosome (BAC clone ever sequenced and its fine analysis. Results This clone contains the CcEIN4 gene, encoding an ethylene receptor, and twenty other predicted genes showing a high gene density of one gene per 7.8 kb. Most of them display perfect matches with C. canephora expressed sequence tags or show transcriptional activities through PCR amplifications on cDNA libraries. Twenty-three transposable elements, mainly Class II transposon derivatives, were identified at this locus. Most of these Class II elements are Miniature Inverted-repeat Transposable Elements (MITE known to be closely associated with plant genes. This BAC composition gives a pattern similar to those found in gene rich regions of Solanum lycopersicum and Medicago truncatula genomes indicating that the CcEIN4 regions may belong to a gene rich region in the C. canephora genome. Comparative sequence analysis indicated an extensive conservation between C. canephora and most of the reference dicotyledonous genomes studied in this work, such as tomato (S. lycopersicum, grapevine (V. vinifera, barrel medic M. truncatula, black cottonwood (Populus trichocarpa and Arabidopsis thaliana. The higher degree of microcollinearity was found between C. canephora and V. vinifera, which belong respectively to the Asterids and Rosids, two clades that diverged more than 114 million years ago. Conclusion This study provides a first glimpse of C. canephora genome composition and evolution. Our data revealed a remarkable conservation of the microcollinearity

  18. A reflection of the coding of meaning in patient-physician interaction: Jürgen Habermas' theory of communication applied to sequence analysis.

    Science.gov (United States)

    Skirbekk, Helge

    2004-08-01

    This paper introduces parts of Jürgen Habermas' theory of communication in an attempt to understand how meaning is coded in patient-physician communication. By having a closer look at how patients and physicians make assertions with their utterances, light will be shed on difficult aspects of reaching understanding in the clinical encounter. Habermas' theory will be used to differentiate assertions into validity claims referring to truth, truthfulness and rightness. An analysis of hypothetical physician-replies to a patient suffering from back pains will substantiate the necessity for such a theory.

  19. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity

    International Nuclear Information System (INIS)

    Lubahn, D.B.; Simental, J.A.; Higgs, H.N.; Wilson, E.M.; French, F.S.; Brown, T.R.; Migeon, C.J.

    1989-01-01

    Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but the binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development

  20. SMANT: a complete code to determine the optimal sequence of dismantling of nuclear power plant components in order to reduce occupational doses

    International Nuclear Information System (INIS)

    Mincarini, M.

    1988-01-01

    The computer program SMANT, developed to assess the best disassembly sequence in case of decommissioning of nuclear installations, is presented in the report. The program is mainly related to: 1) amount of working time; 2) adsorbed doses of radiation by operator teams; 3) available segmenting processes for components piping and walls. An example of application to a real nuclear installation is also presented in appendix

  1. Accurate discrimination of conserved coding and non-coding regions through multiple indicators of evolutionary dynamics

    Directory of Open Access Journals (Sweden)

    Pesole Graziano

    2009-09-01

    Full Text Available Abstract Background The conservation of sequences between related genomes has long been recognised as an indication of functional significance and recognition of sequence homology is one of the principal approaches used in the annotation of newly sequenced genomes. In the context of recent findings that the number non-coding transcripts in higher organisms is likely to be much higher than previously imagined, discrimination between conserved coding and non-coding sequences is a topic of considerable interest. Additionally, it should be considered desirable to discriminate between coding and non-coding conserved sequences without recourse to the use of sequence similarity searches of protein databases as such approaches exclude the identification of novel conserved proteins without characterized homologs and may be influenced by the presence in databases of sequences which are erroneously annotated as coding. Results Here we present a machine learning-based approach for the discrimination of conserved coding sequences. Our method calculates various statistics related to the evolutionary dynamics of two aligned sequences. These features are considered by a Support Vector Machine which designates the alignment coding or non-coding with an associated probability score. Conclusion We show that our approach is both sensitive and accurate with respect to comparable methods and illustrate several situations in which it may be applied, including the identification of conserved coding regions in genome sequences and the discrimination of coding from non-coding cDNA sequences.

  2. Cloning and bioinformatics analyses of the coding DNA sequence (CDS of Delta 6 Desaturase gene from Mortierella alpina (CBS 754.68

    Directory of Open Access Journals (Sweden)

    Esmat Ashaar ghadim

    2018-06-01

    Full Text Available Introduction: Membrane-bound desaturases and related enzymes play a pivotal role in the biosynthesis of unsaturated fatty acids. Delta6 desaturase is a key enzyme in the biosynthesis of the unsaturated fatty acids. Mortierella alpina is an oleaginous fungus with active Delta 6 desaturase which hasbeengreatly considered recently. Materials and methods: In order to isolate and clone Δ6D gene from Mortierella alpina, after extraction of total RNA and synthesis cDNA, PCR amplification has been done using gene specific primers. The amplified fragment was cloned into the pBlueScriptSK+ containing seed specific promoter napin. Then the recombinant plasmid was transformed into E.coli DH5a by freezing and thawing method. The confirmed gene construct was cloned into the binary vector pBI121 and transformed into Agrobacterium LBA4404 in order to transform canola plants. Bioinformatics characterization of target gene was investigated by servers TMHMM, ProtParam and Psipred. Results: Correctness of cloning was confirmed by PCR with specific primers, enzymatic digestion and sequencing. The proliferation of a fragment with 830 bp using internal primer of napin promoter and Delta6 desaturase primer confirmed insertion of the gene along with napin promoter. Nucleotide sequencing results showed that cloned CDS includes 1374 nucleotides that will translate to a protein with 448 amino acids. Using bioinformatics analysis, presence of cytochrome b5 domain, three His-box, secondary and spatial structures, transmembrane and conserved domains were confirmed. Discussion and conclusion: Based on the results of BLAST analysis using nucleotide and protein sequences, and also presence of functional domains in the protein, it can be predicted that cloned CDS will show proper enzyme activity after transformation into plants. Confirming these results requires expression analysis of the gene in appropriate plant system and studying its function in the enzyme level.

  3. Coding Partitions

    Directory of Open Access Journals (Sweden)

    Fabio Burderi

    2007-05-01

    Full Text Available Motivated by the study of decipherability conditions for codes weaker than Unique Decipherability (UD, we introduce the notion of coding partition. Such a notion generalizes that of UD code and, for codes that are not UD, allows to recover the ``unique decipherability" at the level of the classes of the partition. By tacking into account the natural order between the partitions, we define the characteristic partition of a code X as the finest coding partition of X. This leads to introduce the canonical decomposition of a code in at most one unambiguouscomponent and other (if any totally ambiguouscomponents. In the case the code is finite, we give an algorithm for computing its canonical partition. This, in particular, allows to decide whether a given partition of a finite code X is a coding partition. This last problem is then approached in the case the code is a rational set. We prove its decidability under the hypothesis that the partition contains a finite number of classes and each class is a rational set. Moreover we conjecture that the canonical partition satisfies such a hypothesis. Finally we consider also some relationships between coding partitions and varieties of codes.

  4. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  5. Coding Class

    DEFF Research Database (Denmark)

    Ejsing-Duun, Stine; Hansbøl, Mikala

    Sammenfatning af de mest væsentlige pointer fra hovedrapporten: Dokumentation og evaluering af Coding Class......Sammenfatning af de mest væsentlige pointer fra hovedrapporten: Dokumentation og evaluering af Coding Class...

  6. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

    Science.gov (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

    2007-10-01

    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  7. Rilpivirine resistance mutation E138K in HIV-1 reverse transcriptase predisposed by prevalent polymorphic mutations.

    Science.gov (United States)

    Hayashida, Tsunefusa; Hachiya, Atsuko; Ode, Hirotaka; Nishijima, Takeshi; Tsuchiya, Kiyoto; Sugiura, Wataru; Takiguchi, Masafumi; Oka, Shinichi; Gatanaga, Hiroyuki

    2016-10-01

    Rilpivirine is listed as a recommended or alternative key drug in the current ART guidelines. E138K in HIV-1 reverse transcriptase (RT) is a primary mutation in resistance to rilpivirine, although in vitro experiments showed it confers only E138K. The objective of this study was to reveal the mechanism amplifying rilpivirine resistance conferred by E138K. HIV-1 RT sequences were compared in patients who failed rilpivirine-containing ART virologically. The effects of mutations commonly identified with E138K on rilpivirine susceptibility were analysed by using recombinant HIV-1 variants. Rilpivirine-containing ART was introduced in 162 HIV-1-infected patients at the outpatient clinic of the AIDS Clinical Center (National Center for Global Health and Medicine, Tokyo, Japan) between May 2012 and June 2015. Virological treatment failure occurred in six of these patients. E138K emerged in three patients while other rilpivirine resistance mutations emerged in the other three patients. I135T/L were identified in only three patients with E138K and existed before the introduction of rilpivirine-containing ART. Analysis of recombinant HIV-1 variants indicated that E138K conferred low-level rilpivirine resistance and that coexistence of I135T/L with E138K amplified the resistance. I135T/L, escape mutations from HLA-B*51/52-restricted cytotoxic T lymphocytes, which are prevalent in Japan, may predispose HIV-1 to harbour E138K upon failure of rilpivirine-containing ART. The mutation patterns of drug resistance may vary due to baseline polymorphic mutations. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  9. Development of a PCR-based tool for detecting immunologically relevant Alt a 1 and Alt a 1 homologue coding sequences.

    Science.gov (United States)

    Gabriel, M F; Postigo, I; Gutiérrez-Rodríguez, A; Suñén, E; Tomaz, C T; Martínez, J

    2015-08-01

    Alt a 1 has been recognized as the most important allergen produced by the Pleosporaceae family and is a risk factor for asthma development and/or exacerbation. The aim of this study was to develop a detection tool that is highly specific for species that produced airborne Alt a 1. Based on the highly conserved internal nucleotide region of the several Alt a 1 sequences that are available in GenBank, a pair of primers (Alta1CF/Alta1CR) was designed. A set of primers used by other authors for the production of recombinant Alt a 1 (A21F/A21R) was also tested. The molecular analyses were based on the polymerase chain reaction (PCR) amplification and sequencing of the cDNA that was obtained from thirteen common fungal species. The PCR system that utilized Alta1CF/Alta1CR was highly specific, sensitive, and was able to detect an amplicon of approximately 180 bp from Alt a 1 and Alt a 1-like encoding genes from A. alternata, A. tenuissima, A. infectoria, U. botrytis, and S. botryosum. In contrast, the A21F/A21R primers were specific for the very close taxonomically related species A. alternata and A. tenuissima. Thus, this rapid, sensitive, and specific detection tool can be used to assess Alt a 1 exposure levels and to inform the implementation of the appropriate public health measures. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Design of annulated pyrazoles as inhibitors of HIV-1 reverse transcriptase.

    Science.gov (United States)

    Sweeney, Zachary K; Harris, Seth F; Arora, Seth F; Javanbakht, Hassan; Li, Yu; Fretland, Jennifer; Davidson, James P; Billedeau, J Roland; Gleason, Shelley K; Hirschfeld, Donald; Kennedy-Smith, Joshua J; Mirzadegan, Taraneh; Roetz, Ralf; Smith, Mark; Sperry, Sarah; Suh, Judy M; Wu, Jeffrey; Tsing, Stan; Villaseñor, Armando G; Paul, Amber; Su, Guoping; Heilek, Gabrielle; Hang, Julie Q; Zhou, Amy S; Jernelius, Jesper A; Zhang, Fang-Jie; Klumpp, Klaus

    2008-12-11

    Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of HIV. These regimens are extremely effective in suppressing virus replication. Structure-based optimization of diaryl ether inhibitors led to the discovery of a new series of pyrazolo[3,4-c]pyridazine NNRTIs that bind the reverse transcriptase enzyme of human immunodeficiency virus-1 (HIV-RT) in an expanded volume relative to most other inhibitors in this class.The binding mode maintains the beta13 and beta14 strands bearing Pro236 in a position similar to that in the unliganded reverse transcriptase structure, and the distribution of interactions creates the opportunity for substantial resilience to single point mutations. Several pyrazolopyridazine NNRTIs were found to be highly effective against wild-type and NNRTI-resistant viral strains in cell culture.

  11. The microRNAs in an ancient protist repress the variant-specific surface protein expression by targeting the entire coding sequence.

    Directory of Open Access Journals (Sweden)

    Ashesh A Saraiya

    2014-02-01

    Full Text Available microRNAs (miRNA have been detected in the deeply branched protist, Giardia lamblia, and shown to repress expression of the family of variant-specific surface proteins (VSPs, only one of which is expressed in Giardia trophozoite at a given time. Three next-generation sequencing libraries of Giardia Argonaute-associated small RNAs were constructed and analyzed. Analysis of the libraries identified a total of 99 new putative miRNAs with a size primarily in the 26 nt range similar to the size previously predicted by the Giardia Dicer crystal structure and identified by our own studies. Bioinformatic analysis identified multiple putative miRNA target sites in the mRNAs of all 73 VSPs. The effect of miRNA target sites within a defined 3'-region were tested on two vsp mRNAs. All the miRNAs showed partial repression of the corresponding vsp expression and were additive when the targeting sites were separately located. But the combined repression still falls short of 100%. Two other relatively short vsp mRNAs with 15 and 11 putative miRNA target sites identified throughout their ORFs were tested with their corresponding miRNAs. The results indicate that; (1 near 100% repression of vsp mRNA expression can be achieved through the combined action of multiple miRNAs on target sites located throughout the ORF; (2 the miRNA machinery could be instrumental in repressing the expression of vsp genes in Giardia; (3 this is the first time that all the miRNA target sites in the entire ORF of a mRNA have been tested and shown to be functional.

  12. Profiling of Long Non-coding RNAs and mRNAs by RNA-Sequencing in the Hippocampi of Adult Mice Following Propofol Sedation.

    Science.gov (United States)

    Fan, Jun; Zhou, Quan; Li, Yan; Song, Xiuling; Hu, Jijie; Qin, Zaisheng; Tang, Jing; Tao, Tao

    2018-01-01

    Propofol is a frequently used intravenous anesthetic agent. The impairment caused by propofol on the neural system, especially the hippocampus, has been widely reported. However, the molecular mechanism underlying the effects of propofol on learning and memory functions in the hippocampus is still unclear. In the present study we performed lncRNA and mRNA analysis in the hippocampi of adult mice, after propofol sedation, through RNA-Sequencing (RNA-Seq). A total of 146 differentially expressed lncRNAs and 1103 mRNAs were identified. Bioinformatics analysis, including gene ontology (GO) analysis, pathway analysis and network analysis, were done for the identified dysregulated genes. Pathway analysis indicated that the FoxO signaling pathway played an important role in the effects of propofol on the hippocampus. Finally, four lncRNAs and three proteins were selected from the FoxO-related network for further validation. The up-regulation of lncE230001N04Rik and the down-regulation of lncRP23-430H21.1 and lncB230206L02Rik showed the same fold change tendencies but changes in Gm26532 were not statistically significant in the RNA-Seq results, following propofol sedation. The FoxO pathway-related proteins, PI3K and AKT, are up-regulated in propofol-exposed group. FoxO3a is down-regulated at both mRNA and protein levels. Our study reveals that propofol sedation can influence the expression of lncRNAs and mRNAs in the hippocampus, and bioinformatics analysis have identified key biological processes and pathways associated with propofol sedation. Cumulatively, our results provide a framework for further study on the role of lncRNAs in propofol-induced or -related neurotoxicity, particularly with regards to hippocampus-related dysfunction.

  13. Profiling of Long Non-coding RNAs and mRNAs by RNA-Sequencing in the Hippocampi of Adult Mice Following Propofol Sedation

    Directory of Open Access Journals (Sweden)

    Jun Fan

    2018-03-01

    Full Text Available Propofol is a frequently used intravenous anesthetic agent. The impairment caused by propofol on the neural system, especially the hippocampus, has been widely reported. However, the molecular mechanism underlying the effects of propofol on learning and memory functions in the hippocampus is still unclear. In the present study we performed lncRNA and mRNA analysis in the hippocampi of adult mice, after propofol sedation, through RNA-Sequencing (RNA-Seq. A total of 146 differentially expressed lncRNAs and 1103 mRNAs were identified. Bioinformatics analysis, including gene ontology (GO analysis, pathway analysis and network analysis, were done for the identified dysregulated genes. Pathway analysis indicated that the FoxO signaling pathway played an important role in the effects of propofol on the hippocampus. Finally, four lncRNAs and three proteins were selected from the FoxO-related network for further validation. The up-regulation of lncE230001N04Rik and the down-regulation of lncRP23-430H21.1 and lncB230206L02Rik showed the same fold change tendencies but changes in Gm26532 were not statistically significant in the RNA-Seq results, following propofol sedation. The FoxO pathway-related proteins, PI3K and AKT, are up-regulated in propofol-exposed group. FoxO3a is down-regulated at both mRNA and protein levels. Our study reveals that propofol sedation can influence the expression of lncRNAs and mRNAs in the hippocampus, and bioinformatics analysis have identified key biological processes and pathways associated with propofol sedation. Cumulatively, our results provide a framework for further study on the role of lncRNAs in propofol-induced or -related neurotoxicity, particularly with regards to hippocampus-related dysfunction.

  14. Detection of Multiple Budding Yeast Cells and a Partial Sequence of 43-kDa Glycoprotein Coding Gene of Paracoccidioides brasiliensis from a Case of Lacaziosis in a Female Pacific White-Sided Dolphin (Lagenorhynchus obliquidens).

    Science.gov (United States)

    Minakawa, Tomoko; Ueda, Keiichi; Tanaka, Miyuu; Tanaka, Natsuki; Kuwamura, Mitsuru; Izawa, Takeshi; Konno, Toshihiro; Yamate, Jyoji; Itano, Eiko Nakagawa; Sano, Ayako; Wada, Shinpei

    2016-08-01

    Lacaziosis, formerly called as lobomycosis, is a zoonotic mycosis, caused by Lacazia loboi, found in humans and dolphins, and is endemic in the countries on the Atlantic Ocean, Indian Ocean and Pacific Ocean of Japanese coast. Susceptible Cetacean species include the bottlenose dolphin (Tursiops truncatus), the Indian Ocean bottlenose dolphin (T. aduncus), and the estuarine dolphin (Sotalia guianensis); however, no cases have been recorded in other Cetacean species. We diagnosed a case of Lacaziosis in a Pacific white-sided dolphin (Lagenorhynchus obliquidens) nursing in an aquarium in Japan. The dolphin was a female estimated to be more than 14 years old at the end of June 2015 and was captured in a coast of Japan Sea in 2001. Multiple, lobose, and solid granulomatous lesions with or without ulcers appeared on her jaw, back, flipper and fluke skin, in July 2014. The granulomatous skin lesions from the present case were similar to those of our previous cases. Multiple budding and chains of round yeast cells were detected in the biopsied samples. The partial sequence of 43-kDa glycoprotein coding gene confirmed by a nested PCR and sequencing, which revealed a different genotype from both Amazonian and Japanese lacaziosis in bottlenose dolphins, and was 99 % identical to those derived from Paracoccidioides brasiliensis; a sister fungal species to L. loboi. This is the first case of lacaziosis in Pacific white-sided dolphin.

  15. The non-coding RNA TERRA is a natural ligand and direct inhibitor of human telomerase.

    Science.gov (United States)

    Redon, Sophie; Reichenbach, Patrick; Lingner, Joachim

    2010-09-01

    Telomeres, the physical ends of eukaryotes chromosomes are transcribed into telomeric repeat containing RNA (TERRA), a large non-coding RNA of unknown function, which forms an integral part of telomeric heterochromatin. TERRA molecules resemble in sequence the telomeric DNA substrate as they contain 5'-UUAGGG-3' repeats near their 3'-end which are complementary to the template sequence of telomerase RNA. Here we demonstrate that endogenous TERRA is bound to human telomerase in cell extracts. Using in vitro reconstituted telomerase and synthetic TERRA molecules we demonstrate that the 5'-UUAGGG-3' repeats of TERRA base pair with the RNA template of the telomerase RNA moiety (TR). In addition TERRA contacts the telomerase reverse transcriptase (TERT) protein subunit independently of hTR. In vitro studies further demonstrate that TERRA is not used as a telomerase substrate. Instead, TERRA acts as a potent competitive inhibitor for telomeric DNA in addition to exerting an uncompetitive mode of inhibition. Our data identify TERRA as a telomerase ligand and natural direct inhibitor of human telomerase. Telomerase regulation by the telomere substrate may be mediated via its transcription.

  16. Report number codes

    International Nuclear Information System (INIS)

    Nelson, R.N.

    1985-05-01

    This publication lists all report number codes processed by the Office of Scientific and Technical Information. The report codes are substantially based on the American National Standards Institute, Standard Technical Report Number (STRN)-Format and Creation Z39.23-1983. The Standard Technical Report Number (STRN) provides one of the primary methods of identifying a specific technical report. The STRN consists of two parts: The report code and the sequential number. The report code identifies the issuing organization, a specific program, or a type of document. The sequential number, which is assigned in sequence by each report issuing entity, is not included in this publication. Part I of this compilation is alphabetized by report codes followed by issuing installations. Part II lists the issuing organization followed by the assigned report code(s). In both Parts I and II, the names of issuing organizations appear for the most part in the form used at the time the reports were issued. However, for some of the more prolific installations which have had name changes, all entries have been merged under the current name

  17. Report number codes

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, R.N. (ed.)

    1985-05-01

    This publication lists all report number codes processed by the Office of Scientific and Technical Information. The report codes are substantially based on the American National Standards Institute, Standard Technical Report Number (STRN)-Format and Creation Z39.23-1983. The Standard Technical Report Number (STRN) provides one of the primary methods of identifying a specific technical report. The STRN consists of two parts: The report code and the sequential number. The report code identifies the issuing organization, a specific program, or a type of document. The sequential number, which is assigned in sequence by each report issuing entity, is not included in this publication. Part I of this compilation is alphabetized by report codes followed by issuing installations. Part II lists the issuing organization followed by the assigned report code(s). In both Parts I and II, the names of issuing organizations appear for the most part in the form used at the time the reports were issued. However, for some of the more prolific installations which have had name changes, all entries have been merged under the current name.

  18. Computational Analysis of Molecular Interaction Networks Underlying Change of HIV-1 Resistance to Selected Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan

    2010-12-12

    Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.

  19. Serum capacity to inhibit reverse transcriptase in vitro distinguishes HIV-1 infection from HIV-2 or SIV infection

    NARCIS (Netherlands)

    Wolfs, T. F.; Geelen, J. L.; Schellekens, H.; Barin, F.; Dekker, J. T.; Goudsmit, J.

    1989-01-01

    The inhibition of HIV-1 and SIV reverse transcriptase by human and rhesus macaque serum positive for HIV-1 or HIV-2/SIV antibodies was studied. The domain to which reverse transcriptase-inhibiting antibodies were elicited appeared to be highly antigenic. A total of 67% (48 of 72) of individuals had

  20. Network Coding

    Indian Academy of Sciences (India)

    message symbols downstream, network coding achieves vast performance gains by permitting intermediate nodes to carry out algebraic oper- ations on the incoming data. In this article we present a tutorial introduction to network coding as well as an application to the e±cient operation of distributed data-storage networks.

  1. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires

    Directory of Open Access Journals (Sweden)

    Sukrit Silas

    2017-07-01

    Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.

  2. Tissue distribution and engraftment of human mesenchymal stem cells immortalized by human telomerase reverse transcriptase gene

    DEFF Research Database (Denmark)

    Bentzon, J.F.; Stenderup, K.; Hansen, F.D.

    2005-01-01

    Engraftment of mesenchymal stem cells (MSC) in peripheral tissues for replenishing of local stem cell function has been proposed as a therapeutic approach to degenerative diseases. We have previously reported the development of an immortalized human telomerase reverse transcriptase transduced MSC...

  3. The impact of the M184V substitution in HIV-1 reverse transcriptase on treatment response

    NARCIS (Netherlands)

    Miller, V.; Stark, T.; Loeliger, A. E.; Lange, J. M. A.

    2002-01-01

    The M184V mutation in the HIV-1 reverse transcriptase gene is primarily associated with rapid, high-level lamivudine (3TC) resistance. It has also been observed to arise under selective pressure by abacavir, to which it confers low-level resistance. Although the development of viral drug resistance

  4. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients

    DEFF Research Database (Denmark)

    Lundgren, Jens

    2008-01-01

    BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...

  5. Kinetic analysis of reverse transcriptase activity of bacterial family A DNA polymerases.

    Science.gov (United States)

    Yasukawa, Kiyoshi; Konishi, Atsushi; Shinomura, Mayu; Nagaoka, Eriko; Fujiwara, Shinsuke

    2012-10-26

    Some bacterial thermostable, wild-type or genetically engineered family A DNA polymerases have reverse transcriptase activity. However, difference in reverse transcriptase activities of family A DNA polymerases and retroviral reverse transcriptases (RTs) is unclear. In this study, comparative kinetic analysis was performed for the reverse transcriptase activities of the wild-type enzyme of family A DNA polymerase (M1pol(WT)) from Thermus thermophilus M1 and the variant enzyme of family A DNA polymerase (K4pol(L329A)), in which the mutation of Leu329→Ala is undertaken, from Thermotoga petrophila K4. In the incorporation of dTTP into poly(rA)-p(dT)(45), the reaction rates of K4pol(L329A) and M1pol(WT) exhibited a saturated profile of the Michaelis-Menten kinetics for dTTP concentrations but a substrate inhibition profile for poly(rA)-p(dT)(45) concentrations. In contrast, the reaction rates of Moloney murine leukemia virus (MMLV) RT exhibited saturated profiles for both dTTP and poly(rA)-p(dT)(45) concentrations. This suggests that high concentrations of DNA-primed RNA template decrease the efficiency of cDNA synthesis with bacterial family A DNA polymerases. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity

    Science.gov (United States)

    House, M.L.; Kim, C.H.; Reno, P.W.

    1998-01-01

    Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (reverse transcriptase assay.

  7. E138K and M184I mutations in HIV-1 reverse transcriptase coemerge as a result of APOBEC3 editing in the absence of drug exposure.

    Science.gov (United States)

    Fourati, Slim; Malet, Isabelle; Lambert, Sidonie; Soulie, Cathia; Wirden, Marc; Flandre, Philippe; Fofana, Djeneba B; Sayon, Sophie; Simon, Anne; Katlama, Christine; Calvez, Vincent; Marcelin, Anne-Geneviève

    2012-08-24

    Recent clinical trials with rilpivirine combined with emtricitabine and tenofovir revealed that patients failing treatment, frequently, harbored viruses encoding resistance-associated mutations in the HIV-1 reverse transcriptase at position E138K and M184I. We show here that APOBEC3 proteins play a role in the emergence of these drug resistance mutations. We used a Vif mutant that has suboptimal activity against APOBEC3 to assess the in-vitro frequency of APOBEC3-induced resistance mutations in reverse transcriptase. To assess the degree of in-vivo G-to-A viral hypermutation, a large amount of data of HIV-1 RT proviral sequences from peripheral blood mononuclear cells (PBMCs) recovered from infected patients under HAART was analyzed. In-vitro replication experiments in cell lines with and without APOBEC3 expression suggest that APOBEC3-driven mutagenesis contributes to the generation of both M184I and E138K within HIV proviral repository in the absence of drug exposure. Additionally, analysis of 601 patients PBMCs sequences revealed that the copresence of mutations E138K and M184I were never detected in nonhypermutated sequences, whereas these mutations were found at a high frequency (24%) in the context of APOBEC3 editing and in the absence of exposure to etravirine-rilpivirine. We demonstrate using in-vitro experiments and analyzing patients PBMCs sequences that M184I and E138K resistance-associated mutations may pre-exist in proviral reservoir at a high frequency prior to drug exposure, as a result of APOBEC3 editing. Thus, incomplete neutralization of one or more APOBEC3 proteins may favor viral escape to rilpivirine-emtricitabine. © 2012 Wolters Kluwer Health | Lippincott Williams & Wilkins

  8. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires.

    Science.gov (United States)

    Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z

    2017-07-11

    Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From

  9. The sequence of sequencers: The history of sequencing DNA

    Science.gov (United States)

    Heather, James M.; Chain, Benjamin

    2016-01-01

    Determining the order of nucleic acid residues in biological samples is an integral component of a wide variety of research applications. Over the last fifty years large numbers of researchers have applied themselves to the production of techniques and technologies to facilitate this feat, sequencing DNA and RNA molecules. This time-scale has witnessed tremendous changes, moving from sequencing short oligonucleotides to millions of bases, from struggling towards the deduction of the coding sequence of a single gene to rapid and widely available whole genome sequencing. This article traverses those years, iterating through the different generations of sequencing technology, highlighting some of the key discoveries, researchers, and sequences along the way. PMID:26554401

  10. Coding Class

    DEFF Research Database (Denmark)

    Ejsing-Duun, Stine; Hansbøl, Mikala

    Denne rapport rummer evaluering og dokumentation af Coding Class projektet1. Coding Class projektet blev igangsat i skoleåret 2016/2017 af IT-Branchen i samarbejde med en række medlemsvirksomheder, Københavns kommune, Vejle Kommune, Styrelsen for IT- og Læring (STIL) og den frivillige forening......, design tænkning og design-pædagogik, Stine Ejsing-Duun fra Forskningslab: It og Læringsdesign (ILD-LAB) ved Institut for kommunikation og psykologi, Aalborg Universitet i København. Vi har fulgt og gennemført evaluering og dokumentation af Coding Class projektet i perioden november 2016 til maj 2017....... Coding Class projektet er et pilotprojekt, hvor en række skoler i København og Vejle kommuner har igangsat undervisningsaktiviteter med fokus på kodning og programmering i skolen. Evalueringen og dokumentationen af projektet omfatter kvalitative nedslag i udvalgte undervisningsinterventioner i efteråret...

  11. Coding Labour

    Directory of Open Access Journals (Sweden)

    Anthony McCosker

    2014-03-01

    Full Text Available As well as introducing the Coding Labour section, the authors explore the diffusion of code across the material contexts of everyday life, through the objects and tools of mediation, the systems and practices of cultural production and organisational management, and in the material conditions of labour. Taking code beyond computation and software, their specific focus is on the increasingly familiar connections between code and labour with a focus on the codification and modulation of affect through technologies and practices of management within the contemporary work organisation. In the grey literature of spreadsheets, minutes, workload models, email and the like they identify a violence of forms through which workplace affect, in its constant flux of crisis and ‘prodromal’ modes, is regulated and governed.

  12. Characterization of two Arabidopsis thaliana myb-like proteins showing affinity to telomeric DNA sequence.

    Science.gov (United States)

    Schrumpfová, Petra; Kuchar, Milan; Miková, Gabriela; Skrísovská, Lenka; Kubicárová, Tatiana; Fajkus, Jirí

    2004-04-01

    Telomere-binding proteins participate in forming a functional nucleoprotein structure at chromosome ends. Using a genomic approach, two Arabidopsis thaliana genes coding for candidate Myb-like telomere binding proteins were cloned and expressed in E. coli. Both proteins, termed AtTBP2 (accession Nos. T46051 (protein database) and GI:638639 (nucleotide database); 295 amino acids, 32 kDa, pI 9.53) and AtTBP3 (BAB08466, GI:9757879; 299 amino acids, 33 kDa, pI 9.88), contain a single Myb-like DNA-binding domain at the N-terminus, and a histone H1/H5-like DNA-binding domain in the middle of the protein sequence. Both proteins are expressed in various A. thaliana tissues. Using the two-hybrid system interaction between the proteins AtTBP2 and AtTBP3 and self interactions of each of the proteins were detected. Gel-retardation assays revealed that each of the two proteins is able to bind the G-rich strand and double-stranded DNA of plant telomeric sequence with an affinity proportional to a number of telomeric repeats. Substrates bearing a non-telomeric DNA sequence positioned between two telomeric repeats were bound with an efficiency depending on the length of interrupting sequence. The ability to bind variant telomere sequences decreased with sequence divergence from the A. thaliana telomeric DNA. None of the proteins alone or their mixture affects telomerase activity in vitro. Correspondingly, no interaction was observed between any of two proteins and the Arabidopsis telomerase reverse transcriptase catalytic subunit TERT (accession No. AF172097) using two-hybrid assay.

  13. Speech coding

    Energy Technology Data Exchange (ETDEWEB)

    Ravishankar, C., Hughes Network Systems, Germantown, MD

    1998-05-08

    Speech is the predominant means of communication between human beings and since the invention of the telephone by Alexander Graham Bell in 1876, speech services have remained to be the core service in almost all telecommunication systems. Original analog methods of telephony had the disadvantage of speech signal getting corrupted by noise, cross-talk and distortion Long haul transmissions which use repeaters to compensate for the loss in signal strength on transmission links also increase the associated noise and distortion. On the other hand digital transmission is relatively immune to noise, cross-talk and distortion primarily because of the capability to faithfully regenerate digital signal at each repeater purely based on a binary decision. Hence end-to-end performance of the digital link essentially becomes independent of the length and operating frequency bands of the link Hence from a transmission point of view digital transmission has been the preferred approach due to its higher immunity to noise. The need to carry digital speech became extremely important from a service provision point of view as well. Modem requirements have introduced the need for robust, flexible and secure services that can carry a multitude of signal types (such as voice, data and video) without a fundamental change in infrastructure. Such a requirement could not have been easily met without the advent of digital transmission systems, thereby requiring speech to be coded digitally. The term Speech Coding is often referred to techniques that represent or code speech signals either directly as a waveform or as a set of parameters by analyzing the speech signal. In either case, the codes are transmitted to the distant end where speech is reconstructed or synthesized using the received set of codes. A more generic term that is applicable to these techniques that is often interchangeably used with speech coding is the term voice coding. This term is more generic in the sense that the

  14. Integration of maternal genome into the neonate genome through breast milk mRNA transcripts and reverse transcriptase

    Directory of Open Access Journals (Sweden)

    Irmak M

    2012-06-01

    Full Text Available Abstract Human milk samples contain microvesicles similar to the retroviruses. These microvesicles contain mRNA transcripts and possess reverse transcriptase activity. They contain about 14,000 transcripts representing the milk transcriptome. Microvesicles are also enriched with proteins related to “caveolar-mediated endocytosis signaling” pathway. It has recently been reported that microvesicles could be transferred to other cells by endocytosis and their RNA content can be translated and be functional in their new location. A significant percentage of the mammalian genome appears to be the product of reverse transcription, containing sequences whose characteristics point to RNA as a template precursor. These are mobile elements that move by way of transposition and are called retrotransposons. We thought that retrotransposons may stem from about 14,000 transcriptome of breast milk microvesicles, and reviewed the literature. The enhanced acceptance of maternal allografts in children who were breast-fed and tolerance to the maternal MHC antigens after breastfeeding may stem from RNAs of the breast milk microvesicles that can be taken up by the breastfed infant and receiving maternal genomic information. We conclude that milk microvesicles may transfer genetic signals from mother to neonate during breastfeeding. Moreover, transfer of wild type RNA from a healthy wet-nurse to the suckling neonate through the milk microvesicles and its subsequent reverse transcription and integration into the neonate genome could result in permanent correction of the clinical manifestations in genetic diseases.

  15. MicroRNA Regulation of Telomerase Reverse Transcriptase (TERT: Micro Machines Pull Strings of Papier-Mâché Puppets

    Directory of Open Access Journals (Sweden)

    Ammad Ahmad Farooqi

    2018-04-01

    Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.

  16. Basis for early and preferential selection of the E138K mutation in HIV-1 reverse transcriptase.

    Science.gov (United States)

    McCallum, Matthew; Oliveira, Maureen; Ibanescu, Ruxandra-Ilinca; Kramer, Victor G; Moisi, Daniela; Asahchop, Eugene L; Brenner, Bluma G; Harrigan, P Richard; Xu, Hongtao; Wainberg, Mark A

    2013-10-01

    E138K, a G→A mutation in HIV-1 reverse transcriptase (RT), is preferentially selected by etravirine (ETR) and rilpivirine over other substitutions at position E138 that offer greater drug resistance. We hypothesized that there was a mutational bias for the E138K substitution and designed an allele-specific PCR to monitor the emergence of E138A/G/K/Q/R/V during ETR selection experiments. We also performed competition experiments using mutated viruses and quantified the prevalence of E138 minority species in drug-naive patients. E138K, as well as E138G, consistently emerged first during ETR selection experiments, followed by E138A and E138Q; E138R was never selected. Surprisingly, E138K was identified as a tiny minority in 23% of drug-naive subtype B patients, a result confirmed by ultradeep sequencing (UDS). This result could reflect a low fitness cost of E138K; however, E138K was one of the least fit substitutions at codon E138, even after taking into account the deoxynucleoside triphosphate pools of the cells used in competition experiments. Further UDS analysis revealed other minority species in a pattern consistent with the mutational bias of HIV RT. There was no evidence of APOBEC3-hypermutation in these selection experiments or in patients. Our results confirm the mutational bias of HIV-1 in patients and highlight the importance of G→A mutations in HIV-1 drug resistance evolution.

  17. Mutations at position 184 of human immunodeficiency virus type-1 reverse transcriptase affect virus titer and viral DNA synthesis

    International Nuclear Information System (INIS)

    Julias, John G.; Boyer, Paul L.; McWilliams, Mary Jane; Alvord, W. Gregory; Hughes, Stephen H.

    2004-01-01

    Methionine at position 184 of human immunodeficiency virus type-1 (HIV-1) reverse transcriptase (RT) was changed to valine, isoleucine, threonine, or alanine in an HIV-1-based vector. The vectors were analyzed for replication capacity and for resistance to the nucleoside analog 2',3'-dideoxy-3'thiacytidine (3TC) using a single-cycle assay. Viruses containing the valine or isoleucine mutations were highly resistant to 3TC and replicated almost as well as the wild-type virus. The virus containing the threonine mutation was resistant to 3TC, but replicated about 30% as well as the wild-type. The alanine mutation conferred partial resistance to 3TC, but replicated poorly. The amounts of viral DNA synthesized decreased in 3TC-treated cells when the cells were infected with wild-type virus and the M184A mutant. The effect of these mutations on the generation of the ends of the linear viral DNA was determined using the sequence of the 2-LTR circle junctions. The M184T mutation increased the proportion of 2-LTR circle junctions containing a tRNA insertion, suggesting that the mutation affected the RNase H activity of RT

  18. NSURE code

    International Nuclear Information System (INIS)

    Rattan, D.S.

    1993-11-01

    NSURE stands for Near-Surface Repository code. NSURE is a performance assessment code. developed for the safety assessment of near-surface disposal facilities for low-level radioactive waste (LLRW). Part one of this report documents the NSURE model, governing equations and formulation of the mathematical models, and their implementation under the SYVAC3 executive. The NSURE model simulates the release of nuclides from an engineered vault, their subsequent transport via the groundwater and surface water pathways tot he biosphere, and predicts the resulting dose rate to a critical individual. Part two of this report consists of a User's manual, describing simulation procedures, input data preparation, output and example test cases

  19. Speaking Code

    DEFF Research Database (Denmark)

    Cox, Geoff

    Speaking Code begins by invoking the “Hello World” convention used by programmers when learning a new language, helping to establish the interplay of text and code that runs through the book. Interweaving the voice of critical writing from the humanities with the tradition of computing and softwa...... expression in the public realm. The book’s line of argument defends language against its invasion by economics, arguing that speech continues to underscore the human condition, however paradoxical this may seem in an era of pervasive computing....

  20. Targeted next-generation sequencing can replace Sanger sequencing in clinical diagnostics

    NARCIS (Netherlands)

    Sikkema-Raddatz, B.; Johansson, L.F.; de Boer, E.N.; Almomani, R.; Boven, L.G.; van den Berg, M.P.; van Spaendonck-Zwarts, K.Y.; van Tintelen, J.P.; Sijmons, R.H.; Jongbloed, J.D.H.; Sinke, R.J.

    Mutation detection through exome sequencing allows simultaneous analysis of all coding sequences of genes. However, it cannot yet replace Sanger sequencing (SS) in diagnostics because of incomplete representation and coverage of exons leading to missing clinically relevant mutations. Targeted

  1. The Aster code; Code Aster

    Energy Technology Data Exchange (ETDEWEB)

    Delbecq, J.M

    1999-07-01

    The Aster code is a 2D or 3D finite-element calculation code for structures developed by the R and D direction of Electricite de France (EdF). This dossier presents a complete overview of the characteristics and uses of the Aster code: introduction of version 4; the context of Aster (organisation of the code development, versions, systems and interfaces, development tools, quality assurance, independent validation); static mechanics (linear thermo-elasticity, Euler buckling, cables, Zarka-Casier method); non-linear mechanics (materials behaviour, big deformations, specific loads, unloading and loss of load proportionality indicators, global algorithm, contact and friction); rupture mechanics (G energy restitution level, restitution level in thermo-elasto-plasticity, 3D local energy restitution level, KI and KII stress intensity factors, calculation of limit loads for structures), specific treatments (fatigue, rupture, wear, error estimation); meshes and models (mesh generation, modeling, loads and boundary conditions, links between different modeling processes, resolution of linear systems, display of results etc..); vibration mechanics (modal and harmonic analysis, dynamics with shocks, direct transient dynamics, seismic analysis and aleatory dynamics, non-linear dynamics, dynamical sub-structuring); fluid-structure interactions (internal acoustics, mass, rigidity and damping); linear and non-linear thermal analysis; steels and metal industry (structure transformations); coupled problems (internal chaining, internal thermo-hydro-mechanical coupling, chaining with other codes); products and services. (J.S.)

  2. Crystal structures of HIV-1 reverse transcriptase complexes with thiocarbamate non-nucleoside inhibitors

    International Nuclear Information System (INIS)

    Spallarossa, Andrea; Cesarini, Sara; Ranise, Angelo; Ponassi, Marco; Unge, Torsten; Bolognesi, Martino

    2008-01-01

    O-Phthalimidoethyl-N-arylthiocarbamates (TCs) have been recently identified as a new class of potent HIV-1 reverse transcriptase (RT) non-nucleoside inhibitors (NNRTIs), by means of computer-aided drug design techniques [Ranise A. Spallarossa, S. Cesarini, F. Bondavalli, S. Schenone, O. Bruno, G. Menozzi, P. Fossa, L. Mosti, M. La Colla, et al., Structure-based design, parallel synthesis, structure-activity relationship, and molecular modeling studies of thiocarbamates, new potent non-nucleoside HIV-1 reverse transcriptase inhibitor isosteres of phenethylthiazolylthiourea derivatives, J. Med. Chem. 48 (2005) 3858-3873]. To elucidate the atomic details of RT/TC interaction and validate an earlier TC docking model, the structures of three RT/TC complexes were determined at 2.8-3.0 A resolution by X-ray crystallography. The conformations adopted by the enzyme-bound TCs were analyzed and compared with those of bioisosterically related NNRTIs

  3. Miscoding properties of isoguanine (2-oxoadenine) studied in an AMV reverse transcriptase ''in vitro'' system

    International Nuclear Information System (INIS)

    Bukowska, Agnieszka M.; Kusmierek, Jaroslaw T.

    1996-01-01

    We have found that isoguanine (iG) can pair with thymine (iG · T) non-natural base, 5-methylisocytosine (iG · iCM) during template directed synthesis catalyzed by AMV reverse transcriptase. The ratio of these pairings is about 1:10, irrespectively which of the templates, poly(C,iG) or poly(I,iG) is used. This ratio corresponds to the ratio of 2-OH and 2-keto tautomers in monomer in aqueous solution and apparently it is not influenced by the template context. Our results indicate also that formation of the reverse transcriptase catalyzed base pairs between iG and A, G or C can occur only at low frequency. (author). 21 refs, 5 figs, 1 tab

  4. Computational drug design strategies applied to the modelling of human immunodeficiency virus-1 reverse transcriptase inhibitors

    Directory of Open Access Journals (Sweden)

    Lucianna Helene Santos

    2015-11-01

    Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.

  5. Crystal structures of HIV-1 nonnucleoside reverse transcriptase inhibitors: N-benzyl-4-methyl-benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-07-01

    HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.

  6. ANIMAL code

    Energy Technology Data Exchange (ETDEWEB)

    Lindemuth, I.R.

    1979-02-28

    This report describes ANIMAL, a two-dimensional Eulerian magnetohydrodynamic computer code. ANIMAL's physical model also appears. Formulated are temporal and spatial finite-difference equations in a manner that facilitates implementation of the algorithm. Outlined are the functions of the algorithm's FORTRAN subroutines and variables.

  7. Network Coding

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Network Coding. K V Rashmi Nihar B Shah P Vijay Kumar. General Article Volume 15 Issue 7 July 2010 pp 604-621. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/015/07/0604-0621 ...

  8. ANIMAL code

    International Nuclear Information System (INIS)

    Lindemuth, I.R.

    1979-01-01

    This report describes ANIMAL, a two-dimensional Eulerian magnetohydrodynamic computer code. ANIMAL's physical model also appears. Formulated are temporal and spatial finite-difference equations in a manner that facilitates implementation of the algorithm. Outlined are the functions of the algorithm's FORTRAN subroutines and variables

  9. Expander Codes

    Indian Academy of Sciences (India)

    Codes and Channels. A noisy communication channel is illustrated in Fig- ... nication channel. Suppose we want to transmit a message over the unreliable communication channel so that even if the channel corrupts some of the bits we are able to recover ..... is d-regular, meaning thereby that every vertex has de- gree d.

  10. Expander Codes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 1. Expander Codes - The Sipser–Spielman Construction. Priti Shankar. General Article Volume 10 ... Author Affiliations. Priti Shankar1. Department of Computer Science and Automation, Indian Institute of Science Bangalore 560 012, India.

  11. Network Coding

    Indian Academy of Sciences (India)

    Network coding is a technique to increase the amount of information °ow in a network by mak- ing the key observation that information °ow is fundamentally different from commodity °ow. Whereas, under traditional methods of opera- tion of data networks, intermediate nodes are restricted to simply forwarding their incoming.

  12. Inhibitory effect of aqueous dandelion extract on HIV-1 replication and reverse transcriptase activity

    Science.gov (United States)

    2011-01-01

    Background Acquired immunodeficiency syndrome (AIDS), which is caused by the human immunodeficiency virus (HIV), is an immunosuppressive disease that results in life-threatening opportunistic infections. The general problems in current therapy include the constant emergence of drug-resistant HIV strains, adverse side effects and the unavailability of treatments in developing countries. Natural products from herbs with the abilities to inhibit HIV-1 life cycle at different stages, have served as excellent sources of new anti-HIV-1 drugs. In this study, we aimed to investigate the anti-HIV-1 activity of aqueous dandelion extract. Methods The pseudotyped HIV-1 virus has been utilized to explore the anti-HIV-1 activity of dandelion, the level of HIV-1 replication was assessed by the percentage of GFP-positive cells. The inhibitory effect of the dandelion extract on reverse transcriptase activity was assessed by the reverse transcriptase assay kit. Results Compared to control values obtained from cells infected without treatment, the level of HIV-1 replication and reverse transcriptase activity were decreased in a dose-dependent manner. The data suggest that dandelion extract has a potent inhibitory activity against HIV-1 replication and reverse transcriptase activity. The identification of HIV-1 antiviral compounds from Taraxacum officinale should be pursued. Conclusions The dandelion extract showed strong activity against HIV-1 RT and inhibited both the HIV-1 vector and the hybrid-MoMuLV/MoMuSV retrovirus replication. These findings provide additional support for the potential therapeutic efficacy of Taraxacum officinale. Extracts from this plant may be regarded as another starting point for the development of an antiretroviral therapy with fewer side effects. PMID:22078030

  13. Inhibitory effect of aqueous dandelion extract on HIV-1 replication and reverse transcriptase activity

    Directory of Open Access Journals (Sweden)

    Han Huamin

    2011-11-01

    Full Text Available Abstract Background Acquired immunodeficiency syndrome (AIDS, which is caused by the human immunodeficiency virus (HIV, is an immunosuppressive disease that results in life-threatening opportunistic infections. The general problems in current therapy include the constant emergence of drug-resistant HIV strains, adverse side effects and the unavailability of treatments in developing countries. Natural products from herbs with the abilities to inhibit HIV-1 life cycle at different stages, have served as excellent sources of new anti-HIV-1 drugs. In this study, we aimed to investigate the anti-HIV-1 activity of aqueous dandelion extract. Methods The pseudotyped HIV-1 virus has been utilized to explore the anti-HIV-1 activity of dandelion, the level of HIV-1 replication was assessed by the percentage of GFP-positive cells. The inhibitory effect of the dandelion extract on reverse transcriptase activity was assessed by the reverse transcriptase assay kit. Results Compared to control values obtained from cells infected without treatment, the level of HIV-1 replication and reverse transcriptase activity were decreased in a dose-dependent manner. The data suggest that dandelion extract has a potent inhibitory activity against HIV-1 replication and reverse transcriptase activity. The identification of HIV-1 antiviral compounds from Taraxacum officinale should be pursued. Conclusions The dandelion extract showed strong activity against HIV-1 RT and inhibited both the HIV-1 vector and the hybrid-MoMuLV/MoMuSV retrovirus replication. These findings provide additional support for the potential therapeutic efficacy of Taraxacum officinale. Extracts from this plant may be regarded as another starting point for the development of an antiretroviral therapy with fewer side effects.

  14. Mechanisms of inhibition of HIV replication by nonnucleoside reverse transcriptase inhibitors

    OpenAIRE

    Sluis-Cremer, Nicolas; Tachedjian, Gilda

    2008-01-01

    The nonnucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are a therapeutic class of compounds that are routinely used, in combination with other antiretroviral drugs, to treat HIV-1 infection. NNRTIs primarily block HIV-1 replication by preventing RT from completing reverse transcription of the viral single-stranded RNA genome into DNA. However, some NNRTIs, such as efavirenz, have been shown to inhibit the late stages of HIV-1 replication by interfering with HIV-1 Gag-Pol polyprotein...

  15. Reverse Transcriptase and Cellular Factors: Regulators of HIV-1 Reverse Transcription

    OpenAIRE

    Warren, Kylie; Warrilow, David; Meredith, Luke; Harrich, David

    2009-01-01

    There is ample evidence that synthesis of HIV-1 proviral DNA from the viral RNA genome during reverse transcription requires host factors. However, only a few cellular proteins have been described in detail that affect reverse transcription and interact with reverse transcriptase (RT). HIV-1 integrase is an RT binding protein and a number of IN-binding proteins including INI1, components of the Sin3a complex, and Gemin2 affect reverse transcription. In addition, recent studies implicate the c...

  16. Elevated Human telomerase reverse transcriptase gene expression in blood cells associated with chronic and arsenic exposure in Inner Mongolia, China

    Science.gov (United States)

    BACKGROUND: Arsenic exposure is associated with human cancer. Telomerase containing the catalytic subunit, human telomerase reverse transcriptase (hTERT), can extend telomeres of chromosomes, delay senescence and promoting cell proliferation leading to tumorigenesis. OBJECTIVE:...

  17. Natural Plant Alkaloid (Emetine Inhibits HIV-1 Replication by Interfering with Reverse Transcriptase Activity

    Directory of Open Access Journals (Sweden)

    Ana Luiza Chaves Valadão

    2015-06-01

    Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.

  18. Coumarins as Potential Inhibitors of DNA Polymerases and Reverse Transcriptases. Searching New Antiretroviral and Antitumoral Drugs.

    Science.gov (United States)

    Garro, Hugo A; Pungitore, Carlos R

    2015-01-01

    Human Immunodeficiency Virus (HIV) is the viral agent of Acquired Immunodeficiency Syndrome (AIDS), and at present, there is no effective vaccine against HIV. Reverse Transcriptase (RT) is an essential enzyme for retroviral replication, such as HIV as well as for other RNA infectious viruses like Human T lymphocyte virus. Polymerases act in DNA metabolism, modulating different processes like mitosis, damage repair, transcription and replication. It has been widely documented that DNA Polymerases and Reverse Transcriptases serve as molecular targets for antiviral and antitumoral chemotherapy. Coumarins are oxygen heterocycles that are widely distributed throughout the plant kingdom. Natural coumarins have attraction due to their bioactive properties such as tumor promotion inhibitory effects, and anti-HIV activity. Coumarins and derivates exhibit potent inhibitory effects on HIV-1 replication in lymphocytes and compounds isolated from Calophyllum inophyllum or DCK derivates showed inhibitory activity against human RT. Furthermore, natural isocoumarins isolated from cultures of fungi or hydroxycoumarins were able to inhibit human DNA polymerase. In view of their importance as drugs and biologically active natural products, and their medicinally useful properties, extensive studies have been carried out on the synthesis of coumarin compounds in recent years. Non-Nucleoside Reverse Transcriptase Inhibitors (NNRTIs), a class of antiretroviral chemotherapeutic agents, act by binding to an allosteric pocket showing, generally, low toxicity. This work tries to summarize the investigation about natural and synthetic coumarins with the ability to inhibit key enzymes that play a crucial role in DNA metabolism and their possible application as antiretroviral and antitumoral agents.

  19. Transgenic expression of Telomerase reverse transcriptase (Tert) improves cell proliferation of primary cells and enhances reprogramming efficiency into the induced pluripotent stem cell.

    Science.gov (United States)

    Hidema, Shizu; Fukuda, Tomokazu; Date, Shiori; Tokitake, Yuko; Matsui, Yasuhisa; Sasaki, Hiroki; Nishimori, Katsuhiko

    2016-10-01

    The enzymatic activity of telomerase is important for the extension of the telomere repeat sequence and overcoming cellular senescence. We generated a conditional transgenic mouse line, carrying the telomerase reverse transcriptase (Tert) expression cassette, controlled by the Cre-loxP-mediated recombination. In our study, Cre recombinase expression efficiently activated Tert expression, resulting in its increased enzymatic activity, which extended the period of cellular proliferation until the keratinocytes entered senescence. This suggests that transgenic Tert expression is effective in enhancing primary cell proliferation. Notably, Tert expression increased colony formation of induced pluripotent stem (iPS) cells after the introduction of four reprogramming factors, Oct-4, klf4, SOX-2, and c-Myc into the transgenic fibroblasts. To the best of our knowledge, this is the first study to show that the transgenic Tert expression enhances reprogramming efficiency of iPS cells, which indicates a critical role for Tert in the reprogramming process.

  20. Reverse Transcriptase drug resistance mutations in HIV-1 Subtype C infected patients on ART in Karonga District, Malawi

    LENUS (Irish Health Repository)

    Bansode, Vijay B

    2011-10-13

    Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge

  1. Binary sequence detector uses minimum number of decision elements

    Science.gov (United States)

    Perlman, M.

    1966-01-01

    Detector of an n bit binary sequence code within a serial binary data system assigns states to memory elements of a code sequence detector by employing the same order of states for the sequence detector as that of the sequence generator when the linear recursion relationship employed by the sequence generator is given.

  2. Panda code

    International Nuclear Information System (INIS)

    Altomare, S.; Minton, G.

    1975-02-01

    PANDA is a new two-group one-dimensional (slab/cylinder) neutron diffusion code designed to replace and extend the FAB series. PANDA allows for the nonlinear effects of xenon, enthalpy and Doppler. Fuel depletion is allowed. PANDA has a completely general search facility which will seek criticality, maximize reactivity, or minimize peaking. Any single parameter may be varied in a search. PANDA is written in FORTRAN IV, and as such is nearly machine independent. However, PANDA has been written with the present limitations of the Westinghouse CDC-6600 system in mind. Most computation loops are very short, and the code is less than half the useful 6600 memory size so that two jobs can reside in the core at once. (auth)

  3. Linear network error correction coding

    CERN Document Server

    Guang, Xuan

    2014-01-01

    There are two main approaches in the theory of network error correction coding. In this SpringerBrief, the authors summarize some of the most important contributions following the classic approach, which represents messages by sequences?similar to algebraic coding,?and also briefly discuss the main results following the?other approach,?that uses the theory of rank metric codes for network error correction of representing messages by subspaces. This book starts by establishing the basic linear network error correction (LNEC) model and then characterizes two equivalent descriptions. Distances an

  4. The Flutter Shutter Code Calculator

    Directory of Open Access Journals (Sweden)

    Yohann Tendero

    2015-08-01

    Full Text Available The goal of the flutter shutter is to make uniform motion blur invertible, by a"fluttering" shutter that opens and closes on a sequence of well chosen sub-intervals of the exposure time interval. In other words, the photon flux is modulated according to a well chosen sequence calledflutter shutter code. This article provides a numerical method that computes optimal flutter shutter codes in terms of mean square error (MSE. We assume that the observed objects follow a known (or learned random velocity distribution. In this paper, Gaussian and uniform velocity distributions are considered. Snapshots are also optimized taking the velocity distribution into account. For each velocity distribution, the gain of the optimal flutter shutter code with respectto the optimal snapshot in terms of MSE is computed. This symmetric optimization of theflutter shutter and of the snapshot allows to compare on an equal footing both solutions, i.e. camera designs. Optimal flutter shutter codes are demonstrated to improve substantially the MSE compared to classic (patented or not codes. A numerical method that permits to perform a reverse engineering of any existing (patented or not flutter shutter codes is also describedand an implementation is given. In this case we give the underlying velocity distribution fromwhich a given optimal flutter shutter code comes from. The combination of these two numerical methods furnishes a comprehensive study of the optimization of a flutter shutter that includes a forward and a backward numerical solution.

  5. A quantitative reverse-transcriptase PCR assay for the assessment of drug activities against intracellular Theileria annulata schizonts

    Directory of Open Access Journals (Sweden)

    Isabel Hostettler

    2014-12-01

    Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.

  6. Schrödinger's code-script: not a genetic cipher but a code of development.

    Science.gov (United States)

    Walsby, A E; Hodge, M J S

    2017-06-01

    In his book What is Life? Erwin Schrödinger coined the term 'code-script', thought by some to be the first published suggestion of a hereditary code and perhaps a forerunner of the genetic code. The etymology of 'code' suggests three meanings relevant to 'code-script which we distinguish as 'cipher-code', 'word-code' and 'rule-code'. Cipher-codes and word-codes entail translation of one set of characters into another. The genetic code comprises not one but two cipher-codes: the first is the DNA 'base-pairing cipher'; the second is the 'nucleotide-amino-acid cipher', which involves the translation of DNA base sequences into amino-acid sequences. We suggest that Schrödinger's code-script is a form of 'rule-code', a set of rules that, like the 'highway code' or 'penal code', requires no translation of a message. Schrödinger first relates his code-script to chromosomal genes made of protein. Ignorant of its properties, however, he later abandons 'protein' and adopts in its place a hypothetical, isomeric 'aperiodic solid' whose atoms he imagines rearranged in countless different conformations, which together are responsible for the patterns of ontogenetic development. In an attempt to explain the large number of combinations required, Schrödinger referred to the Morse code (a cipher) but in doing so unwittingly misled readers into believing that he intended a cipher-code resembling the genetic code. We argue that the modern equivalent of Schrödinger's code-script is a rule-code of organismal development based largely on the synthesis, folding, properties and interactions of numerous proteins, each performing a specific task. Copyright © 2016. Published by Elsevier Ltd.

  7. Implementation of LT codes based on chaos

    International Nuclear Information System (INIS)

    Zhou Qian; Li Liang; Chen Zengqiang; Zhao Jiaxiang

    2008-01-01

    Fountain codes provide an efficient way to transfer information over erasure channels like the Internet. LT codes are the first codes fully realizing the digital fountain concept. They are asymptotically optimal rateless erasure codes with highly efficient encoding and decoding algorithms. In theory, for each encoding symbol of LT codes, its degree is randomly chosen according to a predetermined degree distribution, and its neighbours used to generate that encoding symbol are chosen uniformly at random. Practical implementation of LT codes usually realizes the randomness through pseudo-randomness number generator like linear congruential method. This paper applies the pseudo-randomness of chaotic sequence in the implementation of LT codes. Two Kent chaotic maps are used to determine the degree and neighbour(s) of each encoding symbol. It is shown that the implemented LT codes based on chaos perform better than the LT codes implemented by the traditional pseudo-randomness number generator. (general)

  8. Role of the K101E substitution in HIV-1 reverse transcriptase in resistance to rilpivirine and other nonnucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A

    2013-11-01

    Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.

  9. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    Ribosomal protein S4X (RPS4X) is one of the 40S ribosomal proteins encoded by the RPS4X gene. The cDNA and the genomic sequence of RPS4X were cloned successfully from giant panda (Ailuropoda melanoleuca) using reverse transcriptase-polymerase chain reaction (RT-PCR) and touchdown-PCR technology ...

  10. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    enoh

    2012-03-13

    Mar 13, 2012 ... Ribosomal protein S4X (RPS4X) is one of the 40S ribosomal proteins encoded by the RPS4X gene. The. cDNA and the genomic sequence of RPS4X were cloned successfully from giant panda (Ailuropoda melanoleuca) using reverse transcriptase-polymerase chain reaction (RT-PCR) and touchdown- ...

  11. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  12. Detecting non-coding selective pressure in coding regions

    Directory of Open Access Journals (Sweden)

    Blanchette Mathieu

    2007-02-01

    Full Text Available Abstract Background Comparative genomics approaches, where orthologous DNA regions are compared and inter-species conserved regions are identified, have proven extremely powerful for identifying non-coding regulatory regions located in intergenic or intronic regions. However, non-coding functional elements can also be located within coding region, as is common for exonic splicing enhancers, some transcription factor binding sites, and RNA secondary structure elements affecting mRNA stability, localization, or translation. Since these functional elements are located in regions that are themselves highly conserved because they are coding for a protein, they generally escaped detection by comparative genomics approaches. Results We introduce a comparative genomics approach for detecting non-coding functional elements located within coding regions. Codon evolution is modeled as a mixture of codon substitution models, where each component of the mixture describes the evolution of codons under a specific type of coding selective pressure. We show how to compute the posterior distribution of the entropy and parsimony scores under this null model of codon evolution. The method is applied to a set of growth hormone 1 orthologous mRNA sequences and a known exonic splicing elements is detected. The analysis of a set of CORTBP2 orthologous genes reveals a region of several hundred base pairs under strong non-coding selective pressure whose function remains unknown. Conclusion Non-coding functional elements, in particular those involved in post-transcriptional regulation, are likely to be much more prevalent than is currently known. With the numerous genome sequencing projects underway, comparative genomics approaches like that proposed here are likely to become increasingly powerful at detecting such elements.

  13. From concatenated codes to graph codes

    DEFF Research Database (Denmark)

    Justesen, Jørn; Høholdt, Tom

    2004-01-01

    We consider codes based on simple bipartite expander graphs. These codes may be seen as the first step leading from product type concatenated codes to more complex graph codes. We emphasize constructions of specific codes of realistic lengths, and study the details of decoding by message passing...

  14. Antiviral Activity of MK-4965, a Novel Nonnucleoside Reverse Transcriptase Inhibitor▿

    Science.gov (United States)

    Lai, Ming-Tain; Munshi, Vandna; Touch, Sinoeun; Tynebor, Robert M.; Tucker, Thomas J.; McKenna, Philip M.; Williams, Theresa M.; DiStefano, Daniel J.; Hazuda, Daria J.; Miller, Michael D.

    2009-01-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are the mainstays of therapy for the treatment of human immunodeficiency virus type 1 (HIV-1) infections. However, the effectiveness of NNRTIs can be hampered by the development of resistance mutations which confer cross-resistance to drugs in the same class. Extensive efforts have been made to identify new NNRTIs that can suppress the replication of the prevalent NNRTI-resistant viruses. MK-4965 is a novel NNRTI that possesses both diaryl ether and indazole moieties. The compound displays potency at subnanomolar concentrations against wild-type (WT), K103N, and Y181C reverse transcriptase (RT) in biochemical assays. MK-4965 is also highly potent against the WT virus and two most prevalent NNRTI-resistant viruses (viruses that harbor the K103N or the Y181C mutation), against which it had 95% effective concentrations (EC95s) of antiviral EC95 of MK-4965 was reduced approximately four- to sixfold when it was tested in 50% human serum. Moreover, MK-4965 was evaluated with a panel of 15 viruses with NNRTI resistance-associated mutations and showed a superior mutant profile to that of efavirenz but not to that of etravirine. MK-4965 was similarly effective against various HIV-1 subtypes and viruses containing nucleoside reverse transcriptase inhibitor or protease inhibitor resistance-conferring mutations. A two-drug combination study showed that the antiviral activity of MK-4965 was nonantagonistic with each of the 18 FDA-licensed drugs tested vice versa in the present study. Taken together, these in vitro data show that MK-4965 possesses the desired properties for further development as a new NNRTI for the treatment of HIV-1 infection. PMID:19289522

  15. Mutations in HIV-1 Reverse Transcriptase Affect the Errors Made in a Single Cycle of Viral Replication

    Science.gov (United States)

    Abram, Michael E.; Ferris, Andrea L.; Das, Kalyan; Quinoñes, Octavio; Shao, Wei; Tuske, Steven; Alvord, W. Gregory; Arnold, Eddy

    2014-01-01

    ABSTRACT The genetic variation in HIV-1 in patients is due to the high rate of viral replication, the high viral load, and the errors made during viral replication. Some of the mutations in reverse transcriptase (RT) that alter the deoxynucleoside triphosphate (dNTP)-binding pocket, including those that confer resistance to nucleoside/nucleotide analogs, affect dNTP selection during replication. The effects of mutations in RT on the spectrum (nature, position, and frequency) of errors made in vivo are poorly understood. We previously determined the mutation rate and the frequency of different types of mutations and identified hot spots for mutations in a lacZα (the α complementing region of lacZ) reporter gene carried by an HIV-1 vector that replicates using wild-type RT. We show here that four mutations (Y115F, M184V, M184I, and Q151M) in the dNTP-binding pocket of RT that had relatively small effects on the overall HIV-1 mutation rate (less than 3-fold compared to the wild type) significantly increased mutations at some specific positions in the lacZα reporter gene. We also show that changes in a sequence that flanks the reporter gene can affect the mutations that arise in the reporter. These data show that changes either in HIV-1 RT or in the sequence of the nucleic acid template can affect the spectrum of mutations made during viral replication. This could, by implication, affect the generation of drug-resistant mutants and immunological-escape mutants in patients. IMPORTANCE RT is the viral enzyme that converts the RNA genome of HIV into DNA. Errors made during replication allow the virus to escape from the host's immune system and to develop resistance to the available anti-HIV drugs. We show that four different mutations in RT which are known to be associated with resistance to anti-RT drugs modestly increased the overall frequency of errors made during viral replication. However, the increased errors were not uniformly distributed; the additional errors

  16. The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA

    Directory of Open Access Journals (Sweden)

    Niu Meijuan

    2004-10-01

    Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.

  17. Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda

    Directory of Open Access Journals (Sweden)

    Mengjuan Zhu

    2016-03-01

    Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.

  18. E138A in HIV-1 reverse transcriptase is more common in subtype C than B: implications for rilpivirine use in resource-limited settings.

    Science.gov (United States)

    Sluis-Cremer, Nicolas; Jordan, Michael R; Huber, Kelly; Wallis, Carole L; Bertagnolio, Silvia; Mellors, John W; Parkin, Neil T; Harrigan, P Richard

    2014-07-01

    The nonnucleoside reverse transcriptase (RT) inhibitor rilpivirine (RPV) has been co-formulated with emtricitabine and tenofovir disoproxil fumarate for initial therapy of HIV-1-infected individuals. RPV, formulated as a long-acting nanosuspension, will also be assessed for its ability to prevent HIV-1 infection in resource limited settings. In this study, we determined whether any pre-existing genetic differences occurred among different HIV-1 subtypes at residues in RT associated with decreased virologic response to RPV. We found that the E138A substitution occurs more frequently in subtype C (range: 5.9-7.5%) than B (range: 0-2.3%) sequences from both treatment-naïve and -experienced individuals (pE138K and E138Q were also more common in RTI-experienced subtype C sequences (1.0% and 1.1%, respectively) than in subtype B sequences (0.3% and 0.6%, respectively). E138A/K/Q in subtype C decreased RPV susceptibility 2.9-, 5.8-, and 5.4-fold, respectively. Taken together, these data suggest that E138A could impact treatment or prevention strategies that include RPV in geographic areas where subtype C infection is prevalent. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. A model for triple helix formation on human telomerase reverse transcriptase (hTERT) promoter and stabilization by specific interactions with the water soluble perylene derivative, DAPER.

    Science.gov (United States)

    Rossetti, Luigi; D'Isa, Giuliana; Mauriello, Clementina; Varra, Michela; De Santis, Pasquale; Mayol, Luciano; Savino, Maria

    2007-08-01

    The promoter of human telomerase reverse transcriptase (hTERT) gene, in the region from -1000 to +1, contains two homopurine-homopyrimidine sequences (-835/-814 and -108/-90), that can be considered as potential targets to triple helix forming oligonucleotides (TFOs) for applying antigene strategy. We have chosen the sequence (-108/-90) on the basis of its unfavorable chromatin organization, evaluated by theoretical nucleosome positioning and nuclease hypersensitive sites mapping. On this sequence, anti-parallel triplex with satisfactory thermodynamic stability is formed by two TFOs, having different lengths. Triplex stability is significantly increased by specific interactions with the perylene derivative N,N'-bis[3,3'-(dimethylamino) propylamine]-3,4,9,10-perylenetetracarboxylic diimide (DAPER). Since DAPER is a symmetric molecule, the induced Circular Dichroism (CD) spectra in the range 400-600 nm allows us to obtain information on drug binding to triplex and duplex DNA. The drug-induced ellipticity is significantly higher in the case of triplex with respect to duplex and, surprisingly, it increases at decreasing of DNA. A model is proposed where self-stacked DAPER binds to triplex or to duplex narrow grooves.

  20. Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

    International Nuclear Information System (INIS)

    Zhu Hanneng; Chen Wenying; Xiong Sidong

    2000-01-01

    Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

  1. Endogenous reverse transcriptase (RT) activity and Chromatin remodeling in normal and transformed cells and early embryos

    International Nuclear Information System (INIS)

    Spadafora, C.; Sciamanna, I.; Misteli, T.

    2009-01-01

    Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma

  2. Substituted tetrahydroquinolines as potent allosteric inhibitors of reverse transcriptase and its key mutants

    Energy Technology Data Exchange (ETDEWEB)

    Su, Dai-Shi; Lim, John J.; Tinney, Elizabeth; Wan, Bang-Lin; Young, Mary Beth; Anderson, Kenneth D.; Rudd, Deanne; Munshi, Vandna; Bahnck, Carolyn; Felock, Peter J.; Lu, Meiqing; Lai, Ming-Tain; Touch, Sinoeun; Moyer, Gregory; DiStefano, Daniel J.; Flynn, Jessica A.; Liang, Yuexia; Sanchez, Rosa; Prasad, Sridhar; Yan, Youwei; Perlow-Poehnelt, Rebecca; Torrent, Maricel; Miller, Mike; Vacca, Joe P.; Williams, Theresa M.; Anthony, Neville J.; Merck

    2010-09-27

    Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are key elements of multidrug regimens, called HAART (Highly Active Antiretroviral Therapy), that are used to treat HIV-1 infections. Elucidation of the structure-activity relationships of the thiocarbamate moiety of the previous published lead compound 2 provided a series of novel tetrahydroquinoline derivatives as potent inhibitors of HIV-1 RT with nanomolar intrinsic activity on the WT and key mutant enzymes and potent antiviral activity in infected cells. The SAR optimization, mutation profiles, preparation of compounds, and pharmacokinetic profile of compounds are described.

  3. Characterization of the double stranded RNA dependent RNase activity associated with recombinant reverse transcriptases.

    OpenAIRE

    Ben-Artzi, H; Zeelon, E; Le-Grice, S F; Gorecki, M; Panet, A

    1992-01-01

    An in situ gel assay was applied to the study of double stranded RNA dependent RNase activity associated with reverse transcriptase (RT) of HIV-1 and murine leukemia virus. Polyacrylamide gels containing [32P] RNA/RNA substrate were used for electrophoresis of proteins under denaturing conditions. The proteins were renatured and in situ enzymatic degradation of 32P-RNA/RNA was followed. E. coli RNaseIII, but not E. coli RNaseH, was active in this in situ gel assay, indicating specificity of t...

  4. Inhibition of Reverse Transcriptase Activity Increases Stability of the HIV-1 Core

    Science.gov (United States)

    Yang, Yang; Fricke, Thomas

    2013-01-01

    Previous studies showed that HIV-1 reverse transcription occurs during or before uncoating, linking mechanistically reverse transcription with uncoating. Here we show that inhibition of reverse transcriptase (RT) during HIV-1 infection by pharmacologic or genetic means increased the stability of the HIV-1 core during infection. Interestingly, HIV-1 particles with increased core stability were resistant to the core-destabilizing effects of rhesus TRIM5α (TRIM5αrh). Collectively, this work implies that the surface of the HIV-1 core is dynamic and changes upon the ongoing processes within the core. PMID:23077298

  5. Focus on Chirality of HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Valeria Famiglini

    2016-02-01

    Full Text Available Chiral HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs are of great interest since one enantiomer is often more potent than the corresponding counterpart against the HIV-1 wild type (WT and the HIV-1 drug resistant mutant strains. This review exemplifies the various studies made to investigate the effect of chirality on the antiretroviral activity of top HIV-1 NNRTI compounds, such as nevirapine (NVP, efavirenz (EFV, alkynyl- and alkenylquinazolinone DuPont compounds (DPC, diarylpyrimidine (DAPY, dihydroalkyloxybenzyloxopyrimidine (DABO, phenethylthiazolylthiourea (PETT, indolylarylsulfone (IAS, arylphosphoindole (API and trifluoromethylated indole (TFMI The chiral separation, the enantiosynthesis, along with the biological properties of these HIV-1 NNRTIs, are discussed.

  6. Interface requirements to couple thermal hydraulics codes to severe accident codes: ICARE/CATHARE

    International Nuclear Information System (INIS)

    Camous, F.; Jacq, F.; Chatelard, P.

    1997-01-01

    In order to describe with the same code the whole sequence of severe LWR accidents, up to the vessel failure, the Institute of Protection and Nuclear Safety has performed a coupling of the severe accident code ICARE2 to the thermalhydraulics code CATHARE2. The resulting code, ICARE/CATHARE, is designed to be as pertinent as possible in all the phases of the accident. This paper is mainly devoted to the description of the ICARE2-CATHARE2 coupling

  7. Interface requirements to couple thermal hydraulics codes to severe accident codes: ICARE/CATHARE

    Energy Technology Data Exchange (ETDEWEB)

    Camous, F.; Jacq, F.; Chatelard, P. [IPSN/DRS/SEMAR CE-Cadarache, St Paul Lez Durance (France)] [and others

    1997-07-01

    In order to describe with the same code the whole sequence of severe LWR accidents, up to the vessel failure, the Institute of Protection and Nuclear Safety has performed a coupling of the severe accident code ICARE2 to the thermalhydraulics code CATHARE2. The resulting code, ICARE/CATHARE, is designed to be as pertinent as possible in all the phases of the accident. This paper is mainly devoted to the description of the ICARE2-CATHARE2 coupling.

  8. Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa

    Directory of Open Access Journals (Sweden)

    Aline Aki Tanikawa

    2013-08-01

    Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.

  9. Modeling of Plasmodium falciparum Telomerase Reverse Transcriptase Ternary Complex: Repurposing of Nucleoside Analog Inhibitors.

    Science.gov (United States)

    Mohanty, Pallavi; Gupta, Akanksha; Bhatnagar, Sonika

    2015-12-01

    The Plasmodium falciparum telomerase reverse transcriptase (PfTERT) is a ribonucleoprotein that assists the maintenance of the telomeric ends of chromosomes by reverse transcription of its own RNA subunit. It represents an attractive therapeutic target for eradication of the plasmodial parasite at the asexual liver stage. Automated modeling using MUSTER and knowledge-based techniques were used to obtain a three-dimensional model of the active site of reverse transcriptase domain of PfTERT, which is responsible for catalyzing the addition of incoming dNTPs to the growing DNA strand in presence of divalent magnesium ions. Further, the ternary complex of the active site of PfTERT bound to a DNA-RNA duplex was also modeled using Haddock server and represents the functional form of the enzyme. Initially, established nucleoside analog inhibitors of PfTERT, AZTTP, and ddGTP were docked in the modeled binding site of the PfTERT ternary complex using AutoDock v4.2. Subsequently, docking studies were carried out with 14 approved nucleoside analog inhibitors. Docking studies predicted that floxuridine, gemcitabine, stavudine, and vidarabine have high affinity for the PfTERT ternary complex. Further analysis on the basis of known side effects led us to propose repositioning of vidarabine as a suitable drug candidate for inhibition of PfTERT.

  10. Antiviral activity of GW678248, a novel benzophenone nonnucleoside reverse transcriptase inhibitor.

    Science.gov (United States)

    Ferris, Robert G; Hazen, Richard J; Roberts, Grace B; St Clair, Marty H; Chan, Joseph H; Romines, Karen R; Freeman, George A; Tidwell, Jeffrey H; Schaller, Lee T; Cowan, Jill R; Short, Steven A; Weaver, Kurt L; Selleseth, Dean W; Moniri, Kelly R; Boone, Lawrence R

    2005-10-01

    The compound GW678248 is a novel benzophenone nonnucleoside reverse transcriptase inhibitor (NNRTI). Preclinical assessment of GW678248 indicates that this compound potently inhibits wild-type (WT) and mutant human immunodeficiency virus type 1 (HIV-1) reverse transcriptase in biochemical assays, with 50% inhibitory concentrations (IC(50)s) between 0.8 and 6.8 nM. In HeLa CD4 MAGI cell culture virus replication assays, GW678248 has an IC(50) of E138K, Y181C, Y188C, Y188L, G190A/E, P225H, and P236L and various combinations. An IC(50) of 86 nM was obtained with a mutant virus having V106I, E138K, and P236L mutations that resulted from serial passage of WT virus in the presence of GW678248. The presence of 45 mg/ml human serum albumin plus 1 mg/ml alpha-1 acid glycoprotein increased the IC(50) approximately sevenfold. Cytotoxicity studies with GW678248 indicate that the 50% cytotoxicity concentration is greater than the level of compound solubility and provides a selectivity index of >2,500-fold for WT, Y181C, or K103N HIV-1. This compound exhibits excellent preclinical antiviral properties and, as a prodrug designated GW695634, is being developed as a new generation of NNRTI for the treatment of HIV-1 in combination with other antiretroviral agents.

  11. Transcription Regulation of the Human Telomerase Reverse Transcriptase (hTERT) Gene.

    Science.gov (United States)

    Ramlee, Muhammad Khairul; Wang, Jing; Toh, Wei Xun; Li, Shang

    2016-08-18

    Embryonic stem cells and induced pluripotent stem cells have the ability to maintain their telomere length via expression of an enzymatic complex called telomerase. Similarly, more than 85%-90% of cancer cells are found to upregulate the expression of telomerase, conferring them with the potential to proliferate indefinitely. Telomerase Reverse Transcriptase (TERT), the catalytic subunit of telomerase holoenzyme, is the rate-limiting factor in reconstituting telomerase activity in vivo. To date, the expression and function of the human Telomerase Reverse Transcriptase (hTERT) gene are known to be regulated at various molecular levels (including genetic, mRNA, protein and subcellular localization) by a number of diverse factors. Among these means of regulation, transcription modulation is the most important, as evident in its tight regulation in cancer cell survival as well as pluripotent stem cell maintenance and differentiation. Here, we discuss how hTERT gene transcription is regulated, mainly focusing on the contribution of trans-acting factors such as transcription factors and epigenetic modifiers, as well as genetic alterations in hTERT proximal promoter.

  12. Sequence History Update Tool

    Science.gov (United States)

    Khanampompan, Teerapat; Gladden, Roy; Fisher, Forest; DelGuercio, Chris

    2008-01-01

    The Sequence History Update Tool performs Web-based sequence statistics archiving for Mars Reconnaissance Orbiter (MRO). Using a single UNIX command, the software takes advantage of sequencing conventions to automatically extract the needed statistics from multiple files. This information is then used to populate a PHP database, which is then seamlessly formatted into a dynamic Web page. This tool replaces a previous tedious and error-prone process of manually editing HTML code to construct a Web-based table. Because the tool manages all of the statistics gathering and file delivery to and from multiple data sources spread across multiple servers, there is also a considerable time and effort savings. With the use of The Sequence History Update Tool what previously took minutes is now done in less than 30 seconds, and now provides a more accurate archival record of the sequence commanding for MRO.

  13. Automatic coding method of the ACR Code

    International Nuclear Information System (INIS)

    Park, Kwi Ae; Ihm, Jong Sool; Ahn, Woo Hyun; Baik, Seung Kook; Choi, Han Yong; Kim, Bong Gi

    1993-01-01

    The authors developed a computer program for automatic coding of ACR(American College of Radiology) code. The automatic coding of the ACR code is essential for computerization of the data in the department of radiology. This program was written in foxbase language and has been used for automatic coding of diagnosis in the Department of Radiology, Wallace Memorial Baptist since May 1992. The ACR dictionary files consisted of 11 files, one for the organ code and the others for the pathology code. The organ code was obtained by typing organ name or code number itself among the upper and lower level codes of the selected one that were simultaneous displayed on the screen. According to the first number of the selected organ code, the corresponding pathology code file was chosen automatically. By the similar fashion of organ code selection, the proper pathologic dode was obtained. An example of obtained ACR code is '131.3661'. This procedure was reproducible regardless of the number of fields of data. Because this program was written in 'User's Defined Function' from, decoding of the stored ACR code was achieved by this same program and incorporation of this program into program in to another data processing was possible. This program had merits of simple operation, accurate and detail coding, and easy adjustment for another program. Therefore, this program can be used for automation of routine work in the department of radiology

  14. Structure-based virtual screening efforts against HIV-1 reverse transcriptase to introduce the new potent non-nucleoside reverse transcriptase inhibitor

    Science.gov (United States)

    Hosseini, Yaser; Mollica, Adriano; Mirzaie, Sako

    2016-12-01

    The human immunodeficiency virus (HIV) which is strictly related to the development of AIDS, is treated by a cocktail of drugs, but due its high propensity gain drug resistance, the rational development of new medicine is highly desired. Among the different mechanism of action we selected the reverse transcriptase (RT) inhibition, for our studies. With the aim to identify new chemical entities to be used for further rational drug design, a set of 3000 molecules from the Zinc Database have been screened by docking experiments using AutoDock Vina software. The best ranked compounds with respect of the crystallographic inhibitor MK-4965 resulted to be five compounds, and the best among them was further tested by molecular dynamics (MD) simulation. Our results indicate that comp1 has a stronger interaction with the subsite p66 of RT than MK-4965 and that both are able to stabilize specific conformational changes of the RT 3D structure, which may explain their activity as inhibitors. Therefore comp1 could be a good candidate for biological tests and further development.

  15. Fundamentals of convolutional coding

    CERN Document Server

    Johannesson, Rolf

    2015-01-01

    Fundamentals of Convolutional Coding, Second Edition, regarded as a bible of convolutional coding brings you a clear and comprehensive discussion of the basic principles of this field * Two new chapters on low-density parity-check (LDPC) convolutional codes and iterative coding * Viterbi, BCJR, BEAST, list, and sequential decoding of convolutional codes * Distance properties of convolutional codes * Includes a downloadable solutions manual

  16. A Pseudorandom Code Modulated LIDAR

    Science.gov (United States)

    Hunt, K. P.; Eichinger, W. E.; Kruger, A.

    2009-12-01

    Typical Light Detection and Ranging (LIDAR) uses high power pulsed lasers to ensure a detectable return signal. For short ranges, modulated diode lasers offer an attractive alternative, particularly in the areas of size, weight, cost, eye safety and use of energy. Flexible electronic modulation of the laser diode allows the development of pseudorandom code (PRC) LIDAR systems that can overcome the disadvantage of low output power and thus low signal to noise ratios. Different PRCs have been proposed. For example, so called M-sequences can be generated simply, but are unbalanced: they have more ones than zeros, which results in a residual noise component. Other sequences such as the A1 and A2 sequences are balanced, but have two autocorrelation peaks, resulting in undesirable pickup of signals from different ranges. In this work, we investigate a new code, an M-sequence with a zero added at the end. The result is still easily generated and has a single autocorrelation peak, but is now balanced. We loaded these sequences into a commercial arbitrary waveform generator (ARB), an Agilent 33250A, which then modulates the laser diode. This allows sequences to be changed quickly and easily, permitting us to design and investigate a wide range of PRC sequences with desirable properties. The ARB modulates a Melles Griot 56ICS near infrared laser diode at a 10 MHz chip rate. Backscatter is collected and focused by a telescope and the detected signal is sampled and correlated with the known PRC. We have gathered data from this LIDAR system and experimentally assessed the performance of this new class of codes.

  17. Structures of Reverse Transcriptase Pre- and Post-Excision Complexes Shed New Light on HIV-1 AZT Resistance

    Directory of Open Access Journals (Sweden)

    Walter A. Scott

    2011-01-01

    Full Text Available HIV-1 resistance to 3'-azido-2',3'-deoxythymidine (AZT, zidovudine results from mutations in reverse transcriptase that increase the ability of the enzyme to excise AZT-monophosphate after it has been incorporated. Crystal structures of complexes of wild type and mutant reverse transcriptase with double-stranded DNA with or without the excision product, AZT adenosine dinucleoside tetraphosphate (AZTppppA, have recently been reported [1]. The excision-enhancing mutations dramatically change the way the enzyme interacts with the excision product.

  18. Identification of a Novel Scaffold for Allosteric Inhibition of Wild Type and Drug Resistant HIV-1 Reverse Transcriptase by Fragment Library Screening

    NARCIS (Netherlands)

    Geitmann, M.; Elinder, M; Seeger, C; Brandt, P; de Esch, I.J.P.; Danielson, U.H.

    2011-01-01

    A novel scaffold inhibiting wild type and drug resistant variants of human immunodeficiency virus type 1 reverse transcriptase (HIV-1RT) has been identified in a library consisting of 1040 fragments. The fragments were significantly different from already known non-nucleoside reverse transcriptase

  19. Nonlinear analysis of biological sequences

    Energy Technology Data Exchange (ETDEWEB)

    Torney, D.C.; Bruno, W.; Detours, V. [and others

    1998-11-01

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The main objectives of this project involved deriving new capabilities for analyzing biological sequences. The authors focused on tabulating the statistical properties exhibited by Human coding DNA sequences and on techniques of inferring the phylogenetic relationships among protein sequences related by descent.

  20. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  1. Automatic sequences

    CERN Document Server

    Haeseler, Friedrich

    2003-01-01

    Automatic sequences are sequences which are produced by a finite automaton. Although they are not random they may look as being random. They are complicated, in the sense of not being not ultimately periodic, they may look rather complicated, in the sense that it may not be easy to name the rule by which the sequence is generated, however there exists a rule which generates the sequence. The concept automatic sequences has special applications in algebra, number theory, finite automata and formal languages, combinatorics on words. The text deals with different aspects of automatic sequences, in particular:· a general introduction to automatic sequences· the basic (combinatorial) properties of automatic sequences· the algebraic approach to automatic sequences· geometric objects related to automatic sequences.

  2. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  3. The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Dolores Bautista-España

    Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

  4. Data on synthesis of methylene bisphosphonates and screening of their inhibitory activity towards HIV reverse transcriptase

    Directory of Open Access Journals (Sweden)

    D.V. Yanvarev

    2016-09-01

    Full Text Available Inorganic pyrophosphate (PPi mimetics designed on a basis of methylenediphosphonic acid backbone are promising inhibitors of two key HIV replication enzymes, IN [1] and RT [2]. Herein, we present chemical synthesis of eleven methylenebisphosphonates (BPs with their NMR and HRMS analysis synthesized via five different ways. Also, we present data on inhibition of HIV RT catalyzed phosphorolysis and polymerization by synthesized BPs using two methods based on denaturing urea PAGE. Tests were also performed for thymidine analogue mutations reverse transcriptase (TAM RT, which was expressed and purified for that. Structure–activity relationships and inhibitory activity data of synthesized BPs are presented in “Methylene bisphosphonates as the inhibitors of HIV RT phosphorolytic activity” [2].

  5. Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection.

    Science.gov (United States)

    Shi, Chao; Shen, Xiaotong; Niu, Shuyan; Ma, Cuiping

    2015-11-04

    RNA detection has become one of the most robust parts in molecular biology, medical diagnostics and drug discovery. Conventional RNA detection methods involve an extra reverse transcription step, which limits their further application for RNA rapid detection. We herein report a novel finding that Bst and Klenow DNA polymerases possess innate reverse transcriptase activities, so that the reverse transcription step and next amplification reaction can be combined to one step in isothermal RNA detection. We have demonstrated that Bst and Klenow DNA polymerases could be successfully used to reverse transcribe RNA within 125-nt length by real time RT-PCR and polyacrylamide gel electrophoresis (PAGE). Our findings will spur the development of a myriad of simple and easy to use RNA detection technologies for isothermal RNA direct detection. This will just meet the future needs of bioanalysis and clinical diagnosis to RNA rapid detection in POC settings and inspection and quarantine.

  6. Vif is an auxiliary factor of the HIV-1 reverse transcriptase and facilitates abasic site bypass.

    Science.gov (United States)

    Cancio, Reynel; Spadari, Silvio; Maga, Giovanni

    2004-11-01

    The HIV-1 accessory protein Vif was found to modulate the RNA- and DNA-dependent DNA synthesis activity of the viral RT (reverse transcriptase) in two ways: (i) it stimulated the binding of the viral RT to the primer by increasing the association rate kcat/K(m) and by decreasing the thermodynamic barrier DeltaH([ES]) for complex formation, and (ii) it increased the polymerization rate of HIV-1 RT. A Vif mutant lacking the final 56 amino acids at the C-terminus failed to stimulate the viral RT. On the other hand, another Vif mutant lacking the first 43 amino acids at the N-terminus, which are involved in RNA binding and interaction with the viral protease, was able to stimulate RT activity. In addition, Vif was found to promote the bypass of an abasic site by HIV-1 RT.

  7. Validated RealTime reverse transcriptase PCR methods for the diagnosis and pathotyping of Eurasian H7 avian influenza viruses

    NARCIS (Netherlands)

    Slomka, M.J.; Pavlidis, T.; Coward, V.J.; Voermans, J.; Koch, G.; Hanna, A.; Banks, J.; Brown, I.H.

    2009-01-01

    Background Avian influenza (AI) caused by H7 AI viruses (AIVs) of both low pathogenicity (LP) and high pathogenicity (HP) are notifiable poultry diseases. Objectives Design and validate two RealTime reverse transcriptase polymerase chain reactions (RRT PCRs) for Eurasian H7 AIV detection and

  8. Immuno-capture reverse transcriptase polymerase chain reaction (]C RT-PCR) voor de detectie van slamozaoekvirus

    NARCIS (Netherlands)

    Berendsen, M.; Koenraadt, H.P.; Vlugt, van der R.A.A.

    1996-01-01

    Wanneer bepaald moet worden of een monster besmet is met het slamozaiekvirus wordt gebruik gemaakt van de ELISA-toets. De interpretatie van de uitslagen is niet altijd even eenvoudig. Het IPO-DLO en de NAKG onderzochten daarom een gevoeliger methode, de Immunocapture Reverse Transcriptase Polymerase

  9. A Direct from Blood Reverse Transcriptase Polymerase Chain Reaction Assay for Monitoring Falciparum Malaria Parasite Transmission in Elimination Settings

    NARCIS (Netherlands)

    Taylor, B.J.; Lanke, K.; Banman, S.L.; Morlais, I.; Morin, M.J.; Bousema, T.; Rijpma, S.R.; Yanow, S.K.

    2017-01-01

    We describe a novel one-step reverse transcriptase real-time PCR (direct RT-PCR) for Plasmodium falciparum malaria parasites that amplifies RNA targets directly from blood. We developed the assay to identify gametocyte-specific transcripts in parasites from patient blood samples, as a means of

  10. Validation of a real-time reverse transcriptase-PCR assay for the detection of H7 avian influenza virus

    Science.gov (United States)

    A subtype specific H7 real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay developed by the Southeast Poultry Research Laboratory (SEPRL) for the detection of H7 in North and South American wild aquatic birds and poultry was validated as a collaborative effort by the SEPRL and Na...

  11. Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples

    Science.gov (United States)

    Human enteric viruses can be present in untreated and inadequately treated drinking water. Molecular methods, such as the reverse transcriptase PCR (RT-PCR), can detect viral genomes in a few hours, but they cannot distinguish between infectious and noninfectious viruses. Since o...

  12. Human immunodeficiency virus fitness in vivo: calculations based on a single zidovudine resistance mutation at codon 215 of reverse transcriptase

    NARCIS (Netherlands)

    Goudsmit, J.; de Ronde, A.; Ho, D. D.; Perelson, A. S.

    1996-01-01

    We monitored a subject newly infected with a zidovudine-resistant human immunodeficiency virus type 1 strain and found that in the absence of drug, the viral population with the resistance-conferring tyrosine (TAC) codon 215 of reverse transcriptase was gradually replaced. By using standard formulas

  13. Effects of the W153L substitution in HIV reverse transcriptase on viral replication and drug resistance to multiple categories of reverse transcriptase inhibitors.

    Science.gov (United States)

    Xu, Hong-Tao; Colby-Germinario, Susan P; Oliveira, Maureen; Rajotte, Daniel; Bethell, Richard; Wainberg, Mark A

    2014-08-01

    A W153L substitution in HIV-1 reverse transcriptase (RT) was recently identified by selection with a novel nucleotide-competing RT inhibitor (NcRTI) termed compound A that is a member of the benzo[4,5]furo[3,2,d]pyrimidin-2-one NcRTI family of drugs. To investigate the impact of W153L, alone or in combination with the clinically relevant RT resistance substitutions K65R (change of Lys to Arg at position 65), M184I, K101E, K103N, E138K, and Y181C, on HIV-1 phenotypic susceptibility, viral replication, and RT enzymatic function, we generated recombinant RT enzymes and viruses containing each of these substitutions or various combinations of them. We found that W153L-containing viruses were impaired in viral replicative capacity and were hypersusceptible to tenofovir (TFV) while retaining susceptibility to most nonnucleoside RT inhibitors. The nucleoside 3TC retained potency against W153L-containing viruses but not when the M184I substitution was also present. W153L was also able to reverse the effects of the K65R substitution on resistance to TFV, and K65R conferred hypersusceptibility to compound A. Biochemical assays demonstrated that W153L alone or in combination with K65R, M184I, K101E, K103N, E138K, and Y181C impaired enzyme processivity and polymerization efficiency but did not diminish RNase H activity, providing mechanistic insights into the low replicative fitness associated with these substitutions. We show that the mechanism of the TFV hypersusceptibility conferred by W153L is mainly due to increased efficiency of TFV-diphosphate incorporation. These results demonstrate that compound A and/or derivatives thereof have the potential to be important antiretroviral agents that may be combined with tenofovir to achieve synergistic results. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. A non-canonical function of zebrafish telomerase reverse transcriptase is required for developmental hematopoiesis.

    Directory of Open Access Journals (Sweden)

    Shintaro Imamura

    Full Text Available Although it is clear that telomerase expression is crucial for the maintenance of telomere homeostasis, there is increasing evidence that the TERT protein can have physiological roles that are independent of this central function. To further examine the role of telomerase during vertebrate development, the zebrafish telomerase reverse transcriptase (zTERT was functionally characterized. Upon zTERT knockdown, zebrafish embryos show reduced telomerase activity and are viable, but develop pancytopenia resulting from aberrant hematopoiesis. The blood cell counts in TERT-depleted zebrafish embryos are markedly decreased and hematopoietic cell differentiation is impaired, whereas other somatic lineages remain morphologically unaffected. Although both primitive and definitive hematopoiesis is disrupted by zTERT knockdown, the telomere lengths are not significantly altered throughout early development. Induced p53 deficiency, as well as overexpression of the anti-apoptotic proteins Bcl-2 and E1B-19K, significantly relieves the decreased blood cells numbers caused by zTERT knockdown, but not the impaired blood cell differentiation. Surprisingly, only the reverse transcriptase motifs of zTERT are crucial, but the telomerase RNA-binding domain of zTERT is not required, for rescuing complete hematopoiesis. This is therefore the first demonstration of a non-canonical catalytic activity of TERT, which is different from "authentic" telomerase activity, is required for during vertebrate hematopoiesis. On the other hand, zTERT deficiency induced a defect in hematopoiesis through a potent and specific effect on the gene expression of key regulators in the absence of telomere dysfunction. These results suggest that TERT non-canonically functions in hematopoietic cell differentiation and survival in vertebrates, independently of its role in telomere homeostasis. The data also provide insights into a non-canonical pathway by which TERT functions to modulate

  15. In vitro characterization of MK-1439, a novel HIV-1 nonnucleoside reverse transcriptase inhibitor.

    Science.gov (United States)

    Lai, Ming-Tain; Feng, Meizhen; Falgueyret, Jean-Pierre; Tawa, Paul; Witmer, Marc; DiStefano, Daniel; Li, Yuan; Burch, Jason; Sachs, Nancy; Lu, Meiqing; Cauchon, Elizabeth; Campeau, Louis-Charles; Grobler, Jay; Yan, Youwei; Ducharme, Yves; Côté, Bernard; Asante-Appiah, Ernest; Hazuda, Daria J; Miller, Michael D

    2014-01-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are a mainstay of therapy for treating human immunodeficiency type 1 virus (HIV-1)-infected patients. MK-1439 is a novel NNRTI with a 50% inhibitory concentration (IC50) of 12, 9.7, and 9.7 nM against the wild type (WT) and K103N and Y181C reverse transcriptase (RT) mutants, respectively, in a biochemical assay. Selectivity and cytotoxicity studies confirmed that MK-1439 is a highly specific NNRTI with minimum off-target activities. In the presence of 50% normal human serum (NHS), MK-1439 showed excellent potency in suppressing the replication of WT virus, with a 95% effective concentration (EC95) of 20 nM, as well as K103N, Y181C, and K103N/Y181C mutant viruses with EC95 of 43, 27, and 55 nM, respectively. MK-1439 exhibited similar antiviral activities against 10 different HIV-1 subtype viruses (a total of 93 viruses). In addition, the susceptibility of a broader array of clinical NNRTI-associated mutant viruses (a total of 96 viruses) to MK-1439 and other benchmark NNRTIs was investigated. The results showed that the mutant profile of MK-1439 was superior overall to that of efavirenz (EFV) and comparable to that of etravirine (ETR) and rilpivirine (RPV). Furthermore, E138K, Y181C, and K101E mutant viruses that are associated with ETR and RPV were susceptible to MK-1439 with a fold change (FC) of <3. A two-drug in vitro combination study indicated that MK-1439 acts nonantagonistically in the antiviral activity with each of 18 FDA-licensed drugs for HIV infection. Taken together, these in vitro data suggest that MK-1439 possesses the desired properties for further development as a new antiviral agent.

  16. Chimeric thermostable DNA polymerases with reverse transcriptase and attenuated 3'-5' exonuclease activity.

    Science.gov (United States)

    Schönbrunner, Nancy J; Fiss, Ellen H; Budker, Olga; Stoffel, Susanne; Sigua, Christopher L; Gelfand, David H; Myers, Thomas W

    2006-10-24

    The synthesis of accurate, full-length cDNA from low-abundance RNA and the subsequent PCR amplification under conditions which provide amplicon that contains minimal mutations remain a difficult molecular biological process. Many of the challenges associated with performing sensitive, long RT/PCR have been alleviated by using a mixture of DNA polymerases. These mixtures have typically contained a DNA polymerase devoid of 3'-5' exonuclease, or "proofreading", activity blended with a small amount of an Archaea DNA polymerase possessing 3'-5' exonuclease activity, since reverse transcriptases lack 3'-5' exonuclease activity and generally have low fidelity. To create a DNA polymerase with efficient reverse transcriptase and 3'-5' exonuclease activity, a family of mutant DNA polymerases with a range of attenuated 3'-5' exonuclease activities was constructed from a chimeric DNA polymerase derived from Thermus species Z05 and Thermotoga maritima DNA polymerases. These "designer" DNA polymerases were fashioned using structure-based tools to identify amino acid residues involved in the substrate-binding site of the exonuclease domain of a thermostable DNA polymerase. Mutation of some of these residues resulted in proteins in which DNA polymerase activity was unaffected, while proofreading activity ranged from 60% of the wild-type level to undetectable levels. Kinetic characterization of the exonuclease activity indicated that the mutations affected catalysis much more than binding. On the basis of their specificity constants (kcat/KM), the mutant enzymes have a 5-15-fold stronger preference for a double-stranded mismatched substrate over a single-stranded substrate than the wild-type DNA polymerase, a desirable attribute for RT/PCR. The utility of these enzymes was evaluated in a RT/PCR assay to generate a 1.7 kb amplicon from HIV-1 RNA.

  17. Genetic code for sine

    Science.gov (United States)

    Abdullah, Alyasa Gan; Wah, Yap Bee

    2015-02-01

    The computation of the approximate values of the trigonometric sines was discovered by Bhaskara I (c. 600-c.680), a seventh century Indian mathematician and is known as the Bjaskara's I's sine approximation formula. The formula is given in his treatise titled Mahabhaskariya. In the 14th century, Madhava of Sangamagrama, a Kerala mathematician astronomer constructed the table of trigonometric sines of various angles. Madhava's table gives the measure of angles in arcminutes, arcseconds and sixtieths of an arcsecond. The search for more accurate formulas led to the discovery of the power series expansion by Madhava of Sangamagrama (c.1350-c. 1425), the founder of the Kerala school of astronomy and mathematics. In 1715, the Taylor series was introduced by Brook Taylor an English mathematician. If the Taylor series is centered at zero, it is called a Maclaurin series, named after the Scottish mathematician Colin Maclaurin. Some of the important Maclaurin series expansions include trigonometric functions. This paper introduces the genetic code of the sine of an angle without using power series expansion. The genetic code using square root approach reveals the pattern in the signs (plus, minus) and sequence of numbers in the sine of an angle. The square root approach complements the Pythagoras method, provides a better understanding of calculating an angle and will be useful for teaching the concepts of angles in trigonometry.

  18. Noncoding sequence classification based on wavelet transform analysis: part I

    Science.gov (United States)

    Paredes, O.; Strojnik, M.; Romo-Vázquez, R.; Vélez Pérez, H.; Ranta, R.; Garcia-Torales, G.; Scholl, M. K.; Morales, J. A.

    2017-09-01

    DNA sequences in human genome can be divided into the coding and noncoding ones. Coding sequences are those that are read during the transcription. The identification of coding sequences has been widely reported in literature due to its much-studied periodicity. Noncoding sequences represent the majority of the human genome. They play an important role in gene regulation and differentiation among the cells. However, noncoding sequences do not exhibit periodicities that correlate to their functions. The ENCODE (Encyclopedia of DNA elements) and Epigenomic Roadmap Project projects have cataloged the human noncoding sequences into specific functions. We study characteristics of noncoding sequences with wavelet analysis of genomic signals.

  19. Model Children's Code.

    Science.gov (United States)

    New Mexico Univ., Albuquerque. American Indian Law Center.

    The Model Children's Code was developed to provide a legally correct model code that American Indian tribes can use to enact children's codes that fulfill their legal, cultural and economic needs. Code sections cover the court system, jurisdiction, juvenile offender procedures, minor-in-need-of-care, and termination. Almost every Code section is…

  20. Affine Grassmann codes

    DEFF Research Database (Denmark)

    Høholdt, Tom; Beelen, Peter; Ghorpade, Sudhir Ramakant

    2010-01-01

    We consider a new class of linear codes, called affine Grassmann codes. These can be viewed as a variant of generalized Reed-Muller codes and are closely related to Grassmann codes.We determine the length, dimension, and the minimum distance of any affine Grassmann code. Moreover, we show that af...

  1. HIV-1 Reverse Transcriptase Still Remains a New Drug Target: Structure, Function, Classical Inhibitors, and New Inhibitors with Innovative Mechanisms of Actions

    Directory of Open Access Journals (Sweden)

    Francesca Esposito

    2012-01-01

    Full Text Available During the retrotranscription process, characteristic of all retroviruses, the viral ssRNA genome is converted into integration-competent dsDNA. This process is accomplished by the virus-coded reverse transcriptase (RT protein, which is a primary target in the current treatments for HIV-1 infection. In particular, in the approved therapeutic regimens two classes of drugs target RT, namely, nucleoside RT inhibitors (NRTIs and nonnucleoside RT inhibitors (NNRTIs. Both classes inhibit the RT-associated polymerase activity: the NRTIs compete with the natural dNTP substrate and act as chain terminators, while the NNRTIs bind to an allosteric pocket and inhibit polymerization noncompetitively. In addition to these two classes, other RT inhibitors (RTIs that target RT by distinct mechanisms have been identified and are currently under development. These include translocation-defective RTIs, delayed chain terminators RTIs, lethal mutagenesis RTIs, dinucleotide tetraphosphates, nucleotide-competing RTIs, pyrophosphate analogs, RT-associated RNase H function inhibitors, and dual activities inhibitors. This paper describes the HIV-1 RT function and molecular structure, illustrates the currently approved RTIs, and focuses on the mechanisms of action of the newer classes of RTIs.

  2. Single-dose tenofovir and emtricitabine for reduction of viral resistance to non-nucleoside reverse transcriptase inhibitor drugs in women given intrapartum nevirapine for perinatal HIV prevention: an open-label randomised trial.

    Science.gov (United States)

    Chi, Benjamin H; Sinkala, Moses; Mbewe, Felistas; Cantrell, Ronald A; Kruse, Gina; Chintu, Namwinga; Aldrovandi, Grace M; Stringer, Elizabeth M; Kankasa, Chipepo; Safrit, Jeffrey T; Stringer, Jeffrey S A

    2007-11-17

    Intrapartum and neonatal single-dose nevirapine are essential components of perinatal HIV prevention in resource-constrained settings, but can induce resistance to other non-nucleoside reverse transcriptase inhibitor drugs. We aimed to investigate whether this complication would be reduced with a single peripartum intervention of tenofovir and emtricitabine. We randomly assigned 400 HIV-infected pregnant women who sought care at two public-sector primary health facilities in Lusaka, Zambia. One was excluded, 200 were assigned to receive a single oral dose of 300 mg tenofovir disoproxil fumarate with 200 mg emtricitabine under direct observation, and 199 to receive no study drug. Short-course zidovudine and intrapartum nevirapine were offered to all HIV-infected women, according to the local standard of care. Women who met national criteria for antiretroviral therapy were referred for care and not enrolled. Our primary study outcome was resistance to non-nucleoside reverse transcriptase inhibitors at 6 weeks after delivery. We used standard population sequencing to determine HIV genotypes. Analysis was per protocol. This study is registered with ClinicalTrials.gov, number NCT00204308. Of the 200 women who were randomly assigned to the intervention, 14 were lost to follow-up or withdrew from the study, two did not take study drug according to protocol, and one specimen was lost; 23 of 199 controls were lost to follow-up or withdrew from the study, and three specimens were lost. Women given the intervention were 53% less likely than controls to have a mutation that conferred resistance to non-nucleoside reverse transcriptase inhibitors at 6 weeks after delivery (20/173 [12%] vs 41/166 [25%]; risk ratio [RR] 0.47, 95% CI 0.29-0.76). We noted postpartum anaemia, the most common serious adverse event in mothers, in four women in each group. 20 of 198 (10%) infants in the intervention group and 23 of 199 (12%) controls had a serious adverse event, mostly due to

  3. An upper bound on the number of errors corrected by a convolutional code

    DEFF Research Database (Denmark)

    Justesen, Jørn

    2000-01-01

    The number of errors that a convolutional codes can correct in a segment of the encoded sequence is upper bounded by the number of distinct syndrome sequences of the relevant length.......The number of errors that a convolutional codes can correct in a segment of the encoded sequence is upper bounded by the number of distinct syndrome sequences of the relevant length....

  4. Accident sequence quantification with KIRAP

    International Nuclear Information System (INIS)

    Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong.

    1997-01-01

    The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP's cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs

  5. Comparative analysis of the human and feline c-sis proto-oncogenes : Identification of 5' human c-sis coding sequences that are not homologous to the transforming gene of simian sarcoma virus

    NARCIS (Netherlands)

    Ouweland, Ans M.W. van den; Breuer, M.L.; Steenbergh, P.H.; Schalken, Jack A.; Bloemers, H.P.J.; Ven, Wim J.M. Van de

    1985-01-01

    Feline and human genetic sequences, homologous to the v-sis gene of simian sarcoma virus, have been isolated from cosmid gene libraries and characterized by restriction endonuclease analysis. Comparison of the two loci revealed their related structural organization. In both loci, similar unique

  6. On the synthesis of DNA error correcting codes.

    Science.gov (United States)

    Ashlock, Daniel; Houghten, Sheridan K; Brown, Joseph Alexander; Orth, John

    2012-10-01

    DNA error correcting codes over the edit metric consist of embeddable markers for sequencing projects that are tolerant of sequencing errors. When a genetic library has multiple sources for its sequences, use of embedded markers permit tracking of sequence origin. This study compares different methods for synthesizing DNA error correcting codes. A new code-finding technique called the salmon algorithm is introduced and used to improve the size of best known codes in five difficult cases of the problem, including the most studied case: length six, distance three codes. An updated table of the best known code sizes with 36 improved values, resulting from three different algorithms, is presented. Mathematical background results for the problem from multiple sources are summarized. A discussion of practical details that arise in application, including biological design and decoding, is also given in this study. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  7. Generalized concatenated quantum codes

    International Nuclear Information System (INIS)

    Grassl, Markus; Shor, Peter; Smith, Graeme; Smolin, John; Zeng Bei

    2009-01-01

    We discuss the concept of generalized concatenated quantum codes. This generalized concatenation method provides a systematical way for constructing good quantum codes, both stabilizer codes and nonadditive codes. Using this method, we construct families of single-error-correcting nonadditive quantum codes, in both binary and nonbinary cases, which not only outperform any stabilizer codes for finite block length but also asymptotically meet the quantum Hamming bound for large block length.

  8. Rateless feedback codes

    DEFF Research Database (Denmark)

    Sørensen, Jesper Hemming; Koike-Akino, Toshiaki; Orlik, Philip

    2012-01-01

    This paper proposes a concept called rateless feedback coding. We redesign the existing LT and Raptor codes, by introducing new degree distributions for the case when a few feedback opportunities are available. We show that incorporating feedback to LT codes can significantly decrease both...... the coding overhead and the encoding/decoding complexity. Moreover, we show that, at the price of a slight increase in the coding overhead, linear complexity is achieved with Raptor feedback coding....

  9. Coding for dummies

    CERN Document Server

    Abraham, Nikhil

    2015-01-01

    Hands-on exercises help you learn to code like a pro No coding experience is required for Coding For Dummies,your one-stop guide to building a foundation of knowledge inwriting computer code for web, application, and softwaredevelopment. It doesn't matter if you've dabbled in coding or neverwritten a line of code, this book guides you through the basics.Using foundational web development languages like HTML, CSS, andJavaScript, it explains in plain English how coding works and whyit's needed. Online exercises developed by Codecademy, a leading online codetraining site, help hone coding skill

  10. Advanced video coding systems

    CERN Document Server

    Gao, Wen

    2015-01-01

    This comprehensive and accessible text/reference presents an overview of the state of the art in video coding technology. Specifically, the book introduces the tools of the AVS2 standard, describing how AVS2 can help to achieve a significant improvement in coding efficiency for future video networks and applications by incorporating smarter coding tools such as scene video coding. Topics and features: introduces the basic concepts in video coding, and presents a short history of video coding technology and standards; reviews the coding framework, main coding tools, and syntax structure of AV

  11. Dolutegravir Plus Two Nucleoside Reverse Transcriptase Inhibitors versus Efavirenz Plus Two Nucleoside Reverse Transcriptase Inhibitors As Initial Antiretroviral Therapy for People with HIV: A Systematic Review.

    Science.gov (United States)

    Rutherford, George W; Horvath, Hacsi

    2016-01-01

    Dolutegravir (DTG) is a once-daily unboosted second-generation integrase-inhibitor that along with two nucleoside reverse transcriptase inhibitors is one of several regimens recommended by the United States, United Kingdom and European Union for first-line antiretroviral treatment of people with HIV infection. Our objective was to review the evidence for the efficacy and safety of DTG-based first-line regimens compared to efavirenz (EFV)-based regimens. We conducted a systematic review. We comprehensively searched a range of databases as well as conference abstracts and a trials registry. We used Cochrane methods in screening and data collection and assessed each study's risk of bias with the Cochrane tool. We meta-analyzed data using a fixed-effects model. We used GRADE to assess evidence quality. From 492 search results, we identified two randomized controlled trials, reported in five peer-reviewed articles and one conference abstract. One trial tested two DTG-based regimens (DTG + abacavir (ABC) + lamivudine (3TC) or DTG + tenofovir + emtricitabine) against an EFV-based regimen (EFV+ ABC+3TC). The other trial tested DTG+ABC+3TC against EFV+ABC+3TC. In meta-analysis, DTG-containing regimens were superior to EFV-containing regimens at 48 weeks and at 96 weeks (RR = 1.10, 95% CI 1.04-1.16; and RR = 1.12, 95% CI 1.04-1.21, respectively). In one trial, the DTG-containing regimen was superior at 144 weeks (RR = 1.13, 95% CI 1.02-1.24). DTG-containing regimens were superior in reducing treatment discontinuation compared to those containing EFV at 96 weeks and at 144 weeks (RR = 0.27, 95% CI 0.15-0.50; and RR = 0.28, 95% CI 0.16-0.48, respectively). Risk of serious adverse events was similar in each regimen at 96 weeks (RR = 1.15, 95% CI 0.80-1.63) and 144 weeks (RR = 0.93, 95% CI 0.68-1.29). Risk of bias was moderate overall, as was GRADE evidence quality. DTG-based regimens should be considered in future World Health Organization guidelines for initial HIV treatment.

  12. A generalized method of subcloning DNA fragments by restriction site reconstruction: application to sequencing the amino-terminal coding region of the transforming gene of Gazdar murine sarcoma virus.

    Science.gov (United States)

    Donoghue, D J; Hunter, T

    1982-01-01

    The technique of restriction site reconstruction was generalized so as to allow the subcloning of any DNA fragment and its subsequent reexcision with EcoRI, XbaI, XhoI or HindIII. After excision, the 3' terminus of each strand will be derived from the starting nucleic acid, permitting the use of such fragments as primers for nucleotide sequencing by primer extension methods. The technique was used to subclone a 56 base pair BstNI-DdeI fragment of Moloney murine sarcoma virus (Mo-MSV) as a unique HindIII-HindIII fragment. This fragment then served as a primer to sequence a portion of the RNA genome of Gazdar murine sarcoma virus (Gz-MSV). The nucleotide sequence which was obtained indicated that the transforming gene of Gz-MSV arose by at least two recombination events involving murine leukemia virus (MLV) and the cellular homologue c-mos. This analysis suggests that a virus indistinguishable from Mo-MSV was an intermediate in the formation of Gz-MSV. Images PMID:6281735

  13. Profile of Mutations in the Reverse Transcriptase and Overlapping Surface Genes of Hepatitis B Virus (HBV) in Treatment-Naïve Indonesian HBV Carriers.

    Science.gov (United States)

    Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake

    2017-11-22

    Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.

  14. Cellular functions of the dual-targeted catalytic subunit of telomerase, telomerase reverse transcriptase--potential role in senescence and aging.

    Science.gov (United States)

    Ale-Agha, Niloofar; Dyballa-Rukes, Nadine; Jakob, Sascha; Altschmied, Joachim; Haendeler, Judith

    2014-08-01

    Over the last 40 years it has become clear that telomeres, the end of the chromosomes, and the enzyme telomerase reverse transcriptase (TERT), which is required to counteract their shortening, play a pivotal role in senescence and aging. However, over the last years several studies demonstrated that TERT belongs to the group of dual-targeted proteins. It contains a bipartite nuclear localization signal as well as a mitochondrial targeting sequence and, under physiological conditions, is found in both organelles in several cell types including terminally differentiated, post-mitotic cells. The canonical function of TERT is to prevent telomere erosion and thereby the development of replicative senescence and genetic instability. Besides telomere extension, TERT exhibits other non-telomeric activities such as cell cycle regulation, modulation of cellular signaling and gene expression, augmentation of proliferative lifespan as well as DNA damage responses. Mitochondrial TERT is able to reduce reactive oxygen species, mitochondrial DNA damage and apoptosis. Because of the localization of TERT in the nucleus and in the mitochondria, it must have different functions in the two organelles as mitochondrial DNA does not contain telomeric structures. However, the organelle-specific functions are not completely understood. Strikingly, the regulation by phosphorylation of TERT seems to reveal multiple parallels. This review will summarize the current knowledge about the cellular functions and post-translational regulation of the dual-targeted protein TERT. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang

    2010-06-01

    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  16. Use of reverse-transcriptase-based HIV-1 viral load assessment to confirm low viral loads in newly diagnosed patients in Switzerland.

    Science.gov (United States)

    Vetter, Beatrice N; Shah, Cyril; Huder, Jon B; Böni, Jürg; Schüpbach, Jörg

    2014-02-13

    Treatment-naïve patients newly diagnosed with HIV occasionally present with low viral RNA of ≤1'000 copies/ml, raising concerns about viral load underestimation. Because falsely low or undetectable viral loads might lead to inadvertent virus transmission or treatment delays, confirmation of such cases by a sequence-independent viral load test is recommended in Switzerland. HIV-1 RNA ≤1'000 cp/ml by Roche's or Abbott's tests in patients newly diagnosed from 2010 to 2012 in Switzerland were subjected to viral load testing by the product-enhanced-reverse transcriptase (PERT) assay. These investigations were complemented with repeat and/or alternative viral RNA measurements. HIV-1 RNA ≤1'000 cp/ml was observed in 71 of 1814 newly diagnosed patients. The PERT assay suggested clinically relevant viral load underestimation in 7 of 32 cases that could be investigated. In four patients, the PERT viral load was 10-1'000-fold higher; this was confirmed by alternative HIV-1 RNA tests. Six of the 7 underestimates had been obtained with meanwhile outdated versions of Roche's HIV-1 RNA test. In the seventh patient, follow-up revealed similar results for RNA and PERT based viral loads. PERT assay revealed occasional severe viral load underestimation by versions of HIV-1 RNA tests meanwhile outdated. Underestimation by contemporary tests appears rare, however.

  17. New tools to analyze overlapping coding regions.

    Science.gov (United States)

    Bayegan, Amir H; Garcia-Martin, Juan Antonio; Clote, Peter

    2016-12-13

    Retroviruses transcribe messenger RNA for the overlapping Gag and Gag-Pol polyproteins, by using a programmed -1 ribosomal frameshift which requires a slippery sequence and an immediate downstream stem-loop secondary structure, together called frameshift stimulating signal (FSS). It follows that the molecular evolution of this genomic region of HIV-1 is highly constrained, since the retroviral genome must contain a slippery sequence (sequence constraint), code appropriate peptides in reading frames 0 and 1 (coding requirements), and form a thermodynamically stable stem-loop secondary structure (structure requirement). We describe a unique computational tool, RNAsampleCDS, designed to compute the number of RNA sequences that code two (or more) peptides p,q in overlapping reading frames, that are identical (or have BLOSUM/PAM similarity that exceeds a user-specified value) to the input peptides p,q. RNAsampleCDS then samples a user-specified number of messenger RNAs that code such peptides; alternatively, RNAsampleCDS can exactly compute the position-specific scoring matrix and codon usage bias for all such RNA sequences. Our software allows the user to stipulate overlapping coding requirements for all 6 possible reading frames simultaneously, even allowing IUPAC constraints on RNA sequences and fixing GC-content. We generalize the notion of codon preference index (CPI) to overlapping reading frames, and use RNAsampleCDS to generate control sequences required in the computation of CPI. Moreover, by applying RNAsampleCDS, we are able to quantify the extent to which the overlapping coding requirement in HIV-1 [resp. HCV] contribute to the formation of the stem-loop [resp. double stem-loop] secondary structure known as the frameshift stimulating signal. Using our software, we confirm that certain experimentally determined deleterious HCV mutations occur in positions for which our software RNAsampleCDS and RNAiFold both indicate a single possible nucleotide. We

  18. Comparative biochemical analysis of recombinant reverse transcriptase enzymes of HIV-1 subtype B and subtype C

    Directory of Open Access Journals (Sweden)

    Moisi Daniella

    2010-10-01

    Full Text Available Abstract Background HIV-1 subtype C infections account for over half of global HIV infections, yet the vast focus of HIV-1 research has been on subtype B viruses which represent less than 12% of the global pandemic. Since HIV-1 reverse transcriptase (RT is a major target of antiviral therapy, and since differential drug resistance pathways have been observed among different HIV subtypes, it is important to study and compare the enzymatic activities of HIV-1 RT derived from each of subtypes B and C as well as to determine the susceptibilities of these enzymes to various RT inhibitors in biochemical assays. Methods Recombinant subtype B and C HIV-1 RTs in heterodimeric form were purified from Escherichia coli and enzyme activities were compared in cell-free assays. The efficiency of (- ssDNA synthesis was measured using gel-based assays with HIV-1 PBS RNA template and tRNA3Lys as primer. Processivity was assayed under single-cycle conditions using both homopolymeric and heteropolymeric RNA templates. Intrinsic RNase H activity was compared using 5'-end labeled RNA template annealed to 3'-end recessed DNA primer in a time course study in the presence and absence of a heparin trap. A mis-incorporation assay was used to assess the fidelity of the two RT enzymes. Drug susceptibility assays were performed both in cell-free assays using recombinant enzymes and in cell culture phenotyping assays. Results The comparative biochemical analyses of recombinant subtype B and subtype C HIV-1 reverse transcriptase indicate that the two enzymes are very similar biochemically in efficiency of tRNA-primed (- ssDNA synthesis, processivity, fidelity and RNase H activity, and that both enzymes show similar susceptibilities to commonly used NRTIs and NNRTIs. Cell culture phenotyping assays confirmed these results. Conclusions Overall enzyme activity and drug susceptibility of HIV-1 subtype C RT are comparable to those of subtype B RT. The use of RT inhibitors (RTIs

  19. DNA Barcoding through Quaternary LDPC Codes.

    Directory of Open Access Journals (Sweden)

    Elizabeth Tapia

    Full Text Available For many parallel applications of Next-Generation Sequencing (NGS technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH or have intrinsic poor error correcting abilities (Hamming. Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10(-2 per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10(-9 at the expense of a rate of read losses just in the order of 10(-6.

  20. DECODING OF STRUCTURALLY AND LOGICAL CODES

    Directory of Open Access Journals (Sweden)

    Yu. D. Ivanov

    2016-01-01

    Full Text Available The article deals with the description of the main points of the structural and logical coding and the features of SLC codes. There are shown the basic points of the generalized algorithm of decoding SLC, which is based on the method of perfect matrix arrangement (PMA of the n-dimensional cube vertices for adequate representation and transformation of boolean functions, which is based on the method of generating sequences of variables for building the maximum coverage of the cube vertices. The structural and logical codes (SLC use natural logic redundancy of the infimum disjunctive normal forms (IDNF of boolean functions, which make the basis for building the SLC codes and correcting the errors, that occur during data transfer in real discrete channels, on the channels with independent errors. The main task is to define the basic relations between the implemented SLC codes of the logical redundancy and boundary values of multiplicity of independent errors which are corrected. The principal difference between the SLC codes and the well-known correcting codes is that the redundancy, that is needed to correct the errors in converting the discrete information, is not introduced into an additional code sequence but is defined in a natural way, during the construction of codewords of SLC.

  1. Analysis of evolution and virological characteristics of rtI233V mutations in the hepatitis B virus reverse transcriptase domain

    Directory of Open Access Journals (Sweden)

    Xiao-ling YE

    2015-04-01

    Full Text Available Objective To analyze the evolution of rtI233V mutation in the reverse transcriptase domain of hepatitis B virus (HBV and its association with adefovir dipivoxil (ADV resistance. Methods The rate of detection of rtI233V mutation in 9830 patients with chronic HBV infection was analyzed. HBV reverse transcriptase genes isolated from serial serum samples of two patients were amplified by nested PCR, and clonal sequencing (>20 clones/sample was performed to analyze the evolution of rtI233V mutations. The replica of pTriEx-HBV1.1 vectors harboring wild-type and mutant strains (rtI233V, rtN236T, rtI233V+rtN236T were respectively constructed and transiently transfected into HepG2 cells. Media containing serial concentrations of lamivudine (LAM, ADV, entecavir (ETV, or tenofovir (TDF were used to treat the cells. Then HBV DNA in the supernatants was quantitatively determined by real-time PCR in order to analyze HBV mutants' replication competence and phenotypic characteristics under the drug pressures. Results The detection rate of rtI233V mutation in 9830 nucleos(tide analogues-treated patients was 0.28% (28/9830, including 0.19% (19 patients with rtI233V individual mutation and 0.09% (9 patients with rtI233V mutation combining with rtN236T or other mutations. All of the patients had rtI233V had ADV exposure history: 16 (57.1% of them received ADV monotherapy for over six months, and 12(42.9% of them received ADV combined sequential therapy for over 12 months. Replication competence and phenotypic resistance analysis showed rtI233V and wild-type strains had similar viral replication competence, while rtN236T exhibited significantly lower replication competence compared with wild-type strains. rtI233V strains remained sensitive to LAM, ADV, ETV, and TDF and showed little influence on drug resistance when combined with rtN236T, but it showed ability to restore the defected replication capacity of rtN236T strains. Conclusions  The rtI233V mutation

  2. Locally orderless registration code

    DEFF Research Database (Denmark)

    2012-01-01

    This is code for the TPAMI paper "Locally Orderless Registration". The code requires intel threadding building blocks installed and is provided for 64 bit on mac, linux and windows.......This is code for the TPAMI paper "Locally Orderless Registration". The code requires intel threadding building blocks installed and is provided for 64 bit on mac, linux and windows....

  3. Error Correcting Codes

    Indian Academy of Sciences (India)

    sound quality is, in essence, obtained by accurate waveform coding and decoding of the audio signals. In addition, the coded audio information is protected against disc errors by the use of a Cross Interleaved Reed-Solomon Code (CIRC). Reed-. Solomon codes were discovered by Irving Reed and Gus Solomon in 1960.

  4. Karakteristik Reverse Transcriptase Gen Polymerase Virus Hepatitis B Pada Penderita Hepatitis B Kronis Asimptomatik Pra-Pengobatan

    Directory of Open Access Journals (Sweden)

    Turyadi Turyadi

    2018-01-01

    Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase.   Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis

  5. Network Coding Taxonomy

    OpenAIRE

    Adamson , Brian; Adjih , Cédric; Bilbao , Josu; Firoiu , Victor; Fitzek , Frank; Samah , Ghanem ,; Lochin , Emmanuel; Masucci , Antonia; Montpetit , Marie-Jose; Pedersen , Morten V.; Peralta , Goiuri; Roca , Vincent; Paresh , Saxena; Sivakumar , Senthil

    2017-01-01

    Internet Research Task Force - Working document of the Network Coding Research Group (NWCRG), draft-irtf-nwcrg-network-coding-taxonomy-05 (work in progress), https://datatracker.ietf.org/doc/draft-irtf-nwcrg-network-coding-taxonomy/; This document summarizes a recommended terminology for Network Coding concepts and constructs. It provides a comprehensive set of terms with unique names in order to avoid ambiguities in future Network Coding IRTF and IETF documents. This document is intended to ...

  6. QR Codes 101

    Science.gov (United States)

    Crompton, Helen; LaFrance, Jason; van 't Hooft, Mark

    2012-01-01

    A QR (quick-response) code is a two-dimensional scannable code, similar in function to a traditional bar code that one might find on a product at the supermarket. The main difference between the two is that, while a traditional bar code can hold a maximum of only 20 digits, a QR code can hold up to 7,089 characters, so it can contain much more…

  7. Sequence of the human glycogen-associated regulatory subunit of type 1 protein phosphatase and analysis of its coding region and mRNA level in muscle from patients with NIDDM

    DEFF Research Database (Denmark)

    Chen, Y H; Hansen, L; Chen, Min

    1994-01-01

    Impaired insulin-stimulated glycogen synthesis of peripheral tissues is a characteristic feature of many patients with non-insulin-dependent diabetes mellitus (NIDDM) and their first-degree relatives with normal glucose tolerance, suggesting putative inherited defects in this metabolic pathway....... In previous studies, we have failed to reveal mutations in the coding regions of the muscle-specific glycogen synthase gene and the three genes that encode the catalytic subunits of protein phosphatase 1 (PP1) as frequent causes of insulin resistance. Because the glycogen-associated regulatory subunit...... of protein phosphatase 1 (PP1 G-subunit) plays a key role in the insulin stimulation of glycogen synthesis and the activity of PP1 is decreased in insulin-resistant subjects, we have now cloned the human G-subunit cDNA to search for abnormalities in the corresponding gene (designated PPP1R3 in the human...

  8. Structure of HIV-1 nonnucleoside reverse transcriptase inhibitors derivatives of N-benzyl-benzimidazole with different substituents in position 4

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2010-01-01

    The constant development of new drugs against HIV-1 is necessary due to global expansion of AIDS and HIV-1 drug resistance. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic drugs in AIDS therapy. The crystal structures of six nonnucleoside inhibitors of HIV-1 reverse transcriptase (RT) derivatives of N-benzyl-benzimidazole are reported here. The investigated compounds belong to the group of so called "butterfly like" inhibitors with characteristic two π-electron moieties with an angled orientation. The structural data show the influence of the substituents of the benzimidazole ring on the geometry of the molecule and correlation between the structure of the inhibitor and its biological activity.

  9. ERVK Polyprotein Processing and Reverse Transcriptase Expression in Human Cell Line Models of Neurological Disease

    Directory of Open Access Journals (Sweden)

    Mamneet Manghera

    2015-01-01

    Full Text Available Enhanced expression of the reverse transcriptase (RT protein encoded by human endogenous retrovirus-K (ERVK is a promising biomarker for several inflammatory and neurological diseases. However, unlike RT enzymes encoded by exogenous retroviruses, little work has been done to identify ERVK RT isoforms, their expression patterns, and cellular localization. Using Western blot, we showcase the ERVK gag-pro-pol polyprotein processing leading to the production of several ERVK RT isoforms in human neuronal (ReNcell CX and astrocytic (SVGA models of neuroinflammatory disease. Since the pro-inflammatory cytokine IFNγ plays a key role in the pathology of several ERVK-associated neurological diseases, we sought to determine if IFNγ can drive ERVK RT expression. IFNγ signalling markedly enhanced ERVK polyprotein and RT expression in both human astrocytes and neurons. RT isoforms were expressed in a cell-type specific pattern and the RT-RNase H form was significantly increased with IFNγ treatment. Fluorescent imaging revealed distinct cytoplasmic, perinuclear and nuclear ERVK RT staining patterns upon IFNγ stimulation of astrocytes and neurons. These findings indicate that ERVK expression is inducible under inflammatory conditions such as IFNγ exposure—and thus, these newly established in vitro models may be useful in exploring ERVK biology in the context of neuroinflammatory disease.

  10. 3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    S. Ganguly

    2008-01-01

    Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.

  11. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo

    2016-06-01

    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  12. The pharmacology of antiretroviral nucleoside and nucleotide reverse transcriptase inhibitors: implications for once-daily dosing.

    Science.gov (United States)

    Back, David J; Burger, David M; Flexner, Charles W; Gerber, John G

    2005-08-01

    The trend toward once-daily dosing in HIV antiretroviral therapy is based on the association between adherence, treatment outcome, and patient preferences. Patients prefer simpler treatments, fewer pills, less frequent dosing, and no food restrictions. When a regimen meets a patient's preferences, the patient is more likely to be adherent, and with good adherence, the regimen is more likely to be effective. Nucleoside/nucleotide reverse transcriptase inhibitors (NRTIs) have been a prime focus for developing once-daily therapies primarily because they form the backbone of most current regimens. Within the NRTI class, however, drugs differ in their pharmacokinetic properties, such as plasma and intracellular half-lives, and thus in their suitability for once-daily dosing. For example, newer NRTIs, such as tenofovir and emtricitabine, combine longer plasma half-lives with longer intracellular half-lives, prolonging exposure and the period of pharmacologic activity. Of equal importance, the clinical impact of systemic and intracellular interactions between concomitant drugs defines which once-daily drugs may be combined in once-daily regimens. To construct simplified and effective therapies for individual patients, clinicians require an understanding of the plasma and intracellular pharmacokinetic properties of NRTIs and how these properties determine a drug's appropriateness for once-daily dosing and placement within a once-daily regimen.

  13. Reverse transcriptase directs viral evolution in a deep ocean methane seep

    Science.gov (United States)

    Paul, B. G.; Bagby, S. C.

    2013-12-01

    Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

  14. Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report

    Directory of Open Access Journals (Sweden)

    Lapadula Giuseppe

    2007-05-01

    Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.

  15. Conditional Knockout of Telomerase Reverse Transcriptase in Mesenchymal Cells Impairs Mouse Pulmonary Fibrosis.

    Directory of Open Access Journals (Sweden)

    Tianju Liu

    Full Text Available Telomerase is typically expressed in cellular populations capable of extended replication, such as germ cells, tumor cells, and stem cells, but is also induced in tissue injury, repair and fibrosis. Its catalytic component, telomerase reverse transcriptase (TERT is induced in lung fibroblasts from patients with fibrotic interstitial lung disease and in rodents with bleomycin-induced pulmonary fibrosis. To evaluate the fibroblast specific role of TERT in pulmonary fibrosis, transgenic mice bearing a floxed TERT allele were generated, and then crossed with an inducible collagen α2(I-Cre mouse line to generate fibroblast specific TERT conditional knockout mice. TERT-specific deficiency in mesenchymal cells caused attenuation of pulmonary fibrosis as manifested by reduced lung hydroxyproline content, type I collagen and α-smooth muscle actin mRNA levels. The TERT-deficient mouse lung fibroblasts displayed decreased cell proliferative capacity and higher susceptibility to induced apoptosis compared with control cells. Additionally TERT deficiency was associated with heightened α-smooth muscle actin expression indicative of myofibroblast differentiation. However the impairment of cell proliferation and increased susceptibility to apoptosis would cause a reduction in the myofibroblast progenitor population necessary to mount a successful myofibroblast-dependent fibrotic response. These findings identified a key role for TERT in fibroblast proliferation and survival essential for pulmonary fibrosis.

  16. In vitro resistance development for RO-0335, a novel diphenylether nonnucleoside reverse transcriptase inhibitor.

    Science.gov (United States)

    Javanbakht, H; Ptak, R G; Chow, E; Yan, J M; Russell, J D; Mankowski, M K; Hogan, P A; Hogg, J H; Vora, H; Hang, J Q; Li, Y; Su, G; Paul, A; Cammack, N; Klumpp, K; Heilek, G

    2010-05-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are important components of current combination therapies for the treatment of human immunodeficiency virus type 1 (HIV-1) infection. However, their low genetic barriers against resistance development, cross-resistance and serious side effects can compromise the benefits of the first generation compounds in this class (efavirenz and nevirapine). To study potential pathways leading to resistance against the novel diphenylether NNRTI, RO-0335, sequential passage experiments at low multiplicity of infection (MOI) were performed to solicit a stepwise selection of resistance mutations. Two pathways to loss of susceptibility to RO-0335 were observed, containing patterns of amino acid changes at either V106I/A plus F227C (with additional contributions from A98G, V108I, E138K, M230L and P236L) or V106I/Y188L (with a potential contribution from L100I, E138K and Y181C). Characterization of the observed mutations by site-directed mutagenesis in the isogenic HXB2D background demonstrated that a minimum of two or more mutations were required for significant loss of susceptibility, with the exception of Y188L, which requires a two-nucleotide change. Patterns containing F227C or quadruple mutations selected by RO-0335 showed a low relative fitness value when compared to wild-type HXB2D.

  17. 2D and 3D QSAR studies of diarylpyrimidine HIV-1 reverse transcriptase inhibitors

    Science.gov (United States)

    Rebehmed, Joseph; Barbault, Florent; Teixeira, Cátia; Maurel, François

    2008-11-01

    2D and 3D QSAR studies were applied on a set of 28 diarylpyrimidine derivatives to model and understand their HIV-1 reverse transcriptase (RT) inhibitory activities. Special cares were taken to build our set of molecules according to their bioactive conformations which is crucial to elaborate good QSAR models. 2D QSAR was performed using the heuristic method in CODESSA which had led to a linear model ( R 2 = 0.928 and s 2 = 0.015) between the inhibitory activity and five descriptors. CoMFA and CoMSIA models were established using SYBYL package of programs. The better predictive ability of the CoMSIA model ( q 2 = 0.730) over the CoMFA model ( q 2 = 0.597) was assigned to the large contribution of hydrogen-bonding interactions to the inhibitory activity. CoMSIA physicochemical properties are in agreement with the 2D QSAR descriptors. The CoMSIA PLS contour surfaces were mapped to the binding pocket of the RT and showed that the results obtained by the 2D and 3D models are in respect with the protein environment. This link permitted us to validate our model and give important insights for the structure activity interpretations. These results will guide further structural modification and prediction of new HIV-1 RT inhibitors.

  18. Universal reverse-transcriptase real-time PCR for infectious hematopoietic necrosis virus (IHNV)

    Science.gov (United States)

    Purcell, Maureen K.; Thompson, Rachel L.; Garver, Kyle A.; Hawley, Laura M.; Batts, William N.; Sprague, Laura; Sampson, Corie; Winton, James R.

    2013-01-01

    Infectious hematopoietic necrosis virus (IHNV) is an acute pathogen of salmonid fishes in North America, Europe and Asia and is reportable to the World Organization for Animal Health (OIE). Phylogenetic analysis has identified 5 major virus genogroups of IHNV worldwide, designated U, M, L, E and J; multiple subtypes also exist within those genogroups. Here, we report the development and validation of a universal IHNV reverse-transcriptase real-time PCR (RT-rPCR) assay targeting the IHNV nucleocapsid (N) gene. Properties of diagnostic sensitivity (DSe) and specificity (DSp) were defined using laboratory-challenged steelhead trout Oncorhynchus mykiss, and the new assay was compared to the OIE-accepted conventional PCR test and virus isolation in cell culture. The IHNV N gene RT-rPCR had 100% DSp and DSe and a higher estimated diagnostic odds ratio (DOR) than virus culture or conventional PCR. The RT-rPCR assay was highly repeatable within a laboratory and highly reproducible between laboratories. Field testing of the assay was conducted on a random sample of juvenile steelhead collected from a hatchery raceway experiencing an IHN epizootic. The RT-rPCR detected a greater number of positive samples than cell culture and there was 40% agreement between the 2 tests. Overall, the RT-rPCR assay was highly sensitive, specific, repeatable and reproducible and is suitable for use in a diagnostic setting.

  19. Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

    International Nuclear Information System (INIS)

    Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado

    2011-01-01

    LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

  20. Structural investigation of HIV-1 nonnucleoside reverse transcriptase inhibitors: 2-Aryl-substituted benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-11-01

    Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.

  1. Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer

    International Nuclear Information System (INIS)

    Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen

    2001-01-01

    Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts

  2. Snapshot of the equilibrium dynamics of a drug bound to HIV-1 reverse transcriptase

    Science.gov (United States)

    Kuroda, Daniel G.; Bauman, Joseph D.; Challa, J. Reddy; Patel, Disha; Troxler, Thomas; Das, Kalyan; Arnold, Eddy; Hochstrasser, Robin M.

    2013-03-01

    The anti-AIDS drug rilpivirine undergoes conformational changes to bind HIV-1 reverse transcriptase (RT), which is an essential enzyme for the replication of HIV. These changes allow it to retain potency against mutations that otherwise would render the enzyme resistant. Here we report that water molecules play an essential role in this binding process. Femtosecond experiments and theory expose the molecular level dynamics of rilpivirine bound to HIV-1 RT. Two nitrile substituents, one on each arm of the drug, are used as vibrational probes of the structural dynamics within the binding pocket. Two-dimensional vibrational echo spectroscopy reveals that one nitrile group is unexpectedly hydrogen-bonded to a mobile water molecule, not identified in previous X-ray structures. Ultrafast nitrile-water dynamics are confirmed by simulations. A higher (1.51 Å) resolution X-ray structure also reveals a water-drug interaction network. Maintenance of a crucial anchoring hydrogen bond may help retain the potency of rilpivirine against pocket mutations despite the structural variations they cause.

  3. NFAT5 regulates transcription of the mouse telomerase reverse transcriptase gene

    International Nuclear Information System (INIS)

    Fujiki, Tsukasa; Udono, Miyako; Kotake, Yojiro; Yamashita, Makiko; Shirahata, Sanetaka; Katakura, Yoshinori

    2010-01-01

    We aimed to clarify the transcription-regulation mechanisms of the mouse telomerase reverse transcriptase gene (mTERT). First, we searched for the promoter region required for transcriptional activation of mTERT and identified an enhancer cis-element (named mTERT-EE) located between - 200 and - 179 bp of the mouse TERT gene (mTERT). EMSA results suggested that nuclear factor of activated T cells (NFAT) member proteins bind to mTERT-EE. We then identified NFAT5 as the factor binding to mTERT-EE and found that it activates the transcription of the mTERT core promoter. The results that siRNA directed against NFAT5 significantly reduced mTERT expression and mTERT core promoter activity and that the expressions of NFAT5 and mTERT were well correlated in various mouse tissues except liver suggest that NFAT5 dominantly and directly regulates mTERT expression. To clarify their functionality further, we investigated the effect of hypertonic stress, a known stimulus affecting the expression and transcriptional activity of NFAT5, on mTERT expression. The result indicated that hypertonic stress activates mTERT transcription via the activation and recruitment of NFAT5 to the mTERT promoter. These results provide useful information about the transcription-regulation mechanisms of mTERT.

  4. NFAT5 regulates transcription of the mouse telomerase reverse transcriptase gene.

    Science.gov (United States)

    Fujiki, Tsukasa; Udono, Miyako; Kotake, Yojiro; Yamashita, Makiko; Shirahata, Sanetaka; Katakura, Yoshinori

    2010-12-10

    We aimed to clarify the transcription-regulation mechanisms of the mouse telomerase reverse transcriptase gene (mTERT). First, we searched for the promoter region required for transcriptional activation of mTERT and identified an enhancer cis-element (named mTERT-EE) located between -200 and -179bp of the mouse TERT gene (mTERT). EMSA results suggested that nuclear factor of activated T cells (NFAT) member proteins bind to mTERT-EE. We then identified NFAT5 as the factor binding to mTERT-EE and found that it activates the transcription of the mTERT core promoter. The results that siRNA directed against NFAT5 significantly reduced mTERT expression and mTERT core promoter activity and that the expressions of NFAT5 and mTERT were well correlated in various mouse tissues except liver suggest that NFAT5 dominantly and directly regulates mTERT expression. To clarify their functionality further, we investigated the effect of hypertonic stress, a known stimulus affecting the expression and transcriptional activity of NFAT5, on mTERT expression. The result indicated that hypertonic stress activates mTERT transcription via the activation and recruitment of NFAT5 to the mTERT promoter. These results provide useful information about the transcription-regulation mechanisms of mTERT. Copyright © 2010 Elsevier Inc. All rights reserved.

  5. Drug Resistance in Non-B Subtype HIV-1: Impact of HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Kamalendra Singh

    2014-09-01

    Full Text Available Human immunodeficiency virus (HIV causes approximately 2.5 million new infections every year, and nearly 1.6 million patients succumb to HIV each year. Several factors, including cross-species transmission and error-prone replication have resulted in extraordinary genetic diversity of HIV groups. One of these groups, known as group M (main contains nine subtypes (A-D, F-H and J-K and causes ~95% of all HIV infections. Most reported data on susceptibility and resistance to anti-HIV therapies are from subtype B HIV infections, which are prevalent in developed countries but account for only ~12% of all global HIV infections, whereas non-B subtype HIV infections that account for ~88% of all HIV infections are prevalent primarily in low and middle-income countries. Although the treatments for subtype B infections are generally effective against non-B subtype infections, there are differences in response to therapies. Here, we review how polymorphisms, transmission efficiency of drug-resistant strains, and differences in genetic barrier for drug resistance can differentially alter the response to reverse transcriptase-targeting therapies in various subtypes.

  6. Sargassum fusiforme fraction is a potent and specific inhibitor of HIV-1 fusion and reverse transcriptase

    Directory of Open Access Journals (Sweden)

    Thornber Carol

    2008-01-01

    Full Text Available Abstract Sargassum fusiforme (Harvey Setchell has been shown to be a highly effective inhibitor of HIV-1 infection. To identify its mechanism of action, we performed bioactivity-guided fractionation on Sargassum fusiforme mixture. Here, we report isolation of a bioactive fraction SP4-2 (S. fusiforme, which at 8 μg/ml inhibited HIV-1 infection by 86.9%, with IC50 value of 3.7 μg. That represents 230-fold enhancement of antiretroviral potency as compared to the whole extract. Inhibition was mediated against both CXCR4 (X4 and CCR5 (R5 tropic HIV-1. Specifically, 10 μg/ml SP4-2 blocked HIV-1 fusion and entry by 53%. This effect was reversed by interaction of SP4-2 with sCD4, suggesting that S. fusiforme inhibits HIV-1 infection by blocking CD4 receptor, which also explained observed inhibition of both X4 and R5-tropic HIV-1. SP4-2 also inhibited HIV-1 replication after virus entry, by directly inhibiting HIV-1 reverse transcriptase (RT in a dose dependent manner by up to 79%. We conclude that the SP4-2 fraction contains at least two distinct and biologically active molecules, one that inhibits HIV-1 fusion by interacting with CD4 receptor, and another that directly inhibits HIV-1 RT. We propose that S. fusiforme is a lead candidate for anti-HIV-1 drug development.

  7. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer

    2014-07-01

    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  8. Deciphering the genetic regulatory code using an inverse error control coding framework.

    Energy Technology Data Exchange (ETDEWEB)

    Rintoul, Mark Daniel; May, Elebeoba Eni; Brown, William Michael; Johnston, Anna Marie; Watson, Jean-Paul

    2005-03-01

    We have found that developing a computational framework for reconstructing error control codes for engineered data and ultimately for deciphering genetic regulatory coding sequences is a challenging and uncharted area that will require advances in computational technology for exact solutions. Although exact solutions are desired, computational approaches that yield plausible solutions would be considered sufficient as a proof of concept to the feasibility of reverse engineering error control codes and the possibility of developing a quantitative model for understanding and engineering genetic regulation. Such evidence would help move the idea of reconstructing error control codes for engineered and biological systems from the high risk high payoff realm into the highly probable high payoff domain. Additionally this work will impact biological sensor development and the ability to model and ultimately develop defense mechanisms against bioagents that can be engineered to cause catastrophic damage. Understanding how biological organisms are able to communicate their genetic message efficiently in the presence of noise can improve our current communication protocols, a continuing research interest. Towards this end, project goals include: (1) Develop parameter estimation methods for n for block codes and for n, k, and m for convolutional codes. Use methods to determine error control (EC) code parameters for gene regulatory sequence. (2) Develop an evolutionary computing computational framework for near-optimal solutions to the algebraic code reconstruction problem. Method will be tested on engineered and biological sequences.

  9. Characteristics and clinical significance of a stabilization assay to detect specific antibodies to reverse transcriptase of human immunodeficiency virus.

    OpenAIRE

    Morita, M; Suzuki, T; Nakajima, K; Shiozawa, C; Gill, M J; Hoshino, H

    1995-01-01

    Antibodies against reverse transcriptase (RT) of human immunodeficiency virus type 1 (HIV-1) have been detected in seropositive subjects by immunoprecipitation, Western immunoblotting, and neutralization assay. Recently, we noticed that the antibodies against RT stabilized RT upon heat inactivation, and we have developed a stabilization assay of RT antibody. Briefly, the RT of HIV-1 is completely inactivated by incubation at 56 degrees C for 20 min, but this inactivation is inhibited in the p...

  10. Analysis of clinical information and reverse transcriptase-polymerase chain reaction for early diagnosis of enteroviral meningitis

    OpenAIRE

    Jin, Dahee; Heo, Tae Hoon; Byeon, Jung Hye; Kim, Gun-Ha; Kim, Mi Kyung; Eun, So-Hee; Eun, Baik-Lin

    2015-01-01

    Purpose Meningitis is among the most common infections affecting the central nervous system. It can be difficult to determine the exact pathogen responsible for the infection and patients are often treated with empiric antibiotics. This study was conducted to identify the most common clinical characteristics of enteroviral meningitis in children and evaluate the diagnostic efficacy of reverse transcriptase-polymerase chain reaction (RT-PCR) for early detection of an enterovirus. Methods We an...

  11. Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P

    2011-12-08

    RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.

  12. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...... on transcriptional evidence. Analysis of repetitive sequences suggests that they are underrepresented in the reference assembly, reflecting an enrichment of gene-rich regions in the current assembly. Characterization of Lotus natural variation by resequencing of L. japonicus accessions and diploid Lotus species...... is currently ongoing, facilitated by the MG20 reference sequence...

  13. The rate of accumulation of nonnucleoside reverse transcriptase inhibitor (NNRTI) resistance in patients kept on a virologically failing regimen containing an NNRTI*

    DEFF Research Database (Denmark)

    Cozzi-Lepri, A; Paredes, R; Phillips, A N

    2012-01-01

    Virological failure of first-generation nonnucleoside reverse transcriptase inhibitors (NNRTIs) can compromise the efficacy of etravirine as a result of the accumulation of NNRTI resistance mutations. How quickly NNRTI resistance accumulates in patients with a delayed switch from nevirapine...

  14. Retroviral reverse transcriptase inhibitory activity in Thai herbs and spices: screening with Moloney murine leukemia viral enzyme.

    Science.gov (United States)

    Suthienkul, O; Miyazaki, O; Chulasiri, M; Kositanont, U; Oishi, K

    1993-12-01

    Fifty-seven Thai herbs and spices were examined for their retroviral reverse transcriptase inhibitory activity. All herbs and spices were extracted with hot-water and methanol. Reverse transcriptase inhibitory activity of the extracts was determined by using Moloney Murine Leukemia Virus reverse transcriptase (M-MuLV-RT) reacted with 3H-dTTP and radioactivity measured with a scintillation counter. Eighty-one per cent (46/57) of hot-water extracts and 54% (31/57) of methanol extracts showed inhibitory activities. At a concentration of 125 micrograms/ml, 13% (6/46) of hot-water extracts, namely Eugenia caryophyllus Bullock et Harrison, Phyllanthus urinaria Linn., Terminalia belerica Roxb., Nelumbo nucifera Gaertn., Psidium guajava Linn. and Lawsonia inermis Linn., had a relative inhibitory ratio (IR) over 50%. They showed ratios of 100%, 91%, 75%, 74%, 61% and 60%, respectively. For methanol extracts, only 10% (3/31) had IR values over 50%. They were T. belerica, E. caryophyllus and N. nucifera which exhibited IR values of 83%, 54% and 54%, respectively.

  15. Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

    Directory of Open Access Journals (Sweden)

    Ajay Kumar

    2010-01-01

    Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

  16. Structure-based evaluation of C5 derivatives in the catechol diether series targeting HIV-1 reverse transcriptase.

    Science.gov (United States)

    Frey, Kathleen M; Gray, William T; Spasov, Krasimir A; Bollini, Mariela; Gallardo-Macias, Ricardo; Jorgensen, William L; Anderson, Karen S

    2014-05-01

    Using a computationally driven approach, a class of inhibitors with picomolar potency known as the catechol diethers were developed targeting the non-nucleoside-binding pocket of HIV-1 reverse transcriptase. Computational studies suggested that halogen-bonding interactions between the C5 substituent of the inhibitor and backbone carbonyl of conserved residue Pro95 might be important. While the recently reported crystal structures of the reverse transcriptase complexes confirmed the interactions with the non-nucleoside-binding pocket, they revealed the lack of a halogen-bonding interaction with Pro95. To understand the effects of substituents at the C5 position, we determined additional crystal structures with 5-Br and 5-H derivatives. Using comparative structural analysis, we identified several conformations of the ethoxy uracil dependent on the strength of a van der Waals interaction with the Cγ of Pro95 and the C5 substitution. The 5-Cl and 5-F derivatives position the ethoxy uracil to make more hydrogen bonds, whereas the larger 5-Br and smaller 5-H position the ethoxy uracil to make fewer hydrogen bonds. EC50 values correlate with the trends observed in the crystal structures. The influence of C5 substitutions on the ethoxy uracil conformation may have strategic value, as future derivatives can possibly be modulated to gain additional hydrogen-bonding interactions with resistant variants of reverse transcriptase. © 2013 John Wiley & Sons A/S.

  17. Interaction of aurintricarboxylic acid (ATA) with four nucleic acid binding proteins DNase I, RNase A, reverse transcriptase and Taq polymerase

    Science.gov (United States)

    Ghosh, Utpal; Giri, Kalyan; Bhattacharyya, Nitai P.

    2009-12-01

    In the investigation of interaction of aurintricarboxylic acid (ATA) with four biologically important proteins we observed inhibition of enzymatic activity of DNase I, RNase A, M-MLV reverse transcriptase and Taq polymerase by ATA in vitro assay. As the telomerase reverse transcriptase (TERT) is the main catalytic subunit of telomerase holoenzyme, we also monitored effect of ATA on telomerase activity in vivo and observed dose-dependent inhibition of telomerase activity in Chinese hamster V79 cells treated with ATA. Direct association of ATA with DNase I ( Kd = 9.019 μM)), RNase A ( Kd = 2.33 μM) reverse transcriptase ( Kd = 0.255 μM) and Taq polymerase ( Kd = 81.97 μM) was further shown by tryptophan fluorescence quenching studies. Such association altered the three-dimensional conformation of DNase I, RNase A and Taq polymerase as detected by circular dichroism. We propose ATA inhibits enzymatic activity of the four proteins through interfering with DNA or RNA binding to the respective proteins either competitively or allosterically, i.e. by perturbing three-dimensional structure of enzymes.

  18. Reverse Transcriptase-Containing Particles Induced in Rous Sarcoma Virus-Transformed Rat Cells by Arginine Deprivation

    Science.gov (United States)

    Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel

    1972-01-01

    Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137

  19. Efficient Coding of Information: Huffman Coding -RE ...

    Indian Academy of Sciences (India)

    1. Introduction. Shannon's landmark paper 'A Mathematical Theory of. Communication' [1] laid the foundation for communica- ... coding theory, codes over graphs and iterative techniques, and informa- tion theory. .... An important consequence of independence is that if. {Xb X2 , . Xn} are independent random variables, each.

  20. Turbo Codes Extended with Outer BCH Code

    DEFF Research Database (Denmark)

    Andersen, Jakob Dahl

    1996-01-01

    The "error floor" observed in several simulations with the turbo codes is verified by calculation of an upper bound to the bit error rate for the ensemble of all interleavers. Also an easy way to calculate the weight enumerator used in this bound is presented. An extended coding scheme is proposed...

  1. Bone mineral density changes in protease inhibitor-sparing vs. nucleoside reverse transcriptase inhibitor-sparing highly active antiretroviral therapy: data from a randomized trial

    DEFF Research Database (Denmark)

    Hansen, Ann-Brit Eg; Obel, N; Nielsen, H

    2011-01-01

    The aim of the study was to compare changes in bone mineral density (BMD) over 144 weeks in HIV-infected patients initiating nucleoside reverse transcriptase inhibitor (NRTI)-sparing or protease inhibitor-sparing highly active antiretroviral therapy (HAART).......The aim of the study was to compare changes in bone mineral density (BMD) over 144 weeks in HIV-infected patients initiating nucleoside reverse transcriptase inhibitor (NRTI)-sparing or protease inhibitor-sparing highly active antiretroviral therapy (HAART)....

  2. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu

    2011-12-12

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  3. Utility of QR codes in biological collections

    Directory of Open Access Journals (Sweden)

    Mauricio Diazgranados

    2013-07-01

    Full Text Available The popularity of QR codes for encoding information such as URIs has increased exponentially in step with the technological advances and availability of smartphones, digital tablets, and other electronic devices. We propose using QR codes on specimens in biological collections to facilitate linking vouchers’ electronic information with their associated collections. QR codes can efficiently provide such links for connecting collections, photographs, maps, ecosystem notes, citations, and even GenBank sequences. QR codes have numerous advantages over barcodes, including their small size, superior security mechanisms, increased complexity and quantity of information, and low implementation cost. The scope of this paper is to initiate an academic discussion about using QR codes on specimens in biological collections.

  4. Utility of QR codes in biological collections.

    Science.gov (United States)

    Diazgranados, Mauricio; Funk, Vicki A

    2013-01-01

    The popularity of QR codes for encoding information such as URIs has increased exponentially in step with the technological advances and availability of smartphones, digital tablets, and other electronic devices. We propose using QR codes on specimens in biological collections to facilitate linking vouchers' electronic information with their associated collections. QR codes can efficiently provide such links for connecting collections, photographs, maps, ecosystem notes, citations, and even GenBank sequences. QR codes have numerous advantages over barcodes, including their small size, superior security mechanisms, increased complexity and quantity of information, and low implementation cost. The scope of this paper is to initiate an academic discussion about using QR codes on specimens in biological collections.

  5. Sequence of the human glycogen-associated regulatory subunit of type 1 protein phosphatase and analysis of its coding region and mRNA level in muscle from patients with NIDDM

    DEFF Research Database (Denmark)

    Chen, Y H; Hansen, L; Chen, Min

    1994-01-01

    . In previous studies, we have failed to reveal mutations in the coding regions of the muscle-specific glycogen synthase gene and the three genes that encode the catalytic subunits of protein phosphatase 1 (PP1) as frequent causes of insulin resistance. Because the glycogen-associated regulatory subunit...... of protein phosphatase 1 (PP1 G-subunit) plays a key role in the insulin stimulation of glycogen synthesis and the activity of PP1 is decreased in insulin-resistant subjects, we have now cloned the human G-subunit cDNA to search for abnormalities in the corresponding gene (designated PPP1R3 in the human...... genome nomenclature) in patients with NIDDM. The human cDNA was isolated from a skeletal muscle cDNA library and was found to encode a 126-kDa protein, which shows 73% amino acid identity to the rabbit PP1 G-subunit. The human G-subunit cDNA from 30 insulin-resistant NIDDM patients was analyzed...

  6. On Coding Non-Contiguous Letter Combinations

    Directory of Open Access Journals (Sweden)

    Frédéric eDandurand

    2011-06-01

    Full Text Available Starting from the hypothesis that printed word identification initially involves the parallel mapping of visual features onto location-specific letter identities, we analyze the type of information that would be involved in optimally mapping this location-specific orthographic code onto a location-invariant lexical code. We assume that some intermediate level of coding exists between individual letters and whole words, and that this involves the representation of letter combinations. We then investigate the nature of this intermediate level of coding given the constraints of optimality. This intermediate level of coding is expected to compress data while retaining as much information as possible about word identity. Information conveyed by letters is a function of how much they constrain word identity and how visible they are. Optimization of this coding is a combination of minimizing resources (using the most compact representations and maximizing information. We show that in a large proportion of cases, non-contiguous letter sequences contain more information than contiguous sequences, while at the same time requiring less precise coding. Moreover, we found that the best predictor of human performance in orthographic priming experiments was within-word ranking of conditional probabilities, rather than average conditional probabilities. We conclude that from an optimality perspective, readers learn to select certain contiguous and non-contiguous letter combinations as information that provides the best cue to word identity.

  7. Evolutionary insights from suffix array-based genome sequence ...

    Indian Academy of Sciences (India)

    2007-08-06

    Aug 6, 2007 ... Keywords. Biological language modelling toolkit (BLMT); genome sequence analysis; n-grams; pattern matching; suffix arrays; suffix trees; short peptide sequences genetic code bias ...

  8. SEVERO code - user's manual

    International Nuclear Information System (INIS)

    Sacramento, A.M. do.

    1989-01-01

    This user's manual contains all the necessary information concerning the use of SEVERO code. This computer code is related to the statistics of extremes = extreme winds, extreme precipitation and flooding hazard risk analysis. (A.C.A.S.)

  9. Model and code development

    International Nuclear Information System (INIS)

    Anon.

    1977-01-01

    Progress in model and code development for reactor physics calculations is summarized. The codes included CINDER-10, PHROG, RAFFLE GAPP, DCFMR, RELAP/4, PARET, and KENO. Kinetics models for the PBF were developed

  10. Coding for optical channels

    CERN Document Server

    Djordjevic, Ivan; Vasic, Bane

    2010-01-01

    This unique book provides a coherent and comprehensive introduction to the fundamentals of optical communications, signal processing and coding for optical channels. It is the first to integrate the fundamentals of coding theory and optical communication.

  11. Leptin as a critical regulator of hepatocellular carcinoma development through modulation of human telomerase reverse transcriptase

    Directory of Open Access Journals (Sweden)

    Stefanou Nikolaos

    2010-08-01

    Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.

  12. New prognostic factor telomerase reverse transcriptase promotor mutation presents without MR imaging biomarkers in primary glioblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)

    2017-12-15

    Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)

  13. Cytogenetic and real-time quantitative reverse-transcriptase polymerase chain reaction analyses in pleomorphic rhabdomyosarcoma.

    Science.gov (United States)

    Li, Guidong; Ogose, Akira; Kawashima, Hiroyuki; Umezu, Hajime; Hotta, Tetsuo; Tohyama, Tsuyoshi; Ariizumi, Takashi; Endo, Naoto

    2009-07-01

    Pleomorphic rhabdomyosarcoma (PRMS) is a rare variant of rhabdomyosarcoma that occurs mostly in adults. A few cytogenetic studies of PRMS have been reported, but no consistent specific chromosome aberrations were detected. We herein report a cytogenetic study of three cases of pleomorphic rhabdomyosarcoma using a conventional G-banded karyotyping analysis. The three cases appeared to exhibit an extremely complex karyotype with numeric and structural rearrangements. Although the three cases displayed several common aberrations, including -2, -4, -9, -13, -14, -15, -19, -21, add(X)(p11), add(1)(q11), add(7)(p11), and add(13)(p11), no recurrent characteristic chromosomal aberrations could be detected. In addition, among these cases and seven other cases of previously reported PRMS, the most frequent chromosomal alterations were -2, -13, -14, -15, -16, and -19. No obviously consistent structural alterations can be found in these 10 PRMS cases, however, thereby suggesting that it is difficult to confirm whether these complex karyotypes correlated with the diagnosis or clinical outcome in PRMS. In this study, we detected MyoD1 and myogenin gene transcripts at the mRNA level in four cases of PRMS together with other soft-tissue sarcomas, including seven cases of malignant fibrous hitiocytoma, five cases of liposacroma, and three cases of leiomyosacroma using a real-time quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) analysis. High-level expressions of MyoD1 and myogenin gene transcripts were determined in all cases of PRMS. In contrast, the other non-PRMS sarcomas showed either no expression or extremely weak expressions for both genes. Our findings suggest that the detections of MyoD1 and myogenin transcripts using real-time quantitative RT-PCR, combined with immunohistochemical stains, are extremely sensitive and useful for the diagnosis of PRMS.

  14. A uniquely prevalent nonnucleoside reverse transcriptase inhibitor resistance mutation in Russian subtype A HIV-1 viruses.

    Science.gov (United States)

    Kolomeets, Anna N; Varghese, Vici; Lemey, Philippe; Bobkova, Marina R; Shafer, Robert W

    2014-11-13

    The subtype A variant in the Former Soviet Union (A(FSU)) causes most of Russia's HIV-1 infections. However, the spectrum of drug-resistance mutations (DRMs) in antiretroviral experienced patients with this variant has not been studied. Between 2010 and 2013, genotypic resistance testing was performed on plasma samples from 366 antiretroviral-experienced patients in Siberia. Three-hundred patients (82%) had subtype A(FSU) and 55 (15%) had CRF02_AG viruses. The pattern of DRMs was consistent with patient antiretroviral history with one exception. G190S was the most common nonnucleoside reverse transcriptase inhibitor (NNRTI) resistance mutation, occurring in 55 (33%) subtype A(FSU) viruses from 167 NNRTI-experienced patients compared with none of 37 CRF02_AG viruses from NNRTI-experienced patients (P viruses. Wild-type glycine (G) at position 190 is encoded by GGC in more than 99% of published A(FSU) strains. By contrast, G190 is encoded by GGA or GGG in 97% of other subtypes and in subtype A strains outside of the FSU. Therefore, G190S results from a single G→A transition: G (GGC) → S (AGC) almost exclusively in subtype A(FSU) viruses. The predisposition of subtype A(FSU) to G190S is concerning because G→A is the most common HIV-1 mutation and because G190S causes higher levels of nevirapine and efavirenz resistance than K103N. This study exemplifies the need for characterizing the genetic mechanisms of resistance in diverse populations and warrants studies to verify that NRTI/NNRTI regimens are as efficacious in treating subtype A(FSU) as viruses belonging to other subtypes.

  15. Antimycobacterial and HIV-1 Reverse Transcriptase Activity of Julianaceae and Clusiaceae Plant Species from Mexico

    Directory of Open Access Journals (Sweden)

    Rocio Gómez-Cansino

    2015-01-01

    Full Text Available The extracts of 14 Julianaceae and 5 Clusiaceae species growing in Mexico were tested in vitro (50 µg/mL against Mycobacterium tuberculosis H37Rv and HIV reverse transcriptase (HIV-RT. The Julianaceae bark and leaf extracts inhibited M. tuberculosis (>84.67% and HIV-RT (58.3% and >67.6%, respectively. The IC50 values for six selected extracts and their cytotoxicity (50 µg/mL to human macrophages were then determined. Amphipterygium glaucum, A. molle, and A. simplicifolium fairly inhibited M. tuberculosis with IC50 of 1.87–2.35 µg/mL; but their IC50 against HIV-RT was 59.25–97.83 µg/mL. Calophyllum brasiliense, Vismia baccifera, and Vismia mexicana effect on M. tuberculosis was noteworthy (IC50 3.02–3.64 µg/mL and also inhibited RT-HIV (IC50 26.24–35.17 µg/mL. These 6 extracts (50 µg/mL presented low toxicity to macrophages (<23.8%. The HPLC profiles of A. glaucum, A. molle, and A. simplicifolium indicated that their antimycobacterial activity cannot be related to masticadienonic, 3α, or 3β-hydromasticadienonic acids, suggesting that other compounds may be responsible for the observed activity or this might be a synergy result. The anti-HIV-RT and antimycobacterial activities induced by C. brasiliense can be attributed to the content of calanolides A, B, as well as soulatrolide.

  16. The structure of FIV reverse transcriptase and its implications for non-nucleoside inhibitor resistance.

    Directory of Open Access Journals (Sweden)

    Meytal Galilee

    2018-01-01

    Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study

  17. Resistance mutations against dolutegravir in HIV integrase impair the emergence of resistance against reverse transcriptase inhibitors.

    Science.gov (United States)

    Oliveira, Maureen; Mesplède, Thibault; Quashie, Peter K; Moïsi, Daniela; Wainberg, Mark A

    2014-03-27

    Among 1222 antiretroviral-naive patients who received dolutegravir (DTG) as part of first-line therapy, none has developed resistance against this compound after 48-96 weeks of follow-up. Moreover, only four occurrences of virological failure with resistance mutations have been documented in previously drug-experienced patients who received DTG as a first time integrase inhibitor as a component of a second-line regimen. The R263K integrase resistance mutation was observed in two of these individuals who received suboptimal background regimens. We have previously selected mutations at position R263K, G118R, H51Y, and E138K as being associated with low-level resistance to DTG. Now, we sought to investigate the facility with which resistance on the part of R263K-containing viruses might develop. We tested the ability of DTG-resistant viruses containing either the R263K or G118R and/or H51Y mutations to develop further resistance against several reverse transcriptase inhibitors during in-vitro selection experiments. Our results show that DTG-resistant viruses are impaired in their ability to acquire further resistance to each of nevirapine and lamivudine as a consequence of their relative inability to develop resistance mutations associated with these two compounds. Our findings provide an explanation for the fact that no individual has yet progressed to virological failure with resistance mutations associated with dolutegravir in clinical trials in which patients received dolutegravir together with an optimized background regimen.

  18. Positive feedback-loop of telomerase reverse transcriptase and 15-lipoxygenase-2 promotes pulmonary hypertension.

    Directory of Open Access Journals (Sweden)

    Tingting Shen

    Full Text Available Pulmonary hypertension (PH is characterized with pulmonary vasoconstriction and vascular remodeling mediated by 15-lipoxygenase (15-LO/15-hydroxyeicosatetraenoic acid (15-HETE according to our previous studies. Meanwhile, telomerase reverse transcriptase (TERT activity is highly correlated with vascular injury and remodeling, suggesting that TERT may be an essential determinant in the development of PH. The aim of this study was to determine the contribution and molecular mechanisms of TERT in the pathogenesis of PH.We measured the right ventricular systolic pressure (RVSP and ventricular weight, analyzed morphometric change of the pulmonary vessels in the hypoxia or monocrotaline treated rats. Bromodeoxyuridine incorporation, transwell assay and flow cytometry in pulmonary smooth muscle cells were performed to investigate the roles and relationship of TERT and 15-LO/15-HETE in PH. We revealed that the expression of TERT was increased in pulmonary vasculature of patients with PH and in the monocrotaline or hypoxia rat model of PH. The up-regulation of TERT was associated with experimental elevated RVSP and pulmonary vascular remodeling. Coimmunoprecipitation experiments identified TERT as a novel interacting partner of 15-LO-2. TERT and 15-LO-2 augmented protein expression of each other. In addition, the proliferation, migration and cell-cycle transition from G0/G1 phase to S phase induced by hypoxia were inhibited by TERT knockdown, which were rescued by 15-HETE addition.These results demonstrate that TERT regulates pulmonary vascular remodeling. TERT and 15-LO-2 form a positive feedback loop and together promote proliferation and migration of pulmonary artery smooth muscle cells, creating a self-amplifying circuit which propels pulmonary hypertension.

  19. Human Telomerase Reverse Transcriptase (hTERT) Gene Expression in Thyroid Carcinoma: Diagnostic and Prognostic Role

    International Nuclear Information System (INIS)

    Asaad, N.Y.; Abdel Wahed, M.M.; Mohammed, A.G.

    2006-01-01

    Background: The catalytic component of telomerase, human telomerase reverse transcriptase (hTERT) has been found to be reactivated in immortalized cell lines and considered as a diagnostic marker for malignancy in different body tissues. Aim of Work: Therefore we thought to determine whether hTERT gene detection could serve as an adjunct in the diagnosis of thyroid lesions together with evaluation of its prognostic value. Patients and Methods: The study included 50 cases of primary thyroid carcinoma including; 28 papillary carcinoma, 14 follicular carcinoma,S anaplastic carcinoma and 3 medullary carcinoma in addition to 5 cases of nodular hyperplasia and 5 cases of follicular adenoma. RNA was extracted from paraffin sections of those patients and hTERT gene expression was identified by Reverse Transcription - Polymerase Chain Reaction (RT-PCR). Results: RT-PCR of hTERT gene revealed expression in 43/50 (86%) malignant thyroid cases; including 25 papillary, 11 follicular, 4 anaplastic and 3 medullary carcinoma cases. On the other hand, hTERT gene expression could not be detected in either hyperplastic nodule or in follicular adenoma cases. The diagnostic validity of hTERT gene detection in benign and malignant thyroid lesions was in the form of 88.3% accuracy, 86% sensitivity, 100% specificity, 100% positive predictive value and 90% negative predictive value. No significant association has been found between hTERT gene expression and any clinico pathologic parameters concerned in this study. In thyroid carcinoma cases, hTERT gene detection was the most independent predictor of poor survival by multivariate survival analysis. Conclusion: Detection of hTERT gene expression should be considered in confirmation of malignant thyroid lesions. Moreover it could be one of the helpful tools in addition to grade, tumor type, and age to stratify patients with thyroid carcinoma into different prognostic categories. Hence, inhibition of hTERT could be of use prospectively in the

  20. New prognostic factor telomerase reverse transcriptase promotor mutation presents without MR imaging biomarkers in primary glioblastoma

    International Nuclear Information System (INIS)

    Ersoy, Tunc F.; Simon, Matthias; Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H.; Gielen, Gerrit H.; Waha, Andreas; Fimmers, Rolf; Heidenreich, Barbara; Kumar, Rajiv

    2017-01-01

    Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O"6-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm"3; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)

  1. Directed evolution of DNA polymerase, RNA polymerase and reverse transcriptase activity in a single polypeptide.

    Science.gov (United States)

    Ong, Jennifer L; Loakes, David; Jaroslawski, Szymon; Too, Kathleen; Holliger, Philipp

    2006-08-18

    DNA polymerases enable key technologies in modern biology but for many applications, native polymerases are limited by their stringent substrate recognition. Here we describe short-patch compartmentalized self-replication (spCSR), a novel strategy to expand the substrate spectrum of polymerases in a targeted way. spCSR is based on the previously described CSR, but unlike CSR only a short region (a "patch") of the gene under investigation is diversified and replicated. This allows the selection of polymerases under conditions where catalytic activity and processivity are compromised to the extent that full self-replication is inefficient. We targeted two specific motifs involved in substrate recognition in the active site of DNA polymerase I from Thermus aquaticus (Taq) and selected for incorporation of both ribonucleotide- (NTP) and deoxyribonucleotide-triphosphates (dNTPs) using spCSR. This allowed the isolation of multiple variants of Taq with apparent dual substrate specificity. They were able to synthesize RNA, while still retaining essentially wild-type (wt) DNA polymerase activity as judged by PCR. One such mutant (AA40: E602V, A608V, I614M, E615G) was able to incorporate both NTPs and dNTPs with the same catalytic efficiency as the wt enzyme incorporates dNTPs. AA40 allowed the generation of mixed RNA-DNA amplification products in PCR demonstrating DNA polymerase, RNA polymerase as well as reverse transcriptase activity within the same polypeptide. Furthermore, AA40 displayed an expanded substrate spectrum towards other 2'-substituted nucleotides and was able to synthesize nucleic acid polymers in which each base bore a different 2'-substituent. Our results suggest that spCSR will be a powerful strategy for the generation of polymerases with altered substrate specificity for applications in nano- and biotechnology and in the enzymatic synthesis of antisense and RNAi probes.

  2. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Science.gov (United States)

    Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado

    2016-02-01

    In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  3. Leptin as a critical regulator of hepatocellular carcinoma development through modulation of human telomerase reverse transcriptase

    International Nuclear Information System (INIS)

    Stefanou, Nikolaos; Papanikolaou, Vassilis; Furukawa, Yoichi; Nakamura, Yusuke; Tsezou, Aspasia

    2010-01-01

    Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC). The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT), a known mediator of cellular immortalization. We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3) and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs) in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis

  4. Enhancing QR Code Security

    OpenAIRE

    Zhang, Linfan; Zheng, Shuang

    2015-01-01

    Quick Response code opens possibility to convey data in a unique way yet insufficient prevention and protection might lead into QR code being exploited on behalf of attackers. This thesis starts by presenting a general introduction of background and stating two problems regarding QR code security, which followed by a comprehensive research on both QR code itself and related issues. From the research a solution taking advantages of cloud and cryptography together with an implementation come af...

  5. Stylize Aesthetic QR Code

    OpenAIRE

    Xu, Mingliang; Su, Hao; Li, Yafei; Li, Xi; Liao, Jing; Niu, Jianwei; Lv, Pei; Zhou, Bing

    2018-01-01

    With the continued proliferation of smart mobile devices, Quick Response (QR) code has become one of the most-used types of two-dimensional code in the world. Aiming at beautifying the appearance of QR codes, existing works have developed a series of techniques to make the QR code more visual-pleasant. However, these works still leave much to be desired, such as visual diversity, aesthetic quality, flexibility, universal property, and robustness. To address these issues, in this paper, we pro...

  6. Dna Sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  7. ARC Code TI: CODE Software Framework

    Data.gov (United States)

    National Aeronautics and Space Administration — CODE is a software framework for control and observation in distributed environments. The basic functionality of the framework allows a user to observe a distributed...

  8. ARC Code TI: ROC Curve Code Augmentation

    Data.gov (United States)

    National Aeronautics and Space Administration — ROC (Receiver Operating Characteristic) curve Code Augmentation was written by Rodney Martin and John Stutz at NASA Ames Research Center and is a modification of ROC...

  9. Refactoring test code

    NARCIS (Netherlands)

    A. van Deursen (Arie); L.M.F. Moonen (Leon); A. van den Bergh; G. Kok

    2001-01-01

    textabstractTwo key aspects of extreme programming (XP) are unit testing and merciless refactoring. Given the fact that the ideal test code / production code ratio approaches 1:1, it is not surprising that unit tests are being refactored. We found that refactoring test code is different from

  10. Error Correcting Codes -34 ...

    Indian Academy of Sciences (India)

    the reading of data from memory the receiving process. Protecting data in computer memories was one of the earliest applications of Hamming codes. We now describe the clever scheme invented by Hamming in 1948. To keep things simple, we describe the binary length 7 Hamming code. Encoding in the Hamming Code.

  11. Morse Code Activity Packet.

    Science.gov (United States)

    Clinton, Janeen S.

    This activity packet offers simple directions for setting up a Morse Code system appropriate to interfacing with any of several personal computer systems. Worksheets are also included to facilitate teaching Morse Code to persons with visual or other disabilities including blindness, as it is argued that the code is best learned auditorily. (PB)

  12. Software Certification - Coding, Code, and Coders

    Science.gov (United States)

    Havelund, Klaus; Holzmann, Gerard J.

    2011-01-01

    We describe a certification approach for software development that has been adopted at our organization. JPL develops robotic spacecraft for the exploration of the solar system. The flight software that controls these spacecraft is considered to be mission critical. We argue that the goal of a software certification process cannot be the development of "perfect" software, i.e., software that can be formally proven to be correct under all imaginable and unimaginable circumstances. More realistically, the goal is to guarantee a software development process that is conducted by knowledgeable engineers, who follow generally accepted procedures to control known risks, while meeting agreed upon standards of workmanship. We target three specific issues that must be addressed in such a certification procedure: the coding process, the code that is developed, and the skills of the coders. The coding process is driven by standards (e.g., a coding standard) and tools. The code is mechanically checked against the standard with the help of state-of-the-art static source code analyzers. The coders, finally, are certified in on-site training courses that include formal exams.

  13. An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

    DEFF Research Database (Denmark)

    Duch, Mogens R.; Carrasco, Maria L; Jespersen, Thomas

    2004-01-01

    Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat, de...

  14. The network code

    International Nuclear Information System (INIS)

    1997-01-01

    The Network Code defines the rights and responsibilities of all users of the natural gas transportation system in the liberalised gas industry in the United Kingdom. This report describes the operation of the Code, what it means, how it works and its implications for the various participants in the industry. The topics covered are: development of the competitive gas market in the UK; key points in the Code; gas transportation charging; impact of the Code on producers upstream; impact on shippers; gas storage; supply point administration; impact of the Code on end users; the future. (20 tables; 33 figures) (UK)

  15. The materiality of Code

    DEFF Research Database (Denmark)

    Soon, Winnie

    2014-01-01

    , Twitter and Facebook). The focus is not to investigate the functionalities and efficiencies of the code, but to study and interpret the program level of code in order to trace the use of various technological methods such as third-party libraries and platforms’ interfaces. These are important...... to understand the socio-technical side of a changing network environment. Through the study of code, including but not limited to source code, technical specifications and other materials in relation to the artwork production, I would like to explore the materiality of code that goes beyond technical...

  16. Coding for Electronic Mail

    Science.gov (United States)

    Rice, R. F.; Lee, J. J.

    1986-01-01

    Scheme for coding facsimile messages promises to reduce data transmission requirements to one-tenth current level. Coding scheme paves way for true electronic mail in which handwritten, typed, or printed messages or diagrams sent virtually instantaneously - between buildings or between continents. Scheme, called Universal System for Efficient Electronic Mail (USEEM), uses unsupervised character recognition and adaptive noiseless coding of text. Image quality of resulting delivered messages improved over messages transmitted by conventional coding. Coding scheme compatible with direct-entry electronic mail as well as facsimile reproduction. Text transmitted in this scheme automatically translated to word-processor form.

  17. DNA as a Binary Code: How the Physical Structure of Nucleotide Bases Carries Information

    Science.gov (United States)

    McCallister, Gary

    2005-01-01

    The DNA triplet code also functions as a binary code. Because double-ring compounds cannot bind to double-ring compounds in the DNA code, the sequence of bases classified simply as purines or pyrimidines can encode for smaller groups of possible amino acids. This is an intuitive approach to teaching the DNA code. (Contains 6 figures.)

  18. An automated annotation tool for genomic DNA sequences using ...

    Indian Academy of Sciences (India)

    Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated ...

  19. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  20. An automated annotation tool for genomic DNA sequences using

    Indian Academy of Sciences (India)

    Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated ...

  1. Full-length sequencing and identification of novel polymorphisms in ...

    Indian Academy of Sciences (India)

    The aim of this work was to sequence the entirecoding region of ACACA gene in Valle del Belice sheep breed to identify polymorphic sites. A total of 51 coding exons of ACACA gene were sequenced in 32 individuals of Valle del Belice sheep breed. Sequencing analysis and alignment of obtained sequences showed the ...

  2. Retrotransposons and non-protein coding RNAs

    DEFF Research Database (Denmark)

    Mourier, Tobias; Willerslev, Eske

    2009-01-01

    does not merely represent spurious transcription. We review examples of functional RNAs transcribed from retrotransposons, and address the collection of non-protein coding RNAs derived from transposable element sequences, including numerous human microRNAs and the neuronal BC RNAs. Finally, we review...

  3. High rate concatenated coding systems using bandwidth efficient trellis inner codes

    Science.gov (United States)

    Deng, Robert H.; Costello, Daniel J., Jr.

    1989-05-01

    High-rate concatenated coding systems with bandwidth-efficient trellis inner codes and Reed-Solomon (RS) outer codes are investigated for application in high-speed satellite communication systems. Two concatenated coding schemes are proposed. In one the inner code is decoded with soft-decision Viterbi decoding, and the outer RS code performs error-correction-only decoding (decoding without side information). In the other, the inner code is decoded with a modified Viterbi algorithm, which produces reliability information along with the decoded output. In this algorithm, path metrics are used to estimate the entire information sequence, whereas branch metrics are used to provide reliability information on the decoded sequence. This information is used to erase unreliable bits in the decoded output. An errors-and-erasures RS decoder is then used for the outer code. The two schemes have been proposed for high-speed data communication on NASA satellite channels. The rates considered are at least double those used in current NASA systems, and the results indicate that high system reliability can still be achieved.

  4. The first genome sequences of human bocaviruses from Vietnam.

    Science.gov (United States)

    Thanh, Tran Tan; Van, Hoang Minh Tu; Hong, Nguyen Thi Thu; Nhu, Le Nguyen Truc; Anh, Nguyen To; Tuan, Ha Manh; Hien, Ho Van; Tuong, Nguyen Manh; Kien, Trinh Trung; Khanh, Truong Huu; Nhan, Le Nguyen Thanh; Hung, Nguyen Thanh; Chau, Nguyen Van Vinh; Thwaites, Guy; van Doorn, H Rogier; Tan, Le Van

    2016-01-01

    As part of an ongoing effort to generate complete genome sequences of hand, foot and mouth disease-causing enteroviruses directly from clinical specimens, two complete coding sequences and two partial genomic sequences of human bocavirus 1 (n=3) and 2 (n=1) were co-amplified and sequenced, representing the first genome sequences of human bocaviruses from Vietnam. The sequences may aid future study aiming at understanding the evolution of the pathogen.

  5. XSOR codes users manual

    International Nuclear Information System (INIS)

    Jow, Hong-Nian; Murfin, W.B.; Johnson, J.D.

    1993-11-01

    This report describes the source term estimation codes, XSORs. The codes are written for three pressurized water reactors (Surry, Sequoyah, and Zion) and two boiling water reactors (Peach Bottom and Grand Gulf). The ensemble of codes has been named ''XSOR''. The purpose of XSOR codes is to estimate the source terms which would be released to the atmosphere in severe accidents. A source term includes the release fractions of several radionuclide groups, the timing and duration of releases, the rates of energy release, and the elevation of releases. The codes have been developed by Sandia National Laboratories for the US Nuclear Regulatory Commission (NRC) in support of the NUREG-1150 program. The XSOR codes are fast running parametric codes and are used as surrogates for detailed mechanistic codes. The XSOR codes also provide the capability to explore the phenomena and their uncertainty which are not currently modeled by the mechanistic codes. The uncertainty distributions of input parameters may be used by an. XSOR code to estimate the uncertainty of source terms

  6. DLLExternalCode

    Energy Technology Data Exchange (ETDEWEB)

    2014-05-14

    DLLExternalCode is the a general dynamic-link library (DLL) interface for linking GoldSim (www.goldsim.com) with external codes. The overall concept is to use GoldSim as top level modeling software with interfaces to external codes for specific calculations. The DLLExternalCode DLL that performs the linking function is designed to take a list of code inputs from GoldSim, create an input file for the external application, run the external code, and return a list of outputs, read from files created by the external application, back to GoldSim. Instructions for creating the input file, running the external code, and reading the output are contained in an instructions file that is read and interpreted by the DLL.

  7. Genetic coding and gene expression - new Quadruplet genetic coding model

    Science.gov (United States)

    Shankar Singh, Rama

    2012-07-01

    Successful demonstration of human genome project has opened the door not only for developing personalized medicine and cure for genetic diseases, but it may also answer the complex and difficult question of the origin of life. It may lead to making 21st century, a century of Biological Sciences as well. Based on the central dogma of Biology, genetic codons in conjunction with tRNA play a key role in translating the RNA bases forming sequence of amino acids leading to a synthesized protein. This is the most critical step in synthesizing the right protein needed for personalized medicine and curing genetic diseases. So far, only triplet codons involving three bases of RNA, transcribed from DNA bases, have been used. Since this approach has several inconsistencies and limitations, even the promise of personalized medicine has not been realized. The new Quadruplet genetic coding model proposed and developed here involves all four RNA bases which in conjunction with tRNA will synthesize the right protein. The transcription and translation process used will be the same, but the Quadruplet codons will help overcome most of the inconsistencies and limitations of the triplet codes. Details of this new Quadruplet genetic coding model and its subsequent potential applications including relevance to the origin of life will be presented.

  8. Optimal interference code based on machine learning

    Science.gov (United States)

    Qian, Ye; Chen, Qian; Hu, Xiaobo; Cao, Ercong; Qian, Weixian; Gu, Guohua

    2016-10-01

    In this paper, we analyze the characteristics of pseudo-random code, by the case of m sequence. Depending on the description of coding theory, we introduce the jamming methods. We simulate the interference effect or probability model by the means of MATLAB to consolidate. In accordance with the length of decoding time the adversary spends, we find out the optimal formula and optimal coefficients based on machine learning, then we get the new optimal interference code. First, when it comes to the phase of recognition, this study judges the effect of interference by the way of simulating the length of time over the decoding period of laser seeker. Then, we use laser active deception jamming simulate interference process in the tracking phase in the next block. In this study we choose the method of laser active deception jamming. In order to improve the performance of the interference, this paper simulates the model by MATLAB software. We find out the least number of pulse intervals which must be received, then we can make the conclusion that the precise interval number of the laser pointer for m sequence encoding. In order to find the shortest space, we make the choice of the greatest common divisor method. Then, combining with the coding regularity that has been found before, we restore pulse interval of pseudo-random code, which has been already received. Finally, we can control the time period of laser interference, get the optimal interference code, and also increase the probability of interference as well.

  9. Super-Resolution Still and Video Reconstruction from MPEG Coded Video

    National Research Council Canada - National Science Library

    Altunbasak, Yucel

    2004-01-01

    Transform coding is a popular and effective compression method for both still images and video sequences, as is evident from its widespread use in international media coding standards such as MPEG, H.263 and JPEG...

  10. Uniform Circular Antenna Array Applications in Coded DS-CDMA Mobile Communication Systems

    National Research Council Canada - National Science Library

    Seow, Tian

    2003-01-01

    ...) has greatly increased. This thesis examines the use of an equally spaced circular adaptive antenna array at the mobile station for a typical coded direct sequence code division multiple access (DS-CDMA...

  11. A bioorganometallic approach for rapid electrochemical analysis of human immunodeficiency virus type-1 reverse transcriptase in serum

    International Nuclear Information System (INIS)

    Labib, Mahmoud; Shipman, Patrick O.; Martic, Sanela; Kraatz, Heinz-Bernhard

    2011-01-01

    Highlights: → Two-dimensional electrochemical assay of HIV-1 reverse transcriptase in serum is presented. → XPS and ToF-SIMS confirmed binding of synthetic ferrocene-lipoic acid to gold. → Dynamic range was 100-500 pg mL -1 with an LOD of 50 pg mL -1 . → The biosensor allows sensitive and selective detection of reverse transcriptase in 20 s. - Abstract: Determination of low-abundance human immunodeficiency virus (HIV) enzymes is essential for early detection of the viral infection. Designed for the rapid detection of the virus in human serum, a rapid and ultrasensitive electrochemical assay for HIV-1 reverse transcriptase (HIV-1 RT) is presented in this article. The assay format is based on the formation of a self-assembled monolayer (SAM) of a synthesized ferrocene (Fc)-labeled lipoic acid onto a gold electrode. X-ray photoelectron spectroscopy (XPS) and Time-of-Flight secondary ion mass spectrometry (ToF-SIMS) were employed to confirm the binding of the Fc-labeled lipoic acid to the gold via the Au-S bond. A short RT-specific peptide, VEAIIRILQQLLFIH, was covalently attached to the Fc-labeled lipoic acid. Square wave voltammetry (SWV) offered a two-dimensional measurement of RT based on the anodic shift and reduction of current density of the Fc redox signal upon binding of RT to its specific peptide. This allowed a linear quantification of the target RT in the range of 100-500 pg mL -1 , equivalent to 85.5-427.4 fM, with a detection limit of 50 pg mL -1 (42.7 fM). The developed biosensor is inexpensive, easy to prepare and operate, and allows a highly selective detection of RT in 20 s.

  12. Frequent somatic mutations of the telomerase reverse transcriptase promoter in ovarian clear cell carcinoma but not in other major types of gynecologic malignancies

    Science.gov (United States)

    Wu, Ren-Chin; Ayhan, Ayse; Maeda, Daichi; Kim, Kyu-Rae; Clarke, Blaise A.; Shaw, Patricia; Chui, M. Herman; Rosen, Barry; Shih, Ie-Ming; Wang, Tian-Li

    2014-01-01

    Up-regulated expression of telomerase reverse transcriptase (TERT) and subsequent maintenance of telomere length are essential in tumor development. Recent studies have implicated somatic gain-of-function mutations at the TERT promoter as one of the mechanisms that promote transcriptional activation of TERT; however, it remains unclear whether this genetic abnormality is prevalent in gynecologic neoplasms. We performed mutational analysis in a total of 525 gynecological cancers, and correlated TERT promoter mutations with clinicopathological features. With the exception of ovarian clear cell carcinomas, in which mutations were found in 37 (15.9%) of 233 cases, the majority of gynecologic malignancies were wild-type. TERT promoter mutation does not appear to be an early event during oncogenesis, as it was not detected in the contiguous endometriosis associated with ovarian clear cell carcinoma. Ovarian clear cell carcinoma cell lines with TERT promoter mutations exhibited higher TERT mRNA expression than those with wild-type sequences (p = 0.0238). TERT promoter mutation tended to be mutually exclusive with loss of ARID1A protein expression (p= 4.4×10−9) and PIK3CA mutation (p= 0.0019) in ovarian clear cell carcinomas. No associations with disease-specific survival were observed for ovarian clear cell carcinoma. The above results, in conjunction with our previous report showing longer telomeres in ovarian clear cell carcinomas relative to other types of ovarian cancer, suggests that aberrations in telomere biology may play an important role in the pathogenesis of ovarian clear cell carcinoma. PMID:24338723

  13. Pre-existing mutations in reverse transcriptase of hepatitis B virus in treatment-naive Chinese patients with chronic hepatitis B.

    Directory of Open Access Journals (Sweden)

    Jie Xu

    Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.

  14. Impact of drug resistance-associated amino acid changes in HIV-1 subtype C on susceptibility to newer nonnucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Basson, Adriaan E; Rhee, Soo-Yon; Parry, Chris M; El-Khatib, Ziad; Charalambous, Salome; De Oliveira, Tulio; Pillay, Deenan; Hoffmann, Christopher; Katzenstein, David; Shafer, Robert W; Morris, Lynn

    2015-02-01

    The objective of this study was to assess the phenotypic susceptibility of HIV-1 subtype C isolates, with nonnucleoside reverse transcriptase inhibitor (NNRTI) resistance-associated amino acid changes, to newer NNRTIs. A panel of 52 site-directed mutants and 38 clinically derived HIV-1 subtype C clones was created, and the isolates were assessed for phenotypic susceptibility to etravirine (ETR), rilpivirine (RPV), efavirenz (EFV), and nevirapine (NVP) in an in vitro single-cycle phenotypic assay. The amino acid substitutions E138Q/R, Y181I/V, and M230L conferred high-level resistance to ETR, while K101P and Y181I/V conferred high-level resistance to RPV. Y181C, a major NNRTI resistance-associated amino acid substitution, caused decreased susceptibility to ETR and, to a lesser extent, RPV when combined with other mutations. These included N348I and T369I, amino acid changes in the connection domain that are not generally assessed during resistance testing. However, the prevalence of these genotypes among subtype C sequences was, in most cases, E138K was not significantly enhanced in the presence of M184V/I, unlike for EFV and NVP. Among patient samples, 97% were resistant to EFV and/or NVP, while only 24% and 16% were resistant to ETR and RPV, respectively. Overall, only a few, relatively rare NNRTI resistance-associated amino acid substitutions caused resistance to ETR and/or RPV in an HIV-1 subtype C background, suggesting that these newer NNRTIs would be effective in NVP/EFV-experienced HIV-1 subtype C-infected patients. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Arm-specific cleavage and mutation during reverse transcription of 2΄,5΄-branched RNA by Moloney murine leukemia virus reverse transcriptase.

    Science.gov (United States)

    Döring, Jessica; Hurek, Thomas

    2017-04-20

    Branchpoint nucleotides of intron lariats induce pausing of DNA synthesis by reverse transcriptases (RTs), but it is not known yet how they direct RT RNase H activity on branched RNA (bRNA). Here, we report the effects of the two arms of bRNA on branchpoint-directed RNA cleavage and mutation produced by Moloney murine leukemia virus (M-MLV) RT during DNA polymerization. We constructed a long-chained bRNA template by splinted-ligation. The bRNA oligonucleotide is chimeric and contains DNA to identify RNA cleavage products by probe hybridization. Unique sequences surrounding the branchpoint facilitate monitoring of bRNA purification by terminal-restriction fragment length polymorphism analysis. We evaluate the M-MLV RT-generated cleavage and mutational patterns. We find that cleavage of bRNA and misprocessing of the branched nucleotide proceed arm-specifically. Bypass of the branchpoint from the 2΄-arm causes single-mismatch errors, whereas bypass from the 3΄-arm leads to deletion mutations. The non-template arm is cleaved when reverse transcription is primed from the 3΄-arm but not from the 2΄-arm. This suggests that RTs flip ∼180° at branchpoints and RNases H cleave the non-template arm depending on its accessibility. Our observed interplay between M-MLV RT and bRNA would be compatible with a bRNA-mediated control of retroviral and related retrotransposon replication. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. MELT-IIIB: an updated version of the melt code

    International Nuclear Information System (INIS)

    Tabb, K.K.; Lewis, C.H.; O'Dell, L.D.; Padilla, A. Jr.; Smith, D.E.; Wilburn, N.P.

    1979-04-01

    The MELT series is a reactor modeling code designed to investigate a wide variety of hypothetical accident conditions, particularly the transient overpower sequence. MELT-IIIB is the latest in the series

  17. The binding of a novel bisheteroarylpiperazine mediates inhibition of human immunodeficiency virus type 1 reverse transcriptase.

    Science.gov (United States)

    Dueweke, T J; Kézdy, F J; Waszak, G A; Deibel, M R; Tarpley, W G

    1992-01-05

    The bisheteroarylpiperazines (BHAPs) are potent inhibitors of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) and specifically block HIV-1 replication (Romero, D. L., Busso, M., Tan, C.-K., Reusser, F., Palmer, J. R., Poppe, S. M., Aristoff, P. A., Downey, K. M., So, A. G., Resnick, L., and Tarpley, W. G. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 8806-8810). Here we show that the radiolabeled BHAP [3H]U-88204 binds specifically to HIV-1 RT with high affinity (KD of 50 nM) and a stoichiometry of 1 mol of U-88204 per 1 mol of p66/p51 RT heterodimer. Binding of [3H]U-88204 to RT is unaffected by the presence of saturating poly(rC).oligo (dG)12-18 template-primer. Direct measurement of competition between [3H]U-88204 and other RT inhibitors for binding to RT reveals mutually exclusive competition between [3H]U-88204 and the non-nucleoside RT inhibitor BI-RG-587 (Kopp, E. B., Miglietta, J. J., Shrutkowski, A. G., Shih, C.-K., Grob, P. M. and Skoog, M.T. (1991) Nucleic Acids Res. 19, 3035-3039), indicating that both share the same binding site. Phosphonoformate in concentrations up to 50 microM shows no competition with [3H]U-88204 for binding to RT either alone or in the presence of template-primer. Dideoxynucleotide RT inhibitors affect the binding of [3H]U-88204 to RT when complementary template-primer is present. [3H]U-88204 and the dideoxynucleotide ddGTP can bind RT simultaneously, but the presence of one ligand decreases the affinity of RT for the second. Inasmuch as ddGTP approximates the nucleotide substrate of RT, the direct demonstration of an RT-dideoxynucleotide-[3H]U-88204 complex validates the use of indirect kinetic methods to assess the strength of BHAP interaction with RT and suggests that RT inhibition by U-88204 is achieved via effects on nucleotide substrate binding.

  18. [Diagnostic significance of serum free DNA human telomerase reverse transcriptase quantitative determination on spinal cord injury].

    Science.gov (United States)

    Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B

    2018-02-06

    Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.

  19. Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M

    2017-12-01

    Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these

  20. Tempol protects cardiomyocytes from nucleoside reverse transcriptase inhibitor-induced mitochondrial toxicity.

    Science.gov (United States)

    Liu, Yongmin; Shim, Eunwoo; Nguyen, Phuonggiang; Gibbons, Alexander T; Mitchell, James B; Poirier, Miriam C

    2014-05-01

    Nucleoside reverse transcriptase inhibitors (NRTIs), essential components of combinational therapies used for treatment of human immunodeficiency virus-1, damage heart mitochondria. Here, we have shown mitochondrial compromise in H9c2 rat cardiomyocytes exposed for 16 passages (P) to the NRTIs zidovudine (AZT, 50μM) and didanosine (ddI, 50μM), and we have demonstrated protection from mitochondrial compromise in cells treated with 200μM 1-oxyl-2,2,6,6-tetramethyl-4-hydroxypiperidine (Tempol) or 200μM 1-hydroxy-4-[2-triphenylphosphonio)-acetamido]-2,2,6,6-tetramethylpiperidine (Tempol-H), along with AZT/ddI, for 16P. Exposure to AZT/ddI caused a moderate growth inhibition at P3, P5, P7, and P13, which was not altered by addition of Tempol or Tempol-H. Mitochondrial oxidative phosphorylation capacity was determined as uncoupled oxygen consumption rate (OCR) by Seahorse XF24 Analyzer. At P5, P7, and P13, AZT/ddI-exposed cells showed an OCR reduction of 8.8-57.2% in AZT/ddI-exposed cells, compared with unexposed cells. Addition of Tempol or Tempol-H, along with AZT/ddI, resulted in OCR levels increased by about 300% above the values seen with AZT/ddI alone. The Seahorse data were further supported by electron microscopy (EM) studies in which P16 cells exposed to AZT/ddI/Tempol had less mitochondrial pathology than P16 cells exposed to AZT/ddI. Western blots of P5 cells showed that Tempol and Tempol-H upregulated expression of mitochondrial uncoupling protein-2 (UCP-2). However, Complex I activity that was reduced by AZT/ddI, was not restored in the presence of AZT/ddI/Tempol. Superoxide levels were increased in the presence of AZT/ddI and significantly decreased in cells exposed to AZT/3TC/Tempol at P3, P7, and P10. In conclusion, Tempol protects against NRTI-induced mitochondrial compromise, and UCP-2 plays a role through mild uncoupling.

  1. Mitochondrial toxicities of nucleoside analogue reverse transcriptase inhibitors in AIDS cases.

    Science.gov (United States)

    Marfatia, Yogesh S; Talwar, Mahima; Agrawal, Meetesh; Sharma, Ajay; Mehta, Kajal

    2014-01-01

    The development of antiretroviral therapy (ART) has been one of the most dramatic progressions in the history of medicine. Concomitant with this momentous therapeutic advance, the mitochondrial toxicities of ART were recognized as an important clinical entity. The aim was to study the mitochondrial toxicities in terms of peripheral neuropathy (PN), lipodystrophy (LD), hepatic steatosis, lactic academia (LA), and pancreatitis developing in AIDS cases on nucleoside analog reverse transcriptase inhibitors (NRTIs) based ART regimens. An observational study, which included 90 AIDS cases, receiving first line ART regimens containing two NRTIs (zidovudine [AZT]/stavudine [d4T] with lamivudine [3TC]) and one nonNRTIs (nevirapine/efavirenz) was conducted at Skin-VD outpatient department of a tertiary care hospital attached to a Medical College. Thorough history was taken, and clinical examination was done. Cases were subjected to measurements of abdominal girth and mid-arm circumference, liver function tests, blood sugar, lipid profile, serum lactate, and amylase levels. Of 90 cases on ART, 66% were males and 34% were females. Mitochondrial toxicities developed in 26 (30%) cases out of 90, which included 3 (7%) out of 42 cases on AZT + 3TC and 23 (48%) out of 48 cases on d4T + 3TC. Most common toxicity was PN seen in 20 (22%) cases; male cases developed PN at a lower CD4 count than female cases. LD was observed in total of 13 (14.5%) cases; deposition of fat in the abdomen in seven cases and at the nape of the neck (buffalo hump) in one case while loss of fat from extremities was seen in seven cases and loss of buccal fat in seven cases. Women presented more with fat accumulation (breast and abdomen), while men with loss of fat (limbs and buttocks). Both PN and LD were more common in d4T based regimen. LA was reported in one case on d4T. Hepatic steatosis was seen in three cases and pancreatitis in one case receiving AZT. Regular monitoring and early diagnosis of

  2. Rilpivirine resistance mutations in HIV patients failing non-nucleoside reverse transcriptase inhibitor-based therapies.

    Science.gov (United States)

    Anta, Lourdes; Llibre, Josep M; Poveda, Eva; Blanco, José L; Alvarez, Marta; Pérez-Elías, María J; Aguilera, Antonio; Caballero, Estrella; Soriano, Vicente; de Mendoza, Carmen

    2013-01-02

    Rilpivirine (RPV) is the latest approved nonnucleoside reverse transcriptase inhibitor (NNRTI). It displays in-vitro activity extending over other NNRTI-resistant HIV strains. There is scarce information about the rate of RPV resistance-associated mutations (RAMs) in patients failing other NNRTIs. RPV RAMs were examined in plasma samples collected from HIV patients that had recently failed NNRTI-based regimens at 22 clinics in Spain. Resistance tests from a total of 1064 patients failing efavirenz (EFV) (54.5%), nevirapine (NVP) (40%) or etravirine (ETR) (5.5%) were examined. The prevalence of RPV RAMs was K101E (9.1%), K101P (1.4%), E138A (3.9%), E138G (0.3%), E138K (0.3%), E138Q (0.8%), V179L (0.2%), Y181C (21.8%), Y181I (0.5%), Y181V (0.2%), H221Y (8.3%), F227C (0.1%) and M230L (1.5%). K101E/M184I was seen in 1%. E138K/M184I were absent. Mutations L100I and V108I were significantly more frequent in patients failing EFV than NVP (7.9 vs. 0.2 and 12.2 vs. 7.3%, respectively). Conversely, Y181C, Y181I, V106A, H221Y and F227L were more prevalent following NVP than EFV failures. Using the Spanish resistance interpretation algorithm, 206 genotypes (19.3%) from patients failing NNRTI (NVP 52%, EFV 40.8% and ETR 7.8%) were considered as RPV resistant. In patients with ETR failure, cross-resistance to RPV was seen in 27.6%, mainly as result of Y181C (81.3%), V179I (43.8%), V90I (31.3%) and V108I (18.8%). RPV resistance is overall recognized in nearly 20% of patients failing other NNRTIs. It is more common following ETR (27.6%) or NVP (25%) failures than EFV (14.5%). E138 mutants are rarely seen in this context.

  3. Hepatitis B virus reverse transcriptase - Target of current antiviral therapy and future drug development.

    Science.gov (United States)

    Clark, Daniel N; Hu, Jianming

    2015-11-01

    Hepatitis B virus (HBV) infections rely on the proper functioning of the viral polymerase enzyme, a specialized reverse transcriptase (RT) with multiple activities. All currently approved antiviral drugs for the treatment of chronic HBV infection, except for interferon, target the RT and belong to the same chemical class - they are all nucleoside analogs. Viral DNA synthesis is carried out by the RT enzyme in several different steps, each with distinct RT conformational requirements. In principle, each stage may be targeted by distinct antiviral drugs. In particular, the HBV RT has the unique ability to initiate viral DNA synthesis using itself as a protein primer in a novel protein priming reaction. In order to help identify RT inhibitors and study their mechanisms of action, a number of experimental systems have been developed, each varying in its ability to dissect the protein priming stage and subsequent stages of viral DNA synthesis at the molecular level. Two of the most effective drugs to date, entecavir and tenofovir, can inhibit both the protein priming and the subsequent DNA elongation stages of HBV DNA synthesis. Interestingly, clevudine, a thymidine analog, can inhibit both protein priming and DNA elongation in a non-competitive manner and without being incorporated into the viral DNA. Thus, a nucleoside RT inhibitor (NRTI) can functionally mimic a non-NRTI (NNRTI) in its inhibition of the HBV RT. Therefore, novel NRTIs as well as NNRTIs may be developed to inhibit the DNA synthesis activity of the HBV RT. Furthermore, additional activities of the RT that are also essential to HBV replication, including specific recognition of the viral RNA and its packaging into viral nucleocapsids, may be exploited for antiviral development. To achieve a more potent inhibition of viral replication and ultimately cure chronic HBV infection, the next generation of anti-HBV therapies will likely need to include NRTIs, NNRTIs, and other agents that target the viral RT as

  4. Spread-spectrum communication using binary spatiotemporal chaotic codes

    International Nuclear Information System (INIS)

    Wang Xingang; Zhan Meng; Gong Xiaofeng; Lai, C.H.; Lai, Y.-C.

    2005-01-01

    We propose a scheme to generate binary code for baseband spread-spectrum communication by using a chain of coupled chaotic maps. We compare the performances of this type of spatiotemporal chaotic code with those of a conventional code used frequently in digital communication, the Gold code, and demonstrate that our code is comparable or even superior to the Gold code in several key aspects: security, bit error rate, code generation speed, and the number of possible code sequences. As the field of communicating with chaos faces doubts in terms of performance comparison with conventional digital communication schemes, our work gives a clear message that communicating with chaos can be advantageous and it deserves further attention from the nonlinear science community

  5. Structure-enhanced methods in the development of non-nucleoside inhibitors targeting HIV reverse transcriptase variants.

    Science.gov (United States)

    Frey, Kathleen M

    2015-01-01

    Resistance continues to emerge as a leading cause for antiretroviral treatment failure. Several mutations in HIV reverse transcriptase (RT) confer resistance to non-nucleoside inhibitors (NNRTIs), vital components of antiretroviral combination therapies. Since the majority of mutations are located in the NNRTI binding pocket, crystal structures of RT variants in complex with NNRTIs have provided ideas for new drug design strategies. This article reviews the impact of RT crystal structures on the multidisciplinary design and development of new inhibitors with improved resistance profiles.

  6. Synthesis, structure-activity relationship and molecular docking of cyclohexenone based analogous as potent non-nucleoside reverse-transcriptase inhibitors

    Science.gov (United States)

    Nazar, Muhammad Faizan; Abdullah, Muhammad Imran; Badshah, Amir; Mahmood, Asif; Rana, Usman Ali; Khan, Salah Ud-Din

    2015-04-01

    The chalcones core in compounds is advantageously chosen effective synthons, which offer exciting perspectives in biological and pharmacological research. The present study reports the successful development of eight new cyclohexenone based anti-reverse transcriptase analogous using rational drug design synthesis principles. These new cyclohexenone derivatives (CDs) were synthesized by following a convenient route of Robinson annulation, and the molecular structure of these CDs were later confirmed by various analytical techniques such as 1H NMR, 13C NMR, FT-IR, UV-Vis spectroscopy and mass spectrometry. All the synthesized compounds were screened theoretically and experimentally against reverse transcriptase (RT) and found potentially active reverse transcriptase (RT) inhibitors. Of the compounds studied, the compound 2FC4 showed high interaction with RT at non-nucleoside binding site, contributing high free binding energy (ΔG -8.01 Kcal) and IC50 (0.207 μg/ml), respectively. Further results revealed that the compounds bearing more halogen groups, with additional hydrophobic character, offered superior anti-reverse transcriptase activity as compared to rest of compounds. It is anticipate that the present study would be very useful for the selection of potential reverse transcriptase inhibitors featuring inclusive pharmacological profiles.

  7. The Aesthetics of Coding

    DEFF Research Database (Denmark)

    Andersen, Christian Ulrik

    2007-01-01

    Computer art is often associated with computer-generated expressions (digitally manipulated audio/images in music, video, stage design, media facades, etc.). In recent computer art, however, the code-text itself – not the generated output – has become the artwork (Perl Poetry, ASCII Art, obfuscated...... code, etc.). The presentation relates this artistic fascination of code to a media critique expressed by Florian Cramer, claiming that the graphical interface represents a media separation (of text/code and image) causing alienation to the computer’s materiality. Cramer is thus the voice of a new ‘code...... avant-garde’. In line with Cramer, the artists Alex McLean and Adrian Ward (aka Slub) declare: “art-oriented programming needs to acknowledge the conditions of its own making – its poesis.” By analysing the Live Coding performances of Slub (where they program computer music live), the presentation...

  8. The aeroelastic code FLEXLAST

    Energy Technology Data Exchange (ETDEWEB)

    Visser, B. [Stork Product Eng., Amsterdam (Netherlands)

    1996-09-01

    To support the discussion on aeroelastic codes, a description of the code FLEXLAST was given and experiences within benchmarks and measurement programmes were summarized. The code FLEXLAST has been developed since 1982 at Stork Product Engineering (SPE). Since 1992 FLEXLAST has been used by Dutch industries for wind turbine and rotor design. Based on the comparison with measurements, it can be concluded that the main shortcomings of wind turbine modelling lie in the field of aerodynamics, wind field and wake modelling. (au)

  9. Gauge color codes

    DEFF Research Database (Denmark)

    Bombin Palomo, Hector

    2015-01-01

    Color codes are topological stabilizer codes with unusual transversality properties. Here I show that their group of transversal gates is optimal and only depends on the spatial dimension, not the local geometry. I also introduce a generalized, subsystem version of color codes. In 3D they allow t...... the transversal implementation of a universal set of gates by gauge fixing, while error-dectecting measurements involve only four or six qubits....

  10. Doubled Color Codes

    Science.gov (United States)

    Bravyi, Sergey

    Combining protection from noise and computational universality is one of the biggest challenges in the fault-tolerant quantum computing. Topological stabilizer codes such as the 2D surface code can tolerate a high level of noise but implementing logical gates, especially non-Clifford ones, requires a prohibitively large overhead due to the need of state distillation. In this talk I will describe a new family of 2D quantum error correcting codes that enable a transversal implementation of all logical gates required for the universal quantum computing. Transversal logical gates (TLG) are encoded operations that can be realized by applying some single-qubit rotation to each physical qubit. TLG are highly desirable since they introduce no overhead and do not spread errors. It has been known before that a quantum code can have only a finite number of TLGs which rules out computational universality. Our scheme circumvents this no-go result by combining TLGs of two different quantum codes using the gauge-fixing method pioneered by Paetznick and Reichardt. The first code, closely related to the 2D color code, enables a transversal implementation of all single-qubit Clifford gates such as the Hadamard gate and the π / 2 phase shift. The second code that we call a doubled color code provides a transversal T-gate, where T is the π / 4 phase shift. The Clifford+T gate set is known to be computationally universal. The two codes can be laid out on the honeycomb lattice with two qubits per site such that the code conversion requires parity measurements for six-qubit Pauli operators supported on faces of the lattice. I will also describe numerical simulations of logical Clifford+T circuits encoded by the distance-3 doubled color code. Based on a joint work with Andrew Cross.

  11. Phonological coding during reading

    Science.gov (United States)

    Leinenger, Mallorie

    2014-01-01

    The exact role that phonological coding (the recoding of written, orthographic information into a sound based code) plays during silent reading has been extensively studied for more than a century. Despite the large body of research surrounding the topic, varying theories as to the time course and function of this recoding still exist. The present review synthesizes this body of research, addressing the topics of time course and function in tandem. The varying theories surrounding the function of phonological coding (e.g., that phonological codes aid lexical access, that phonological codes aid comprehension and bolster short-term memory, or that phonological codes are largely epiphenomenal in skilled readers) are first outlined, and the time courses that each maps onto (e.g., that phonological codes come online early (pre-lexical) or that phonological codes come online late (post-lexical)) are discussed. Next the research relevant to each of these proposed functions is reviewed, discussing the varying methodologies that have been used to investigate phonological coding (e.g., response time methods, reading while eyetracking or recording EEG and MEG, concurrent articulation) and highlighting the advantages and limitations of each with respect to the study of phonological coding. In response to the view that phonological coding is largely epiphenomenal in skilled readers, research on the use of phonological codes in prelingually, profoundly deaf readers is reviewed. Finally, implications for current models of word identification (activation-verification model (Van Order, 1987), dual-route model (e.g., Coltheart, Rastle, Perry, Langdon, & Ziegler, 2001), parallel distributed processing model (Seidenberg & McClelland, 1989)) are discussed. PMID:25150679

  12. Flexibility of the genetic code with respect to DNA structure

    DEFF Research Database (Denmark)

    Baisnée, P. F.; Baldi, Pierre; Brunak, Søren

    2001-01-01

    acids allows only for the superimposition of punctual and loosely positioned signals to conserved amino acid sequences. The degree of flexibility of the genetic code is low or average with respect to several classes of alternative codes. This result is consistent with the view that DNA structure...

  13. Integer sequence discovery from small graphs.

    Science.gov (United States)

    Hoppe, Travis; Petrone, Anna

    2016-03-11

    We have exhaustively enumerated all simple, connected graphs of a finite order and have computed a selection of invariants over this set. Integer sequences were constructed from these invariants and checked against the Online Encyclopedia of Integer Sequences (OEIS). 141 new sequences were added and six sequences were extended. From the graph database, we were able to programmatically suggest relationships among the invariants. It will be shown that we can readily visualize any sequence of graphs with a given criteria. The code has been released as an open-source framework for further analysis and the database was constructed to be extensible to invariants not considered in this work.

  14. Integer sequence discovery from small graphs

    Science.gov (United States)

    Hoppe, Travis; Petrone, Anna

    2015-01-01

    We have exhaustively enumerated all simple, connected graphs of a finite order and have computed a selection of invariants over this set. Integer sequences were constructed from these invariants and checked against the Online Encyclopedia of Integer Sequences (OEIS). 141 new sequences were added and six sequences were extended. From the graph database, we were able to programmatically suggest relationships among the invariants. It will be shown that we can readily visualize any sequence of graphs with a given criteria. The code has been released as an open-source framework for further analysis and the database was constructed to be extensible to invariants not considered in this work. PMID:27034526

  15. MORSE Monte Carlo code

    Energy Technology Data Exchange (ETDEWEB)

    Cramer, S.N.

    1984-01-01

    The MORSE code is a large general-use multigroup Monte Carlo code system. Although no claims can be made regarding its superiority in either theoretical details or Monte Carlo techniques, MORSE has been, since its inception at ORNL in the late 1960s, the most widely used Monte Carlo radiation transport code. The principal reason for this popularity is that MORSE is relatively easy to use, independent of any installation or distribution center, and it can be easily customized to fit almost any specific need. Features of the MORSE code are described.

  16. Bar Code Labels

    Science.gov (United States)

    1988-01-01

    American Bar Codes, Inc. developed special bar code labels for inventory control of space shuttle parts and other space system components. ABC labels are made in a company-developed anodizing aluminum process and consecutively marketed with bar code symbology and human readable numbers. They offer extreme abrasion resistance and indefinite resistance to ultraviolet radiation, capable of withstanding 700 degree temperatures without deterioration and up to 1400 degrees with special designs. They offer high resistance to salt spray, cleaning fluids and mild acids. ABC is now producing these bar code labels commercially or industrial customers who also need labels to resist harsh environments.

  17. QR codes for dummies

    CERN Document Server

    Waters, Joe

    2012-01-01

    Find out how to effectively create, use, and track QR codes QR (Quick Response) codes are popping up everywhere, and businesses are reaping the rewards. Get in on the action with the no-nonsense advice in this streamlined, portable guide. You'll find out how to get started, plan your strategy, and actually create the codes. Then you'll learn to link codes to mobile-friendly content, track your results, and develop ways to give your customers value that will keep them coming back. It's all presented in the straightforward style you've come to know and love, with a dash of humor thrown

  18. MORSE Monte Carlo code

    International Nuclear Information System (INIS)

    Cramer, S.N.

    1984-01-01

    The MORSE code is a large general-use multigroup Monte Carlo code system. Although no claims can be made regarding its superiority in either theoretical details or Monte Carlo techniques, MORSE has been, since its inception at ORNL in the late 1960s, the most widely used Monte Carlo radiation transport code. The principal reason for this popularity is that MORSE is relatively easy to use, independent of any installation or distribution center, and it can be easily customized to fit almost any specific need. Features of the MORSE code are described

  19. Tokamak Systems Code

    International Nuclear Information System (INIS)

    Reid, R.L.; Barrett, R.J.; Brown, T.G.

    1985-03-01

    The FEDC Tokamak Systems Code calculates tokamak performance, cost, and configuration as a function of plasma engineering parameters. This version of the code models experimental tokamaks. It does not currently consider tokamak configurations that generate electrical power or incorporate breeding blankets. The code has a modular (or subroutine) structure to allow independent modeling for each major tokamak component or system. A primary benefit of modularization is that a component module may be updated without disturbing the remainder of the systems code as long as the imput to or output from the module remains unchanged

  20. ARC Code TI: ACCEPT

    Data.gov (United States)

    National Aeronautics and Space Administration — ACCEPT consists of an overall software infrastructure framework and two main software components. The software infrastructure framework consists of code written to...